Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.

Abstract: The present invention discloses a method of preparing solar-grade silicon single crystals by using the Czochralski and float-zone process: in the equal-diameter growth process during the float-zone phase, under the control by the electric control system of a float-zone single crystal furnace, a downward-rotating motor alternates forward rotations and reverse rotations; said downward-rotating motor drives silicon single crystals to rotate by the preset forward angle or reverse angle. The present invention improves the radial resistivity variation of solar-grade silicon single crystals and solves the black heart problem with solar-grade silicon single crystals. Thus, the conversion efficiency of the solar cells manufactured using such solar-grade silicon single crystals can be increased.