Abstract: Provided is a novel anti-HCV agent including as an active ingredient a peroxide derivative represented by the general formula (I). In the general formula (I), C represents an alicyclic hydrocarbon ring group which may be substituted, n represents an integer of from 1 to 6, and R represents a hydrogen atom or a hydroxyalkyl group. The peroxide derivative exhibits potent anti-HCV activity by remarkably suppressing HCV-RNA replication.

Abstract: An object of the present invention is to provide a novel antischistosomal agent, and more specifically, to provide a novel drug capable of inhibiting a growth of schistosomes in vivo to prevent development of liver dysfunction due to eggs of the schistosomes in the case of infection with the schistosomes. The novel antischistosomal agent includes as an active ingredient a peroxide derivative. Specifically, the novel antischistosomal agent includes as an active ingredient a peroxide derivative represented by the general formula (I): where C represents an alicyclic hydrocarbon ring group which may be substituted, and n represents an integer of 1 to 6.

Abstract: Provided is a novel anti-HCV agent including as an active ingredient a peroxide derivative represented by the general formula (I). In the general formula (I), C represents an alicyclic hydrocarbon ring group which may be substituted, n represents an integer of from 1 to 6, and R represents a hydrogen atom or a hydroxyalkyl group. The peroxide derivative exhibits potent anti-HCV activity by remarkably suppressing HCV-RNA replication.

Abstract: An object of the present invention is to provide a novel antischistosomal agent, and more specifically, to provide a novel drug capable of inhibiting a growth of schistosomes in vivo to prevent development of liver dysfunction due to eggs of the schistosomes in the case of infection with the schistosomes. The novel antischistosomal agent includes as an active ingredient a peroxide derivative. Specifically, the novel antischistosomal agent includes as an active ingredient a peroxide derivative represented by the general formula (I): where C represents an alicyclic hydrocarbon ring group which may be substituted, and n represents an integer of 1 to 6.

Abstract: Compounds with high antimalarial activity; and antimalarial drugs containing the same as an active ingredient. There are provided compounds with antimalarial activity represented by the chemical formula: (wherein R1 is H, Cl or OCH3; R2 is H or CH3; R3 is CH, CH2, C(CH3), CH(CH3) or C(CH3)2; Ar is imidazole, triazole, pyridine, benzene, pyrrole, furan, thiophene or derivatives thereof; n is 1 to 5; and m is 1 to 5). Further, there are provided antimalarial drugs containing these compounds with antimalarial activity or pharmacologically acceptable salts thereof as active ingredients.

Abstract: An object of the present invention is to provide a novel antischistosomal agent, and more specifically, to provide a novel drug capable of inhibiting a growth of schistosomes in vivo to prevent development of liver dysfunction due to eggs of the schistosomes in the case of infection with the schistosomes. The novel antischistosomal agent includes as an active ingredient a peroxide derivative. Specifically, the novel antischistosomal agent includes as an active ingredient a peroxide derivative represented by the general formula (I): where C represents an alicyclic hydrocarbon ring group which may be substituted, and n represents an integer of 1 to 6.

Abstract: Compounds with high antimalarial activity; and antimalarial drugs containing the same as an active ingredient. There are provided compounds with antimalarial activity represented by the chemical formula: (wherein R1 is H, Cl or OCH3; R2 is H or CH3; R3 is CH, CH2, C(CH3), CH(CH3) or C(CH3)2; Ar is imidazole, triazole, pyridine, benzene, pyrrole, furan, thiophene or derivatives thereof; n is 1 to 5; and m is 1 to 5). Further, there are provided antimalarial drugs containing these compounds with antimalarial activity or pharmacologically acceptable salts thereof as active ingredients.

Abstract: Compounds with high antimalarial activity; and antimalarial drugs containing the same as an active ingredient. There are provided compounds with antimalarial activity represented by the chemical formula: (wherein R1 is H, Cl or OCH3; R2 is H or CH3; R3 is CH, CH2, C(CH3), CH(CH3) or C(CH3)2; Ar is imidazole, triazole, pyridine, benzene, pyrrole, furan, thiophene or derivatives thereof; n is 1 to 5; and m is 1 to 5). Further, there are provided antimalarial drugs containing these compounds with antimalarial activity or pharmacologically acceptable salts thereof as active ingredients.

Abstract: The present invention is to provide an antimalarial agent having excellent antimalarial activity with little side effects, in particular, having remarkable antimalarial activity against drug-resistant malaria parasites, and being capable of increasing solubility not only to organic solvent including olive oil, but also to water, and therefore, being usable not only as oral drugs but also as injectable solutions. The antimalarial agent of the present invention contains a compound represented by the following general formula (I) [wherein Z represents an unsubstituted or optionally substituted alicyclic hydrocarbon group, R0 represents a water-soluble functional group, m represents any one of integers of from 0 to 6, n represents any one of integers of from 0 to 10.].

Abstract: An antibiotic SF2487 substance having the formula (I) or a salt thereof possesses an antimalarial activity against the proliferation of malarial parasites and is therefore useful as an antimalarial drug.

Abstract: The present invention is to provide an antimalarial agent having excellent antimalarial activity with little side effects, in particular, having remarkable antimalarial activity against drug-resistant malaria parasites, and being capable of increasing solubility not only to organic solvent including olive oil, but also to water, and therefore, being usable not only as oral drugs but also as injectable solutions. The antimalarial agent of the present invention contains a compound represented by the following general formula (I) [wherein Z represents an unsubstituted or optionally substituted alicyclic hydrocarbon group, R0 represents a water-soluble functional group, m represents anyone of integers of from 0 to 6, n represents any one of integers of from 0 to 10.].

Abstract: A febrifugine represented by Formula (A): and an isofebrifugine represented by Formula (B): which exhibit extremely strong activities against tropical malarial protozoan are provided, together with a total synthesis route which enables efficient large scale synthesis of the same.

Abstract: An object of the present invention is to provide a novel compound having antimalarial acitivity and an antimalarial agent containing the novel compound as an active component. An antimalarial agent containing 12-hidroxy-2-(1-methoxy-carbonylethyl)-5-oxo-10,11,13-trioxatricyclo[7.2.0.01,6]tridecane represented by a following formula (II) as an active agent is prepared.

Abstract: An antibiotic SF2487 substance having the formula (I) 1

Abstract: An object of the present invention is to provide a novel compound having antimalarial acitivity and an antimalarial agent containing the novel compound as an active component. An antimalarial agent containing 12-hidroxy-2-(1-methoxy-carbonylethyl)-5-oxo-10,11,13-trioxatricyclo[7.2.0.01,6]tridecane represented by a following formula (II) as an active agent is prepared.

Abstract: A febrifugine represented by Formula (A): 1

Abstract: A febrifugine represented by Formula (A): and an isofebrifugine represented by Formula (B): which exhibit extremely strong activities against tropical malarial protozoan are provided, together with a total synthesis route which enables efficient large scale synthesis of the same.

Abstract: A method of detecting falciparum, tertian, quartan and ovale malaria parasites by using primers represented by the sequences (SEQ ID NO:1), (SEQ ID NO:3) to (SEQ ID NO:10):5'AAGTCATCTTTCGAGGTGAC3' (SEQ ID NO:4)5'GAATTTTCTCTTCGGAGTTTA3' (SEQ ID NO:5)5'GAGACATTCTTATATATG3' (SEQ ID NO:3)5'GAAAATTCCTTTCGGGGA3' (SEQ ID NO:1)5'CGACTAGGTGTTGGATGA3' (SEQ ID NO:6)5'GAACGAAAGTTAAGGGAGT3' (SEQ ID NO:7)5'ACTGAAGGAAGCAATCTAA3' (SEQ ID NO:8)5'TCAGATACCGTCGTAATCTT3' (SEQ ID NO:9)5'CCAAAGACTTTGATTTCTCAT3' (SEQ ID NO:10)This invention allows all of the plasmodia, which infect the human, to be detected easily, rapidly and with a high sensitivity or distinguished accurately from one another, thus permitting treatment for malaria and large-scale mass examination in the area where malaria is prevalent.