Patents by Inventor Witold Filipowicz

Witold Filipowicz has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20180208928
    Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for miRNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or miRNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.
    Type: Application
    Filed: December 6, 2017
    Publication date: July 26, 2018
    Applicant: FRIEDRICH MIESCHER INSTITUTE FOR BIOMEDICAL RESEARCH
    Inventors: Volker Busskamp, Witold Filipowicz, Jacek Krol, Botond Roska
  • Publication number: 20160304865
    Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for mi RNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or mi RNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.
    Type: Application
    Filed: September 25, 2014
    Publication date: October 20, 2016
    Applicant: Friedrich Miescher Institute for Biomedical Research
    Inventors: Volker Busskamp, Witold Filipowicz, Jacek Krol, Botond Roska
  • Publication number: 20130252233
    Abstract: The application relates to methods for determining whether or not antiviral therapies will be effective. In particular, the present application provides a method using miRNA, e.g. miR-122 or miR-296-5p, for determining the likelihood that a subject having a viral infection of the liver will be responsive to antiviral therapy that includes stimulation of Interferon (IFN) activity, and kits for the performance of said determination.
    Type: Application
    Filed: May 9, 2013
    Publication date: September 26, 2013
    Applicants: Research
    Inventors: Witold Filipowicz, Markus Heim, Magdalena Filipowicz, Jacek Krol, Ilona Markiewicz
  • Publication number: 20130059749
    Abstract: The application relates to treatments for improving antiviral therapies and to method for determining whether or not antiviral therapies will be effective. In particular, the present application provides a method for determining the likelihood that a subject having a viral infection of the liver will be responsive to antiviral therapy that includes stimulation of Interferon (IFN) activity, and kits for the performance of said determination.
    Type: Application
    Filed: August 1, 2012
    Publication date: March 7, 2013
    Inventors: Witold Filipowicz, Markus Heim, Magdalena Sarasin-Filipowicz, Francois H.T. Duong
  • Publication number: 20110256534
    Abstract: The application relates to methods for determining whether or not antiviral therapies will be effective. In particular, the present application provides a method using miRNA, e.g. miR-122 or miR-296-5p, for determining the likelihood that a subject having a viral infection of the liver will be responsive to antiviral therapy that includes stimulation of Interferon (IFN) activity, and kits for the performance of said determination.
    Type: Application
    Filed: June 26, 2009
    Publication date: October 20, 2011
    Inventors: Witold Filipowicz, Markus Heim, Jacek Krol, Ilona Krol, Magdalena Filipowicz
  • Publication number: 20110117563
    Abstract: The application relates to treatments for improving antiviral therapies and to method for determining whether or not antiviral therapies will be effective. In particular, the present application provides a method for determining the likelihood that a subject having a viral infection of the liver will be responsive to antiviral therapy that includes stimulation of Interferon (IFN) activity, and kits for the performance of said determination.
    Type: Application
    Filed: April 20, 2009
    Publication date: May 19, 2011
    Inventors: Witold Filipowicz, Markus Heim, Magdalena Filipowicz, Francois H.T. Duong, Edward J. Oakeley
  • Publication number: 20100167302
    Abstract: The application relates to treatments for improving antiviral therapies and to method for determining whether or not antiviral therapies will be effective. In particular, the present application provides a method for determining the likelihood that a subject having a viral infection of the liver will be responsive to antiviral therapy that includes stimulation of Interferon (IFN) activity, and kits for the performance of said determination.
    Type: Application
    Filed: September 8, 2008
    Publication date: July 1, 2010
    Applicant: NOVARTIS AG
    Inventors: Witold Filipowicz, Markus Heim, Magdalena Sarasin-Filipowicz, Francois H. T. Duong
  • Publication number: 20080045417
    Abstract: The present invention relates to oligonucleotide microarrays comprising short chemically modified RNA oligonucleotides and uses of such microarrays in genomics applications. More specifically, the invention provides an oligonucleotide array comprising a surface and a plurality of oligonucleotide, wherein at least one oligonucleotide has at least one modified sugar moiety at the 2'OH position. The microarrays of the invention are more specifically useful to detect small RNAs.
    Type: Application
    Filed: October 13, 2004
    Publication date: February 21, 2008
    Inventors: Jan Weiler, Jonathan Hall, Christoph Wanke, Jorg Bernd Lange, Witold Filipowicz, Fabrice Kolb
  • Publication number: 20040235764
    Abstract: A method is provided for inhibiting gene expression in a mammalian cell based on dsRNA, as well as construct useful for carrying out the invention and resulting cells and transgenic mammals.
    Type: Application
    Filed: October 3, 2003
    Publication date: November 25, 2004
    Inventors: Eric Billy, Witold Filipowicz, Ulrich Mueller
  • Patent number: 6307037
    Abstract: The invention relates to genes isolated from Ashbya gossypii that code for proteins essential for normal fungal growth and development. The invention also includes the methods of using these proteins to discover new fungicides, based on the essentiality of the gene for normal growth and development. The invention can also be used in a screening assay to identify inhibitors that are potential fungicides.
    Type: Grant
    Filed: July 21, 2000
    Date of Patent: October 23, 2001
    Assignee: Syngenta Participations AG
    Inventors: Thomas Deane Gaffney, Albert Flavier, Michelle M. Cloyd Kirksey, Peter Phillippsen, Frederick Dietrich, Jurgen Wendland, Paul Bernasconi, Kimberly White, Witold Filipowicz
  • Patent number: 6018103
    Abstract: The present invention relates to a chimeric gene construction comprising one promoter element and a 3' termination signal in functional combination with a gene, wherein a) the promoter is an snRNA promoter element from plants specific for RNA polymerase II b) promoter element, of signalling the formation of RNA 3' ends, c)the gene codes for a polypeptide for sense RNA, for anti-sense RNA or for snRNA, with the proviso that, in the case of the snRNA, the 3' termination signal used in b) represents a eukaryotic poly(A) signal.
    Type: Grant
    Filed: December 15, 1995
    Date of Patent: January 25, 2000
    Assignee: Novartis Finance Corporation
    Inventors: Witold Filipowicz, Sheila Connelly