Abstract: A method for reducing vortex formation in molten metal when bottom tapping the molten metal from a metallurgical vessel in a metal making process. The method includes the steps of tapping the molten metal via a tapping hole in the metallurgical vessel, and providing a flow of the molten metal in the metallurgical vessel while tapping via a time-varying electromagnetic field applied to the metallurgical vessel, the flow of the molten metal being such that it constantly moves vortices in the molten metal away from a tapping hole region during the tapping to thereby prevent accumulation of the vortices for vortex formation over the tapping hole. It is also presented an arrangement for carrying out the method.

Abstract: Provided are forward-imaging optical coherence tomography (OCT) systems and probes.

Abstract: Provided are forward-imaging optical coherence tomography (OCT) systems and probes. In one embodiment, a scanning reflector surface is configured to be rotated about two axes in a single operating plane to direct light transmitted along the sample path to a sample to be imaged.

Abstract: A method for melting steel in an electric arc furnace (EAF). A hot heel is provided in the EAF. Metal scrap is loaded into the EAF. The metal scrap is melted in the EAF. The mass of the hot heel in relation to the mass of the metal scrap that is initially beyond the surface of the hot heel is a certain minimum. This minimum is 0.75 times the relation between the heat required to melt the metal scrap beyond the surface of the hot heel and the heat that can be taken from the hot heel without it being solidified when a theoretical heat balance calculation is applied as defined in a formula.

Abstract: Disclosed is a control system for a melting process in an electric arc furnace for melting a metallic material. By means of the present disclosure it is possible to minimize desired process properties such as the melting time or the total power consumption of the melting process. The system includes a processing unit adapted for receiving or collecting measured data of at least one process variable, determining the current state of the process, performing an optimization of the melting process, determining a process input based on the result of the optimization, and controlling the melting process by means of the process input. A method is also presented herein.

Abstract: A method of controlling a melting process in an electric arc furnace for melting a metallic material. By means of the present disclosure it is possible to minimize desired process properties such as the melting time or the total power consumption of the melting process. The method includes the steps of receiving or collecting measured data of at least one process variable, determining the current state of the process, performing an optimization of the melting process, determining a process input based on the result of the optimization, and controlling the melting process by means of the process input. A control system is also presented herein.

Abstract: An apparatus for electromagnetic stirring of the steel melt in an electrical arc furnace includes two electromagnetic stirrer units, a current supply, and a control unit. The two stirrers are mounted on an outer bottom surface of the electrical arc furnace at opposites sides of a central position of the bottom surface, the current supply is operatively connected to the two electromagnetic stirrer units, and the control unit is operatively connected to the current supply to control the operation of the two electromagnetic stirrer units.

Abstract: A method for melting steel in an electric arc furnace (EAF). A hot heel is provided in the EAF. Metal scrap is loaded into the EAF. The metal scrap is melted in the EAF. The mass of the hot heel in relation to the mass of the metal scrap that is initially beyond the surface of the hot heel is a certain minimum. This minimum is 0.75 times the relation between the heat required to melt the metal scrap beyond the surface of the hot heel and the heat that can be taken from the hot heel without it being solidified when a theoretical heat balance calculation is applied as defined in a formula.

Abstract: A method and device for controlling a melting and refining process in an electric arc furnace for melting a metal, wherein the electric arc furnace includes molten and solid metal and a slag layer on the surface of the molten metal, wherein an electromagnetic stirrer is arranged for stirring the molten metal. The method includes calculating/determining masses of the molten and solid metal at a point of time, wherein the calculation is based on initial values of the molten and solid metal, an arc power supplied to the electric arc furnace, and temperatures of the molten and solid metal, determining a stirring power based on the calculated/determined masses, and supplying the determined stirring power to the electromagnetic stirrer.

Abstract: A handheld imaging probe for performing optical coherence tomography is disclosed. The handheld imaging probe includes a lens tube and a housing. The lens tube contains an objective lens and a polycarbonate sheet. The polycarbonate sheet provides a bio-safe contact with a tissue sample to be examined. The housing, which is connected to the lens tube, contains a micromirror for directing a laser beam to irradiate the tissue sample via the objective lens and the polycarbonate sheet.

Abstract: A method for reducing vortex formation in molten metal when bottom tapping the molten metal from a metallurgical vessel in a metal making process. The method includes the steps of tapping the molten metal via a tapping hole in the metallurgical vessel, and providing a flow of the molten metal in the metallurgical vessel while tapping via a time-varying electromagnetic field applied to the metallurgical vessel, the flow of the molten metal being such that it constantly moves vortices in the molten metal away from a tapping hole region during the tapping to thereby prevent accumulation of the vortices for vortex formation over the tapping hole. It is also presented an arrangement for carrying out the method.

Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.

Abstract: A method of controlling a melting process in an electric arc furnace for melting a metallic material. By means of the present disclosure it is possible to minimize desired process properties such as the melting time or the total power consumption of the melting process. The method includes the steps of receiving or collecting measured data of at least one process variable, determining the current state of the process, performing an optimization of the melting process, determining a process input based on the result of the optimization, and controlling the melting process by means of the process input. A control system is also presented herein.

Abstract: The present invention discloses a conductive sensor and a urinal having conductive sensor. Said conductive sensor is installed in the sewer pipe of the urinal or toilet, which comprises an insulating body and a detecting electrode used for detecting the electric conductivity of the liquid in the sewer pipe. Said conductive sensor also comprises a self-cleaning device used for cleaning the end of the detecting electrode. Said self-cleaning device comprises a housing, a piston unit and a brush head unit. A water inlet pipe connected with the tap water pipe and a water outlet pipe connected with the sewer pipe are installed to said housing. Said brush head unit comprises a brush head used for cleaning the end of the detecting electrode. Thus, the detected result of conductive sensor and the urinal having conductive sensor are more reliable and the device is easy to be maintained.

Abstract: Provided are forward-imaging optical coherence tomography (OCT) systems and probes.

Abstract: Advances in sequencing technologies have dramatically reduced costs in producing high quality draft genomes. There are still many contigs and possible misassembled regions in those draft genomes. Described herein are methods for improving the quality of sequencing techniques, and particularly methods for overcoming the loading bias inherent in, for instance, the PacBio sequencing process. Compared to Sanger sequencing technology, the herein described method is not only cost-effective but also can close gaps greater than 2.5 Kb in a single round of reactions. It can also sequence through high GC regions and difficult secondary structures such as hairpin loops.

Abstract: An optical imaging system having two micromirrors is disclosed. Each of the two micromirrors can be rotated by a first set of combdrive actuators along a first axis and a second set of combdrive actuators along a second axis. Each of the first and second set of combdrive actuators includes multiple stator comb fingers and multiple rotor comb fingers capable of rotating about a torsion bar. One of the micromirrors can be tuned by applying a current to the torsion bar to change the Young's modulus of the torsion bar via thermoelectrical heating of the torsion bar.

Abstract: An apparatus for electromagnetic stirring of the steel melt in an electrical arc furnace includes two electromagnetic stirrer units, a current supply, and a control unit. The two stirrers are mounted on an outer bottom surface of the electrical arc furnace at opposites sides of a central position of the bottom surface, the current supply is operatively connected to the two electromagnetic stirrer units, and the control unit is operatively connected to the current supply to control the operation of the two electromagnetic stirrer units.

Abstract: According to an example embodiment of the present invention, a vibration-actuated microsurgical system includes an optical force detection arrangement having an optical encoding device configured to modulate an intensity of light in response to a displacement of a portion of the microsurgical system. Light sensing circuitry is configured to detect a force applied to the microsurgical system (e.g., and thereby to a sample) based on the intensity of light sensed from the optical encoding device. This detected force is used in controlling the application of the microsurgical system.

Abstract: An apparatus for isolating rare cells from a blood sample is disclosed. The apparatus includes a reservoir for supplying the blood sample and a pump for receiving the blood sample. The apparatus also includes a microchip and a set of magnets. The microchip has a microchannel formed between the microchip and a glass slide. The microchannel is connected between the reservoir and the pump to allow the blood sample to flow from the reservoir to the pump. The set of magnets is located adjacent to the glass slide to form a magnetic gradient along the glass slide on which rare cells can be isolated from the blood sample.