Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Abstract: A production process and a related device comprises a formation process comprising: contacting a first liquid material and a second liquid material with each other at a contact point in a gas atmosphere, wherein at the contact point at least one of the first liquid material and the second liquid material is provided as a liquid jet propagating in a direction, to provide at the contact point a third jet of a coalesced third material propagating in a third direction.

Abstract: A production process comprises a formation process that includes: contacting a first liquid material and a second liquid material with each other at a contact point in a gas atmosphere, wherein at the contact point at least one of the first liquid material and the second liquid material is provided as a liquid jet propagating in a direction, to provide at the contact point a third jet of a coalesced third material propagating in a third direction. A production process device can perform the formation process.

Abstract: A method of printing a cellular solid by direct bubble writing comprises introducing an ink formulation comprising a polymerizable monomer and a gas into a nozzle, which includes a core flow channel radially surrounded by an outer flow channel. The ink formulation is directed into the outer flow channel and the gas is directed into the core flow channel. The ink formulation and the gas are ejected out of the nozzle as a stream of bubbles, where each bubble includes a core comprising the gas and a liquid shell overlying the core that comprises the ink formulation. After ejection, the polymerizable monomer is polymerized to form a solid polymeric shell from the liquid shell, and the bubbles are deposited on a substrate moving relative to the nozzle. Thus, a polymeric cellular solid having a predetermined geometry is printed.

Abstract: A micro-fluidic system, comprising at least one first nozzle (10) that releases at least one liquid jet (15) of a first liquid into a gaseous atmosphere and a second nozzle (20) that releases a liquid film jet (25) of a second liquid in said gaseous atmosphere. Said first jet (15) is directed to be incident of said liquid film (25) at an interaction area (50). Collecting means (40) are provided for receiving an interaction product (55) of said first and second liquid downstream of said interaction area. Support means (30) are provided, having a support surface (35) that receives and supports said liquid film (25) of said second liquid from said second nozzle (20). Said support surface (35) carries said liquid film to said interaction area (55) and said interaction area (55) is supported by said support surface (35).

Abstract: A method of printing a cellular solid (120) by direct bubble writing comprises introducing an ink formulation (102) comprising a polymerizable monomer and a gas (104) into a nozzle (106), which includes a core flow channel (108) radially surrounded by an outer flow channel (110). The ink formulation is directed into the outer flow channel (110) and the gas is directed into the core flow channel (108). The ink formulation (102) and the gas (104) are ejected out of the nozzle (106) as a stream of bubbles (112), where each bubble includes a core (114) comprising the gas and a liquid shell (116) overlying the core that comprises the ink formulation. After ejection, the polymerizable monomer is polymerized to form a solid polymeric shell (118) from the liquid shell (116), and the bubbles are deposited on a substrate (122) moving relative to the nozzle (106). Thus, a polymeric cellular solid (120) having a predetermined geometry is printed.

Abstract: The invention provides a construct (1) comprising a number N of material types (100, 110, . . . ), wherein N is at least 2, wherein at least two of the material types (100, 110, . . . ) comprise granular material (101) comprising particles (10), wherein the granular material (101) at least defines an exterior surface (6) of the construct (1), wherein the construct (1) is self-supporting, and wherein the construct (1) is (i) self-healing or is (ii) configured for being self-healing by changing a liquid (15) content of the construct (1); wherein the different material types (100, 110, . . . ) mutually differ in at least one characteristic (19) selected from the group consisting of a physical characteristic and a chemical characteristic.

Abstract: A production process and a related device comprises a formation process comprising: contacting a first liquid material and a second liquid material with each other at a contact point in a gas atmosphere, wherein at the contact point at least one of the first liquid material and the second liquid material is provided as a liquid jet propagating in a direction, to provide at the contact point a third jet of a coalesced third material propagating in a third direction.

Abstract: A production process comprises a formation process that includes: contacting a first liquid material and a second liquid material with each other at a contact point in a gas atmosphere, wherein at the contact point at least one of the first liquid material and the second liquid material is provided as a liquid jet propagating in a direction, to provide at the contact point a third jet of a coalesced third material propagating in a third direction. A production process device can perform the formation process.

Abstract: A production process and a related device comprises a formation process comprising: contacting a first liquid material and a second liquid material with each other at a contact point in a gas atmosphere, wherein at the contact point at least one of the first liquid material and the second liquid material is provided as a liquid jet propagating in a direction, to provide at the contact point a third jet of a coalesced third material propagating in a third direction.

Abstract: A method of printing a cellular solid (120) by direct bubble writing comprises introducing an ink formulation (102) comprising a polymerizable monomer and a gas (104) into a nozzle (106), which includes a core flow channel (108) radially surrounded by an outer flow channel (110). The ink formulation is directed into the outer flow channel (110) and the gas is directed into the core channel (108). The ink formulation (102) and the gas (104) are ejected out of the nozzle (106) as a stream of bubbles (112), where each bubble includes a core (114) comprising the gas and a liquid shell (116) overlying the core that comprises the ink formulation. After ejection, the polymerizable monomer is polymerized to form a solid polymeric shell (118) from the liquid shell (116), and the bubbles are deposited on a substrate (122) moving relative to the nozzle (106). Thus, a polymeric cellular solid (120) having a predetermined geometry is printed.

Abstract: Techniques are described for enabling users to configure the auto scaling of virtual computing resources using various intent-based auto scaling configurations. Intent-based configurations generally provide various indications of how a user intends to use a scalable group of virtual computing resources and what expectations a user might have about how those resources are scaled in response to changes in demand. A service provider network receives first input to create a scalable group of virtualized computing resources, the first input indicating at least one primary scaling configuration used by the hardware virtualization service to scale the scalable group of compute instances over time, and further receives second input indicating at least one secondary, intent-based scaling configuration used to scale the virtualized computing resources, for example, when the service is unable to scale the group of virtualized computing resources according to the at least one primary scaling condition.

Abstract: A production process and a related device comprises a formation process comprising: contacting a first liquid material and a second liquid material with each other at a contact point in a gas atmosphere, wherein at the contact point at least one of the first liquid material and the second liquid material is provided as a liquid jet propagating in a direction, to provide at the contact point a third jet of a coalesced third material propagating in a third direction.

Abstract: A method of and apparatus for securing valuable articles wherein the articles are provided within a tamper evident primary container (10) or envelope, the primary container is contained within a secondary container (60) or box, and dispensing means (12) is provided in the secondary container (60) selectively to dispense a staining medium. The invention provides that the primary container (10) is partitioned into first (30) and second (32) portions that communicate with each other through at least one path (34.1); the articles to be secured are inserted into the first portion (30) which is then sealed (26); and the dispensing means (12, 42) is arranged to dispense the staining medium into the second portion (32) when activated. A plurality of spaced flow paths (34.2) may be formed between the first (30) and second (32) portions, the paths being arranged to prevent access to the first portion through the second portion.

Abstract: A tamper evident primary container (20) for storing and/or transporting valuables, particularly currency and other documents comprises an envelope (14) with tamper evident features and a partition for dividing the envelope into first (30) and second portions (32) that communicate with each other through at least one path. A first opening (22) in the envelope is provided through which articles can be inserted into the first portion and a seal for sealing the first opening is provided. A second opening (36) opens into the second portion through which a staining medium can be introduced into the second portion when desired. The path is constructed and arranged so as at least to inhibit access to the first portion through the second portion and to indicate tampering if access is breached. The partition is intermittent to form a plurality of paths that can permit a staining medium to be dispensed into the first portion through the second portion.