Patents by Inventor Vittorio De Franciscis
Vittorio De Franciscis has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).
-
Publication number: 20230227832Abstract: The present invention relates to a nucleotide aptamer or a variant thereof, or a functional fragment thereof, the medical or diagnostic use thereof, the related pharmaceutical composition and a method for selecting a nucleotide aptamer which specifically binds to exosomes isolated from target cells. The present invention further relates to a kit and nucleic acid coding for the aptamer.Type: ApplicationFiled: June 17, 2021Publication date: July 20, 2023Applicant: CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Vittorio DE FRANCISCIS, Gerolama CONDORELLI, Silvia CATUOGNO, Carla Lucia ESPOSITO, Cristina QUINTAVALLE, Francesco INGENITO
-
Publication number: 20230167453Abstract: Provided herein are RNA aptamers targeting CD5L. Further provided herein are methods of use thereof for the treatment of a disease or disorder, such as cancer.Type: ApplicationFiled: April 1, 2021Publication date: June 1, 2023Applicants: Board of Regents, The University of Texas System, Consiglio Nazionale delle RicercheInventors: Anil K. SOOD, Paola AMERO, Gabriel LOPEZ-BERESTEIN, Vittorio DE FRANCISCIS
-
Publication number: 20220411799Abstract: An aptamer, capable of inhibiting DNA methyltransferase 1 (DNMT1) for use in therapy of diseases characterised by aberrant DNA methylation, e.g. cancer. Method for identifying inhibitors of DNA methyltransferase. An aptamer, capable of inhibiting DNA methyltransferase 1 (DNMT1) for use in therapy of diseases characterised by aberrant DNA methylation, e.g. cancer. SELEX method for identifying aptamers of DNA methyltransferase optionally using 2-fluoro-pyrimindine nucleotide derivatives.Type: ApplicationFiled: October 28, 2020Publication date: December 29, 2022Inventors: Daniel Geoffrey Tenen, Carla Lucia Esposito, Annalisa Di Ruscio, Vittorio De Franciscis, Alexander K. Ebralidze
-
Publication number: 20220380766Abstract: Provided herein are DNA aptamers targeting AXL receptor kinase. The DNA aptamers may comprise a thiophosphate backbone and be chemically modified. Further provided herein are methods of use thereof for the treatment of a disease or disorder, such as cancer.Type: ApplicationFiled: December 16, 2019Publication date: December 1, 2022Applicants: Board of Regents, The University of Texas System, Consiglio Nazionale delle RicercheInventors: Gabriel LOPEZ-BERESTEIN, Paola AMERO, Cristian RODRIGUEZ-AGUAYO, Rahul MITRA, Anil K. SOOD, Vittorio DE FRANCISCIS, David VOLK, Lokesh Ganesh L. RAO
-
Publication number: 20220356475Abstract: A chimeric complex comprising a microRNA in combination with an aptamer for AXL receptor tyrosine kinase is provided. Use of the chimeric complex for targeted treatment of a tumor disease, in particular in a therapy affecting onset and/or progression of tumor metastasis is also provided.Type: ApplicationFiled: August 31, 2020Publication date: November 10, 2022Inventors: Daniela TAVERNA, Lorena QUIRICO, Francesca ORSO, Vittorio DE FRANCISCIS, Carla Lucia ESPOSITO, Silvia CATUOGNO
-
Publication number: 20220348923Abstract: The present invention provides nucleic acid aptamers binding to the Carbonic Anhydrase IX (CA-IX) enzyme, derivatives and conjugates thereof and their use as diagnostic tools, particularly for the imaging of organs and tissues expressing CA-IX, or as therapeutic agents for prevention or treatment of CA-IX related diseases.Type: ApplicationFiled: September 16, 2020Publication date: November 3, 2022Applicant: BRACCO IMAGING S.P.A.Inventors: Vittorio DE FRANCISCIS, Carla Lucia ESPOSITO, Silvia CATUOGNO, Silvia NUZZO, Alessandro MAIOCCHI, Margherita IABONI, Aldo DI VITO, Erika REITANO, Luisa POGGI
-
Patent number: 11274308Abstract: The present invention provides nucleic acid aptamers binding to the Intercellular Adhesion Molecule-1 (ICAM-1), derivatives and conjugates thereof and their use as diagnostic tools, particularly for the imaging of organs and tissues expressing ICAM-1, or as therapeutic agents for prevention or treatment of ICAM-1-related diseases.Type: GrantFiled: July 24, 2019Date of Patent: March 15, 2022Assignee: BRACCO IMAGING S.P.A.Inventors: Vittorio De Franciscis, Silvia Catuogno, Carla Lucia Esposito, Alessandro Maiocchi, Margherita Iaboni, Luisa Poggi, Erika Reitano
-
Publication number: 20210292762Abstract: The present invention provides nucleic acid aptamers binding to the Intercellular Adhesion Molecule-1 (ICAM-1), derivatives and conjugates thereof and their use as diagnostic tools, particularly for the imaging of organs and tissues expressing ICAM-1, or as therapeutic agents for prevention or treatment of ICAM-1-related diseases.Type: ApplicationFiled: July 24, 2019Publication date: September 23, 2021Applicant: BRACCO IMAGING S.P.A.Inventors: Vittorio DE FRANCISCIS, Silvia CATUOGNO, Carla Lucia ESPOSITO, Alessandro MAIOCCHI, Margherita IABONI, Luisa POGGI, Erika REITANO
-
Patent number: 9234202Abstract: Nuclease-resistant RNA aptamers are provided which are capable of neutralizing PDGFR? and are therefore useful in the diagnosis and/or therapy of PDGFR?-associated and hyperproliferative-associated diseases, such as cancer and primary tumor metastasis. RNA aptamers provided herein include a modified synthetic RNA sequence wherein at least one pyrimidine residue is modified to 2?-fluoropyrimidine. Pharmaceutical compositions and diagnostic kits comprising RNA aptamers are also provided.Type: GrantFiled: October 4, 2013Date of Patent: January 12, 2016Assignee: CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Laura Cerchia, Gerolama Condorelli, Vittorio De Franciscis
-
Publication number: 20150275215Abstract: Nuclease-resistant RNA aptamers are provided which are capable of neutralizing PDGFR? and are therefore useful in the diagnosis and/or therapy of PDGFR?-associated and hyperproliferative-associated diseases, such as cancer and primary tumour metastasis. RNA aptamers provided herein include a modified synthetic RNA sequence wherein at least one pyrimidine residue is modified to 2?-fluoropyrimidine. Pharmaceutical compositions and diagnostic kits comprising RNA aptamers are also provided.Type: ApplicationFiled: October 4, 2013Publication date: October 1, 2015Inventors: Laura Cerchia, Gerolama Condorelli, Vittorio De Franciscis
-
Patent number: 9125930Abstract: The present invention concerns a nucleotide aptamer having the sequence 5? GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3? (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.Type: GrantFiled: October 10, 2011Date of Patent: September 8, 2015Assignee: CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Vittorio De Franciscis, Laura Cerchia
-
Patent number: 8741870Abstract: The present invention concerns a nucleotide aptamer having the sequence: 5?-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3?(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.Type: GrantFiled: October 10, 2011Date of Patent: June 3, 2014Assignee: Consiglio Nazionale delle RicercheInventors: Vittorio De Franciscis, Laura Cerchia
-
Publication number: 20130197070Abstract: The present invention concerns a nucleotide aptamer having the sequence: 5?-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3?(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.Type: ApplicationFiled: October 10, 2011Publication date: August 1, 2013Applicant: CNR - CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Vittorio De Franciscis, Laura Cerchia
-
Patent number: 8492082Abstract: The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for therapeutic, diagnostic and prognostic purposes.Type: GrantFiled: September 1, 2009Date of Patent: July 23, 2013Assignee: Consiglio Nazionale delle RichercheInventors: Vittorio De Franciscis, Laura Cerchia, Gerolama Condorelli
-
Publication number: 20130177556Abstract: The present invention concerns a nucleotide aptamer having the sequence 5? GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3? (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.Type: ApplicationFiled: October 10, 2011Publication date: July 11, 2013Applicant: CNR - CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Vittorio De Franciscis, Laura Cerchia
-
Publication number: 20110166213Abstract: The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for therapeutic, diagnostic and prognostic purposes.Type: ApplicationFiled: September 1, 2009Publication date: July 7, 2011Applicant: CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Vittorio De Franciscis, Laura Cerchia, Gerolama Condorelli
-
Publication number: 20080227735Abstract: The invention relates to aptamers selected from live tumor cells and to the use thereof for diagnosis and treatment of certain cancers and other pathologies.Type: ApplicationFiled: March 17, 2005Publication date: September 18, 2008Applicant: COMMISSARIAT A L'ENERGIE ATOMIQUEInventors: Bertrand Tavitian, Frederic Duconge, Domenico Libri, Vittorio De Franciscis, Laura Cerchia