Abstract: The present invention relates to a thermoplastic resin composition and an exterior material including the same. More particularly, the present invention has an effect of providing a thermoplastic resin composition having even and low gloss while maintaining mechanical properties and processability equal or superior to those of a conventional ASA resin; having natural coloring through control for a uniform refractive index; and being capable of reducing appearance defects due to excellent co-extrusion processability with PVC and an exterior material including the thermoplastic resin.

Abstract: Disclosed in the present invention are polymorphic forms of a compound and a preparation method therefor and an application thereof. A crystal form III of a compound A uses Cu—K? radiation, and X-ray powder diffraction expressed at 2? angles has characteristic peaks at 12.15±0.20°, 15.98±0.20°, 16.62±0.20°, 17.14±0.20°, 24.32±0.20°, and 26.08±0.20°. A crystal form VII of the compound A uses Cu—K? radiation, and X-ray powder diffraction expressed at 2? angles has characteristic peaks at 12.94±0.20°, 14.41±0.20°, 15.64±0.20°, 17.25±0.20°, 21.75±0.20°, and 24.23±0.20°. The polymorphic forms prepared by the present invention are good in stability, and can be stably stored under the conditions of high temperature and low relative humidity.

Abstract: A method of user equipment may comprise: determining whether an error condition for a first beam communicating with a base station is met; when it is determined that the error condition for the first beam is met, determining whether a first physical uplink control channel (PUCCH) allocated to the user equipment is present within a predetermined first period of time; when it is determined that the first PUCCH is not present, transmitting a sounding reference signal (SRS) transmission approval request and an identifier of the user equipment to the base station through a second PUCCH pre-configured to be shared by all pieces of user equipment; and when an SRS transmission approval is received from the base station, transmitting an SRS to the base station.

Abstract: Disclosed is a transformer, including a first resonance coil, a primary coil, a secondary coil, a second resonance coil, and a magnetic core which includes a first base, a second base, a third base, a magnetic cover, a first center pillar, a second center pillar, a third center pillar, a fourth center pillar, a fifth center pillar, and a sixth center pillar. The first and second center pillars extend from the first base towards the second base. The third and fourth center pillars extend from the second base towards the third base. The fifth and sixth center pillars extend from the third base towards the magnetic cover. The first resonance coil surrounds the first and second center pillars. The primary coil surrounds the third and fourth center pillars. The secondary coil surrounds the third and fourth center pillars. The second resonance coil surrounds the fifth and sixth center pillars.

Abstract: A cracking furnace system for converting a hydrocarbon feedstock into cracked gas includes a convection section, a radiant section and a cooling section. The convection section includes a plurality of convection banks configured to receive only a hydrocarbon feedstock and a diluent. The radiant section includes a firebox comprising at least oxygen or oxygen enriched air burners and several radiant coils configured to heat up the feedstock to a temperature allowing a pyrolysis reaction. The cooling section includes at least two transfer line exchangers (TLE), a primary transfer line exchanger (PTLE) and a secondary transfer line exchanger (STLE). The system includes a mixing device for mixing the preheated hydrocarbon feedstock and the preheated diluent. The system is configured such that the hydrocarbon feedstock and diluent mixture is preheated in the secondary transfer line exchanger before entry into the radiant section. The primary transfer line exchanger is configured to generate saturated steam.

Abstract: Provided is an upper retractable controller for a bidet filter, including a controller main body 120 from which a capsule type bidet filter 400 is detachable through an upper portion, a water supply part 150 configured inside the controller main body 120 and supplying raw water to the bidet filter 400, an operation part 110 configured in the controller main body 120 and controlling the water supply part 150, an opening and closing cover part 130 coupled to the upper portion of the controller main body 120 and sealing the bidet filter 400, and a filter detachable frame 300 provided in the controller main body 120 and on which the bidet filter 400 is detachably seated to support an inflow of water and a supply of purified cleaning water to a nozzle assembly of a bidet.

Abstract: The present disclosure relates to a graft copolymer. Additionally provided is a graft copolymer composition having excellent particulate dispersibility in a curable resin such as an epoxy resin and being applicable as a particulate impact reinforcing agent, a curable resin composition including the graft copolymer, and methods of preparing them.

Abstract: Proposed is a large displacement precision positioning adjustment apparatus including a mirror at an upper end, a fixed plate at a lower portion, linear driving parts including a linear driver performing a large displacement fine operation and a movement supporting part including a guide guiding a movement direction and a fixing part fixing the driver. The linear driver includes a first rotation driving part performing a large displacement movement, a third rotation driving part, a second rotation driving part performing a fine movement, and a moving shaft. The linear driving part includes an upper end connection part connecting an upper end of the linear driving part to the mirror, and a lower end connection part connecting a lower end of the linear driving part and the fixed plate, a first controller controlling a position of the linear driving part, and a second controller controlling a position of the mirror.

Abstract: A display driver integrated circuit, System-On-Chip, and display system including the System-On-Chip are provided.

Abstract: A communication system using user interfaces for executing the instant messenger is provided. The system receives, via a network, data corresponding to at least one chat room; displays, based on the data and in a user interface of the instant messenger application, a chat room list; in response to receiving, via the user interface, a user input that indicates focus on a displayed portion of a first chat room, displays, via the user interface, chat room information that comprises metadata corresponding to the first chat room; and based on a determination that a focusing time for the displayed portion of the first chat room satisfies a threshold: displays, via the user interface and during display of the chat room information, a chat preview window corresponding to the first chat room; and displays, in the chat preview window, at least one chat communication occurred in the first chat room.

Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.

Abstract: Disclosed are an integrated user interface platform development system and method. The user interface platform development system according to an embodiment of the present invention may comprise: a development tool which provides a WYSIWYG screen file development environment and generates a screen file source in which a user interface platform is composed of structured components; a server which provides resources for screen file development using the development tool and on which developed screen file sources are registered; and a client which includes a client engine that loads the screen file source requested of and received from the server, and which provides the user interface platform executed in a browser window and corresponding to a linked device, wherein the development tool includes a design system module for maintaining design consistency.

Abstract: A foldable display device and a method for driving the same are provided. The foldable display device comprises a display panel, at least one capacitive sensor and at least one detection circuit, wherein the display panel comprises at least one bending area configured for bending, the capacitive sensor comprises a first electrode structure and a second electrode structure configured to form a sensing capacitor, and the detection circuit is connected to the first electrode structure and the second electrode structure, respectively, and is configured to detect a capacitance value of the sensing capacitor and obtain a bending angle of the foldable display device according to the capacitance value or a capacitance change amount of the sensing capacitor.

Abstract: Disclosed are a circuit breaking unit and an air circuit breaker including the same. The present disclosure provides a circuit breaking unit, including: a fixed contact; a movable contact that is in contact with or spaced apart from the fixed contact; a fixed contact terminal having the fixed contact disposed at a lower end thereof and extending upward; a movable contact terminal on which the movable contact is disposed and configured such that the movable contact moves in a direction toward the fixed contact or in a direction away from the fixed contact; and a low runner disposed extending upward from the fixed contact, one end thereof coupled to the fixed contact terminal, and the other end thereof spaced apart from the fixed contact terminal, wherein a magnet unit or a U assembly is disposed between the low runner and the fixed contact terminal.

Abstract: An apparatus and method for calibration between wide angle-narrow angle lenses through a dual-ChArUco board is disclosed. A method of calibration between wide angle-narrow angle lenses through a dual-ChArUco board includes recognizing a first pattern through a wide-angle lens of a first sensor and recognizing a second pattern through a narrow-angle lens of a second sensor, storing the first pattern and the second pattern; and calibrating the stored first pattern and the stored second pattern.

Abstract: Disclosed is a source driver IC including a first latch circuit configured to sample image data, a second latch circuit configured to latch and output the sampled image data at a rising edge of a latch enable signal, a latch enable signal output control circuit configured to output the latch enable signal at a first timing or second timing according to a timing setting signal, a digital-to-analog converter configured to convert the image data into an analog data voltage, an output buffer circuit configured to amplify and output the data voltage in synchronization with the latch enable signal, and a Mux circuit configured to be turned on during a period of a low level of a source output enable signal to output the data voltage to each channel.

Abstract: A digitizer includes a first sensing coil disposed in an active region, a first dummy line disposed in the same layer as the first sensing coil, a second sensing coil disposed below the first sensing coil in the active region, a second dummy line disposed in the same layer as the second sensing coil, a bridge line disposed below the second sensing coil, and a third dummy line disposed in the same layer as the bridge line.

Abstract: A terminal unit and a battery protection unit including the terminal unit are disclosed. In an embodiment of the disclosed technology, a terminal unit may include a terminal housing including an accommodation space, a connection duct connected to a rear face of the terminal housing and structured to communicate with the accommodation space, and a door connected to the terminal housing. The door includes a door body including an end coupled to a hinge of the terminal housing, and a door coupling part positioned at another end of the door body and detachably coupled to the terminal housing. The door body includes a door groove including a concave surface that faces the connection duct in a state in which the door coupling part is coupled to the terminal housing.

Abstract: A coil component includes a body having a first surface and a second surface opposing each other in a first direction, a support member disposed in the body, the support member having a first surface and a second surface opposing each other, a coil disposed on the support member, a pad portion disposed on the first surface of the support member to be connected to the coil, an external electrode disposed on the first surface of the body, and a via electrode connecting the pad portion and the external electrode to each other.

Abstract: A pixel circuit, a display device, and a mobile terminal including the display device are disclosed. The pixel circuit includes one or more first switch elements configured to be turned on in response to a first gate signal; one or more second switch elements configured to be turned on in response to a second gate signal; one or more third switch elements configured to be turned on in response to a third gate signal; an internal gate signal generator configured to receive the first gate signal and the second gate signal to output the third gate signal; and a driving element configured to drive a light emitting element.