Patents by Inventor Vittorio De Franciscis

Vittorio De Franciscis has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20230227832
    Abstract: The present invention relates to a nucleotide aptamer or a variant thereof, or a functional fragment thereof, the medical or diagnostic use thereof, the related pharmaceutical composition and a method for selecting a nucleotide aptamer which specifically binds to exosomes isolated from target cells. The present invention further relates to a kit and nucleic acid coding for the aptamer.
    Type: Application
    Filed: June 17, 2021
    Publication date: July 20, 2023
    Applicant: CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Vittorio DE FRANCISCIS, Gerolama CONDORELLI, Silvia CATUOGNO, Carla Lucia ESPOSITO, Cristina QUINTAVALLE, Francesco INGENITO
  • Publication number: 20230167453
    Abstract: Provided herein are RNA aptamers targeting CD5L. Further provided herein are methods of use thereof for the treatment of a disease or disorder, such as cancer.
    Type: Application
    Filed: April 1, 2021
    Publication date: June 1, 2023
    Applicants: Board of Regents, The University of Texas System, Consiglio Nazionale delle Ricerche
    Inventors: Anil K. SOOD, Paola AMERO, Gabriel LOPEZ-BERESTEIN, Vittorio DE FRANCISCIS
  • Publication number: 20220411799
    Abstract: An aptamer, capable of inhibiting DNA methyltransferase 1 (DNMT1) for use in therapy of diseases characterised by aberrant DNA methylation, e.g. cancer. Method for identifying inhibitors of DNA methyltransferase. An aptamer, capable of inhibiting DNA methyltransferase 1 (DNMT1) for use in therapy of diseases characterised by aberrant DNA methylation, e.g. cancer. SELEX method for identifying aptamers of DNA methyltransferase optionally using 2-fluoro-pyrimindine nucleotide derivatives.
    Type: Application
    Filed: October 28, 2020
    Publication date: December 29, 2022
    Inventors: Daniel Geoffrey Tenen, Carla Lucia Esposito, Annalisa Di Ruscio, Vittorio De Franciscis, Alexander K. Ebralidze
  • Publication number: 20220380766
    Abstract: Provided herein are DNA aptamers targeting AXL receptor kinase. The DNA aptamers may comprise a thiophosphate backbone and be chemically modified. Further provided herein are methods of use thereof for the treatment of a disease or disorder, such as cancer.
    Type: Application
    Filed: December 16, 2019
    Publication date: December 1, 2022
    Applicants: Board of Regents, The University of Texas System, Consiglio Nazionale delle Ricerche
    Inventors: Gabriel LOPEZ-BERESTEIN, Paola AMERO, Cristian RODRIGUEZ-AGUAYO, Rahul MITRA, Anil K. SOOD, Vittorio DE FRANCISCIS, David VOLK, Lokesh Ganesh L. RAO
  • Publication number: 20220356475
    Abstract: A chimeric complex comprising a microRNA in combination with an aptamer for AXL receptor tyrosine kinase is provided. Use of the chimeric complex for targeted treatment of a tumor disease, in particular in a therapy affecting onset and/or progression of tumor metastasis is also provided.
    Type: Application
    Filed: August 31, 2020
    Publication date: November 10, 2022
    Inventors: Daniela TAVERNA, Lorena QUIRICO, Francesca ORSO, Vittorio DE FRANCISCIS, Carla Lucia ESPOSITO, Silvia CATUOGNO
  • Publication number: 20220348923
    Abstract: The present invention provides nucleic acid aptamers binding to the Carbonic Anhydrase IX (CA-IX) enzyme, derivatives and conjugates thereof and their use as diagnostic tools, particularly for the imaging of organs and tissues expressing CA-IX, or as therapeutic agents for prevention or treatment of CA-IX related diseases.
    Type: Application
    Filed: September 16, 2020
    Publication date: November 3, 2022
    Applicant: BRACCO IMAGING S.P.A.
    Inventors: Vittorio DE FRANCISCIS, Carla Lucia ESPOSITO, Silvia CATUOGNO, Silvia NUZZO, Alessandro MAIOCCHI, Margherita IABONI, Aldo DI VITO, Erika REITANO, Luisa POGGI
  • Patent number: 11274308
    Abstract: The present invention provides nucleic acid aptamers binding to the Intercellular Adhesion Molecule-1 (ICAM-1), derivatives and conjugates thereof and their use as diagnostic tools, particularly for the imaging of organs and tissues expressing ICAM-1, or as therapeutic agents for prevention or treatment of ICAM-1-related diseases.
    Type: Grant
    Filed: July 24, 2019
    Date of Patent: March 15, 2022
    Assignee: BRACCO IMAGING S.P.A.
    Inventors: Vittorio De Franciscis, Silvia Catuogno, Carla Lucia Esposito, Alessandro Maiocchi, Margherita Iaboni, Luisa Poggi, Erika Reitano
  • Publication number: 20210292762
    Abstract: The present invention provides nucleic acid aptamers binding to the Intercellular Adhesion Molecule-1 (ICAM-1), derivatives and conjugates thereof and their use as diagnostic tools, particularly for the imaging of organs and tissues expressing ICAM-1, or as therapeutic agents for prevention or treatment of ICAM-1-related diseases.
    Type: Application
    Filed: July 24, 2019
    Publication date: September 23, 2021
    Applicant: BRACCO IMAGING S.P.A.
    Inventors: Vittorio DE FRANCISCIS, Silvia CATUOGNO, Carla Lucia ESPOSITO, Alessandro MAIOCCHI, Margherita IABONI, Luisa POGGI, Erika REITANO
  • Patent number: 9234202
    Abstract: Nuclease-resistant RNA aptamers are provided which are capable of neutralizing PDGFR? and are therefore useful in the diagnosis and/or therapy of PDGFR?-associated and hyperproliferative-associated diseases, such as cancer and primary tumor metastasis. RNA aptamers provided herein include a modified synthetic RNA sequence wherein at least one pyrimidine residue is modified to 2?-fluoropyrimidine. Pharmaceutical compositions and diagnostic kits comprising RNA aptamers are also provided.
    Type: Grant
    Filed: October 4, 2013
    Date of Patent: January 12, 2016
    Assignee: CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Laura Cerchia, Gerolama Condorelli, Vittorio De Franciscis
  • Publication number: 20150275215
    Abstract: Nuclease-resistant RNA aptamers are provided which are capable of neutralizing PDGFR? and are therefore useful in the diagnosis and/or therapy of PDGFR?-associated and hyperproliferative-associated diseases, such as cancer and primary tumour metastasis. RNA aptamers provided herein include a modified synthetic RNA sequence wherein at least one pyrimidine residue is modified to 2?-fluoropyrimidine. Pharmaceutical compositions and diagnostic kits comprising RNA aptamers are also provided.
    Type: Application
    Filed: October 4, 2013
    Publication date: October 1, 2015
    Inventors: Laura Cerchia, Gerolama Condorelli, Vittorio De Franciscis
  • Patent number: 9125930
    Abstract: The present invention concerns a nucleotide aptamer having the sequence 5? GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3? (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.
    Type: Grant
    Filed: October 10, 2011
    Date of Patent: September 8, 2015
    Assignee: CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Vittorio De Franciscis, Laura Cerchia
  • Patent number: 8741870
    Abstract: The present invention concerns a nucleotide aptamer having the sequence: 5?-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3?(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.
    Type: Grant
    Filed: October 10, 2011
    Date of Patent: June 3, 2014
    Assignee: Consiglio Nazionale delle Ricerche
    Inventors: Vittorio De Franciscis, Laura Cerchia
  • Publication number: 20130197070
    Abstract: The present invention concerns a nucleotide aptamer having the sequence: 5?-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3?(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.
    Type: Application
    Filed: October 10, 2011
    Publication date: August 1, 2013
    Applicant: CNR - CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Vittorio De Franciscis, Laura Cerchia
  • Patent number: 8492082
    Abstract: The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for therapeutic, diagnostic and prognostic purposes.
    Type: Grant
    Filed: September 1, 2009
    Date of Patent: July 23, 2013
    Assignee: Consiglio Nazionale delle Richerche
    Inventors: Vittorio De Franciscis, Laura Cerchia, Gerolama Condorelli
  • Publication number: 20130177556
    Abstract: The present invention concerns a nucleotide aptamer having the sequence 5? GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3? (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.
    Type: Application
    Filed: October 10, 2011
    Publication date: July 11, 2013
    Applicant: CNR - CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Vittorio De Franciscis, Laura Cerchia
  • Publication number: 20110166213
    Abstract: The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for therapeutic, diagnostic and prognostic purposes.
    Type: Application
    Filed: September 1, 2009
    Publication date: July 7, 2011
    Applicant: CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Vittorio De Franciscis, Laura Cerchia, Gerolama Condorelli
  • Publication number: 20080227735
    Abstract: The invention relates to aptamers selected from live tumor cells and to the use thereof for diagnosis and treatment of certain cancers and other pathologies.
    Type: Application
    Filed: March 17, 2005
    Publication date: September 18, 2008
    Applicant: COMMISSARIAT A L'ENERGIE ATOMIQUE
    Inventors: Bertrand Tavitian, Frederic Duconge, Domenico Libri, Vittorio De Franciscis, Laura Cerchia