Abstract: The invention provides methods and compositions for early diagnosis and treatment of a disease associated with a specific antibody by employing the detection of a cross-idiotypic epitope on the specific antibody to detect the cells that produce the antibody before the development of clinical symptoms of the disease.

Abstract: The invention provides methods and compositions for early diagnosis and treatment of a disease associated with a specific antibody by employing the detection of a cross-idiotypic epitope on the specific antibody to detect the cells that produce the antibody before the development of clinical symptoms of the disease.

Abstract: The invention provides methods and compositions for early diagnosis and treatment of a disease associated with a specific antibody by employing the detection of a cross-idiotypic epitope on the specific antibody to detect the cells that produce the antibody before the development of clinical symptoms of the disease.

Abstract: The invention provides methods and compositions for early diagnosis and treatment of a disease associated with a specific antibody by employing the detection of a cross-idiotypic epitope on the specific antibody to detect the cells that produce the antibody before the development of clinical symptoms of the disease.

Abstract: A method of inhibiting infection by Flaviviridae viruses including HCV, GBC/HGV, and BVD in addition to VSV and any other virus capable of forming a complex with a lipoprotein strategies: preventing formation of a complex should one form, altering the conformation of such a complex to prevent its interaction with the cell receptor, blocking the cell receptor for the complex using an antibody to the receptor, blocking binding of the lipoprotein complex to the cell receptor using soluble lipoprotein receptor or fragments thereof, or downregulating the LDL receptor activity of the cells.

Abstract: A method of inhibiting infection by Flaviviridae viruses including HCV, GBC/HGV, and BVD in addition to VSV and any other virus capable of forming a complex with a lipoprotein strategies: preventing formation of a complex should one form, altering the conformation of such a complex to prevent its interaction with the cell receptor, blocking the cell receptor for the complex using an antibody to the receptor, blocking binding of the lipoprotein complex to the cell receptor using soluble lipoprotein receptor or fragments thereof, or downregulating the LDL receptor activity of the cells.

Abstract: A method of inhibiting infection by Flaviviridae viruses including HCV, GBC/HGV, and BVD in addition to VSV and any other virus capable of forming a complex with a lipoportein strategies: preventing formation of a complex should one form, altering the conforamtion of such a complex to prevent its interacton with the cell receptor, blocking the cell receptor for the complex using an antibody to the receptor, blocking binding of the lipoprotein complex to the cell receptor using soluble lipoprotein receptor or framents thereof, or downregulating the LDL receptor activity of the cells.

Abstract: A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT and 3' antisense, ccagagcatctggcacgtgg primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.

Abstract: An assay for systemic lupus erythematosus based upon capture of the anti-dsDNA portion of IgG in a human serum specimen by the Fc part of a molecule using solid phase immobilized F(ab')2 fragment of anti-human IgG specific for Fc, the captured IgG being then incubated with a synthetic dsDNA tagged with a moiety from which a signal proportional to the quantity of said synthetic dsDNA can be elicited. Upon eliciting a signal from the moiety, the amount of antibody to dsDNA can be quantified, providing diagnostic and prognostic information regarding the disease.

Abstract: A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT (SEQ ID NO:1) and 3' antisense, CCAGAGCATCTGGCACGTGG (SEQ ID NO:2) primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.