Lectin compositions and methods for modulating an immune response to an antigen
The present invention provides a fusion polypeptide which can bind to a cell surface binding moiety (e.g., a carbohydrate) and serve as a ligand for a cell surface polypeptide, as well as a vector comprising a nucleic acid encoding for such a fusion polypeptide, and a host cell comprising such nucleic acid. The present invention also provides a composition comprising an antigen bearing target and such a fusion polypeptide, as well as a composition comprising a virus or a cell and such a fusion polypeptide. The present invention further relates to a method of modulating an immune response in an animal using such compositions.
Latest Genitrix, LLC Patents:
[0001] The present application is a divisional application to U.S. Utility Application with Ser. No. 10/645,000, filed Aug. 20, 2003, which claims priority to U.S. Provisional application 60/404,823, filed Aug. 20, 2002 and 60/487,407, filed Jul. 15, 2003, the entirety of each is hereby incorporated by reference.
BACKGROUND OF THE INVENTION[0002] Typically, the specific modulation of an immune response to an antigen in a subject requires the administration of another substance, e.g. an adjuvant, in admixture with the antigen in order to initiate and/or direct the modulation. Traditional adjuvants, though, have a number of weaknesses. For example, many are crude, heterogeneous preparations. In addition, many are relatively weak immunomodulators, and some cause severe local inflammation that is unacceptable in humans. Purified soluble polypeptides, such as cytokines, have some advantages over crude adjuvants, but their value is limited because they diffuse away from the antigen upon administration. While certain cell-surface molecules may be potential immunomdulators as components of cell-based vaccines, their application generally involves gene transfer into the cells, which is often problematic.
[0003] The invention therefore fills heretofore unmet needs by providing molecules that can bind to antigen bearing targets, such as cells, viruses, and isolated antigens, and that can serve as immunomodulators when administered with an antigen bearing target. In addition, the invention provides compositions comprising these molecules and related methods. The compositions and methods of the invention are also useful for other applications, e.g. any application in which it is desirable to attach a biological effeector, such as a polypeptide ligand for a cell surface receptor, to a target structure, such as a virus or a cell.
SUMMARY OF THE INVENTION[0004] The present invention relates to a multifunctional molecule, e.g. a fusion polypeptide, comprising a first part which is capable of binding to an antigen bearing target and a second part which is capable of binding to a cell. In a preferred embodiment, the first part is a first cell surface binding moiety and the second part is a second cell surface binding moiety. In this embodiment, the first cell surface binding moiety can attach to a virus or cell, e.g. a tumor cell, which comprises an antigen. It is also particularly preferred that the second cell surface binding moiety can bind to a cell-surface polypeptide, e.g. a non-immunoglobulin polypeptide, of an antigen presenting cell (APC). Thus, in some embodiments, a multifunctional molecule of the invention can serve as a bridge or link between an antigen bearing target and an APC.
[0005] As used herein an “antigen bearing target” is an entity which comprises an antigen. As used herein an “antigen bearing target” includes, for example, a whole cell which expresses an antigen a cell fraction comprising an antigen, a membrane fraction comprising an antigen, a virus comprising an antigen, a viral particle comprising an antigen, or an antigen, e.g. a polypeptide antigen, which may be free of any other cell-derived or virus-derived material. Cellular fractions may be prepared using methods known to those of skill in the art such as those taught in Cell Biology A Laboratory Handbook (Academic Press 1994 Editor J. E. Celis ISBN 0-12-164715-3)
[0006] The term “antigen” as used herein refers to a molecule against which a subject can initiate a humoral and/or cellular immune response. Antigens can be any type of biologic molecule including, for example, simple intermediary metabolites, sugars, lipids, and hormones as well as macromolecules such as complex carbohydrates, phospholipids, nucleic acids and proteins. Common categories of antigens include, but are not limited to, viral antigens, bacterial antigens, fungal antigens, protozoa and other parasitic antigens, tumor antigens, antigens involved in autoimmune disease, allergy and graft rejection, and other miscellaneous antigens. In the compositions and methods of the invention, it is preferred that the antigen is a polypeptide, e.g., one comprising at least seven amino acids.
[0007] As used herein, “antigen presenting cell” or “APC” refers to cells that ingest and present antigen to T cells. These cells include phagocytic leukocytes, macrophages, and dendritic cells, B lymphocytes, and endothelial cells. A “professional APC” is an APC that is constitutively able to activate a T lymphocyte. Professional APCs typically constitutively express class II major histocompatibility molecules and costimulatory molecules such as B7-1 and/or B7-2.
[0008] In one embodiment, the invention encompasses a multifunctional molecule, the first part of which is a lectin. Thus, the multifunctional molecule can bind to one or more carbohydrates of an antigen bearing target. In a preferred embodiment of the invention, the first part of the multifunctional molecule is a lectin and the second portion is a ligand for a cell surface protein (e.g., a ligand for a cell surface receptor). Preferably, the cell surface protein is a cell surface receptor of an APC. Ligands for a cell surface receptor include any ligand which will bind to a cell surface protein, and preferably include, but are not limited to, an opsonin, cytokine, adhesion molecule, counterreceptor of a T cell costimulatory molecule, a defensin, a ligand for a CD40 molecule, or a heat shock protein, or a portion of any of these ligands, including about (or at least about) 5, 8, 10, 12, 15, 20, 25, 35, 50, 60, 70, 80, 100, or 120 contiguous amino acids of such a ligand. Preferably, the multifunctional molecule which comprises first and second parts comprises an amino acid sequence which can bind to a cell surface protein (e.g., a cell surface receptor) including, but not limited to an adhesion molecule, a costimulatory molecule for a T cell, or a receptor for at least one of the following types of molecules: a cytokine, a defensin, a heat shock protein, a CD40 molecule, or an opsonin.
[0009] A cell surface protein (e.g., a cell surface receptor) useful in the present invention is any cell surface molecule which can bind the ligand portion of a multifunctional molecule of the invention. Preferably, the cell surface receptor is a CD40 molecule, a T cell costimulatory molecule, an adhesion molecule, or a receptor for a cytokine, a defensin, a heat shock protein, an opsonin, or an adhesion molecule. Cell surface proteins, useful in the invention include, but are not limited to the cell surface molecules identified by GenBank Accession number in Appendix I and II, or those cell surface molecules which are encoded by a nucleic acid molecule identified by GenBank Accession number in Appendix I or II.
[0010] The term “cytokine” as used herein refers to a polypeptide molecule that is naturally secreted by mammalian cells and that binds to a cell surface protein on a leukocyte, inducing a change (e.g., a change in the proliferative state, a change in the transcriptional profile or a change in the propensity to migrate) in the leukocyte (other than mere occupancy of the leukocyte's receptors for the cytokine). “Change” refers to at least about a 5% increase or decrease as compared to in the absence of a cytokine. The term “cytokine” also refers herein to a polypeptide molecule that is a ligand for a receptor for a naturally occurring cytokine.
[0011] Examples of cytokines which are useful in the methods and compositions of the invention include the following: GM-CSF, Il-2, IL-4, IL-6, IL-12, ligands for hematopoietin receptors, ligands for immunoglobulin superfamily receptors, ligands for interferon receptors, ligands for TNF receptors, and ligands for chemokine receptors. An antibody against a cytokine receptor can also be a cytokine.
[0012] In one embodiment of the invention, it is preferred that a cytokine comprised by a composition of the invention promote a Th1 immune response, i.e., the generation of T cells that express Th1 cytokines such as IL-2 and IFN-&ggr;. In another embodiment, it is preferred that a cytokine comprised by a composition of the invention promote a Th2 immune response, i.e., the generation of T cells that express Th2 cytokines such as IL-4 and IL-10.
[0013] “Engineered cytokines” as described herein are cytokines which comprise a heterologous cell surface binding moiety.
[0014] The term “opsonin” as used herein refers to naturally occurring and non-naturally occurring molecules which are capable, by virtue of being contemporaneously bound or attached to both an antigen-containing cell and an antigen-presenting cell (APC), of acting as a link or coupling agent (an adapter) between the antigen and the APC to allow more efficient binding, engulfment, and internalization of the antigen-containing cell by the APC. An opsonin useful according to the invention, also includes non-naturally occurring opsonins capable of binding to APCs via receptors that can bind naturally occurring opsonins.
[0015] The term “opsonin” as used herein can also refer to molecules which can be processed such that at least one product of the processing step or steps is capable of, by virtue of being contemporaneously bound or attached to both an antigen-containing cell and an APC, acting as a link or coupling agent to allow more efficient binding, engulfment, and internalization of other antigen-containing cells by the APC. An opsonin can also be any polypeptide chain of a multichain opsonin.
[0016] Examples of opsonins which are useful in the methods and compositions of the invention include the following: vitronectin, fibronectin, complement components such as C1q (including any of its component polypeptide chains A, B and C), complement fragments such as C3d, C3b and C4b, mannose binding protein, conglutinin, surfactant proteins A and D, C-reactive protein (CRP), alpha-2-macroglobulin, and immunoglobulins, for example, the Fc portion of an immunoglobulin.
[0017] “Innate opsonins” are opsonins of the innate immune system and are known in the art as secreted polypeptide molecules of the innate immune system and are believed to bind contemporaneously to an antigen and to the surface of an APC. They can thus act as “bridges”, and are thought, by virtue of this property, to promote internalization of antigens by APCs. The mode in which opsonins bind to antigens varies among opsonins, and can be covalent or noncovalent. In general, the antigen-binding moieties of innate opsonins differ from the antigen-binding moieties of immunoglobulins in that the former are relatively invariant among members of the same species, and do not undergo diversification during the ontogeny of an individual.
[0018] A molecule containing a naturally occurring APC-binding moiety shall be considered an opsonin if it contains a moiety through which it can be stably bound or attached to a cell such that the APC-binding moiety is located in the extracellular space, whether or not the opsonin molecule contains its natural antigen-binding domain.
[0019] “Engineered opsonins”, as described herein, include molecules in which a cell surface binding moiety is substituted for the natural antigen-binding domain of an opsonin or where a cell surface binding moiety is linked to the opsonin without modification or removal of the natural antigen-binding domain of the opsonin.
[0020] A “cell surface binding moiety” is a moiety through which a molecule can be stably bound to a cell surface, e.g. a cell wall, a polysaccharide capsule, or the lipid or protein component of a plasma membrane, or to the surface of a virus. Such moieties include but are not limited to crosslinking moieties and lipid moieties. It is preferred that the cell surface binding moiety bind to a cell by a means other than interaction of a polypeptide with its cognate cell-surface polypeptide. It is further preferred that the cell surface binding moiety comprise a non-polypeptide moiety. In a preferred embodiment, a lipid moiety is linked to the engineered molecule via a glycosylphosphatidylinositol (GPI) moiety. In another preferred embodiment, the lipid comprises a fatty acid, e.g. palmitate. In yet another preferred embodiment of the invention, the cell surface binding moiety is linked to an opsonin or an antigen-binding domain-truncated opsonin at the antigen-binding end of the opsonin. In another preferred embodiment, the multifunctional molecule comprises an idiotypic portion of an immunoglobulin which can bind to an APC. Preferably, the opsonin of an opsonin-enhanced cell is one of alpha′ chain C3b or mannose binding protein.
[0021] If the opsonin is a fragment of C3, it is preferred hat it bind to CR1 with a greater affinity than to CR2. It is further preferred that the fragment of C3 not be a ligand for CR2. Preferably, the opsonin is neither C3bi, C3d, nor C3dg.
[0022] It is preferred that the opsonins bind to receptors that trigger phagocytosis and that are non-clonotypic and thus do not vary from cell to cell as, for example, clonotypic receptors do. Non-clonotypic receptors are present on cells which play a role in innate immunity, and include, e.g., non-idiotypic receptors. Examples of such receptors include CR1, CR2, CR3, CR4, and C1q receptor, receptors containing a component of the C1q receptor, collectin receptors, receptors for &agr;2m, receptors for CRP, and Fc receptors for immunoglobulins.
[0023] “Exogenous” refers to something which is introduced from or produced outside the cell.
[0024] “Endogenous” refers to something which is expressed or present naturally in a cell.
[0025] “Heterologous” refers to something which is not naturally expressed in a cell.
[0026] Preferably, the multifunctional molecule which comprises first and second parts can bind, via the second part, to the surface or plasma membrane of an antigen presenting cell (APC), i.e. a cell that can present antigen to a T cell, e.g. a cell that can activate a T cell, at least in part by presenting antigen to the T cell. The APC may be a leukocyte, e.g. a cell of monocytic lineage and/or a dendritic cell. Preferably, binding of the multifunctional molecule is independent of expression of an idiotype, e.g. a clonotypic determinant of an immunoglobulin, on the APC. Most preferably, the multifunctional molecule comprises a first end which can bind to a cell that comprises an antigen and a second end which can bind to a APC.
[0027] The multifunctional molecule may bind to an antigen bearing target cell by, e.g., inserting into the lipid portion of a cell membrane or by binding to a structure, e.g. a polypeptide or a carbohydrate, that is physically associated with the lipid portion of the membrane. The structure need not be directly in contact with the lipid portion of the membrane, but may be indirectly attached, e.g. a carbohydrate that is part of a cell-surface glycoprotein. Preferably the multifunctional molecule can bind via a first part to an antigen bearing target, preferably a mammalian cell that comprises an antigen, and via a second part to an APC. The invention also encompasses the use of a molecule that can bind via a first part to a virus or to a non-mammalian cell, e.g. a fungal or bacterial cell, and via a second part to an APC. In the latter cases, the first part may bind, e.g., to a component of a cell wall or a capsule.
[0028] In a preferred embodiment, the multifunctional molecule which comprises first and second parts comprises a first part which comprises a lectin and a second part that can bind to a leukocyte, e.g. an APC, e.g. a cell of monocytic lineage or a dendritic cell (which may itself be of monocytic lineage). A “lectin”, according to the invention, is a molecule or part of a molecule, e.g. an amino acid sequence, which can bind to a carbohydrate, e.g. a polysaccharide. Families of naturally occurring lectins include:
[0029] 1) Galectins, a rapidly growing family of animal lectins. All of them share galactose-specificity.
[0030] 2) Calcium-dependent (C-type) animal lectins, an extremely large family composed of members having diverse structures and functions.
[0031] 3) Among this C-type lectin family, selectins form a distinguishable subfamily by their specific function in leukocyte adhesion to endothelial cells through sialyl-Lewis X recognition.
[0032] 4) Collectins, another subfamily of C-type lectins specific for mannose, which have a unique structure consisting of a C-type lectin domain and a collagen-like domain. They are involved in innate immunity.
[0033] 5) Invertebrates are known to contain various lectins in their body fluids, probably as body-protection factors. Recently, some lectins from an echinoderm were found to show hemolytic activity.
[0034] 6) Annexins, a group of proteins having affinity to lipids that were recently shown to be lectins showing binding to glycosaminoglycans.
[0035] 7) The legume lectin family, which consists of a large number of members, such as ConA, with variable saccharide specificity comparable to C-type lectins.
[0036] 8) Ricin, the first lectin investigated in Russia more than 100 years ago. It is now evident that the ricin family has many other homologous members which differ in either toxicity or sugar-binding specificities.
[0037] Thus, a multifunctional molecule of the invention may bind to one or more carbohydrates. Carbohydrates to which lectins may bind also include, for example, carbohydrates comprising lactose, D-mannose, D-glucose, D-fucose, L-fucose (e.g. alpha-L-fucose), D-galactose, blood group A oligosaccharides, blood group B oligosaccharides, saccharides comprising alpha-D-Gal(1->3)[alpha-Lfuc(1->2)]-beta-D-Gal(1->3/4-beta-D-GlcNAc, saccharides comprising alpha-sialyl [2->3]-lactose, alpha-D-mannosyl glycoconjugates, alpha-NeuNAc-[2->6]-Gal, alpha-NeuNAc-[2->6]-GalNAc, alpha-NeuNAc-[2->3]-Gal, N-acetyl-beta-D-glucosamine, terminal alpha-D-galactosyl residues, terminal beta-D-galactosyl residues, N-acetyllactosamine, terminal alpha-D-mannosyl residues, N-acetyl-beta-D-glucosamine, terminal N-acetyl-D-galactosamine, N-acetylneuraminic acid, and terminal alpha-D-galactosaminyl residues.
[0038] The multifunctional molecule which comprises a lectin may comprise, for example, the whole of a naturally occurring lectin or a portion of a naturally occurring lectin, e.g about (or at least about) 5, 8, 10, 12, 15, 20, 25, 35, 50, 60, 70, 80, 100, or 120 contiguous amino acids of a naturally occurring polypeptide lectin. In one embodiment the multifunctional molecule comprises a carbohydrate-binding domain of a naturally occurring lectin, i.e., a portion of a lectin that can bind to a carbohydrate in the absence of the remainder of the lectin. In another embodiment the lectin may be non-naturally occurring, e.g. identified from an artificial library of molecules or designed by modifying the structure of a naturally occurring lectin.
[0039] Lectins known as “hemagglutinins” bind to carbohydrates on erythrocytes, e.g. blood group antigens, and when incubated with these cells cause them to aggregate. The influenza virus hemagglutinin, for example, binds to sialic acid (as does the human parainfluenza virus 3 hemagglutinin/neuraminidase). There are at least 15 known influenza hemagglutinin subtypes, defined by their distinct antigenic properties. Any of these subtypes, designated, e.g., H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, and H15, may provide amino acid sequences useful in the compositions and methods of the invention. In one embodiment of the invention, the hemagglutinin is of a subtype from a virus that infects humans, e.g. H1, H2, or H3. In another embodiment, the hemagglutinin is of a subtype from a virus that does not infect humans, e.g. one of H4 through H15. Amino acid sequences can vary up to about 20% for influenza hemagglutinins within a given subtype, and can vary between about 30% and about 70% for influenza hemagglutinins from different subtypes.
[0040] Influenza hemagglutinin is expressed as a single polypeptide chain, designated HA0, which trimerizes post-translationally. HA0 is proteolytically cleaved to yield two domains, HA1 and HA2, which are disulfide-bonded to each other. HA1 comprises significant sialic acid binding activity, while HA2 is anchored to the viral membrane and facilitates fusion of this membrane with a host cell membrane. In preferred embodiments of the invention, the multifunctional molecule comprising first and second parts comprises an amino acid sequence of an HA1 domain.
[0041] The molecule may be a fusion polypeptide which comprises one or more amino acids interposed between the first and second parts which bind to cells, e.g. a fusion polypeptide which comprises a first amino acid sequence which can bind to an antigen bearing target and a second amino acid sequence which can bind to a leukocyte, and which further comprises at least one amino acid interposed between the first and second parts. The interposed amino acids may comprise, e.g., a linker sequence intended to lessen steric hindrance or other undesirable interactions between the aforementioned first and second parts. For, example, one such type of sequence takes the form (Gly3Ser)n. Additional useful linkers include, but are not limited to (Arg-Ala-Arg-Asp-Pro-Arg-Val-Pro-Val-Ala-Thr)1-5 (Xu et al., 1999, Proc. Natl. Acad. Sci. U.S.A. 96: 151-156), (Gly-Ser)n (Shao et al., 2000, Bioconjug. Chem. 11: 822-826), (Thr-Ser-Pro), (Kroon et al., 2000, Eur. J. Biochem. 267: 6740-6752), (Gly-Gly-Gly)n (Kluczyk et al., 2000, Peptides 21: 1411-1420), and (Glu-Lys), (Klyczyk et al., 2000, supra), wherein n is 1 to 15 (each of the preceding references is also incorporated herein by reference). In another embodiment, no amino acids are interposed between the first and second parts.
[0042] The present invention further provides a nucleic acid molecule, preferably a recombinant nucleic acid molecule which encodes a multifunctional polypeptide of the present invention. The nucleic acid molecule may be, for example, DNA, RNA, cDNA, or mRNA. The nucleic acid molecule may be naturally occuring or may be partially or wholly synthesized using techniques known to those of skill in the art. In a preferred embodiment, the nucleic acid molecule is a DNA molecule comprising a first nucleic acid sequence encoding a first amino acid sequence which can bind to an antigen bearing target, and a second nucleic acid sequence encoding a second amino acid sequence which can bind to a cell surface receptor on an APC.
[0043] The present invention still further provides a vector comprising the nucleic acid molecule encoding a multifunctional polypeptide of the invention, e.g. an expression vector suitable for expressing in a host cell, wherein the host cell is preferably a eukaryotic cell, more preferably an animal cell, more preferably a mammalian cell, and still more preferably a human cell. In another preferred embodiment the host cell is a yeast cell, e.g. Saccharomyces cerevesiae.
[0044] The invention also provides a host cell comprising a nucleic acid vector which comprises a sequence encoding the multifunctional molecule of the present invention. Preferably, the host cell is a eukaryotic cell, such as a yeast cell- or an animal cell, preferably a human cell. The host cell may also be a prokaryotic cell.
[0045] The invention also encompasses a molecule, e.g. a polypeptide, e.g. a fusion polypeptide, which comprises a first part that can bind to an antigen bearing target, e.g. a cell, e.g. a cell that comprises an antigen, and a second part that can bind to a cell, e.g. a leukocyte, e.g. an APC. The molecule may have any of the characteristics taught in the descriptions of methods and compositions herein. Preferably the first and second parts are heterologous to each other. The molecule may be, e.g., a recombinant polypeptide expressed in a mammalian cell, an insect cell, a plant cell, a yeast cell, or a bacterial cell.
[0046] The invention also encompasses a method of modulating an immune response in an animal comprising the step of expressing in an animal, e.g. expressing in a host cell of the animal, a multifunctional molecule of the invention, e.g. a polypeptide which comprises a first part that can bind to a antigen bearing target and a second part that can bind to a cell. According to the invention, “expressing in an animal” means “causing to be present in an animal”. When the molecule is a polypeptide, it is preferably expressed by introducing into the host cell, in vivo or ex vivo, a nucleic acid encoding the polypeptide. If the nucleic acid is introduced into the host cell ex vivo, the host cell may subsequently be administered to the animal. In a preferred embodiment, the method further comprises administering to the animal the antigen to which the immune response is modulated. For example, the antigen may be administered to the animal as part of a composition which further comprises a nucleic acid that encodes the multifunctional molecule. In another preferred embodiment, the antigen is already present in the animal at the time the multifunctional molecule is expressed. In yet another preferred embodiment, the antigen is administered to the animal after administration of the multifunctional molecule. In still other preferred embodiments, the antigen is expressed in the animal, e.g. by administering to the animal a composition comprising a nucleic acid encoding the antigen, either before or after expression of the multifunctional molecule in the animal. In another embodiment, nucleic acid sequences encoding the multifunctional molecule and the antigen are introduced into one or more host cells of the animal, e.g. by administering to the animal a composition comprising those nucleic acid sequences.
[0047] As used herein, the term “modulating an immune response” to a selected antigen using the methods and compositions of the invention means rendering the response more or less efficient, more or less rapid, greater or lesser in magnitude, and/or more or less easily induced than the response obtained from administration of a composition which is identical in every respect except that it does not comprise a multifunctional molecule of the invention. In a preferred embodiment, the response is between about 5 and 100%, or preferably between about 5 and 50% or more preferably between about 5 and 25% more or less efficient, more or less rapid, greater or lesser in magnitude, and/or more or less easily induced than the response obtained from administration of a composition which is identical in every respect except that it does not comprise a multifunctional molecule of the invention.
[0048] The term “modulate the immune response” may refer to stimulation/activation of an immune response to a selected antigen, or it may refer to suppression, elimination, or attenuation of an immune response to a selected antigen. In a preferred embodiment, modulating the immune response results in stimulation/activation of an immune response to a selected antigen by about at least 5%, or preferably between 5 and 50% or more preferably between 50 and 100%, as compared to an immune response in the absence of vaccination, or it may result in suppression, elimination, or attenuation of an immune response to a selected antigen by about at least 5%, or preferably between 5 and 50% or more preferably between 50 and 100%, as compared to an immune response in the absence of vaccination. In some cases, one immune response to an antigen (e.g. a Th1 response) may be increased while another immune response to the same antigen (e.g. a Th2 response) may be diminished.
[0049] The invention also encompasses a composition comprising a multifunctional molecule of the invention and antigen bearing target, e.g. a virus, a prion, or a cell. Preferably, when the antigen bearing target is a cell, the multifunctional molecule is exogenous to the cell. The multifunctional molecule may be heterologous to the cell. In one embodiment, the multifunctional molecule is expressed within the cell, e.g. from a recombinant nucleic acid within the cell. The invention also encompasses a cell comprising a nucleic acid encoding a multifunctional molecule of the invention. The multifunctional molecule may have any of the characteristics set forth herein. An antigen bearing target (e.g., a cell) useful in the invention includes, for example, malignant cells, benign tumor cells, lymphocytes, e.g. B or T lymphocytes which may be pathogenic and/or autoreactive, cells expressing an antigen from an exogenously introduced nucleic acid molecule, eukaryotic cells such as mammalian cells, human cells, fibroblasts, insect and fungal cells, and prokaryotic cells such as bacterial cells. Examples of viruses useful in the invention include, e.g., retroviruses such as human immunodeficiency viruses 1 and 2; herpesviruses such as herpes simplex viruses 1 and 2, cytomegalovirus, and varicella zoster virus; human papilloma virus; rabies virus; rotavirus; influenza viruses A, B, and C; hepatitis viruses A, B, C, and E or delta agent; adenoviruses; measles virus; mumps virus; polio virus; rubella virus; parainflunza viruses; coxsackie viruses A and B; variola virus; yellow fever virus; dengue and other hemorrhagic fever viruses; West Nile fever virus; Eastern equine encephalitis virus; Western equine encephalitis virus; Venezuelan equine encephalitis virus; Japanese encephalitis virus; rhinoviruses; and foot and mouth disease virus. Prions include the agents of scrapie, kuru, and bovine spongiform encephalitis. The cell, virus, or prion may be attenuated, i.e. rendered non-pathogenic, by, e.g, killing, irradiation, chemical fixation, passaging in culture with selection for diminished pathogenicity, or genetic manipulation. Preferably, the composition further comprises a leukocyte, e.g. a monocyte, a cell of monocytic lineage, a macrophage, or a dendritic cell or another APC.
[0050] Preferably, in the inventive methods and compositions, the cell is substantially unable to divide in vitro. “Substantially unable to divide in vitro” means that the cell divides at a rate that is less than about 50% of the rate of division of corresponding cells which are not treated to prevent cell division. In a preferred embodiment, the cell divides at a rate that is less than about 30-50% of the rate of division of corresponding cells which are not treated to prevent cell division.
[0051] Preferably, the composition is substantially free of culture medium. As used herein, “culture medium” refers to medium that is used in cell culture containing at least 2% animal serum, such as fetal calf serum.
[0052] More particularly, the present invention provides a multifunctional molecule which is a fusion polypeptide comprising: a lectin which comprises at least about 10 contiguous amino acids of an influenza virus hemagglutinin, and at least about 5 contiguous amino acids of a naturally occurring GM-CSF molecule.
[0053] In one embodiment, the lectin is N-terminal to the contiguous amino acids of a naturally occurring GM-CSF molecule.
[0054] In an alternate embodiment, the lectin is C-terminal to the contiguous amino acids of a naturally occurring GM-CSF molecule.
[0055] In one embodiment, the lectin comprises at least about 10 contiguous amino acids of the HA1 domain of an influenza virus hemagglutinin.
[0056] In one embodiment, the lectin is the HA1 domain of an influenza virus hemagglutinin.
[0057] Preferably, the influenza virus hemagglutinin is a hemagglutinin of an influenza A virus. In other preferred embodiments the influenza virus hemagglutinin is a hemagglutinin of an influenza B or influenza C virus.
[0058] In one embodiment, the influenza virus hemagglutinin is of a subtype from a virus that infects humans. Preferably, the influenza virus hemagglutinin is of an H1 subtype. Still more preferably, the influenza virus hemagglutinin is from the influenza A strain PR/8/34.
[0059] In one embodiment, the influenza virus hemagglutinin is of an H2 subtype.
[0060] In one embodiment, the influenza virus hemagglutinin is of an H3 subtype.
[0061] In one embodiment, the influenza virus hemagglutinin is of a subtype from a virus that does not infect humans.
[0062] In one embodiment the fusion polypeptide comprises the entire amino acid sequence of a naturally occurring GM-CSF molecule.
[0063] Preferably, the GM-CSF molecule is a murine GM-CSF. Still more preferably, the GM-CSF molecule is a human GM-CSF.
[0064] In one aspect, the invention encompasses a method of reducing the number of metastases, e.g. tumor metastases, in a subject, e.g. a mammal, e.g. a human, comprising the step of administering to the subject any of the compositions described herein, e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. Typically, such a composition will further comprise an antigen associated with the disease, or a nucleic acid encoding such an antigen. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein.
[0065] The invention provides, a method of reducing the number of metastasis in an animal comprising administering to said animal a composition comprising a cell comprising an antigen, said composition further comprising a fusion protein comprising a lectin and a ligand for a cell surface protein.
[0066] As used herein, a “metastasis” refers to a focus of disease that is caused by a malignent cell or infectious organism which has traveled from one site in a host to a second site in the host (e.g., from one site to a non-contiguous site; e.g., from a first organ to a second organ). More specifically, “metastasis” refers to a detectable focus of malignant tumor or infection that is derived from, and spread from, and is distinct from the primary site of disease. Accordingly, “metastases” refers to a plurality of foci either in a single organ or tissue in a subject, or in two or more organs or tissues in a subject. A “focus” as used herein may be at least a single malignant or infectious cell, or may be a detectable focus, which is detectable by one or more of the methods described hereinbelow. Metastases is said to be detected where a metastases is able to be detected by one of skill in the art using one or more of the assay methods described hereinbelow.
[0067] According to the invention, “reducing the number of metastases” may mean either causing there to be fewer (e.g., at least 10% fewer, 20%, 30%, 50%, 70%, 90%, and up to at least 100% fewer) metastases than expected (where the number or severity of metastases expected is based on the observations made in a set (e.g., more than one) or similar subjects which has not received the multifunctional molecule of the invention). In one embodiment “reducing the number of metastases” may encompass preventing metastases (e.g. a subject does not develop any detectable foci of disease), e.g. in a subject with a tumor, or causing one or more preexisting metastases to become undetectable, e.g. by radiologic, non-invasive imaging techniques, or other techniques as described herein. Those skilled in the art will recognize that a metastasis itself may become undetectable even though residual scarring or fibrosis may be detectable. Metastases may be, for example, to bone, brain, liver, lung, or spinal cord, or any other organ or tissue.
[0068] In another aspect, the invention encompasses a method of reducing the number of metastases in a population of subjects comprising the step of administering to one or more subjects any of the compositions described herein e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. Typically, such a composition will further comprise an antigen associated with the disease, or a nucleic acid encoding such an antigen. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein.
[0069] In another aspect, the invention encompasses a method of reducing the size of a metastasis in a subject comprising the step of administering to the subject any of the compositions described herein, e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. Typically, such a composition will further comprise an antigen associated with the disease, or a nucleic acid encoding such an antigen. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein. The “size” of a metastasis, as used herein refers to the one, two or three dimensional area encompassed by a metastasis, or alternatively, refers to the number of malignant or infectious cells present in a metastasis. The size of the metastasis, which may be measured by direct visualization or by noninvasive imaging, may be reduced by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%.
[0070] The invention provides a method of reducing the size of a metastasis in an animal comprising administering to said animal a composition comprising a cell comprising an antigen, said composition further comprising a fusion protein comprising a lectin and a ligand for a cell surface protein.
[0071] In another aspect, the invention encompasses a method of reducing the average size of metastases in a subject comprising the step of administering to the subject any of the compositions described herein. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein. According to the invention, “reducing the average size of metastases” may mean either causing metastases to be smaller on average than expected, e.g. by preventing one or more of them from growing to the expected size, or causing one or more preexisting metastases to become smaller, thus decreasing the mean size of the metastases. The average size of the metastases, which may be determined by direct visualization or by noninvasive imaging, may be reduced by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%.
[0072] In another aspect, the invention encompasses a method of reducing the average size of metastases in a population comprising the step of administering to one or more subjects any of the compositions described herein, e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein.
[0073] Thus, in another aspect the invention encompasses preventing or treating a disease in a subject by administering to the subject any of the compositions described herein, e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. Typically, such a composition will further comprise an antigen associated with the disease, or a nucleic acid encoding such an antigen. The disease may be, for example, a benign or malignant tumor, an infectious disease, an allergy, or an autoimmune disease. “Treating a disease” means decreasing morbidity or mortality associated with the disease in a patient or population afflicted with the disease. For example, survival, relapse-free survival, or disease-free survival may be prolonged by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%, or the number of metastases may be reduced by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%. For preventive applications, the incidence of the targeted disease may be reduced by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%.
[0074] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising the antigen and not comprising (i.e. free of) the multifunctional molecule administered in step 1. Generally, the two steps will be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the multifunctional molecule is administered to the subject prior to the composition which is free of the multifunctional molecule. In another embodiment, the composition which is free of the multifunctional molecule is administered to the subject prior to the composition which comprises the multifunctional molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle.
[0075] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising the antigen and further comprising a nucleic acid molecule encoding a multifunctional molecule of the invention and 2) administering to the subject a composition comprising the antigen and not comprising (i.e. free of) the nucleic acid molecule administered in step 1. Again, the two steps will generally be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the nucleic acid molecule is administered to the subject prior to the composition which is free of the nucleic acid molecule. In another embodiment, the composition which is free of the nucleic acid molecule is administered to the subject prior to the composition which comprises the nucleic acid molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle. The nucleic acid molecule may be comprised by an expression vector.
[0076] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and not comprising (i.e. free of) the multifunctional molecule administered in step 1. Generally, the two steps will be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the multifunctional molecule is administered to the subject prior to the composition which is free of the multifunctional molecule. In another embodiment, the composition which is free of the multifunctional molecule is administered to the subject prior to the composition which comprises the multifunctional molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle. One or more of the nucleic acid molecules may be comprised by an expression vector.
[0077] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and not comprising (i.e. free of) the multifunctional molecule administered in step 1. Generally, the two steps will be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the multifunctional molecule is administered to the subject prior to the composition which is free of the multifunctional molecule. In another embodiment, the composition which is free of the multifunctional molecule is administered to the subject prior to the composition which comprises the multifunctional molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle. The nucleic acid molecule may be comprised by an expression vector.
[0078] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising the antigen and not comprising (i.e. free of) the multifunctional molecule administered in step 1. Generally, the two steps will be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or a least 1 year apart. In one embodiment, the composition comprising the multifunctional molecule is administered to the subject prior to the composition which is free of the multifunctional molecule. In another embodiment, the composition which is free of the multifunctional molecule is administered to the subject prior to the composition which comprises the multifunctional molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle. The nucleic acid molecule may be comprised by an expression vector.
[0079] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a nucleic acid molecule encoding a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and not comprising (i.e. free of) the nucleic acid molecule encoding the multifunctional molecule, which was administered in step 1. Again, the two steps will generally be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the nucleic acid molecule is administered to the subject prior to the composition which is free of the nucleic acid molecule encoding the multifunctional molecule. In another embodiment, the composition which is free of the nucleic acid molecule encoding the multifunctional molecule is administered to the subject prior to the composition which comprises the nucleic acid molecule encoding the multifunctional molecule. One or more of the nucleic acid molecules may be comprised by an expression vector.
[0080] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a nucleic acid molecule encoding a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a multifunctional molecule of the invention. The multifunctional molecules of step 1 and step 2 may be the same or different. Again, the two steps will generally be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or a least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the nucleic acid molecule is administered to the subject prior to the composition which is free of the nucleic acid molecule encoding the multifunctional molecule. In another embodiment, the composition which is free of the nucleic acid molecule encoding the multifunctional molecule is administered to the subject prior to the composition which comprises the nucleic acid molecule encoding the multifunctional molecule. One or more of the nucleic acid molecules may be comprised by an expression vector.
[0081] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a nucleic acid molecule encoding a multifunctional molecule of the invention. The multifunctional molecules of step 1 and step 2 may be the same or different. Again, the two steps will generally be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the nucleic acid molecule is administered to the subject prior to the composition which is free of the nucleic acid molecule encoding the multifunctional molecule. In another embodiment, the composition which is free of the nucleic acid molecule encoding the multifunctional molecule is administered to the subject prior to the composition which comprises the nucleic acid molecule encoding the multifunctional molecule. One or more of the nucleic acid molecules may be comprised by an expression vector.
[0082] The present invention encompasses a method of modulating an immune response in an animal comprising the step of administering a composition comprising a multifunctional molecule, e.g. a polypeptide, e.g. a fusion polypeptide, which comprises a first part that can bind to a antigen bearing target and a second part that can bind to a cell. In a preferred embodiment, the composition further comprises an antigen, an immune response to which is modulated by administration of the composition. The antigen may be, for example, a polypeptide (e.g. a recombinant polypeptide), a lipid (e.g. a glycolipid), or a carbohydrate (e.g. a polysaccharide or a component of a bacterial or fungal cell wall). The composition therefore comprises an antigen bearing target, whether, e.g., a homogeneous antigen or a heterogeneous structure such as a cell or a virus. When the antigen bearing target is a cell, it may be autologous, syngeneic, allogeneic, or xenogeneic to the animal. In other preferred embodiments, the antigen is already present in the animal at the time the molecule is administered, and/or the antigen is administered to the animal prior to administration of the molecule. In yet another preferred embodiment, the antigen is administered to the animal after administration of the molecule.
[0083] Preferably, the composition comprises multifunctional molecules which are not bound to an antigen bearing target. In a preferred embodiment, the composition further comprises an antigen bearing target, e.g. a cell. In one embodiment of the invention, the composition comprises multifunctional molecules, some of which are bound to a antigen bearing target, e.g. to the surface of a cell, and some of which are external to and not bound to any target. In another embodiment, the composition comprises a multifunctional molecule and further comprises a portion of a cell, e.g. a membrane fraction of a cell (i.e., an antigen bearing target). In yet another embodiment, the composition comprises a multifunctional molecule and further comprises a multiplicity of different molecules derived from a cell, as is found, e.g., in a cell lysate. Cells may be lysed, for example, by freezing and thawing, preferably repeatedly. In a preferred embodiment, the composition is cell-free.
[0084] The present invention further encompasses a method of vaccinating a mammal to a selected antigen comprising administering to the animal a vaccine composition comprising a multifunctional molecule of the invention comprising a first part which is a lectin, and a second part which is a ligand for a cell surface protein, e.g. a cell surface receptor of an APC. Preferably, the lectin can bind to an antigen bearing target which comprises the antigen.
[0085] In one embodiment, the invention provides a method of vaccinating a mammal to a selected antigen comprising removing at least one cell from the mammal, wherein the cell comprises the antigen, contacting the cell ex vivo with a multifunctional molecule comprising a first part which is a lectin and is capable of binding to at least one carbohydrate molecule on the surface of the antigen bearing cell, and a second part which is a ligand for a cell surface protein of an APC, so as to form an antigen bearing cell/multifunctional molecule complex; and placing the complex back into the mammal.
[0086] In a preferred embodiment, the composition comprises an antigen, an immune response to which is modulated by administration of the composition.
[0087] The invention provides a method of modulating an immune response to a selected antigen in a mammal comprising administering to said animal a composition comprising a cell comprising said antigen, and a multifunctional molecule comprising a lectin and a ligand for a cell surface protein.
[0088] The invention also relates to a method of vaccinating an animal to a selected antigen comprising removing at least one cell from said animal, wherein the cell comprises said antigen; contacting said cell ex vivo with a fusion polypeptide comprising a lecting and a ligand for a cell surface protein of an antigen presenting cell so as to form a complex; and placing said complex back in said animal.
[0089] The present invention provides a method for juxtaposing an APC with an antigen bearing target comprising: contacting an APC and antigen bearing target with a multifunctional molecule comprising a first part comprising a lectin which is able to bind to at least one carbohydrate moiety on the antigen bearing target and a second part comprising a ligand for a cell surface protein on the APC. Preferably, the multifunctional molecule is first contacted with the antigen bearing target and the resulting antigen bearing target/multifunctional molecule complex is subsequently contacted with the APC. In one embodiment the antigen bearing target is a cell from an animal comprising an antigen, and is contacted with the multifunctional molecule ex vivo under conditions which permit the binding of the lectin to at least one carbohydrate moiety of the cell. The resulting multifunctional molecule/antigen bearing cell complex is then administered back to the animal from which the antigen bearing cell was derived wherein it is able to bind to a cell surface receptor on an APC via the ligand portion of the multifunctional molecule, thereby juxtaposing the antigen bearing target and the APC.
[0090] “Juxtaposition”, in the context of the present invention, includes but is not limited to physical contact. An APC and antigen bearing target are “juxtaposed” with one another if they are sufficiently close for the APC to internalize the antigen bearing target. An APC and antigen bearing target are also “juxtaposed” if they are separated by no more that 20 &mgr;m, preferably no more than 10 &mgr;m, and still more preferably no more than 5 &mgr;m, and more preferably no more than 1 &mgr;m.
[0091] As used herein, “contacting” refers to admixing in vitro or in vivo.
[0092] The invention also encompasses a method of modulating an immune response to an antigen comprising contacting in vitro an antigen bearing target, a multifunctional molecule of the invention, and an APC and administering the resultant composition to a subject. In one embodiment the antigen bearing target/multifunctional molecule complex is contacted with an APC for a time sufficient to permit internalization of the antigen bearing target by the APC. In other embodiments the antigen bearing target/multifunctional molecule complex is contacted with an APC for a time that allows internalization of less than about 80%, less than about 60%, less than about 40%, less than about 20%, less than about 10%, or less than about 5% of the antigen bearing target by the APC. Methods for determining the amount of target internalized, e.g. by measuring the amount remaining outside the APC and subtracting from the starting amount, are well-known in the art. Preferably, the antigen bearing target/multifunctional molecule complex is contacted with an APC for less than about 10 minutes, less than about 30 minutes, less than about 60 minutes, less than about 90 minutes, less than about 120 minutes, or less than about 180 minutes.
[0093] As used herein, “time sufficient to permit internalization” refers to a period of time that is of a sufficient duration to allow internalization of the selected antigen or antigen bearing targtet by the APC (for example, no more than about fourteen days, or seven days, or five or three days, or as little as about 24, 12, 6, 3, 2 or 1 hour, or even as little as about 30, 20, 10, 5, or 1 minute).
[0094] The invention also encompasses a method of attaching a ligand for a cell surface polypeptide to an antigen bearing target comprising admixing the antigen bearing target with a multifunctional molecule which comprises the ligand. The invention also encompasses a method of attaching an amino acid sequence to an antigen bearing target comprising admixing the antigen bearing target with a fusion polypeptide which comprises the amino acid sequence and further comprises a lectin. The invention also encompasses a composition comprising an antigen bearing target admixed with a fusion polypeptide which comprises a first amino acid sequence which is not a lectin and a second amino acid sequence which comprises a lectin.
[0095] The invention also comprises methods of producing a multifunctional molecule of the invention in each of the following cell types: a yeast cell, a mammalian cell, a bacterial cell, an insect cell. Each of these methods comprises the step of introducing a nucleic acid encoding a multifunctional molecule into the respective cell type, as taught hereinbelow.
[0096] The invention also encompasses methods of detecting or quantifying a multifunctional molecule of the invention comprising contacting the multifunctional molecule with an antibody or other ligand that binds to the multfunctional molecule. Such methods include ELISA assays and flow cytometry, as described hereinbelow. Preferably, the multifunctional molecule to be detected or quantitated is bound to an antigen bearing target.
DETAILED DESCRIPTION[0097] The present invention is based, in part, on the discovery that a multifunctional fusion protein comprising a first polypeptide which is a lectin and a second polypeptide which is a ligand of a cell surface receptor of an APC, can effectively target an antigen bearing target, such as a cell bearing an antigen of interest, to an APC, wherein the antigen is engulfed by the APC, and an appropriate immune response to the antigen is mounted by an animal to which the multifunctional molecule is administered.
[0098] Accordingly, the present invention provides a method for vaccinating a mammal comprising administering to the animal a vaccine composition comprising a multifunctional molecule of the invention comprising a first part which is a lectin and which can bind to a target bearing the antigen, and a second part which is a ligand for a cell surface protein of an APC. In one embodiment, the method comprises removing at least one cell from the mammal, wherein the cell comprises the antigen, contacting the cell ex vivo with a multifunctional molecule comprising a first part which is a lectin and is capable of binding to at lease one carbohydrate molecule on the surface of the antigen bearing cell, and a second part which is a ligand for a cell surface protein of an APC, so as to form an antigen bearing cell/multifunctional molecule complex; and placing the complex back into the mammal.
[0099] Multifunctional Molecules
[0100] The present invention encompasses a multifunctional molecule comprising a first part which can bind to an antigen bearing target, and a second part which is a ligand for a cell surface protein of a cell, e.g. an antigen presenting cell. Preferably, the first part which can bind to an antigen bearing target is a lectin which binds to at least one carbohydrate molecule present on the antigen bearing target. Preferably the lectin is an influenza hemagglutinin and binds to sialic acid residues present on the antigen bearing target. Preferably, the ligand of a cell surface protein of an antigen presenting cell is selected from an opsonin, a cytokine, a ligand for a CD40 molecule, an adhesion molecule, a defensin, a heat shock protein, or a counterreceptor for a T cell costimulatory molecule. Cell surface molecules which can act as receptors for the second part of the multifunctional molecule include CD40 molecules and specific receptors for an opsonin, a cytokine, an adhesion molecule, a defensin, a heat shock protein, or a counterreceptor for a T cell costimulatory molecule, and also include, but are not limited to the cell surface molecules listed in Apendix I and II.
[0101] Lectins
[0102] The multifunctional molecule which comprises first and second parts can comprise a first part which comprises a lectin and a second part that can bind to a leukocyte, e.g. an APC, e.g. a cell of monocytic lineage or a dendritic cell (which may itself be of monocytic lineage). A “lectin”, according to the invention, is a molecule or part of a molecule, e.g. an amino acid sequence, which can bind to a carbohydrate, e.g. a polysaccharide. Families of naturally occurring lectins include:
[0103] 1) Galectins, a rapidly growing family of animal lectins. All of them share galactose-specificity.
[0104] 2) Calcium-dependent (C-type) animal lectins, an extremely large family composed of members having diverse structures and functions.
[0105] 3) Among this C-type lectin family, selectins form a distinguishable subfamily by their specific function in leukocyte adhesion to endothelial cells through sialyl-Lewis X recognition.
[0106] 4) Collectins, another subfamily of C-type lectins specific for mannose, which have a unique structure consisting of a C-type lectin domain and a collagen-like domain. They are involved in innate immunity.
[0107] 5) Invertebrates are known to contain various lectins in their body fluids, probably as body-protection factors. Recently, some lectins from an echinoderm were found to show hemolytic activity.
[0108] 6) Annexins, a group of proteins having affinity to lipids that were recently shown to be lectins showing binding to glycosaminoglycans.
[0109] 7) The legume lectin family, which consists of a large number of members, such as ConA, with variable saccharide specificity comparable to C-type lectins.
[0110] 8) Ricin, the first lectin investigated in Russia more than 100 years ago. It is now evident that the ricin family has many other homologous members which differ in either toxicity or sugar-binding specificities.
[0111] Thus, a multifunctional molecule of the invention may bind to one or more carbohydrates. Carbohydrates to which lectins may bind also include, for example, carbohydrates comprising lactose, D-mannose, D-glucose, D-fucose, L-fucose (e.g. alpha-L-fucose), D-galactose, blood group A oligosaccharides, blood group B oligosaccharides, saccharides comprising alpha-D-Gal(1->3)[alpha-Lfuc(1->2)]-beta-D-Gal(1->3/4-beta-D-GlcNAc, saccharides comprising alpha-sialyl-[2->3]-lactose, alpha-D-mannosyl glycoconjugates, alpha-NeuNAc-[2->6]-Gal, alpha-NeuNAc-[2->6]-GalNAc, alpha-NeuNAc-[2->3]-Gal, N-acetyl-beta-D-glucosamine, terminal alpha-D-galactosyl residues, terminal beta-D-galactosyl residues, N-acetyllactosamine, terminal alpha-D-mannosyl residues, N-acetyl-beta-D-glucosamine, terminal N-acetyl-D-galactosamine, N-acetylneuraminic acid, and terminal alpha-D-galactosaminyl residues.
[0112] The multifunctional molecule which comprises a lectin may comprise, for example, the whole of a naturally occurring lectin or a portion of a naturally occurring lectin, e.g about (or at least about) 5, 8, 10, 12, 15, 20, 25, 35, 50, 60, 70, 80, 100, or 120 contiguous amino acids of a naturally occurring polypeptide lectin. In one embodiment the multifunctional molecule comprises a carbohydrate-binding domain of a naturally occurring lectin, i.e., a portion of a lectin that can bind to a carbohydrate in the absence of the remainder of the lectin. In another embodiment the lectin may be non-naturally occurring, e.g. identified from an artificial library of molecules or designed by modifying the structure of a naturally occurring lectin.
[0113] Lectins known as “hemagglutinins” bind to carbohydrates on erythrocytes, e.g. blood group antigens, and when incubated with these cells cause them to aggregate. The influenza virus hemagglutinin, for example, binds to sialic acid. There are at least 15 known influenza hemagglutinin subtypes, defined by their distinct antigenic properties. Any of these subtypes, designated, e.g., H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, and H15, may provide amino acid sequences useful in the compositions and methods of the invention. In one embodiment of the invention, the hemagglutinin is of a subtype from a virus that infects humans, e.g. H1, H2, or H3. In another embodiment, the hemagglutinin is of a subtype from a virus that does not infect humans, e.g. one of H4 through H15. Amino acid sequences can vary up to about 20% for influenza hemagglutinins within a given subtype, and can vary between about 30% and about 70% for influenza hemagglutinins from different subtypes. Methods for determining amino acid sequence homology are known to those of skill in the art. Examples of other software that can perform sequence comparisons to determine the % identity between hemagglutanin variants (or variants of any portion of the multifunctional molecules disclosed herein) include, but are not limited to, the BLAST package (Ausubel et al., 1995, Short Protocols in Molecular Biology, 3rd Edition, John Wiley & Sons), FASTA (Atschul et al., 1990, J. Mol. Biol., 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching.
[0114] Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied. It is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.
[0115] Advantageously, the BLAST algorithm is employed, with parameters set to default values. The BLAST algorithm is described in detail in Altschul et al., (1990) J. Mol. Biol. 215:403-410, which is incorporated herein by reference. The search parameters are defined as follows, and can be advantageously set to the defined default parameters.
[0116] Advantageously, “substantial identity” when assessed by BLAST equates to sequences which match with an EXPECT value of at least about 7, preferably at least about 9 and most preferably 10 or more. The default threshold for EXPECT in BLAST searching is usually 10.
[0117] BLAST (Basic Local Alignment Search Tool) is the heuristic search algorithm employed by the programs blastp, blastn, blastx, tblastn, and tblastx; these programs ascribe significance to their findings using the statistical methods of Karlin and Altschul (Karlin and Altschul 1990, Proc. Natl. Acad. Sci. USA 87:2264-68; Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90:5873-7) with a few enhancements. The BLAST programs are tailored for sequence similarity searching, for example to identify homologues to a query sequence. For a discussion of basic issues in similarity searching of sequence databases, see Altschul et al (1994) Nature Genetics 6:119-129.
[0118] The five BLAST programs available through the National Institutes of Health (NIII; Bethesda, Md.) perform the following tasks: blastp compares an amino acid query sequence against a protein sequence database; blastn compares a nucleotide query sequence against a nucleotide sequence database; blastx compares the six-frame conceptual translation products of a nucleotide query sequence (both strands) against a protein sequence database; tblastn compares a protein query sequence against a nucleotide sequence database dynamically translated in all six reading frames (both strands); tblastx compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.
[0119] BLAST uses the following search parameters:
[0120] HISTOGRAM—Display a histogram of scores for each search; default is yes. (See parameter H in the BLAST Manual).
[0121] DESCRIPTIONS—Restricts the number of short descriptions of matching sequences reported to the number specified; default limit is 100 descriptions. (See parameter V in the manual page).
[0122] EXPECT—The statistical significance threshold for reporting matches against database sequences; the default value is 10, such that 10 matches are expected to be found merely by chance, according to the stochastic model of Karlin and Altschul (1990). If the statistical significance ascribed to a match is greater than the EXPECT threshold, the match will not be reported. Lower EXPECT thresholds are more stringent, leading to fewer chance matches being reported. Fractional values are acceptable. (See parameter E in the BLAST Manual).
[0123] CUTOFF—Cutoff score for reporting high-scoring segment pairs. The default value is calculated from the EXPECT value (see above). HSPs are reported for a database sequence only if the statistical significance ascribed to them is at least as high as would be ascribed to a lone HSP having a score equal to the CUTOFF value. Higher CUTOFF values are more stringent, leading to fewer chance matches being reported. (See parameter S in the BLAST Manual). Typically, significance thresholds can be more intuitively managed using EXPECT.
[0124] ALIGNMENTS—Restricts database sequences to the number specified for which high-scoring segment pairs (HSPs) are reported; the default limit is 50. If more database sequences than this happen to satisfy the statistical significance threshold for reporting (see EXPECT and CUTOFF below), only the matches ascribed the greatest statistical significance are reported. (See parameter B in the BLAST Manual).
[0125] MATRIX—Specify an alternate scoring matrix for BLASTP, BLASTX, TBLASTN and TBLASTX. The default matrix is BLOSUM62 (Henikoff & Henikoff, 1992). The valid alternative choices include: PAM40, PAM120, PAM250 and IDENTITY. No alternate scoring matrices are available for BLASTN; specifying the MATRIX directive in BLASTN requests returns an error response.
[0126] STRAND—Restrict a TBLASTN search to just the top or bottom strand of the database sequences; or restrict a BLASTN, BLASTX or TBLASTX search to just reading frames on the top or bottom strand of the query sequence.
[0127] FILTER—Mask off segments of the query sequence that have low compositional complexity, as determined by the SEG program of Wootton & Federhen (1993) Computers and Chemistry 17:149-163, or segments consisting of short-periodicity internal repeats, as determined by the XNU program of Clayerie & States (1993) Computers and Chemistry 17:191-201, or, for BLASTN, by the DUST program of Tatusov and Lipman (NIH). Filtering can eliminate statistically significant but biologically uninteresting reports from the blast output (e.g., hits against common acidic-, basic- or proline-rich regions), leaving the more biologically interesting regions of the query sequence available for specific matching against database sequences.
[0128] Low complexity sequence found by a filter program is substituted using the letter “N” in nucleotide sequence (e.g., “NNNNNNNNNNN”) and the letter “X” in protein sequences (e.g., “XXXXXXXXX”).
[0129] Filtering is only applied to the query sequence (or its translation products), not to database sequences. Default filtering is DUST for BLASTN, SEG for other programs.
[0130] It is not unusual for nothing at all to be masked by SEG, XNU, or both, when applied to sequences in SWISS-PROT, so filtering should not be expected to always yield an effect. Furthermore, in some cases, sequences are masked in their entirety, indicating that the statistical significance of any matches reported against the unfiltered query sequence should be suspect.
[0131] NCBI-gi—Causes NCBI gi identifiers to be shown in the output, in addition to the accession and/or locus name.
[0132] Most preferably, sequence comparisons are conducted using the simple BLAST search algorithm provided by the NIH. In some embodiments of the present invention, no gap penalties are used when determining sequence identity.
[0133] Influenza hemagglutinin is expressed as a single polypeptide chain, designated HA0, which trimerizes post-translationally. HA0 is proteolytically cleaved to yield two domains, HA1 and HA2, which are disulfide-bonded to each other. HA1 comprises significant sialic acid binding activity, while HA2 is anchored to the viral membrane and facilitates fusion of this membrane with a host cell membrane. In preferred embodiments of the invention, the
[0134] multifunctional molecule comprising first and second parts comprises an amino acid sequence of an HA1 domain.
[0135] Additional examples of lectin molecules useful in the present invention include, but are not limited to, those lectins shown in Table 1, and variants thereof having at least 50%, 70%, 90%, and up to 99% sequence homology with the sequences of the lectins shown in Table 1. 1 TABLE 1 KEY NAME ABBREVIATION CLASS LECTIN CODE [1] /../. Quail Intestinal . LECa.Ggg.Sss.xx.Xxxx. Lectin. [2] /../. Porcine Heart Lectin . LECa.Ggg.Sss.xx.Xxxx. (PHL). [3] /../. Hepatic beta- S-lectin or GLTa.Ggg.Sss.xx.Xxxx. galactoside binding Galectin. lectins. [4] /../. Mammalian Brain S-lectin or GLTa.Ggg.Sss.xx.Xxxx. Beta-Galactoside- Galectin. binding Lectin. [5] Aaptos papillata. . . LECi.Ada.Pap.xx.Xxxx. [6] Abelmoschus . . LECp.Abe.Esc.xx.Xxxx. esculentus. [7] Abramis brana. . . LECp.Abr.Bra.xx.Xxxx. [8] Abrus precatorius. APA; APA-A; APA- beta-trefoil lectin LECp.AbrPre.se.Cga1 C; Abrin. (APA); Type 2 (abrin) RIP. LECp.AbrPre.se.Cga2 (APA). [10] Achatina fulica. Achatina fulica Cold . LECi.Ach.ful.xx.Xsi1. Aggltutinin; achatinin-H. [13] Actinomyces . . LECf.Act.Vis.xx.Xga1. viscosus. [14] Adenia digitata. Modeccin. Type 2 RIP. LECp.AdeDig.ro.Cga1. [15] Adenia volksensii. Volkensin. Type 2 RIP. LECp.AdeVol.ro.Cga1. [16] Aegilops . Hevein domain LECp.Aeg.Gen.se.Hch1. geniculata. lectin, chitin binding. [19] Aegopodium APA. . LECp.Aeg.Pod.rh.Hga1. podagraria. [20] Aeromonas . . LECb.Aer.Sal.xx.Xxxx. salmonicida. [21] Afzelia africana. . . LECz.Afz.Afr.xx.Xxxx. [22] Agardhiella tenera. . . LECz.Aga.Ten.xx.Xxxx. [23] Agaricales. . . LECz.Aga.sss.xx.Xxxx. [24] Agaricus bisporus. ABA-I, ABA-II, . LECf.Aga.Bis.xx.Xga1. ABA-III, ABA-IV. [25] Agaricus blazei. . . LECf.Aga.Bla.xx.Xxxx. [26] Agaricus . . LECf.Aga.Cam.xx.Xxxx. campestris. [27] Agaricus edulis. . . LECf.Aga.Edu.xx.Xxxx. [28] Agrobacterium . . LECu.Agr.Rad.xx.Xxxx. radiobacter. [29] Agrocybe aegerita. . . LECf.Agr.Aeg.xx.Xxxx. [30] Agropyrum AREL, ARLL. Hololectin; LECp.Agr.Rep.se.Hch1 repens. Monocot (AREL) mannose-binding LECp.Agr.Rep.le.Hch1 lectins. (ARLL). [31] Aleuria aurantia. . . LECf.Ale.Aur.xx.Xfu1. [32] Allium AAA. Monocot LECp.All.Asc.bu.Hma1. ascalonicum. mannose-binding lectins. [36] Allium cepa. ACA. Monocot LECp.All.Cep.bu.Hma1. mannose-binding lectins. [37] Allium moly. AMA. Monocot LECp.All.Mol.bu.Hma1. mannose-binding lectins. [38] Allium porrum. APA. Monocot LECp.All.Por.le.Hma1. mannose-binding lectins. [39] Allium sativam. ASA. Monocot LECp.All.Sat.bu.Hma1 Mannose-binding (ASA-I) lectin. LECp.All.Sat.bu.Hma1 (ASA-I) LECp.All.Sat.bu.Hma1 (ASA-I) LECp.All.Sat.bu.Hma1 (ASA-I) LECp.All.Sat.bu.Hma2 (ASA-II) LECp.All.Sat.le.Hma1 (ASA-III) LECp.All.Sat.ro.Hma1 (ASA-IV). [40] Allium ursinum. AUA-I, AUA-II, Monocot LECp.All.Urs.bu.Hma1 AUA-III, AUA-Ir, Mannose-binding (AUA-I) AUA-L, AUA-Iir. lectin LECp.All.Urs.bu.Hma2 (AUA-II) LECp.All.Urs.le.Hma1 (AUA-L) LECp.All.Urs.ro.Hma1 (AUA-Ir) LECp.All.Urs.ro.Hma2 (AUA-IIr). [42] Allium vineale. AVA. Monocot LECp.All.Vin.bu.Hma1. Mannose-binding lectin. [43] Allomyrina . . LECi.All.Dic.xx.Xxxx. dichotoma. [44] Alocasia indica. . . LECp.Alo.Ind.tu.Hcu1. [45] Aloe arborescens. Aloctin, AAA. AAA: Monocot LECp.Alo.Arb.le.? Mannose-binding (Aloctin-A) proteins Aloctin- LECp.Alo.Arb.le.Hma1 A: u. (AAA). [46] Amaranthus ACA, Amaranthin, beta-trefoil lectin, LECp.Ama.Cau.se.Hga1. caudatus. ACL. Amaranthin group. [47] Amaranthus . Amaranthin LECp.Ama.Cru.se.Hga1. cruentus. group. [48] Amaranthus AHML, Amaranthin. Amaranthin LECp.Ama.Hyp.xx.Xgal1. hypochondriacus. group. [49] Amaranthus . Amaranthin LECp.Ama.Leu.se.Hga1. leucocarpus. group. [50] Amaranthus ASL. Amaranthin LECp.Ama.Spi.se.Hga1. spinosus. group. [51] Amphicarpaea ABrA. Legume lectins. LECp.Amp.Bra.se.Hma1. bracteata. [52] Anadara granosa. Anadarin MS. . LECi.Ana.Gra.xx.Xsi1. [53] Anguilla anguilla. AAL. . LECi.Ang.Ang.xx.Xfu1. [54] Anthocidaris . Novel, unique LECi.Ant.Cra.xx.Xxxx. crassispina. lectin class. [55] Anthocidaris . . LECi.Ant.Cra.xx.Xxxx. crassispina Ovum. [57] Apium graveolens. . . LECp.Api.Gra.xx.Xxxx. [58] Aplysia . . LECi.Apl.Dac.xx.Xxxx. dactylomela. [59] Aplysia depilans. . . LECi.Apl.Dep.xx.Xga1. [60] Aplysina archeria. . . LECu.Apl.Arc.xx.Xxxx. [61] Arachis hypogea. PNA, GNL, MNL, All Arachnis LECp.Ara.Hyp.se.Hga1 PRA-I, PRA-II. lectins are classed (PNA) as legume lectins LECp.Ara.Hyp.no.Hga1 (GNL) LECp.Ara.Hyp.se.Hga1 (MNL) LECp.Ara.Hyp.se.Hga1 (PRA-I) LECp.Ara.Hyp.se.Hga1 (PRA-II). [62] Araucaria Lectin I, Lectin II. . LECp.Ara.Bra.se.Hmg1 brasiliensis. (Lectin I) LECp.Ara.Bra.se.Hmg2 (Lectin II). [63] Arion . . LECi.Ari.Emp.xx.Xxxx. empiricorum. [64] Arisaema ACA. . LECp.Ari.Con.tu.Hcu1. consanguineum. [65] Arisaema ACmA. . LECz.Ari.Cur.tu.Hcu1. curvatum. [66] Arthrobotrys AOL. . LECf.Art.Oli.xx.Xxxx. oligospora. [68] Artocarpus hirsuta. . . LECp.Art.Hir.xx.Xxxx. [69] Artocarpus incisa. . . LECp.Art.Inc.xx.Xxxx. [70] Artocarpus Jacalin, AIA, KM+, beta-prism plant LECp.Art.Int.se.Hga1. integrifolia. Artocarpin. lectin, Jacalin- related lectins. [71] Artocarpus Artocarpin, ALA-I, Jacalin-related LECp.Art.Lak.se.Hga1. lakoocha. ALA-II. lectins. [72] Arum maculatum. AMA. Monocot binding LECp.Aru.Mac.tu.Hma1. lectins. [73] Ascaris . . LECi.Asc.Lum.xx.Xxxx. lumbricoides. [74] Asparagus . . LECp.Asp.Off.xx.Xxxx. officinalis. [75] Bacillus . . LECb.Bac.Pols.xx.Xxxx. polymyxa. [76] Bacterioides . . LECb.Bac.Fra.xx.Xxxx. fragilis. [77] Bandeiraca BS-I, BS-I-A4, BS-I- . LECp.Ban.Sim.xx.Xxxx. simplicifolia. B4, BS-II. [78] Basidiomycotina. . . LECf.Bas.Sss.xx.Xxxx. [79] Bauhinia purpurea. BPA. Legume lectin. LECp.Bau.Pur.se.Hga1. [80] Bauhinia . . LECz.Bau.Tom.xx.Xxxx. tomentosa. [81] Beauveria . . LECf.Bea.Bas.xx.Xsi1. bassiana. [82] Beta vulgaris. . . LECp.Bet.Vul.xx.Xxxx. [83] Beta vulgaris. . . LECp.Bet.Vul.xx.Xxxx. [84] Biomphalaria BGL-I, BGL-II. . LECp.Bio.Gla.xx.Xxxx. glabrata. [85] Biomphalaria . . LECi.Bio.Gla.xx.Xxxx. glabrata. [86] Birgus latro. . . LECz.Bir.Lat.xx.Xxxx. [87] Blaberus BDL1, BDL2, BDL3. . LECi.Bla.Dis.xx.Xxxx. discoidalis. [88] Bordetella Pertussis toxin 1PRT. . LECz.Ggg.Sss.xx.Xxxx. pertussis. [89] Bos Taurus. Mannose 6-phosphate P-lectin. LECa.Bos.Tau.xx.Xxxx. receptor (1C39). [90] Bos taurus. Bovine Conglutinin. C-lectin or LECa.Bos.Tau.xx.Xxxx. Collectin. [91] Bos taurus. Bovine collectin-43 C-lectin or Leca.Bos.Tau.xx.Xxxx. (CL-43). Collectin. [92] Botryllus . S-lectin. LECi.Bot.Sch.xx.Xxxx. schlosseri. [93] Botrytis cinerea. . . LECz.Bot.Cin.xx.Xxxx. [94] Bowringia BMA. Legume lectins. LECp.Bow.Mil.se.Hmg1. milbraedii. [95] Brachypodium BsyL. Chitin-binding LECp.Bra.Syl.se.Hch1. sylvaticum. lectins. [96] Bradyrhizobium . . LECp.Bra.Jap.xx.Xga1. japonicum. [97] Branchiostoma . . LECi.Bra.Lan.xx.Xxxx. lanceolatum. [98] Brassica . . LECp.Bra.Cam.xx.Xxxx. campetsris. [99] Brassica . . LECp.Bra.Nap.xx.Xxxx. napobrassica. [100] Brassica napus. . . LECp.Bra.Nap.xx.Xxxx. [101] Bryonia dioica. BDA. . LECp.Bry.Dio.tu.Hga1. [113] Cancer . . LECi.Can.Ant.xx.Xsi1. antennarius. [114] Candida albican Adhesins. . LECf.Can.Alb.xx.Xfu1. adhesin. [115] Canna generalis. . . LECp.Can.Gen.rh.Hma1. [116] Capnocytophaga . . LECu.Cap.Gin.xx.Xxxx. gingivalis Actinomyces israelii Coaggregation agglutinin. [117] Capsicum annum. . . LECp.Cap.Ann.xx.Xxxx. [118] Caragana CAA-I, CAA-II. . LECp.Car.Arb.se.Hga1 arborescens. (CAA-I) LECp.Car.Arb.se.Hga2 (CAA-II). [119] charhinus . . LECa.Car.Spr.xx.Xxxx. ingeri. [120] Carcinoscorpious L10; carcinoscorpin. . LECi.Car.Rot.xx.Xsi1. rotundacauda. [121] Carica papya. . . LECp.Car.Pap.xx.Xxxx. [123] Carum carvia. . . LECp.Car.Car.xx.Xxxx. [124] Carybdea alata . . LECi.Car.Ala.xx.Xxxx. Hemolysin. [125] Castanea crenata. CCA. . LECp.Cas.Cre.xx.Xxxx. [126] Cepaea hortensis CHA-I. . LECi.Cep.Hor.xx.Xxxx. [127] Channa punctatus. . . LECa.Cha.Pun.xx.Xxxx. [129] Chelidonium . . LECp.Che.Maj.se.Hch1. majus. [132] Chicorium . . LECp.Chi.Int.xx.Xxxx. intybus. [133] Cholla opuntia. . . LECp.Cho.Opu.xx.Xxxx. [134] Cicer arietinum. CAA. . LECp.Cic.Ari.se.Hcu1. [135] Cinachyrella . . LECi.Cin.All.xx.Xxxx. alloclada. [136] Cinnamonum . . LECp.Cin.Cam.xx.Xxxx. camphora. [137] Citrullus vulgaris. . . LECp.Cit.Vul.xx.Xxxx. [139] Citrus aurantium. . . LECp.Cit.Aur.se.Cnd1. [140] Citrus aurantium. . . LECp.Cit.Aur.xx.Xxxx. [141] Citrus medica. . . LECp.Cit.Med.xx.Xxxx. [142] Cladrastis lutea. CLA-I, CLA-II. . LECp.Cla.Lut.ba.Hmg1 (CLA-I) LECp.Cla.Lut.ba.Hmg2 (CLA-II). [143] Clerodendron CTA. . LECp.Cle.Tri.fr.Hga1. trichotomum. [144] Clitocyba . . LECf.Cli.Neb.xx.Xxxx. nebularis. [145] Clivia miniata. CMA. . LECp.Cli.Min.le.Hma1. [146] Clostridium . . LECb.Clo.Bot.xx.Xxxx. botulinum. [147] Clostridium tetani. Tetanus toxin . LECb.Ggg.Sss.xx.Xxxx. (1A8D). [148] Clupea harengus. . . LECa.Clu.Har.xx.Xxxx. [149] Coccinia grandis. CIA. . LECp.Coc.Gra.fr.Hch1. [151] Cocus nucifera. . . LECp.Coc.Nuc.xx.Xxxx. [152] Codium fragilis. . . LECu.Cod.Fra.xx.Xxxx. [153] Cofea arabica. . . LECp.Cof.Ara.xx.Xxxx. [154] Colchicum CAA. . LECp.Col.Aut.bu.Hcu1. autumnale. [155] Collybia velutipes. . . LECf.Col.Vels.xx.Xxxx. [156] Colocasia CEA. . LECp.Col.Esc.tu.Hma1. esculentum. [157] Conger myriaster. Congerin I, Congerin S-lectin. LECi.Con.Myr.xx.Xga1. II. [159] Conidiobolus . . LECf.Con.Obs.xx.Xga1. obscurus. [160] Coprinus cinereus. Cg1, Cg2. Galectin. LECf.Cop.Cin.xx.Xxxx. [161] Corbicula . . LECi.Cor.Flu.xx.Xxxx. fluminea Hemolysin. [163] Corylus avellania. . . LECp.Cor.Ave.xx.Xxxx. [164] Cratylia mollis. . . LECz.Cra.Mol.xx.Xxxx. [165] Crenomytilus CGL. . LECi.Cre.Gra.xx.Xxxx. grayanus. [166] Crocus sativum. . . LECp.Cro.Sat.bu.Hma1. [167] Crocus vernus. CVA. . LECp.Cro.Ver.xx.Xxxx. [169] Crotalaria striata. . . LECp.Cro.Str.se.Hga1. [170] Crotolaria . . LECz.Cro.Aeg.xx.Xxxx. aegyptica. [171] Crotolaria falcata. . . LECz.Cro.Fal.xx.Xxxx. [172] Crotolaria juncea. . . LECp.Cro.Jun.se.Hga1. [174] Croton tiglium. . . LECp.Cro.Tig.se.Hcu1. [175] Cucumaria CEL-III. . LECi.Cuc.Ech.xx.Xxxx. echinata. [176] Cucumis . . LECp.Cuc.Cat.xx.Xxxx. catalupensis. [177] Cucumis melo. . . LECp.Cuc.Mel.xx.Xch1. [178] Cucumis sativus. . . LECp.Cuc.Sat.xx.Xch1. [180] Cucurbita ficifolia. . . LECp.Cuc.Fic.xx.Xxxx. [181] Cucurbita maxima. CMA, PP2. . LECp.Cuc.Max.ps.Hch1. [182] Cucurbita pepe. . . LECp.Cuc.Pep.xx.Xxxx. [183] Cucurbita pepo. CPA. . LECp.Cuc.Pep.fr.Hch1. [184] Cucurbita sativus. . . LECp.Cuc.Sat.xx.Xxxx. [185] Cydonia oblonja. . . LECp.Cyd.Obl.xx.Xxxx. [186] Cymbidium . . LECz.Cym.Hyb.le.Hma1. hybrid. [187] Cyphomandra . . LECp.Cyp.Bet.xx.Xxxx. betacea. [188] Cytisis CMA-I, CMA-II. . LECp.Cyt.Mul.se.Hch1 multiflorus. (CMA-I) LECp.Cyt.Mul.se.Hfu1 (CMA-II). [189] Cytisus scoparius. CSA-I, CSA-II, . LECp.Cyt.Sco.se.Hga1 CMH-I, CMH-II. (CS-I) LECp.Cyt.Sco.se.Hga2 (CS-II). [190] Cytisus . . LECp.Cyt.Ses.se.Hch1 sessilfolius. (CSA-I) LECp.Cyt.Ses.se.Hga1 (CSA-II). [191] Dacrymycetales. . . LECz.Dac.sss.xx.Xxxx. [192] Dalbergia. . . LECz.Dal.sss.xx.Xxxx. [193] Datura innoxia. . . LECp.Dat.Inn.xx.Xxxx. [194] Datura DSA. Chitin-bindng LECp.Dat.Str.se.Hch1. stramonium. lectins. [195] Daucus carrota. . . LECp.Dau.Car.xx.Xxxx. [196] Dendroaspis JML, Jameson's . LECi.Den.Jam.xx.Xga1. jamesoni. Mamba Venon. [198] Deuteromycetes. . . LECz.Deu.sss.xx.Xxxx. [199] Dicolea lehmani. . . LECz.Dio.Leh.xx.Xxxx. [200] Dictyostelium Discoidin I. . LECu.Dic.Dis.xx.Xxxx. discoideum. [201] Dictyostelium Purpurin. . LECu.Dic.Pur.xx.Xxxx. purpureum. [202] Didemnum DTL, DCL-I, DCL- . LECi.Did.Sss.xx.Xga1. candidum. II. [203] Dieffenbachia . . LECp.Dif.Seq.xx.Xxxx. sequina. [204] Dioclea . Legume lectin. LECp.Dio.Gra.xx.Xxxx. grandifolia. [205] Dioclea DLL-I, DLL-II, Legume lectin. LECp.Dio.Gui.xx.Xmg1. guianensis. DLL-III. [206] Dioclea virgata. . Legume lectin. LECz.Dio.Vir.xx.Xxxx. [207] Dolichos biflorus. DBA-S, DBA-R, Legume lectin. LECp.Dol.Bif.se.Hga1 DB-58, DB-57, (DBA) DB46. LECp.Dol.Bif.pl.Hcu1 (DB58) LECp.Dol.Bif.pl.Hcu2 (DB57) LECp.Dol.Bif.ro.?ga1 (DB46). [208] Drosophila. . . LECi.Dro.Meg.xx.Xxxx. [209] Dumasia. . . LECz.Dum.sss.xx.Xxxx. [210] Echinocereus . . LECp.Echi.Eng.xx.Xxxx. engelmanii. [211] Echis EMS16. . LECi.Ech.Mul.xx.Xxxx. multisquamatus. [212] Electrophorus Electrolectin. . LECi.Ele.Ele.xx.Xxxx. electricus. [213] Elymus . Hevein domain LECp.Ely.Can.se.Hch1. canadensis. lectin, chitin binding. [223] Erythrina velutina. . . LECp.Ery.Vel.xx.Xxxx. [224] Escherichia coli. Pili mannose-specific Verotoxin-1: LECb.Ech.Col.xx.Xxxx. FimH adhesin ADP-ribosylating (1QUN),. toxins. [225] Euhadra . . LECz.Euh.Cal.xx.Xxxx. callizoma. [226] Euphorbia . . LECp.Eup.Sss.xx.Xxxx. characias. [227] Euphorbia . . LECp.Eup.Het.xx.Xga1. heterophylla. [228] Evonymus . . LECp.Evo.Eur.se.Hcu1. europaea. [229] Falcata japonica. . . LECp.Fal.Jap.se.Hga1. [230] Ficus cunia. . . LECp.Fic.Cun.xx.Xxxx. [231] Flammulina . . LECf.Fla.Vel.xx.Xxxx. veltipes. [232] Fomes . . LECz.Fom.Fom.xx.Xxxx. fomentarius. [233] Fragaria vesca. . . LECp.Fra.Ves.xx.Xxxx. [234] Fucus serratus. . . LECu.Fuc.Ser.xx.Xxxx. [235] Fucus vesiculosis. . . LECu.Fuc.Ves.xx.Xxxx. [236] Galactia tashiroi. . . LECp.Gal.Tas.se.Hga1. [237] Galactia . . LECp.Gal.Ten.se.Hga1. tenuiflora. [238] Galanthus nivalis. . Monocot lectin. LECp.Gal.Niv.bu.Hma1. [239] Galleria . . LECi.Gal.Mel.xx.Xxxx. mellonella. [240] Gallus gallus. GGL. S-lectin or GLTa.Gal.Gal.xx.Xxxx. Galectin. [241] Gallus gallus. Chicken Hepatic . LECa.Gal.Gal.xx.Xxxx. lectins (CHL). [242] Gallus gallus. Chicken egg . LECa.Gal.Gal.xx.Xxxx. agglutinins. [243] Gallus gallus. Chick Beta- S-lectin or LECa.Gal.Gal.xx.Xxxx. galactoside-Binding Galectin. lectins. [244] Gallus gallus. Chicken Serum C-lectin or LECa.Gal.Gal.xx.Xxxx. Mannose-Binding Collectin. Protein. [245] Gallus gallus. Chicken Liver C-lectin or LECa.Gal.Gal.xx.Xxxx. Mannose-Binding Collectin. Protein. [246] Gallus gallus. Chicken Thymic S-lectin or GLTa.Gal.Gal..xx.Xxxx. Electrolectin (CTE). Galectin. [247] Gallus gallus. Chick Embryonic S-lectin or GLTa.Gal.Gal.xx.Xxxx. Skin Lectins. Galectin. [248] Genypterus . . LECi.Epi.Tre.xx.Xxxx. blacodes. [249] Geodia cydonium. . . LECi.Geo.Cyd.xx.Xga1. [250] Giardia lambia Taglin. . LECu.Gia.Lam.xx.Xxxx. Surface lectin. [251] Gliricida sepium. Lectin A, Lectin B. . LECp.Gli.Sep.se.Hga1 (Lectin A) LECp.Gli.Sep.se.Hga2 (Lectin B). [252] Glossina . . LECi.Glo.Lon.xx.Xxxx. longipennis lectin. [253] Glycine max. SBA. Legume lectin. LECp.Gly.Max.se.Hga1. [254] Gonatanthus . . LECz.Gon.Pum.ti.Hcu1. pumilus. [256] Grateulopia . . LECu.Gra.Fil.xx.Xxxx. filicina. [257] Griffithsia . . LECu.Gri.Flo.xx.Xxxx. flosculosa. [258] Griffonia GS-I-A4, GS-I-A4, Legume lectin. LECp.Gri.Sim.se.Hga1 simplicifolia GS-I-B4, GS-II, GS- (GS-I-A4) lectins. IV. LECp.Gri.Sim.se.Hga2 (GS-I-B4) LECp.Gri.Sim.se.Hch1 (GS-II) LECp.Gri.Sim.se.Hfu1 (GS- IV) LECp.Gri.Sim.le.Hga1 (GS-I-A4) LECp.Gri.Sim.le.Hga2 (GS- I-B4) LECp.Gri.Sim.le.Hch1 (GS- II) LECp.Gri.Sim.le.Hfu1 (GS-IV). [260] Grifola frondosa. GFL. . LECf.Gri.Fro.xx.Xga1. [261] Haemonchus . . LECz.Xxx.Xxx.xx.Xxxx. contortus. [262] Halidrys siliquosa. . . LECu.Hal.Sil.xx.Xxxx. [263] Halimeda opuntia. . . LECu.Hal.Opu.xx.Xxxx. [264] Halocynthia . . LECi.Hal.Pyr.xx.Xxxx. pyriformis. [265] Halocynthia . . LECi.Hal.Ror.xx.Xga1. roretzi. [266] Haynaldia villosa. . Hevein domain LECp.Hay.Vil.se.Hch1. lectin, chitin binding. [269] Helianthus annus. . beta-prism plant LECp.Hel.Ann.xx.Xxxx. lectin. [270] Helianthus HTA. Jacalin-related LECp.Hel.Tub.tu.Hmmm1. tuberosus. lectins. [271] Helicobacter HP-SAL. . LECb.Hel.Pyl.xx.Xxxx. pylori. [272] Helix aspersa. . . LECi.Hel.Asp.xx.Xxxx. [273] Helix pomatia. HPA. . LECi.Hel.Pom.xx.Xxxx. [274] Herpetomonas. . . LECz.Her.xx.Xxxx. [276] Heteranthelium . Hevein domain LECp.Het.Pil.se.Hch1. piliferum. lectin, chitin binding. [277] Heterometrus . . LECi.Het.gra.xx.Xsi1. granulomanus. [279] Hevea brasiliensis. HBA, Hevein. Chitin-binding LECp.Hev.Bra.la.Mch1. lectin with hevein domain. [280] Hippeastrum HHA. Monocot lectin. LECp.Hip.Hyb.bu.Hma1. hybrid. [281] Hippopus Tridacnin. C-lectin. LECi.Hip.Hip.xx.Xxxx. hippopus. [282] Hizoctonia solani. . . LECz.Hiz.Sol.xx.Xxxx. [283] Hohenbuehelia . . LECf.Hoh.Ser.xx.Xxxx. serotina. [284] Homarus HAA. . LECi.Hom.Ame.xx.Xxxx. americanus. [285] Homo sapiens. P-selectin (1KJD). C-lectin. LECh.Hom.Sap.xx.Xxxx. [286] Homo sapiens. Human Mannose C-lectin. LECh.Hom.Sap.xx.Xxxx. Binding Protein (MBP) (1HUP). [287] Homo sapiens. Gut Mucus Anti- . LECh.Hom.Sap.xx.Xxxx. Salmonella Lectin. [288] Homo sapiens. Human Membrane . LECh.Hom.Sap.Xxxx. Lectins (HKML, HCCML). [289] Homo sapiens. Human Synovial . LECh.Hom.Sap.xx.Xxxx. Tissue Lectins. [290] Homo sapiens. Human Placenta . LECh.Hom.Sap.xx.Xxxx. Lectins (HPL-H, HPL-BG). [291] Homo sapiens. Human Brain . LECh.Hom.Sap.xx.Xxxx. Galactoside-binding Lectin. [292] Homo sapiens. Human 14-kDa . LECh.Hom.Sap.xx.Xxxx. Lectins. [293] Homo sapiens. Human Core-specific . LECh.Hom.Sap.xx.Xxxx. Lectin (HCSL). [294] Homo sapiens. Cell Membrane . LECh.Hom.Sap.xx.Xxxx. Lectins. [295] Homo sapiens. Tumoricidal . LECh.Hom.Sap.xx.Xga1. Macrophage Lectin. [296] Homo sapiens. Tumor-associated . LECa.Ggg.Sss.xx.Xxxx. Vertebrate Lectin. [297] Homo sapiens. Human Conglutinin- . LECh.Hom.Sap.xx.Xxxx. like Protein. [298] Homo sapiens. Mannose-Specific . LECh.Hom.Sap.xx.Xma1. Endocytosis Receptor. [299] Homo sapiens. Human Penultimate . LECh.Hom.Sap.xx.Xxxx. Galactose Lectin. [300] Homo sapiens. Thrombospondin. . LECh.Hom.Sap.xx.Xxxx. [301] Homo sapiens. Tetranectin. . LECh.Hom.Sap.xx.Xxxx. [302] Homo sapiens. Human Dendritic . LECh.Hom.Sap.xx.Xxxx. Cell Immunoreceptor (DCIR). [303] Homo sapiens. Human Seminal . LECh.Hom.Sap.xx.Xxxx. Lectin (HSL). [304] Homo sapiens. Charcot-Leyden S-lectin or GLTh.Hom.Sap.xx.Xxxx. crystal protein Galectin. (1LCL). [305] Homo sapiens. Galectin II L-14-II Proto S-lectin or GLTh.Hom.Sap.xx.Xxxx. (1HLC). Galectin. [306] Homo sapiens. Human Lung C-lectin or GLTh.Hom.Sap.xx.Xxxx. Surfactant Protein Collectin. (1B08). [307] Homo sapiens. Galectin III. Chimera S-lectin GLTh.Hom.Sap.xx.Xxxx. or Galectin. [308] Homo sapiens. Galectin VII, hGal-7. Proto S-lectin or GLTh.Hom.Sap.xx.Xxxx. Galectin. [309] Homo sapiens. Pentraxin (1CRV). Pentraxin, S- GLTh.Hom.Sap.xx.Xxxx. lectin or Galectin. [310] Homo sapiens. Sialoadhesin. I-lectin. LECz.Ggg.Sss.xx.Xxxx. [311] Homo sapiens. Serum Amyloid P Pentraxin. LECh.Hom.Sap.xx.Xxxx. Component. [312] Homo sapiens. E-Selectin (1ESL). C-lectin. SELh.Hom.Sap.xx.Xxxx. [313] Homo sapiens. L-Selectin (1KJB). C-lectin. SELh.Hom.Sap.xx.Xxxx. [314] Homo sapiens. C-Reactive protein Pentraxin, S- GLTh.Hom.Sap.xx.Xxxx. (1CRV). lectin or Galectin. [315] Homo sapiens. Galectin XII. S-lectin or GLTh.Hom.Sap.xx.Xxxx. Galectin. [316] Homo sapiens. Galectin I. Proto S-lectin or GLTh.Hom.Sap.xx.Xxxx. Galectin. [317] Homo sapiens. Galectin IX, Tandem Repeat GLTh.Hom.Sap.sr.Xxxx. Ecalectin. S-lectin or Galectin. [318] Homo sapiens. Galectin VIII. Tandem Repeat GLTh.Hom.Sap.xx.Xxxx. S-lectin or Galectin. [319] Homo sapiens. Galectin IV. Tandem Repeat GLTh.Hom.Sap.xx.Xxxx. S-lectin or Galectin. [320] Homo sapiens. Alpha-1/Beta-1 Integrin A (or I) INTh.Hom.Sap.xx.Xxxx. integrin. domain. [321] Homo sapiens. Alpha-2/Beta-1 Integrin A (or I) INTh.Hom.Sap.xx.Xxxx. integrin. domain. [322] Homo sapiens. Alpha-3/Beta-1 Integrin A (or I) INTh.Xxx.Xxx.xx.Xxxx. integrin. domain. [323] Homo sapiens. Alpha-4/Beta-1 Integrin A (or I) INTh.Xxx.Xxx.xx.Xxxx. integrin. domain. [338] Homo sapiens. Alpha-5/Beta-8 Integrin A (or I) INTh.Hom.Sap.xx.Xxxx. integrin. domain. [339] Homo sapiens. Alpha-4/Beta-7 Integrin. INTh.Hom.Sap.xx.Xxxx. Integrin. [340] Homo sapiens. Alpha-E/Beta-7. Integrin. INTh.Hom.Sap.xx.Xxxx. [341] Homo sapiens. Mucosal addressin Addressin. LECh.Xxx.Xxx.xx.Xxxx. cell adhesion molecule-1 (MADCAM-1). [342] Homo sapiens. Vascular Adhesion . LECh.Xxx.Xxx.xx.Xxxx. Molecule (VCAM-1. [343] Homo sapiens. P-Selectin Selectin. SELh.Xxx.Xxx.xx.Xxxx. [344] Homo sapiens. Intercellular Addressin?. LECh.Xxx.Xxx.xx.Xxxx. Adhesion Molecule (ICAM-1, ICAM-2). [345] Homo sapiens. Peripheral Lymph Addressin. LECh.Xxx.Xxx.xx.Xxxx. Node Addressin (PNAd). [346] Homo sapiens. Vascular Adhesion . LECh.Xxx.Xxx.xx.Xxxx. Protein (VAP-1). [347] Homo sapiens. LFA-3. Addression?. LECh.Xxx.Xxx.xx.Xxxx. [348] Homo sapiens. Versican. Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (‘Lecticans’). [349] Homo sapiens. Aggrecan. Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (‘Lecticans’). [350] Homo sapiens. Neurocan. Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (‘Lecticans’). [351] Homo sapiens. Brevican. Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (‘Lecticans’). [352] Homo sapiens. Annexin V. Annexin. ANNh.Hom.Sap.xx.Xxx5. [353] Homo sapiens. Annexin II. Annexin. ANNh.Hom.Sap.xx.Xxx2. [354] Homo sapiens. Annexin IV. Annexin. ANNh.Hom.Sap.xx.Xxx4. [355] Homo sapiens. Annexin I Annexin. ANNh.Hom.Sap.xx.Xxx1. (Lipocortin-1), ANX1. [356] Homo sapiens. Annexin VII, . ANNh.Hom.Sap.xx.Xxx7. Synexin. [357] Homo sapiens. Activated Leukocyte . LECh.Hom.Sapxx. Adhesion Molecule (ALCAM). [358] Homo sapiens. E-cadherin. . CDHh.Hom.Sap.xx.XxxE. [360] Homo sapiens. N-cadherin . CDHh.Hom.Sap.xx.XxxN. (uvomorulin). [361] Homo sapiens. VE-cadherin . CDHh.Hom.Sap.xx.XxxVE. (Vascular Endothelial Cadherin). [362] Homo sapiens. P-cadherin. . CDHh.Hom.Sap.xx.XxxP. [363] Homo sapiens. Annexin XI (CAP- . ANNh.Hom.Sap.xx.Xxx9. 50). [364] Homo sapiens. Endothelial Cell- . CDHh.Hom.Sapxxx. Selective Adhesion Molecule (ESAM). [365] Homo sapiens. ELAM-1. . CDHh.Xxx.Xxx.xx.Xxxx. [366] Homo sapiens. GMP-140. . CDHh.Xxx.Xxx.xx.Xxxx. [367] Homo sapiens. Cutaneous . LECh.Xxx.Xxx.xx.Xxxx. Lymphocyte Antigen (CLA). [369] Homo sapiens. Lymphocyte . LECh.Xxx.Xxx.xx.Xxxx. Function-Associated Antigen-1 (LFA-1). [370] Homo sapiens. Very Late Antigen 4 . LECh.Xxx.Xxx.xx.Xxxx. (VLA-4). [371] Hordeum vulgare. HVA. . LECp.Hor.Vul.se.Hch1. [372] Hura crepitans. HCA. Type 2 RIP. LECp.Hur.Cre.se.Cga1 (HCA) LECp.Hur.Cre.la.Cga1. [373] Hygrophorus . . LECf.Hyg.Hyp.xx.Xxxx. hypothejus. [374] Hypnea . . LECu.Hyp.Cer.xx.Xxxx. cervicornis. [375] Hyptos . . LECz.Hyp.Sua.xx.Xxxx. suaveolens. [376] Iberis amara. . . LECp.Ibe.Ama.xx.Xxxx. [377] Influenza virus. Hemagglutinin. Hemagglutinin. LECv.Inf.Vir.xx.Xxxx. [378] Ipomoea batatas. . . LECp.Ipo.Bat.xx.Xxxx. [379] Iris hollandica. . . LECp.Iri.Hol.xx.Xxxx. [380] Iris hybrid. IRA. Type 2 RIP. LECp.Iri.Hyb.bu.Cga1. [381] Juglans regia. . . LECp.Jug.Reg.xx.Xxxx. [382] Klyveromyces . . LECz.Kly.Bul.xx.Xxxx. bulgaricus. [383] Kuehneromyces . . LECu.Kue.Mut.xx.Xxxx. mutabilis. [384] Labiaceae . . LECp.Lab.Ori.xx.Xxxx. origanum. [385] Lablab purpureus. DLA, LPA. Legum lectin. LECp.Lab.Pur.se.Hmg1. [386] Laburnum LAA-I, LAA-II. Legume lectin. LECp.Lab.Alp.se.Hch1 alpinum. (LAA-I) LECp.Lab.Alp.se.Hga1 (LAA-II). [387] Laccaria . . LECz.Lac.Ame.xx.Xxxx. amethystina. [389] Lachesis huta. BML. . LECi.Lac.Jut.xx.Xxxx. [390] Lactarius LDL. . LECf.Lac.Del.xx.Xgal1. deliciosus. [391] Lactarius . . LECz.Lac.Lig.xx.Xxxx. lignyotus. [392] Lactuca scariole. PLA-I, PLA-II. . LECa.Lac.Sca.xx.Xxxx. [393] Laelia autumnalis. . . LECp.Lae.Aut.xx.Xxxx. [394] Laetiporus PSL. . LECf.Lae.Sul.xx.Xxxx. sulfureus. [395] Lathyrus cicera. LcLI, LcLII. . LECp.Lat.Cic.xx.Xxxx. [396] Lathyrus nissolia. . . LECp.Lat.Nis.xx.Xxxx. [397] Lathyrus ochrus. LOL-I, LOL-II. Legume lectin. LECp.Lat.Och.xx.Xxxx. [398] Lathyrus odoratus. . . LECp.Lat.Odo.xx.Xxxx. [399] Lathyrus silvestris. . . LECp.Lat.Sil.xx.Xxxx. [400] Lathyrus . . LECp.Lat.Tub.xx.Xxxx. tuberosus. [401] Lens culinaris. LCA, LcH. Legume lectins. LECp.Len.Cul.se.Hmg1. [402] Lepidium . . LECp.Lep.Sat.xx.Xxxx. sativuum. [403] Leptonychotes . . LECz.Lep.Wed.xx.Xxxx. weddelli. [404] Leptospermum LAA. . LECp.Lep.Arc.xx.Xxxx. archinoides. [405] Leucojum. . . LECz.Leu.sss.xx.Xxxx. [406] Leucojum LAA. Monocot LECp.Leu.Aes.bu.Hma1. aestivum. mannose-binding lectins. [407] Leucojum vernum. LVA. Monocot LECp.Leu.Ver.bu.Hma1. mannose-binding lectins. [408] Limulus Limulin. Pentraxin. LECi.Lim.Pol.xx.Xsi1. polyphemus. [409] Liocarcinus . . LECi.Lio.Dep.xx.Xxxx. depurator. [410] Listeria ovata. LOA, LOMBP. Monocot LECp.Lis.Ova.le.Hma1 mannose binding (LOA) proteins. LECp.Lis.Ova.le.Mma1 (LMOBP). [411] Litchi chinensis. LCL. . LECp.Lit.Chi.xx.Xxxx. [412] Lonchocarpus . Legume lectin. LECp.Lon.Cap.se.Hga1. capassa. [413] Lontonis bainesii. . Legum lectins. LECp.Lon.Bai.se.Hga1 LECp.Lon.Bai.ro.Hga1. [414] Lophocereus . . LECp.Lop.Sho.xx.Xxxx. shotti. [415] Lotus LTA. Legume lectins. LECp.Lot.Tet.se.Hfu1. tetragonolobus. [416] Luffa acutangula. LAA. Cucurbtaceae LECp.Luf.Acu.fr.Hch1. phloem lectins. [417] Lumbricus EW29. . LECi.Lum.Ter.xx.Xxxx. terrestris. [418] Lycopersion LEA, TL, LEL. Chitin-binding LECp.Lyc.Esc.fr.Hch1. esculentum. lectins. [419] Lycoris aurea. . Monocot LECp.Lyc.Aur.bu.Hma1. mannose-binding lectins. [420] Maackia MALb, MAHb, Legume lectins. LECp.Maa.Amu.se.Hsi1 amurensis. MAL, MAHs. (MAHs, MAH) LECp.Maa.Amu.se.Hsi2 (MAHs, MAH) LECp.Maa.Amu.ba.Hsi1 (MAHb) LECp.Maa.Amu.ba.Hsi1 (MALb). [421] Machaerocereus MEA-I, MEA-II. ?. LECp.Mac.Eru.st.Hga1. eruca. [422] Machaerocereus . Hevein domain LECp.Mac.Gum.xx.Xxxx. gummosus. lectin, chitin binding. [423] Maclura pomifera. MPA. beta-prism plant LECi.Mac.Pom.xx.Xxxx. lectin. [424] Macrobdella LL1-63. . LECi.Mac.Dec.xx.Xxxx. decora. [425] Macrobrachium MrL. . LECi.Mac.Ros.xx.Xxxx. rosenbergii. [426] Macrotyloma . . LECp.Mac.Axi.xx.Xxxx. axillare. [427] Malus officinalis. . . LECp.Mal.Off.xx.Xxxx. [428] Manduca sexta. Immulectin. C-lectin. LECi.Man.Sex.xx.Xxxx. [429] Mangifera indica. MIA. . LECp.Man.Ind.xx.Xxxx. [430] Marah . . LECp.Mar.Mac.xx.Xxxx. macrocarpus. [431] Marasmius . . LECf.Mar.Ore.xx.Xxxx. oreades. [432] Medicago sativa. . . LECp.Med.Sat.xx.Xxxx. [433] Medicago . . LECp.Med.Tru.xx.Xxxx. truncatula. [434] Megabalanus rosa. . . LECi.Mag.Ros.xx.Xxxx. [435] Megapitaria . . LECi.Meg.Squ.xx.Xxxx. squalida. [436] Melanoleuca . . LECf.Mel.Mel.xx.Xxxx. melaleuca. [437] Melastiza chateri. . . LECf.Mel.Cha.xx.Xxxx. [438] Mesocricetus . Pentraxin. LECz.Ggg.Sss.xx.Xxxx. auratus. [474] Orchidaceae. . . LECp.Orc.Sss.xx.Xxxx. [475] Ornithodoros Dorin-M. . LECi.Orn.Mou.xx.Xxxx. moubata. [476] Oryza sativa. OSA. Chitin binding LECp.Ory.Sat.see.Hch1. lectins. [477] Oscillatoria . . LECu.Osc.Aga.xx.Xxxx. agardhii. [478] Otala lactea. . . LECi.Ota.Lac.xx.Xxxx. [480] Pachydereus . . LECp.Pac.Pri.se.Hch1. pringleii. [481] Pacifastacus . . LECi.Pac.Len.xx.Xxxx. leniusculus. [482] Palmaria palmata. . . LECz.Pal.Pal.xx.Xxxx. [483] Paracentrotus . . LECi.Par.Liv.xx.Xxxx. lividus. [484] Parkia . . LECp.Par.Big.xx.Xxxx. biglandulosa. [485] Parkia discolor. . . LECz.Par.Dis.xx.Xxxx. [486] Parkia . . LECz.Par.Pla.xx.Xxxx. platycephala. [487] Parkia speciosa. . . LECp.Park.Spe.xx.Xxxx. [488] Paxillus . . LECz.Pax.Atr.xx.Xxxx. atrotomentosus. [489] Paxillus . . LECf.Pax.Pan.Sss.xx.Xxxx. panuoides. [490] Penaeus . . LECp.Pen.Cal.xx.Xxxx. californiensis. [492] Penaeus . . LECi.Pen.Sty.xx.Xxxx. stylirostris. [494] Penaeus vannamei. . . LECi.Pen.Van.xx.Xxxx. [495] Perca fluviatilis. . . LECa.Per.Flu.xx.Xxxx. [496] Peresea gratissima. . . LECz.Per.Gra.xx.Xxxx. [497] Persea americana. PAA. . LECp.Per.Ame.xx.Xxxx. [498] Petromyzon . . LECz.Pet.Mar.xx.Xxxx. marinus. [499] Petrosecinum . . LECp.Pet.Hor.xx.Xxxx. hortense. [500] Peziza badia. . . LECp.Pez.Bad.xx.Xxxx. [501] Phage p22. Phage P22 . LECb.Ggg.Sss.xx.Xxxx. TailspikeProteins (1TSP). [502] Phalera flavescens. PFA. . LECi.Pha.Fla.xx.Xxxx. [503] Phallus impudicus. . . LECf.Pha.Imp.xx.Xxxx. [504] Phallusia . . LECi.Pha.Mam.xx.Xxxx. mamillata. [505] Phaseolus . Legume lectins. LECp.Pha.Acu.se.Hcu1 acutifolius. (erythroagglutinin) LECp.Pha.Acu.se.Hcu2 (lymphoagglutinin). [506] Phaseolus aureus. . . LECp.Pha.Aur.xx.Xxxx. [507] Phaseolus PCA. Legume lectin. LECp.Pha.Coc.se.Hcu1 coccineus. (PCA) LECp.Pha.Coc.se.Hcu2. [508] Phaseolus . . LECp.Pha.Coc.xx.Xxxx. coccineus. [509] Phaseolus PLA, LBA, LBL. Legume lectins. LECp.Pha.Lim.se.Hga1. limenesis. [510] Phaseolus lunatus. . . LECp.Pha.Lun.se.Xxxx. [511] Phaseolus PHA-E, PHA-L. Legume lectin. LECp.Pha.Vul.xx.Xxxx. vulgaris. [512] Phaseolus GNlL, GNpL, GNsL. . LECp.Pha.Vul.xx.Xxxx. vulgaris. [513] Phaseolus Pinto III. . LECa.Pha.Vul.xx.Xxxx. vulgaris. [514] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [515] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [516] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [517] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [518] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [519] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [520] Phlomis . . LECz.Phl.Fru.xx.Xxxx. fructicosa. [521] Pholiota aurivella. PAA. . LECf.Ggg.Sss.xx.Xxxx. [522] Pholiota squarrosa. . . LECf.Pho.Squ.xx.Xxxx. [524] Phoradendron . . LECz.Pjo.Cal.xx.Xxxx. californicum. [525] Phragmites. . . LECz.Phr.sss.xx.Xxxx. [526] Phragmites . . LECp.Phr.Aus.xx.Xxxx. austalis. [527] Physalia physalis. Physalitoxin. . LECi.Phy.Phy.xx.Xxxx. [528] Physalis angulata. PA-VII-A, PA-VII-B . LECz.Phy.Ang.xx.Xxxx. and PA-VII-C. [529] Physarum . . LECu.Phy.Pol.xx.Xxxx. polycephalum. [530] Phytolacca PWM, Pa-1, Pa-2 . LECp.Phy.Ame.ro.Hch1 (Pa- americana. (PL-A) Pa-3, Pa-4 1) (PL-C), Pa-5. LECp.Phy.Ame.ro.Hch2(Pa- 2) LECp.Phy.Ame.ro.Hch3(Pa- 3) LECp.Phy.Ame.ro.Hch4(Pa- 4) LECp.Phy.Ame.ro.Hch5(Pa- 5) LECp.Phy.Ame.ro.Hch6(PL- B). [531] Pimenta . . LECp.Pim.Off.xx.Xxxx. officinalis. [532] Pisum sativum. PSA, PsA. Legume lectins. LECp.Pis.Sat.se.Hmg1 (PSA, PsA) LECp.Pis.Sat.ro.Hmg1. [533] Plecoglossus PAL. . LECa.Ple.Alt.xx.Xxxx. altivelis. [535] Pleurocybella . . LECf.Ggg.Sss.xx.Xxxx. porrigens. [536] Pleurotus . . LECf.Ple.Ost.xx.Xxxx. ostreatus. [537] Plumaria elegans. . . LECu.Plu.Ele.xx.Xxxx. [538] Polyandrocarpa . C-lectin. LECi.Pol.Mis.xx.Xgal. misakiensis. [539] Polygonum . . LECp.Pol.Mul.xx.Xxxx. multiformum. [540] Polyomavirus. 1VPN. . LECV.Pol.Vir.xx.Xxxx. [541] Polyporus . . LECf.Pol.Fom.xx.Xxxx. fomentarius. [542] Polyporus . . LECf.Pol.Squ.xx.Xxxx. squamosus. [543] Polysphondylium . . LECu.Pol.Pal.xx.Xxxx. pallidum. [544] Potamon . . LECi.Pot.Pot.xx.Xxxx. potamios. [545] Prunus americana. . . LECp.Pru.Ame.xx.Xxxx. [546] Prunus avium. . . LECp.Pru.Avi.xx.Xxxx. [547] Psathyrostachys . Hevein domain LECp.Psa.Jun.se.Hch1. juncea. lectin, chitin binding. [548] Pseudomonas . . LECb.Pse.Aer.xx.Xga1. aeruginosa. [549] Pseudomonas . . LECb.Pse.Apl.xx.Xxxx. aplysia. [550] Psophocarpus PTL-I (WBA-I), . LECp.Pso.Tet.se.Hga1 tetragonolobus. PTL-II (WBA-II), (PTL-I) WBTL, L-I, L-II. LECp.Pso.Tet.se.Hga2 (PTL-II) LECp.Pso.Tet.ro.Hga1 (WBTL) LECp.Pso.Tet.so.Hga2 LECp.Pso.Tet.le.Hga1 (L-I) LECp.Pso.Tet.le.Hga2 (L- II). [551] Ptilota serrata. . . LECu.Pxx.Ser.xx.Xxxx. [552] Punica granatum. . . LECp.Pun.Gra.xx.Xxxx. [553] Rana catesbeiana. . Lectins LECa.Ran.Cat.xx.Xxxx. Displaying RNase Activity (Leczymes). [554] Rana catesbeiana cSBL. Lectins LECa.Ran.Cat.xx.Xxxx. ovum lectin. Displaying RNase Activity (Leczymes). [555] Rana japonica. jSBL. Lectins LECa.Ran.Jap.xx.Xxxx. Displaying RNase Activity (Leczymes). [557] Rana . . LECa.Ran.Nig.xx.Xxxx. nigromaculata. [558] Raphanus sativus. . . LECp.Rap.Sat.xx.Xxxx. [559] Ratus norvegicus. Mannan Binding C-lectin or LECa.Rat.Nor.xx.Xxxx. Protein (MBP-A). Collectin. [560] Ratus ratus. Rat peritioneal . LECa.Rat.Rat.xx.Xfu1 macrophage lectin. LECa.Rat.Rat.xx.Xga1. [561] Ratus ratus. . . LECa.Rat.Rat.xx.Xxxx. [562] Ratus ratus. Galectin II. S-lectin or GLT2.Rat.Rat.xx.Xxxx. Galectin. [563] Ratus ratus. Galectin IV. Tandem Repeat GLTa.Rat.Rat.xx.Xxxx. S-lectin or Galectin. [564] Rheum . . LECp.Rhe.Rhas.xx.Xxxx. rhapontium. [565] Ribes rubrum. . . LECp.Rib.Rubs.xx.Xxxx. [566] Ricinus RCA-I, RCA-II, beta-trefoil lectin. LECp.Ric.Com.se.Cga1 communis. Ricin. (Ricin D) LECp.Ric.Com.se.Cga2 (Ricin E) LECp.Ric.Com.se.Cga2 (RCA, RSL). [567] Robinia RPA-I, RCA-III, . LECp.Rob.Pse.se.Hcu1 pseudoacacia. (RPsA-I) LECp.Rob.Pse.se.Hcu2 (RPsA-II) LECp.Rob.Pse.se.Hcu1 (RPbA-I) LECp.Rob.Pse.se.Hcu2 (RPbA-II). [568] Rubus fructicosus. RFA. ?. LECp.Rub.Fru.tc.Xga1. [569] Rubus idaeus. . . LECp.Rub.Ida.xx.Xxxx. [570] Rutilus rutilus. . . LECv.Rut.Rut.xx.Xxxx. [571] Salmo gairdneri. . . LECa.Sal.Gai.xx.Xxxx. [572] Salmo salar v. . . LECa.Sal.Sal.xx.Xma1. atlantica. [573] Salmo salar v. . . LECa.Sal.Sal.xx.Xxxx. chinook. [574] Salmo trutta. . . LECa.Sal.Tru.xx.Xxxx. [618] Tetragonolobus . . LECp.Tet.Pur.xx.Xxxx. pupurea. [619] Thermopsis. . . LECz.The.sss.xx.Xxxx. [621] Toxopneustes . C-lectin. LECi.Xxx.Xxx.xx.Xxxx. pileolu. [622] Trichoderma. . . LECf.Tri.Sss.xx.Xxxx. [623] Tricholoma . . LECf.Tri.Mon.xx.Xxxx. mongolicum. [624] Tricholomataceae . . LECf.Tri.Sss.xx.Xxxx. 93-138. [625] Tricholomataceae . . LECz.Tri.Sss.xx.Xxxx. 93-34. [626] Trichosanthes TJA-II, TJA-I, TK-I, . LECp.Tri.Jap.xx.Xxxx. japonica. TK-II. [627] Trifolium repens. . . LECp.Tri.Rep.xx.Xxxx. [628] Triticum WGA. Hevein domain LECp.Tri.Aes.se.Hch1. aestivium. lectin, chitin binding lectin. [629] Tulipa gesneriana. TGA. . LECp.Tul.Ges.xx.Xxxx. [630] Udotea petiolata. . . LECp.Udo.Pet.xx.Xxxx. [631] Ulex europaeus. UEA-I, UEA-II, Legume lectin. LECp.Ule.Eur.xx.Xxxx. UEA-III. [632] Ulva lactuca. . . LECu.Ulv.Lac.xx.Xxxx. [633] Ulva laetevirens. . . LECu.Ulv.Lae.xx.Xxxx. [635] Ulva rigida. . . LECz.Ulv.Rig.xx.Xxxx. [637] Urtica dioica. UDA. Chitin-binding LECp.Urt.Dio.rh.Hch1. lectins. [638] Vaejovis . . LECi.Vae.Con.xx.Xxxx. confuscius. [639] Vatairea VML. . LECp.Vat.Mac.xx.Xxxx. macrocarpa. [640] Vibrio . . LECb.Vib.Alg.xx.Xch1. alginolyticus. [641] Vibrio cholera. VPCV; Chitovibrin . LECb.Vib.Cho.xx.Xxxx. [642] Vicia cracca. . . LECp.Vic.Cra.xx.Xxxx. [643] Vicia ervilia. . . LECp.Vic.Erv.xx.Xxxx. [644] Vicia faba. VFA, Favin. Legume lectin. LECp.Vic.Fab.xx.Xxxx. [645] Vicia graminea. VGA. . LECp.Vic.Gra.xx .Xxxx. [646] Vicia hyrcanica. . . LECp.Vic.Hyr.xx.Xxxx. [647] Vicia sativa. . . LECp.Vic.Sat.xx.Xxxx. [648] Vicia unijuga. VUA. . LECp.Vic.Unj.xx.Xxxx. [649] Vicia villosa. VVA-A4, VVL-A4. Legume lectin. LECp.Vic.Vil.xx.Xxxx. [650] Vigna radiata. MBL-I, MBL-II. . LECp.Vig.Rad.xx.Xxxx. [651] Vigna unguiculata. . . LECp.Vig.Ung.xx.Xxxx. [652] Viscum album. ML-I, ML-II, ML-III, Beta-trefoil lectin LECp.Vis.Alb.pl.Cga1 Viscumin, (ML-I). (ML-I, viscumin) VisAlbCBA. LECp.Vis.Alb.pl.Cga2 (ML-II, viscumin) LECp.Vis.Alb.pl.Cga3 (ML-III, VAA-II) LECp.Vis.Alb.pl.Hch1 (VisAlbCBA). [653] Vitis vinifera. . . LECp.Vit.Vin.xx.Xxxx. [654] Volvariella VVL. . LECf.Vol.Vol.xx.Xxxx. volvacea. [655] Wistaria WFA. . LECp.Wis.Flo.xx.Xxxx. floribunda. [656] Wistaria . . LECp.Wis.Flo.xx.Xxxx. floribunda. [657] Wistaria sinensis. . . LECp.Wis.Sin.xx.Xxxx. [658] Wistaris . . LECz.Wis.Bra.xx.Xxxx. brachbotrys. [659] Xanthosoma . . LECp.Xan.Sag.xx.Xxxx. sagittifolium. [660] Xenopus laevis . . LECa.Xen.Lae.xx.Xga1. ovum. [661] Xeromus . . LECz.Xer.Chr.xx.Xxxx. chrysenteron. [662] Xylaria . . LECf.Xyl.Pol.xx.Xxxx. polymorpha. [663] Zea mays. ZMA-I, ZMA-II, . LECp.Zea.May.xx.Xxxx. ZMEA. [664] Cannabis sativa. CSA. . LECp.CanSat.se.Glu. [665] Smilax glabra. Sarparilla. . LECp.SmiGla.rh.xxx. [666] Trichosanthes Snake gourd. . . anguina.
[0136] Lectin codes take the following form: 2 LLLx.Ggg.Sss.ti.TspN
[0137] An explanation of each index variable follows.
[0138] LLL refers to the general category of agglutinin. At this point six general categories are recognized: lectins (LEC), integrins (INT), cadherins (CDH), annexins (ANN), selectins (SEL) and galectins (GLT). The x value refers to the taxonomic groups of the agglutinin, Table 1 summarizes these categories: 3 Category Taxonomic group LECa, GLTa Lectin or galectin from higher animal, typically vertebrates. LECh, GLTh Lectin or galectin from humans LECi, GLTi Lectin or galectin from invertebrates LECp. Plant lectins LECf. Lectin from fungi LECu. Lectin from unicellular organisms LECb. Lectin from Bacteria LECv. Viral lectins
[0139] Ggg stands for the three first letters of the plant genus name (in Latin).
[0140] Sss stands for the three first letters of the plant species name (in Latin).
[0141] ti refers to the tissue from which the lectin has been isolated. Table 2 summarizes the indices used for the various tissues: 4 Tissue, cell or organ Taxonomic grouping Index Bark Plant Ba Bulb Plant Bu Cell membrane Bacteria, Unicellular Cm Epidermis Human, vertebrates Ep Fruit Plant Fr Hemolymph Invertebrates He Latex Plant La Leaf Plant Le Nodule Plant No Organ or cell type Human, vertebrates, Oc Invertebrates Phloem sap Plant Ps Rhizome Plant Rh Root Plant Ro Seed Plant Se Serum or plasma Human, vertebrates, Sr Invertebrates Spores or fruiting bodies Fungi Sp Stem Plant St Tentacles Invertebrates Te Tuber Plant Tu Whole body homogenate Invertebrates Wb Venom Invertebrates Ve Undefined Human, vertebrates, Un Invertebrates, Bacteria, Unicellular, Virus, Fungal
[0142] T refers to the lectin subtype. Hololectins, merolectins, chimerolectins and superlectins are indicated by the letters H, M, C and S, respectively.
[0143] sp refers to the specificity group. Each group is indicated by the index given in Table 3: 5 Specificity Index of group Mannose-binding lectins ma Mannose/maltose-binding mm lectins Mannose/glucose-binding mg lectins GlcNAc/(GlcNAc)-binding ch lectins Gal/GalNAc-binding lectins ga Fucose-binding lectins fu Sialic acid-binding lectins si Lectins with a complex but co known specificity Lectins with a complex and cu unknown specificity Lectins with a dual specificity du Lectins with an undetermined nd specificity
[0144] Lipids
[0145] A multifunctional molecule of the invention can also be a molecule that comprises a first part which comprises a lipid and a second part which comprises an amino acid sequence which can bind to a cell surface molecule, e.g. a cell surface molecule of an APC. The attachment of a lipid, e.g. a long-chain fatty acid, to a molecule, e.g. a polypeptide, can permit the complex to become stably associated with the plasma membrane when the complex is admixed with a cell (Nagarajan et al, 1995, J Immunol Methods 184:241-51; McHugh et al, 1995, PNAS 92:8059-63; van den Berg et al, 1995, J Cell Biol, 131:669-77). This is believed to occur through intercalation of the lipid into the membrane. A convenient method of producing a lipid-associated polypeptide comprises expressing, in a suitable host cell, a nucleic acid encoding, in part, a signal sequence directing the post-translational addition of a GPI moiety. Using recombinant DNA technology, a naturally non-GPI linked protein can be expressed as a GPI-linked protein by constructing a nucleic acid that encodes the protein linked to a heterologous GPI signal sequence. Nucleotide sequences encoding GPI signal sequences useful for this purpose include, for example, those comprised by decay accelerating factor (e.g., sequences encoding amino acid sequence “22” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32; sequences encoding signal sequences disclosed in Caras et al, U.S. Pat. No. 5,109,113); brevican (e.g., nt 1982-2047 of Genbank accession number X86406), mesothelin (e.g., nt 1858-1983 of Genbank U40434), coccidioides immitis antigen 2 (e.g., sequences encoding amino acids 172-194 of NCBI Entrez protein database accession #1256444, Zhu et al, 1996, Gene 181:121-5), acetylcholinesterase (e.g., sequences encoding the peptide “HC” as described in Duval et al, 1992, EMBO J. 11:3255-61; (e.g., sequences encoding amino acid sequence “19” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32)), human folate receptors alpha and beta (e.g., sequences encoding amino acids 230-257 of NCBI Entrez protein database accession #182416 or amino acids 228-255 of NCBI Entrez protein database accession #1655592, Yan and Ratnam, 1995, Biochemistry 34:14594-600), 5′ nucleotidase (e.g., sequences encoding amino acids 547-570 or 547-574 of NCBI Entrez protein database accession #404502, Furukawa et al, 1994, Biochim Biophys Acta 1190:273-8; (e.g., sequences encoding amino acid sequences “5” or “6” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32)), CD59 (e.g. encoded by nt 393-473 of Genbank U48255; sequences encoding amino acid sequence “20” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32; sequences encoding amino acids 74-101 of FIG. 2 of Powell et al, 1997, J Immunol 158:1692-1702), T-cadherin (e.g., sequences encoding the 76 C-terminal amino acids of chick T cadherin as described by Koller and Ranscht, 1996, J Biol Chem 271:30061-7), aminopeptidase P (e.g., sequences encoding amino acids 649-673 of NCBI Entrez protein database accession #1517942, Hyde et al, 1996, Biochem J 319:197-201), carboxypeptidase M, CD16B, Thy 1, carbonic anhydrase IV (e.g., sequences encoding amino acids 284-312 of NCBI Entrez protein database accession #179791, Okuyama et al, 1995, Arch Biochem Biophys 320:315-22), placental alkaline phosphatase (e.g., sequences encoding amino acids 498-529 of NCBI Entrez protein database accession #178464, Oda et al, 1994, Biochem J 301:577-83), neuronal glycoprotein F3, carcinoembryonic antigen (e.g., sequences encoding amino acid sequence “28” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), MRC-OX45 (e.g., sequences encoding amino acid sequence “2” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), RT 6.2 (e.g., sequences encoding amino acid sequence “3” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), D. discoideum prespore-specific antigen (e.g., sequences encoding amino acid sequence “4” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), microsomal dipeptidase (e.g., sequences encoding amino acid sequence “8” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), CAMPATH-1 (e.g., sequences encoding amino acid sequence “9” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei PARP (e.g., sequences encoding amino acid sequence “10” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG Mit 118a (e.g., sequences encoding amino acid sequence “11” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG Mit 117a (e.g., sequences encoding amino acid sequence “12” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG MITat 1.1000 BC (e.g., sequences encoding amino acid sequence “13” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG MITat 1.5b (e.g., sequences encoding amino acid sequence “14” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG ILTat 1.1 (e.g., sequences encoding amino acid sequence “15” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG TxTat 1 (e.g., sequences encoding amino acid sequence “16” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG Mit 221 (e.g., sequences encoding amino acid sequence “17” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), prion proteins (e.g., sequences encoding amino acid sequence “18” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), urokinase receptor (e.g., sequences encoding amino acid sequence “21” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. congolense VSG YNat 1.1 (e.g., sequences encoding amino acid sequence “23” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), S. cerevesiae GAS-1 (e.g., sequences encoding amino acid sequence “24” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), Thy-1 (e.g., sequences encoding amino acid sequences “25” or “26” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), L. major PSP (e.g., sequences encoding amino acid sequence “29” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), D. discoideum contact site A glycoprotein (e.g., sequences encoding the 25 C-terminal amino acids as described in Barth et al, 1996, Biochem J 317:533-40) CD24, and synthetic sequences (e.g. as described by Coyne et al, 1993, J Biol Chem 268:6689-93).
[0146] GPI-linked polypeptides can be extracted from cells using the following method. 5×106 cells are spun down and frozen at −80° C. The pellet is thawed in 14 ml of 0.15M NaCl/10 mM Tris 7.4/0.1 mM primaquine/2% Trito X-114 with stirring at 0° C. for 1 h, then centrifuged at 8800 g at 0° C. for 10 min. The supernatant is maintained at −20° C. overnight, thawed at room temperature, and then placed at 32° C. for 12 min. It is then centrifuged at 3000 g for 3 min at 32° C. The top layer is decanted and 11 ml of cold Buffer A (0.15M NaCl/10 mM Tris 7.4/0.1 mM primaquine/0.06% Triton X-114) is added to the bottom layer. This is incubated on ice for 10 min. The 12 min 32° C. incubation 32° C. 30002 centrifugation, decanting of top layer, and addition of 11 ml cold Buffer A to bottom layer are repeated. The solution is centrifuged at 18000 g for 10 min at 0° C. The 12 min 32° C. incubation, 32° C. 3000 g centrifugation, and decanting of top layer are repeated. 3 vol of cold acetone are added to the final bottom phase. The solution is centrifuged at 12, 000 RPM for 30 min, the supernatant removed, and the protein pellet containing the GPI fraction dried under vacuum. Specific proteins can be purified by methods well-known to those skilled in the art, e.g. immunoaffinity purification.
[0147] Another method of producing a lipid-linked polypeptide is to chemically link the polypeptide to a fatty acid such as palmitate. 1.5 mg/ml of the polypeptide is suspended in PBS, pH 7.8, containing 0.3% deeoxycholic acid, 0.1% sodium bicarbonate, and 0.1% sodium azide. The optimal final pH of the solution is 7.6-8.0. The mixture is warmed to 37° C. and the N-hydroxysuccinimide ester of palmitic acid (Research Organics, Cleveland, Ohio) is added to a final concentration of 0.1 mg/ml. The solution is incubated overnight at room temperature. The polypeptide is purified by passage through a 16×250 mm Sephadex G-75 chromatography column equilibrated with 0.15% deoxycholic acid in PBS, pH 7.6.
[0148] Crosslinking Moieties Useful According to the Invention
[0149] Another convenient method of linking a ligand to an antigen bearing target is to use a crosslinking agent. A “crosslinking agent” is a chemical entity that can react with functional groups on at least two other molecules, e.g. two polypeptides or a polypeptide and a lipid, such that upon reaction with the crosslinking agent the two molecules become covalently linked. Thus, a ligand for CD40 can be crosslinked to a molecule on the surface of a cell.
[0150] A wide variety of crosslinking agents, both bifunctional and polyfunctional, are known in the art and are commercially available, e.g. from Sigma (St. Louis, Mo.). These include, for example, S-acetylmercaptosuccinic anhydride, 5-acetylthioglycolic acid N-hydroxysuccinimide ester, S-acetylthiopropionic acid N-hydroxysuccinimide ester, adipic acid dihydrazide, 4-azidobenzoic acid N-hydroxysuccinimide ester, N-(5-azido-2-nitrobenzyloxy)succinimide, 6-(4-azido-2-nitrophenylamino)hexanoic acid N-hydroxysuccinimide ester, p-azidophenacyl bromide, N-(4-azidophenylthio)phthalimide, 4-azidosalicylic acid N-hydroxysuccinimide ester, bromoacetic acid N-hydroxysuccinimide ester, 1,4-butanediol diglycidyl ether, carbonyl-bis(L-methionine p-nitrophenyl ester), 2-diazo-3,3,3-trifluoropropionic acid p-nitrophenyl ester, diethyl malonimidate, 1,5-difluoro-2,4-dinitrobenzene, 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid, dimethyl adipimidate, dimethyl 3,3′-dithiobispropionimidate, dimethyl pimelimidate, dimethyl suberimidate, 4,4′-dithiobisphenyl azide, dithiobis(propionic acid N-hydroxysuccinimide ester), ethylene glycol bis-(succinic acid N-hydroxysuccinimide ester), 4-fluoro-3-nitrophenyl azide, bis-(4-fluoro-3-nitrophenyl) sulfone, p-formylbenzoic acid N-hydroxysuccinimide ester, glutaraldehyde, 2-iminothiolane, 6-(iodoacetamido)caproic acid N-hydroxysuccinimide ester, iodoacetic acid N-hydroxysuccinimide ester, 3-malemidoacetic acid N-hydroxysuccinimide ester, 3-malemidobenzoic acid N-hydroxysuccinimide ester, 4-(N-malemido)benzophenone, gamma-malemidobutyric acid N-hydroxysuccinimide ester, epsilon-malemidocaproic acid N-hydroxysuccinimide ester, 4-(N-malemidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide ester, 4-(N-malemidomethyl)cyclohexanecarboxylic acid 3-sulfo-N-hydroxysuccinimide ester, beta-malemidopropionic acid N-hydroxysuccinimide ester, N,N′-bis(3-malemidopropionyl)-2-hydroxy-1,3-propanediamine, 1,4-phenylene diisothiocyanate, N,N′-o-phenylene dimalemide, N,N′-p-phenylene dimalemide, polyoxyethylene bis(glycidyl ether), bis(polyoxyethylene bis(glycidyl ether)), polyoxyethylene bis(imidazolylcarbonyl), bis(polyoxyethylene bis(imidazolylcarbonyl)), polyoxyethylene bis(p-nitrophenyl carbonate), 3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide ester, suberic acid bis(N-hydroxysuccinimide) ester, succinic acid malemidoethyl N-hydroxysuccinimide ester, 1, 5 bis(succinimidooxycarbonyloxy)-pentane, and bis(N-succinimidyl) carbonate.
[0151] Ligands of a Cell Surface Protein
[0152] The multifunctional molecules of the present invention comprise one part which is a lectin and is capable of binding to at least one carbohydrate molecule on an antigen bearing target, and a second part comprising a ligand for a cell surface protein of an antigen presenting cell. The ligand can be any ligand which binds to one or more of the cell surface molecules indicated by GenBank Accession number in Appendix I or II. More preferably, however, the ligand includes, but is not limited to an opsonin, a cytokine, a heat shock protein, an adhesion molecule. a defensin, or a counterreceptor for a T cell costimulatory molecule; or a portion of any of these molecules, e.g., about (or at least about) 5, 8, 10, 12, 15, 20, 25, 35, 40, 50, 60, 70, 80, 100, or 120 contiguous amino acid residues, up to the full length of such a molecule.
[0153] Cytokines Useful According to the Invention
[0154] The term “cytokine” as defined hereinabove refers to a polypeptide molecule that is naturally secreted by mammalian cells and that binds to a cell surface receptor on a leukocyte. The term “cytokine” also refers herein to a polypeptide molecule that is a ligand for a receptor for a naturally occurring cytokine. Unlike an opsonin, a cytokine does not naturally contemporaneously bind an antigen and a cell-surface receptor.
[0155] Leukocytes which bear receptors for cytokines include, for example, monocytes, macrophages, dendritic cells, neutrophils, eosinophils, basophils, platelets, lymphocytes, T lymphocytes, B lymphocytes, NK cells, myeloma cells, lymphoma cells, and leukemic cells.
[0156] Without being bound by any one mechanism, it is believed that cell-surface associated cytokines provide an advantage over freely diffusible cytokines by allowing stable juxtaposition of the cytokine to the cell, thus increasing the concentration of cytokine in the vicinity of the cell.
[0157] Preferred cytokines are non-rodent cytokines, e.g primate, e.g. human cytokines.
[0158] Some cytokines can be regarded as belonging to one or more families of cytokines based on structural and/or functional properties. One such family consists of the interleukins. Interleukins are structurally diverse, but share the property of both being expressed by and acting on leukocytes. Examples of interleukins include IL-1 (e.g. polypeptides encoded by Genbank Accession No. M15330, M28983, E04743, M15131) IL-2 (e.g. polypeptides encoded by Genbank Accession No. E01108, K02797), IL-3 (e.g. polypeptides encoded by Genbank Accession No. A02046, M14743), IL-4 (e.g. polypeptides encoded by M13982, M25892), IL-5 (e.g. polypeptides encoded by X06270, J03478), IL-6 (e.g. polypeptides encoded by E02772, M20572), IL-7 (e.g. polypeptides encoded by J04156, M29054-29057), IL-8 (e.g. polypeptides encoded by M28130), IL-9 (e.g. sequences disclosed in Kelleher et al, Blood. 1991; 77: 1436-1441, Immunogenetics 1990;31(4):265-270), IL-10 (e.g. polypeptides encoded by M84340, U16720), IL-11 (e.g. sequences disclosed in Paul et al, Proc Natl Acad Sci USA. 1990; 87: 7512-7516, Morris et al, Exp Hematol. 1996; 24: 1369-1376), IL-12 (e.g. polypeptides encoded by Genbank Accession No. M86671, S82412; Genbank protein P29459, P29460), IL-13 (e.g. polypeptides encoded by U31120, L13028), 1L-14 (e.g. sequences disclosed in Ambrus et al, Proceedings of the National Academy of Science (USA) 1993; 90: 6330-4), IL-15 (e.g. polypeptides encoded by AF031167, U22339), 1L-16 (e.g. polypeptides encoded by AF006001, M90391), IL-17 (e.g. polypeptides encoded by U32659, U43088), IL-18 (e.g. polypeptides encoded by D49949, D49950), IL-19 (e.g. polypeptides encoded by AY040367), IL-20 (e.g. polypeptides encoded by NM02130, NM018724), IL-21 (e.g. polypeptides encoded by AF254069, AF254070), IL-22 (e.g. polypeptides encoded by AF279437), IL-23 (e.g. polypeptides encoded by AF301619, AF301620, AY055379 [p19 alpha chain combines with IL-12 p40 chain to form IL-23]), IL-24 (e.g. polypeptides encoded by AF276916, NM053095), IL-25 (e.g. polypeptides encoded by NM080837), TNF-alpha (e.g. polypeptides encoded by M16441, Y00467), and GM-CSF (e.g. polypeptides encoded by X03019, M11220) and their homologues among species. Nucleotide sequences encoding homologues will hybridize to each other under moderate- to high-stringency conditions.
[0159] Another family consists of the hematopoietins. Members of this family comprise helical regions, known as helices A, B, C, and D. Helices A and B and helices C and D run roughly parallel to each other, respectively. Examples of hematopoietins include IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-12, IL-13, IL-15, GM-CSF, G-CSF (e.g. polypeptides encoded by Genbank Accession No. E01219, M13926), oncostatin M (e.g. polypeptides encoded by Genbank Accession No. D31942, sequences disclosed in Malik et al, Mol Cell Biol 1989, 9:2847-2853), LIF (e.g. polypeptides encoded by Genbank Accession No. X13967, X06381), CNTF (e.g. polypeptides encoded by Genbank Accession No. U05342, X60542), and their homologues among species. Nucleotide sequences encoding homologues will hybridize to each other under moderate- to high-stringency conditions.
[0160] Human IL2 is a protein of 133 amino acids (15.4 kDa) with a slightly basic pI. Murine and human IL2 display a homology of approximately 65%. IL2 is synthesized as a precursor protein of 153 amino acids with the first 20 amino-terminal amino acids functioning as a hydrophobic secretory signal sequence. The protein contains a single disulfide bond (positions Cys58/105) essential for biological activity.
[0161] IL2 is O-glycosylated at threonine at position 3. Variants with different molecular masses and charges are due to variable glycosylation. Non-glycosylated IL2 is also biologically active. Glycosylation appears to promote elimination of the factor by hepatocytes.
[0162] A dimeric form of human IL2, produced by the action of a transglutaminase isolated from regenerating fish optic nerves, has been shown to be a cytotoxic factor for rat brain oligodendrocytes in culture.
[0163] The human IL2 gene contains four exons. The IL2 gene maps to human chromosome 4q26-28 (murine chromosome 3). The homology of murine and human IL2 is 72% at the nucleotide level in the coding region.
[0164] The biological activities of IL2 are mediated by a membrane receptor that is expressed almost exclusively on activated, but not on resting, T-cells at densities of 4-12×13 receptors/cell. Activated B-cells and resting mononuclear leukocytes rarely express this receptor. The expression of the IL2 receptor is modulated by IL5 and IL6. Three different types of IL2 receptors are distinguished that are expressed differentially and independently. The high affinity IL2 receptor (Kdis ˜10 pM) constitutes approximately 10% of all IL2 receptors expressed by a cells. This receptor is a membrane receptor complex consisting of the two subunits IL2R-alpha (TAC antigen=T-cell activation antigen; p55) and IL2R-beta (p75; CD122) as the ligand binding domains and a gamma chain as a signaling component. p75 is expressed constitutively on resting T-lymphocytes, NK-cells, and a number of other cell types while the expression of p55 is usually observed only after cell activation. p55 is, however, synthesized constitutively by a number of tumor cells and by HTLV-1-infected cells.
[0165] IL2 receptor expression of monocytes is induced by IFN-gamma, so that these cells become tumor-cytotoxic. In T-cells the expression of p75 can be reduced by IL3. An intermediate affinity IL2 receptor (Kdis=100 pM) consists of the p75 subunit and a gamma chain (see below) while a low affinity receptor (Kdis=10 nM) is formed by p55 alone.
[0166] p55 (e.g. polypeptides encoded by Genbank Accession No. X01057) has a length of 251 amino acids with an extracellular domain of 219 amino acids an a very short cytoplasmic domain of 13 amino acids. The p55 gene maps to human chromosome 10p14-p15.
[0167] p75 (e.g. polypeptides encoded by Genbank Accession No. M26062, M28052) has a length of 525 amino acids with an extracellular domain of 214 amino acids and a cytoplasmic domain of 286 amino acids. The p75 gene contains 10 exons and has a length of approximately 24 kb. It maps to human chromosome 22q11.2-q12 and to murine chromosome 15 (band E).
[0168] A third 64 kDa subunit of the IL2 receptor, designated gamma, has been described (e.g. polypeptides encoded by Genbank Accession No. D13821, D11086). Murine and human gamma subunits of the receptor have approximately 70% sequence identity at the nucleotide and amino acid levels. This subunit is required for the generation of high and intermediate affinity IL2 receptors but does not bind IL2 by itself. These two receptor types consist of an alpha-beta-gamma heterotrimer and a beta-gamma heterodimer, respectively. The gene encoding the gamma subunit of the IL2 receptor maps to human chromosome Xq13, spans approximately 4.2 kb and contains eight exons. The gamma subunit of the IL2 receptor has been shown recently to be a component of the receptors for IL4 and IL7. It is also believed to be a component of the IL13 receptor.
[0169] The amino acids at positions 267-317 lying directly adjacent to the transmembrane region of p75 are involved in IL2-mediated signal transduction. In addition the IL2 receptor is associated with a number of other proteins (p22, p40, p100) which are thought to be involved in mediating conformational changes in the receptor chains, receptor-mediated endocytosis, and further signal transduction processes. One of the identified proteins is the 95 kDa cell adhesion molecule ICAM-1 which probably focuses IL2 receptors at regions of cell-to-cell contacts and thus may mediate paracrine activities, for example, during IL2-mediated stimulation of T-cells. Another protein associated with p75 is a tyrosine-specific protein kinase called lck. The observation that proliferation of cells induced by IL2 is inhibited by specific inhibitors of protein tyrosine kinases in an lck negative cell line suggests that other kinases may also be associated with IL2 receptors. Two such kinases, called fyn and lyn, have been identified. In addition, IL2 receptor signaling may also be mediated by vav.
[0170] Activated lymphocytes continuously secrete a 42 kDa fragment of the TAC antigen. This fragment circulates in the serum and plasma and functions as a soluble IL2 receptor (sIL2R). The concentrations of this soluble receptor vary markedly in different pathological situations, for example, infections, autoimmune diseases, leukemias, or after organ transplantation. Levels may increase up to 100-fold. The levels of sIL2R appear to correlate with the severity of HIV-induces diseases and may be of diagnostic value also in other settings.
[0171] Mouse and human IL2 both cause proliferation of T-cells of the homologous species at high efficiency. Human IL2 also stimulates proliferation of mouse T-cells at similar concentrations, whereas mouse IL2 stimulates human T-cells at a lower (sixfold to 170-fold) efficiency.
[0172] IL2 is a growth factor for all subpopulations of T-lymphocytes. It is an antigen-unspecific proliferation factor for T-cells that induces cell cycle progression in resting cells and thus allows clonal expansion of activated T-lymphocytes. This effect is modulated by hormones such as prolactin.
[0173] IL2 also promotes the proliferation of activated B-cells also this requires the presence of additional factors, for example, IL4.
[0174] Due to its effects on T-cells and B-cells IL2 is a central regulator of immune responses. It also plays a role in anti-inflammatory reactions, in hematopoiesis and in tumor surveillance. IL2 stimulates the synthesis of IFN-gamma in peripheral leukocytes and also induces the secretion of IL1, TNF-alpha and TNF-beta.
[0175] It is believed that he induction of the secretion of tumoricidal cytokines apart from the activity in the expansion of LAK cells (lymphokine-activated killer cells) are probably the main factors responsible for the antitumor activity of IL2.
[0176] IL2 can be assayed in bioassays employing cell lines that respond to the factor (e.g., ATH8, CT6, CTLL-2, FDCPmix, HT-2, NKC3, TALL-103). Specific ELISA assays for IL2 and enzyme immunoassays for the soluble receptor are also available. The soluble receptor can be detected also by employing biotinylated IL2 and flow-through cytometry or ELISA assays.
[0177] IL2 displays significant anti-tumor activity for a variety of tumor cell types since it supports the proliferation and clonal expansion of T-cells that specifically attack certain tumors. IL2 is increasingly used to treat patients with cancers refractory to conventional treatment. Combination therapy with systemically administered IL2 has resulted in long-term remissions in 30% of patients with metastatic renal cell carcinoma, for which there is no standard treatment. Objective and long-lived clinical responses have been documented also in a proportion of patients with melanoma or acute myeloid leukemia.
[0178] High dose systemic IL2 therapy is also associated with a great number of unwanted toxic side-effects. IL2 has additional effects on other components of the cellular immune system, including B-cells and macrophages, and induces the secretion of other soluble mediators, including TNF-alpha, TNF-beta, and IFN-gamma. These effects may contribute to the antitumor activity of IL2 as well as to its dose-related toxicity.
[0179] The transduction of murine tumor cells with a functional IL2 gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts. Altered tumor cells expressing IL2 also increase systemic immunity.
[0180] Human IL4 is a protein of 129 amino acids (20 kDa) that is synthesized as a precursor containing a hydrophobic secretory signal sequence of 24 amino acids. IL4 is glycosylated at two arginine residues (positions 38 and 105) and contains six cysteine residues involved in disulfide bond formation. The disulfide bonds are essential for biological activity. Some glycosylation variants of IL4 have been described that differ in their biological activities. A comparison of murine and human IL4 shows that both proteins only diverge at positions 91-128.
[0181] An IL4 variant, Y124D, in which Tyr124 of the recombinant human protein is substituted by an aspartic acid residue, binds with high affinity to the IL4 receptor (Kd=310 pM). This variant is a powerful antagonist for the IL4 receptor system. It retains no detectable proliferative activity for T-cells and competitively inhibits IL4-dependent T-cell proliferation (K(i)=620 pM). The existence of this mutant demonstrates that high affinity binding and signal generation can be uncoupled efficiently in a ligand. Y124D also acts as a powerful antagonist for the IL13 receptor.
[0182] The human IL4 gene contains four exons and has a length of approximately 10 kb. It maps to chromosome 5q23-31. The murine gene maps to chromosome 11. The IL4 gene is in close proximity to other genes encoding hematopoietic growth factors (e.g., GM-CSF, M-CSF, IL3, IL5). The distance between the IL4 and the IL5 gene is approximately 90-240 kb.
[0183] At the nucleotide level the human and the murine IL4 gene display approximately 70% homology. The 5′ region of the IL4 contains several sequence elements, designated CLE (conserved lymphokine element), that are binding sites for transcription factors controlling the expression of this and other genes. A sequence motif, called P sequence (CGAAAATTTCC; SEQ ID NO: 1) in the 5′ region of the human IL4 gene (positions −79-−69) is the binding site for a nuclear factor, called NF(P), mediating the response to T-cell activation signals.
[0184] The biological activities of IL4 are mediated by a specific receptor (Kdis=20-100 pM) which is expressed at densities of 100-5000 copies/cell (e.g. polypeptides encoded by Genbank Accession No. M29854, X52425). The extracellular domain of the IL4 receptor is related to the receptors for erythropoietin (Epo), IL6, and the beta chain of the IL2 receptor. It has been given the name CD124.
[0185] The cDNA for the murine IL4 receptor encodes a transmembrane protein of 810 amino acids (including a secretory signal sequence). This receptor has a large intracellular domain of 553 amino acids. The human receptor has an extracellular domain of 207 amino acids, a transmembrane domain of 24 residues, and a large intracellular domain of 569 amino acids.
[0186] The IL4 receptor has been shown recently to contain the gamma subunit of the IL2 receptor as a signaling component. This gamma subunit is also associated with the receptors for IL4 and IL7 and probably also of IL13. Two forms of the receptor have been described, one of which is secreted. The secreted receptor only contains the extracellular IL4 binding domain and is capable of blocking IL4 activities. An IL4 binding protein (IL4-BP) that binds IL4 with the same affinity as the IL4 receptor has been shown also to be a soluble IL4 receptor variant. These soluble receptors probably function as physiological regulators of cytokine activities by inhibiting receptor binding or act as transport proteins. Soluble receptors or binding proteins have been described also for IL1 (IL1 receptor antagonist), IL2, IL6, IL7, TNF-alpha, IGF, and IFN-gamma.
[0187] The biological activities of IL4 are species-specific; mouse IL4 is inactive on human cells and human IL4 is inactive on murine cells. IL4 promotes the proliferation and differentiation of activated B-cells, the expression of class II MHC antigens, and of low-affinity IgE receptors in resting B-cells. IL4 enhances expression of class II MHC antigens on B-cells. It can promote their capacity to respond to other B-cell stimuli and to present antigens for T-cells. This may be one way to promote the clonal expansion of specific B-cells and the immune system may thus be able to respond to very low concentrations of antigens. The production of IL4 by non-B non-T-cells is stimulated if these cells interact with other cells via their Fc receptors for IgE or IgG. This effect can be enhanced by IL3. IL2 and PAF (platelet activating factor) induce the synthesis of IL4 while TGF-beta inhibits it.
[0188] IL3 antagonizes the IL2-induced effects in B-cells and causes a slow decrease of the expression of IL2 receptors, thus inhibiting the proliferation of human B-cells stimulated by IL2. In activated B-cells IL4 stimulates the synthesis of IgG1 and IgE and inhibits the synthesis of IgM, IgG3, IgG2a and IgG2b. This isotype switching induced by IL4 in B-cells is antagonized by IFN-gamma. The growth of multiple myelomas can be suppressed by IL4 which inhibits the synthesis of IL6, a myeloma growth factor. IL4 also inhibits the synthesis of IL6 in human alveolar macrophages.
[0189] Pretreatment of macrophages with IL4 prevents the production of IL1, TNF-alpha and prostaglandins in response to activation of the cells by bacterial endotoxins or IFN-gamma.
[0190] IL4 synergises with Epo and G-CSF/Epo in the generation of colonies containing granulocytes or erythroid progenitor cells in a colony formation assay.
[0191] The classical detection method for IL4 is a B-cell costimulation assay measuring the enhanced proliferation of stimulated purified B-cells. IL4 can be detected also in bioassays, employing IL4-responsive cells (e.g., BALM-4; BCL1; CT.4S; CTL44; CTLL-2; Da; FDCPmix; HT-2; L4; L138.8A; M07E; MC/9; NFS-60; Ramos, Sez627, TF-1; TS1). A specific detection method for human IL4 is the induction of CD23 in a number of B-cell lines with CD23 detected either by flow-through cytometry or by a fluorescence immunoassay. An immunoassay that allows rapid determination of the rate of IN production under conditions preventing consumption/degradation is cytokine immunotrapping.
[0192] IL4 inhibits the growth of colon and mammary carcinomas. It has been shown to augment the development of LAK cells. The transduction of murine tumor cells with a functional IL4 gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts. Altered tumor cells expressing IL4 also increase systemic immunity. Mice vaccinated with transduced cells reject a subsequent challenge of non-transduced cells, and, in some cases, a pre-existing tumor.
[0193] Human IL6 is a protein of 185 amino acids glycosylated at positions 73 and 172. It is synthesized as a precursor protein of 212 amino acids. Monocytes express at least five different molecular forms of IL6 with molecular masses of 21.5-28 kDa. They mainly differ by post-translational alterations such as glycosylation and phosphorylation.
[0194] IL6 isolated from various cell types shows some microheterogeneity in its N terminus. A 42-45 kDa form has been observed in plasma that is probably complexed with a carrier protein, alpha-2-macroglobulin (&agr;2M). Murine and human IL6 show 65% sequence homology at the DNA level and 42% homology at the protein level.
[0195] IL6 is a member of a family of cytokines which also includes LIF, CNTF, Oncostatin M, IL11, and CT-1. All known members of the IL6 cytokine family induce hepatic expression of acute phase proteins.
[0196] A stable and highly bioactive designer cytokine consisting of a fusion protein between IL6 and a soluble IL6 receptor, designated H-IL6, has been used for human hematopoietic progenitor cell expansion and is useful in cases in which cells do not respond to IL6 but require a stable complex consisting of IL6 and a soluble IL6 receptor.
[0197] The human IL6 gene has a length of approximately 5 kb and contains five exons. It maps to human chromosome 7p21-p14 between the markers D7S135 and D7S370. The murine gene maps to chromosome 5. The nucleotide sequences of IL6 and G-CSF genes resemble each other in a way suggesting a possible evolutionary relationship.
[0198] The IL6 receptor (e.g. polypeptides encoded by Genbank Accession No. M20566, E03515) is expressed on T-cells, mitogen-activated B-cells, peripheral monocytes and some macrophage- and B-cell-derived tumor cell types. It is not expressed in resting B-cells but is in resting T-cells. In hepatocytes the IL6 receptor expression is enhanced after treatment with IL6 or IL1. In several cell types the expression of the IL6 receptor is also enhanced by glucocorticoids. The IL6 receptor gene maps to human chromosome 1q21.
[0199] The IL6 receptor is a strongly glycosylated protein of 80 kDa and a length of 449 amino acids. It has been designated CD126. It is synthesized as a precursor of 468 amino acids. The molecular structure resembles that of receptors for M-CSF, PDGF and IL1 in that the receptor contains an immunoglobulin-like sequence domain in the aminoterminal region of the extracellular receptor domain.
[0200] The intracellular domain of the IL6 receptor has a length of approximately 82 amino acids and does not show any homology to other proteins involved in intracellular signal transduction. Two different forms of the receptor have been described that bind IL6 with different affinities (Kdis=10−9 and 10−11 M) and most likely arise by post-translational modification of the same receptor protein. Biological activities of IL6 have been found also at concentrations of 10−13-10−15 M suggesting either the existence of other high-affinity receptor conformations or the existence of further receptor molecules with higher affinities.
[0201] IL6 receptor-mediated signal transduction involves protein kinase C and also adenylate cyclase.
[0202] The complex formed between IL6 and its receptor associates with a transmembrane glycoprotein, gp130 (918 amino acids; cytoplasmic domain of 277 amino acids), that is involved in signal transduction. Binding of IL6 to its receptor leads to disulfide-linked homodimerization of gp130 and the associated activation of a tyrosine kinase as the first step of signal transduction. gp130 is expressed also in cells that do not express IL6 receptors. It has been found to be a component of other receptors, including those for IL11, LIF, Oncostatin M, and CNTF, and CT-1. This explains why LIF, CNTF, and IL6 share many biological activities although the factors themselves are not related to each other. A factor resembling STAT proteins, termed LIL factor, has been found to be involved in signaling pathways of IL6, and also of IL1 and bacterial lipopolysaccharides.
[0203] A soluble form of the IL6 receptor (IL6R-SUP (IL6 receptor soluble urinary protein)) has been described also that also interacts with gp130. These soluble receptors probably function as physiological regulators of cytokine activities by inhibiting receptor binding or act as transport proteins. Similar soluble receptors or binding proteins have been described also for IL1 (IL1ra, IL1 receptor antagonist), IL2, IL4, IL7, TNF-alpha, IGF, and IFN-gamma.
[0204] Some cells, including hematopoietic progenitor cells and neuronal cells, are only responsive towards a combination of IL6 and soluble IL6 receptor but not to IL6 alone.
[0205] Human IL6 is biologically active in monkeys, rats, and mice. Murine IL6 is not active in human cells. The plethora of biological activities is exemplified by the many different acronyms under which IL6 has been described. IL6 is a pleiotropic cytokine influencing antigen-specific immune responses and inflammatory reactions. It is one of the major physiological mediators of cute phase reaction. In hepatocytes IL6 in combination with glucocorticoids induces the synthesis of metallothioneins and increases intracellular zinc levels, thus preventing CCL4-induced hepatotoxicity. IL6 is a neurotrophic factor for cholinergic neurons that promotes their survival in culture. Some neuronal cell lines can be induced to differentiate by IL6.
[0206] IL6, like IL1, stimulates the synthesis of ACTH (Corticotropin) in the pituitary. Glucocorticoids synthesized in response to ACTH inhibit the production of IL6, IL1 and TNF in vivo, thus establishing a sort of negative feedback loop between the immune system and neuroendocrine functions. In astrocytes IL6 induces the synthesis of Nerve Growth Factor (NGF).
[0207] IL6 is a B-cell differentiation factor in vivo and in vitro and an activation factor for T-cells. In the presence of IL2 IL6 induces the differentiation of mature and immature T-cells into cytotoxic T-cells. IL6 also induces the proliferation of thymocytes and probably plays a role in the development of thymic T-cells.
[0208] IL6 is capable of inducing the final maturation of B-cells into immunoglobulin-secreting plasma cells if the cells have been pre-activated by IL4. In B-cells IL6 stimulates the secretion of antibodies to such a degree that serum IgG1 levels can rise 120-400-fold.
[0209] IL6 at concentrations of only 0.002 ng/mL is one of the major autocrine growth modulator for many human myelomas. The growth of these cells can be inhibited by monoclonal antibodies directed against IL6. It can be inhibited also by the introduction of antisense oligonucleotides against IL6 or by IL4. The growth-inhibitory effects of corticosteroids on myeloma cells is probably due to the steroid-induced reduction in the expression of IL6. The growth of human IL6 dependent myeloma cells can be inhibited also by IFN-gamma. IL6 may also function as an autocrine growth modulator for other tumor types, some of which have been found to secrete IL6 constitutively. IL6 has been shown to be an autocrine modulator of growth for in vitro cervical tumor cell growth. On the other hand IL6 blocks the growth of some solid tumors such as mammary carcinomas, cervical carcinomas, human lung cancer cell lines, histiocytic lymphomas, and melanomas.
[0210] IL6 and IL3 synergise in vitro in promoting the proliferation of multipotent hematopoietic progenitor cells. IL6 is also a thrombopoietin that induces the maturation of megakaryocytes in vitro and increases platelet counts in vivo. In murine, but not in human bone marrow cultures IL6 shows activities resembling those of GM-CSF.
[0211] Plasmacytoma cells produce IL6 and also the IL6 receptor. It has been suggested that these cells are stimulated in an autocrine fashion. A paracrine mechanism involving the presence of two different cell populations, one producing the factor and the other expressing the receptor, has been described also.
[0212] IL6 can be detected in bioassays employing IL6 responsive cell lines (e.g., 7TD1; B19; CESS, KPMM2, KT-3; M1, MH60-BSF-2, M07E; Mono Mac 6; NFS-60; PIL-6; SKW6-C14; T1165; XG-1). IL6 can be assayed also by its activity as a hybridoma growth factor. Sensitive immunoassays and colorimetric tests are also available. An ELISA assay exists for detecting the receptor-associated gp130 protein.
[0213] In combination with other cytokines (for example, IL2) IL6 may be useful in the treatment of some tumor types. The transduction of murine tumor cells with a functional IL6 gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts. Altered tumor cells expressing IL6 also increase systemic immunity. Mice vaccinated with transduced cells reject a subsequent challenge of non-transduced cells, and, in some cases, a pre-existing tumor.
[0214] Human IL10 is a homodimeric protein with subunits having a length of 160 amino acids. Human IL10 shows 73% amino acid homology with murine IL10. The human IL10 contains four exons. It is closely related to the product of the BCRF-1 gene (Bam HI C fragment rightward reading frame) of Epstein-Barr virus (84% homology at the protein level). These two proteins are more closely related to each other than human and murine IL10. BCRF-1 has therefore also been called viral IL10 (vIL10). The human IL10 gene maps to chromosome 1. The human IL10 shows 81% homology with murine IL10 at the nucleotide level.
[0215] A receptor has been identified on murine and human cells by using radiolabeled IL10 (e.g. polypeptides encoded by Genbank Accession No. L12120, U00672). Mouse IL10 is capable of blocking binding of human IL10 to mouse but not human cells. The murine IL10 receptor has been cloned. This receptor is a protein of approximately 110 kDa that binds murine IL10 specifically. This receptor is structurally related to receptors for IFN.
[0216] IL10 inhibits the synthesis of a number of cytokines such as IFN-gamma, IL2 and TNF-beta in Th1 subpopulations of T-cells but not of Th2 cells. This activity is antagonized by IL4. The inhibitory effect on IFN-gamma production is indirect and appears to be the result of a suppression of IL12 synthesis by accessory cells. In the human system, IL10 is produced by, and down-regulates the function of, Th1 and Th2 cells. In macrophages stimulated by bacterial lipopolysaccharides IL10 inhibits the synthesis of IL1, IL6 and TNF-alpha by promoting, among other things, the degradation of cytokine mRNA. It also leads to an inhibition of antigen presentation. In human monocytes IFN-gamma and IL1 antagonize each other's production and function. IL10 has been shown also to be a physiologic antagonist of IL12.
[0217] IL10 also inhibits mitogen- or anti-CD3-induced proliferation of T-cells in the presence of accessory cells and reduces the production of IFN-gamma and IL2. Exogenous 1L2 and IL4 inhibit the proliferation-inhibitory effect but do not influence the production of IFN-gamma. In LPS-stimulated macrophages IFN-gamma increases the synthesis of IL6 by inhibiting the production of IL10. IL10 appears to be responsible for most or all of the ability of Th2 supernatants to inhibit cytokine synthesis by Th1 cells.
[0218] IL10 inhibits secretion of Ig by T-cell-independent antigens induced by IL5 but not that induced by IL2.
[0219] Murine Ly-1 B cells are the principal source of IL10. In contrast to other B-cells, Ly-1 B-cells express greatly elevated constitutive and inducible levels of IL10. These cells also have the distinctive property of continuous self-replenishment. The continuous treatment of newborn mice with anti-IL10 antibodies leads to a depletion of the Ly-1 B-cells while maintaining a normal population of splenic B-cells. These mice also contain greatly reduced serum immunoglobulin M levels and are also impaired in their antibody responses to specific antigens. IL10 is therefore a regulator of Ly-1 B-cell development. The mechanism of Ly-1 B-cell depletion appears to involve the increased production of IFN-gamma since co-administration of neutralizing anti-IFN-gamma antibodies substantially restores the number of peritoneal-resident Ly-1 B-cells in these mice.
[0220] IL10 is also a costimulator for the growth of mature and immature thymocytes (together with IL2, IL4 and IL7) and functions as a cytotoxic T-cell differentiation factor, promoting a higher number of IL2-activated cytotoxic T-lymphocyte precursors to proliferate and differentiate into cytotoxic effector cells. IL10 sustains viability of B-cells in vitro and also stimulates B-cells and promotes their differentiation. It enhances the expression of MHC class II antigens on B-cells whereas it inhibits MHC class II expression on monocytes. In B-cells activated via their antigen receptors or via CD40 IL10 induces the secretion of IgG, IgA and IgM. This effect is synergised by IL4 while the synthesis of immunoglobulins induced by IL10 is antagonized by TGF-beta. The activation of macrophages can be prevented by IL10.
[0221] It has been shown that human IL10 is a potent and specific chemoattractant for human T-lymphocytes. The chemotactic activity is directed towards cells expressing CD8 and not towards CD4 (+)cells. IL10 also inhibits the chemotactic response of CD4 (+)cells, but not of CD8 (+)cells, towards IL8. IL10 can be detected with a sensitive ELISA assay. The murine mast cell line D36 can be used to bioassay human IL10. The intracellular factor can be detected also by flow cytometry.
[0222] The introduction of an IL10 expression vector into CHO cells has been used to analyze the consequences of local IL10 production in vivo. These altered cells were no longer tumorigenic in nude mice or severe combined immunodeficient SCID mice and also suppressed the growth of equal numbers of co-injected normal CHO cells. While normal CHO tumors are usually substantially infiltrated by macrophages, these were virtually absent within CHO-IL10 tumor tissues, suggesting that IL10 indirectly suppresses tumor growth of certain tumors by inhibiting infiltration of macrophages which may provide tumor growth promoting activity.
[0223] Human IL12 is a heterodimeric 70 kDa glycoprotein consisting of a 40 kDa subunit (p40, 306 amino acids; 10% carbohydrate) and a 35 kDa subunit (p35, 197 amino acids; 20% carbohydrate) linked by disulfide bonds that are essential for the biological activity of IL12. p40 contains 10 cysteines and a binding site for heparin; p35 contains 7 cysteines.
[0224] The two subunits of IL12 are not related to any other known proteins. p40 shows some homology with the extracellular domain of the receptor for IL6, and p35 appears to be a homologue of IL6.
[0225] Bioactive murine and human IL12 fusion proteins combining the two IL12 subunits in a single molecule have been described. This designer cytokine retains antitumor activity in vivo. Flexi 12, a single chain protein retaining all of the biological characteristics of the dimeric recombinant IL12, has also been described.
[0226] The gene encoding the p40 subunit of IL12 (IL12B) maps to human chromosome 5q31-q33 in the same region that also harbors other cytokine genes. The gene encoding the p35 subunit of IL12 (IL12A) maps to human chromosome 3p 12-q 13.2. The expression of the two genes is regulated independently of each other.
[0227] The IL12 receptor appears to be a single protein of approximately 110 kDa (e.g. polypeptides encoded by Genbank Accession No. U03187, U23922, U64198, U64199). Up to 1000-9000 high affinity IL12 receptors/cell are expressed on peripheral blood mononuclear cells activated by various T-cell mitogens or by IL2. IL12 receptors are present on activated T-cells expressing CD4 and CD8 and on activated CD56 positive natural killer cells. Resting peripheral blood mononuclear cells, tonsillar B-cells, or tonsillar B-cells activated by anti-IgM/Dx, anti-IgM/Dx+IL2, or SAC+IL2 do not express the receptor. High affinity IL12 receptors are expressed constitutively on a transformed marmoset NK-like cell line, HVS.SILVA 40.
[0228] Binding of IL12 to its receptor can be prevented by monoclonal antibodies directed against the p40 subunit which therefore contains the binding site. The p40 subunit of IL12 shows homology with the extracellular domain of the IL6 receptor. A virus-encoded homologue of the p40 subunit is EBV-induced gene-3.
[0229] Human IL12 is not active in murine lymphocytes. Hybrid heterodimers consisting of murine p35 and human p40 subunits retain bioactivity on murine cells; however, the combination of human p35 and murine p40 is completely inactive on murine cells. Murine IL12 is active on both murine and human lymphocytes. The p40 subunit of murine IL12 subunit p40 (IL12p40) has been shown to specifically antagonize the effects of the IL12 heterodimer in different assay systems and to function as an endogenous specific inhibitor for the IL12 heterodimer.
[0230] IL12 stimulates the proliferation of human lymphoblasts activated by phytohemagglutinin. IL12 activates NK-cells positive for CD56, and this activity is blocked by antibodies specific for TNF-alpha. IL12 promotes specific allogenic CTL reactions. IL12 synergizes also with anti-CD3 antibodies and with allogeneic stimulation in mixed lymphocyte cultures in inducing T-cell proliferation.
[0231] In peripheral lymphocytes of the Th1 type IL12 induces the synthesis of IFN-gamma and IL2, and TNF. TNF-alpha also appears to be involved in mediating the effects of IL12 on natural killer cells since the effects of IL12 are inhibited by an antibody directed against TNF-alpha. IL12 and TNF-alpha are costimulators for IFN-gamma production with IL12 maximizing the IFN-gamma response; the production of IL12, TNF, and IFN-gamma is inhibited by IL10. In Th2 helper cells IL12 reduces the synthesis of IL4, IL5, and IL10.
[0232] IL12 synergises with suboptimal amounts of IL2 in promoting the proliferation of mononuclear cells in the peripheral blood and in promoting the generation of LAK cells (lymphokine activated killer cells). Picomolar concentrations of IL12 are as effective as nanomolar concentrations of IL2 in augmenting the cytolytic activity of natural killer cells expanded in vivo by IL2. IL12 also acts as a co-mitogen and potentiates the proliferation of resting peripheral cells induced by IL2.
[0233] IL12 enhances myelopoiesis of primitive bone marrow progenitor cells induced by SCF (stem cell factor) and synergizes with colony stimulating factors to induce proliferation. IL12 also has synergistic effects on more committed bone marrow progenitors, synergising with IL3, IL11, or IL3 plus SCF.
[0234] IL12 is potential clinical interest since it allows the reduction of doses of IL2 required for the generation of LAK cells (lymphokine-activated killer cells). IL12 has been shown to inhibit the growth of a variety of experimental tumors in vivo and to have antiangiogenic effects in vivo, which are, at least in part, mediated by IFN-gamma. IL12 therefore seems to be a potential candidate also for the treatment of angiogenesis-dependent malignancies.
[0235] IL19 and IL10 share 21 percent amino acid identity and are probably homologs. In monocytes treatment with bacterial lipopolysaccharides induces the synthesis of IL19 and this effect is potentiated in the presence of IL4 or IL13 but is unaffected by IFN-gamma. GM-CSF directly induces IL19 gene expression in monocytes. IL19 has been shown to bind to the IL20 receptor complex (Dumoutier L et al Cutting edge: STAT activation by IL-19, IL-20 and mda-7 through IL-20 receptor complexes of two types. Journal of Immunology 167(7): 3545-9 (2001); Gallagher G et al Cloning, expression and initial characterization of interleukin-19 (IL-i 9), a novel homologue of human interleukin-10 (IL-10). Genes Immun 1(7): 442-50 (2000)).
[0236] IL20 is structurally related to IL10. IL20 appears to be an autocrine factor for keratinocytes that regulates their participation in inflammation. Overexpression of IL20 in transgenic mice causes neonatal lethality with skin abnormalities characterized by an impairment of epidermal differentiation (Blumberg H et al Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell 104(1): 9-19 (2001); Dumoutier L et al Cutting edge: STAT activation by IL-19, IL-20 and mda-7 through IL-20 receptor complexes of two types. Journal of Immunology 167(7): 3545-9 (2001); Rich BE and Kupper TS Cytokines: IL-20-a new effector in skin inflammation. Current Biology 11(13): R531-4 (2001)).
[0237] An IL20 receptor has been identified to consist of two orphan class 2 cytokine receptor subunits. The receptor is expressed in skin and its expression is upregulated dramatically in psoriatic skin. Engagement of the receptor in a keratinocyte cell line involves signaling by one member of the STAT proteins, STAT3.
[0238] The IL20 receptor complex has been shown to bind also IL19 and IL24.
[0239] IL21 has been isolated by Parrish-Novak et al from a cDNA library derived from activated CD3 (+)T-cells in a search for the ligand of a type-I cytokine receptor isolated previously. The cDNA encodes a secreted protein of 131 amino acids protein most closely related to IL2 and IL15. The IL21 gene maps to human chromosome 4q26-q27 near the IL2 gene. IL21 mRNA is expressed in CD4 (+) but not in CD8 (+) T-cells after cell activation. It is not expressed also in B-cells and monocytes (Asao H et al Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. Journal of Immunology 167(1):1-5 (2001); Ozaki K et al Cloning of a type I cytokine receptor most related to the IL-2 receptor beta chain. Proceedings of the National Academy of Science (USA) 97: 11439-11444 (2000); Parrish-Novak J et al Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature 408: 57-63 (2000)).
[0240] IL21 stimulates proliferation of B-cell stimulated by crosslinking of the CD40 antigen. It inhibits proliferation stimulated by IL4 plus anti-IgM. IL21 augments stimulation of the proliferation of naive (CD45RA (+)) but not memory (CD45RO (+)) T-cells mediated by engagement of CD3. IL21 stimulates the proliferation of bone marrow progenitor cells and the expression of the NK-cell marker CD56 in the presence of IL15.
[0241] The IL21 receptor has been isolated by Parrish-Novak et al and found to be expressed by CD23 (+)B-cells, B-cell lines, a T-cell leukemia line, and NK-cell lines. The receptor gene has been mapped to human chromosome 16p12. The same receptor has been isolated by Ozaki et al, who called it NILR (novel interleukin receptor). The receptor (538 amino acids) is most closely related to human IL2 beta receptor. The receptor contains a WSXWS motif in the extracellular region, typical of type-1 cytokine receptors. The receptor is expressed on NK-cells, T-cells, and B-cell lines.
[0242] The common gamma chain, which is an indispensable subunit of the functional receptor complexes for IL2, IL4, 1L7, IL9, and IL15 has been shows also to be part of the IL21 receptor complex. The functional signalling complex activates Janus kinases JAK1, JAK3, and the STAT proteins STAT1, and STAT3 (Asao et al).
[0243] IL22 (180 amino acids including a signal sequence; 25 kDa; also called IL-TIF) was identified by a cDNA subtraction method as a gene induced specifically by IL9 in mouse T lymphocytes. The protein shows limited homology with IL10 (22 percent amino acid identity). Human and murine IL-TIF proteins share 79 percent amino acid identity.
[0244] The murine and human IL-TIF genes both consist of 6 exons. The human single-copy gene maps to chromosome 12q15 (90 Kb from the IFN-gamma gene, and 27 Kb from the AK155 gene encoding another IL10-related cytokine. In mice the gene is located also in the same region as the IFN-gamma gene. In BALB/c and DBA/2 mice the gene is a single copy gene. In C57B1/6, FVB and 129 mice the gene is duplicated. The two copies, termed IL-TIF-alpha and IL-TIF-beta show 98 percent nucleotide identity in the coding region and differ by a deletion of 658 nucleotide in IL-TIF-beta. This gene may be inactive.
[0245] Expression of IL-TIF is induced by IL9 in thymic lymphomas, T-cells, and mast cells, and by lectins in freshly isolated splenocytes. IL-TIF expression in T-cells does not require protein synthesis, and depends on the activation Janus kinases and STAT proteins. IL-TIF is expressed constitutively in thymus and brain.
[0246] In HepG2 human hepatoma cells IL-TIF up-regulates the production of acute phase proteins. IL-TIF also acts as a pro-inflammatory cytokine in vivo because injection of the protein also induces the synthesis of acute phase proteins. Synthesis of IL-TIF is induced rapidly after injection of bacterial lipopolysaccharides. In contrast to IL10, IL22 does not inhibit the production of pro-inflammatory cytokines by monocytes in response to bacterial lipopolysaccharides. It also does not impair IL10 function on monocytes. IL-TIF has some inhibitory effects on IL4 production from Th2 T-helper cells.
[0247] IL10 and IL-TIF utilise a common receptor subunit. Antibodies directed against the beta chain of the IL10 receptor block the induction of acute phase proteins by IL-TIF. The functional IL-TIF receptor complex consists of two receptor chains. One chain has been identified as the orphan receptor CRF2-4 that is expressed in normal liver and kidney. The other chain is the L10 receptor-2, the second chain of the IL10 receptor complex. Monkey COS expressing CRF2-9 alone respond to IL-TIF. In hamster cells both chains must be expressed to yield functional IL-TIF receptors. Although both receptor chains can bind IL-TIF independently binding of IL-TIF to the receptor complex is greater. This sharing of receptor subunits is similar to the shared use of the common gamma chain by cytokines such as IL2, IL4, IL7, IL9, and IL15. Some cell lines that do not respond to IL10 respond to IL-TIF by activation of STAT-1, STAT-3, and STAT-5.
[0248] A soluble secreted receptor (231 amino acids), designated IL22BP [IL22 binding protein] has been described (Kotenko et al). The protein demonstrates 34 percent amino acid identity with the extracellular domain of the IL22R1 chain and is known also as CRF2-10. The gene maps to human chromosome 6q24, 35 kb from the IFN-gamma R1 gene. It is expressed in various tissues with maximal expression in breast, lungs, and colon. The protein binds IL-TIF and inhibits its activity, blocking its interaction with the cell surface IL22 receptor complex and thus acting as a natural cytokine antagonist. IL22BP also blocks induction of the suppressors of cytokine signaling-3 (SOCS-3) gene expression by IL22 in HepG2 cells (Dumoutier L et al Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9. Journal of Immunology 164(4): 1814-1819 (2000); Dumoutier L et al Human interleukin-10-related T cell-derived inducible factor: molecular cloning and functional characterization as an hepatocyte-stimulating factor. Proceedings of the National Academy of Science (USA) 97(18): 10144-9 (2000); Dumoutier L et al IL-TIF/IL-22: genomic organization and mapping of the human and mouse genes. Genes Immun 1(8): 488-494 (2000); Dumoutier L et al Cloning and characterization of il-22 binding protein, a natural antagonist of il-10-related t cell-derived inducible factor/il-22. Journal of Immunology 166(12): 7090-5 (2001); Kotenko S V et al Identification, cloning, and characterization of a novel soluble receptor that binds IL-22 and neutralizes its activity. Journal of Immunology 166(12): 7096-7103 (2001); Kotenko S V et al Identification of the functional interleukin-22 (IL-22) receptor complex: the IL-10R2 chain (IL-10Rbeta) is a common chain of both the IL-10 and IL-22 (IL-10-related T cell-derived inducible factor, IL-TIF) receptor complexes. Journal of Biological Chemistry 276(4): 2725-32 (2001); Xie M H et al Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. Journal of Biological Chemistry 275(40): 31335-9 (2000)).
[0249] IL-23 is the name given to a factor that is composed of the p40 subunit of IL12 (IL12B) and another protein of 19 kDa, designated p19. p19 is structurally related to IL6, G-CSF, and the p35 subunit of IL12. In databanks the p19 subunit is found also under the acronym SGRF (IL6 G-CSF related factor).
[0250] p19 by itself is biologically inactive while the complex of p19 with p40 is active. The active complex is secreted by dendritic cells after cell activation.
[0251] Mouse memory T-cells (CD4 (+) CD45 Rb(low)) proliferate in response to IL23 but not in response to IL12. Human IL23 has been shown to stimulate the production of IFN-gamma by PHA blast T-cells and memory T-cells. It also induces proliferation of both cell types.
[0252] IL23 binds to the beta-1 subunit but not to the beta-2 subunit of the IL12 receptor, activating one of the STAT proteins, STAT4, in PHA blast T-cells.
[0253] Expression of p19 in transgenic mice leads to runting, systemic inflammation, infertility, and death before 3 months of age. The animals show high serum concentrations of the pro-inflammatory cytokines TNF-alpha and IL1. The number of circulating neutrophils is increased. Acute phase proteins are expressed constitutively. Animals expressing p19 specifically in the liver do not show these abnormalities. Expression of p19 is most likely due to hematopoietic cells as bone marrow transplantation of cells expressing p19 causes the same phenotype as that observed in the transgenic animals (Oppmann B et al Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13(5): 715-25 (2000); Wiekowski M T et al Ubiquitous Transgenic Expression of the IL-23 Subunit p 19 Induces Multiorgan Inflammation, Runting, Infertility, and Premature Death. Journal of Immunology 166(12): 7563-70 (2001)).
[0254] IL24 is a name given to a protein that is known also as ST16 [suppression of tumorigenicity-16] and MDA-7 [melanoma differentiation-associated gene 7]. The rat counterpart of IL24 has been identified as mob-5 or C49a. The murine counterpart is FISP.
[0255] MDA-7 protein (206 amino acids) was identified initially as a melanoma differentiation-associated cDNA in a study using cultured human melanoma cells that lose proliferative capacity and terminally differentiate in response to human IFN-beta and mezerein. The expression of MDA-7 is upregulated as a consequence of terminal differentiation. H0-1 and C8161 human melanoma cells engineered to express MDA-7 show reduces growth and do not form colonies in a colony formation assay. MDA-7 selectively suppresses the growth of human breast cancer cells by promoting cell death by apoptosis. Ectopic expression of MDA-7 by means of a replication defective adenovirus results in growth suppression and induction of apoptosis in a broad spectrum of additional cancers, including melanoma, glioblastoma multiforme, osteosarcoma and carcinomas of the breast, cervix, colon, lung, nasopharynx and prostate. No apparent harmful effects are observed after expression of MDA-7 in normal epithelial or fibroblast cells.
[0256] In human hematopoietic cells MDA-7 expression is induced during megakaryocyte differentiation in response to treatment with TPA (12-O-tetradecanoyl-phorbol-13-acetate).
[0257] The human MDA-7 gene maps to chromosome 1q32 and is tightly linked (within a region of 195 kb) to the genes encoding IL10, IL19, and IL20.
[0258] The receptor for IL24 has been identified as the IL20 receptor complex. This receptor also binds to IL19 (Blumberg H et al Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell 104(1): 9-19 (2001); Dumoutier L et al Cutting edge: STAT activation by IL-19, IL-20 and mda-7 through IL-20 receptor complexes of two types. Journal of Immunology 167(7): 3545-9 (2001); Huang E Y et al Genomic structure, chromosomal localization and expression profile of a novel melanoma differentiation associated (mda-7) gene with cancer specific growth suppressing and apoptosis inducing properties. Oncogene 20(48): 7051-63 (2001); Jiang H et al Subtraction hybridization identifies a novel melanoma differentiation associated gene, mda-7, modulated during human melanoma differentiation, growth and progression. Oncogene 11: 2477-2486 (1995); Jiang H et al The melanoma differentiation associated gene mda-7 suppresses cancer cell growth. Proceedings of the National Academy of Science (USA) 93: 9160-9165 (1996); Su Z et al The cancer growth suppressor gene mda-7 selectively induces apoptosis in human breast cancer cells and inhibits tumor growth in nude mice. Proceedings of the National Academy of Science (USA) 95: 14400-14405 (1998)).
[0259] IL25 (also known as SF20) has been identified in a search for factors that stimulate cell proliferation. The factor is secreted by bone marrow stromal cells
[0260] The IL25 receptor has been identified as mouse thymic shared antigen-1 (TSA-1). Enforced expression of the receptor in one of the factor-dependent cell lines, BaF3, which does not express the receptor, causes cell proliferation. FDCP2 cells, which express the receptor, also proliferate in response to SF20/IL25. In both cases proliferation is abolished by specific blocking antibodies directed against the receptor.
[0261] SF20/IL-25 has no detectable myelopoietic activity but supports proliferation of cells in the lymphoid lineage (Tulin E E et al SF20/IL-25, a Novel Bone Marrow Stroma-Derived Growth Factor That Binds to Mouse Thymic Shared Antigen-1 and Supports Lymphoid Cell Proliferation. Journal of Immunology 167(11): 6338-47 (2001)).
[0262] The members of the TNF ligand superfamily (TNFalpha, TNF-beta, LT beta, CD27 ligand, CD30 ligand, CD40 ligand, CD95 ligand, 41BB, OX40 ligand, TRAIL) share common biological activities, but some properties are shared by only some ligands, while others are unique. Human TNF-alpha is a non-glycosylated protein of 17 kDa and a length of 157 amino acids. Murine TNF-alpha is N-glycosylated. Homology with TNF-beta is approximately 30%. TNF-alpha forms dimers and trimers. The 17 kDa form of the factor is produced by processing of a precursor protein of 233 amino acids. A TNF-alpha converting enzyme has been shown to mediate this conversion. A transmembrane form of 26 kDa has been described also.
[0263] TNF-alpha contains a single disulfide bond that can be destroyed without altering the biological activity of the factor. Mutations Ala84 to Val and Val91 to Ala reduce the cytotoxic activity of the factor almost completely. These sites are involved in receptor binding. The deletion of 7 N-terminal amino acids and the replacement of Pro8Ser9Asp10 by ArgLysArg yields a mutated factor with an approximately 10-fold enhanced antitumor activity and increased receptor binding, as demonstrated by the L-M cell assay, while at the same time reducing the toxicity.
[0264] The gene has a length of approximately 3.6 kb and contains four exons. The primary transcript has a length of 2762 nucleotides and encodes a precursor protein of 233 amino acids. The aminoterminal 78 amino acids function as a presequence. The human gene maps to chromosome 6p23-6q12. It is located between class I HLA region for HLA-B and the gene encoding complement factor C. The gene encoding TNF-beta is approximately 1.2 kb downstream of the TNF-alpha gene. However, both genes are regulated independently. The two genes also lie close to each other on murine chromosome 17.
[0265] Approximately 500-10000 high-affinity receptors (Ka=2.5×10−9 M) for ‘I’ N-alpha are expressed on all somatic cell types with the exception of erythrocytes. Two receptors of 55 kDa (TNF-R1; new designation: CD120a) (e.g. polypeptides encoded by Genbank Accession No. X55313) and 75 kDa (TNF-R2; new designation: CD120b) (e.g. as described in Goodwin R G et al (1991) Molecular Cellular Biology 11: 3020-6) have been described. One receptor is a glycosylated protein of 455 amino acids that contains an extracellular domain of 171 and a cytoplasmic domain of 221 amino acids. Sequence homologies in the cysteine-rich domains of the extracellular portion reveal that the receptor is related to the low-affinity receptor of NGF and to human cell surface antigen CD40.
[0266] Deletion analysis in the C-terminal intracellular region of the 55 kDa receptor, TNF-R1 has revealed the existence of a so-called death domain, which is involved in signaling processes leading to programmed cell death. The death domain of TNF-R1 interacts with a variety of other signaling adaptor molecules, including TRADD, and RIP.
[0267] The two known receptors bind both TNF-alpha and TNF-beta. p55 is expressed particularly on cells susceptible to the cytotoxic action of TNF. p75 is also present on many cell types, especially those of myeloid origin (a virus-encoded homologue of the receptor subunit is EBV-induced gene-6). It is strongly expressed on stimulated T-cells and B-lymphocytes. The differential activities of TNF on various cell types, i.e. growth-promoting and growth-inhibiting activities, are probably mediated by the differential expression and/or regulation of multiple receptors in combination with other distinct receptor-associated proteins. p55 appears to play a critical role in host defenses against microorganisms and their pathogenic factors.
[0268] A third receptor subtype is expressed in normal human liver. It binds TNF-alpha but not TNF-beta. Some viruses contain genes encoding secreted proteins with TNF binding properties that are closely homologous to the p55 and p75 TNF receptors. Differential effects of the two receptor subtypes have been found also in TNF-mediated adhesion of leukocytes to the endothelium. It appears that engagement of the p55 receptor specifically leads to the induction of the cellular adhesion molecules ICAM-1, E-selectin, V-CAM-1, and CD44, while engagement of both the p55 and the p75 receptor induces expression of alpha-2 integrin.
[0269] Truncated soluble forms of the receptor have been found also. The soluble forms, in particular the soluble extracellular domain of the p60 receptor, block the antiproliferative effects of TNF and, therefore, may modulate the harmful effects of TNF.
[0270] Receptor densities are reduced by IL1 and tumor promoters such as phorbol esters. The expression of TNF-alpha receptor density is induced by IFN-alpha, IFN-beta, and IFN-gamma.
[0271] Signal transducers that associate with the cytoplasmic domains of members of the TNF receptor superfamily comprise TRAF (Tumor necrosis factor receptor-associated factors).
[0272] Human TNF-alpha is active on murine cells with a slightly reduced specific activity. In general, TNF-alpha and TNF-beta display similar spectra of biological activities in in-vitro systems, although TNF-beta is often less potent or displays apparent partial agonist activity.
[0273] TNF-alpha shows a wide spectrum of biological activities. It causes cytolysis and cytostasis of many tumor cell lines in vitro. Sensitive cells die within hours after exposure to picomolar concentrations of the factor and this involves, at least in part, mitochondria-derived second messenger molecules serving as common mediators of TNF cytotoxic and gene-regulatory signaling pathways. The factor induces hemorrhagic necrosis of transplanted tumors. Within hours after injection TNF-alpha leads to the destruction of small blood vessels within malignant tumors. The factor also enhances phagocytosis and cytotoxicity in neutrophilic granulocytes and also modulates the expression of many other proteins, including fos, myc, IL1 and IL6.
[0274] The 26 kDa form of TNF is found predominantly on activated monocytes and T-cells. It is also biologically active and mediates cell destruction by direct cell-to-cell contacts.
[0275] The chemotactic properties of fMLP (Formyl-Met-Leu-Phe) for neutrophils are enhanced by TNF-alpha. TNF-alpha induces the synthesis of a number of chemoattractant cytokines, including IP-10, JE, KC, in a cell-type and tissue-specific manner.
[0276] TNF-alpha is a growth factor for normal human diploid fibroblasts. It promotes the synthesis of collagenase and prostaglandin E2 in fibroblasts. It may also function as an autocrine growth modulator for human chronic lymphocytic leukemia cells in vivo and has been described to be an autocrine growth modulator for neuroblastoma cells. The autocrine growth-promoting activity is inhibited by IL4.
[0277] In resting macrophages TNF induces the synthesis of IL1 and prostaglandin E2. It also stimulates phagocytosis and the synthesis of superoxide dismutase in macrophages. TNF activates osteoclasts and thus induces bone resorption.
[0278] In leukocyte and lymphocyte progenitors TNF stimulates the expression of class I and II HLA and differentiation antigens, and the production of IL1, colony stimulating factors, IFN-gamma, and arachidonic acid metabolism. It also stimulates the biosynthesis of collagenases in endothelial cells and synovial cells.
[0279] IL6 suppresses the synthesis of IL1 induced by bacterial endotoxins and TNF, and the synthesis of TNF induced by endotoxins.
[0280] The neurotransmitter SP (substance P) induces the synthesis of TNF and IL1 in macrophages. IL1, like IL6, stimulates the synthesis of ACTH (corticotropin) in the pituitary. Glucocorticoids synthesized in response to ACTH in turn inhibit the synthesis of IL6, IL1 and TNF in vivo, thus establishing a negative feedback loop between the immune system and neuroendocrine functions.
[0281] TNF-alpha enhances the proliferation of T-cells induced by various stimuli in the absence of IL2. Some subpopulations of T-cells only respond to IL2 in the presence of TNF-alpha. In The presence of IL2 TNF-alpha promotes the proliferation and differentiation of B-cells.
[0282] The functional capacities of skin Langerhans cells are also influenced by TNF-alpha. These cells are not capable of initiating primary immune responses such as contact sensibilisation. They are converted into immunostimulatory dendritic cells by GM-CSF and also IL1. These cells therefore are a reservoir for immunologically immature lymphoid dendritic cells. The enhanced ability of maturated Langerhans cells to process antigens is significantly reduced by TNF-alpha.
[0283] Although TNF-alpha is also required for normal immune responses the overexpression has severe pathological consequences. TNF-alpha is the major mediator of cachexia observed in tumor patients (hence its name, cachectin). TNF is also responsible for some of the severe effects during Gram-negative sepsis.
[0284] TNF-alpha can be detected in bioassays involving cell lines that respond to it (e.g., BT-20, CT6, EL4; PK15; L929; L-M; M07E; T1165; WEHI-3B). TNF-alpha can be detected also by a sensitive sandwich enzyme immunoassay, ELISA, an immunoradiometric assay (IRMA), and by an assay designated RELAY (receptor-mediated label-transfer assay). Intracellular factor is detected by two color immunofluorescence flow cytometry. Higuchi et al have described an assay based on the release of tritiated thymidine from cells undergoing apoptosis after treatment with either TNF-alpha or TNF-beta. IFN-alpha, IFN-beta, IFN-gamma, TGF-beta, IL4, LIF and GM-CSF have been shown not to interfere with this assay.
[0285] In contrast to chemotherapeutic drugs TNF specifically attacks malignant cells. Extensive preclinical studies have documented a direct cytostatic and cytotoxic effect of TNF-alpha against subcutaneous human xenografts and lymph node metastases in nude mice, as well as a variety of immunomodulatory effects on various immune effector cells, including neutrophils, macrophages, and T-cells. Single- and multiple-dose phase I studies have confirmed that TNF can be administered safely to patients with advanced malignancies in a dose range associated with anticancer effect without concomitant serious toxicities such as shock and cachexia. However, clinical trials on the whole have unfortunately so far failed to demonstrate significant improvements in cancer treatment, with TNF-induced systemic toxicity being a major limitation for the use of TNF as an antineoplastic agent in most cases. The combined use of TNF and cytotoxic or immune modulatory agents, particularly IFN-gamma and possibly IL2, may be of advantage in the treatment of some tumors. In some cases intratumoral application of TNF has been found to be of advantage in tumor control.
[0286] Some mutant forms of TNF-beta with selective activity on the p55 receptor have been described recently. It has been shown that activation of the p55 receptor is sufficient to trigger cytotoxic activity towards transformed cells. Some of these mutants have been described to retain their antitumor activity in nude mice carrying transplanted human tumors.
[0287] TNF can also be used to increase the aggressiveness of lymphokine-activated killer cells. Studies with an experimental fibrosarcoma metastasis model have shown that TNF induces significant enhancement of the number of metastases in the lung. It has been suggested that low doses of endogenous TNF or administration of TNF during cytokine therapy may enhance the metastatic potential of circulating tumor cells. The transduction of murine tumor cells with a functional TNF-alpha gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts.
[0288] The interferons are a family of cytokines that induce a virus-nonspecific antiviral state in target cells. Binding of an interferon to its receptor induces new protein synthesis which, in turn, results in the inactivation of initiation factor eIF-2. The inactivation is thought to contribute to the antiviral state induced by the interferons. Interferons also induce pathways that activate intracellular endonucleases which degrade viral mRNA. Many interferons also possess immunomodulatory activities, such as activation of macrophages and lymphocytes. Examples of interferons include IFN-gamma (e.g. polypeptides encoded by Genbank Accession No. K01900, J00209, M12350, J00213, J00216, J00214, M11003, M11026, M34913, M54886, X01974, L38698, M13710, K01238, M13660, M68944, X01972, X01971, X01973, X01969), IFN-gamma (e.g. polypeptides encoded by Genbank Accession No.M28622, X14029, X14455, K00020, J00218, E00171, X04430, A09363, M27327, M16656, M25460, K03196), IFN-gamma e.g. polypeptides encoded by Genbank Accession No. A34532, X87308, E00756, K00083), IFN-gamma e.g. polypeptides encoded by Genbank Accession No. X58822, A12140), bovine trophoblast protein-1 (IFN-gamma) e.g. polypeptides encoded by Genbank Accession No. M31556, M31557, M31558), and their homologues among species. Human IFN-gamma and IFN-gamma are thought to bind to a common receptor (e.g. polypeptides encoded by Genbank Accession No. X60459, M89641) which is distinct from the receptor for IFN-gamma (e.g. polypeptides encoded by Genbank Accession No. J03143, M28233).
[0289] At least 23 different variants of IFN-alpha are known. The individual proteins have molecular masses between 19-26 kDa and consist of proteins with lengths of 156-166 and 172
[0290] amino acids. All IFN-alpha subtypes possess a common conserved sequence region between amino acid positions 115-151 while the amino-terminal ends are variable. Many IFN-alpha subtypes differ in their sequences at only one or two positions. Naturally occurring variants also include proteins truncated by 10 amino acids at the carboxy-terminal end. Disulfide bonds are formed between cysteines at positions 1/98 and 29/138. The disulfide bond 29/138 is essential for biological activity while the 1/98 bond can be reduces without affecting bioactivity.
[0291] Human IFN-beta is a glycoprotein (approximately 20% sugar moiety) of 20 kDa and has a length of 166 amino acids. Glycosylation is not required for biological activity in vitro. The protein contains a disulfide bond Cys31/141) required for biological activity. At the DNA level IFN-beta displays 34% sequence homology with IFN-beta-2 and approximately 30% homology with other IFN-alpha subtypes. In contrast to IFN-gamma IFN-beta is stable at pH2.
[0292] Human IFN-gamma is a dimeric protein with subunits of 146 amino acids. The protein is glycosylated at two sites. The pI is 8.3-8.5. IFN-gamma is synthesized as a precursor protein of 166 amino acids including a secretory signal sequence of 23 amino acids. Two molecular forms of the biologically active protein of 20 and 25 kDa have been described. Both of them are glycosylated at position 25. The 25 kDa form is also glycosylated at position 97. The observed differences of natural IFN-gamma with respect to molecular mass and charge are due to variable glycosylation patterns. 40-60 kDa forms observed under non-denaturing conditions are dimers and tetramers of IFN-gamma.
[0293] Members of the CSF family of cytokines allow the growth and differentiation of bone marrow cells immobilized on soft agar or methylcellulose. While hematopoietic progenitor cells can be maintained only for short periods of time in the absence of such factors, their presence allows the development of colonies containing erythroid cells, neutrophils, eosinophils, macrophages, and/or megakaryocytes, depending on the particular factor. The biochemical analysis of various activities stimulating colony formation supporting the growth and development of these cell types revealed that there existed many different and distinct factors of this sort.
[0294] Many of these factors are either N- or O-glycosylated. Glycosylation has been shown to enhance the solubility, stability and resistance to proteolytic enzymes. It does not appear to be required for the full spectrum of biological activities of these factors. The genes encoding many of the human colony stimulating factors have been cloned and mapped. Some of the genes are in close vicinity but they do not show great homology among each other with the exception of some conserved regions.
[0295] Colony stimulating factors are produced by many different cell types, including, for example, B-lymphocytes, epithelial cells, fibroblasts, endothelial cells, macrophages, Stromal cell line, T-lymphocytes. They are synthesized as precursor molecules containing a classical hydrophobic secretory signal sequence of approximately 25-32 amino acids. The secreted factors have an extremely high specific biological activity are active at very low concentrations (1-100 pM). These factors are absolutely required for the proliferation of hematopoietic progenitor cells. The concentrations required for mere maintenance of viability are usually orders of magnitude lower than those required to induce cell proliferation or to elicit specific functional activities of the cells.
[0296] The names of the individual factors usually indicate the cell types that respond to these factors. The classical colony stimulating factors include M-CSF (e.g. polypeptides encoded by Genbank Accession No. E03235, M64592, U22386, X05010) (macrophage-specific), G-CSF (granulocyte-specific), GM-CSF (macrophage/granulocyte-specific), IL3 (multifunctional) and MEG-CSF (e.g. polypeptides encoded by Genbank Accession No.D86370, U70136) (megakaryocyte-specific). G-CSF and M-CSF are lineage-specific while GM-CSF and IL3 are multifunctional hematopoietic growth factors acting on earlier stages of differentiation of hematopoietic progenitor cells.
[0297] Human GM-CSF is a monomeric protein of 127 amino acids with two glycosylation sites. The protein is synthesized as a precursor of 144 amino acids, which included a hydrophobic secretory signal sequence at the aminoterminal end. The sugar moiety is not required for the full spectrum of biological activities. Non-glycosylated and glycosylated GM-CSF show the same activities in vitro. Fully glycosylated GM-CSF is biologically more active in vivo than the non-glycosylated protein. The different molecular weight forms of GM-CSF (14 kDa, 35 kDa) described in the literature are the result of varying degrees of glycosylation. GM-CSF contains four cysteine residues (positions 54/96 and 88/121).
[0298] A comparison of the protein sequence of GM-CSF with those of the other colony stimulating factors reveals that they are not strongly homologous to each other. Human and murine GM-CSF display 60% homology at the protein level and 70% at the nucleotide level. The two factors do not, however, cross-react immunologically. GM-CSF can be associated with the extracellular matrix of cells as a complex with heparan sulfate proteoglycans. This allows storage of the factor in a biologically inactive form. The exact mechanism by which the factor is eventually released from these depots is not known.
[0299] The human gene has a length of approximately 2.5 kb and contains four exons. The distance between the GM-CSF gene and the IL3 gene is approximately 9 kb. The human GM-CSF gene maps to chromosome 5q22-31 in the vicinity of other genes encoding hematopoietic growth factors (M-CSF, IL3, IL4, IL5) and the gene encoding the M-CSF receptor. The 5′ region of the GM-CSF gene contains several sequence elements known as CLE (conserved lymphokine element). They function as binding sites for transcription factors, modulating the expression of the GM-CSF gene.
[0300] GM-CSF receptors are expressed at densities of several 100 to several 1000 copies/cell on the cell surface of myeloid cells. The receptor is expressed also on non-hematopoietic cells such as endothelial cells and small cell lung carcinoma cells. In receptor-positive cell lineages the receptor density decreases with increasing degrees of maturation.
[0301] The receptor shows significant homologies with other receptors for hematopoietic growth factors, including IL2-beta, IL3, IL6, IL7, Epo and the prolactin receptors. One cloned subunit of the GM-CSF receptor (GM-R alpha, 45 kDa) binds GM-CSF with low affinity (e.g. polypeptides encoded by Genbank Accession No. SEG_HUMGRAS). The second subunit (GM-R beta, 120 kDa) does not bind GM-CSF. GM-R alpha is a protein of 400 amino acids that contains only a short cytoplasmic domain of 54 amino acids. The high affinity GM-CSF receptor is formed by the aggregation of the two receptor subunits. The GM-R beta subunit of the receptor (e.g. polypeptides encoded by Genbank Accession No. SEG_MUSAIC2B, M59941) is also a constituent of other cytokine receptor systems. It is a component of the high affinity receptors for IL3 and IL5, both of which also contain a cytokine-specific subunit (AIC2A).
[0302] Human GM-CSF is not active on murine cells and vice versa. GM-CSF was isolated initially as a factor stimulating the growth of macrophage/granulocyte-containing colonies in soft agar cultures (colony formation assay). GM-CSF is indispensable for the growth and development of granulocyte and macrophage progenitor cells. It stimulates myeloblasts and monoblasts and triggers irreversible differentiation of these cells. GM-CSF synergises with Epo in the proliferation of erythroid and megakaryocytic progenitor cells. In combination with another colony stimulating factor, M-CSF, one observes the phenomenon of synergistic suppression, i.e., the combination of these two factors leads to a partial suppression of the generation of macrophage-containing cell colonies.
[0303] For some types of blast cells from patients with acute myeloid leukemia GM-CSF acts as an autocrine mediator of growth. GM-CSF is a strong chemoattractant for neutrophils. It enhances microbicidal activity, oxidative metabolism, and phagocytotic activity of neutrophils and macrophages. It also improves the cytotoxicity of these cells. GM-CSF displays a less pronounced specificity than, for example, G-CSF. It stimulates the proliferation and differentiation of neutrophilic, eosinophilic, and monocytic lineages. It also functionally activates the corresponding mature forms, enhancing, for example, the expression of certain cell surface adhesion proteins (CD-11A, CD-11C). The overexpression of these proteins could be one explanation for the observed local accumulation of granulocytes at sites of inflammation. In addition, GM-CSF also enhances expression of receptors for fMLP (Formyl-Met-Leu-Phe) which is a stimulator of neutrophil activity.
[0304] At pico to nanomolar concentrations GM-CSF is chemotactic for eosinophils and also influences the chemotactic behavior of these cells in response to other chemotactic factors.
[0305] In granulocytes GM-CSF stimulates the release of arachidonic acid metabolites and the increased generation of reactive oxygen species. The activation of the Na+/H+ antiport system leads to a rapid alkalization of the cytosol. Phagocytotic activities of neutrophil granulocytes and the cytotoxicity of eosinophils is also enhanced considerably by GM-CSF. Since GM-CSF is produced by cells (T-lymphocytes, tissue macrophages, endothelial cells, mast cells) present at sites of inflammatory responses it can be assumed that it is an important mediator for inflammatory reactions.
[0306] The functional state of Langerhans cells of the skin is also influenced by GM-CSF. These cells are not capable of initiating primary immune responses, for example, contact sensibilization. They are converted to highly potent immunostimulatory dendritic cells by GM-CSF (and also IL1). Langerhans cells therefore form an in situ reservoir for immunologically immature lymphoid dendritic cells. The maturation of these cells which is seen as an increased ability to process antigens, can be down-regulated by TNF-alpha.
[0307] At nanomolar concentrations GM-CSF induces the expression of complement C3a receptors on basophils. Cells which normally do not respond to C3a and which have been activated by GM-CSF degranulate in response to the C3a stimulus. This is accompanied by the release of histamine and leukotriene C4. This process may be of significance in hypersensitivity reactions associated with inflammatory responses (T-lymphocytes, tissue macrophages, endothelial cells, mast cells). GM-CSF has been shown also to be a potent inducer of trophoblast interferon (TP-1).
[0308] GM-CSF synergises with some other cytokines, including IL1, IL3 and G-CSF. GM-CSF and G-CSF must act in concert to allow the development of neutrophil-containing colonies in vitro.
[0309] IL3 by itself only negligibly expands the number of circulating blood cells; a subsequent dose of GM-CSF, however, significantly increases cell numbers, probably because IL3 first leads to an expansion of those cells capable of responding to GM-CSF.
[0310] The observations that most IL3-dependent cell lines can also grow in the presence of GM-CSF and IL4 and that several synergistic effects are observed between GM-CSF and IL4 suggest that these three factors perform similar functions in controlling the growth of cells. There are some indications that the mechanism of signal transduction contains at least some common factors.
[0311] Experiments with tyrosine-specific protein kinases encoded by an oncogene have shown that the expression of this kinase activity in factor-dependent cells abolishes their dependence on GM-CSF, IL3 and IL4. The exact mechanism by which these factors regulate the proliferation and differentiation of cells is still unknown.
[0312] The consequences of a deregulated expression of GM-CSF have been studied in transgenic mice harboring a constitutively expressed GM-CSF gene. The overexpression of the transgene encoding GM-CSF leads to pathological alterations in the retina and causes blindness and also causes muscle deterioration. These mice are characterized by a very pronounced increase in activated macrophages. In addition, the overexpression of GM-CSF leads to the activation of mature macrophages secreting large amounts of IL1 and TNF, suggesting that these cytokines may be responsible for some aspects of the transgenic mouse disease.
[0313] Histopathological examination demonstrates a pronounced increase in the progenitor cell population of the monocytic lineage. GM-CSF-transgenic animals usually die within months from the massive tissue damage resulting from the overexpression of these factors. Similar results have been obtained with mice possessing a bone marrow manipulated to overexpress GM-CSF by transformation with suitable retrovirus vectors. These findings do not seem to be of clinical significance, though. The long-term treatment of primates and mice with GM-CSF has shown that life-threatening complications do not occur.
[0314] The biological consequences of GM-CSF gene disruption have been studied in mice generated from ES cells carrying a targeted deletion of the gene. Mice homozygous for a targeted disruption of the GM-CSF gene are characterized by an unimpaired steady-state hematopoiesis, demonstrating that GM-CSF is not essential for maintaining normal levels of the major types of mature hematopoietic cells and their precursors in blood, marrow, and spleen.
[0315] Most GM-CSF-deficient mice are superficially healthy and fertile but develop abnormal lungs. GM-CSF-deficient mice develop a progressive accumulation of surfactant lipids and proteins in the alveolar space, the defining characteristics of the idiopathic human disorder pulmonary alveolar proteinosis. Extensive lymphoid hyperplasia associated with lung airways and blood vessels is found also. These results demonstrate an unexpected, critical role for GM-CSF in pulmonary homeostasis.
[0316] Transgenic mice homozygous for null mutations of the gene encoding the common beta subunit (beta C) of the GM-CSF, IL3, and IL5 receptor complexes exhibit normal development and survive to young adult life. They develop pulmonary peribroncnovascular lymphoid infiltrates and areas resembling alveolar proteinosis. Eosinophil numbers in peripheral blood and bone marrow of homozygous deletion mutants are reduced, while other hematological parameters are normal. Bone marrow cells from homozygous deletion mutants do not show high-affinity binding of GM-CSF, while cells from heterozygous animals show an intermediate number of high-affinity receptors. In clonal cultures of bone marrow cells derived from homozygous deletion mutants, even high concentrations of GM-CSF and IL5 do not stimulate colony formation in the colony formation assay. Differences in the systemic clearance and distribution of GM-CSF between mutant and wild-type littermates are not observed.
[0317] Nishinakamura et al have crossed beta-c mutant mice with mice deficient for IL3. The double-mutant mice lacking all IL3, GM-CSF, and IL5 functions are apparently normally fertile. The animals show the same reduced numbers of eosinophils and a lack of eosinophilic response to parasites as beta-c mutant mice. The immune response of the double mutant mice to Listeria monocytogenes is normal. Hematopoietic recovery after treatment with fluorouracil is also normal. These findings suggest the existence of alternative mechanism to produce blood cells that do not depend on the presence of IL3, GM-CSF, and IL5.
[0318] GM-CSF can be assayed in a colony formation assay by the development of colonies containing macrophages, neutrophils, eosinophils, and megakaryocytes. GM-CSF is also detected in specific bioassays with cells lines that depend in their growth on the presence of GM-CSF or that respond to this factor (e.g., AML-193; B6SUt-A; BAC1.2F5; BCL1; Da; FDCP1; GF-D8; GM/SO; IC-2; M07E; NFS-60; PT-18; TALL-103; TF-1; UT-7).
[0319] GM-CSF can be employed for the physiological reconstitution of hematopoiesis in all diseases characterized either by an aberrant maturation of blood cells or by a reduced production of leukocytes. The main and most important clinical application of GM-CSF is probably the treatment of life-threatening neutropenia following chemo and/or radiotherapy, which is markedly reduced under GM-CSF treatment. GM-CSF can be used also to correct chemotherapy-induced cytopenias and to counteract cytopenia-related predisposition to infections and hemorrhages.
[0320] In order to avoid potential complications following the administration of GM-CSF careful clinical monitoring is required in certain patient groups, for example those with myelodysplastic syndrome, acute myeloid leukemia, inflammatory disease, autoimmune thrombocytopenia or malfunctional immunological responsiveness.
[0321] Several studies have demonstrated that the use of GM-CSF enhances tolerance to cytotoxic drug treatment and can be used to prevent dose reductions necessitated by the side effects of cytotoxic drug treatment. GM-CSF treatment frequently permits to increase the doses of cytotoxic drugs per course. These studies have also revealed a significantly reduced morbidity under GM-CSF treatment.
[0322] The transduction of murine tumor cells with a functional GM-CSF gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts. Moreover, vaccination with GM-CSF transduced tumor cells prevents growth of a subsequent inoculum of wild-type syngeneic tumor cells.
[0323] The chemokine family of cytokines consists of relatively small, structurally similar polypeptides that induce chemotaxis in leukocytes. Chemokines have molecular masses of 8-10 kDa and show approximately 20-50% sequence homology among each other at the protein level. The proteins also share common gene structures and tertiary structures. All chemokines possess a number of conserved cysteine residues involved in intramolecular disulfide bond formation.
[0324] According to the chromosomal locations of individual genes two different subfamilies of chemokines are distinguished. Members of the alpha-chemokines are referred to also as the 4q chemokine family because the genes encoding members of this family map to human chromosome 4q12-21. The first two cysteine residues of members of this family are separated by a single amino acids and these proteins, therefore, are called also C-X-C chemokines. This subfamily includes 9E3 (e.g. Genbank protein P08317), AMCF (e.g. polypeptides encoded by Genbank Accession No. M99367, M99368), beta-thromboglobulin (e.g. as disclosed in Begg G S et al (1978), Biochemistry 17: 1739-44), CINC family members (e.g. polypeptides encoded by Genbank Accession No. D21095), ENA-78 (e.g. polypeptides encoded by Genbank Accession No. X78686), eotaxin (e.g. polypeptides encoded by Genbank Accession No. U46572, U40672), GCP-2 (e.g. polypeptides encoded by Genbank Accession No. Y08770, U83303), IL8, IP-10 (e.g. polypeptides encoded by Genbank Accession No. L07417, X02530), KC (e.g. polypeptides encoded by Genbank Accession No. J04596), LIX (e.g. polypeptides encoded by Genbank Accession No. U27267), mig (e.g. polypeptides encoded by Genbank Accession No. M34815, Z24725), MGSA (e.g. polypeptides encoded by Genbank Accession No. X12510), mob-1 (e.g. polypeptides encoded by Genbank Accession No. U17035), NAP-2 (as described in Clark-Lewis I et al (1991) Biochemistry 30: 3128-35, Cohen A B et al (1992) American Journal of Physiology 263: L249-56), NAP-3 (as described in: Schröder J M et al (1991) Journal of Experimental Medicine 171: 1091-100), NAP-4 (as described in Schröder T M et al (1990) Biochemical zui Biophysical Research Communications 172: 898-904), PBSF (SDF) (e.g. polypeptides encoded by Genbank Accession No. D21072, U16752, D50645), and PF4 (e.g. polypeptides encoded by Genbank Accession No. M25897).
[0325] IL8, MGSA, mouse KC, MIP-2 (e.g. polypeptides encoded by Genbank Accession No. X65647 and as described in Blum S et al Three human homologues of a murine gene encoding an inhibitor of stem cell proliferation. DNA Cell Biol. 9: 589-602 (1990); Clements J M et al Biological and structural properties of MIP-1 alpha expressed in yeast. Cytokine 4: 76-82 (1992); Devatelis G et al Cloning and characterization of a cDNA for murine macrophage inflammatory protein (MIP), a novel monokine with inflammatory and chemokinetic properties. Journal of Experimental Medicine 167: 1939-44 (1988) (erratum in JEM 170: 2189 (1989)); Farber J M A macrophage mRNA selectively induced by gamma-interferon encodes a member of the platelet factor 4 family of cytokines. Proceedings of the National Academy of Science (USA) 87: 5238-42 (1990); Haskill S et al Identification of three related human GRO genes encoding cytokine functions. Proceedings of the National Academy of Science (USA) 87: 7732-6 (1990); Poltorak A N et al (1995) Journal of Inflammation 45(3): 207-19; Rossi D L et al (1997) Journal of Immunology 158(3): 1033-1036; Sherry B et al (1988) Journal of Experimental Medicine 168: 2251-9; Tekamp-Olson P et al (1990) Journal of Experimental Medicine 172: 911-9; Wolpe S D et al (1989) Proceedings of the National Academy of Science (USA) 86: 612-16; Wolpe S D et al (1989) FASEB Journal 3: 2565-73), NAP-2, ENA-78, and GCP-2 comprise a subgroup of the human C-X-C-chemokines defined by the conserved ELR sequence motif (glutamic acid-leucine-arginine) immediately preceding the first cysteine residue near the amino-terminal end. Chemokines with an ELR sequence motif have been found to chemoattract and activate primarily neutrophils. Chemokines without the ELR sequence motif appear to chemoattract and activate monocytes, dendritic cells, T-cells, NK-cells, B-lymphocytes, basophils, and eosinophils.
[0326] Members of the beta-chemokines or 17q chemokine family map to human chromosome 17q11-32 (murine chromosomel 1). The first two cysteine residues are adjacent and, therefore, these proteins are called also C-C chemokines. This subfamily includes ACT-2 (e.g. polypeptides encoded by Genbank Accession No. J04130), CdO (e.g. as described in Berger M S et al (1993) DNA Cell Biol. 12: 839-47. Berger M S et al (1996) &dgr;: 439-447), CCF18 (e.g. as described in Hara T et al (1995) Journal of Immunology 155: 5352-8), DC-CK1 (e.g. as described in Adema G J et al (1997) Nature 387: 713-717), ELC (e.g. polypeptides encoded by Genbank Accession No. AB000887, AF059208), Eotaxin-2 (e.g. as described in Forssmann U et al (1997) Journal of Experimental Medicine 185: 2171-2176), Exodus (e.g. polypeptides encoded by Genbank Accession No. U64197, U88320, U88321, U88322), FIC (e.g. polypeptides encoded by Genbank Accession No. L04694), GDCF and GDCF-2 (e.g. as described in Kuratsu J et al (1989) Journal of the National Cancer Institute 81: 347-51; Yoshimura T et al (1989) Journal of Experimental Medicine 169: 1449-59; Yoshimura T et al (1989) Journal of Immunology 142: 1956-62), HC-21 (e.g. as described in Chang H C & Reinherz E L (1989) European Journal of Immunology 19:1045-1051), HCC-1 (e.g. polypeptides encoded by Genbank Accession No. Z49270), I-309 (e.g. polypeptides encoded by Genbank Accession No. M57502), JE (e.g. polypeptides encoded by Genbank Accession No. AF058786, M28226), LAG-1 (lymphocyte activation gene-1) (e.g. polypeptides encoded by Genbank Accession No. X53683), LARC D86955), LD78 E03130, E03131, MARC (e.g. as described in Thirion S et al (1994) Biochemical and Biophysical Research Communications 201: 493-499), MCAF M24545 and as described in Apella E et al (1990) Progress in Clinical and Biological Research 349: 405-17), MCP-1 (e.g. polypeptides encoded by Genbank Accession No. X14768), MCP-2 (e.g. polypeptides encoded by Genbank Accession No. Y16645), MCP-3 (e.g. polypeptides encoded by Genbank Accession No. X72308, S71251), MCP-4 (e.g. polypeptides encoded by Genbank Accession No. X98306), MCP-5 (e.g. polypeptides encoded by Genbank Accession No. U50712), MIP (macrophage inflammatory protein) (e.g. polypeptides encoded by Genbank Accession No. U77180, U77035, U49513, M35590), MRP-2 (e.g. as described in Youn B S et al (1995) Journal of Immunology 155: 2661-7), RANTES SDF (e.g. polypeptides encoded by Genbank Accession No. M21121, M77747), TARC (e.g Genbank protein Accession No. Q92583).
[0327] In addition there are several other factors that are related to chemokines but that either have not been assigned yet to one of the two chemokine groups or that do not possess the classical features of either of the two chemokine groups (for example, ATAC (e.g. polypeptides encoded by Genbank Accession No. X86474), Ltn (e.g. polypeptides encoded by Genbank Accession No. U15607, U23772), SCM-1 (e.g. polypeptides encoded by Genbank Accession No. D63789, D637090, D43769). These have been referred to as C-type chemokines or gamma-chemokines.
[0328] Yet another group of chemokines has been identified that comprises neurotactin (e.g. polypeptides encoded by Genbank Accession No. AF010586, which is characterized by a CX(3)C cysteine signature motif. The existence of clearly defined subgroups of chemokines on the basis of structural and functional properties illustrates the importance of chemoattractant diversity in the regulation of leukocyte movement through the body.
[0329] The biological activities of chemokines are mediated by specific receptors and also by receptors with overlapping ligand specificities that bind several of these proteins which always belong either to the C-C-chemokines or the group of C-X-C-chemokines. Chemokine receptors belong to the large group of G-protein-coupled seven transmembrane domain receptors which contain seven hydrophobic alpha-helical segments that transverse the membrane. These receptors form a structurally related group within the superfamily of G-protein-coupled receptors which mediate signalling via heterotrimeric G-proteins.
[0330] The receptors that bind C-X-C chemokines are designated CXCR followed by a number (e.g., CXCR-1 (e.g. polypeptides encoded by Genbank Accession No. L19591), CXCR-2 (e.g. polypeptides encoded by Genbank Accession No. M94582), CXCR-3 (e.g. polypeptides encoded by Genbank Accession No. X95876), CXCR-4 (e.g. polypeptides encoded by Genbank Accession No. D87747, AF025375) while those binding C-C chemokines are designated CCR followed by a number (e.g., CCR-1 (e.g. polypeptides encoded by Genbank Accession No.L09230, U29678), CCR-2 (e.g. polypeptides encoded by Genbank Accession No. U29677, U95626), CCR-3 (e.g. polypeptides encoded by Genbank Accession No. U51241), CCR-4 (e.g. polypeptides encoded by Genbank Accession No. X90862, X85740), CCR-5 (e.g. polypeptides encoded by Genbank Accession No. U54994, U83327), CCR-6 (e.g. polypeptides encoded by Genbank Accession No. U95626), CCR-7 (e.g. polypeptides encoded by Genbank Accession No. L31581), CCR-8 (e.g. polypeptides encoded by Genbank Accession No. Z98206, U45983). Viral chemokine receptor homologues include ECRF-3, EBI-1 (EBV-induced gene-1), and US28.
[0331] It is now assumed that the combinatorial effects of multiple chemokines and other mediators are responsible for the cellular composition at inflammatory sites. In addition, many chemokines also directly activate cells. Some of them activate granulocytes and/or monocytes and cause respiratory bursts, degranulation, and the release of lysosomal enzymes. Others prime immune cells to respond to sub-optimal amounts of other inflammatory mediators. Yet others have been shown to be potent histamine releasing factors for basophils. It has been proposed that erythrocytes through their promiscuous chemokine receptor play an important role in regulating the chemokine network. Chemokines bound to the erythrocyte receptor are known to be inaccessible to their normal target cells. This appears to provide a sink for superfluous chemokines and may serve to limit the systemic effects of these mediators without disrupting localized processes taking place at the site of inflammation.
[0332] Certain C-C chemokines exhibit biological activities other than mere chemotaxis. Some chemokines have been shown to be capable of inducing the proliferation and activation of killer cells known as CHAK (C-C-chemokine-activated killer), which are similar to cells activated by IL2.
[0333] Another particularly useful cytokine according to the invention is flt-3 ligand (e.g., polypeptides encoded by Genbank Accession Nos. U04806, U04807, U03858, L23636, U29874, U29875, U44024). This cytokine binds to the flt-3 tyrosine kinase (e.g., polypeptides encoded by Genbank Accession Nos. Z26652, X59398). The human flt-3 ligand also stimulates the proliferation of cells expressing murine flt-3 receptors.
[0334] The effects of flt-3 ligand are synergized by coexpression of G-C SF, GM-C SF, M-CSF, IL3, PIXY-321, and SCF. In combination with SCF and IL3 flt-3 ligand can cause expansion of cells with the marker spectrum CD34 (+)CD38 (−). Alone flt-3 ligand supports the survival of precursor cell types in the lineage of blood-forming cells such as CFU-GM, CFU-GEMM, and the very primitive high proliferative potential colony-forming cells. flt-3 ligand only has marginal effects on erythroid and megakaryocyte progenitor cells.
[0335] In the mouse, flt-3 ligand potently enhances growth of various types of progenitor/precursor cells in synergy with G-CSF, GM-CSF, M-CSF, IL3, IL6, IL7, IL11, IL12 and SCF. flt-3 ligand supports growth of LTC-IC (long-term culture-initiating cells). The ability of flt-3 ligand to promote the survival of hematopoietic progenitor cells is abrogated by TGF-beta and counteracted by TNF-alpha.
[0336] A study of the expression of functional flt-3 receptor and the responses to the ligand in AML (acute myeloid leukemia) and ALL (acute lymphoblastic leukemia) shows a considerable heterogeneity. BCP-ALL in particular fails to proliferate in the presence of flt-3 ligand despite strong expression of surface flt-3 receptor.
[0337] It has been shown that in patients with aplastic anemia and in cancer patients with chemotherapy-induced transient suppression of hematopoiesis, serum levels of flt-3 ligand fluctuate in an inverse relationship to the degree of bone marrow failure. flt-3 ligand levels in serum inversely correlate with the colony forming ability in vitro of bone marrow precursors from patients with aplastic anemia. flt-3 ligand treatment of mice challenged with syngeneic fibrosarcoma cells has been shown to result in complete tumor regression and in decreased tumor growth rates.
[0338] Antitumor cytokines are especially useful in the methods and compositions of the invention. According to the invention, an “antitumor cytokine” is a cytokine that can limit the growth or metastasis of tumor cells in vitro or in vivo, or can prolong the survival of a tumor-bearing animal, when either admixed with the cells or administered to the animal. The cytokine can be formulated as a solution in a biologically compatible buffer, e.g. PBS, and admixed with tumor cells in vitro. The concentration of cytokine may be from about the picomolar range to about the micromolar range. An antitumor cytokine will, for example, reduce the growth rate of the cells, e.g. by at least 10% compared to buffer alone, or inhibit metastatic properties of the cells, as may be evidenced by, e.g., increased cell adhesiveness or decreased ability to invade an extracellular matrix substrate, such as an artificial basement membrane. Alternatively, an antitumor cytokine may inhibit the growth or metastasis of a tumor in vivo, or may prolong the survival of a tumor-bearing animal. To evaluate the in vivo antitumor effects of a cytokine, the cytokine may be formulated in a pharmaceutically acceptable carrier and administered, e.g., by intravenous, intratumoral, or intraperitoneal injection. The cytokine may also be administered in association with cells, such as tumor cells that express or are coated with the cytokine.
[0339] Assays for Bioactivity
[0340] According to the invention, it is preferred that a cytokine be “bioactive”, “highly bioactive”, “extremely bioactive”, “natively bioactive”, or “suprabioactive”. Different levels of bioactivity relate to the ability to induce a change in a leukocyte (other than mere occupancy of the leukocyte's receptors for the cytokine). According to the invention, all naturally occuring cytokines are natively bioactive. Many types of assay can demonstrate the bioactivity of a non-naturally occurring cytokine. For example, a cytokine may be shown to induce survival and/or proliferation of a particular cell type. As another example, a cytokine may change the concentration of an intracellular second messenger, such as cAMP, arachidonic acid, calcium ions, or inositol triphosphate. The following are examples of assays for bioactivity:
[0341] Assay 1
[0342] Each well of one or more 60-well Lux microtiter trays is loaded with 200 FDC-P1 cells in 10 ul Dulbecco's modified Eagle's medium with a final concentration of 10% newborn calf serum. Cytokine in a concentration in at most the micromolar range is added to each well in a volume of 5 ul. The tray is incubated for 48 h at 37° C. in 10% CO2. Viable cell counts are performed. The average number of viable cells/well is counted. This assay is useful, for example, for identifying bioactivity mediated through a murine GM-CSF receptor.
[0343] Assay 2
[0344] Cytokine sample and a recombinant standard identical to a naturally occurring cytokine are each diluted serially in complete RPM1-10 in 96-well flat-bottom microtiter plates. Each dilution is plated in triplicate. CT.4S cells in active log-phase growth are collected, washed at least twice in complete RPM1-10, and resuspended in complete RPM1-10 at 1×105 cells/ml. 50 ul of the cell suspension is added to each well of the plate, which is then incubated for 24 h at 37° C. in 5% CO2 Tritiated thymidine is added to each well and the plate is incubated for an additional 24 h. The cells are then harvested and tritium incorporation is measured by liquid scintillation counting. This assay is useful, for example, for identifying bioactivity mediated through an IL-4 receptor.
[0345] Assay 3 (Colony Formation Assay)
[0346] Agar (4% w/v) is melted in sterile water by boiling 3 min. The agar is then cooled to 42° C. and added to 42° C. RPM1-15 to a final concentration of 0.4%. The solution is maintained at 42° C. Femurs are removed from young mice using sterile technique. Marrow is collected by flushing the opened ends of the bones with sterile Hank's Balanced Salt Solution (HBSS) using a syringe equipped with a 23G needle. Marrow is placed in a 15 ml tissue culture tube and vortexed into a cell suspension. Bone fragments are allowed to settle for 5 min, and the supernatant suspension is removed. The suspension is adjusted to 7.5×106 nucleated cells/ml and diluted 1:100 by adding the 42° C. RPMI with 0.4% agar. 2-fold serial dilutions of cytokine are added to 35 mm tissue culture dishes in a volume<=0.2 ml. Control dishes have no cytokine added. 1 ml warm cell suspension is added to each dish and the agar is allowed to set at room temperature. The cultures are incubated for 5-7 days at 37° C. in 5% CO2. Colony formation is then evaluated by microscopy. The average number of colonies of a given type (or aggregate number of colonies of given different types) on the cytokine plates and the average number on the control plates is counted. This assay is useful, for example, for identifying bioactivity mediated through CSF receptors.
[0347] Assay 4
[0348] Cytokine is diluted serially in RPMI 1640/25 mM HEPES/1% BSA. 25 ul of each dilution is plated in triplicate in a multiwell chemotaxis chamber bottom. Wells containing medium alone serve as negative controls and wells containing chemotaxis-inducing naturally occurring cytokine serve as positive controls. A polycarbonate membrane is placed over the chamber bottom and the chamber is assembled. 50 ul of peripheral blood mononuclear cells at 1.5×106 cells/ml in the RPMI/HEPES/BSA is added to each of the upper wells of the chamber. The chamber is incubated for 90 min at 37° C. in 5% CO2. The membrane is removed, washed, and stained. Migrated cells in 3-5 random fields of each well are counted by microscopy.
[0349] Assay 5
[0350] Naturally-occurring cytokine reference standard is diluted to 2 ng/ml in a 17×100 mm tube using supplemented medium. 3 further 5-fold serial dilutions are also prepared. Serial dilutions of cytokine are prepared in 17×100 mm tubes from 2 ng/ml to 20 pg/ml. 50 ul of PHA-activated human lymphoblasts 4×105 cells/ml in supplemental medium is added to each well of a 96-well flat-bottom microtiter plate. 50 ul of each dilution of reference standard or cytokine is added to triplicate wells. Negative control wells receive 50 ul of supplemented media alone. The plate is incubated for 48 h at 37° C. in 5% CO2 and the cells are labeled with tritiated thymidine. Incorporation is measured by liquid scintillation counting. This assay is useful, for example, for identifying bioactivity mediated through an IL-12 receptor.
[0351] Assay 6
[0352] In another assay for bioactivity, an immunocompetent animal is vaccinated with on the order of 104-108 irradiated cytokine-transduced or cytokine-coated tumor cells, and challenged with on the order of 104-108 live wild-type tumor cells (in any temporal sequence). Readouts of the assay are survival, tumor onset, or number of metastases.
[0353] Further examples of cytokine assays can be found, e.g., in: Callard R E et al Assay for human B cell growth and differentiation factors. in: Clemens M J et al (eds) Lymphokines and Interferons. A practical Approach, pp. 345-64, IRL Press, Oxford 1987; Coligan J E et al Current protocols in immunology. Grene and Wiley-Interscience, New York 1991); Dotsika E N Assays for mediators affecting cellular immune functions. Current Opinion in Immunology 2: 932-5 (1989); Feldmann M et al Cytokine assays: role in evaluation of the pathogenesis of autoimmunity. Immunological Reviews 119: 105-123 (1991); Guiguet M et al Misinterpretation of the biological activity of cytokine-containing preparations attributable to unrecognized interacting components. Analytical Biochemistry 247(2): 441-442 (1997); Hamblin A S & O'Garra A Assays for interleukins and other related factors. In: Lymphocytes, a practical approach, Klaus G G B (edt), pp. 209-28, IRL Press, Oxford, (1987); Laska E M & Meisner M J Statistical methods and applications of bioassay. Annu. Rev. Pharmacol. Toxicol. 27: 385-97 (1987); Mosman T R & Fong T A T Specific assays for cytokine production by T cells Journal of Immunological Methods 116: 151-8 (1989); Newton R C & Uhl J Assays relevant to the detection and quantitation of cytokines and their inhibitors. Modem Methods in Pharmacol. 5: 83-99 (1989); Thorpe R et al Detection and measurement of cytokines. Blood Rev. 6: 133-48 (1992); van Zoelen E J The use of biological assays for detection of polypeptide growth factors. Progress in Growth Factor Research 2: 131-52 (1990); Winstanley F P Cytokine bioassay. In: Gallagher G et al (eds) Tumor Immunobiology, A practical Approach. Oxford University Press, pp. 179-303 (1993); Wadha M et al Quantitative biological assays for individual cytokines. In: Balkwill F R (edt) Cytokines, A practical approach. Oxford University press, pp. 309-330 (1991)
[0354] According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is at least 10% but not more than 29% (to the nearest 1%) of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “bioactive”. According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is at least 30% but not more than 49% (to the nearest 1%) of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “highly bioactive”. According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is at least 50% but not more than 69% (to the nearest 1%) of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “extremely bioactive”. According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is at least 70% but not more than 100% (to the nearest 1%) of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “natively bioactive”. According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is greater than 100% of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “suprabioactive”.
[0355] Ligands for CD40 Useful According to the Invention
[0356] Nucleotide sequences encoding the CD40 proteins of various species are provided by, e.g. Genbank Accession Nos. Y10507, M83312, and U57745. Human CD40 is a transmembrane glycoprotein with a length of 277 amino acids (48 kDa). CD40 is a phosphoprotein and can be expressed as a homodimer. A soluble form of CD40 (28 kDa) has also been described. CD40 protein is expressed on all B-lymphocytes during various stages of development, activated T-cells and monocytes, follicular dendritic cells, thymic epithelial cells, and various carcinoma cell lines. It is expressed on most mature B-cell malignancies and on some early B-cell acute lymphocytic leukemias. CD40 has been demonstrated on the majority of myeloma cell lines and myeloma cells from patients with plasma cell dyscrasia.
[0357] Induction of CD40 mRNA and enhancement of cell surface protein expression in primary human monocytes is observed after treatment with GM-CSF, IL3, or IFN-gamma. The human CD40 gene maps to chromosome 20.
[0358] CD40 has been proposed to play a role in the development of memory cells. It also plays a role in cell activation, functioning as a competence factor and progression factor. Crosslinking of the CD40 antigen (in combination with cytokines such as IL4 and IL5) leads to B-cell proliferation and induces immunoglobulin class switching from IgM to the synthesis of IgG, IgA, and IgE in the absence of activated T-cells. CD40 is one of the obligatory signals required for commitment of naive B-cells to IgA secretion; the mechanism of IgA induction requires the cooperation of IL10 and TGF-beta. Soluble CD40 inhibits T-cell-dependent B-cell proliferation.
[0359] Monoclonal antibodies against CD40 mediate a variety of effects on B-lymphocytes, including induction of intercellular adhesion (via CD11a/CD18 (LFA-1)), short- and long-term proliferation, differentiation and enhanced tyrosine phosphorylation of proteins. Germinal center centrocytes are prevented from undergoing cell death by apoptosis by activation through CD40 and antigen receptors.
[0360] In human resting B-cells expression of CD40 is induced by IL4. Treatment of human B-cells with IL6 leads to the phosphorylation of the intracellular CD40 domain. CD40 does not, however, function as a receptor for IL6. In activated human B-cells the synthesis of IL6 is induced by treatment of the cells with monoclonal antibodies directed against CD40, suggesting that CD40 participates in signal transduction mechanisms dependent on IL6.
[0361] Some limited sequence homologies have been found with receptors for Nerve Growth Factor, TNF-alpha and CD27 and it has been assumed that CD40 may be involved also in modulating the biological activity of these and other cytokines.
[0362] CD40 has biological functions also in non-immune cells although these are still largely unknown. CD40 ligation has been shown to induce cell death by apotosis in transformed cells of mesenchymai and epithelial origin. In part these processes are mediated through the death domain present in the cytoplasmic domain of CD40.
[0363] A particularly useful ligand for CD40 is CD154. CD154 (“CD40 ligand”; human protein 29.3 kDa, 261 amino acids) is a member of the TNF family of proteins. The human protein shows 82.8% and 77.4% identity at the cDNA and protein level, respectively, with a similar protein isolated from murine EL4 thymoma cells. Both proteins are the ligands for the CD40 cell surface antigen expressed on resting B-cells. The human gene encoding CD154 maps to chromosome Xq26.3-q27. Nucleotide sequences encoding the native CD40 ligands of various species are provided by, e.g., Genbank Accession Nos. X67878, X96710, X68550, X65453, Z48469, and L07414. Amino acid sequences of the CD154 molecules of various species are provided, e.g., by Entrez protein database Accession Nos. 1705713, 231718, 560693, 3047129, 116000, 1518170, 38412, 109639, 1083014, 38484, and 37270.
[0364] CD154 is naturally synthesized as a transmembrane polypeptide. Nevertheless, a biologically active soluble fragment of human CD154 has been described (Pietravalle et al, 1996, J Biol Chem 271:5965-5967.) Mazzei et al (1995, J Biol Chem 270:7025-7028) identified a biologically active soluble fragment of CD154 as a homotrimer of polypeptides consisting of amino acids Glu 108 through Leu 261 of intact transmembrane CD154. Graf et al (1995, Eur J Immunol 25:1749) describe another active fragment consisting of the C-terminal fragment produced by proteolyttic cleavage at Met 113. Aruffo et al disclose soluble forms of CD154 and their use to stimulate B cells in vitro in U.S. Pat. No. 5,540,926. In the present invention, particularly useful ligands for CD40 include polypeptides that comprise a sequence as set forth in SEQ ID NO. 2 of the '926 patent, from amino acid residues 47 to 261. These residues are comprised by the extracellular domain of human CD154.
[0365] Another particularly useful type of ligand for CD40 is an antibody to CD40. Examples of such antibodies include the monoclonal antibodies designated product numbers MCA1143 and MCA1590 of Harlan Bioproducts for Science (Indianapolis, Ind.); monoclonal antibodies designated catalog numbers P61640F (produced by clone 14G7), P42374M (produced by clone MAB89), P61046M (produced by clone BL-C4), and P54486M (produced by clone B-B20) of Biodesign International (Kennebunk, Me.); monoclonal antibody designated catalog number 05-422 (produced by clone 626.1) of Upstate Biotechnology (Lake Placid, N.Y.); monoclonal antibody designated catalog number 3601 (produced by clone S2C6) of Mabtech (Nacka, Sweden); monoclonal antibodies designated catalog numbers RDI-CBL486 (produced by clone BB20), RDI-M1691clb (produced by clone CLB-14G7), RDI-mCD40-323 (produced by clone 3/23) of Research Diagnostics (Flanders, N.J.); monoclonal antibodies described in Schwabe et al, 1997, Hybridoma 16:217-226; monoclonal antibodies described in Bjorck et al, 1994, Immunology 83:430-437; monoclonal antibody G28-5 described by Ledbetter et al, 1994, Circ Shock 44:67-72; and monoclonal antibodies described in Buske et al, 1997, Exp Hematol 25:329-337.
[0366] Opsonins Useful According to the Invention
[0367] As defined hereinabove, “opsonin” refers to naturally occurring and non-naturally occurring molecules which bind to both antigens and antigen presenting cells (APCs), such as, for example, phagocytic leukocytes (including monocytes and macrophages), dendritic cells (for example, Langerhans cells of the skin), B lymphocytes and, in humans, endothelial cells, or molecules which can be processed such that at least one product of the processing step or steps can bind to both antigens and antigen presenting cells (APCs), such as, for example, phagocytic leukocytes, dendritic cells, B lymphocytes, and, in humans, endothelial cells.
[0368] Without being bound to any one mechanism of action, it is believed that opsonin-enhanced cells provide a beneficial effect according to the invention because the opsonin portion acts as a link or coupling agent between the antigen and the APC to allow more efficient binding, engulfment, and internalization of the antigen. In addition, the opsonin itself can be internalized with the antigen. “Internalization” refers to the cellular uptake of a molecule such that it is brought into the cytoplasm or a compartment within the cytoplasm of the cell. Phagocytosis is a process by which a molecule is internalized by a cell.
[0369] Preferred opsonins are non-rodent opsonins, e.g., primate, e.g., human, opsonins. Opsonins useful according to the invention bind to receptors on APCs (e.g., phagocytic leukocytes, e.g., macrophages and other cells of the phagocytic system) such as receptors on cells which play a role in innate immunity, as described herein.
[0370] Some sets of opsonins can be regarded as structurally and functionally similar. For example, one family comprises fragments of complement components C3 and C4. These two components are highly structurally homologous, and each possesses an intramolecular thiolester bond that is broken when a peptide (C3a or C4a respectively) is proteolytically cleaved from the native molecule. Disruption of the thiolester makes available a chemical structure that can form an ester linkage with an antigen. The moiety of C3 on which this ester bond resides, i.e. the non-C3a moiety, is designated C3b, and C4b is the analogous product of C4 cleavage. C3b can be further proteolysed by proteins such as factor I to yield fragments such as C3bi and C3d, which also remain linked to the antigen via the ester bond.
[0371] There are four structurally unique proteins that are known to function as high affinity receptors for biologically active, membrane-bound fragments of C3 and/or C4. CR1 is the major receptor for the C3b fragment of C3 and C4b fragment of C4. It is expressed on monocytes and monocyte-derived APCs, among other cell types. CR2 is the major receptor for the fragment of C3 known as C3d, and is expressed on, e.g., mature B lymphocytes, but not on cells of monocytic lineage. The major role of CR2 on B lymphocytes is believed to be direct costimulation of B cells in concert with their cognate antigens.
[0372] CR3 is expressed primarily by neutrophils and monocytes and is also expressed on FDC, Kupffer cells, and NK cells. CR3 is a C3 fragment receptor with a primary specificity for C3bi. CR3 has been proposed as an important organizer of cytoskeletal events necessary for adhesive interactions and membrane reorganization during processes such as phagocytosis.
[0373] CR4 is a member of the beta2 integrin family, and its alpha chain is structurally similar to the alpha chain of CR3 and LFA-1. Its primary physiologic ligands are believed to be C3d and C3d,g;, however, its biologic activities are less well understood than CR3.
[0374] Another example of a family of innate opsonins is the collectins, a group of collagenous C-type lectins that comprises complement component C1q, mannose binding protein, surfactant proteins A and D, and conglutinin. Each molecule comprises a lectin domain that can bind to an antigen, and a collagenous domain that can bind to receptors on phagocytic mononuclear cells, including receptors that are wholly or partially identical to the C1q receptor (Nepomuceno et al, Immunity 6:11'9-29; Tenner et al, Immunity 3:485-93; Guan et al, J Immunol 152:4005-16; Geertsma et al, Am J Physiol 267:L578-84; Miyamura et al, Biochem J 300:237-42; Malhotra et al, J Exp Med 172:955-9; Malhotra et al, Biochem J 293:15-19). Most known collectins comprise multiple polypeptide chains, in some cases homomeric and in others heteromeric, that are assembled post-translationally, in part by covalent cross-linkage of hydroxyproline and hydroxylysine residues. Collectins are demonstrated to be opsonins in, for example, Pikaar et al, J Infect Dis 172:481-9; Alvarez-Dominguez et al, Infection & Immunity 61:3664-72; Kuhlman et al, J Exp Med 169:1733-45; and Geertsma et al, op cit.
[0375] Among the other innate opsonins useful according to the invention are C-reactive protein (CRP), alpha-2 macroglobulin, and fibronectin. CRP, a member of the pentraxin family of molecules, binds to receptors on cells of monocytic lineage and has been shown to be an opsonin (Tebo and Mortenson, J Immunol 144:231-8; Holzer et al, J Immunol 133:1424-30). Alpha-2 macroglobulin, like C3 and C4, comprises an internal thiolester bond that can be disrupted when the molecule is proteolysed. Such disruption allows covalent binding of the molecule to an antigen, and binding of alpha-2 macroglobulin to an APC can promote uptake of the conjugate. Fibronectin binds to the alpha 5 beta 1 integrin and can also bind to various antigens, allowing it to function as an opsonin (Cosio, J Lab Clin Med 103:613-9; Czop and Austen, J Immunol 129:2678-81).
[0376] Immunoglobulins (antibodies) can function as opsonins by binding antigens via their variable regions and APCs via their constant regions. Typically, an immunoglobulin comprises two heavy chains which are covalently bound to each other and each of which is bound to one light chain. These heterotetramers can further assemble into higher-order structures, such as the pentamers of IgM. Both heavy and light chain variable regions can contribute to the structure of the antigen binding site, whereas the APC binding site is located on the heavy chain constant region. Recombinant single-chain antibodies have also been described. APC receptors for immunoglobulins include Fc alpha, Fc gamma, Fc epsilon, and Fc mu receptors for IgA, IgG, IgE, and IgM, respectively.
[0377] Opsonins that are naturally expressed by multicellular eukaryotic organisms are secreted. The latter characteristic distinguishes opsonins from adhesion molecules. A non-naturally occurring molecule containing a naturally occurring APC-binding moiety shall be considered an opsonin if it contains a moiety through which it can be stably bound or attached to a cell such that the APC-binding moiety is located in the extracellular space, whether or not the molecule contains an antigen-binding moiety of a naturally occurring antigen. Moieties through which molecules can be stably bound to a cell include crosslinking moieties, transmembrane sequences, and lipid moieties. The preparation of proteins containing these sequences or moieties is well-known to one of skill in the art.
[0378] An “APC binding moiety of an opsonin” is a sequence or domain of an opsonin which when included in a chimeric molecule permits binding of the chimeric molecule to a receptor that is physiologically expressed on an APC with an affinity at least in the nanomolar range.
[0379] There are a number of examples of opsonin fragments that comprise APC binding moieties. Such a fragment may be any length so long as it retains an APC binding function; for example, it may be about 40 amino acids, 100 amino acids, 150 amino acids, 500 amino acids, 800 amino acids, or even as long as 3000 amino acids. For example, Las Holtet et al, 1994, FEBS Lett 344:242 describe a carboxy-terminal fragment of human &agr;2m (val1299-ala1451) that binds with high affinity to the &agr;2m receptor. Fragments comprising amino acids 1314-1451 of human &agr;2m and the corresponding domain of rat &agr;2m also bind to &agr;2m receptors, albeit with 1-2% of the affinities of native &agr;2m (Van Leuven et al, 1986, J Biol Chem 261:11369; Enghild et al, 1989, Biochemistry 28:1406; Salvesen et al, 1992, FEBS Lett 313:198; Sottrup-Jensen et al, 1986, FEBS Lett 205:20).
[0380] Becherer and Lambris, 1988, J Biol Chem 263:14586 describe fragments of C3b that bind to CR1, e.g., C3c, fragments of C3 generated by elastase treatment and comprising the N-terminal of the alpha′ chain of C3b, and a synthetic peptide comprising the 42 N-terminal amino acids of the C3b alpha′ chain. A binding sequence in C3 for CR3 has also been described (Wright et al, 1987, PNAS 84:4235).
[0381] “Collagen stalks” of C1q, which are N-terminal fragments obtained by pepsin digestion, bind to the C1q receptor (Reid, 1981, Methods Enzymol 80:16; Malhotra et al, 1993, Biochem J 293:15). Malhotra et al, ibid., also provide evidence that an APC binding moiety of conglutinin is comprised by its 55 N-terminal amino acids. Ezekowitz (U.S. Pat. No. 5,270,199) offers a putative APC binding site in human mannose binding protein consisting of nucleotides 370-438 of FIG. 2in the '199 patent. In addition, by homology with conglutinin, exon 1 disclosed in the '199 patent may comprise an APC binding moiety.
[0382] An APC binding moiety of IgG comprises the CH2 domain and the lower hinge region, including residues 234-237, as described by Canfield and Morrison, 1991, J Exp Med 173:1483-91; Lund et al, 1991, J Immunol 147:2657-62; and Sarmay et al, 1992, Mol Immunol, 29:633-9.
[0383] Examples of opsonins which can be used in the compositions and methods of the invention include fibronectin (e.g., Genbank accessions X02761, K00799, K02273, X82402, X00307, X00739), CRP (e.g., Genbank accessions X17496, M11880, M11881, M11882), complement components such as C1q (e.g., Genbank accessions X66295, M22531, X03084, X58861, and Swiss-Prot accessions P02747, P02745), complement fragments such as C3b and C3d (e.g., Genbank accessions K02782, K02765), mannose binding protein (e.g., Genbank accessions S42292, S42294, X15422), conglutinin (e.g., Genbank accession X71774), alpha-2-macroglobulin (e.g., Genbank accessions M93264, M11313), and surfactant proteins A (e.g., Genbank accessions M68519, S48768) and D (e.g., Genbank accessions L40156, X65018, S38981), immunoglobulins, and their homologues among species. 6 TABLE 2 Exemplary Opsonin, APC binding moiety/APC receptor pairs useful according to the invention. Exemplary APC Binding Opsonin Moiety Receptor &agr;- Val(1299)-Ala(1451) of &agr;-2 m receptor, CD91 2 macroglobulin human &agr;-2 m C3b 42 N-terminal amino acids of CR1 the &agr;′ chain of human C3b C3bi C3bi CR2, CR3 C3d C3d CR2, CR4 Clq Collagen stalks Collectin receptor (Reid, 1981, Methods (Nepomuceno et al., Enzymol. 80:16) 1997, Immunity 6:119), CD93 Conglutinin 55 N-terminal amino acids of Collectin receptor bovine conglutinin MBP 1. Polypeptide encoded by nt Collectin receptor, 370-438 of FIG. 2, CD35, CD14 U.S. Pat. No. 5,270,199 2. Polypeptide encoded by Econ . . . I of FIG. 2, U.S. Pat. No. 5,270,199 CRP CRP CRP receptor, Fc&ggr;RI, Fc&ggr;RIIa (CD32) Fibronectin Fibronectin &agr;5b1 integrin IgG CH2 domain plus lower Fc&ggr;RI, Fc&ggr;RII, hinge including amino acids Fc&ggr;RIII 234-237, as described by Lund et al., 1991, J. Immunol. 147:2657 Surfactant Surfactant Protein A Collectin receptor, Protein A CD14 Surfactant Surfactant Protein D Protein D
[0384] Determination of Opsonicity According to the Invention
[0385] A given naturally occurring opsonin is considered useful according to the invention if it is determined to possess opsonicity according to one or more of the following assays, and if it is a secreted molecule.
[0386] Assay 1
[0387] In one assay of opsonicity, as described by O'Rear and Ross in Current Protocols in Immunology, 1994, John Wiley & Sons, pp. 13.4.5-9, SRBC bound via a physiologically occurring linkage to the candidate opsonin molecule are obtained. APCs from the species to which the candidate opsonin is native are suspended at 4×106/ml in ice-cold HBSS with 1% (w/v) Cohn fraction of BSA. If the candidate opsonin is a fragment of C3, the APCs are freshly drawn, uncultivated peripheral blood monocytes. SRBC linked to the candidate opsonin or control SRBC (identical to the former but not linked to the candidate opsonin) are suspended in the same solution at 2×108/ml. 100 ul of SRBC suspension and 100 ul of APC suspension are mixed in a 10×75 mm plastic tube. The tube is rotated at 40 rpm at 37° C. for 2-20 min. A small drop of the suspension is placed on a slide, covered with a coverslip, and allowed to stand for 5-10 min. Excess fluid can be removed by pressure on the coverslip, and the coverslip can be sealed to the slide, e.g. with clear nail polish. The slide is examined microscopically, and the percentage of APCs visibly adherent to 4 or more SRBCs is determined. If the percentage is 50% or greater when there are up to 4×104 candidate opsonin molecules/SRBC′, the candidate opsonin can be an opsonin.
[0388] Assay 2 (For Protease-Activated Candidate Opsonin)
[0389] Candidate opsonin or radiolabeled Candidate opsonin is treated with a 1.5-3 fold molar excess of protease (0.05 M triethanolamine-0.1 M NaCl, pH 8.0, room temperature overnight). In this assay, the protease can serve as the antigen or an excess of another antigen can be added. Prior to binding studies, the candidate opsonin-antigen complex is dialyzed against HBSS (4° C.).
[0390] Candidate opsonin-antigen complex binding to monocytes is measured by incubating labeled ligand at a concentration up to 1.0 M with (1.5-4.0)×106 monocytes in 200 ml volume on ice. Nonspecific binding of radiolabeled ligands is determined in the presence of a 100-fold molar excess labeled candidate opsonin-antigen complex. The unbound ligand is separated from the cells and cell-bound ligand by rapid vacuum filtration on glass fiber filters. Studies are performed on ice to avoid potential complications due to endocytosis. Binding constarts and the number of sites per cell are determined by analysis and by nonlinear curve fit. If candidate opsonin-antigen complex affinity for a monocyte binding site is in at least the nanomolar range, the candidate opsonin is an opsonin.
[0391] Assay 3
[0392] Part I
[0393] To directly evaluate whether candidate opsonin is bound to the surface of P. carinii, immunoelectron microscopy is performed. P. carinii are isolated from bronchoaveolar lavage (BAL) of moribund infected rats using TBS with 1 mM calcium to preserve surface-bound candidate opsonin. Isolated organisms are fixed in periodate-lysine-paraformaldehyde buffer and embedded in Lowacryl mounting medium (Ted Pella, Inc., Redding, Calif.). Ultrathin sections are obtained, blocked with normal goat serum (2%) for 1 h, and incubated with either rabbit anti-candidate opsonin or nonimmune rabbit IgG (25 mg/ml) overnight. After washing, the sections are subsequently incubated with goat and rabbit IgG conjugated to 15 nM colloidal gold (Amersham Corp., Arlington Heights, Ill.). The sections are washed again and examined on a transmission electron microscope (model 6400:JEOL USA, Inc., Peabody, Mass.).
[0394] Part II
[0395] The attachment of P. carinii to cultured alveolar macrophages in the presence or absence of antibody to the candidate opsonin or with the addition of purified candidate is quantified as follows. Adherence of P. carinii to alveolar macrophages is assayed by 51Cr-labeling the organisms. P. carinii are isolated from infected rats with TBS containing 1 mM calcium to prevent loss of surface-bound candidate opsonin. The organisms are radiolabeled by incubation for 8 h at 37° C. in 2 ml of DME containing 20% FCS and 200 mCi of 51Cr-sodium chromate (New England Nuclear). Normal alveolar macrophages are lavaged from healthy rats and plated in tissue culture plates (1×105) cells/well) which are been precoated with normal rat IgG (100 mg/ml×60 min) in order to ensure firm adherence of the macrophages. After 1 h, the macrophages are gently washed with HBSS to remove nonadherent cells. >95% of macrophages are adherent after this wash. 51Cr-P. carinii (1×106) containing surface-associated candidate opsonin are added to the macrophages and incubated at 37° C. for an additional hour. Subsequently, nonadherent P. carinii are removed by washing. The macrophage monolayers containing adherent P. carinii are solubilized in 1 N NaOH and quantified. Adherence of P. carinii is defined as: percentage of adherence=(A/A+B)×100, where A=51Cr-P. carinii associated with the monolayer, and B=unattached 51Cr-P. carinii. To assess the effect of candidate opsonin on the attachment of P. carinii to alveolar macrophage lung cells in culture, P. carinii adherence assays are conducted in the presence or absence of a polyclonal rabbit antibody generated against the candidate opsonin (100 mg/ml).
[0396] If candidate opsonin binding to P. carinii is apparent in Part I and if, in Part II, % adherence is diminished in the presence of anti-candidate opsonin with statistical significance of P<0.05, the candidate opsonin is an opsonin.
[0397] Assay 4
[0398] Association of bacteria with adherent monocytes is measured as follows. Endotoxin level in the modified PBS and in all buffers used is below 50 pg/ml as determined by the Limulus assay. 5×103 monocytes in modified PBS are allowed to adhere to the wells of a Terasaki plate for 2 h at 37° C. After nonadherent cells are removed by three washes with PBS, 5×104 FITC-labeled bacteria in 0.5 ml buffer with or without 10-50 micrograms/ml of candidate opsonin are added. A bacteria-to-monocyte ratio of 10:1 to 50:1 is used. After 30 min of incubation at 37° C. in the dark, the nonadherent bacteria are removed by five washes with warm PBS. Assays are performed in quadruplicate; in each well, the number of bacteria associated with 3 100 monocytes is counted under a flourescence microscope using ×400 magnification. Results are expressed as the number of bacteria associated with 100 monocytes. If this number with candidate opsonin can be at least twice that without candidate opsonin, the candidate opsonin is an opsonin.
[0399] Assay 5
[0400] Part I
[0401] About 1×107 to 6×107 bacteria per ml are incubated (20 min, 0° C.) with 10 mcg/ml of 125I-candidate opsonin in a total volume of 0.7 ml. of PBS aliquots, 100 ml, of the reaction mixtures are layered over 150 ml of an oil cushion (60% dibutyl phthalate, 40% dioctyl phthalate [Eastman Kodak Co., Rochester, N.Y.]), and the mixtures are centrifuged (10,000×g, 60 s, 4° C.). The tip of the tube, containing the cell pellet, is cut with a Mozart razor blade, and the radioactivity is counted.
[0402] Part II
[0403] APCs are plated in 96-well tissue culture plates (Costar, Cambridge, Mass.) at 2×105 cells per ml the evening before use. 2×106 bacteria per well (0.1 ml per well) are added to the culture plates with or without 100 mcg/ml of candidate opsonin. The plates are then centrifuged at 1,000×g for 7 min. After 15 min at 37° C. to allow the uptake of bacteria, free bacteria are removed by several washes with cold PBS. They are then incubated (45 min, 37° C.) in RPMI 1640 plus an amount of antibiotic that, when present in the culture for 45 min, kills all extracellular bacteria. The end of this incubation period is considered time zero. Monolayers are washed three times with Hanks' balanced saline solution, and the same volume of RPMI 1640 (R0) is added. The cells are lysed by using several cycles of freezing and thawing. The number (CFU) of viable bacteria per well is determined by quantitative plate counts on blood agar plates (Columbia blood agar; Becton Dickinson, San Jose, Calif.) after 24 h of incubation. Each result is given as the mean of three determinations.
[0404] If, in Part I, candidate opsonin-treated bacterial pellet has >75 KCPM and this incorporation can be inhibited by unlabeled candidate opsonin, and if in Part II the CFU with candidate opsonin is greater than without (P<0.05), the candidate opsonin can be an opsonin.
[0405] Assay 6
[0406] 200 &mgr;l of GHBSS (Hanks Balanced Salt Solution)+0.1% of gelatin containing 10 m mol CaCl2) containing 107 bacteria is prepared. The bacteria are then incubated at 4° C. with 20-100 &mgr;g/ml of candidate opsonin. Binding assays are done in the presence or absence of a competitive inhibitor. After incubation for 30 minutes, the bacteria are washed five times in a GHBSS+10 mmol CaCl2 at room temperature in a microfuge at 1,300 g for 3 minutes. Thereafter, a 1:1,000 dilution of rabbit anti-candidate opsonin antiserum is incubated with the bacteria for 1 h in PBS+5% FCS and 10 mmol CaCl2 and then the bacteria are washed three times in GHBSS+10 mmol CaCl2 plus 0.05% Tween 20. Binding of anti-serum to bacteria is detected by a 1:1,000 dilution of goat anti-rabbit IgG conjugated to rhodamine (Fisher Pharmaceuticals, Orangeburg, N.Y.). After incubation, the bacteria are washed five times in GHBSS+10 mmol CaCl2 plus 0.05% Tween 20, smeared onto glass slides and allowed to air dry. Thereafter bacteria are fixed with 100% ice cold methanol for 5 minutes. Negative controls included the absence of candidate opsonin and no first step antibody. Numerous fields of triplicate assays are examined by fluorescence microscopy.
[0407] Part II Association of Radiolabeled Bacteria with Cells.
[0408] 107 radiolabeled bacteria are resuspended in 200 &mgr;l of GHBSS+10 mmol CaCl2 and are incubated with or without candidate opsonin ranging from 2 &mgr;g/ml to 40 &mgr;g/ml at 4° C. for 30 min. The bacteria are then washed three times in GHBSS+10 mmol CaCl2 for 3 min at room temperature in a microfuge at 1,300 g, resuspended in 50 &mgr;l of GHBSS and added to a 1-ml suspension containing on the order of 106 APCs (GHBSS). The bacteria and APCs are gently rocked at 37° C. for 20 min and thereafter the unattached bacteria are removed by five washes using differential centrifugation at 82 g in a microfuge. Before the last wash, an aliquot from each sample is plated on a Labtek slide and cells are adhered for 10 min, fixed in methanol, stained with Giemsa, and scored by light microscopy. To score the cells plated on the Labtek slides, at least 400 cells are counted. The phagocytic index represented the number of attached or ingested particles per 100 PMNs. The pellet from above containing cells and radiolabeled bacteria is then lysed in 100 &mgr;l PBS+0.5% Triton X-100 and the radioactivity is measured in a scintillation counter. If, in Part I, specific binding of candidate opsonin to bacteria is evident, and in Part II the specific uptake of bacteria, in cpm, is more than three times greater with candidate opsonin than without, the candidate opsonin can be an opsonin.
[0409] Assay 7
[0410] Part I
[0411] To investigate binding to L donovani promastigotes cultures are seeded at 5×105 parasites ml. At regular time points up to 9 days, a fraction of parasites are counted, washed, and resuspended in 1% BSA, 0.5 mM Ca2+. 0.05% NaN3, Tris-buffered saline (TBS), (10 mM Tris-HCl, 0.15 M NaCl, pH 8.0) (diluent) to 2×105 ml−1. Fifty microliters of this suspension are then added to 200-&mgr;l microfuge tubes containing 70 &mgr;l 5 &mgr;g/ml radiolabled candidate opsonin (0.12 &mgr;Ci/&mgr;g) in diluent without EDTA, which had been layered over 150 &mgr;l of a dinonyl phthalate/dibutyl phthalate (40:60 v/v) oil mixture. Parasites are incubated for 1 h and centrifuged through the oil layer, the cell pellet is cut off, and associated candidate is detected by gamma counting. Each assay is performed in triplicate. The concentration dependency of candidate binding to promastigotes is also measured as above, using an activity of 0.045 &mgr;Ci/&mgr;g and a twofold dilution series from 60 to 0.015 &mgr;g/ml candidate.
[0412] Part II
[0413] APCs are plated out at 1×106 cells/well on glass coverslips in a 24-well tissue culture plate. Cells are incubated in RPMI 1640 (Life Technologies) supplemented with 10% PCS, 1 mM glutamine, 200 U/ml penicillin and 200 &mgr;g/ml streptomycin in a humidified incubator at 37° C. After 24 h, nonadherent cells are removed and remaining cells are used after 6 days. Promastigotes are incubated with or without candidate at 30 &mgr;g/ml in RPMI 1640 for 1 h and then washed three times before adding to the APC cultures at 106/well. Promastigotes are allowed to infect APCs for 1 h, then cells are washed, fixed with methanol, and Geimsa stained (BDH, Poole, Dorset, U.K.) before counting. The percentage of APCs infected and the number of parasites/100 macrophages is determined from quadruplicate cultures.
[0414] If in Part I the affinity of candidate opsonin for parasites is at least in the nanomolar range and in Part II the number of parasites taken up/100 APCs is, with candidate opsonin, at least twice that without candidate opsonin, the candidate opsonin can be an opsonin.
[0415] Assay 8
[0416] Part I
[0417] Portions (0.5 ml) of [35S] methionine-labeled culture medium containing 5 percent fetal calf serum and the candidate opsonin are incubated for 30 minutes at room temperature with 0.1 ml or 0.2 ml of a 10 percent suspension of a microorganism). The microorganisms tested may include, for example, Salmonella typhimurium, Bacillus subtilis, Staphylococcus aureus, Escherichia coli, and Saccharomyces cerevisiae. Bound proteins are released by boiling in buffer containing 2 percent SDS and 0.1 M dithiothreitol and are analyzed on a 5 percent SDS gel.
[0418] Part II
[0419] Fixed bacteria (0.1 ml; 10 percent by volume; 1010 organisms per millileter), labeled with [3H]thymidine, are incubated with 0.1 ml of serum with or without depletion of the candidate opsonin. After being washed with PBS, the bacteria are incubated with on the order of 1×107 APCs in a final volume of 0.9 ml PBS containing divalent cations. At intervals 0.2 ml is removed to ice-cold PBS with N-ethylmaleimide (2 mM) to block further endocytosis, and the cells are washed (at about 100 g for 10 seconds)
[0420] If in Part I a band corresponding to the candidate opsonin is apparent, and if in Part II the CPM after 6-10 min of incubation is at least three times greater for undepleted samples with serum than with depleted serum, the candidate opsonin can be an opsonin.
[0421] In lieu of results form Parts I of assays 3, 5, 6, 7, 8, a candidate opsonin that satisfies Part II of an assay can be an opsonin if it can bind to the antigen of the assay with an affinity in at least the nanomolar range.
[0422] Assay 9
[0423] SRBC coated with at least 1.2×104 molecules/cell of a fragment of C3 are prepared as described by O'Rear and Ross in Current Protocols in Immunology, 1994, John Wiley & Sons, pp. 13.4.5-9. 250 ul of monocytes at 2×105 cells/ml of RPMI with 10% fetal calf serum are added to each well of an 8-well glass tissue culture plate and incubated at 37° C., 5% CO2 for 3 h. The monocytes are washed twice with HBSS, and 50 ul of the SRBC at 1.5×108/ml of DVBS2+ are added to each well. The plate is centrifuged at 50 g for 5 min and then incubated at 37° C., 5% CO2 for 3 h. The walls are washed twice with HBSS, fixed with 0.5% glutaraldehyde, and stained with Giemsa stain. If >40% of the monocytes form rosettes with at least 1 SRBC as determined by light microscopy, the candidate can be an opsonin.
[0424] Heat Shock Proteins Useful in the Invention
[0425] Heat shock proteins (HSPs) are associated in cells with a broad spectrum of peptides, polypeptides, denatured proteins and antigens with which they form complexes. Such HSP-peptide complexes have been described as being useful in vaccines against cancers and infectious diseases by Srivastava et al., “Heat shock protein-peptide complexes in cancer immunotherapy” in Current Opinion in Immunology (1994), 6:728-732; Srivastava, “Peptide-Binding Heat Shock Proteins in the Endoplasmic Reticulum” in Advances in Cancer Research (1993), 62:153-177. The HSP-peptide complexes appear to work as vaccines, because they may function as antigen carrying and presentation molecules. The development of vaccines using such antigens has been described by Baltz, “Vaccines in the treatment of Cancer” in Am. J. Health-Syst. Pharm. (1995), 52:2574-2585. The antigenicity of heat shock proteins appears to derive not from the heat shock protein itself, but from the associated peptides, see Udono et al., “Heat Shock Protein 70-associated Peptides Elicit Specific Cancer Immunity” in J. Exp. Med. (1993), 178:1391-1396; Srivastava et al., “Heat shock proteins transfer peptides during antigen processing and CTL priming” in Immunogenetics (1994), 39:93-98; Srivastava, “A Critical Contemplation on the Roles of Heat Shock Proteins in Transfer of Antigenic Peptides During Antigen Presentation” in Behring Inst. Mitt. (1994), 94:37-47. HSPs appear to be part of the process by which peptides are transported to the Major Histocompatibility Complex (MHC) molecules for surface presentation.
[0426] A number of different HSPs have been shown to exhibit immunogenicity, and are useful in the present invention, including, but not limited to: gp96, hsp90, hsp100, hsp60, hsp 25 and hsp70, see Udono et al., supra. and Udono et al., “Comparison of Tumor-Specific Immunogenicities of Stress-Induced Proteins gp96, hsp90, and hsp 70” in Journal of Immunology (1994), 5398-5403; gp96 and grp94, Li et al., “Tumor rejection antigen gp96/grp94 is an ATPase: implications for protein folding and antigen presentation” in The EMBO Journal, Vol. 12, No. 8 (1993), 3143-3151; and gp96, hsp90 and hsp70, Blachere et al., “Heat Shock Protein Vaccines Against Cancer” in Journal Of Immunotherapy (1993), 14:352-356.
[0427] Heat shock proteins may be purified for use in the present invention using a procedure employing DE52 ionexchange chromatography followed by affinity chromatography on ATP-agarose, see Welch et al., “Rapid Purification of Mammalian 70,000-Dalton Stress Proteins: Affinity of the Proteins for Nucleotides” in Molecular and Cellular Biology (June 1985), 1229-1237.
[0428] Adhesion Molecules Useful in the Invention
[0429] Adhesion molecules useful in the present invention include any cell-surface protein which is involved in bediating the recognition and adhesion of cell sto their substrate and to other cells. Cellular adhesion molecules can be divided into two primary classes: Ca2+ dependent (cadherins) and Ca2+ independent.
[0430] There are over a dozen different types of Ca2+ dependent adhesion molecules called cadherins. Most cadherins are single-pass transmembrane glycoproteins composed of about 700-750 amino acid residues. The large extracellular part of the molecule is usually folded into five domains, each containing about 100 amino acid residues. Four of these domains contain presumptive Ca2+ binding sites. Cadherins are often present in the cell membrane as dimers.
[0431] Cadherens useful in the present invention include, but are not limited to cadherin E, cadherin N, cadherin BR, cadherin P, cadherin R, cadherin M, cadherin VE, cadherin T&H, cadherin OB, cadherin K, cadherin 7, cadherin 8, cadherin KSP, cadherin LI, cadherin 18, fibroblast 1, cadherin, fibroblast 2, cadherin, fibroblast 3, cadherin 23, desmocollin 1, desmocollin 2, desmoglein 1, desmoglein 2, desmoglein 3, and protocadherin 1, 2, 3, 7, 8, and 9.
[0432] The remaining adhesion molecules are Ca2+ independent, and, like the cadherins, may be used as ligands of a cell surface protein on an APC in the present invention. General classes of adhesion molecules as well as specific adhesion molecules useful in the present invention are shown below in Table 3. 7 TABLE 3 Selectins L-selectin; E-selectin; P-selectin Integrins &agr;1&bgr;1; &agr;2&bgr;1; &agr;3&bgr;1; &agr;4&bgr;1; &agr;5&bgr;1; &agr;6&bgr;1; &agr;7&bgr;1; &agr;8&bgr;1; &agr;9&bgr;1; &agr;v&bgr;1; &agr;L&bgr;2; &agr;M&bgr;2; &agr;X&bgr;2; &agr;IIb&bgr;3; &agr;v&bgr;3; &agr;6&bgr;4; &agr;v&bgr;5; &agr;v&bgr;6; &agr;v&bgr;7; &agr;IEL&bgr;7; &agr;11 Immunoglobulin Neural Specific: Adhesion molecule on glia (AMOG); Superfamily L1CAM; Myelin-associated glycoprotein (MAG); Myelin-oligodendrocyte glycoprotein (MOG); NCAM-1 (CD-56); NrCAM; OBCAM; P0protein; PMP-22protein; Neurofascin; NgCAM Systemic IgCAMS: ALCAM; Basigin (CD147); BL-CAM (CD22); CD44; ICAM-1 (CD54); ICAM-3 (CD50); Lymphocyte function antigen-2 (LFA-2); LFA-3 (CD58; MHC molecules; MAdCAM-1; PECAM (CD31); T-cell receptor; VACM-1 Other Adhesion Agrin; CD34; GlyCAM-1; Molecules Oligodendrocyte-myelin glycoprotein (OMGP)
[0433] Defensins Useful in the Invention
[0434] In one embodiment, the portion of the multifunctional molecule which is a ligand of a cell surface protein of an APC is a defensin. Defensins are a large family of broad-spectrum antimicrobial peptides, identified originally in leukocytes of rabbits and humans. Defensins, cationic, polar peptides (30-35 aa, 3-4 kDa), are distinguished by a conserved tri-disulfide and largely beta sheet structure. When expressed at the cell surface, defensins have been hypothesized to function as a biocheical barrier against microbial invection by inhibiting colonization of the epithelium by a wide range of pathogenic microorganisms. Defensins useful in the present invention include, but are not limited to human alpha defensins 1-6, human neutrophil peptides 1-4, human beta defensin 1 and 2, and rat beta defeinsin 1 and 2.
[0435] Counter-Receptors of T Cell Co-Stimulatory Molecules of the Invention
[0436] In one embodiment of the invention the portion of the multifunctional molecule which is a ligand of a cell surface protein of an APC is a counter-receptor of a T cell co-stimulatory molecule. Costimulation is defined as a signaling pathway that does more than simply augment antigen receptor-proximal activation events, but that intersects with antigen-specific signals synergistically to allow lymphocyte activation. Accordingly, a counter-receptor of a co-stimulatory molecule, useful in the present invention includes, but is not limited to a receptor for one or more of B7-1, B7-2, ICOS:B7h, PD-1:PD-L1/PD-L2, CD48, CD40 ligand, and OX40. Counter-receptors useful in the present invention include, but are not limited to CD28, CTLA-4, ICOS, PD-1, members of the TNF receptor family, CD40, the major B cell costimulatory molecule, as well as OX-40, 4-1BB, CD30, and CD27.
[0437] Peptide Linkers
[0438] In one embodiment, the multifunctional molecule is a fusion polypeptide which comprises one or more amino acids interposed between the first and second parts which bind to cells, e.g. a fusion polypeptide which comprises a first amino acid sequence which can bind to an antigen bearing target and a second amino acid sequence which can bind to a leukocyte, and which further comprises at least one amino acid interposed between the first and second parts. The interposed amino acids may comprise, e.g., a linker sequence intended to lessen steric hindrance or other undesirable interactions between the aforementioned first and second parts. For, example, one such type of sequence takes the form (GlyxSer)n, wherein n is an integer from between 1 and 15, and x is an integer betewen 1 and 10. Additional useful linkers include, but are not limited to (Arg-Ala-Arg-Asp-Pro-Arg-Val-Pro-Val-Ala-Thr)1-5 (Xu et al., 1999, Proc. Natl. Acad. Sci. U.S.A. 96: 151-156), (Gly-Ser), (Shao et al., 2000, Bioconjug. Chem. 11: 822-826), (Thr-Ser-Pro)n (Kroon et al., 2000, Eur. J. Biochem. 267: 6740-6752), (Gly-Gly-Gly), (Kluczyk et al., 2000, Peptides 21: 1411-1420), and (Glu-Lys)n (Klyczyk et al., 2000, supra), wherein n is 1 to 15 (each of the preceding references is also incorporated herein by reference). In another embodiment, no amino acids are interposed between the first and second parts.
[0439] Antigens Useful According to the Invention
[0440] 1. Viral Antigens
[0441] Examples of viral antigens include, but are not limited to, retroviral antigens such as retroviral antigens from the human immunodeficiency virus (HIV) antigens such as gene products of the gag, pol, and env genes, the Nef protein, reverse transcriptase, and other HIV components; hepatitis viral antigens such as the S. M, and L proteins of hepatitis B virus, the pre-S antigen of hepatitis B virus, and other hepatitis, e.g., hepatitis A, B. and C, viral components such as hepatitis C viral RNA; influenza viral antigens such as hemagglutinin and neuraminidase and other influenza viral components; measles viral antigens such as the measles virus fusion protein and other measles virus components; rubella viral antigens such as proteins E1 and E2 and other rubella virus components; rotaviral antigens such as VP7sc and other rotaviral components; cytomegaloviral antigens such as envelope glycoprotein B and other cytomegaloviral antigen components; respiratory syncytial viral antigens such as the RSV fusion protein, the M2 protein and other respiratory syncytial viral antigen components; herpes simplex viral antigens such as immediate early proteins, glycoprotein D, and other herpes simplex viral antigen components; varicella zoster viral antigens such as gpI, gpII, and other varicella zoster viral antigen components; Japanese encephalitis viral antigens such as proteins E, M-E, M-E-NS 1, NS 1, NS 1-NS2A, 80% E, and other Japanese encephalitis viral antigen components; rabies viral antigens such as rabies glycoprotein, rabies nucleoprotein and other rabies viral antigen components. See Fundamental Virology, Second Edition, e's. Fields, B. N. and Knipe, D. M. (Raven Press, New York, 1991) for additional examples of viral antigens.
[0442] 2. Bacterial Antigens
[0443] Bacterial antigens which can be used in the compositions and methods of the invention include, but are not limited to, pertussis bacterial antigens such as pertussis toxin, filamentous hemagglutinin, pertactin, FIM2, FIM3, adenylate cyclase and other pertussis bacterial antigen components; diptheria bacterial antigens such as diptheria toxin or toxoid and other diphtheria bacterial antigen components; tetanus bacterial antigens such as tetanus toxin or toxoid and other tetanus bacterial antigen components; streptococcal bacterial antigens such as M proteins and other streptococcal bacterial antigen components; grarn-negative bacilli bacterial antigens such as lipopolysaccharides and other gram-negative bacterial antigen components; Mycobacterium tuberculosis bacterial antigens such as mycolic acid, heat shock protein 65 (HSP65), the 30 kDa major secreted protein, antigen 85A and other mycobacterial antigen components; Helicobacter pylori bacterial antigen components; pneumococcal bacterial antigens such as pneumolysin, pneumococcal capsular polysaccharides and other pneumococcal bacterial antigen components; hemophilus influenza bacterial antigens such as capsular polysaccharides and other hemophilus influenza bacterial antigen components; anthrax bacterial antigens such as anthrax protective antigen and other anthrax bacterial antigen components; rickettsiae bacterial antigens such as romps and other rickettsiae bacterial antigen component. Also included with the bacterial antigens described herein are any other bacterial, mycobacterial, mycoplasmal, rickettsial, or chlamydial antigens.
[0444] 3. Fungal Antigens
[0445] Fungal antigens which can be used in the compositions and methods of the invention include, but are not limited to, candida fungal antigen components; histoplasma fungal antigens such as heat shock protein 60 (HSP60) and other histoplasma fungal antigen components; cryptococcal fungal antigens such as capsular polysaccharides and other cryptococcal fungal antigen components; coccidiodes fungal antigens such as spherule antigens and other coccidiodes fungal antigen components; and tinea fungal antigens such as trichophytin and other coccidiodes fungal antigen components.
[0446] 4. Parasite Antigens
[0447] Examples of protozoa and other parasitic antigens include, but are not limited to, plasmodium falciparum antigens such as merozoite surface antigens, sporozoite surface antigens, circumsporozoite antigens, gametocyte/gamete surface antigens, blood-stage antigen pf 1 55/RESA and other plasmodial antigen components; toxoplasma antigens such as SAG-1, p30 and other toxoplasma antigen components; schistosomae antigens such as glutathione-S-transferase, paramyosin, and other schistosomal antigen components; leishmania major and other leishmaniae antigens such as gp63, lipophosphoglycan and its associated protein and other leishmanial antigen components; and trypanosoma cruzi antigens such as the 75-77 kDa antigen, the 56 kDa antigen and other trypanosomal antigen components.
[0448] 5. Tumor Antigens.
[0449] Tumor antigens which can be used in the compositions and methods of the invention include, but are not limited to, telomerase components; multidrug resistance proteins such as P-glycoprotein; MAGE-1, alpha fetoprotein, carcinoembryonic antigen, mutant p53, immunoglobulins of B-cell derived malignancies, fusion polypeptides expressed from genes that have been juxtaposed by chromosomal translocations, human chorionic gonadotrpin, calcitonin, tyrosinase, papillomavirus antigens, gangliosides or other carbohydrate-containing components of melanoma or other tumor cells. It is contemplated by the invention that antigens from any type of tumor cell can be used in the compositions and methods described herein.
[0450] 6. Antigens Relating to Autoimmunity.
[0451] Antigens involved in autoimmune diseases, allergy, and graft rejection can be used in the compositions and methods of the invention. For example, an antigen involved in any one or more of the following autoimmune diseases or disorders can be used in the present invention: diabetes mellitus, arthritis (including rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis), multiple sclerosis, myasthenia gravis, systemic lupus erythematosis, autoimmune thyroiditis, dermatitis (including atopic dermatitis and eczematous dermatitis), psoriasis, Sjogren's Syndrome, including keratoconjunctivitis sicca secondary to Sjogren's Syndrome, alopecia areata, allergic responses due to arthropod bite reactions, Crohn's disease, aphthous ulcer, iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma, cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis, drug eruptions, leprosy reversal reactions, erythema nodosum leprosum, autoimmune uveitis, allergic encephalomyelitis, acute necrotizing hemorrhagic encephalopathy, idiopathic bilateral progressive sensorineural hearing loss, aplastic anemia, pure red cell anemia, idiopathic thrombocytopenia, polychondritis, Wegener's granulomatosis, chronic active hepatitis, Stevens-Johnson syndrome, idiopathic sprue, lichen planus, Crohn's disease, Graves ophthalmopathy, sarcoidosis, primary biliary cirrhosis, uveitis posterior, and interstitial lung fibrosis. Examples of antigens involved in autoimmune disease include glutamic acid decarboxylase 65 (GAD 65), native DNA, myelin basic protein, myelin proteolipid protein, acetylcholine receptor components, thyroglobulin, and the thyroid stimulating hormone (TSH) reception. Examples of antigens involved in allergy include pollen antigens such as Japanese cedar pollen antigens, ragweed pollen antigens, rye grass pollen antigens, animal derived antigens such as dust mite antigens and feline antigens, histocompatiblity antigens, and penicillin and other therapeutic drugs. Examples of antigens involved in graft rejection include antigenic components of the graft to be transplanted into the graft recipient such as heart, lung, liver, pancreas, kidney, and neural graft components. An antigen can also be an altered peptide ligand useful in treating an autoimmune disease.
[0452] Examples of miscellaneous antigens which can be can be used in the compositions and methods of the invention include endogenous hormones such as luteinizing hormone, follicular stimulating hormone, testosterone, growth hormone, prolactin, and other hormones, drugs of addiction such as cocaine and heroin, and idiotypic fragments of antigen receptors such as Fab-containing portions of an anti-leptin receptor antibody.
[0453] Determination of Binding of a Multifunctional Molecule to a Antigen Bearing Target or APC
[0454] Multiple techniques are known to those of skill in the art for detecting protein-protein binding. That is, the binding of a multifunctional molecule of the invention to either or both of an antigen bearing target and an APC.
[0455] The association between the multifunctional molecule and an antigen bearing target and/or an APC may be measured for example by Fluorescent Resonance Energy Transfer (FRET), wherein one peptide (i.e., the multifunctional molecule) comprises a fluorescent label moiety, and the antigen bearing target or APC harbours a second such moiety, and where excitation at an appropriate wavelength may result in absorption of photons by one label, followed by FRET, and emission at a second wavelength characteristic of the second fluorophore, this emission being measured and corresponding to the amount of antigen bearing target or APC which is associated with the multifunctional molecule. Alternatively, this association may be measured in one of many other ways which are described more fully below.
[0456] A “fluorescent tag” or “fluorescent group” refers to either a fluorophore or a fluorescent protein or fluorescent fragment thereof, or refers to a fluorescent amino acid such as tryptophan which may be incorporated into a polypeptide. “Fluorescent protein” refers to any protein which fluoresces when excited with appropriate electromagnetic radiation. This includes proteins whose amino acid sequences are either natural or engineered.
[0457] It is additionally preferred that the fluorophores comprise fluorescein and tetramethylrhodamine or another suitable pair. In another preferred embodiment, the label comprises two different fluorescent proteins. It is preferred that fluorescent proteins comprise any protein selected from the group consisting of green fluorescent protein (GFP), blue fluorescent protein, red fluorescent protein and other engineered forms of GFP.
[0458] Preferably, the polypeptide comprises a cysteine amino acid through which the label is attached via a covalent bond. More preferably, the label may be attached via a primary amine group such as via a lysine residue. As will be apparent to a person skilled in the art, it is preferable to avoid using the same chemistry for both labelling and immobilising polypeptides of the invention. For example, if the polypeptide is immobilised via cysteine residues, the label is advantageously attached via lysine residues.
[0459] Preferably, the measuring is performed by fluorescent resonance energy transfer (FRET), fluorescence anisotropy or fluorescence correlation spectroscopy, or by measuring the binding of a fluorescent partner polypeptide to an immobilised polypeptide. Techniques for performing such measurements are well known to those of skill in the art.
[0460] It is preferred that the fluorescence emitting means comprise two different fluorophores, and particularly preferred that the fluorophores comprise fluorescein and tetramethylrhodamine or another suitable pair.
[0461] As used herein with regard to fluorescent labels for use in FRET, the term “appropriate combination” refers to a choice of reporter labels such that the emission wavelength spectrum of one (the “donor” moiety) is within the excitation wavelength spectrum of the other (the “acceptor” moiety).
[0462] Methods of detection without use of label are known in the art. These include detection using surface plasmon resonance to detect changes in the mass of, for example the multifunctional molecule, which would occur if binding of the partner polypeptide increased or decreased. Such measurements may be made for example using a BIACORE machine. In this embodiment, the multifunctional molecule is immobilized on a solid support prior to contacting the molecule with the antigen bearing moiety and/or APC.
[0463] In addition to the above methods, one technique for determing the binding of a multifunctional molecule of the invention to an antigen bearing moiety and/or and APC involves the use of antibodies specifically directed to the multifunctional molecule. Briefly, antigen bearing cells, for example, are incubated with the multifunctional molecule of the invention in RPMI 1640, or other suitable buffer, for 1-4 hours at 37° C. with shaking. The cells are then washed in PBS containing 2% FBS, or other cell culture serum. The antigen bearing cells are then incubated with, for example, an FITC labeled anti-multifunctional molecule antibody for 1 hour at 4° C. After additional washing in PBS, the cells are analyzed by flow cytometry, wherein the identification of labeled cells is indicative of the binding of the multifunctional molecule of the invention to the antigen bearing cell.
[0464] Preparation of a Cell Containing a Recombinant Nucleic Acid According to the Invention
[0465] In one embodiment of the present invention, a nucleic acid molecule encoding a multifunctional molecule of the present invention is introduced into a host cell capable of expressing the nucleic acid molecule so as to produce the multifunctional molecule. In one embodiment, the host cell is permitted to express the nucleic acid ex vivo. In an alternate embodiment, the host cell is transfected with the nucleic acid molecule encoding the multifunctional molecule, and then placed back into the host animal from which it was obtained, wherein the multifunctional polypeptide molecule is expressed in vivo in the host animal.
[0466] Host cells are transfected, as taught herein, via conventional methods well-known in the art. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals. Additional examples of methods of introducing nucleic acid molecules encoding multifunctional molecules are described below. The cells containing the introduced nucleic acid molecules encoding, for example, multifunctional molecule and/or an antigen, can themselves be administered to a subject (as the antigen) according to the methods of the invention, e.g., in a vaccine composition.
[0467] A. Introduction of Naked Nucleic Acid into Cells
[0468] 1. Transfection mediated by DEAE-dextran: Naked nucleic acid can be introduced into cells by forming a mixture of the nucleic acid and DEAE-dextran and incubating the mixture with the cells. A dimethylsulfoxide or chloroquine shock step can be added to increase the amount of nucleic acid uptake. DEAE-dextran transfection is only applicable to in vitro modification of cells and can be used to introduce nucleic acid transiently into cells but is not preferred for creating stably transfected cells. Thus, this method can be used for short term production of a gene product but is not a method of choice for long-term production of a gene product. Protocols for DEAE-dextran-mediated transfection can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (e's.) Greene Publishing Associates, (1989), Section 9.2 and in Molecular Cloning: A Laboratory Manual. 2nd Edition. Sambrook et al. Cold Spring Harbor Laboratory Press, (1989), Sections 16.41-16.46 or other standard laboratory manuals.
[0469] 2. Electroporation: Naked nucleic acid can also be introduced into cells by incubating the cells and the nucleic acid together in an appropriate buffer and subjecting the cells to a high-voltage electric pulse. The efficiency with which nucleic acid is introduced into cells by electroporation is influenced by the strength of the applied field, the length of the electric pulse, the temperature, the conformation and concentration of the nucleic acid and the ionic composition of the media. Electroporation can be used to stably (or transiently) transfect a wide variety of cell types and is only applicable to in vitro modification of cells. Protocols for electroporating cells can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (e's.) Greene Publishing Associates, (1989), Section 9.3 and in Molecular Cloning: A Laboratory Manual, 2nd Edition, Sambrook et al. Cold Spring Harbor Laboratory Press, (1989), Sections 16.54-16.55 or other standard laboratory manuals.
[0470] 3. Liposome-mediated transfection (“lipofection”): Naked nucleic acid can be introduced into cells by mixing the nucleic acid with a liposome suspension containing cationic lipids. The nucleic acid/liposome complex is then incubated with cells. Liposome mediated transfection can be used to stably (or transiently) transfect cells in culture in vitro. Protocols can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (e's.) Greene Publishing Associates, (1989), Section 9.4 and other standard laboratory manuals. Additionally, gene delivery in vivo has been accomplished using liposomes. See for example Nicolau et al. (1987) Meth. Enz. 149:157-176; Wang and Huang (1987) Proc. Natl. Acad. Sci. SA 84:7851-785S; Brigham et al. (1989) Am. J. Med. Sci. 298:278; and Gould-Fogerite et al. (1989) Gene 84:429-438.
[0471] 4. Direct Injection: Naked nucleic acid can be introduced into cells by directly injecting the nucleic acid into the cells. For an in vitro culture of cells, nucleic acid can be introduced by microinjection. Since each cell is microinjected individually, this approach is very labor intensive when modifying large numbers of cells. However, a situation wherein microinjection is a method of choice is in the production of transgenic animals (discussed in greater detail below). In this situation, the nucleic acid is stably introduced into a fertilized oocyte which is then allowed to develop into an animal. The resultant animal contains cells carrying the nucleic acid introduced into the oocyte. Direct injection has also been used to introduce naked nucleic acid into cells in vivo (see e.g., Acsadi et al. (1991) Nature 332: 815-818; Wolff et al. (1990) Science 247:1465-1468). A delivery apparatus (e.g., a “gene gun”) for injecting DNA into cells in vivo can be used. Such an apparatus is commercially available (e.g., from BioRad).
[0472] 5. Receptor-Mediated DNA Uptake: Naked nucleic acid can also be introduced into cells by complexing the nucleic acid to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor (see for example Wu, G. and Wu, C. H. (1988) J. Biol. Chem 263:14621; Wilson et al. (1992) J. Biol. Chem. 267:963-967; and U.S. Pat. No. 5,166,320). Binding of the nucleic acid-ligand complex to the receptor facilitates uptake of the nucleic acid by receptor-mediated endocytosis. Receptors to which a nucleic acid-ligand complex have targeted include the transferrin receptor and the asialoglycoprotein receptor. A nucleic acid-ligand complex linked to adenovirus capsids which naturally disrupt endosomes, thereby releasing material into the cytoplasm can be used to avoid degradation of the complex by intracellular lysosomes (see for example Curiel et al. (1991) Proc. Natl. Acad. Sci. USA 88:8850; Cristiano et al. (1993) Proc. Natl. Acad. Sci USA 90:2122-2126). Receptor-mediated nucleic acid uptake can be used to introduce nucleic acid into cells either in vitro or in vivo and, additionally, has the added feature that nucleic acid can be selectively targeted to a particular cell type by use of a ligand which binds to a receptor selectively expressed on a target cell of interest.
[0473] Generally, when naked nucleic acid is introduced into cells in culture (e.g., by one of the transfection techniques described above) only a small fraction of cells (about 1 out of 105) typically integrate the transfected nucleic acid into their genomes (i.e., the nucleic acid is maintained in the cell episomally). Thus, in order to identify cells which have taken up exogenous nucleic acid, it is advantageous to transfect nucleic acid encoding a selectable marker into the cell along with the nucleic acid(s) of interest. Preferred selectable markers include those which confer resistance to drugs such as G418, hygromycin and methotrexate. Alternatively, a selectable marker maybe one which emits a detectable signal upon expression such as green fluorescen protein or blue fluorescent protein. Selectable markers may be introduced on the same plasmid as the gene(s) of interest or may be introduced on a separate plasmid.
[0474] B. Viral-Mediated Gene Transfer
[0475] A preferred approach for introducing nucleic acid encoding a gene product into a cell is by use of a viral vector containing nucleic acid, e.g. a cDNA, encoding the gene product. Infection of cells with a viral vector has the advantage that a large proportion of cells receive the nucleic acid, which can obviate the need for selection of cells which have received the nucleic acid. Additionally, molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells which have taken up viral vector nucleic acid and viral vector systems can be used either in vitro or in vivo.
[0476] 1. Retroviruses: Defective retroviruses are well characterized for use in gene transfer for gene therapy purposes (for a review see Miller, A. D. (1990) Blood 76:271). A recombinant retrovirus can be constructed having a nucleic acid encoding a gene product of interest inserted into the retroviral genome. Additionally, portions of the retroviral genome can be removed to render the retrovirus replication defective. The replication defective retrovirus is then packaged into virions which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are well known to those skilled in the art. Examples of suitable packaging virus lines include &phgr;Crip, &phgr;Cre, —2, and_Am. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-115; U.S. Pat. No. 4,868,116; U.S. Pat. No. 4,980,286; PCT Application WO 89/07136; PCT Application WO 89/02468; PCT Application WO 89/05345; and PCT Application WO 92/07573). Retroviral vectors require target cell division in order for the retroviral genome (and foreign nucleic acid inserted into it) to be integrated into the host genome to stably introduce nucleic acid into the cell. Thus, it may be necessary to stimulate replication of the target cell.
[0477] 2. Adenoviruses: The genome of an adenovirus can be manipulated such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See for example Berkner et al. (1988) BioTechniques 6:616; Rosenfeld et al. (1991) Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155. Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 d1324 or other strains of adenovirus (e.g., Adz, Ad3, Ad7 etc.) are well known to those skilled in the art. Recombinant adenoviruses are advantageous in that they do not require dividing cells to be effective gene delivery vehicles and can be used to infect a wide variety of cell types, including airway epithelium (Rosenfeld et al. (1992) cited supra), endothelial cells (Lemarchand et al. (1992) Proc. Natl. Acad. Sci. USA 89:6482-6486), hepatocytes (Herz and Gerard (1993) Proc. Natl. Acad. Sci. USA 90:2812-2816) and muscle cells (Quantin et al. (1992) Proc. Natl. Acad. Sci. USA 89:2581-2584). Additionally, introduced adenoviral nucleic acid (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situations where introduced nucleic acid becomes integrated into the host genome (e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al. cited supra; Haj-Ahmand and Graham (1986) J. Virol. 57:267). Most replication-defective adenoviral vectors currently in use are deleted for all or parts of the viral E1 and E3 genes but retain as much as 80% of the adenoviral genetic material.
[0478] 3. Adeno-Associated Viruses: Adeno-associated virus (AAV) is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al. Curr. Topics in Micro. and Immunol. (1992) 158:97-129). It is also one of the few viruses that may integrate its DNA into non-dividing cells, and exhibits a high frequency of stable integration (see for example Flotte et al. (1992) Am. J. Respir. Cell. Mol. Biol. 7:349-356; Samulski et al. (1989) J. Virol. 63:3822-3828; and McLaughlin et al. (1989) J. Virol 62:1963-1973). Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous nucleic acid is limited to about 4.5 kb. An AAV vector such as that described in Tratschin et al. (1985) Mol. Cell. Biol. 5:3251-3260 can be used to introduce nucleic acid into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al. (1984) Proc. Natl. Acad. Sci. USA 81 :6466-6470; Tratschin et al. (1985) Mol. Cell. Biol. 4:2072-2081; Wondisford et al. (1988) Mol. Endocrinol. 2:32-39; Tratschin et al. (1984) J. Virol.51:611-619; and Flotte et al. (1993) J. Biol. Chem. 268:3781-3790).
[0479] The efficacy of a particular expression vector system and method of introducing nucleic acid into a cell can be assessed by standard approaches routinely used in the art. For example, nucleic acid introduced into a cell can be detected by a filter hybridization technique (e.g., Southern blotting) and RNA produced by transcription of introduced nucleic acid can be detected, for example, by Northern blotting, RNase protection or reverse transcriptase-polymerase chain reaction (RI-PCR). The gene product can be detected by an appropriate assay, for example by immunological detection of a produced protein, such as with a specific antibody, or by a functional assay to detect a functional activity of the gene product, such as an enzymatic assay. If the gene product of interest to be expressed by a cell is not readily assayable, an expression system can first be optimized using a reporter gene linked to the regulatory elements and vector to be used. The reporter gene encodes a gene product which is easily detectable and, thus, can be used to evaluate the efficacy of the system. Standard reporter genes used in the art include genes encoding beta-galactosidase, chloramphenicol acetyl transferase, luciferase and human growth hormone.
[0480] Cells Useful According to the Invention
[0481] The invention provides for host cells transfected with nucleic acid constructs encoding a multifunctional molecule of the invention. Host cells useful in the invention include but are not limited to the following.
[0482] A host cell can be any cell which is able to act as a carrier for an antigen according to the invention and thus may be a nucleated cell or a procaryotic cell into which nucleic acid can be artificially introduced. Procaryotic cells useful according to the invention include bacterial cells. Eucaryotic (nucleated) cells useful according to the invention include cells of a yeast, fungus, cells of a parasite and mammalian cells. Mammalian cells useful according to the invention include but are not limited to fibroblasts, including specialized mesenchymal cells such as a synoviocytes; keratinocytes, epithelial cells, endothelial cells, leukocytes and tumor cells.
[0483] Cell lines useful according to the invention include but are not limited to B16, CMS-5 fibrosarcoma cells, Cos1 cells and CHO cells, TS/A, Lewis lung carcinoma, RENCA, Dunning rat prostate carcinoma, and cell lines included in the catalogue of the American Type Culture Collection (Manassas, Va.).
[0484] Host cells comprising a nucleic acid molecule encoding a multifunctional molecule of the invention can be prepared from pathogenic cells according to the invention. Pathogenic cells include tumor cells (e.g. B16 cells, CMS-5 fibrosarcoma cells, and cells derived from the tumors included in the section entitled “Tumors for which the Invention is Useful”), and cells derived from pathogenic bacterium, pathogenic fungus, pathogenic virus, pathogenic parasite, or a pathogenic arthropod.
[0485] Methods of Detecting Expression From an Artificially Introduced Recombinant Nucleic Acid Sequence
[0486] The invention provides for methods of detecting a protein (e.g., a multifunctional molecule) that is expressed from a recombinant nucleic acid molecule that has been artificially introduced into a cell.
[0487] Preparation of Antibodies
[0488] Antibodies specific for a protein useful according to the invention (e.g., a multifunctional molecule) are useful for protein purification, and for the detection of expression of these proteins from cells into which a recombinant nucleic acid molecule expressing these proteins has been artificially introduced. By antibody, we include constructions using the binding (variable) region of such an antibody, and other antibody modifications. Thus, an antibody useful in the invention may comprise a whole antibody, an antibody fragment, a polyfunctional antibody aggregate, or in general a substance comprising one or more specific binding sites from an antibody. The antibody fragment may be a fragment such as an Fv, Fab or F(ab′)2 fragment or a derivative thereof, such as a single chain Fv fragment. The antibody or antibody fragment may be non-recombinant, recombinant or humanized. The antibody may be of an immunoglobulin isotype, e.g., IgG, IgM, and so forth. In addition, an aggregate, polymer, derivative and conjugate of an immunoglobulin or a fragment thereof can be used where appropriate.
[0489] Although a protein product (or fragment or oligopeptide thereof) of a protein according to the invention (e.g., a multifunctional molecule according to the invention) that is useful for the production of antibodies does not require biological activity, it must be antigenic. Antibodies may be directed to any portion of the multifunctional molecule of the invention. For example, an antibody may be directed to the lecting portion of the multifunctional molecule or to the ligand portion of the multifunctional molecule. Peptides used to induce specific antibodies may have an amino acid sequence consisting of at least five amino acids and preferably at least 10 amino acids. Preferably, they should be identical to a region of the natural protein and may contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of amino acids corresponding to the protein product of a recombinant nucleic acid encoding a protein useful according to the invention (e.g., a multifunctional molecule according to the invention) may be fused with amino acids from another protein such as keyhole limpet hemocyanin or GST, and antibody will be produced against the chimeric molecule. Procedures well known in the art can be used for the production of antibodies to the protein products of recombinant nucleic acids of the invention.
[0490] For the production of antibodies, various hosts including goats, rabbits, rats, mice etc. may be immunized by injection with the protein products (or any portion, fragment, or oligonucleotide thereof which retains immunogenic properties) of the recombinant nucleic acid molecules encoding proteins useful according to the invention. Depending on the host species, various adjuvants may be used to increase the immunological response. Such adjuvants include but are not limited to Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are potentially useful human adjuvants.
[0491] I. Polyclonal Antibodies.
[0492] The antigen protein may be conjugated to a conventional carrier in order to increase its immunogenicity, and an antiserum to the peptide-carrier conjugate will be raised. Coupling of a peptide to a carrier protein and immunizations may be performed as described (Dymecki et al., 1992, J. Biol. Chem., 267: 4815). The serum can be titered against protein antigen by ELISA (below) or alternatively by dot or spot blotting (Boersma and Van Leeuwen, 1994, J. Neurosci. Methods, 51: 317). At the same time, the antiserum may be used in tissue sections prepared as described. A useful serum will react strongly with the appropriate peptides by ELISA, for example, following the procedures of Green et al., 1982, Cell, 28: 477.
[0493] 2. Monoclonal Antibodies.
[0494] Techniques for preparing monoclonal antibodies are well known, and monoclonal antibodies may be prepared using a candidate antigen (e.g., a mulispecific molecule or a lectin whose level is to be measured or which is to be either inactivated or affinity-purified, preferably bound to a carrier, as described by Arnheiter et al., 1981, Nature, 294;278.
[0495] Monoclonal antibodies are typically obtained from hybridoma tissue cultures or from ascites fluid obtained from animals into which the hybridoma tissue was introduced.
[0496] Monoclonal antibody-producing hybridomas (or polyclonal sera) can be screened for antibody binding to the target protein.
[0497] 3. Antibody Detection Methods
[0498] Particularly preferred immunological tests rely on the use of either monoclonal or polyclonal antibodies and include enzyme-linked immunoassays (ELISA), immunoblotting and immunoprecipitation (see Voller, 1978, Diagnostic Horizons, 2:1, Microbiological Associates Quarterly Publication, Walkersville, Md.; Voller et al., 1978, J. Clin. Pathol., 31: 507; U.S. Reissue Pat. No. 31,006; UK Patent 2,019,408; Butler, 1981, Methods Enzymol., 73: 482; Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton, Fla.) or radioimmunoassays (RIA) (Weintraub, B., Principles of radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March 1986, pp. 1-5, 46-49 and 68-78). For analysing tissues for the presence or absence of a protein produced by a recombinant nucleic acid encoding a protein useful according to the invention (e.g., multifunctional molecule or portion thereof), immunohistochemistry techniques may be used. It will be apparent to one skilled in the art that the antibody molecule may have to be labelled to facilitate easy detection of a target protein. Techniques for labelling antibody molecules are well known to those skilled in the art (see Harlow and Lane, 1989, Antibodies, Cold Spring Harbor Laboratory).
[0499] Determining Whether an Immune Response is Modulated According to the Invention
[0500] The multifunctional molecules described herein are useful according to the invention to modulate an immune response in a mammalian, preferably a human, to an antigen or antigens contained in the antigen bearing target which is bound to the lectin portion of the multifunctional molecule. In one embodiment, a composition comprising a multifunctional molecule bound to an antigen bearing target is administered to an animal, preferably a human. The second portion of the multifunctional molecule comprising a ligand for a cell-surface molecule of an APC targets the composition to antigen presenting cells in the animal to which the composition has been administered. The antigen bearing target is taken up (i.e., ingested or phagocytosed) by antigen presenting cells. Alternatively, the multifunctional molecule/antigen bearing target complex is contacted with antigen presenting cells in vitro under conditions which allow phagocytosis, wherein the APCs are subsequently returned to the host organinsm from which they were derived.
[0501] The present invention thus provides a method for modulating an immune response in an mammal comprising administering to the mammal a composition comprising at least a multifunctional molecule as described herein. In one embodiment, the composition further comprises an antigen bearing target. In a further embodiment, the composition still further comprises an APC.
[0502] An “immune response” refers to stimulation/activation of a selected response involving the immune system, or suppression, elimination, or attenuation of a selected response. In a preferred embodiment, an immune response refers to stimulation/activation of a selected response involving the immune system by about at least 5%, or preferably between 5 and 50% or more preferably between 50 and 100% or at least 100% or greater, or suppression, elimination, or attenuation of a selected response by about at least 5%, or preferably between 5 and 50% or more preferably between 50 and 100% or at least 100% or greater, as compared to control cells that are not CD 40-ligand enhanced cells. Thus, to modulate an immune response means that the desired response is more efficient, more rapid, greater in magnitude, and/or more easily induced than when an antigen bearing target is contacted with an APC in the absence of a multifunctional molecule. Different immune responses in the subject may be modulated differentially, e.g., the cellular immune response may be selectively enhanced while the humoral response may be selectively attenuated, and vice versa.
[0503] The following in vitro and in vivo assays are useful for determining whether an immune response is modulated according to the invention. The assays described in detail below measure stimulation or suppression of cellular or humoral immune responses to an antigen. The antigens referred to in the following assays are representative. It will be apparent to one of skill in the art that an immune response to a selected antigen useful according to the invention may be measured using one or more of the following assays by adapting the assay to that antigen.
[0504] I. Detection of Increased Phagocytosis
[0505] The following assay may be used in order to determine whether opsonin-enhanced cells stimulate phagocytosis by antigen presenting cells.
[0506] Phagocytosis is examined using monocytes that have been adhered at 37° for 30 min in RPMI without added FCS. Sheep erythrocytes are incubated with an opsonin, or its precursor, under conditions such that there are no more than 300 of such molecules, on average, are deposited on each erythrocyte. If a precursor is used, coated erythrocytes are then processed to convert all precursors to the actual candidate molecule (e.g., See Carlo et al., J. Immunol. 123:523-8(1979)). Fresh monocytes are isolated from the subject, and 5×-1×105 of these cells suspended in 0.25-0.5 ml of RPMI medium with 1% BSA. This aliquot is placed in a tissue culture well and incubated for 30 min at 37° C. An excess of coated erythrocytes, suspended at 1.2×108 cells/ml, is overlain on the monocytes, the plate is centrifuged for 5 min at 50 g, and incubated for 30 min at 37° C. Non-ingested material is removed in two hypotonic lysis steps using ice-cold lysing buffer before fixing and staining the adherent cells, and examining the cells under light microscopy. Phagocytosis is quantified by determining the percentage of 100 monocytes ingesting one or more target cells, and the total number of ingested E/100 monocyptes (PI) is recorded. Stimulation of phagocytosis according to the invention is indicated by a phagocytic index of equal to or greater than 40.
[0507] Another assay for phagocytosis is as follows: Cells of the murine macrophage line are harvested and suspended in DMEM-10 at 4×105/ml. 2.0 ml of this suspension is aliquoted into individual 3.5 cm cell culture plates, and the dishes incubated at 37° C. in 5% CO2 overnight. Target cells, as well as control cells, are harvested on the same day as the macrophages, washed in PBS, and resuspended 2 min in PKH26 dye (a 2 &mgr;M solution in 1 ml of the supplied diluent) at 5×106 cells/ml. The fluorescent PKH26 dye emits in the red spectrum when excited, whereas the FITC label that is used for the phagocytes emits in the green spectrum. PKH26 is stable in the endosomal/lysosomal compartment of phagocytes. The dyed target cells are washed 3 times with PBS and cultured overnight to allow leaching of PKH26 out into the medium. This minimizes leakage of dye during the assay. The following day the target cells are harvested, washed 3 times with PBS, and resuspended in serum-free DMEM at 5×105/ml. The phagocytic cells are rinsed vigorously with PBS on the culture plates in order to remove serum, and 2 ml of target cells is added to each plate After 0, 2, 4, or 8 h, the plates are rinsed 3 times with PBS to remove all non-adhered cells and the remaining cells are incubated with 2 mM EDTA to release them from the plate. The released cells are washed with 1% FBS/PBS, and suspending in 100 &mgr;l of the same buffer. 2 &mgr;g anti-phagocyte (e.g. anti-CR3) antibody is added and the cells placed on ice for 25 min. The cells are washed 3 times with 1% FBS/PBS, resuspended in 100 &mgr;l of this solution, and stained with a 1:25 dilution of FITC-conjugated secondary IgG for 25 min on ice. Cells are washed 3 times and resuspended in 500 &mgr;l 1% FBS/PBS, then analyzed on a Becton Dickinson FACScan with CellQuest software.
[0508] FL-1 (green) fluorescence is used to gate phagocytes. The FL-2 (red) fluorescence of these cells, which reflects internalization of PKH26-labeled target cells, is then measured. Phagocytosis induced by, e.g., an opsonin is indicated by the difference between mean FL-2 fluorescence of macrophages incubated with opsonin-coated versus non-opsonin-coated target cells. Use of an opsonin will increase mean FL-2 fluorescence by, e.g. at least 10%., or enough to obtain ap value less than or equal to 0.05 by student t-test.
[0509] II. Amplification of the Immune Response Usually Involves Proliferation of Particular Subpopulations of Lymphoid Cells that are Normally in the Resting State.
[0510] Proliferative assays have the following applications in clinical studies: (1) Assessment of overall immunologic competence of T cells or B cells as manifested in their ability to respond to polyclonal proliferation signals such as mitogens or anti-CD3 antibodies. Defects in the proliferation may be indicative of fundamental cellular immunologic defect. Low proliferation is often found as a nonspecific secondary effect of chronic disease. (2) Assessment of an individual's response to specific antigens, where low responses are indicative of general or specific immunologic defect. (3) Determination of MHC compatibility by the mixed lymphocyte reaction (MLR).
[0511] In addition, proliferative assays are useful for estimating lymphokine production, investigating signal transduction, and assessing growth factor requirements (e.g., lymphokines) for T or B cells. The procedure outlined here measures incorporation of [3H]thymidine into DNA, which usually correlates well with cell growth as measured by changes in cell number. However, when the activation stimulus is toxic, as with chemical activators such as ionomycin plus phorbol myristate acetate (PMA), the burst of new DNA synthesis following activation may not be accompanied with a net increase in viable cells, and, in fact, a decline in cell number may be observed. In this instance, [3H]thymidine incorporation in DNA is more indicative of initial cell stimulation than estimation of cell number. In addition, [3H]thymidine incorporation provides information on cell populations, not on individual cells. Alternate methods, such as flow cytometry may be used for studies requiring that type of information.
[0512] Assay for Antigen-Induced T Cell Proliferation
[0513] This protocol is designed to test the proliferation of T cells in response to a specific antigen—tetanus toxoid. It can be modified to test T cell proliferation in response to any protein or polysaccharide antigen. Materials: (T cell suspension, autologous antigen-presenting cell suspension (non-T cells), Tetanus toxoid solution (Connaught or State Laboratory Institute of Massachusetts)). (1) Count T cells and adjust to 1×106 cells/ml with complete RPM1-10 AB. (2) Treat antigen-presenting cells with mitomycin C (or irradiate with 2500 rad) as in step 2 of one-way MLR protocol. Adjust concentration of antigen-presenting cells to 2×105 cells/ml. Antigen-presenting cells can consist of autologous non-T cells or autologous monocytes/macrophages. (3) Add 100 ul T cell suspension and 50 ul antigen-presenting cell population to wells; mix just before dispensing. (4) Add 50 ul tetanus toxoid solution to give final concentrations of 0, 1, 5, 10, and 20 ug/ml. Prepare three wells for each dilution. (5) Incubate 6 days in a humidified 37° C., 5% CO2 incubator. (6) Pulse with [3H]thymidine and harvest as described in support protocol.
[0514] Assay for Lymphokine-Dependent Cell Proliferation
[0515] This protocol assays the lymphokine-dependent proliferation of a lymphocyte population, in this case, the IL-4 dependent proliferation of B cells. Materials: (Tonsil B cell suspension, Anti-Img cross-linked to Sepharose beads (Bio-Rad), 10,000 U/ml human rIL-4 (Genzyme) in complete RPM1-10). (1) Count tonsil B cells and adjust concentration to 1×106 cells/ml with complete RPM1-10. (2) Dispense 100 ul of tonsil B cells into each well. Prepare three wells for each experimental condition. (3) Dilute 10,000 U/ml rIL-4 solution 1:10, 1:100, and 1:1000. Add 20 ul of the stock or dilution to appropriate wells to yield 1000 U/ml, 100 U/ml, 10 U/ml, and 1 U/ml. Include a control well with no rIL-4. (4) Pipet anti-IgM beads into appropriate wells.
[0516] Determine the optimal concentration of beads with pilot experiments. It is best to include several concentrations of beads in each experiment to “bracket” the optimal dose. Prepare wells with tonsil B cells and IL-4 dilutions alone, anti-IgM beads alone, culture medium alone, and all the combinations of IL-4 and anti-IgM bead dilutions. (5) Increase the volume of each well to 200 ul with complete RPM1-10 as necessary. (6) Culture 5 days in a humidified 37° C., 5% CO2 incubator. (7) Pulse with [3H]thymidine and harvest as described in support protocol.
[0517] [3H]Thymidine Pulse and Harvest of Cell Cultures
[0518] This protocol is used in conjunction with the preceding protocols to complete the [3H] thymidine incorporation assay. (1) Add 20 ul of 50 uCi/ml [3H]thymidine to each culture (1.0 uCi) at a fixed time before terminating the culture (usually 6 or 18 hr). (2) Harvest cell cultures using an automated multiwell harvester that aspirates cells, lyses cells, and transfers DNA onto filter paper, while allowing unincorporated [3H]thymidine to wash out. Fill and aspirate each row of the microtiter plate ten times to ensure complete cell transfer and complete removal of unincorporated thymidine. Wash each filter strip with 100% ethanol to facilitate drying. Transfer to scintillation vials. For semiautomated harvester, transfer filter dots for each well into scintillation counting vials. For manual transfer, dry filters under lamp and transfer to scintillation vial with forceps. Add scintillation fluid to each vial. (3) Count samples in scintillation counter until standard deviation is less than 2%. Calculate mean cpm for background cultures and for each experimental condition. There should be less than 20% variation in replicate cultures.
[0519] III. Induction and Measurement of In Vitro Antibody Responses
[0520] The capacity of the human immune system to mount an antibody response following in vivo immunization with a protein or polysaccharide antigen is a revealing indication of the overall integrity of both the B and T cell arms of the immune system. As such, in vivo immunization followed by measurement of the antibody response is an appropriate test of immune function in the various acquired and congenital immunodeficiencies and in a host of other conditions affecting the immune system. The following procedures are for in vivo immunization and for the measurement of the subsequent immune response using an ELISA technique.
[0521] Immuno-Enzymetric Assay for Cytokines Using NIP- and HRPO-Labeled Antibodies
[0522] This protocol describes an immunonoenzymetric assay for cytokines using a heterogeneous, noncompetitive immunoassay reaction in which the cytokine is immobilized by a coating antibody bound to a microtiter plate. Unbound material is washed free, and detection is carried out using a different anti-cytokine antibody labeled with the hapten nitroiodophenyl (NIP). This is in turn detected by a horseradish peroxidase (HRPO) conjugate of an anti-NIP antibody, which is revealed with the chromogenic substrate ABTS. In this noncompetitive immunoassay, the immunoassay signal (A405) increases as a direct function of the amount of cytokine present in the sample. Antibodies are prepared as described in Current Protocols in Immunology, 1995, 6.20.2-6.20.10.
[0523] Coat assay plate. (1) Using a multichannel pipettor, transfer 100 ul of an appropriate dilution of coating antibody into all wells of the assay plate that are to be used. (2) Seal plates with microtiter plate sealer or Parafilm and incubate 2 hr. At 37° C. Prepare samples and standards in preparation plate. (3) Dilute each sample (or aliquot of conditioned medium) to be assayed with an equal volume of immunoassay diluent. (4) Pipet less than or equal to 1 ml of each diluted sample to be assayed into the upper chamber of a separate Spin-X microfiltration device. Microcentifuge 5 min. At 10,000 rpm and save the filtrates that collect in the lower chambers. (5) Add 65 ul of each diluted sample to the appropriate well of a preparation plate (i.e., a separate 96-well microtiter plate). (6) Thaw an aliquot of cytokine standard at room temperature and make sure that it is well mixed. Pipet 130 ul into the well of the preparation plate representing the highest concentration on the standard curve. Transfer 65 ul from this well into the next, then continue performing serial 1:1 dilutions in immunoassay diluent so that 65 ul of each concentration represented on the standard curve is placed in appropriate well of the preparation plate. (7) Thaw an aliquot of calibrator at room temperature (if used). Dilute with an equal volume of immunoassay diluent, then pipet 65 ul of diluted calibrator into appropriate well or wells of preparation plate.
[0524] Incubate with coating antibody. (8) Remove coated assay plate from incubator. Dip in 2-liter beaker filled with 1× with buffer, then invert over sink and flick to remove liquid. Repeat two more times, then bang dry on paper towel. (9) Transfer 50 ul of solution from each well of preparation plate to corresponding well of the assay plate using multichannel pipettor. (10) Seal plate with microtiter plate sealer or Parafilm and incubate 2 hr. at room temperature.
[0525] Incubate with detecting antibody. (11) Dilute NIP-labeled detecting antibody specific to cytokine of interest to 1 ug/ml in detecting buffer. (12) Wash assay plate as in step 8. (13) Add 75 ul diluted detecting antibody from step 11 to all wells of assay plate, including unused outer walls. (14) Reseal plate with microtiter plate sealer or Parafilm and incubate 1 hr. at room temperature.
[0526] Incubate with HRPO-conjugated anti-NIP antibody. (15) Dilute HRPO-conjugated anti-NIP Mab 1:3000 in detecting buffer. (16) Wash assay plate as in step 8. (17) Add 75 ul of diluted HRPO-labeled anti-NIP antibody from step 15 to all wells of assay plate. (18) Reseal plate with microtiter plate sealer or Parafilm and incubate 1 hr. at room temperature.
[0527] Incubate with chromogenic substrate. (19) Wash assay plate as in step 8. (20) Add 100 ul ABTS substrate working solutions to all wells of assay plate. Cover plate and incubate at room temperature until color development reaches desired level (generally until A405 for wells containing the highest concentration of standard is between 1.5 and 2). This protocol usually produces an assay that can be read after 30 to 60 min.
[0528] Read plate and analyze data. (21) Using microtiter plate reader with computer interface, measure absorbance in all wells at 405 nm in single-wavelength mode or at 405 and 650 nm in dual-wavelength mode. (22) Fit standard data to a curve described by a first-degree (linear), second degree (quadratic), or four-parameter (nonlinear) mathematical function using curve-fitting software. (23) Interpolate absorbance data from unknown cytokine samples to fitted standard curve, and calculate cytokine concentrations.
[0529] IV. Induction of an In Vivo Antibody Response Provides an Approach to the Evaluation of the Overall Integrity of the Immune System.
[0530] In the protocols presented here, diptheria and tetanus toxoids are used as representative protein antigens and pneumococcal polysaccharides are used as representative polysaccharide antigens because of their safety and availability. It should be noted, however, that the responses elicited by these antigens are likely to be secondary responses because of past vaccination or natural exposure. To obtain a primary response, an unusual antigen such as keyhole limpet hemocyanin should be used.
[0531] When antigens are administered by the intramuscular or subcutaneous route, as they are here, a “systemic” immune response is induced and measurement of circulating antibody is most appropriate. It is, however, sometimes of interest to evaluate “local” or mucosal immune responses. In this case, the antigen is given either intranasally to stimulate respiratory lymphoid tissue or orally to stimulate gastrointestinal lymphoid tissue and bronchial washings or intestinal fluids, rather than blood, is assayed for antibody content; in addition, antigens are used that are more appropriate for stimulation of the local/mucosal response (i.e., influenza virus antigen for respiratory responses and cholera toxin for gastrointestinal responses).
[0532] In assaying the in vivo antibody response, it is important to determine responses to both protein and polysaccharide antigens because these antigens stimulate different components of the immune system. In this regard, the major antibody response to protein antigen is composed of IgG1 and IgG3 subclass antibodies, whereas the major antibody response to polysaccharide antigen is composed of IgG2 subclass antibody.
[0533] A variety of immunoassay techniques have been used to measure antibody responses in materials obtained after in vivo immunization. Of these, the ELISA assay is perhaps the most useful because it yields a stable, easily measurable, reproducible, and safe readout.
[0534] Induction of In Vivo Antibody Responses to Protein/Polysaccharide Antigens
[0535] In this protocol antigens are administered by the intramuscular or subcutaneous route and serum is collected for measurement of responses. (1) Draw preimmunized blood sample, allow blood to clot, and separate serum from clot by centrifugation. Store serum at −20° C. to −70° C. in appropriately labeled plastic tubes. (2) Inject 0.5 ml of toxoid mixture into an appropriately prepared intramuscular site (deltoid or thigh), taking care not to inject material intravenously. (3) Inject 0.5 ml polyvalent pneumococcal vaccine into an appropriately prepared subcutaneous site, taking care not to inject material intravenously. (4) Draw post-immunization blood samples at desired intervals, usually at 1, 2, and 3 weeks. Separate serum and store at −20° C. to −70° C. (5) After all serum samples are collected, assay samples for presence of antibodies using ELISA.
[0536] The ELISA offers a rapid, sensitive, reproducible, nonradioactive method for measuring in vivo antibody responses to a variety of antigens, including protein and polysaccharide antigens in sera obtained from individuals vaccinated with tetanus and diphtheria boosters and the polyvalent pneumococcal polysaccharide vaccine. Assays specific for tetanus, diphtheria and the pneumococcal polysaccharide types I, II, and III are detailed in Current Protocols in Immunology, 1995, Vols. 6 and 7.
[0537] Assay Using Tumor Rejection
[0538] In another assay for immunomodulation, an immunocompent animal is vaccinated with on the order of 104-108 irradiated cytokine-coated tumor cells, and challenged with on the order of 104-108 live wild-type tumor cells (in any temporal sequence). If survival or tumor onset in these animals differs from that of animal vaccinated, using identical parameters, with irradiated non-cytokine coated cells instead of opsonin-enhanced cells, immunomodulation has occurred. For example, if at least 10% of the animals in the test group survive 100% longer than mean survival in the control group, the test is positive. As another example, onset of tumors in 20% of the test animals might be 50% later than mean onset in the control animals.
[0539] Dosage and Administration
[0540] The invention encompasses methods of modulating an immune response in a mammal to a selected antigen, the method comprising administering to a mammal a therapeutic amount of a composition comprising a multifunctional molecule as described herein, or a composition comprising a multifunctional molecule of the invention and an antigen bearing target, or administering a composition comprising a therapeutic amount of APCs which have been contacted with a multifunctional molecule and antigen bearing target in vitro.
[0541] Compositions described herein may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in or suspension in, liquid prior to infection can also be prepared. The preparation can also be emulsified, or encapsulated in liposomes. The active immunogenic ingredients are often mixed with carriers which are pharmaceutically acceptable and compatible with the active ingredient. The term “pharmaceutically acceptable carrier” refers to a carrier that does not cause an allergic reaction or other untoward effect in subjects to whom it is administered. As used herein, a “pharmaceutically acceptable carrier” does not include culture medium, or any solution containing about 0.2-2% serum or greater. Suitable pharmaceutically acceptable carriers include, for example, one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the vaccine can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the vaccine. Examples of adjuvants which may be effective include but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-alanine-2-1′-2′-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (COP) 19835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosporyl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2% squalene/Tween 80 emulsion. Other examples of adjuvants include DDA (dimethyldioctadecylammonium bromide), Freund's complete and incomplete adjuvants and QuilA. In addition, immune modulating substances such as lymphokines (e.g., IFN-, IL-2 and IL-12) or synthetic IFN-inducers such as poly I:C can be used in combination with adjuvants described herein.
[0542] Compositions of the invention can be administered parenterally, by injection, for example, either subcutaneously or intramuscularly. Additional formulations which are suitable for other modes of administration include suppositories, and in some cases, oral formulations or formulations suitable for distribution as aerosols. In the case of the oral formulations, the manipulation of T-cell subsets employing adjuvants, antigen packaging, or the addition of individual cytokines to various formulations can result in improved oral vaccines with optimized immune responses. For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1%-2%. Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10%-95% of active ingredient, preferably 25-70%.
[0543] The compositions of the invention can be formulated into the vaccine compositions as neutral or salt forms. Pharmaceutically acceptable salts include the acid addition salts (formed with free amino groups of the peptide) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or with organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
[0544] Any cellular component of such vaccine compositions can, in preparation for inclusion in such compositions, be subjected to treatments which involve attenuation or inactivation of the cells of the vaccine, including, for example, exposure to ionizing radiation, which can inhibit cell division, antiproliferative agents such as cyclophosphamide, cytochalasin D, or colchicine, or killing with or without fixation.
[0545] The compositions, including antigen bearing targets and APCs are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and/or therapeutically effective. The quantity to be administered depends on the subject to be treated, including, e.g., capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired. Suitable dose ranges are on the order of several hundred micrograms active ingredient per vaccination with a preferred range from about 0.1 &mgr;g to 1000 &mgr;g, such as in the range from about 1 &mgr;g to 300 &mgr;g, and preferably in the range from about 10 &mgr;g to 50 &mgr;g. Suitable regiments for initial administration and booster shots are also variable but are typified by an initial administration followed by subsequent inoculations or other administrations. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and may be peculiar to each subject. It will be apparent to those of skill in the art that the therapeutically effective amount of cells of this invention will depend, inter alia, upon the administration schedule, the unit dose of antigen administered, whether the cells are administered in combination with other therapeutic agents, the immune status and health of the recipient, and the therapeutic activity of the particular composition.
[0546] The compositions can be given in a single dose schedule, or preferably in a multiple dose schedule. A multiple dose schedule is one in which a primary course of vaccination can include 1-10 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example, at 1-4 months for a second dose, and if needed, a subsequent dose(s) after several months. Periodic boosters at intervals of 1-5 years, usually 3 years, are preferable to maintain the desired levels of protective immunity. The course of the immunization can be followed by in vitro proliferation assays of peripheral blood lymphocytes (PBLs) co-cultured with ESAT6 or ST-CF, and by measuring the levels of IFN-released from the primed lymphocytes. The assays can be performed using conventional labels, such as radionucleotides, enzymes, fluorescent labels and the like. These techniques are known to one skilled in the art and can be found in U.S. Pat. Nos. 3,791,932, 4,174,384 and 3,949,064, which are hereby incorporated by reference.
[0547] Tumors for Which the Invention is Applicable
[0548] The invention contemplates treatment of tumors including but not limited to the following:
[0549] Melanomas, squamous cell tumors, basal cell carcinomas, astrocytomas, gliomas, glioblastoma multiforme, meningiomas, ependymomas, schwannomas, neuroblastomas, retinoblastomas, meningiomas, glomus tumors, sarcomas, including, e.g., osteosarcomas, Ewing's sarcomas, chondrosarcomas, myosarcomas, synovial cell sarcomas, fibrosarcomas, spindle cell tumors, angiosarcomas, primitive neuroectodermal cell tumors, and Kaposi's sarcomas, lymphomas, acute and chronic leukemias, tumors of the head and neck, nasopharyngeal carcinomas, carcinomas of the pharynx, laryngeal carcinomas, carcinomas of the thyroid, carcinomas of the parathyroids, thymomas, esophageal carcinomas, gastric carcinomas, tumors of the small bowel, carcinomas of the colon and rectum, mesotheliomas, lung carcinomas, including adenocarcinomas, squamous cell carcinomas, bronchoalveolar carcinomas, and small cell tumors, pancreatic carcinomas, islet cell and non-islet cell tumors, carcinomas of the breast, cardiac myxomas, pituitary tumors, carcinoid tumors, nepatomas, cholangiocarcinomas, hepatoblastomas, renal cell carcinomas, nephroblastomas, Wilms' tumors, adrenal carcinomas, pheochromocytomas, germ cell tumors, choriocarcinomas, ovarian carcinomas, testicular tumors, seminomas, endometrial tumors, carcinomas of the prostate, carcinomas of the seminal vesicles, vaginal tumors, carcinomas of the penis, hydatiform moles, carcinomas of the gall bladder, and carcinomas of the urinary bladder.
[0550] Subjects for Treatment According to the Invention
[0551] The present invention provides a method for reducing the size and/or number of metastases in a subject. The method comprises administering to the subject a vaccine composition comprising a multifunctional molecule of the invention. A “subject” as used herein, may refer to an organism of the Kingdom animalia, preferably a mammal, and still more preferably a human. A “subject”, according to the invention may also be an animal in need of anti-metastases therapy, e.g., a patient with malignant metastases to one or more organs or tissues, e.g., a human patient with lung or lymph node metastases. A “subject”, according to the invention may also be an animal model of metastases, in which the animal is manipulated, either genetically, or by injection of malignant cells, or by other methods known to those of skill in the art, to simulate the appearance of foci of malignant cells or infected cells which are observed in a similar animal with naturally occurring metastases. The generation of animal models of metastasis is well known in the art, and examples of such models may be found in, for example, Ryan M H et al., J. Immunol. 2001;167:4286-92; Specht J M et al., J Exp Med. 1997;186:1213-21; Nakanishi et al., Tumour Biol. 2003 24:70-6; Wang et al., Int J Gastrointest Cancer, 2001;29(1):37-46; Muralidharan et al., J Clin Laser Med Surg. 2003 21(2):75-83; Tanaka et al., Chest 2003, 123(4):1248-53; Huang et al., Clin Exp Metastasis 2002;19(4):359; and Irvine K R et al., J. Immunol. 1996;156:238-45. One of skill in the art would be able to readily adapt the animal models of metastasis known in the art to generate a metastasis model of interest for any given application.
[0552] Detection of Metastases
[0553] The present invention provides a method of reducing the number and/or size of metastases in a subject comprising administering to a subject, a multifunctional molecule as described herein. One of skill in the art will recognize that the detection and measurement of metastases is routine in the art and may be accomplished using well established methods. For example, metastases may be detected using gross examination of a subject, such as exploratory surgery (e.g., laparotomy). Alternatively, metastases may be detected, measure, and/or observed using less invasive techniques and methods such as thorascopy, mediastinoscopy, and laparoscopy. One of skill in the art may also detect the presence of metastases using imaging techniques known to those of skill in the art. Such techniques include, but are not limited to radiographic imaging, computerized tomography (CT scan), magnetic resonance imaging (MRI), positron emission tomography (PET scan), single photon excitation (SPECT), and radionuclide scintigraphy (e.g., bone scan). The sensitivity of many of the above imaging methods may be enhanced, as known by those of skill in the art by injection or IV administration of contrast agents (e.g., iodine or barium) to a subject to be imaged. Additional methods for assessing the presence of, or detecting, or measuring metastasis is through the use of gross or histological pathologic examination (i.e., in which a tissue sample is removed from a subject an examined at eaither or both of the gross anatomical level, or at the histological or ultrastructural level according to methods which are well known in the art). The above methods for the detection, measurement, and imaging of metastases are known to those of skill in the art and may be adapted according to the knowledge in the art to particular tissues, organs, or cells which one of skill in the art wishes to asses according to the methods of the invention. More detailed descriptions of such methods may be found in the art, for example, the Oxford Textbook of Oncology, 2nd Ed., New York, Oxford University Press, 2002.
[0554] According to the invention, metastasis is detected if any amount of metastasis is detected in a subject. That is, upon the detection of even a single foci in a subject, metastasis may be said to have been detected. Preferably, metastasis is detected as plural metastatic foci, in one or preferably one or more organs in a subject.
[0555] Transgenic Animals According to the Invention
[0556] A nucleic acid molecule encoding a multifunctional molecule as described herein can be used to produce nonhuman transgenic animals, and cells of such transgenic animals can be isolated and used in a vaccine formulation in animal or human vaccination.
[0557] For example, in one embodiment, a nucleic acid molecule is introduced into a fertilized oocyte or an embryonic stem cell. Such cells can then be used to create non-human transgenic animals in which exogenous nucleic acid molecules encoding the polypeptides of the invention have been introduced into their genome or homologous recombinant animals in which endogenous nucleic acid molecules have been altered. Such animals are useful for studying the function and/or activity of the molecules of the invention and for identifying and/or evaluating modulators of the activity of the molecules of the invention. As used herein, a “transgenic animal” is a non-human animal, prefers mammal, more preferably a mouse, in which one or more of the cells of the animal includes a transgene. A transgene is exogenous nucleic acid which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.
[0558] A transgenic animal of the invention can be created by introducing nucleic acid molecules encoding the polypeptides described herein (i.e., a multifunctional molecule) into the male pronuclei of a fertilized oocyte, e.g., by microinjection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence(s) can be operably linked to the transgene to direct expression of a polypeptide of the invention to particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the nucleic acid molecule of the invention, e.g., the transgene in its genome and/or expression of the transgene mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding polypeptides of the invention can further be bred to other transgenic animals carrying other transgenes.
[0559] The invention is further illustrated by the following exemplifications which should not be construed as being further limiting.
EXAMPLES Example 1 Cloning of a Murine GM-CSF Fused to the S. cerevesiae Gas1 GPI Modification Signal Sequence[0560] The starting point for producing a yeast expression vector was the pUC 19-GM-CSF-mammalian GPI signal sequence plasmid (pUC19-GM-CSF-GPI). This plasmid encodes murine GM-CSF (upstream) fused in-frame to the human Thy-1 GPI modification signal sequence (downstream). The following two oligonucleotides were purchased from Midland Certified Reagent Company (Midland, Tex.): 8 GTX-5 5′pAATTCCGCGCCGGCACAGTGCTCAGAGACAAACTGGTCAAGTGTGAGGGCATCA GCCTGCTGGCTCAGAACACCTCGTGGCTGCTGCTGCTCCTGCTGTCCCTCTCCCTCCT CCAGGCCACGGATTTCATGTCCCTGTGACTGGGTAC3′
[0561] GTX-5 comprises:
[0562] a. Sequences at the 5′ end suitable for ligating to an EcoRI site (bases 1-5)
[0563] b. An NgoM1 site for creating an in-frame chimeric coding sequence (bases 9-14)
[0564] c. The coding sequence for the GPI modification sequence of human Thy-1 (Genbank Accession No. M11749) (bases 15-137)
[0565] d. A termination codon (bases 138-140)
[0566] e. Sequences at the 3′ end for ligating to a KpnI site (bases 144-148) 9 GTX-6 5′pCCAGTCACAGGGACATGAAATCCGTGGCCTGGAGGAGGGAGAGGGAC AGCAGGAGCAGCAGCAGCCACGAGGTGTTCTGAGCCAGCAGGCTGATGCC CTCACACTTGACCAGTTTGTCTCTGAGCACTGTGCCGGCGCGG3′
[0567] This oligonucleotide is complementary to GTX-5, except for staggered ends.
[0568] GTX-5 and GTX-6 were dissolved in individual tubes in sterile water at a final concentration of 1 microgram/lambda. GTX-5 and GTX-6 were mixed at a final concentration of 100 ng/lambda and allowed to anneal for 60 minutes at room temperature.
[0569] The GTX-5:GTX-6 double stranded oligonucleotide was then cloned into the plasmid pUC19. Four micrograms of pUC19 DNA was digested with EcoRI and KpnI. After electrophoresis, the linear DNA was purified from a 0.7% agarose gel using a Qiagen (Santa Clarita, Calif.) gel purification kit according to instructions provided by the manufacturer. 100 ng of the GTX-5:GTX-6 oligonucleotide was ligated to 200 ng of the EcoRI-KpnI digested pUC19 in a final volume of 20 microliters at room temperature for 60 minutes.
[0570] The plasmid was transformed into competent AG-1 cells, which were purchased from Stratagene. Transformed E. coli were inoculated onto LB-amp plates. Bacterial colonies grown on LB plates containing ampicillin (100 micrograms/ml) were picked and inoculated into one ml of LB with amp and grown overnight at 37° with shaking.
[0571] Plasmid DNA was isolated using a standard alkaline lysis miniprep protocol and DNA was digested with EcoRI and KpnI. DNA was electrophoresed on 1.6% agarose gels stained with ethidium bromide, and colonies containing an EcoRI-KpnI fragment of approximately 148 bp were thus identified. Positive colonies were inoculated into 100 ml of LB with ampicillin and grown overnight. Plasmid DNA was again purified using kits purchased from Qiagen.
[0572] The nucleotide sequence of a Thy-GPI positive clone, designated pUC-GPI 21, was sequenced, confirming its identity.
[0573] The GM-CSF coding sequence was amplified by PCR from a mouse lung cDNA library purchased from Clontech. PCR was performed for 35 cycles using pfu polymerase and the following primers: 10 Upstream 5′CCGAATTCATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCT AC3′ Downstream 5′CAGCCGGCTTTTTGGACTGGTTTTTTGCATTCAAAGGGGATATCAGTC AG3′
[0574] PCR parameters were denaturation at 90° for 1 minute, annealing at 60° for 1 minute, and extension at 720 for 1 minute.
[0575] The GM-CSF chain PCR product was purified after electrophoresis through a 1% agarose gel. The DNA band was excised and the DNA fragment purified using a kit purchased from Qiagen.
[0576] The purified GM-CSF DNA fragment was digested with EcoRI and NgoM1. After digestion, the reaction mix was extracted with phenol:chloroform (1:1) followed by chloroform. The aqueous phase was adjusted to 0.3M sodium acetate pH 5.2 and the DNA was precipitated with 2 volumes of ethanol at −80° for 2 hours. The DNA was pelleted by centrifugation, ethanol was removed, and the pellet was rinsed with 70% ethanol. The pellet was dried under vacuum.
[0577] The GM-CSF DNA was resuspended in sterile water and ligated to pUC19-GPI 21 that had been digested with EcoRI-NgoM1. Ligation was for one hour at room temperature. PUC19 GPI 21 ligated to GM-CSF DNA was used to transform competent AG-1 cells. Transformed AG-1 cells were selected on LB plates with ampicillin. Plasmid DNA was isolated and analyzed as above. Restriction digests were performed to confirm the pUC 19 GPI-GM-CSF chimeric construct. The DNA from several positive clones was isolated and sequenced.
[0578] This plasmid was digested with NgoMIV and KpnI, and the larger resulting fragment isolated after electrophoresis through a 1% agarose gel.
[0579] The 280 bp GPI modification signal sequence from the yeast protein Gas1 was amplified by PCR from the yeast cosmid clone C9952 (ATCC). This PCR employed pfu polymerase and the primers: 11 Upstream Primer 5′GTAGCCGGCGCTAGCTCGGGGTCTTCTTCCAAGTCTA Downstream Primer 5′TACGGTACCCCTAGGCCACAATGAAATAAGATACCATACC3′
[0580] These primers add a 5′ NgoMIV site and a 3′ KpnI site to the Gas I fragment. 12 Conditions Denaturation 90° one minute for PCR were: Annealing 60° one minute Extension 72° one minute Cycles 25
[0581] The PCR product was purified after electrophoresis through a 1% agarose gel and digested with NgoM IV and KpnI. The Gas1 GPI signal sequence was then ligated into the pUC19-GM-CSF-GPI plasmid prepared above so that the Gas1 signal sequence was fused in-frame downstream of the GM-CSF sequence, replacing the Thy-1 sequence. This vector is termed pUC19-GMCSF-Gas1.1. The resultant plasmid was then transformed into AG-1 competent E. coli (Stratagene) and plasmid clones were isolated by alkaline lysis mini-prep. Plamids were then screened for inserts by restriction digest. DNA from a positive clone was sequenced to confirm the identity of the GAS1 coding region.
[0582] A yeast expression plasmid for GPI-GM-CSF was then generated utilizing the pITY-4 vector, which was kindly provided by Dr. K. Dane Wittrup (University of Illinois). This plasmid stably integrates into the yeast genome and allows high-level expression of heterologous genes. Features of pITY-4 include: a delta sequence (LTR of Ty element) that enables multiple integration events by homologous recombination; a neo/kanamycin resistance gene that provides for selection in E. coli and tunable selection in yeast; the Gal1 promoter for high-level inducible transcription; a unique EagI cloning site; a synthetic Pre-Pro sequence optimized for efficient secretion of expressed genes; the alpha factor termination sequence; and an origin of replication for propagation in E. coli. In this system, yeast are grown in dextrose-containing media for 3 days, then are switched to media containing galactose to induce transcription of genes inserted downstream of the Gal1 promoter.
[0583] The GMCSF-Gas1 insert described above was amplified by PCR from pUC 19-GMCSF-Gas1.1 using pfu polymerase and the primers: 13 Upsteam 5′TACGGCCGGCACCCACCCGCTCACCC3′ Downstream 5′TACGGCCGCCACAATGAAAATAAGATACCAT3′
[0584] These primers add EagI sites at both ends for cloning into the pITY-4 plasmid. 14 Conditions Denaturation 90° one minute for PCR were: Annealing 60° one minute Extension 72° one minute Cycles 25
[0585] The PCR product was purified after electrophoresis through a 1% agarose gel and digested with EagI. The EagI-flanked GMCSF-Gas1 fragment was ligated into EagI-digested pITY-4 and used to transform E. coli AG1 cells. E. coli were then grown on kanamycin-containing LB plates (100 ug/ml). Plasmids from kanamycin resistant colonies were purified by mini-prep and mapped by restriction digests for presence and correct orientation of inserts. The identity of a positive clone was confirmed by sequencing. This plasmid is termed pITY-GMCSF-Gas1.1.
Example 2 Expression of Murine GM-CSF Fused to the Gas1 GPI Modification Signal Sequence in Yeast[0586] A 50 ml culture of the E. coli clone containing pITY-GMCSF-Gas1.1 was grown in LB with 100 ug/ml kanamycin and the plasmid purified using a Midi-Prep Kit from Qiagen. The S. cerevesiae strain BJ5464 (ATCC) was then transformed with pITY-GMCSF-Gas 1.1 using a lithium acetate (LiAc) protocol. A 10 ml overnight culture of BJ5464 in YPD (Per liter: 20 g Bactotryptone, 10 g yeast extract, 20 g dextrose) was used to inoculate a 100 ml flask. Yeast were grown for 3 hours at 30° and then harvested by centrifugation at 12,000×g for 2 minutes at room temperature. Cells were washed with sterile water and centrifuged again. The cells were resuspended in 1.0 ml of 100 mM LiAc, transferred to a 1.5 ml microfuge tube and centrifuged in an Eppendorf microfuge at top speed for 15 seconds. The cells were then resuspended in 0.5 ml of 100 mM LiAc and 50 uL samples were aliquoted to individual tubes. The cells were pelleted. 240 uL of PEG (50% w/v), 36 uL 1.0M LiAc, 5 uL (10 mg/ml) boiled carrier DNA (salmon sperm DNA, Sigma), and 2 ug plasmid in 75 uL water, were then added in that order. After the addition of plasmid, the tube was vortexed, incubated at 30° for 30 minutes and heat-shocked at 42° for 15 minutes. The cells were then pelleted, resuspended in sterile water and plated on YPD plates containing 1 mg/ml G418.
[0587] Individual colonies of G418-resistant yeast were picked and grown in one ml of YPD with 1 mg/ml G418 for 3 days. The cells were then pelleted by centrifugation in a microfuge and the YPD (dextrose-containing, galactose-free) media was replaced with YPG (20 g bactotryptone, 10 g yeast extract, 20 g galactose per liter) with 1 mg/ml G418. Yeast were grown in YPG for 3 days to allow full induction of transcription from the Gal1 promoter. After induction, cells were pelleted, washed with TN (0.15M NaCl, 25 mM Tris pH 7.4) and lysed in TN containing 20 mM octyl glucopyranoside (OGP), 1 mM PMSF, and lug/ml each aprotinin, leupeptin and pepstatin. Yeast were lysed by vortexing with acid-washed glass beads (425-600 microns, Sigma). Insoluble material was pelleted and the supernatant assayed using a murine GM-CSF ELISA (Endogen). A colony expressing high levels of GPI-GM-CSF was identified. Based on standard curve of soluble GMCSF, we estimate expression to be approximately 25 ug/L, a significant improvement over mammalian expression and sufficient for in vivo experiments. This yeast clone is designated SC-GM-GPI.
[0588] One of the advantages of stably integrating vectors for expression in yeast is that, after the initial cloning and colony isolation, antibiotic maintenance is no longer required. To confirm this, cells were grown with and without G418 and tested for GPI-GM-CSF expression. We have seen no decrease in expression levels in the absence of G418 over 8 months.
[0589] To produce GPI-GM-CSF on a scale suitable for in vitro and in vivo functional characterization, 500 ml of YPD was inoculated with SC-GM-GPI and grown for three days at 300 with shaking. Cells were pelleted by centrifugation at 12,000×g for 2 minutes at room temperature and transferred to an equal volume of YPG for an additional three days of growth. Cells were then pelleted, washed with TN and lysed in 25 ml of TN containing 20 mM OGP, 1 mM PMSF, and lug/ml each aprotinin, leupeptin and pepstatin. Cells were then lysed by vortexing with acid washed glass beads, 20 g/500 ml culture, (425-600 microns, Sigma). Insoluble material was pelleted at 8,000×g for 10 minutes at room temperature and the soluble material was applied to an immunoaffinity column of anti-murine GMCSF monoclonal antibody (Endogen) linked to cyanogen bromide-activated Sepharose 4B (Sigma). Coupling of the monoclonal to the Sepharose was performed according to the manufacturer's instructions. Efficiency of coupling was monitored using OD280 and binding of murine GM-CSF to immobolized antibody was confirmed using commercially available, recombinant cytokine.
[0590] Soluble yeast-derived material was applied to the column and allowed to flow by gravity. The column was washed sequentially with: (a) 20 volumes of TN with 1% Triton X-100; (b) 5 volumes of 50 mM Tris pH 8.0, 1 mM OGP; (c) 20 volumes TN with 1 mM OGP. Bound material was then eluted with 10 volumes of 0.15M NaCl, 25 mM Tris pH 2.5 with 1 mM OGP. Eluted material was neutralized with {fraction (1/200)} volume of 1.5M Tris pH8.8. The purified material was concentrated using a Microsep 3K centrifugal device (Pall Gelman Laboratory). Yields of GPI-GM-CSF were determined by ELISA (Endogen) to be 25 ug/L of culture. Final concentration was adjusted to 40 ug/ml by addition of 0.15M NaCl, 25 mM Tris pH 7.4 with 1 mM OGP.
[0591] Purified GPI-GM-CSF was analyzed by stained gel and western blot. Approximately lug of purified GPI-GM-CSF or recombinant soluble murine GM-CSF per lane were electrophoresed. Gels were then stained with silver nitrate using the Sigma silver staining kit according to the manufacturer's directions (Sigma). For western blots, gels were transferred to Protran BA83 (Schleicher and Schuell) using an Owl Scientific electric transblotter and blocked with TBS (Tris Buffered Saline) containing 0.05% Tween 20 and 2% nonfat dry milk overnight at room temperature. The blot was then incubated with primary antibody (rat monoclonal anti-murine GMCSF, Endogen) at 1:5000 dilution in blocking buffer for 2 hours at room temperature. The blot was washed with TBS-0.05% Tween 20, and incubated with a secondary antibody, alkaline phosphatase conjugated goat anti-rat IgG (Sigma) at 1:10,000 for 1 hour at room temperature. After washing, color was developed with NBT-BCIP (Sigma). A single dominant band migrating at approximately the same rate as a recombinant soluble GM-CSF standard was clearly present on both the gel and the blot (the molecular weight of the GPI moiety is only approximately 1500 compared to approximately 14,000 for the protein moiety]. Given the immunoreactivity with anti-GM-CSF and the ability of this material to bind to tumor cell membranes, these bands appear to represent GPI-GM-CSF. While some high molecular weight material, possibly representing aggregates, is visible in the blot, this material is not visible in the less sensitive silver stain, indicating that it is present in lower amount than the dominant band.
Example 3 Attachment of Murine GM-CSF Fused to the Gas1 GPI Modification Signal Sequence to Cells[0592] Wild type CMS-5 murine fibrosarcoma cells grown in DMEM, 10% FBS, Pen-Strep were harvested, washed twice with RPMI 1640 (Life Technologies) and resuspended in RPMI 1640 at a concentration of 5×105 cells/ml. 0.9 ml aliquots of the cell suspension were dispensed to Eppendorf siliconized microfuge tubes. Each aliquot received either 1 ug of purified GPI-GM-CSF prepared as in Example 2, 1 ug of soluble recombinant murine GM-CSF (Intergen, supplied as lyophilized powder and reconstituted at 40 ug/ml in the same buffer as GPI-GM-CSF), or media alone. Cells were then incubated for 3 hours at 37° C. with shaking and then washed 3 times with PBS containing 2% FBS.
[0593] For detection of GPI-GM-CSF by flow cytometry, cells were incubated with a rat anti-murine GM-CSF monoclonal antibody (Endogen) for one hour at 4° C. The cells were then washed 3 times with PBS containing 2% FBS, and incubated with FITC-labeled goat anti-rat IgG antibody (Sigma) for one hour at 4° C., and again washed 3 times with PBS containing 2% FBS. The cells were analyzed by flow cytometry on a Becton-Dickinson Facscalibur. Decoration with GPI-GM-CSF caused an approximately 10-fold increase in peak and mean FL-1 fluorescence relative to cells incubated with media alone. In contrast, cells incubated with soluble GM-CSF had virtually the same profile as the negative control cells. This data indicates that GPI-GM-CSF, but not soluble recombinant GM-CSF, can bind to tumor cells.
[0594] GPI-GM-CSF attached to CMS-5 cells was also detected and quantitated by ELISA. CMS-5 cells were harvested and washed as described above. 1×106 cells in 1 ml of RPMI 1640 were incubated with 1 ug of purified GPI-GM-CSF. After incubation for 2 hours at 37° C., the cells were washed 3 times with PBS containing 2% FBS. The cell pellet was lysed with 50 microliters of PBS containing 0.15% deoxycholate and the detergent subsequently diluted by the addition of 200 microliters of PBS. The material was serially diluted with PBS and amounts of GM-CSF determined using an ELISA kit (Endogen) against a soluble, recombinant GM-CSF standard provided by the manufacturer. Based on this data, the mean number of GPI-GM-CSF molecules incorporated/cell over five experiments was 37,000+/−33,000. The large standard deviation was due to one experiment in which the number of molecules/cell was 66,000. Excluding this experiment, the mean was 29,500+/−4,500.
[0595] “Decoration” of B16 murine melanoma cells with GPI-GM-CSF was also quantitated by ELISA. Decoration and ELISA were performed exactly as described for CMS-5 cells. The mean number of molecules/cell over three experiments was 21,000+/−11,500.
Example 4 Stability of Murine GM-CSF Fused to the Gas1 GPI Modification Signal Sequence on Cells[0596] To study the stability of incorporated GPI-GM-CSF on cells, CMS-5 cells were harvested and decorated as described above in Example 3. After decoration, the cells were washed 3 times with PBS containing 2% FBS and then resuspended at 4×106 cells/ml in RPMI 1640. The cells were irradiated at 3500 rads from a 137CS source. The cells were then incubated at 37° C. in 5% CO2 and aliquots were removed at hourly intervals, washed three times, and lysed in 50 ul PBS with 0.15% deoxycholate. 200 ul of PBS was then added to dilute the deoxycholate. Cell-associated GM-CSF was measured by ELISA. Even at 6 hours, cells showed only about a 20% loss of cell-surface GPI-GM-CSF. After 6 hours, viability of irradiated cells (both decorated and non-decorated) as measured by microscopic inspection with trypan blue staining was significantly compromised. However, in vivo data (see below) indicates that both cell-surface retention of GPI-GM-CSF and post-irradiation cellular viability are sufficient to sustain a biological effect.
Example 5 Bioactivity of Murine GM-CSF Fused to the Gas I GPI Modification Signal Sequence to Cells[0597] The bioactivity of GPI-GM-CSF was assayed by determining the molecule's ability to support the proliferation of the FDC-P1 cell line, a murine bone-marrow derived, GM-CSF dependent cell line. Proliferation of FDC cells was measured with the Biotrak Cell Proliferation ELISA (Amersham Pharmacia), an assay that utilizes the thymidine analogue 5-bromo-2′-deoxyuridine (BrdU). WEHI cells (ATCC) were grown in Iscove MEM, 10% FBS, Penicillin-streptomycin, as a source of conditioned media for FDC-P1 cells. FDC-P1 cells were grown in DMEM, 10% FBS, Penicillin-streptomycin with 25% WEHI conditioned media, harvested, and washed 3 times with DMEM, 10% FBS, Penicillin-streptomycin. The cells were resuspended at 1×105/ml in DMEM, 10% FBS, Penicillin-streptomycin and 100 uL was aliquoted to individual wells of a 96 well microtitre plate. Groups, done in triplicate, were as follows:
[0598] A. Media—No Cells
[0599] B. FDC-P1 Cells-Unstimulated
[0600] C. FDC-P1 Cells+10 ng soluble GM-CSF
[0601] D. FDC-P1 Cells+10 ng GM-CSF as GPI-GM-CSF (as determined by ELISA against GM-CSF standard)
[0602] E. FDC-P1 Cells+10 ng GPI-GM-CSF (as in “D”) denatured by extraction of the protein with chloroform:methanol (3:1) followed by acetone precipitation and resuspension.
[0603] All protein solutions were diluted to 100 ng/ml in 0.15M NaCl, 25 mM Tris pH 7.4 with 1 mM OGP, so that the volume added to each well was 100 uL.
[0604] The non-isotopic proliferation assay was performed according to the manufacturer's instructions. The plated cells were grown for two days at 37° C. in 5% CO2. On day 3, 10 ul of the BrdU solution was added to individual wells and the cells incubated for 3 more hours. The plate was then centrifuged at 300×g for 10 minutes and the supernatant removed. The plate was dried by incubating at 60° C. for one hour. The plate was then fixed and blocked according to the manufacturer's instructions. The fixed cells were then incubated with peroxidase-labelled anti-BrdU for 90 minutes. The wells were then washed and color developed with TMB according to the manufacturer's instructions. In two experiments, GPI-GM-CSF consistently sustained proliferation at a level somewhat (about 25%) higher than did soluble recombinant GM-CSF, indicating that GPI-GM-CSF is suprabioactive. The effect of GPI-GM-CSF was not due to the GPI moiety alone, since denatured GPI-GM-CSF did not support proliferation. The GPI moiety remained linked to the protein after denaturation, since the protein was still able to decorate cells as demonstrated by ELISA, which recognizes linear epitopes on GM-CSF.
Example 6 Effective Immunization with Cells Admixed with GPI-GM-CSF[0605] These experiments included mice vaccinated with:
[0606] (a) Wild-type cells (WT)
[0607] (b) Cells incubated with soluble GM-CSF—Unwashed (total GM-CSF in dose: 1 microgram)
[0608] (c) Cells decorated with GPI-GM-CSF—Unbound GPI-GM-CSF Washed off Following Incubation (total GPI-GM-CSF in dose: 0.74 nanograms by ELISA [mean of 2 experiments; 73 and 75 ng individually]
[0609] (d) Cells decorated with GPI-GM-CSF-Unwashed (total GM-CSF in dose: 1 microgram)
[0610] GPI-GM-CSF mass and concentration values are expressed in terms of equivalence to GM-CSF as determined by ELISA against a soluble GM-CSF standard.
[0611] CMS-5 cells were grown to 70% confluence in DMEM, 10% FBS, Penicillin-streptomycin, harvested trypsinization, and washed 3 times with RPMI 1640. Viability was determined by trypan blue staining of an aliquot and the cells were then resuspended at a concentration of 4×106 cells/ml a 1 ul aliquots dispensed into siliconized microfuge tubes. The cells were incubated with 1 ug GPI-GM-CSF or 1 ug soluble recombinant murine GM-CSF per 106 cells for 3 hours at 37° C. “Washed” groups were then washed 3 times with PBS, 2% FBS and resuspended at 4×106 cells/ml in RPMI 1640. An aliquot of the washed GPI-GM-CSF decorated cells was removed and the amount of cell-associated GM-CSF measured by ELISA as described above. There were approximately 31,000 and 32,000 GPI-GM-CSF molecules/cell in the washed decorated groups in the two experiments, respectively.
[0612] The cells were irradiated at 3500 rads from a 137CS source. 8-10 week-old female Balb/c mice (which are syngeneic for CMS-5) were anesthetized by metofane inhalation and vaccinated subcutaneously in the left inguinal fold with 1×106 cells in 0.25 ml. Seven days later, wild-type CMS-5 cells at 70% confluence were harvested and washed 3 times in HBSS. Viability was determined by trypan blue staining of an aliquot and cells were adjusted to 4×106/ml in HBSS. The previously vaccinated mice were then injected subcutaneously behind the neck, under metofane anesthesia, with 2×106 live, wild-type CMS-5 cells in 0.5 ml HBSS.
[0613] Tumor development was assessed daily by palpation and visual inspection. “Onset” was defined as the first day on which a tumor mass was both palpable and visible. The observer was blinded to the vaccine received by each set of mice to ensure against bias. Mice were sacrificed by CO2 asphyxiation when tumors become unwieldy. Experiments were terminated 70 days after tumor challenge, as planned in advance.
[0614] Data is pooled from three experiments for GPI-GM-CSF unwashed, soluble GM-CSF, and wild-type vaccine groups. Data for these groups includes that from undepleted controls in a lymphocyte subset depletion experiment. Data for the GPI-GM-CSF washed group is pooled from two experiments, since this group was not included in the initial depletion experiment. The depletion experiment had 4 mice/group, and the other experiments had 5/group. In terms of total mouse numbers, n=14 for GPI-GM-CSF unwashed; 10 for GPI-GM-CSF washed; 14 for soluble GM-CSF unwashed; and 14 for WT. Approximate percentages of mice surviving tumor-free to day 70 after challenge were: WT, 15%; soluble GM-CSF, 50%; GPI-GM-CSF washed, 60%; GPI-GM-CSF unwashed, 85%. Thus, even though the GPI-GM-CSF washed vaccine contained over a thousand-fold less GM-CSF than the unwashed soluble, administration of cells decorated with GPI-GM-CSF was more effective. Furthermore, the GPI-GM-CSF unwashed vaccine, in which some molecules were not attached to a cell, was even more effective.
Example 7 Cloning and Expression of Human GM-CSF Fused to the Gas1 GPI Modification Signal Sequence[0615] Human GM-CSF is amplified by PCR from a human T cell cDNA library (Clontech) using Pfu polymerase (Stratagene). The following primers are used: 15 Upstream 5′GCGAATCCCGGCCGGCACCCGCCCGCTCGCCCAGCCCC Downstream 5′CAGCCGGCCTCCTGGACTGGCTCCCAGCAGTC
[0616] The upstream primer contains EcoR1 and Eag1 restriction sites immediately preceding the first amino acid found in the mature human GM-CSF protein. Since expression in S. cerevisiae utilizes a yeast leader sequence, cloning of the human GM-CSF begins at the N terminus of the mature protein. Each downstream primer omits the native stop codon to allow in-frame ligation to the sequence encoding the Gas1 GPI modification signal. The downstream primer contains an NgoM IV restriction site, consistent with restriction sites used in other constructs.
[0617] PCR parameters are denaturation at 97° C. for 1 minute,
[0618] annealing at 56° C. for 1 minute, and
[0619] extension at 72° C. for 2 minutes.
[0620] PCR is performed for the least number of cycles yielding a visible band on agarose gel electrophoresis. After amplification, the reaction mix is allowed to cool at 4° for 10 minutes.
[0621] The PCR product is isolated by electrophoresis through a 1% agarose gel and eluted from the excised agarose band using a commercially available kit (Qiagen). The purified hGM-CSF DNA fragment is digested with EcoR1 and NgoM IV and ligated to the (murine) pUC19 GM-CSF-GPI plasmid that has been digested with EcoR1 and NgoM IV. This replaces the murine GM-CSF with its human counterpart. The pUC19-hGM-CSF GPI plasmid is then transformed into competent AG-1 E. coli cells, 30 colonies are picked for mini-culture, and plasmid clones are isolated and purified using commercially available kits (Qiagen). Positive clones are identified by restriction enzyme test digest and agarose gel electrophoresis. Positive E. coli colonies are grown overnight in maxi-culture and their plasmids purified using Qiagen maxi-prep kits. Inserts are sequenced.
[0622] To clone GM-CSF GAS1g into the pITY-4 expression vector, PCR of this construct from the pUC19 vector is performed. The primers are: 16 5′TACGGCCGGCACCCGCCCGCTCGCCCAGCCCC 3′TACGGCCGCCACAATGAAAATAAGATACCAT
[0623] The upstream primer has an EagI site immediately preceding the first codon of the mature GM-CSF. This removes the mammalian secretion signal and allows for in-frame ligation to the yeast signal sequence. The same restriction site can be used as for the mouse construct because it is absent in the human sequence. The downstream primer appends an EagI site at the 3′ end. PCR is performed using Pfu polymerase for 25 cycles. Conditions for PCR are: denaturation 90° one minute, annealing 60° one minute, extension 720 one minute. After amplification, the reaction mix is allowed to cool at 4° for 10 minutes.
[0624] The PCR product is isolated by electrophoresis through a 1% agarose gel and eluted from the excised agarose band using a commercially available kit (Qiagen). The purified GM-CSF GAS1g DNA fragment is digested with EagI, ligated to pITY-4, and transformed into AG-1 chemically competent bacteria (Stratagene). 30 colonies are picked for mini-culture and plasmid clones are isolated and purified using commercially available kits (Qiagen). Positive clones are identified by restriction enzyme test digest and agarose gel electrophoresis. Positive E. coli colonies are grown overnight in maxi-culture and their plasmids purified using Qiagen maxi-prep kits. Inserts are sequenced.
[0625] The GPI-human GM-CSF molecule is expressed in S. cerevesiae as described for the murine molecule in Example 2. Immunoaffinity purification is performed as described in Example 2, substituting an anti-human GM-CSF antibody for the anti-murine GM-CSF antibody. ELISA to detect and quantitate the molecule, whether in isolation or bound to an antigen bearing target, is performed using an anti-human GM-CSF monoclonal antibody, as is flow cytometry on cells decorated with the molecule.
Example 8 Cloning of GM-CSF/Influenza Hemagglutinin Chimeric Proteins[0626] pUC19 GMCSF-K-GAS1.1
[0627] pUC19 GM-CSF-K-HA was cloned starting with pUC19 GM-CSF-K-Gas1.1, which we produced in our laboratory. This plasmid includes a sequence that encodes murine GM-CSF fused to a downstream glycosylphosphatidylinositol modification sequence derived from the yeast GAS 1 protein (the latter obtained from Dr. D. Wittrup, University of Illinois). A linker sequence is interposed between the GM-CSF and GAS 1 portions. To insert the linker sequence, the plasmid pUC19 GMCSF-Gas1.1, also previously produced in our lab, was digested with NgoM IV and NheI. These restriction enzymes cut at the 3′ end of the GM-CSF molecule and at the 5′ end of the Gas 1.1 sequence, respectively. The resulting plasmid was purified after electrophoresis through agarose gel using a kit manufactured by Qiagen. The following oligonucleotides were purchased: 17 5′CCGGCACTAGTGGCGGAGGGGGCTCCGGCGGCGGGGGCAGCG 5′CTAGCGCTGCCCCCGCCGCCGGCGCCCCCTCCGCCACTAGTG
[0628] The synthetic oligonucleotides contain:
[0629] 1. 5′ overhang that anneals to NgoM IV digested plasmid DNA
[0630] 2. 3′ overhang that anneals to Nhe I digested plasmid DNA
[0631] 3. DNA sequence coding for the peptide GGGGSGGGGS where G stands for glycine and S stands for serine. This 10 amino acid sequence (G4S)2 is designed to insert a kink/spacer in the protein between the GMCSF and the Gas 0.1 moieties.
[0632] 4. SpeI site to allow confirmation of cloning of the small fragment and for further manipulations.
[0633] The two oligonucleotides were mixed in equimolar concentrations, boiled for 2 minutes and allowed to anneal at room temperature. The oligonucelotide was ligated into the NgoM IV-Nhe I digested plasmid and the plasmid was used to transform the E. coli strain AG-1. Transformants were selected on LB plates containing 100 ug/ml ampicillin. Plasmid DNA was isolated, digested with Spe I, and electrophoresed on agarose gels to confirm the presence of the (G4S)2 sequence.
[0634] pUC19 GM-CSF-K-hemagglutinin (HA)
[0635] The plasmid pUC19 GM-CSF-K-HA was produced, which encodes a chimeric protein containing (from amino terminal to carboxy terminal): (1) murine GM-CSF; (2) the (G4S)2 linker described above; and (3) the HA1 domain of the H1 HA from the A/PR/8/34 influenza A isolate. The HA1 sequence used (amino acids 18 to 344 of the HA precursor) omits the N-terminal leader sequence and the downstream HA2 domain. A termination codon was added after amino acid 344.
[0636] pUC 19 GM-CSF-K-Gas 1.1. was digested with Nhe I and Kpn L. Nhe I cuts at the 5′ end of the Gas 1.1 coding sequence and Kpn I cuts at the 3′ end of the Gas 1.1 coding sequence, respectively. The resulting plasmid with the GPI coding region removed, was purified after electrophoresis through agarose gel using a kit manufactured by Qiagen. The HA1 coding sequence was cloned by PCR from a plasmid encoding the HA gene of the A/PR/8/34 strain of influenza. The HA1 sequence used begins at amino acid 18, the start of the mature protein, i.e. lacking the secretion signal sequence. The 3′ end corresponds to amino acid 344, eliminating the transmembrane region and substituting a termination codon. Primers for PCR of the HA1 sequence were as follows: 18 Upstream HA1 Primer 5′ATGCTAGCGACACAATATGTATAGGC Downstream HA1 Primer 5′ATGGTACCCGGCCGTTATCATCTGGATTGAATGGACGG
[0637] 19 Conditions Denaturation 90° one minute for PCR were: Annealing 60° one minute Extension 72° one minute
[0638] PCR was performed for 20 cycles using vent polymerase.
[0639] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the HA1 cDNA was extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified HA1 DNA fragment was digested with Nhe I and Kpn I. To make the fusion protein, the purified Nhe 1-Kpn I HA fragment was ligated into the pUC 19 GM-CSF-K-Gas1.1 vector that had been digested with Nhe I and Kpn I to remove the Gas1.1 coding region. The DNA was used to transform E. coli AG1 and transformants selected on LB-ampicillin plates. Plasmid DNA from individual colonies was isolated and digested with restriction enzymes. Restriction digests identified a pUC19 GM-CSF-K-HA plasmid.
[0640] The pUC19 GM-CSF-K-HA plasmid was purified according to the manufacturer's instructions using a kit purchased from Qiagen.
Example 9 Cloning of GM-CSF-K-HA into Yeast Expression Vector[0641] PCR of pUC19 GM-CSF-K-HA was used to isolate a DNA fragment encoding GM-CSF-K-HA for cloning into a yeast expression vector. The PCR product contains Eag I cloning sites for in frame insertion into the yeast expression vector. 20 Upstream Primer 5′TACGGCCGGCACCCACCCGCTCACCC Downstream Primer 5′ATGGTACCCGGCCGTTATCATCTGGATTGAATGGACGG
[0642] 21 Conditions Denaturation 90° one minute for PCR were: Annealing 60° one minute Extension 72° one minute
[0643] PCR was performed for 20 cycles using vent polymerase.
[0644] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the GM-CSF-K-HA gene was extracted from the gel using a Qiagen kit according to the manufacturers instructions. The purified DNA fragment was digested with Fag I and ligated to the yeast expression vector ITK that had been digested with Eag I. The ITK vector is designed for (1) replication in E. coli and (2) expression of genes in the yeast Saccharomyces cerevisiae after stable integration using homologous recombination. The vector contains:
[0645] 1. Sequences for replication of the plasmid in E. coli
[0646] 2. Yeast Gal promoter for expression of heterologous genes in yeast grown in media containing galactose.
[0647] 3. PrePro—Synthetic DNA sequence, optimized for secretion and signal sequence cleavage of distal genes in yeast.
[0648] 4. Unique Eag I site for cloning genes to be expressed.
[0649] 5. Alpha terminator—DNA sequence for efficient termination of proximal genes.
[0650] 6. Delta sequence that allows for stable integration of the plasmid by recombination with endogenous delta sequences in the yeast chromosome.
[0651] 7. Antibiotic resistance gene allowing for selection in E. coli with kanamycin and selection in yeast with G418.
[0652] This plasmid was used to transform E. coli strain AG-1. Transformants were selected by growth on LB plates containing 100 ug/ml kanamycin. Individual colonies were grown in LB media containing kanamycin and plasmids were purified. Restriction digests determined orientation of inserts. The resulting plasmid ITK GM-CSF-K-HA was purified using a kit purchased from Qiagen according to the manufacturer's instructions.
Example 10 Expression of GM-CSF-K-HA in Yeast[0653] The purified plasmid was linearized with Mfe 1 and used to transform the yeast strain Saccharomyces cerevisiae WDHY131 using lithium acetate (LiAc). A 10 ml culture of S. cerevisiae grown to saturation at 30° in YPD media (per liter/20 g Bactotryptone; 20 g dextrose: 10 g yeast extract) was used to inoculate 100 ml of YPD. The culture was grown at 300 with shaking for 3 hours. The yeast were harvested by centrifugation at 11,000×g for 2 minutes and resuspended in 25 ml of sterile water. The yeast were centrifuged as above and resuspended in 1.0 ml of 100 mM lithium acetate and transferred to a 1.5 ml microfuge tube. The yeast were pelleted by centrifugation at 12,000×g for 15 seconds and the supernatant removed. The cells were resuspended in 0.5 ml of 100 mM LiAc. 50 uL of cell suspension was added to individual microfuge tubes and centrifuged as above. Supernatant was removed.
[0654] Transformation mix added to the yeast pellet consisted of: 240 uL PEG (50% w/v); 36 uL 1.0 M LiAc; 5 uL single stranded DNA (10 mg/ml) and 1 ug of linearized ITK GM-CSF-K-HA in 75 uL of water. The mixture was vortexed to resuspend the cell pellet and incubated at 30° for 30 minutes. The cells were then shocked at 42° for 15 minutes, centrifuged to pellet cells and resuspended in 0.5 ml of YPD. Yeast were incubated in YPD media for 3 hours and plated on YPD plates containing 2 mg/ml G418. Plates were grown at 30° for 3 days until individual colonies appeared. To screen for expression of GM-CSF-K-HA, individual colonies were grown in 1 ml of YPD media at 300 for 2 days. The cells were centrifuged at 8,000×g for 2 minutes and the YPD media removed and replaced with 1 ml of YPG media (per liter/20 g Bactotryptone; 20 g galactose; 10 g yeast extract) for induction from the gal promoter. Yeast were grown in YPG media for 2 days. At this time, an aliquot was removed and cells were pelleted. The supernatant was tested for GM-CSF expression using an ELISA kit purchased from Endogen. Protocol was according to the manufacturer. A high-expressing yeast clone secreting the chimeric protein GM-CSF-K-HA was identified. Based on standard curve of soluble GMCSF, expression level was approximately 2.4 mg/L of GM-CSF moiety.
Example 11 Production of pUC 19 HA (hemagglutinin)-K-GM-CSF[0655] The plasmid pUC19 HA-K-GM-CSF was also produced, which encodes a chimeric protein containing (from amino terminal to carboxy terminal): (1) an HA1 domain (2) K, the (G4S)2 linker described above, and (3) murine GM-CSF, The HA1 begins at the amino terminus of the mature protein, amino acid 18, eliminating the leader sequence. The 3′ end terminates at amino acid 344. The (G4S)2 has been added to supply a flexible linker. The GM-CSF begins at amino acid 18 of the GM-CSF protein, corresponding to the first amino acid of the mature protein.
[0656] The HA-K sequence was first cloned by PCR of the HA1 coding sequence from a plasmid encoding the HA gene of the A/PR/8134 strain of influenza. 22 Upstream Primer 5′ CTGAATTCCGGCCGGACACAATATGTATAGGC Downstream Primer 5′ ATGGTACCGCTGCCCCCGCCGCCGGAGCCCCCTCCGCCACTTCTGGA TTGAATGGACGGAAT
[0657] The oligonucleotides for PCR generate a nucleic acid with:
[0658] 1. A 5′ EcoRI site at the amino terminus of the mature HA
[0659] 2. The (G4S)2 linker at the carboxy terminus of the HA1 domain (amino acid 344 of the HA precursor)
[0660] 3. A Kpn I site distal to the end of the (G4S)2 sequence 23 Conditions Denaturation 90° one minute for PCR were: Annealing 60° one minute Extension 72° one minute
[0661] PCR was performed for 20 cycles using vent polymerase.
[0662] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the HA1-K DNA was extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified HA-K DNA fragment was digested with EcoRI and Kpn I and the fragment was cloned into pUC19 that had been digested with EcoRI and KpnI. The plasmid was used to transform E. coli AG-1 to ampr. Individual colonies were picked and grown in LB-amp. The identity of plasmids with the correct insert was determined by restriction mapping. The resulting plasmid termed pUC19 HA-K was purified using a Qiagen kit according to the manufacturer's instructions.
[0663] The GM-CSF fragment was cloned by PCR. 24 Upstream Primer 5′ ACGGTACCGCACCCACCCGCTCACCCATC Downstream Primer 5′ TAGGATCCCGGCCGTCATTTTTGGACTGGTTTTTTGCACG
[0664] The PCR primers generate a GM-CSF fragment with
[0665] 1. 5′ KpnI site that allows in frame translation from the (G4S)2 portion of the HA-K molecule to the start of the mature GM-CSF molecule at amino acid 18.
[0666] 2. A termination codon at the 3′ end of the GM-CSF
[0667] 3. 3′ BamHI site 25 Conditions Denaturation 90° one minute for PCR were: Annealing 60° one minute Extension 72° one minute
[0668] PCR was performed for 20 cycles using vent polymerase.
[0669] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the GM-CSF gene was extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified fragment was digested with Kpn I and BamHI and the fragment was ligated into pUC19 HA-K plasmid that had been digested with KpnI and BamHI. The plasmid was used to transform E. coli AG-1 to ampr. Individual colonies were picked and grown in LB-amp. The identity of plasmids with the correct insert was determined by restriction mapping. The resulting plasmid termed pUC19 HA-K-GM-CSF was purified using a Qiagen kit according to the manufacturer's instructions.
Example 12 Cloning of HA-K-GM-CSF into Yeast Expression Vector[0670] PCR of pUC19 HA-K-GM-CSF was used to generate a DNA fragment encoding HA-K-GM-CSF for cloning into a yeast expression vector. The PCR product contains Eag I cloning sites for in-frame insertion into the yeast expression vector. 26 Upstream Primer 5′ CTGAATTCCGGCCGGACACAATATGTATAGGC Downstream Primer 5′ TAGGATCCCGGCCGTCATTTTTGGACTGGTTTTTTGCACG
[0671] 27 Conditions Denaturation 90° one minute for PCR were: Annealing 60° one minute Extension 72° one minute
[0672] PCR was performed for 20 cycles using vent polymerase.
[0673] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the HA-K-GM-CSF gene was extracted from the gel using a Qiagen kit according to the manufacturers instructions. The purified DNA fragment was digested with Eag I and ligated to the yeast expression vector ITK, that had been digested with Eag I. The ITK vector is designed for (1) replication in E. coli and (2) expression of genes in the yeast Saccharomyces cerevisiae after stable integration using homologous recombination. The vector contains:
[0674] 1. Sequences for replication of the plasmid in E. coli
[0675] 2. Yeast Gal promoter for expression of heterologous genes in media containing galactose.
[0676] 3. PrePro—Synthetic DNA sequence, optimized for secretion and signal sequence cleavage of distal genes in yeast.
[0677] 4. Unique Eag I site for cloning genes to be expressed.
[0678] 5. Alpha terminator—DNA sequence for efficient termination of proximal genes.
[0679] 6. Delta sequence that allows for stable integration of the plasmid by recombination with endogenous delta sequences in the yeast chromosome.
[0680] 7. Antibiotic resistance gene allowing for selection in E. coli with kanamycin and selection in yeast with G418.
[0681] This plasmid was used to transform E. coli strain AG-1. Transformants were selected by growth on LB plates containing 100 ug/ml kanamycin. Individual colonies were grown in LB media containing kanamycin and plasmids were purified. Restriction digests determined orientation of inserts. The resulting plasmid ITK HA-K-GM-CSF was purified using a kit purchased from Qiagen according to the manufacturer's instructions.
[0682] The purified plasmid was linearized with Mfe 1 and used to transform the yeast strain Saccharomyces cerevisiae WDHY131 using lithium acetate (LiAc). A 10 ml culture of S. cerevisiae grown to saturation at 30° C. in YPD media (per liter/20 g Bactotryptone; 20 g dextrose; 10 g yeast extract) was used to inoculate 100 ml of YPD. The culture was grown at 30° C. with shaking for 3 hours. The yeast were harvested by centrifugation at 11,000×g for 2 minutes and resuspended in 25 ml of sterile water. The yeast were centrifuged as above and resuspended in 1.0 ml of 100 mM lithium acetate and transferred to a 1.5 ml microfuge tube. The yeast were pelleted by centrifugation at 12,000×g for 15 seconds and the supernatant removed. The cells were resuspended in 0.5 ml of 100 mM LiAc. 50 uL of cell suspension was added to individual microfuge tubes and centrifuged as above. Supernatant was removed. Transformation mix added to the yeast pellet consisted of: 240 uL PEG (50% w/v); 36 uL 1.0 M LiAc; 5 uL single stranded DNA (10 mg/ml) and 1 ug of linearized ITK HA-K-GM-CSF in 75 uL of water. The mixture was vortexed to resuspend the cell pellet and incubated at 300 for 30 minutes. The cells were then shocked at 42° C. for 15 minutes, centrifuged to pellet cells and resuspended in 0.5 ml of YPD. Yeast were incubated in YPD media for 3 hours and plated on YPD plates containing 2 mg/ml G418. Plates were grown at 30° C. for 3 days until individual colonies appeared. To screen for expression of HA-K-GM-CSF, individual colonies were grown in 1 ml of YPD media at 30° C. for 2 days. The cells were centrifuged at 8,000×g for 2 minutes and the YPD media removed and replaced with 1 ml of YPG media (per liter/20 g Bactotryptone; 20 g galactose; 10 g yeast extract) for induction from the gal promoter. Yeast were grown in YPG media for 2 days. At this time, an aliquot was removed and cells were pelleted. The supernatant was tested for GM-CSF expression using an ELISA kit purchased from Endogen. The protocol was according to the manufacturer.
[0683] A colony expressing high levels of the chimeric protein was identified. Based on standard curve of soluble GMCSF, expression level is approximately 2.0 mg/L of soluble material. There is no decrease in expression levels in the absence of G418.
Example 13 Scale Up Purification of GM-CSF-K-HA[0684] For scaled-up purification of the chimeric protein, yeast were inoculated into 500 ml of YPD and grown for three days at 30° C. Cells were pelleted by centrifugation at 12,000×g for 2 minutes and transferred to an equal volume of YPG for an additional three days of growth. The cells were then pelleted by centrifugation at 12,000×g for 2 minutes and the supernatant collected. The soluble material was applied to an immunoaffinity column of anti-murine GMCSF monoclonal antibody (Endogen) linked to cyanogen bromide-activated Sepharose 4B (Sigma). Coupling of the monoclonal to the Sepharose was performed according to the manufacturer. Efficiency of coupling was monitored using OD280 and of binding of GMCSF to immobolized antibody was tested using soluble, commercially available material.
[0685] Soluble yeast-derived material was applied to the column and allowed to flow by gravity. The column was washed with: (a) 20 volumes of 0.15M NaCl, 25 mM Tris pH 7.4 (TN) (b) 5 volumes of 50 mM Tris pH 8.0 (c) 20 volumes TN. Bound material was then eluted with 10 volumes of 0.15M NaCl, 25 mM Tris pH 2.5. Eluted material was neutralized with 1/200 volume of 1.5M Tris pH8.8. The purified material was concentrated using a Microsep 3K centrifugal devise (Pall Gelman Laboratory). Yields of chimeric protein were determined by ELISA (Endogen) according to the manufacturer's instructions.
[0686] Purified GM-CSF-K-HA
[0687] Purified GM-CSF-K-HA was analyzed by western blot. Approximately lug of GM-K-HA per lane was electrophoresed along with soluble GMCSF. For western blot, gels were transferred to Protran BA83 (Schleicher and Schuell), blocked with TBS (Tris Buffered Saline) containing 0.05% Tween 20 and 2% Nonfat Dry Milk. The blot was incubated with primary antibody (rat monoclonal anti-murine GMCSF, Endogen) at 1:5000 dilution in blocking buffer for 2 hours at room temperature. The blot was washed with TBS-0.05% Tween 20. Secondary antibody, alkaline phosphatase conjugated anti-rat IgG (Sigma) was incubated at 1:10,000 for 1 hour at room temperature.
Example 14 Decoration of Cells with GM-K-HA[0688] Purified GM-CSF-K-HA was used to decorate CMS 5 murine fibrosarcoma cells. CMS 5 cells were grown in DMEM, 10% FBS, Penicillin-streptomycin, harvested by trypsinization and washed 3 times with RPMI 1640 (Gibco). Cells were diluted to 1×106/ml in RPMI 1640 and 0.9 ml were aliquoted to siliconized tubes. Cells were incubated for 2 hours at 37° C. with shaking and then washed 3 times with PBS containing 2% FBS. Primary antibody, rat anti-murine GMCSF monoclonal, was incubated for one hour at 4° C. Cells were washed as above, treated with FITC labeled anti-rat antibody (Sigma), and incubated for one hour at 4° C. After additional washing, the cells were analyzed by flow cytometry, which confirmed the presence of GM-CSF-K-HA on the surface of the tumor cells.
Example 15 Quantitation of GM-CSF-K-HA on the Cell Surface of CMS 5 Cells After Decoration[0689] CMS 5 cells were harvested and washed as described above. 1×106 cells in 1 ml of RPMI 1640 were incubated with 1 ug of purified GM-K-HA. After incubation for 15 min, 30 min, 1 hour, or 2 hours at 4° C., room temperature, or 37° C., the cells were washed 3 times with PBS containing 2% FBS. The cell pellet was lysed with 50 microliters of PBS containing 0.15% deoxycholate and the detergent subsequently diluted by the addition of 200 microliters of PBS. The material was serially diluted with PBS and tested by ELISA (Endogen). Based on the amount of GM-CSF detected in the cell lysates, it was possible to quantitate the average number of GM-CSF molecules associated with each cell. For example, after a 15 min incubation at 4° C., 58,700 molecules were present per cell. After a 15 min incubation at room temperature, 25,700 molecules were present per cell. After a 15 min incubation at 37° C., 17,200 molecules were present per cell.
Example 16 Effective Immunization with Tumor Cells Admixed with GM-CSF/Hemagglutinin Fusion Polypeptides[0690] CMS-5 murine fibrosarcoma cells were grown to 70% confluence in DMEM, 10% FBS, Penicillin-streptomycin, harvested by trypsinization, and washed 3 times with RPMI 1640. Viability was determined by trypan blue staining of an aliquot and the cells were then resuspended at a concentration of 4×106 cells/ml and 1 ml aliquots dispensed into siliconized microfuge tubes. The cells were incubated with 1 ug (microgram) murine GM-CSF-K-HA or 10 ng (nanograms) HA-K-murine GM-CSF per 106 cells for 3 hours at 37° C. Cells were then washed 3 times with RPMI 1640 and resuspended at 4×106 cells/ml in RPMI 1640. An aliquot of the cells was removed and the amount of cell-associated GM-CSF measured by ELISA as described above. There were approximately 20,240 and 18,000 molecules/cell in the GM-CSF-K-HA and HA-K-GM-CSF groups, respectively. Cells for a control vaccine, to be administered without a molecule of the invention (or any other immunomodulator), were prepared in parallel.
[0691] The cells were irradiated at 3500 rads from a 137Cs source. 8 week-old female Balb/c mice (which are syngeneic for CMS-5) were anesthetized by metofane inhalation and vaccinated subcutaneously in the left inguinal fold with 1×106 cells in 0.25 ml. Each mouse received cells from only one vaccine type. Seven days later, wild-type CMS-5 cells at 70% confluence were harvested and washed 3 times in HBSS. Viability was determined by trypan blue staining of an aliquot and cells were adjusted to 4×106/ml in HBSS. The previously vaccinated mice were then injected subcutaneously behind the neck, under metofane anesthesia, with 2×106 live, wild-type CMS-5 cells in 0.5 ml HBSS. The groups receiving the HA-K-GM-CSF and control vaccines each consisted of 5 mice, whereas the group receiving the GM-CSF-K-HA vaccine consisted of 4 mice because 1 mouse failed to awaken from anesthesia.
[0692] Tumor development was assessed daily by palpation and visual inspection. The observer was blinded to the vaccine received by each set of mice to ensure against bias. Mice were sacrificed by CO2 asphyxiation when tumors become unwieldy. All mice that had received the control vaccine developed tumors within 18 days after challenge with live tumor cells. In contrast, 100% of mice that had received the GM-CSF-K-HA vaccine and 60% of mice that had received the HA-K-GM-CSF vaccine remained tumor-free at the end of the experiment, 40 days after challenge. Thus, immunization with a composition comprising tumor cells and a molecule of the invention confers significantly longer tumor-free survival than immunization with a composition comprising tumor cells but not comprising a molecule of the invention.
Example 17 Cloning of Human GM-CSF-K-HA[0693] pUC19 human GM-CSF-K-HA (hGM-CSF-K-HA) is cloned starting with pUC19 GM-CSF-K-HA. pUC19 GM-CSF-K-HA. is digested with EcoRI and NgoM IV. EcoRI cuts at the 5′ end of the murine GM-CSF coding sequence and Ngo M IV cuts at the 3′ end of the murine GM-CSF molecule. The resulting plasmid with the murine GM-CSF coding region removed is purified after electrophoresis through agarose gel using a kit manufactured by Qiagen. The human GM-CSF coding segment is generated by PCR from a commercially available human cDNA library (Clontech). The human sequence begins at amino acid 18, the start of the mature protein, i.e. lacking the secretory signal sequence. The 3′ end corresponds to amino acid 144, eliminating the endogenous termination codon. 28 Upstream hGM-CSF Primer 5′ GCGAATTCCGGCCGGCACCCGCCCGCTCGCCCAGC Downstream hGM-CSF Primer 5′ TAGCCGGCCTCCTGGACTGGCTCCCAGCA
[0694] 29 Conditions Denaturation 90° one minute for PCR were: Annealing 60° one minute Extension 72° one minute
[0695] PCR is performed for 20 cycles using vent polymerase.
[0696] Following PCR, the product is electrophoresed through a 1.0% agarose gel and the hGM-CSF gene is extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified hGM-CSF DNA fragment is digested with Eco RI and NgoM IV and ligated into the pUC 19 murine GM-CSF-K-HA vector that has been digested with EcoRI and NgoM IV to remove the murine GM-CSF sequence. The DNA is used to transform E. coli AG1 and transformants are selected on LB-ampicillin plates. Plasmid DNA from individual colonies is isolated and digested with restriction enzymes to identify clone harboring a pUC19 hGM-CSF-K-HA plasmid.
[0697] The pUC19 hGM-CSF-K-HA plasmid is purified according to the manufacturer's instructions using a kit purchased from Qiagen. PCR of pUC19 hGM-CSF-K-HA is used to generate a DNA fragment encoding hGM-CSF-K-HA for cloning into a yeast expression vector. The PCR product contains Eag I cloning sites for in frame insertion into the yeast expression vector. 30 Upstream Primer 5′ GCGAATTCCGGCCGGCACCCGCCCGCTCGCCCAGC Downstream Primer 5′ ATGGTACCCGGCCGTTATCATCTGGATTGAATGGACGG
[0698] 31 Conditions Denaturation 90° one minute for PCR were: Annealing 60° one minute Extension 72° one minute
[0699] PCR is performed for 20 cycles using vent polymerase.
[0700] Following PCR the product is electrophoresed through a 1.0% agarose gel and the hGM-CSF-K-HA gene is extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified DNA fragment is digested with Eag I and ligated to the yeast expression vector ITK that has been digested with Eag I. The ITK vector is designed for (1) replication in E. coli and (2) expression of genes in the yeast Saccharomyces cerevisiae after stable integration using homologous recombination. The vector contains:
[0701] 1. Sequences for replication of the plasmid in E. coli
[0702] 2. Yeast Gal promoter for expression of heterologous genes in yeast grown in media containing galactose.
[0703] 3. PrePro—Synthetic DNA sequence, optimized for secretion and signal sequence cleavage of distal genes in yeast.
[0704] 4. Unique Eag I site for cloning genes to be expressed.
[0705] 5. Alpha terminator—DNA sequence for efficient termination of proximal genes.
[0706] 6. Delta sequence that allows for stable integration of the plasmid by recombination with endogenous delta sequences in the yeast chromosome.
[0707] 7. Antibiotic resistance gene allowing for selection in E. coli with kanamycin and selection in yeast with G418.
[0708] This plasmid is used to transform E. coli strain AG-1. Transformants are selected by growth on LB plates containing 100 ug/ml kanamycin. Individual colonies are grown in LB media containing kanamycin and plasmids are purified. Restriction digests determine orientation of inserts. The resulting plasmid ITK hGM-CSF-K-HA is purified using a kit purchased from Qiagen according to the manufacturer's instructions.
[0709] The purified plasmid is linearized with Mfe 1 and used to transform the yeast strain Saccharomyces cerevisiae WDHY131 using lithium acetate (LiAc). A 10 ml culture of S. cerevisiae grown to saturation at 30° in YPD media (per liter/20 g Bactotryptone; 20 g dextrose; 10 g yeast extract) is used to inoculate 100 ml of YPD. The culture is grown at 30° with shaking for 3 hours. The yeast are harvested by centrifugation at 11,000×g for 2 minutes and resuspended in 25 ml of sterile water. The yeast are centrifuged as above and resuspended in 1.0 ml of 100 mM lithium acetate and transferred to a 1.5 ml microfuge tube. The yeast are pelleted by centrifugation at 12,000×g for 15 seconds and the supernatant removed. The cells are resuspended in 0.5 ml of 100 mM LiAc. 50 uL of cell suspension is added to individual microfuge tubes and centrifuged as above. Supernatant is removed. Transformation mix added to the yeast pellet consists of: 240 uL PEG (50% w/v); 36 uL 1.0 M LiAc; 5 uL single stranded DNA (10 mg/ml) and 1 ug of linearized ITK hGM-CSF-K-HA in 75 uL of water. The mixture is vortexed to resuspend the cell pellet and incubated at 30° for 30 minutes. The cells are then shocked at 42° for 15 minutes, centrifuged to pellet, and resuspended in 0.5 ml of YPD. Yeast are incubated in YPD media for 3 hours and plated on YPD plates containing 2 mg/ml G418. Plates are grown at 30° for 3 days until individual colonies appear.
[0710] To screen for expression of hGM-CSF-K-HA, individual colonies are grown in 1 ml of YPD media at 30° for 2 days. The cells are centrifuged at 8,000×g for 2 minutes and the YPD media removed and replaced with 1 ml of YPG media (per liter/20 g Bactotryptone; 20 g galactose; 10 g yeast extract) for induction from the gal promoter. Yeast are grown in YPG media for 2 day. An aliquot is then removed and the cells are pelleted. The supernatant is tested for hGM-CSF expression using an ELISA kit purchased from Endogen. Protocol is according to the manufacturer.
Example 18 Reduction of Metastases in a Mouse Model[0711] B16F10 murine melanoma cells were harvested and washed three times in PBS. Cells were then suspended at 5×105 viable cells/ml in PBS, with viability determined by staining an aliquot of cells with Trypan blue. 100 ul of this suspension was injected into the tail veins of 8-10 week old female C57BL/6 mice. On day 1 or day 3 after tumor challenge, mice were immunized with 1×106 irradiated B16F10 cells subcutaneously in the left inguinal fold. Groups (3 mice each) received either cells alone, cells mixed with 1 ug soluble recombinant murine GM-CSF (Serologicals Corp.), or cells mixed with 1 ug of a multifunctional molecule of the invention comprising murine GM-CSF at the N terminus, a (Gly4Ser)2 flexible linker, and the HA1 domain of influenza A/PR/8/34 hemagglutinin at the C terminus. The latter composition comprised both free and cell-bound multifunctional molecule.
[0712] Mice were sacrificed on day 12, the thoracic cavity opened with dissecting scissors, and the lungs removed en bloc by tracheal transection. Metastases were enumerated with a hand lens. In the mice immunized 1 day after challenge, the average number of metastases/mouse was as follows: 32 Cells alone: 30.00 Cells + GM-CSF: 14.33 Cells + multifunctional molecule: 0.67
[0713] In the mice immunized 3 days after challenge, the average number of metastases/mouse was as follows: 33 Cells alone: 36.33 Cells + GM-CSF: 10.33 Cells + multifunctional molecule: 1.00
[0714] Thus, administration of the composition comprising a multifunctional molecule of the invention was able to effectively reduce metastases and treat disease.
Example 19 GM-CSF-HA1-Mediated Protection Against Tumor Challenge In Vivo[0715] As an allogeneic tumor vaccine model, C57BL/6 mice (haplotype b) were immunized with C3H (haplotype k)-derived K1735 melanoma cells, followed by challenge with C57BL/6-derived B16F10 melanoma cells. K1735 cells were grown to 70% confluence in DMEM with 10% FBS and penicillin-streptomycin, harvested by trypsinization, and washed 3 times with RPMI 1640. Viability was determined by trypan blue staining of an aliquot and the cells were then resuspended at a concentration of 4×106 cells/ml for K1735. One ml aliquots were then dispensed into siliconized microfuge tubes. The cells were incubated with 1 ug mGM-CSF-HA1 (a fusion polypeptide consisting of murine GM-CSF at the N terminus, a (Gly4Ser)2 linker, and the HA1 domain of influenza AIPR/8/34) per 106 cells for 2 hours at 4° C. An aliquot of the cells was removed for measurement of cell-associated GM-CSF by ELISA. Mean cell-associated GM-CSF across two experiments was approximately 60,000. Cells that were not admixed with any polypeptide and, in one experiment, cells mixed with 1 ug soluble murine GM-CSF (Serologicals Corp.) were prepared in parallel as control vaccines.
[0716] The cells were irradiated at 3500 rads from a 137CS source. 8 week-old female C57BL/6 mice were anesthetized by metofane inhalation and vaccinated subcutaneously in the left inguinal fold with or 1×106 cells in 0.25 ml RPMI, along with a total of 1 ug GM-CSF-HA1 (including bound and free fusion polypeptide). Each mouse received cells from only one vaccine type. Seven days later, B16F10 cells, as appropriate, at 70% confluence were harvested and washed 3 times in HBSS. Viability was determined by trypan blue staining of an aliquot and cells were adjusted in HBSS to 1×105/ml. The previously vaccinated mice were then challenged subcutaneously behind the neck, under metofane anesthesia, with 0.5 ml of the B16F10 cell suspension.
[0717] Tumor development was assessed daily by palpation and visual inspection. “Onset” was defined as the first day on which a tumor mass was both palpable and visible. The observer was blinded to the vaccine received by each set of mice to ensure against bias. Mice were sacrificed by CO2 asphyxiation when tumors become unwieldy. Experiments were terminated 70 days after tumor challenge, as planned in advance.
[0718] In pooled results from two experiments, 70 days after challenge, 7/10 mice that had been vaccinated with cells admixed with fusion polypeptide remained tumor-free. In contrast, 10/10 mice that had been vaccinated with cells alone developed tumors, as did 4/5 mice vaccinated with cells admixed with soluble murine GM-CSF.
[0719] Other Embodiments
[0720] The foregoing examples demonstrate experiments performed and contemplated by the present inventors in making and carrying out the invention. It is believed that these examples include a disclosure of techniques which serve to both apprise the art of the practice of the invention and to demonstrate its usefulness. It will be appreciated by those of skill in the art that the techniques and embodiments disclosed herein are preferred embodiments only that in general numerous equivalent methods and techniques may be employed to achieve the same result.
[0721] All of the references identified hereinabove, are hereby expressly incorporated herein by reference to the extent that they describe, set forth, provide a basis for or enable compositions and/or methods which may be important to the practice of one or more embodiments of the present inventions.
[0722] Appendix I
[0723] 4: BC025704 Homo sapiens, leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5, clone MGC:34418 IMAGE:5223581, mRNA, complete cds
[0724] gi|19344005|gb|BC025704.1|[19344005]
[0725] 5: BC025713 Homo sapiens, T-cell receptor interacting molecule, clone MGC:34314 IMAGE:5227396, mRNA, complete cds
[0726] gi|19343996|gb|BC025713.1|[19343996]
[0727] 6: BC025722 Homo sapiens, adenosine A2b receptor, clone MGC:34640 IMAGE:5198898, mRNA, complete cds
[0728] gi|19343938|gb|BC025722.1|[19343938]
[0729] 7: BC025717 Homo sapiens, chemokine (C-C motif) receptor-like 2, clone MGC:34104 IMAGE:5228561, mRNA, complete cds
[0730] gi|19343936|gb|BC025717.1|[19343936]
[0731] 8: BC025695 Homo sapiens, endothelial differentiation, lysophosphatidic acid
[0732] G-protein-coupled receptor, 4, clone MGC:34227 IMAGE:5209267, mRNA, complete cds
[0733] gi|19343926|gb|BC025695.1|[19343926]
[0734] 9: BC025727 Homo sapiens, Similar to T cell receptor alpha locus, clone MGC:34712 IMAGE:5201547, mRNA, complete cds
[0735] gi|19343616|gb|BC025727.1|[19343616]
[0736] 10: BC025691 Homo sapiens, interleukin 2 receptor, beta, clone MGC:34584 IMAGE:5207833, mRNA, complete cds
[0737] gi|19343610|gb|BC025691.1|[19343610]
[0738] 11: AF474992 Homo sapiens G protein-coupled receptor SNSR6 gene, complete cds
[0739] gi|19338917|gb|AF474992.1|[19338917]
[0740] 12: AF474991 Homo sapiens G protein-coupled receptor SNSR5 gene, complete cds
[0741] gi|19338915|gb|AF474991.1|[19338915]
[0742] 13: AF474990 Homo sapiens G protein-coupled receptor SNSR4 gene, complete cds
[0743] gi|19338913|gb|AF474990.1|[19338913]
[0744] 14: AF474989 Homo sapiens G protein-coupled receptor SNSR3 gene, complete cds
[0745] gi|19338911|gb|AF474989.1|[19338911]
[0746] 15: AF474988 Homo sapiens G protein-coupled receptor SNSR2 gene, complete cds
[0747] gi|19338909|gb|AF474988.1|[19338909]
[0748] 71: AF453877 Homo sapiens neuronal nicotinic receptor beta 4 subunit precursor, gene, exon 1 and partial cds
[0749] gi|18042122|gb|AF453877.1|[18042122]
[0750] 73: U62556 Homo sapiens chemokine receptor-like protein (TER1) gene, complete cds
[0751] gi|1468978|gb|U62556.1|HSU62556[1468978]
[0752] 74: AF449218 Homo sapiens 43 kDa acetylcholine receptor-associated protein (RAPSN) mRNA, complete cds
[0753] gi|19310212|gb|AF449218.1|[19310212]
[0754] 84: AJ437349 Homo sapiens partial mRNA for T-cell receptor beta chain (V14-D-J-C) (TCRB gene), clone 11
[0755] gi|19262919|emb|AJ437349.1|HSA437349[19262919]
[0756] 85: AJ011371 Homo sapiens mRNA for serotonin 4 receptor, splice variant h5-HT4(e)
[0757] gi|3646277|emb|AJ011371.1|HSAJ1371[3646277]
[0758] 88: BC025294 Homo sapiens, Similar to toll-like receptor 4, clone IMAGE:4868078, mRNA
[0759] gi|19263693|gb|BC025294.1|[19263693]
[0760] 89: BM875542 ij54d02.y1 Human insulinoma Homo sapiens cDNA clone IMAGE:5634842 5′ similar to TR:O00559 O00559 RECEPTOR-BINDING CANCER ANTIGEN EXPRESSED ON SISO CELLS;, mRNA sequence
[0761] gi|19243208|gb|BM875542.1|BM875542[19243208]
[0762] 99: AY059419 Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL1) mRNA, KIR3DL1*011 allele, partial cds
[0763] gi|19224338|gb|AY059419.1|[19224338]
[0764] 100: AY059418 Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL2) mRNA, KIR3DL2*010 allele, partial cds
[0765] gi|19224336|gb|AY059418.1|[19224336]
[0766] 101: AY059417 Homo sapiens killer-cell immunoglobulin-like receptor KIR3DL1/2v mRNA, partial cds
[0767] gi|19224334|gb|AY059417.1|[19224334]
[0768] 102: AY059420 Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL2) mRNA, KIR3DL2*012 allele, partial cds
[0769] gi|19224332|gb|AY059420.1|[19224332]
[0770] 103: AC079385 Homo sapiens 12q BAC RP11-482D24 (Roswell Park Cancer Institute Human BAC Library) complete sequence
[0771] gi|14670063|gb|AC079385.18|[14670063]
[0772] 104: AC078889 Homo sapiens 12q BAC RP11-33512 (Roswell Park Cancer Institute Human BAC Library) complete sequence
[0773] gi|11072039|gb|AC078889.20|[11072039]
[0774] 105: AC010168 Homo sapiens 12 p12-31.7-32.2 BAC RP11-174G6 (Rosewell Park Cancer Institute Human Bac Library) complete sequence
[0775] gi|6855156|gb|AC010168.61[6855156]
[0776] 106: U14188 Homo sapiens LERK-4 (EPLG4) mRNA, complete cds
[0777] gi|642834|gb|U14188.1|HSU14188[642834]
[0778] 107: U14187 Homo sapiens LERK-3 (EPLG3) mRNA, complete cds
[0779] gi|642832|gb|U14187.1|HSU14187[642832]
[0780] 108: U15637 Homo sapiens CD40 binding protein (CD40BP) mRNA, complete cds
[0781] gi|595910|gb|U15637.1|HSU15637[595910]
[0782] 109; AF262304 Homo sapiens clone 6 CC chemokine receptor 3-like mRNA, partial sequence, alternatively spliced
[0783] gi|19171650|gb|AF262304.1|[19171650]
[0784] 110: AF262303 Homo sapiens clone 6 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[0785] gi|19171648|gb|AF262303.1|[19171648]
[0786] 111: AF262302 Homo sapiens clone 5 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[0787] gi|19171646|gb|AF262302.1|[19171646]
[0788] 112: AF262301 Homo sapiens clone 4 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[0789] gi|19171644|gb|AF262301.1|[19171644]
[0790] 113: AF262300 Homo sapiens clone 2 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[0791] gi|19171642|gb|AF262300.1|[19171642]
[0792] 114: AF262299 Homo sapiens clone 1 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[0793] gi|19171640|gb|AF262299.1|[19171640]
[0794] 118: AF247361 Homo sapiens CC chemokine receptor 3 (CCR3) gene, complete cds
[0795] gi|19110542|gb|AF247361.1|[19110542]
[0796] 122: AF416619 Homo sapiens prolactin receptor short isoform 1a (PRLR) mRNA, complete cds, alternatively spliced
[0797] gi|16506717|gb|AF416619.1|[16506717]
[0798] 123: AF416618 Homo sapiens prolactin receptor short isoform 1b (PRLR) mRNA, complete cds, alternatively spliced
[0799] gi|16506715|gb|AF416618.1|[16506715]
[0800] 125: AJ303165 Homo sapiens partial gene for putative transmembrane receptor
[0801] gi|13162199|emb|AJ303165.1|HSA303165[13162199]
[0802] 126: NM—017451 Homo sapiens BA11-associated protein 2 (BAIAP2) transcript variant 2, mRNA
[0803] gi|9257198|ref|NM—017451.1|[9257198]
[0804] 127: NM—017450 Homo sapiens BA11-associated protein 2 (BAIAP2) transcript variant 1, mRNA
[0805] gi|9257196|ref|NM—017450.1|[9257196]
[0806] 128: NM—006340 Homo sapiens BA11-associated protein 2 (BAIAP2) transcript variant 3, mRNA
[0807] gi|5453564|ref|NM—006340.1|[5453564]
[0808] 131: AF350881 Homo sapiens channel kinase 2 (CHAK2) mRNA, complete cds
[0809] gi|18860923|gb|AF350881.2|[18860923]
[0810] 132: AF022044 Homo sapiens natural killer cell receptor KIR3D51 variant mRNA, complete cds
[0811] gi|2760894|gb|AF022044.1|[2760894]
[0812] 133: AF034773 Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 3, complete cds
[0813] gi|2739181|gb|AF034773.1|[2739181]
[0814] 134: AF034772 Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 2, complete cds
[0815] gi|2739179|gb|AF034772.1|[2739179]
[0816] 135: AF034771 Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 1, complete cds
[0817] gi|2739177|gb|AF034771.1|[2739177]
[0818] 136: AF022047 Homo sapiens natural killer cell inhibitory receptor KIR2D53 variant mRNA, complete cds
[0819] gi|2738966|gb|AF022047.1|[2738966]
[0820] 137: AF022046 Homo sapiens natural killer cell inhibitory receptor KIR2D51 variant mRNA, complete cds
[0821] gi|2738964|gb|AF022046.1|[2738964]
[0822] 138: AF022045 Homo sapiens natural killer cell receptor KIR2DL1 variant mRNA, complete cds
[0823] gi|2738962|gb|AF022045.1|[2738962]
[0824] 139: U56255 Homo sapiens CW-1 mRNA, complete cds
[0825] gi|1399688|gb|U56255.1|HSU56255[1399688]
[0826] 140: AJ422056 Homo sapiens partial GRM5 gene for metabotrophic glutamate receptor, exon 1A
[0827] gi|19069804|emb|AJ422056.1|HSA422056[19069804]
[0828] 141: AY028912 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 7 and complete cds, alternatively spliced
[0829] gi|19067944|gb|AY028912.1|AY028906S7[19067944]
[0830] 142: AY028911 Homo sapiens ectodysplasin A receptor associated death domain (ED.hD)T ene, exon 6
[0831] gi|19067943|gb|AY028911.1|AY028906S6[19067943]
[0832] 143: AY028910 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 5
[0833] gi|19067942|gb|AY028910.1|AY028906S5[19067942]
[0834] 144: AY028909 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 4
[0835] gi|19067941|gb|AY028909.1|AY028906S4[19067941]
[0836] 145: AY028908 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 3
[0837] gi|19067940|gb|AY028908.1|AY028906S3[19067940]
[0838] 146: AY028907 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 2
[0839] gi|19067939|gb|AY028907.1|AY028906S2[19067939]
[0840] 147: AY028906 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 1
[0841] gi|9067938|gb|AY028906.1|AY028906S1[19067938]
[0842] 148: AH010677 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, complete cds, alternatively spliced
[0843] gi|19067937|gb|AH010677.1|SEG_AY028906S[19067937]
[0844] 149: AY028913 Homo sapiens ectodysplasia A receptor associated death domain A (EDARADD) mRNA, complete cds; alternatively spliced
[0845] gi|19067935|gb|AY028913.1|[19067935]
[0846] 150: BM735809 06E08 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens glycine receptor, beta, mRNA sequence
[0847] gi|19057142|gb|BM735809.1|BM735809[19057142]
[0848] 151: BM735756 06A09 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens glycine receptor, beta subunit, mRNA sequence
[0849] gi|19057089|gb|BM735756.1|BM735756[19057089]
[0850] 152: BM735711 10E11 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens protein tyrosine phosphatase, receptor-type, Z polypeptide 1, mRNA sequence
[0851] gi|19057044|gb|BM735711.1|BM735711[19057044]
[0852] 155: AC007165 Homo sapiens BAC clone RP11-451C2 from 2, complete sequence
[0853] gi|19033999|gb|AC007165.4|[19033999]
[0854] 156: AF245699 Homo sapiens type 1 angiotensin II receptor (AGTR1) gene, complete cds
[0855] gi|7862074|gb|AF245699.1|[7862074]
[0856] 157: BC024229 Homo sapiens, prostaglandin E receptor 3 (subtype EP3), clone MGC:27302 IMAGE:4660371, mRNA, complete cds
[0857] gi|18999476|gb|BC024229.1|[18999476]
[0858] 176: AJ417555 Homo sapiens partial mRNA for killer cell immunoglobulin receptor (KIR2D54 gene), strain 4053
[0859] gi|18958228|emb|AJ417555.1|HSA417555[18958228]
[0860] 177: AJ417554 Homo sapiens partial mRNA for killer cell immunoglobulin receptor (KIR2D54 gene), strain 3321
[0861] gi|18958226|emb|AJ417554.1|HSA417554[18958226]
[0862] 179: NM—003877 Homo sapiens STAT induced STAT inhibitor-2 (STAT12), mRNA
[0863] gi|18921206|ref|NM—003877.2|[18921206]
[0864] 180: NM—017662 Homo sapiens transient receptor potential cation channel, subfamily M, member 6(TRPM6), mRNA
[0865] gi|18921092|ref|NM—017662.3|[18921092]
[0866] 191: NM—016148 Homo sapiens SH3 and multiple ankyrin repeat domains 1 (SHANK1), mRNA
[0867] gi|11968151|ref|NM—016148.1|[11968151]
[0868] 193: NM—017729 Homo sapiens epidermal growth factor receptor pathway substrate 8 related protein 1 (EPS8R1), mRNA
[0869] gi|8923231|ref|NM—017729.1|[8923231]
[0870] 195: M13824 Homo sapiens T cell receptor gamma chain variable region (TCRG) gene, partial cds
[0871] gi|339169|gb|M13824.1|HUMTCGXL[339169]
[0872] 196: M12960 Homo sapiens T-cell receptor gamma-chain J1, partial cds
[0873] gi|339144|gb|M12960.1|HUMTCGJB[339144]
[0874] 197: M13823 Homo sapiens T cell receptor gamma chain (TCRG) gene, partial cds
[0875] gi|292736|gb|M13823.1|HUMTCGXK[292736]
[0876] 198: L12398 Homo sapiens dopamine receptor D4 (DRD4) mRNA, complete cds
[0877] gi|291945|gb|L12398.1|HUMD4C[291945]
[0878] 199: M86383 Homo sapiens nicotinic acetylcholine receptor alpha 3 subunit precursor, mRNA, complete cds
[0879] gi|177897|gb|M86383.1|HUMA3NARSP[177897]
[0880] 202: NM—012245 Homo sapiens SKI-interacting protein (SNW1), mRNA
[0881] gi|18860912|ref|NM—012245.2|[18860912]
[0882] 203: NM—006750 Homo sapiens syntrophin, beta 2 (dystrophin-associated protein A1, 59 kD, basiccomponent 2) (SNTB2), transcript variant 1, mRNA
[0883] gi|18860911|ref|NM—006750.2|[18860911]
[0884] 204: NM—130845 Homo sapiens syntrophin, beta 2 (dystrophin-associated protein A1, 59 kD, basic component 2) (SNTB2), transcript variant 2, mRNA
[0885] gi|18860909|ref|NM—130845.1|[18860909]
[0886] 205: NM—002846 Homo sapiens protein tyrosine phosphatase, receptor type, N (PTPRN), mRNA
[0887] gi|18860905|ref|NM—002846.2|[18860905]
[0888] 206: NM—002845 Homo sapiens protein tyrosine phosphatase, receptor type, M (PTPRM), mRNA
[0889] gi|18860903|ref|NM—002845.2|[18860903]
[0890] 207: NM—002844 Homo sapiens protein tyrosine phosphatase, receptor type, K (PTPRK), mRNA
[0891] gi|18860901|ref|NM—002844.2|[18860901]
[0892] 208: NM—002843 Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA
[0893] gi|18860899|ref|NM—002843.2|[18860899]
[0894] 209: NM—002841 Homo sapiens protein tyrosine phosphatase, receptor type, G (PTPRG), mRNA
[0895] gi|18860897|ref|NM—002841.2|[18860897]
[0896] 210: NM—130440 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 2, mRNA
[0897] gi|18860895|ref|NM—130440.1|[18860895]
[0898] 211: NM—130393 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 4, mRNA
[0899] gi|18860893|ref|NM—130393.1|[18860893]
[0900] 212: NM—130392 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 3, mRNA
[0901] gi|18860891|ref|NM—130392.1|[18860891]
[0902] 213: NM—130391 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 2, mRNA
[0903] gi|18860889|ref|NM—130391.1|[18860889]
[0904] 214: NM—003682 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 4, mRNA
[0905] gi|18860876|ref|NM—003682.2|[18860876]
[0906] 215: NM—130476 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 8, mRNA
[0907] gi|18860874|ref|NM—130476.1|[18860874]
[0908] 216: NM—130475 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 7,
[0909] mRNA
[0910] gi|18860872|ref|NM—130475.1|[18860872]
[0911] 217: NM—002840 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 1, mRNA
[0912] gi|18860871|ref|NM—002840.2|[18860871]
[0913] 218: NM—130474 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 6, mRNA
[0914] gi|18860869|ref|NM—130474.1|[18860869]
[0915] 219: NM—130473 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 5, mRNA
[0916] gi|18860867|ref|NM—130473.1|[18860867]
[0917] 220: NM—130472 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 3, mRNA
[0918] gi|18860865|ref|NM—130472.1|[18860865]
[0919] 221: NM—130471 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 2, mRNA
[0920] gi|18860863|ref|NM—130471.1|[18860863]
[0921] 222: NM—130470 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 1, mRNA
[0922] gi|18860861|ref|NM—130470.1|[18860861]
[0923] 223: NM—006504 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 1, mRNA
[0924] gi|18860861|ref|NM—006504.2|[18860860]
[0925] 224: NM—130435 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 2, mRNA
[0926] gi|18860858|ref|NM—130435.1|[18860858]
[0927] 225: AJ431177 Homo sapiens mRNA for WIRE protein
[0928] gi|18857713|emb|AJ431177.1|HSA431177[18857713]
[0929] 226: NM—006474 Homo sapiens lung type-I cell membrane-associated glycoprotein (T1A-2), mRNA
[0930] gi|18767663|ref|NM—006474.2|[18767663]
[0931] 228: NM—006794 Homo sapiens G protein-coupled receptor 75 (GPR75), mRNA
[0932] gi|5803024|ref|NM—006794.1|[5803024]
[0933] 229: NM—002842 Homo sapiens protein tyrosine phosphatase, receptor type, H (PTPRH), mRNA
[0934] gi|4506312|ref|NM—002842.1|[4506312]
[0935] 230: NM—002839 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 1, mRNA
[0936] gi|4506308|ref|NM—002839.1|[4506308]
[0937] 231: BC024145 Homo sapiens, TNF receptor-associated factor 1, clone MGC:10353 IMAGE:3832475, mRNA, complete cds
[0938] gi|18848176|gb|BC024145.1|[18848176]
[0939] 232: AF469756 Homo sapiens clone S9 interleukin-1 receptor type I (IL1R1) gene, partial sequence
[0940] gi|18846656|gb|AF469756.1|[18846656]
[0941] 233: AF469755 Homo sapiens clone S8 interleukin-1 receptor type I (IL1R1) gene, partial sequence
[0942] gi|18846655|gb|AF469755.1|[18846655]
[0943] 234: AF469754 Homo sapiens clone S7 interleukin-1 receptor type I (IL1R1) gene, partial
[0944] sequence
[0945] gi|18845036|gb|AF469754.1|[18845036]
[0946] 237: AF416711 Homo sapiens Fc-gamma receptor IIc5 mRNA, partial cds
[0947] gi|18765992|gb|AF416711.1|[18765992]
[0948] 238: NM—023068 Homo sapiens sialoadhesin (SN), mRNA
[0949] gi|18765743|ref|NM—023068.2|[18765743]
[0950] 239: NM—004782 Homo sapiens synaptosomal-associated protein, 29 kD (SNAP29), mRNA
[0951] gi|18765736|ref|NM—004782.2|[18765736]
[0952] 240: NM—130798 Homo sapiens synaptosomal-associated protein, 23 kD (SNAP23), transcript variant 2, mRNA
[0953] gi|18765730|ref|NM—130798.1|[18765730]
[0954] 241: NM—003825 Homo sapiens synaptosomal-associated protein, 23 kD (SNAP23), transcript variant 1, mRNA
[0955] gi|18765728|ref|NM—003825.2|[18765728]
[0956] 245: AF439409 Homo sapiens G-protein-coupled receptor kinase 7 (GRK7) mRNA, GRK7-S allele, complete cds
[0957] gi|17933258|gb|AF439409.1|[17933258]
[0958] 246: NM—032211 Homo sapiens lysyl oxidase-like 4 (LOXL4), mRNA
[0959] gi|16933522|ref|NM—032211.4|[16933522]
[0960] 247: AF411122 Homo sapiens importin 4 mRNA, complete cds
[0961] gi|18700634|gb|AF411122.1|[18700634]
[0962] 289: NM—130441 Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 11 (CLECSF11), mRNA
[0963] gi|18466805|ref|NM—130441.1|[18466805]
[0964] 290: NM—030876 Homo sapiens olfactory receptor, family 5, subfamily V, member 1 (OR5V1), mRNA
[0965] gi|14495550|ref|NM—030876.2|[14495550]
[0966] 291: NM—032732 Homo sapiens hypothetical protein MGC10763 (IL17RL), mRNA
[0967] gi|14249349|ref|NM—032732.1|[14249349]
[0968] 292: NM—030959 Homo sapiens olfactory receptor, family 12, subfamily D, member 3 (OR12D3), mRNA
[0969] gi|13624334|ref|NM—030959.1|[13624334]
[0970] 294: NM—018844 Homo sapiens B-cell receptor-associated protein BAP29 (BAP29), mRNA
[0971] gi|9994198|ref|NM—018844.1|[9994198]
[0972] 295: NM—002825 Homo sapiens pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1) (PTN), mRNA
[0973] gi|18656935|ref|NM—002825.2|[18656935]
[0974] 299: NM—016372 Homo sapiens seven transmembrane domain orphan receptor (TPRA40), mRNA
[0975] gi|7705964|ref|NM—016372.1|[7705964]
[0976] 300: NM—014288 Homo sapiens integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), mRNA
[0977] gi|7657205|ref|NM—014288.1|[7657205]
[0978] 301: L43588 Homo sapiens T cell antigen receptor mRNA, partial cds
[0979] gi|18654191|gb|L43588.1|HUMTCARF[18654191]
[0980] 318: U77589 Homo sapiens MHC class II HLA-DQ-alpha chain (HLA-DQA1) mRNA, HLA-DQA1*0104 allele, complete cds
[0981] gi|1916744|gb|U77589.1|HSU77589[1916744]
[0982] 319: AF410465 Homo sapiens importin 9 mRNA, complete cds
[0983] gi|15529702|gb|AF410465.1|[15529702]
[0984] 320: AF332759 Homo sapiens partially duplicated CHRNA7 gene, hybrid intron A/4 and partial exon 5
[0985] gi|13345792|gb|AF332759.1|[13345792]
[0986] 321: AF332758 Homo sapiens alpha-7 nicotinic cholinergic receptor subunit (CHRNA7) gene, partial intron 4 and partial cds
[0987] gi|13345790|gb|AF332758.1|[13345790]
[0988] 322: NM—003744 Homo sapiens numb homolog (Drosophila) (NUMB), mRNA
[0989] gi|18644887|ref|NM—003744.2|[18644887]
[0990] 323: NM—003681 Homo sapiens pyridoxal (pyridoxine, vitamin B6) kinase (PDXK), mRNA
[0991] gi|18644884|ref|NM—003681.2|[18644884]
[0992] 324: NM—080706 Homo sapiens transient receptor potential cation channel, subfamily V, member 1(TRPV1), transcript variant 3, mRNA
[0993] gi|18375670|ref|NM—080706.1|[18375670]
[0994] 325: NM—080705 Homo sapiens transient receptor potential cation channel, subfamily V, member 1(TRPV1), transcript variant 4, mRNA
[0995] gi|18375668|ref|NM—080705.1|[18375668]
[0996] 326: NM—080704 Homo sapiens transient receptor potential cation channel, subfamily V, member 1(TRPV1), transcript variant 1, mRNA
[0997] gi|18375666|ref|NM—080704.1|[18375666]
[0998] 327: NM—018727 Homo sapiens transient receptor potential cation channel, subfamily V, member 1(TRPV1), transcript variant 2, mRNA
[0999] gi|18375664|ref|NM—018727.3|[18375664]
[1000] 328: NM—080819
[1001] Homo sapiens G protein-coupled receptor 78 (GPR78), mRNA
[1002] gi|18201873|ref|NM—080819.1|[18201873]
[1003] 329: NM—080738
[1004] Homo sapiens EDAR-associated death domain (EDARADD), mRNA
[1005] gi|18152768|ref|NM—080738.1|[18152768]
[1006] 330: NM—080491 Homo sapiens GRB2-associated binding protein 2 (GAB2), transcript variant 1, mRNA
[1007] gi|18105041|ref|NM—080491.1|[18105041]
[1008] 331: NM—012296 Homo sapiens GRB2-associated binding protein 2 (GAB2), transcript variant 2, mRNA
[1009] gi|18105040|ref|NM—012296.2|[18105040]
[1010] 332: NM—032027 Homo sapiens beta-amyloid binding protein precursor (BBP), mRNA
[1011] gi|17738309|ref|NM—032027.2|[17738309]
[1012] 333: NM—057159 Homo sapiens endothelial differentiation, lysophosphatidic acid
[1013] G-protein-coupled receptor, 2 (EDG2), transcript variant 2, mRNA
[1014] gi|16950637|ref|NM—057159.1|[16950637]
[1015] 334: NM—001401 Homo sapiens endothelial differentiation, lysophosphatidic acid
[1016] G-protein-coupled receptor, 2 (EDG2), transcript variant 1, mRNA
[1017] gi|16950635|ref|NM—001401.2|[16950635]
[1018] 335: NM—007070 Homo sapiens FKBP-associated protein (FAP48), transcript variant 2, mRNA
[1019] gi|16933538|ref|NM—007070.2|[16933538]
[1020] 336: NM—053274 Homo sapiens FKBP-associated protein (FAP48), transcript variant 1, mRNA
[1021] gi|16933536|ref|NM—053274.1|[16933536]
[1022] 337: NM—003726 Homo sapiens src family associated phosphoprotein 1 (SCAP1), mRNA
[1023] gi|16753209|ref|NM—003726.2|[16753209]
[1024] 338: NM—033632 Homo sapiens F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila) (FBXW7), transcript variant 1, mRNA
[1025] gi|16117780|ref|NM—033632.1|[16117780]
[1026] 339: NM—018315 Homo sapiens F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila) (FBXW7), transcript variant 2, mRNA
[1027] gi|16117778|ref|NM—018315.2|[16117778]
[1028] 340: NM—021203 Homo sapiens APMCF1 protein (APMCF1), mRNA
[1029] gi|14917112|ref|NM—021203.2|[14917112]
[1030] 341: NM—002927 Homo sapiens regulator of G-protein signalling 13 (RGS13), mRNA
[1031] gi|14589857|ref|NM—002927.2|[14589857]
[1032] 344: NM—020167 Homo sapiens neuromedin U receptor 2 (NMU2R), mRNA
[1033] gi|9910461|ref|NM—020167.1|[9910461]
[1034] 346: AF190052 Homo sapiens interleukin 1 receptor type I (IL1R1) gene, exon 1C sequence
[1035] gi|9719300|gb|AF190052.1|[9719300]
[1036] 347: NM—018965 Homo sapiens triggering receptor expressed on myeloid cells 2 (TREM2), mRNA
[1037] gi|9507202|ref|NM—018965.1|[9507202]
[1038] 348: NM—018643 Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), mRNA
[1039] gi|8924261|ref|NM—018643.1|[8924261]
[1040] 349: NM—018647 Homo sapiens tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), mRNA
[1041] gi|8924251|ref|NM—018647.1|[8924251]
[1042] 350: NM—018695 Homo sapiens erbb2 interacting protein (ERBB2IP), mRNA
[1043] gi|8923908|ref|NM—018695.1|[8923908]
[1044] 351: NM—017636 Homo sapiens transient receptor potential cation channel, subfamily M, member 4(TRPM4), mRNA
[1045] gi|8923048|ref|NM—017636.1|[8923048]
[1046] 353: NM—016559 Homo sapiens PXR2b protein (PXR2b), mRNA
[1047] gi|7706670|ref|NM—016559.1|[7706670]
[1048] 354: NM—016382 Homo sapiens natural killer cell receptor 2B4 (CD244), mRNA
[1049] gi|7706528|ref|NM—016382.1|[7706528]
[1050] 357: NM—015986 Homo sapiens cytokine receptor-like factor 3 (CRLF3), mRNA
[1051] gi|7705331|ref|NM—015986.1|[7705331]
[1052] 358: NM—014815 Homo sapiens KIAA0130 gene product (KIAA0130), mRNA
[1053] gi|7661929|ref|NM—014815.1|[7661929]
[1054] 359: NM—014053 Homo sapiens FLVCR protein (FLVCR), mRNA
[1055] gi|7661707|ref|NM—014053.1|[7661707]
[1056] 360: NM—014478 Homo sapiens calcitonin gene-related peptide-receptor component protein
[1057] (CGRP-RCP), mRNA
[1058] gi|7656976|ref|NM—014478.1|[7656976]
[1059] 361: NM—012470 Homo sapiens transportin-SR (TRN-SR), mRNA
[1060] gi|6912733|ref|NM—012470.1|[6912733]
[1061] 362: NM—007357 Homo sapiens low density lipoprotein receptor defect C complementing (LDLC), mRNA
[1062] gi|6678675|ref|NM—007357.1|[6678675]
[1063] 366: NM—005162 Homo sapiens angiotensin receptor-like 2 (AGTRL2), mRNA
[1064] gi|6031157|ref|NM—005162.2|[6031157]
[1065] 367: NM—005501 Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), transcript variant b, mRNA
[1066] gi|6006010|ref|NM—005501.1|[6006010]
[1067] 370: NM—007053 Homo sapiens natural killer cell receptor, immunoglobulin superfamily member (BY55), mRNA
[1068] gi|5901909|ref|NM—007053.1|[5901909]
[1069] 371: NM—006653 Homo sapiens suc1-associated neurotrophic factor target 2 (FGFR signalling adaptor) (SNT-2), mRNA
[1070] gi|5730058|ref|NM—006653.1|[5730058]
[1071] 374: NM—005761 Homo sapiens plexin C1 (PLXNC1), mRNA
[1072] gi|5032222|ref|NM—005761.1|[5032222]
[1073] 375: NM—005866 Homo sapiens sigma receptor (SR31747 binding protein 1) (SR-BP1), mRNA
[1074] gi|5032116|ref|NM—005866.1|[5032116]
[1075] 377: NM—005506 Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II) (CD36L2), mRNA
[1076] gi|5031630|ref|NM—005506.1|[5031630]
[1077] 379: NM—004799 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 3, mRNA
[1078] gi|4759059|ref|NM—004799.1|[4759059]
[1079] 380: NM—004292 Homo sapiens ras inhibitor (RIN1), mRNA
[1080] gi|4759039|ref|NM—004292.1|[4759039]
[1081] 381: NM—004828 Homo sapiens lymphocyte antigen 95 (activating NK-receptor; NK-p44) (LY95), mRNA
[1082] gi|4758693|ref|NM—004828.1|[4758693]
[1083] 382: NM—004767 Homo sapiens endothelin type b receptor-like protein 2 (ET(B)R-LP-2), mRNA
[1084] gi|4758309|ref|NM—004767.1|[4758309]
[1085] 383: NM—004440 Homo sapiens EphA7 (EPHA7), mRNA
[1086] gi|4758281|ref|NM—004440.1|[4758281]
[1087] 384: NM—003999 Homo sapiens oncostatin M receptor (OSMR), mRNA
[1088] gi|4557039|ref|NM—003999.1|[4557039]
[1089] 386: NM—003305 Homo sapiens transient receptor potential cation channel, subfamily C, member 3(TRPC3), mRNA
[1090] gi|4507686|ref|NM—003305.1|[4507686]
[1091] 388: NM—003626 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (PPFIA1), mRNA
[1092] gi|4505982|ref|NM—003626.1|[4505982]
[1093] 389: NM—003876 Homo sapiens putative receptor protein (PMI), mRNA
[1094] gi|4505900|ref|NM—003876.1|[4505900]
[1095] 390: NM—003559 Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type II, beta (PIP5K2B), mRNA
[1096] gi|4505818|ref|NM—003559.1|[4505818]
[1097] 391: NM—003629 Homo sapiens phosphoinositide-3-kinase, regulatory subunit, polypeptide 3 (p55, gamma) (PIK3R3), mRNA
[1098] gi|4505804|ref|NM—003629.1|[4505804]
[1099] 392: NM—003676 Homo sapiens degenerative spermatocyte homolog, lipid desaturase (Drosophila) (DEGS), mRNA
[1100] gi|4505192|ref|NM—003676.1|[4505192]
[1101] 393: NM—002270 Homo sapiens karyopherin (importin) beta 2 (KPNB2), mRNA
[1102] gi|4504906|ref|NM—002270.1|[4504906]
[1103] 394: NM—002204 Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), transcript variant a, mRNA
[1104] gi|4504746|ref|NM—002204.1|[4504746]
[1105] 395: NM—001560 Homo sapiens interleukin 13 receptor, alpha 1 (IL13RA1), mRNA
[1106] gi|4504646|ref|NM—001560.1|[4504646]
[1107] 396: NM—000842 Homo sapiens glutamate receptor, metabotropic 5 (GRM5), mRNA
[1108] gi|4504142|ref|NM—000842.1|[4504142]
[1109] 397: NM—001883 Homo sapiens corticotropin releasing hormone receptor 2 (CRHR2), mRNA
[1110] gi|4503044|ref|NM—001883.1|[4503044]
[1111] 398: NM—001873 Homo sapiens carboxypeptidase E (CPE), mRNA
[1112] gi|4503008|ref|NM—001873.1|[4503008]
[1113] 400: L29395 Homo sapiens v-erbB-related protein gene, partial cds
[1114] gi|459807|gb|L29395.1|HUMERBB[459807]
[1115] 401: L08584 Homo sapiens T cell receptor beta chain (TCRB) mRNA, partial cds
[1116] gi|307497|gb|L08584.1|HUMTCVB7A[307497]
[1117] 403: NM—015638 Homo sapiens chromosome 20 open reading frame 188 (C20orf188), mRNA
[1118] gi|18158415|ref|NM—015638.1|[18158415]
[1119] 405: NM—054032 Homo sapiens G protein-coupled receptor MRGX4 (MRGX4), mRNA
[1120] gi|16876454|ref|NM—054032.1|[16876454]
[1121] 406: NM—054031 Homo sapiens G protein-coupled receptor MRGX3 (MRGX3), mRNA
[1122] gi|16876452|ref|NM—054031.1|[16876452]
[1123] 407: NM—054030 Homo sapiens G protein-coupled receptor MRGX2 (MRGX2), mRNA
[1124] gi|16876450|ref|NM—054030.1|[16876450]
[1125] 408: NM—052931 Homo sapiens activating NK receptor (KALI), mRNA
[1126] gi|16418406|ref|NM—052931.1|[16418406]
[1127] 409: NM—032871 Homo sapiens tumor necrosis factor receptor superfamily, member 19-like (TNFRSF19L), mRNA
[1128] gi|14249611|ref|NM—032871.1|[14249611]
[1129] 410: NM—032553 Homo sapiens putative purinergic receptor (FKSG79), mRNA
[1130] gi|14211848|ref|NM—032553.1|[14211848]
[1131] 411: NM—025179 Homo sapiens plexin A2 (PLXNA2), mRNA
[1132] gi|13378152|ref|NM—025179.1|[13378152]
[1133] 413: NM—021249 Homo sapiens sorting nexin 6 (SNX6), mRNA
[1134] gi|13027619|ref|NM—021249.1|[13027619]
[1135] 414: NM—014045 Homo sapiens DKFZP564C1940 protein (DKFZP564C1940), mRNA
[1136] gi|13027587|ref|NM—014045.1|[13027587]
[1137] 415: NM—080923 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 4, mRNA
[1138] gi|18641365|ref|NM—080923.1|[18641365]
[1139] 416: NM—080922 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 3, mRNA
[1140] gi|18641363|ref|NM—080922.1|[18641363]
[1141] 417: NM—080921 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 2, mRNA
[1142] gi|18641361|ref|NM—080921.1|[18641361]
[1143] 418: NM—130386 Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant I, mRNA
[1144] gi|18641359|ref|NM—130386.1|[18641359]
[1145] 419: NM—030781 Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant II, mRNA
[1146] gi|18641357|ref|NM—030781.2|[18641357]
[1147] 420: NM—002838 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 1, mRNA
[1148] gi|18641346|ref|NM—002838.2|[18641346]
[1149] 421: NM—130770 Homo sapiens 5-hydroxytryptamine receptor 3 subunit C (HTR3C), mRNA gi|18640739|ref|NM—130770.1|[18640739]
[1150] 430: BD010218 Novel hemopoietin receptor protein, NR12
[1151] gi|18638591|dbj|BD010218.1|[18638591]
[1152] 431: BD010217 Novel hemopoietin receptor protein, NR12
[1153] gi|18638590|dbj|BD010217.1|[18638590]
[1154] 432: BD010216 Novel hemopoietin receptor protein, NR12
[1155] gi|18638589|dbj|BD010216.1|[18638589]
[1156] 433: BD010215 Novel hemopoietin receptor protein, NR12
[1157] gi|18638588|dbj|BD010215.1|[18638588]
[1158] 434: BD010214 Novel hemopoietin receptor protein, NR12
[1159] gi|18638587|dbj|BD010214.1|[18638587]
[1160] 435: BD010125 Peptide leukotriene receptor
[1161] gi|18638498|dbj|BD010125.1|[18638498]
[1162] 436: BD010114 Novel receptor and gene encoding the same
[1163] gi|18638487|dbj|BD010114.1|[18638487]
[1164] 437: BD010057 Novel G protein coupled receptor protein and its DNA
[1165] gi|18638430|dbj|BD010057.1|[18638430]
[1166] 438: BD010056 Novel G protein coupled receptor protein and its DNA
[1167] gi|18638429|dbj|BD010056.1|[18638429]
[1168] 439: BD010055 Novel G protein coupled receptor protein and its DNA
[1169] gi|18638428|dbj|BD010055.1|[18638428]
[1170] 440: BD010054 Novel G protein coupled receptor protein and its DNA
[1171] gi|18638427|dbj|BD010054.1|[18638427]
[1172] 441: BD010053 Novel G protein coupled receptor protein and its DNA
[1173] gi|18638426|dbj|BD010053.1|[18638426]
[1174] 442: BD010052 Novel G protein coupled receptor protein and its DNA
[1175] gi|18638425|dbj|BD010052.1|[18638425]
[1176] 443: BD010051 Novel G protein coupled receptor protein and its DNA
[1177] gi|18638424|dbj|BD010051.1|[18638424]
[1178] 444: BD010050 Novel G protein coupled receptor protein and its DNA
[1179] gi|18638423|dbj|BD010050.1[18638423]
[1180] 445: BD010049 Novel G protein coupled receptor protein and its DNA
[1181] gi|18638422|dbj|BD010049.1|[18638422]
[1182] 446: BD010046 Novel G protein coupled receptor protein and its DNA
[1183] gi|18638419|dbj|BD010046.1|[18638419]
[1184] 447: BD010035 Novel G protein coupled receptor protein and its DNA
[1185] gi|18638408|dbj|BD010035.1|[18638408]
[1186] 448: BD010034 Novel G protein coupled receptor protein and its DNA
[1187] gi|18638407|dbj|BD010034.1|[18638407]
[1188] 449: BD010028 Novel G protein coupled receptor protein and its DNA
[1189] gi|18638401|dbj|BD010028.1|[18638401]
[1190] 450: BD010022 Novel G protein coupled receptor protein and its DNA
[1191] gi|18638395|dbj|BD010022.1|[18638395]
[1192] 451: BD009263 GABAA receptor subunit epsilon-related protein
[1193] gi|18637636|dbj|BD009263.1|[18637636]
[1194] 452: BD009262 GABAA receptor subunit epsilon-related protein
[1195] gi|18637635|dbj|BD009262.1|[18637635]
[1196] 453: BD009261 GABAA receptor subunit epsilon-related protein
[1197] gi|18637634|dbj|BD009261.1|[18637634]
[1198] 454: BD009260 GABAA receptor subunit epsilon-related protein
[1199] gi|18637633|dbj|BD009260.1|[18637633]
[1200] 455: BD006753 Human G protein chemokine receptor HDGNR10
[1201] gi|18635124|dbj|BD006753.1|[18635124]
[1202] 460: E51301 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein
[1203] gi|18633577|dbj|E51301.1|[18633577]
[1204] 461: E51300 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein
[1205] gi|18633576|dbj|E51300.1|[18633576]
[1206] 462: E51299 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633575|dbj|E51299.1|[18633575]
[1207] 463: E51298 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633574|dbj|E51298.1|[18633574]
[1208] 464: E51297 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633573|dbj|E51297.1|[18633573]
[1209] 465: E51296 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633572|dbj|E51296.1|[18633572]
[1210] 466: E50838 Novel G protein-coupled receptor
[1211] gi|18633543|dbj|E50838.1|[18633543]
[1212] 467: E50837 Novel G protein-coupled receptor
[1213] gi|18633542|dbj|E50837.1|[18633542]
[1214] 468: E50836 Novel G protein-coupled receptor
[1215] gi|18633541|dbj|E50836.1|[18633541]
[1216] 469: E50835 Novel G protein-coupled receptor
[1217] gi|18633540|dbj|E50835.1|[18633540]
[1218] 470: E50834 Novel G protein-coupled receptor
[1219] gi|18633539|dbj|E50834.1|[18633539]
[1220] 471: E50833 Novel G protein-coupled receptor
[1221] gi|18633538|dbj|E50833.1|[18633538]
[1222] 490: BD003056 Novel G protein-coupled receptor protein and DNA thereof
[1223] gi|18631017|dbj|BD003056.1|[18631017]
[1224] 491: E55122 Novel G protein-coupled receptor and the G protein-coupled receptor gene gb|18629753|dbj|E55122.1|[18629753]
[1225] 492: E55121 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629752|dbj|E55121.1|[18629752]
[1226] 493: E55120 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629751|dbj|E55120.1|[18629751]
[1227] 494: E55119 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629750|dbj|E55119.1|[18629750]
[1228] 495: E55118 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629749|dbj|E55118.1|[18629749]
[1229] 496: E55117 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629748|dbj|E55117.1|[18629748]
[1230] 497: E49128 Novel G protein-conjugated receptor protein
[1231] gi|18629265|dbj|E49128.1|[18629265]
[1232] 498: E49127 Novel G protein-conjugated receptor protein
[1233] gi|18629264|dbj|E49127.1|[18629264]
[1234] 499: E49126 Novel G protein-conjugated receptor protein
[1235] gi|18629263|dbj|E49126.1|[18629263]
[1236] 500: E49125 Novel G protein-conjugated receptor protein
[1237] gi|18629262|dbj|E49125.1|[18629262]
[1238] 501: D21847
[1239] Human mRNA for T cell receptor alpha chain TcHST2Va7, V segment, J segment and C region
[1240] gi|431140|dbj|D21847.1|HUMTCHST24[431140]
[1241] 502: D21846
[1242] Human mRNA for T cell receptor beta chain HPBL3xVb20, V segment, D segment, J segment and C region
[1243] gi|431139|dbj|D21846.1|HUMHPBL3X3[431139]
[1244] 503: D21845
[1245] Human mRNA for T cell receptor alpha chain HPBL3xVa7, V segment, J segment and C region
[1246] gi|431138|dbj|D521845.1|HUMHPBL3X2[431138]
[1247] 504: D21844
[1248] Human mRNA for T cell receptor alpha chain HPBL(−)Va7, V segment, J segment and
[1249] C region
[1250] gi|431137|dbj|D521844.1|HUMCHPBL1[431137]
[1251] 505: D13083
[1252] Human mRNA for T-cell receptor beta-chain V region, partial cds, clone WBDM19C
[1253] gi|407766|dbj|D13083.1|HUMVB73B[407766]
[1254] 506: D13085
[1255] Human mRNA for T-cell receptor beta-chain V region, partial cds, clone WBDM28A
[1256] gi|407764|dbj|D513085.1|HUMVB69B[407764]
[1257] 507: D13088
[1258] Human TCRBV2.3a mRNA for T-cell receptor beta-chain V region, partial cds
[1259] gi|407762|dbj|D13088.1|HUMVB23A[407762]
[1260] 508: D13087
[1261] Human TCRBV2.1c mRNA for T-cell receptor beta-chain V region, partial cds
[1262] gi|407760|dbj|D13087.1|HUMVB21C[407760]
[1263] 509: D13082
[1264] Human mRNA for T-cell receptor beta-chain V region, partial cds, clone WBDM17A
[1265] gi|407758|dbj|D13082.1|HUMVB21AA[407758]
[1266] 510: D13086
[1267] Human TCRBV20.1a mRNA for T-cell receptor beta-chain V region, partial cds
[1268] gi|407756|dbj|D13086.1HUMVB201A[407756]
[1269] 511: D13084
[1270] Human TCRBV12.5a mRNA for T-cell receptor beta-chain V region, partial cds
[1271] gi|407754|dbj|D513084.1|HUMVB125A[407754]
[1272] 512: D13073
[1273] Human TCRAVN1 mRNA for T-cell receptor alpha-chain V region, partial cds
[1274] gi|407752|dbj|D13073.1|HUMVAN1[407752]
[1275] 513: D13079
[1276] Human TCRAV8.1a mRNA for T-cell receptor alpha-chain V region, partial cds
[1277] gi|407750|dbj|D13079.1|HUMVA81A[407750]
[1278] 514: D13069
[1279] Human TCRAV5.1a mRNA for T-cell receptor alpha-chain V region, partial cds
[1280] gi|407748|dbj|D13069.1HUMVA51A[407748]
[1281] 515: D13078
[1282] Human TCRAV2.5a mRNA for T-cell receptor alpha-chain V region, partial cds
[1283] gi|407746|dbj|D13078.1|HUMVA25A[407746]
[1284] 516: D13072
[1285] Human mRNA for T-cell receptor alpha-chain V-J-C, partial cds, clone WADM13D
[1286] gi|407744|dbj|D13072.1|HUMVA221AJ[407744]
[1287] 517: D13076
[1288] Human TCRAV21.1a mRNA for T-cell receptor alpha-chain V region, partial cds
[1289] gi|407742|dbj|D13076.1|HUMVA211A[407742]
[1290] 518: D13071
[1291] Human mRNA for T-cell receptor alpha-chain V region, partial cds, clone WADM11H
[1292] gi|407740|dbj|D13071.1|HUMVA171A[407740]
[1293] 519: D13074
[1294] Human TCRAV14.1a mRNA for T-cell receptor alpha-chain V region, partial cds
[1295] gi|407738|dbj|D13074.1|HUMVA141A[407738]
[1296] 520: D13070
[1297] Human TCRAV1.3a mRNA for T-cell receptor alpha-chain V region, partial cds
[1298] gi|407736|dbj|D13070.1|HUMVA13A[407736]
[1299] 521: D13077
[1300] Human TCRAV1.2a mRNA for T-cell receptor alpha-chain V region, partial cds
[1301] gi|407734|dbj|D13077.1|HUMVA12A[407734]
[1302] 522: D13075
[1303] Human TCRAV10.1a mRNA for T-cell receptor alpha-chain V region, partial cds
[1304] gi|407732|dbj|D13075.1|HUMVA101A[407732]
[1305] 523: D13081
[1306] Human mRNA for T-cell receptor alpha-chain J segment, partial cds, clone WADM36G
[1307] gi|407730|dbj|D13081.1|HUMJAAC17[407730]
[1308] 524: D13080
[1309] Human mRNA for T-cell receptor alpha-chain J segment, partial cds, clone WADM36A
[1310] gi|407728|dbj|D13080.1|HUMJAAB19[407728]
[1311] 525: D16584
[1312] Homo sapiens mRNA for T cell receptor beta chain, N-terminal
[1313] gi|391732|dbj|D16584.1|HUMTCRB17[391732]
[1314] 526: D16586
[1315] Homo sapiens mRNA for T cell receptor alpha chain, N-terminal
[1316] gi|391731|dbj|D16586.1|HUMTCRB17[391731]
[1317] 527: D16585
[1318] Homo sapiens mRNA for T cell receptor alpha chain, N-terminal
[1319] gi|391730|dbj|D16585.1|HUMTCRA32[391730]
[1320] 528: NM—003268
[1321] Homo sapiens toll-like receptor 5 (TLR5), mRNA
[1322] gi|19718736|ref|NM—003268.3|[19718736]
[1323] 529: NM—003265
[1324] Homo sapiens toll-like receptor 3 (TLR3), mRNA
[1325] gi|19718735|ref|NM—003265.2|[19718735]
[1326] 530: NM—003264
[1327] Homo sapiens toll-like receptor 2 (TLR2), mRNA
[1328] gi|19718733|ref|NM—003264.2|[19718733]
[1329] 531: NM—003263
[1330] Homo sapiens toll-like receptor 1 (TLR1), mRNA
[1331] gi|19718732|ref|NM—003263.2|[19718732]
[1332] 534: NM—020350
[1333] Homo sapiens angiotensin II, type I receptor-associated protein (ATRAP), mRNA
[1334] gi|19705427|ref|NM—020350.2|[19705427]
[1335] 535: AY081843
[1336] Homo sapiens GnRH receptor II 5TM mRNA, complete cds
[1337] gi|19697895|gb|AY081843.1|[19697895]
[1338] 539: NM—016511
[1339] Homo sapiens C-type lectin-like receptor-1 (LOC51267), mRNA
[1340] gi|7706062|ref|NM—016511.1|[7706062]
[1341] 540: NM—016509
[1342] Homo sapiens C-type lectin-like receptor-2 (LOC51266), mRNA
[1343] gi|7706060|ref|NM—016509.1|[7706060]
[1344] 546: AL713657
[1345] Homo sapiens mRNA; cDNA DKFZp547G1215 (from clone DKFZp547G1215)
[1346] gi|19584339|emb|AL713657.1|HSM802985[19584339]
[1347] 547: AJ438313
[1348] Homo sapiens partial mRNA for KIT protein
[1349] gi|19571549|emb|AJ438313.1|HSA438313[19571549]
[1350] 575: AF390036
[1351] Homo sapiens FCRLd mRNA, partial cds
[1352] gi|16611715|gb|AF390036.1|[16611715]
[1353] 576: AF329495
[1354] Homo sapiens FCRLe mRNA, complete cds
[1355] gi|16506270|gb|AF329495.1|[16506270]
[1356] 577: AF329494
[1357] Homo sapiens FCRLc1 mRNA, complete cds
[1358] gi|16506268|gb|AF329494.1|[16506268]
[1359] 578: AF329493
[1360] Homo sapiens FCRLb mRNA, complete cds
[1361] gi|16506266|gb|AF329493.1|[16506266]
[1362] 579: AF329491
[1363] Homo sapiens FCRLc2 mRNA, complete cds
[1364] gi|16506262|gb|AF329491.1|[16506262]
[1365] 580: AF329489
[1366] Homo sapiens FCRLa mRNA, complete cds
[1367] gi|16506258|gb|AF329489.1|[16506258]
[1368] 582: AB060695
[1369] Homo sapiens TLR5 mRNA for Toll-like receptor 5, complete cds
[1370] gi|13810567|dbj|AB060695.1|[13810567]
[1371] 583: AJ276429
[1372] Homo sapiens mRNA for 19A protein
[1373] gi|12619176|emb|AJ276429.2|HSA276429[12619176]
[1374] 584: AL136801
[1375] Homo sapiens mRNA; cDNA DKFZp434K0220 (from clone DKFZp434K0220); complete cds
[1376] gi|12053114|emb|AL136801.1|HSM801769[12053114]
[1377] 585: AL136652
[1378] Homo sapiens mRNA; cDNA DKFZp56401762 (from clone DKFZp56401762); complete cds
[1379] gi|12052829|emb|AL136652.1|HSM801622[12052829]
[1380] 587: AB012911
[1381] Homo sapiens mRNA for Frizzled-6, complete cds
[1382] gi|3062802|dbj|AB012911.1|[3062802]
[1383] 589: AY071862
[1384] Homo sapiens crinkled (CR) mRNA, complete cds
[1385] gi|19568064|gb|AY071862.1|[19568064]
[1386] 596: NM—133169
[1387] Homo sapiens osteoclast-associated receptor (OSCAR), transcript variant 2, mRNA
[1388] gi|19557667|ref|NM—133169.1|[19557667]
[1389] 597: NM—133168
[1390] Homo sapiens osteoclast-associated receptor (OSCAR), transcript variant 3, mRNA
[1391] gi|19557663|ref|NM—133168.1|[19557663]
[1392] 598: NM—130771
[1393] Homo sapiens osteoclast-associated receptor (OSCAR), transcript variant 1, mRNA
[1394] gi|19557659|ref|NM—130771.1|[19557659]
[1395] 599: AF426461
[1396] Homo sapiens FREB mRNA, complete cds
[1397] gi|18056674|gb|AF426461.1|[18056674]
[1398] 600: AF428134
[1399] Homo sapiens T-cell receptor beta-chain (TCRVb13.1-Jb1.5) mRNA, partial cds
[1400] gi|16566700|gb|AF428134.1|[16566700]
[1401] 601: AF428133
[1402] Homo sapiens T-cell receptor beta-chain (TCRVb13.1-Jb1.2) mRNA, partial cds
[1403] gi|16566697|gb|AF428133.1|[16566697]
[1404] 602: AF428132
[1405] Homo sapiens T-cell receptor beta-chain (TCRVb8.1-Jb2.3) mRNA, partial cds
[1406] gi|16566694|gb|AF428132.1|[16566694]
[1407] 603: AF428131
[1408] Homo sapiens T-cell receptor beta-chain (TCRVb8.2-Jb2.7) mRNA, partial cds
[1409] gi|16566691|gb|AF428131.1|[16566691]
[1410] 604: AF428130
[1411] Homo sapiens T-cell receptor beta-chain (TCRVb8.1-Jb2.3) mRNA, partial cds
[1412] gi|16566688|gb|AF428130.1|[16566688]
[1413] 605: AF428129
[1414] Homo sapiens T-cell receptor beta-chain (TCRVb7.1-Jb1.2) mRNA, partial cds
[1415] gi|16566685|gb|AF428129.1|[16566685]
[1416] 606: AF428128
[1417] Homo sapiens T-cell receptor beta-chain (TCRVb7.2-Jb1.6) mRNA, partial cds
[1418] gi|16566682|gb|AF428128.1|[16566682]
[1419] 607: AF428127
[1420] Homo sapiens T-cell receptor beta-chain (TCRVb7.1-Jb1.2) mRNA, partial cds
[1421] gi|16566679|gb|AF428127.1|[16566679]
[1422] 608: AF428126
[1423] Homo sapiens T-cell receptor beta-chain (TCRVb7.2-Jb1.2) mRNA, partial cds
[1424] gi|16566676|gb|AF428126.1|[16566676]
[1425] 609: AF428125
[1426] Homo sapiens T-cell receptor beta-chain (TCRVb7.1-Jb1.5) mRNA, partial cds
[1427] gi|16566673|gb|AF428125.1|[16566673]
[1428] 611: AF242456
[1429] Homo sapiens interleukin 13 receptor alpha 1-binding protein-1 mRNA, complete cds
[1430] gi|19548138|gb|AF242456.1|[19548138]
[1431] 616: S57283
[1432] Homo sapiens endothelin ET-B receptor mRNA, complete cds
[1433] gi|298321|gb|S57283.1|[298321]
[1434] 617: L14854
[1435] Homo sapiens T cell receptor TCR-beta D38 (TCRB) mRNA, partial cds
[1436] gi|292794|gb|L14854.1|HUMTCRD38[292794]
[1437] 618: NM—024080
[1438] Homo sapiens transient receptor potential cation channel, subfamily M, member 8
[1439] (TRPM8), mRNA
[1440] gi|13129071|ref|NM—024080.1|[13129071]
[1441] 619: AY069961
[1442] Homo sapiens lymphocyte effector toxicity activation ligand (LETAL) mRNA, complete cds
[1443] gi|19525539|gb|AY069961.1|[19525539]
[1444] 620: U43901
[1445] Homo sapiens 37 kD laminin receptor precursor/p40 ribosome associated protein (LAMR1) gene, complete cds; and E2 small nuclear RNA gene, complete sequence
[1446] gi|19483807|gb|U43901.2|HSU43901[19483807]
[1447] 621: NM—021044
[1448] Homo sapiens desert hedgehog homolog (Drosophila) (DHH), mRNA
[1449] gi|19482157|ref|NM—021044.1|[19482157]
[1450] 622: AC078860
[1451] Homo sapiens 12q BAC RP11-186F10 (Roswell Park Cancer Institute Human BAC Library) complete sequence
[1452] gi|13491193|gb|AC078860.19|[13491193]
[1453] 623: AC003683
[1454] Homo sapiens x BAC RP1-147H15 (Roswell Park Cancer Institute Human BAC Library)
[1455] complete sequence
[1456] gi|13489135|gb|AC003683.2|[13489135]
[1457] 624: AC007397
[1458] Homo sapiens 12 p13 BAC RPCI11-439G16 (Roswell Park Cancer Institute Human BAC Library) complete sequence
[1459] gi|5685879|gb|AC007397.21|[5685879]
[1460] 625: AC007784
[1461] Homo sapiens 12 p13 BAC RPCI11-1092P21 (Roswell Park Cancer Library Human BAC Library) complete sequence
[1462] gi|5597031|gb|AC007784.7|[5597031]
[1463] 627: AF451730
[1464] Homo sapiens isolate R5255 T cell receptor delta chain (TRD@) mRNA, partial cds
[1465] gi|19401669|gb|AF451730.1|[19401669]
[1466] 628: AF451729
[1467] Homo sapiens isolate Q5252 T cell receptor delta chain (TRD@) mRNA, partial cds
[1468] gi|19401667|gb|AF451729.1|[19401667]
[1469] 629: AF451728
[1470] Homo sapiens isolate P5739 T cell receptor delta chain (TRD@) mRNA, partial cds
[1471] gi|19401665|gb|AF451728.1|[19401665]
[1472] 630: AF451727
[1473] Homo sapiens isolate P5742 T cell receptor delta chain (TRD@) mRNA, partial cds
[1474] gi|19401663|gb|AF451727.1|[19401663]
[1475] 631: AF451726
[1476] Homo sapiens isolate P5738 T cell receptor delta chain (TRD@) mRNA, partial cds
[1477] gi|19401661|gb|AF451726.1|[19401661]
[1478] 632: AF451725
[1479] Homo sapiens isolate 0581 T cell receptor delta chain (TRD@) mRNA, partial cds
[1480] gi|19401658|gb|AF451725.1|[19401658]
[1481] 633: AF451724
[1482] Homo sapiens isolate N505 T cell receptor delta chain (TRD@) mRNA, partial cds
[1483] gi|19401656|gb|AF451724.1|[19401656]
[1484] 634: AF451723
[1485] Homo sapiens isolate N504 T cell receptor delta chain (TRD@) mRNA, partial cds
[1486] gi|19401653|gb|AF451723.1|[19401653]
[1487] 635: AF451722
[1488] Homo sapiens isolate P5729 T cell receptor delta chain (TRD@) mRNA, partial cds
[1489] gi|19401650|gb|AF451722.1|[19401650]
[1490] 636: AF451721
[1491] Homo sapiens isolate P5728 T cell receptor delta chain (TRD@) mRNA, partial cds
[1492] gi|19401647|gb|AF451721.1|[19401647]
[1493] 637: AF451720
[1494] Homo sapiens isolate 0268 T cell receptor delta chain (TRD@) mRNA, partial cds
[1495] gi|19401645|gb|AF451720.1|[19401645]
[1496] 638: AF451719
[1497] Homo sapiens isolate 038 T cell receptor delta chain (TRD@) mRNA, partial cds
[1498] gi|19401642|gb|AF451719.1|[19401642]
[1499] 639: AF451718
[1500] Homo sapiens isolate 037 T cell receptor delta chain (TRD@) mRNA, partial cds
[1501] gi|19401640|gb|AF451718.1|[19401640]
[1502] 640: AF449218
[1503] Homo sapiens 43 kDa acetylcholine receptor-associated protein (RAPSN) mRNA, complete cds
[1504] gi|19310212|gb|AF449218.1|[19310212]
[1505] 644: BC025704
[1506] Homo sapiens, leukocyte immunoglobulin-like receptor, subfamily B (with TM and
[1507] ITIM domains), member 5, clone MGC:34418 IMAGE:5223581, mRNA, complete cds
[1508] gi|19344005|gb|BC025704.1|[19344005]
[1509] 645: BC025713
[1510] Homo sapiens, T-cell receptor interacting molecule, clone MGC:34314 IMAGE:5227396, mRNA, complete cds
[1511] gi|19343996|gb|BC025713.1|[19343996]
[1512] 646: BC025722
[1513] Homo sapiens, adenosine A2b receptor, clone MGC:34640 IMAGE:5198898, mRNA, complete cds
[1514] gi|19343938|gb|BC025722.1|[19343938]
[1515] 647: BC025717
[1516] Homo sapiens, chemokine (C-C motif) receptor-like 2, clone MGC:34104 IMAGE:5228561, mRNA, complete cds
[1517] gi|19343936|gb|BC025717.1|[19343936]
[1518] 648: BC025695
[1519] Homo sapiens, endothelial differentiation, lysophosphatidic acid
[1520] G-protein-coupled receptor, 4, clone MGC:34227 IMAGE:5209267, mRNA, complete cds
[1521] gi|19343926|gb|BC025695.1|[19343926]
[1522] 650: BC025691
[1523] Homo sapiens, interleukin 2 receptor, beta, clone MGC:34584 IMAGE:5207833, mRNA,
[1524] complete cds
[1525] gi|19343610|gb|BC025691.1|[19343610]
[1526] 651: AF474992
[1527] Homo sapiens G protein-coupled receptor SNSR6 gene, complete cds
[1528] gi|19338917|gb|AF474992.1|[19338917]
[1529] 652: AF474991
[1530] Homo sapiens G protein-coupled receptor SNSR5 gene, complete cds
[1531] gi|19338915|gb|AF474991.1|[19338915]
[1532] 653: AF474990
[1533] Homo sapiens G protein-coupled receptor SNSR4 gene, complete cds
[1534] gi|19338913|gb|AF474990.1|[19338913]
[1535] 654: AF474989
[1536] Homo sapiens G protein-coupled receptor SNSR3 gene, complete cds
[1537] gi|19338911|gb|AF474989.1|[19338911]
[1538] 655: AF474988
[1539] Homo sapiens G protein-coupled receptor SNSR2 gene, complete cds
[1540] gi|19338909|gb|AF474988.1|[19338909]
[1541] 656: AF474987
[1542] Homo sapiens G protein-coupled receptor SNSR1 gene, complete cds
[1543] gi|19338907|gb|AF474987.1|[19338907]
[1544] 695: AF453877
[1545] Homo sapiens neuronal nicotinic receptor beta 4 subunit precursor, gene, exon 1
[1546] and partial cds
[1547] gi|18042122|gb|AF453877.1|[18042122]
[1548] 697: U62556
[1549] Homo sapiens chemokine receptor-like protein (TER1) gene, complete cds
[1550] gi|1468978|gb|U62556.1|HSU62556[1468978]
[1551] 698: AJ011371
[1552] Homo sapiens mRNA for serotonin 4 receptor, splice variant h5-HT4(e)
[1553] gi|3646277|emb|AJ011371.1|HSAJ1371[3646277]
[1554] 712: AY059419
[1555] Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL1) mRNA, KIR3DL1*011 allele, partial cds
[1556] gi|19224338|gb|AY059419.1|[19224338]
[1557] 713: AY059418
[1558] Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL2) mRNA, KIR3DL2*010 allele, partial cds
[1559] gi|19224336|gb|AY059418.1|[19224336]
[1560] 714: AY059417
[1561] Homo sapiens killer-cell immunoglobulin-like receptor KIR3DL1/2v mRNA, partial
[1562] cds
[1563] gi|19224334|gb|AY059417.1|[19224334]
[1564] 715: AY059420
[1565] Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL2) mRNA, KIR3DL2*012 allele, partial cds
[1566] gi|19224332|gb|AY059420.1|[19224332]
[1567] 716: AC079385
[1568] Homo sapiens 12q BAC RP11-482D24 (Roswell Park Cancer Institute Human BAC Library) complete sequence
[1569] gi|14670063|gb|AC079385.18|[14670063]
[1570] 717: AC078889
[1571] Homo sapiens 12q BAC RP11-335112 (Roswell Park Cancer Institute Human BAC Library) complete sequence
[1572] gi|11072039|gb|AC078889.20|[11072039]
[1573] 718: AC010168
[1574] Homo sapiens 12 p12-31.7-32.2 BAC RP11-174G6 (Rosewell Park Cancer Institute Human Bac Library) complete sequence
[1575] gi|6855156|gb|AC010168.6|[6855156]
[1576] 719: U14188
[1577] Homo sapiens LERK-4 (EPLG4) mRNA, complete cds
[1578] gi|642834|gb|U14188.1|HSU14188[642834]
[1579] 720: U14187
[1580] Homo sapiens LERK-3 (EPLG3) mRNA, complete cds
[1581] gi|642832|gb|U14187.1|HSU14187[642832]
[1582] 721: U15637
[1583] Homo sapiens CD40 binding protein (CD40BP) mRNA, complete cds
[1584] gi|595910 gb|U15637.1|HSU15637[595910]
[1585] 722: AF262304
[1586] Homo sapiens clone 7 CC chemokine receptor 3-like mRNA, partial sequence, alternatively spliced
[1587] gi|19171650|gb|AF262304.1|[19171650]
[1588] 723: AF262303
[1589] Homo sapiens clone 6 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[1590] gi|19171648|gb|AF262303.1|[19171648]
[1591] 724: AF262302
[1592] Homo sapiens clone 5 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[1593] gi|19171646|gb|AF262302.1|[19171646]
[1594] 725: AF262301
[1595] Homo sapiens clone 4 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[1596] gi|19171644|gb|AF262301.1|[19171644]
[1597] 726: AF262300
[1598] Homo sapiens clone 2 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[1599] gi|19171642|gb|AF262300.1|[19171642]
[1600] 727: AF262299
[1601] Homo sapiens clone 1 CC chemokine receptor 3 (CCR3) mRNA, partial cds
[1602] gi|19171640|gb|AF262299.1|[19171640]
[1603] 729: AF247361
[1604] Homo sapiens CC chemokine receptor 3 (CCR3) gene, complete cds
[1605] gi|19110542|gb|AF247361.1|[19110542]
[1606] 730: AF247360
[1607] Homo sapiens CC chemokine receptor 3 (CCR3) gene, promoter region and partial sequence
[1608] gi|1911054|gb|AF247360.1|[19110541]
[1609] 731: AF247359
[1610] Homo sapiens CC chemokine receptor 3 (CCR3) gene, promoter region and partial sequence
[1611] gi|19110540|gb|AF247359.1|[19110540]
[1612] 733: AF416619
[1613] Homo sapiens prolactin receptor short isoform 1a (PRLR) mRNA, complete cds, alternatively spliced
[1614] gi|16506717|gb|AF416619.1|[16506717]
[1615] 734: AF416618
[1616] Homo sapiens prolactin receptor short isoform 1b (PRLR) mRNA, complete cds, alternatively spliced
[1617] gi|16506715|gb|AF416618.1[16506715]
[1618] 736: AJ303165
[1619] Homo sapiens partial gene for putative transmembrane receptor
[1620] gi|13162199|emb|AJ303165.1|HSA303165[13162199]
[1621] 738: AF350881
[1622] Homo sapiens channel kinase 2 (CHAK2) mRNA, complete cds
[1623] gi|18860923|gb|AF350881.2|[18860923]
[1624] 739: AF022044
[1625] Homo sapiens natural killer cell receptor KIR3D51 variant mRNA, complete cds
[1626] gi|2760894|gb|AF022044.1|[2760894]
[1627] 740: AF034773
[1628] Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 3, complete cds
[1629] gi|2739181|gb|AF034773.1|[2739181]
[1630] 741: AF034772
[1631] Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 2,
[1632] complete cds
[1633] gi|2739179|gb|AF034772.1([2739179]
[1634] 742: AF034771
[1635] Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 1, complete cds
[1636] gi|2739177|gb|AF034771.1|[2739177]
[1637] 743: AF022047
[1638] Homo sapiens natural killer cell inhibitory receptor KIR2D53 variant mRNA, complete cds
[1639] gi|2738966|gb|AF022047.1|[2738966]
[1640] 744: AF022046
[1641] Homo sapiens natural killer cell inhibitory receptor KIR2D51 variant mRNA, complete cds
[1642] gi|2738964|gb|AF022046.1|[2738964]
[1643] 745: AF022045
[1644] Homo sapiens natural killer cell receptor KIR2DL1 variant mRNA, complete cds
[1645] gi|2738962|gb|AF022045.1|[2738962]
[1646] 746: U56255
[1647] Homo sapiens CW-1 mRNA, complete cds
[1648] gi|1399688|gb|U56255.1|HSU56255[1399688]
[1649] 747: AJ422056
[1650] Homo sapiens partial GRM5 gene for metabotrophic glutamate receptor, exon 1A
[1651] gi|19069804|emb|AJ422056.1|HSA422056[19069804]
[1652] 748: AY028912
[1653] Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 7 and complete cds, alternatively spliced
[1654] gi|19067944|gb|AY028912.1|AY028906S7[19067944]
[1655] 749: AY028911
[1656] Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 6
[1657] gi|19067943|gb|AY028911.1|AY028906S6[19067943]
[1658] 750: AY028910
[1659] Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 5
[1660] gi|19067942|gb|AY028910.1|AY028906S5[19067942]
[1661] 751: AY028909
[1662] Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 4
[1663] gi|1906794|gb|AY028909.1|AY028906S4[19067941]
[1664] 752: AY028908
[1665] Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 3
[1666] gi|19067940|gb|AY028908.1|AY028906S3[19067940]
[1667] 753: AY028907
[1668] Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 2
[1669] gi|19067939|gb|AY028907.1|AY028906S2[19067939]
[1670] 754: AY028906
[1671] Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 1
[1672] gi|19067938|gb|AY028906.1|AY028906S1[19067938]
[1673] 755: AH010677
[1674] Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, complete cds, alternatively spliced
[1675] gi|19067937|gb|AH010677.1|SEG_AY028906S[19067937]
[1676] 756: AY028913
[1677] Homo sapiens ectodysplasia A receptor associated death domain A (EDARADD) mRNA,
[1678] complete cds; alternatively spliced
[1679] gi|9067935|gb|AY028913.1|[19067935]
[1680] 757: BM735809
[1681] 06E08 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens
[1682] glycine receptor, beta, mRNA sequence
[1683] gi|19057142|gb|BM735809.1|BM735809[19057142]
[1684] 758: BM735756
[1685] 06A09 Canine Brain cDNA Library Canis familiaris cDNA 5; similar to Homo sapiens
[1686] glycine receptor, beta subunit, mRNA sequence
[1687] gi|19057089|gb|BM735756.1|BM735756[19057089]
[1688] 759: BM735711
[1689] 10E11 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens
[1690] protein tyrosine phosphatase, receptor-type, Z polypeptide 1, mRNA sequence
[1691] gi|19057044|gb|BM735711.1|BM735711[19057044]
[1692] 762: AC007165
[1693] Homo sapiens BAC clone RP11-451C2 from 2, complete sequence
[1694] gi|19033999|gb|AC007165.4|[19033999]
[1695] 763: AF245699
[1696] Homo sapiens type 1 angiotensin II receptor (AGTR1) gene, complete cds
[1697] gi|7862074|gb|AF245699.1|[7862074]
[1698] 764: BC024229
[1699] Homo sapiens, prostaglandin E receptor 3 (subtype EP3), clone MGC:27302 IMAGE:4660371, mRNA, complete cds
[1700] gi|18999476|gb|BC024229.1|[18999476]
[1701] 783: AJ417555
[1702] Homo sapiens partial mRNA for killer cell immunoglobulin receptor (KIR2D54 gene), strain 4053
[1703] gi|18958228|emb|AJ417555.1|HSA417555[18958228]
[1704] 784: AJ417554
[1705] Homo sapiens partial mRNA for killer cell immunoglobulin receptor (KIR2D54 gene), strain 3321
[1706] gi|18958226|emb|AJ417554.1|HSA417554[18958226]
[1707] 786: NM—003877
[1708] Homo sapiens STAT induced STAT inhibitor-2 (STAT12), mRNA
[1709] gi|18921206|ref|NM—003877.2|[18921206]
[1710] 787: NM—017662
[1711] Homo sapiens transient receptor potential cation channel, subfamily M, member 6
[1712] (TRPM6), mRNA
[1713] gi|18921092|ref|NM—017662.3|[18921092]
[1714] 788: NM—133181
[1715] Homo sapiens epidermal growth factor receptor pathway substrate 8 related protein 3 (EPS8R3), mRNA
[1716] gi|18874727|ref|NM—133181.1|[18874727]
[1717] 802: M13823
[1718] Homo sapiens T cell receptor gamma chain (TCRG) gene, partial cds
[1719] gi|292736|gb|M13823.1|HUMTCGXK[292736]
[1720] 803: L12398
[1721] Homo sapiens dopamine receptor D4 (DRD4) mRNA, complete cds
[1722] gi|291945|gb|L12398.1|HUMD4C[291945]
[1723] 804: M86383
[1724] Homo sapiens nicotinic acetylcholine receptor alpha 3 subunit precursor, mRNA,
[1725] complete cds
[1726] gi|177897|gb|M86383.1|HUMA3NARSP[177897]
[1727] 805: NG—000019
[1728] Homo sapiens chorionic gonadotropin beta region (CGB@) on chromosome 19
[1729] gi|18860921|ref|NG—000019.2|[18860921]
[1730] 807: NM—012245
[1731] Homo sapiens SKI-interacting protein (SNW1), mRNA
[1732] gi|18860912|ref|NM—012245.2|[18860912]
[1733] 808: NM—006750
[1734] Homo sapiens syntrophin, beta 2 (dystrophin-associated protein A1, 59 kD, basic
[1735] component 2) (SNTB2), transcript variant 1, mRNA
[1736] gi|18860911|ref|NM—006750.2|[18860911]
[1737] 809: NM—130845
[1738] Homo sapiens syntrophin, beta 2 (dystrophin-associated protein A1, 59 kD, basic
[1739] component 2) (SNTB2), transcript variant 2, mRNA
[1740] gi|18860909|ref|NM—130845.1|[18860909]
[1741] 810: NM—002846
[1742] Homo sapiens protein tyrosine phosphatase, receptor type, N (PTPRN), mRNA
[1743] gi|18860905|ref|NM—002846.2|[18860905]
[1744] 811: NM—002845
[1745] Homo sapiens protein tyrosine phosphatase, receptor type, M (PTPRM), mRNA
[1746] gi|18860903|ref|NM—002845.2|[18860903]
[1747] 812: NM—002844
[1748] Homo sapiens protein tyrosine phosphatase, receptor type, K (PTPRK), mRNA
[1749] gi|18860901|ref|NM—002844.2|[18860901]
[1750] 813: NM—002843
[1751] Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA
[1752] gi|18860899|ref|NM—002843.2|[18860899]
[1753] 814: NM—002841
[1754] Homo sapiens protein tyrosine phosphatase, receptor type, G (PTPRG), mRNA
[1755] gi|18860897|ref|NM—002841.2|[18860897]
[1756] 815: NM—130440
[1757] Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript
[1758] variant 2, mRNA
[1759] gi|18860895|ref|NM—130440.1|[18860895]
[1760] 816: NM—130393
[1761] Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript
[1762] variant 4, mRNA
[1763] gi|18860893|ref|NM—130393.1|[18860893]
[1764] 817: NM—130392
[1765] Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript
[1766] variant 3, mRNA
[1767] gi|18860891|ref|NM—130392.1|[18860891]
[1768] 818: NM—130391
[1769] Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript
[1770] variant 2, mRNA
[1771] gi|18860889|ref|NM—130391.1|[18860889]
[1772] 819: NM—003682
[1773] Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 4, mRNA
[1774] gi|18860876|ref|NM—003682.2|[18860876]
[1775] 820: NM—130476
[1776] Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 8, mRNA
[1777] gi|18860874|ref|NM—130476.1|[18860874]
[1778] 821: NM—130475
[1779] Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 7, mRNA
[1780] gi|18860872|ref|NM—130475.1|[18860872]
[1781] 822: NM—002840
[1782] Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript
[1783] variant 1, mRNA
[1784] gi|18860871|ref|NM—002840.2|[18860871]
[1785] 823: NM—130474
[1786] Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 6, mRNA
[1787] gi|18860869|ref|NM—130474.2|[18860869]
[1788] 824: NM—130473
[1789] Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 5, mRNA
[1790] gi|18860867|ref|NM—130473.1|[18860867]
[1791] 825: NM—130472
[1792] Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 3, mRNA
[1793] gi|18860865|ref|NM—130472.1|[18860865]
[1794] 826: NM—130471
[1795] Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 2, mRNA
[1796] gi|18860863|ref|NM—130471.1|[18860863]
[1797] 827: NM—130470
[1798] Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 1, mRNA
[1799] gi|18860861|ref|NM—130470.1|[18860861]
[1800] 828: NM—006504
[1801] Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript
[1802] variant 1, mRNA
[1803] gi|18860860|ref|NM—006504.2|[18860860]
[1804] 829: NM—130435
[1805] Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript
[1806] variant 2, mRNA
[1807] gi|18860858|ref|NM—130435.1|[18860858]
[1808] 830: AJ431177
[1809] Homo sapiens mRNA for WIRE protein
[1810] gi|18857713|emb|AJ431177.1|HSA431177[18857713]
[1811] 831: NM—006474
[1812] Homo sapiens lung type-I cell membrane-associated glycoprotein (T1A-2), mRNA
[1813] gi|18767663|ref|NM—006474.2|[18767663]
[1814] 833: NM—006794
[1815] Homo sapiens G protein-coupled receptor 75 (GPR75), mRNA
[1816] gi|5803024|ref|NM—006794.1|[5803024]
[1817] 834: NM—002842
[1818] Homo sapiens protein tyrosine phosphatase, receptor type, H (PTPRH), mRNA
[1819] gi|4506312|ref|NM—002842.1|[4506312]
[1820] 835: NM—002839
[1821] Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript
[1822] variant 1, mRNA
[1823] gi|4506308|ref|NM—002839.1|[4506308]
[1824] 836: BC024145
[1825] Homo sapiens, TNF receptor-associated factor 1, clone MGC:10353 IMAGE:3832475, mRNA, complete cds
[1826] gi|18848176|gb|BC024145.1|[18848176]
[1827] 837: AF469756
[1828] Homo sapiens clone S9 interleukin-1 receptor type I (IL1R1) gene, partial sequence
[1829] gi|18846656|gb|AF469756.1|[18846656]
[1830] 838: AF469755
[1831] Homo sapiens clone S8 interleukin-1 receptor type I (IL1R1) gene, partial sequence
[1832] gi|18846655|gb|AF469755.1|[18846655]
[1833] 839: AF469754
[1834] Homo sapiens clone S7 interleukin-1 receptor type I (IL1R1) gene, partial sequence
[1835] gi|18845036|gb|AF469754.1|[18845036]
[1836] 841: BM565570
[1837] ih27b03.x1 Human insulinoma Homo sapiens cDNA clone IMAGE: 3′ similar to SW:FCEG_HUMAN P30273 HIGH AFFINITY IMMUNOGLOBULIN EPSILON RECEPTOR GAMMA-SUBUNIT
[1838] PRECURSOR; mRNA sequence
[1839] gi|18825852|gb|BM565570.1|BM565570[18825852]
[1840] 842: AF416711
[1841] Homo sapiens Fc-gamma receptor IIc5 mRNA, partial cds
[1842] gi|18765992|gb|AF416711.1|[18765992]
[1843] 843: NM—023068
[1844] Homo sapiens sialoadhesin (SN), mRNA
[1845] gi|18765743|ref|NM—023068.2|[18765743]
[1846] 844: NM—004782
[1847] Homo sapiens synaptosomal-associated protein, 29 kD (SNAP29), mRNA
[1848] gi|18765736|ref|NM—004782.2|[18765736]
[1849] 845: NM—130798
[1850] Homo sapiens synaptosomal-associated protein, 23 kD (SNAP23), transcript variant
[1851] 2, mRNA
[1852] gi|18765730|ref|NM—130798.1|[18765730]
[1853] 846: NM—003825
[1854] Homo sapiens synaptosomal-associated protein, 23 kD (SNAP23), transcript variant
[1855] 1, mRNA
[1856] gi|18765728|ref|NM—003825.2|[18765728]
[1857] 850: AF439409
[1858] Homo sapiens G-protein-coupled receptor kinase 7 (GRK7) mRNA, GRK7-S allele,
[1859] complete cds
[1860] gi|17933258|gb|AF439409.1|[17933258]
[1861] 851: NM—032211
[1862] Homo sapiens lysyl oxidase-like 4 (LOXL4), mRNA
[1863] gi|16933522|ref|NM—032211.4|[16933522]
[1864] 852: AF411122
[1865] Homo sapiens importin 4 mRNA, complete cds
[1866] gi|18700634|gb|AF411122.1|[18700634]
[1867] 894: NM—130441
[1868] Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin,
[1869] superfamily member 11 (CLECSF11), mRNA
[1870] gi|18466805|ref|NM—130441.1|[18466805]
[1871] 895: NM—030876
[1872] Homo sapiens olfactory receptor, family 5, subfamily V, member 1 (OR5V1), mRNA
[1873] gi|14495550|ref|NM—030876.2|[14495550]
[1874] 896: NM—032732
[1875] Homo sapiens hypothetical protein MGC10763 (IL17RL), mRNA
[1876] gi|14249349|ref|NM—032732.1|[14249349]
[1877] 897: NM—030959
[1878] Homo sapiens olfactory receptor, family 12, subfamily D, member 3 (OR12D3), mRNA
[1879] gi|13624334|ref|NM—030959.1|[13624334]
[1880] 898: NM—018842
[1881] Homo sapiens insulin receptor tyrosine kinase substrate (LOC55971), mRNA
[1882] gi|10047119|ref|NM—018842.1|[10047119]
[1883] 899: NM—018844
[1884] Homo sapiens B-cell receptor-associated protein BAP29 (BAP29), mRNA
[1885] gi|9994198|ref|NM—018844.1|[9994198]
[1886] 900: NM—002825
[1887] Homo sapiens pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1) (PTN), mRNA
[1888] gi|18656935|ref|NM—002825.2|[18656935]
[1889] 904: NM—016372
[1890] Homo sapiens seven transmembrane domain orphan receptor (TPRA40), mRNA
[1891] gi|7705964|ref|NM—016372.1|[7705964]
[1892] 905: NM—014288
[1893] Homo sapiens integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), mRNA
[1894] gi|7657205|ref|NM—014288.1|[7657205]
[1895] 906: L43588
[1896] Homo sapiens T cell antigen receptor mRNA, partial cds
[1897] gi|18654191|gb|L43588.1|HUMTCARF[18654191]
[1898] 907: AB050954
[1899] Homo sapiens irs-2 gene for insulin receptor substrate-2, partial cds
[1900] gi|18652856|dbj|AB050954.1|[18652856]
[1901] 923: U77589
[1902] Homo sapiens MHC class II HLA-DQ-alpha chain (HLA-DQA1) mRNA, HLA-DQA1*0104 allele, complete cds
[1903] gi|1916744|gb|U77589.1|HSU77589[1916744]
[1904] 924: AF410465
[1905] Homo sapiens importin 9 mRNA, complete cds
[1906] gi|15529702|gb|AF410465.1|[15529702]
[1907] 925: AF332759
[1908] Homo sapiens partially duplicated CHRNA7 gene, hybrid intron A/4 and partial exon 5
[1909] gi|13345792|gb|AF332759.1|[13345792]
[1910] 926: AF332758
[1911] Homo sapiens alpha-7 nicotinic cholinergic receptor subunit (CHRNA7) gene, partial intron 4 and partial cds
[1912] gi|13345790|gb|AF332750.1|[13345790]
[1913] 927: NM—003744
[1914] Homo sapiens numb homolog (Drosophila) (NUMB), mRNA
[1915] gi|18644887|ref|NM—003744.2|[18644887]
[1916] 928: NM—003681
[1917] Homo sapiens pyridoxal (pyridoxine, vitamin B6) kinase (PDXK), mRNA
[1918] gi|18644884|ref|NM—003681.2|[18644884]
[1919] 929: NM—080706
[1920] Homo sapiens transient receptor potential cation channel, subfamily V, member 1
[1921] (TRPV1), transcript variant 3, mRNA
[1922] gi|18375670|ref|NM—080706.1|[18375670]
[1923] 930: NM—080705
[1924] Homo sapiens transient receptor potential cation channel, subfamily V, member 1
[1925] (TRPV1), transcript variant 4, mRNA
[1926] gi|18375668|ref|NM—080705.1|[18375668]
[1927] 931: NM—080704
[1928] Homo sapiens transient receptor potential cation channel, subfamily V, member 1
[1929] (TRPV1), transcript variant 1, mRNA
[1930] gi|18375666|ref|NM—080704.1|[18375666]
[1931] 932: NM—018727
[1932] Homo sapiens transient receptor potential cation channel, subfamily V, member 1
[1933] (TRPV1), transcript variant 2, mRNA
[1934] gi|18375664|ref|NM—018727.3|[18375664]
[1935] 933: NM—080819
[1936] Homo sapiens G protein-coupled receptor 78 (GPR78), mRNA
[1937] gi|18201873|ref|NM—080819.1|[18201873]
[1938] 934: NM—080738
[1939] Homo sapiens EDAR-associated death domain (EDARADD), mRNA
[1940] gi|18152768|ref|NM—080738.1|[18152768]
[1941] 935: NM—080491 Homo sapiens GRB2-associated binding protein 2 (GAB2), transcript variant 1, mRNA gi|18105041|ref|NM—080491.1|[18105041]
[1942] 936: NM—012296 Homo sapiens GRB2-associated binding protein 2 (GAB2), transcript variant 2, mRNA gi|18105040|ref|NM—012296.2|[18105040]
[1943] 937: NM—032027 Homo sapiens beta-amyloid binding protein precursor (BBP), mRNA gi|17738309|ref|NM—032027.2|[17738309]
[1944] 938: NM—057159 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 (EDG2), transcript variant 2, mRNA
[1945] gi|16950637|ref|NM—057159.1|[16950637]
[1946] 939: NM—001401 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 (EDG2), transcript variant 1, mRNA
[1947] gi|16950635|ref|NM—001401.2|[16950635]
[1948] 940: NM—007070 Homo sapiens FKBP-associated protein (FAP48), transcript variant 2, mRNA gi|16933538|ref|NM—007070.2|[16933538]
[1949] 941: NM—053274 Homo sapiens FKBP-associated protein (FAP48), transcript variant 1, mRNA gi|16933536|ref|NM—053274.1|[16933536]
[1950] 942: NM—003726 Homo sapiens src family associated phosphoprotein 1 (SCAP1), mRNA gi|16753209|ref|NM—003726.2|[16753209]
[1951] 943: NM—033632 Homo sapiens F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila) (FBXW7), transcript variant 1, mRNA
[1952] gi|16117780|ref|NM—033632.1|[16117780]
[1953] 944: NM—018315 Homo sapiens F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila) (FBXW7), transcript variant 2, mRNA
[1954] gi|16117778|ref|NM—018315.2|[16117778]
[1955] 945: NM—021203 Homo sapiens APMCF1 protein (APMCF1), mRNA
[1956] gi|14917112|ref|NM—021203.2|[14917112]
[1957] 946: NM—002927 Homo sapiens regulator of G-protein signalling 13 (RGS13), mRNA gi|14589857|ref|NM—002927.2|[14589857]
[1958] 949: NM—020167 Homo sapiens neuromedin U receptor 2 (NMU2R), mRNA
[1959] gi|9910461|ref|NM—020167.1|[9910461]
[1960] 950: NM—020149 Homo sapiens Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse) (MEIS2), mRNA
[1961] gi|9910355|ref|NM—020149.1|[9910355]
[1962] 951: AF190052 Homo sapiens interleukin 1 receptor type I (IL1R1) gene, exon 1C sequence gi|9719300|gb|AF190052.1|[9719300]
[1963] 952: NM—018965 Homo sapiens triggering receptor expressed on myeloid cells 2 (TREM2), mRNA gi|9507202|ref|NM—018965.1|[9507202]
[1964] 953: NM—018643 Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), mRNA gi|8924261|ref|NM—018643.1|[8924261]
[1965] 954: NM—018647 Homo sapiens tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), mRNA gi|8924251|ref|NM—018647.1|[8924251]
[1966] 955: NM—018695 Homo sapiens erbb2 interacting protein (ERBB2IP), mRNA
[1967] gi|8923908|ref|NM—018695.1|[8923908]
[1968] 956: NM—017636 Homo sapiens transient receptor potential cation channel, subfamily M, member 4(TRPM4), mRNA gi|8923048|ref|NM—017636.1|[8923048]
[1969] 958: NM—016559 Homo sapiens PXR2b protein (PXR2b), mRNA
[1970] gi|7706670|ref|NM—016559.1|[7706670]
[1971] 959: NM—016382 Homo sapiens natural killer cell receptor 2B4 (CD244), mRNA
[1972] gi|7706528|ref|NM—016382.1|[7706528]
[1973] 962: NM—015986 Homo sapiens cytokine receptor-like factor 3 (CRLF3), mRNA
[1974] gi|7705331|ref|NM—015986.1|[7705331]
[1975] 963: NM—014815 Homo sapiens KIAA0130 gene product (KIAA0130), mRNA
[1976] gi|7661929|ref|NM—014815.1|[7661929]
[1977] 964: NM—014053 Homo sapiens FLVCR protein (FLVCR), mRNA
[1978] gi|7661707|ref|NM—014053.1|[7661707]
[1979] 965: NM—014478 Homo sapiens calcitonin gene-related peptide-receptor component protein (CGRP-RCP), mRNA gi|7656976|ref|NM—014478.1|[7656976]
[1980] 966: NM—012470
[1981] Homo sapiens transportin-SR (TRN-SR), mRNA
[1982] gi|6912733|ref|NM—012470.1|[6912733]
[1983] 967: NM—007357 Homo sapiens low density lipoprotein receptor defect C complementing (LDLC), mRNA gi|6678675|ref|NM—007357.1|[6678675]
[1984] 969: NM—007324 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 1, mRNA gi|6552338|ref|NM—007324.1|[6552338]
[1985] 970: NM—007323 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 2, mRNA gi|6552336|ref|NM—007323.1|[6552336]
[1986] 971: NM—005162 Homo sapiens angiotensin receptor-like 2 (AGTRL2), mRNA
[1987] gi|6031157|ref|NM—005162.21[6031157]
[1988] 972: NM—005501 Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), transcript variant b, mRNA
[1989] gi|6006010|ref|NM—005501.1|[6006010]
[1990] 975: NM—007053 Homo sapiens natural killer cell receptor, immunoglobulin superfamily member (BY55), mRNA gi|5901909|ref|NM—007053.1|[5901909]
[1991] 978: NM—006254 Homo sapiens protein kinase C, delta (PRKCD), mRNA
[1992] gi|5453969|ref|NM—006254.1|[5453969]
[1993] 979: NM—005761 Homo sapiens plexin C1 (PLXNC1), mRNA
[1994] gi|5032222|ref|NM—005761.1|[5032222]
[1995] 980: NM—005866 Homo sapiens sigma receptor (SR31747 binding protein 1) (SR-BP1), mRNA gi|5032116|ref|NM—005866.1|[5032116]
[1996] 982: NM—005506 Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II) (CD36L2), mRNA gi|5031630|ref|NM—005506.1|[5031630]
[1997] 984: NM—004799 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 3, mRNA gi|4759059|ref|NM—004799.1|[4759059]
[1998] 985: NM—004292 Homo sapiens ras inhibitor (RIN1), mRNA
[1999] gi|4759039|ref|NM—004292.1|[4759039]
[2000] 986: NM—004828 Homo sapiens lymphocyte antigen 95 (activating NK-receptor; NK-p44) (LY95), mRNA gi|4758693|ref|NM—004828.1|[4758693]
[2001] 987: NM—004767 Homo sapiens endothelin type b receptor-like protein 2 (ET(B)R-LP-2), mRNA gi|4758309|ref|NM—004767.1|[4758309]
[2002] 988: NM—004440 Homo sapiens EphA7 (EPHA7), mRNA
[2003] gi|4758281|ref|NM—004440.1|[4758281]
[2004] 989: NM—003999 Homo sapiens oncostatin M receptor (OSMR), mRNA
[2005] gi|4557039|ref|NM—003999.1|[4557039]
[2006] 990: NM—003904 Homo sapiens zinc finger protein 259 (ZNF259), mRNA
[2007] gi|4508020|ref|NM—003904.1|[4508020]
[2008] 991: NM—003305 Homo sapiens transient receptor potential cation channel, subfamily C, member 3(TRPC3), mRNA gi|4507686|ref|NM—003305.1|[4507686]
[2009] 992: NM—003804 Homo sapiens receptor (TNFRSF)-interacting serine-threonine kinase 1 (RIPK1), mRNA gi|4506538|ref|NM—003804.1|[4506538]
[2010] 993: NM—003626 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (PPFIA1), mRNA
[2011] gi|4505982|ref|NM—003626.1|[4505982]
[2012] 994: NM—003876 Homo sapiens putative receptor protein (PMI), mRNA
[2013] gi|4505900|ref|NM—003876.1|[4505900]
[2014] 995: NM—003559 Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type II, beta (PIP5K2B), mRNA gi|4505818|ref|NM—003559.1|[4505818]
[2015] 996: NM—003629 Homo sapiens phosphoinositide-3-kinase, regulatory subunit, polypeptide 3 (p55, gamma) (PIK3R3), mRNA gi|4505804|ref|NM—003629.1|[4505804]
[2016] 997: NM—003676 Homo sapiens degenerative spermatocyte homolog, lipid desaturase (Drosophila) (DEGS), mRNA gi|4505192|ref|NM—003676.1|[4505192]
[2017] 998: NM—002270 Homo sapiens karyopherin (importin) beta 2 (KPNB2), mRNA
[2018] gi|4504906|ref|NM—002270.1|[4504906]
[2019] 999: NM—002204 Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), transcript variant a, mRNA
[2020] gi|4504746|ref|NM—002204.1|[4504746]
[2021] 1000: NM—001560 Homo sapiens interleukin 13 receptor, alpha 1 (IL13RA1), mRNA
[2022] gi|4504646|ref|NM—001560.1|[4504646]
[2023] sapiens AND receptor NOT similar NOT non-receptor NOT nuclear NOT receptor-associated NOT “thyroid hormone” NOT “steroid receptor”
[2024] 779: NM—000842
[2025] Homo sapiens glutamate receptor, metabotropic 5 (GRM5), mRNA
[2026] gi|4504142|ref|NM—000842.1|[4504142]
[2027] 780: NM—001883
[2028] Homo sapiens corticotropin releasing hormone receptor 2 (CRHR2), mRNA
[2029] gi|4503044|ref|NM—001883.1|[4503044]
[2030] 781: NM—001873
[2031] Homo sapiens carboxypeptidase E (CPE), mRNA
[2032] gi|4503008|ref|NM—001873.1|[4503008]
[2033] 783: L29395
[2034] Homo sapiens v-erbB-related protein gene, partial cds
[2035] gi|459807|gb|L29395.1|HUMERBB[459807]
[2036] 784: L08584
[2037] Homo sapiens T cell receptor beta chain (TCRB) mRNA, partial cds
[2038] gi|307497|gb|L08584.1|HUMTCVB7A[307497]
[2039] 786: NM—015638
[2040] Homo sapiens chromosome 20 open reading frame 188 (C20orf188), mRNA
[2041] gi|18158415|ref|NM—015638.1|[18158415]
[2042] 787: NM—058167
[2043] Homo sapiens ubiquitin conjugating enzyme 6 (Ubc6p), mRNA
[2044] gi|17157996|ref|NM—058167.1|[17157996]
[2045] 788: NM—054032
[2046] Homo sapiens G protein-coupled receptor MRGX4 (MRGX4), mRNA
[2047] gi|16876454|ref|NM—054032.1|[16876454]
[2048] 789: NM—054031
[2049] Homo sapiens G protein-coupled receptor MRGX3 (MRGX3), mRNA
[2050] gi|16876452|ref|NM—054031.1|[16876452]
[2051] 790: NM—054030
[2052] Homo sapiens G protein-coupled receptor MRGX2 (MRGX2), mRNA
[2053] gi|16876450|ref|NM—054030.1|[16876450]
[2054] 791: NM—052931
[2055] Homo sapiens activating NK receptor (KALI), mRNA
[2056] gi|16418406|ref|NM—052931.1|[16418406]
[2057] 792: NM—032871
[2058] Homo sapiens tumor necrosis factor receptor superfamily, member 19-like (TNFRSF19L), mRNA
[2059] gi|14249611|ref|NM—032871.1|[14249611]
[2060] 793: NM—032553
[2061] Homo sapiens putative purinergic receptor (FKSG79), mRNA
[2062] gi|14211848|ref|NM—032553.1|[14211848]
[2063] 794: NM—025179
[2064] Homo sapiens plexin A2 (PLXNA2), mRNA
[2065] gi|13378152|ref|NM—025179.1|[13378152]
[2066] 795: NM—024419
[2067] Homo sapiens Phosphatidylglycerophosphate Synthase (PGS1), mRNA
[2068] gi|13259369|ref|NM—024419.1|[13259369]
[2069] 796: NM—021249
[2070] Homo sapiens sorting nexin 6 (SNX6), mRNA
[2071] gi|13027619|ref|NM—021249.1|[13027619]
[2072] 797: NM—014045
[2073] Homo sapiens DKFZP564C1940 protein (DKFZP564C1940), mRNA
[2074] gi|13027587|ref|NM—014045.1|[13027587]
[2075] 798: NM—080923
[2076] Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript
[2077] variant 4, mRNA
[2078] gi|18641365|ref|NM—080923.1|[18641365]
[2079] 799: NM—080922
[2080] Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript
[2081] variant 3, mRNA
[2082] gi|18641363|ref|NM—080922.1|[18641363]
[2083] 800: NM—080921
[2084] Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript
[2085] variant 2, mRNA
[2086] gi|18641361|ref|NM—080921.1|[18641361]
[2087] 801: NM—130386
[2088] Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant I, mRNA
[2089] gi|18641359|ref|NM—130386.1|[18641359]
[2090] 802: NM—030781
[2091] Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant II, mRNA
[2092] gi|18641357|ref|NM—030781.2|[18641357]
[2093] 803: NM—002838
[2094] Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript
[2095] variant 1, mRNA
[2096] gi|18641346|ref|NM—002838.2|[18641346]
[2097] 804: NM—130770
[2098] Homo sapiens 5-hydroxytryptamine receptor 3 subunit C (HTR3C), mRNA
[2099] gi|18640739|ref|NM—130770.1|[18640739]
[2100] 813: BD010218
[2101] Novel hemopoietin receptor protein, NR12
[2102] gi|18638591|dbj|BD010218.1|[18638591]
[2103] 814: BD010217
[2104] Novel hemopoietin receptor protein, NR12
[2105] gi|18638590|dbj|BD010217.1|[18638590]
[2106] 815: BD010216
[2107] Novel hemopoietin receptor protein, NR12
[2108] gi|18638589|dbj|BD010216.1|[18638589]
[2109] 816: BD010215
[2110] Novel hemopoietin receptor protein, NR12
[2111] gi|18638588|dbj|BD010215.1|[18638588]
[2112] 817: BD010214
[2113] Novel hemopoietin receptor protein, NR12
[2114] gi|18638587|dbj|BD010214.1|[18638587]
[2115] 818: BD010125
[2116] Peptide leukotrien receptor
[2117] gi|18638498|dbj|BD010125.1|[18638498]
[2118] 819: BD010114
[2119] Novel receptor and gene encoding the same
[2120] gi|18638487|dbj|BD010114.1|[18638487]
[2121] 820: BD010057
[2122] Novel G protein coupled receptor protein and its DNA
[2123] gi|18638430|dbj|BD010057.1|[18638430]
[2124] 821: BD010056
[2125] Novel G protein coupled receptor protein and its DNA
[2126] gi|18638429|dbj|BD010056.1|[18638429]
[2127] 822: BD010055
[2128] Novel G protein coupled receptor protein and its DNA
[2129] gi|18638428|dbj|BD010055.1|[18638428]
[2130] 823: BD010054
[2131] Novel G protein coupled receptor protein and its DNA
[2132] gi|18638427|dbj|BD010054.1|[18638427]
[2133] 824: BD010053
[2134] Novel G protein coupled receptor protein and its DNA
[2135] gi|18638426|dbj|BD010053.1|[18638426]
[2136] 825: BD010052
[2137] Novel G protein coupled receptor protein and its DNA
[2138] gi|18638425|dbj|BD010052.1|[18638425]
[2139] 826: BD010051
[2140] Novel G protein coupled receptor protein and its DNA
[2141] gi|18638424|dbj|BD010051.1|[18638424]
[2142] 827: BD010050
[2143] Novel G protein coupled receptor protein and its DNA
[2144] gi|18638423|dbj|BD010050.1|[18638423]
[2145] 828: BD010049
[2146] Novel G protein coupled receptor protein and its DNA
[2147] gi|18638422|dbj|BD010049.1|[18638422]
[2148] 829: BD010046
[2149] Novel G protein coupled receptor protein and its DNA
[2150] gi|18638419|dbj|BD010046.1|[18638419]
[2151] 830: BD010035
[2152] Novel G protein coupled receptor protein and its DNA
[2153] gi|18638408|dbj|BD010035.1|[18638408]
[2154] 831: BD010034
[2155] Novel G protein coupled receptor protein and its DNA
[2156] gi|18638407|dbj|BD010034.1|[18638407]
[2157] 832: BD010028
[2158] Novel G protein coupled receptor protein and its DNA
[2159] gi|18638401|dbj|BD010028.1|[18638401]
[2160] 833: BD010022
[2161] Novel G protein coupled receptor protein and its DNA
[2162] gi|18638395|dbj|BD010022.1|[18638395]
[2163] 834: BD009263
[2164] GABAA receptor subunit epsilon-related protein
[2165] gi|18637636|dbj|BD009263.1|[18637636]
[2166] 835: BD009262
[2167] GABAA receptor subunit epsilon-related protein
[2168] gi|18637635|dbj|BD009262.1|[18637635]
[2169] 836: BD009261
[2170] GABAA receptor subunit epsilon-related protein
[2171] gi|18637634|dbj|BD009261.1|[18637634]
[2172] 837: BD009260
[2173] GABAA receptor subunit epsilon-related protein
[2174] gi|18637633|dbj|BD009260.1|[18637633]
[2175] 838: BD006753
[2176] Human G protein chemokine receptor HDGNR10
[2177] gi|18635124|dbj|BD006753.1|[18635124]
[2178] 843: E51301
[2179] Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein
[2180] gi|18633577|dbj|E51301.1|[18633577]
[2181] 844: E51300
[2182] Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein
[2183] gi|18633576|dbj|E51300.1|[18633576]
[2184] 845: E51299
[2185] Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein
[2186] gi|18633575|dbj|E51299.1|[18633575]
[2187] 846: E51298
[2188] Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein
[2189] gi|18633574|dbj|E51298.1|[18633574]
[2190] 847: E51297
[2191] Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein
[2192] gi|18633573|dbj|E51297.1|[18633573]
[2193] 848: E51296
[2194] Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein
[2195] gi|18633572|dbj|E51296.1|[18633572]
[2196] 849: E50838
[2197] Novel G protein-coupled receptor
[2198] gi|18633543|dbj|E50838.1|[18633543]
[2199] 850: E50837
[2200] Novel G protein-coupled receptor
[2201] gi|18633542|dbj|E50837.1|[18633542]
[2202] 851: E50836
[2203] Novel G protein-coupled receptor
[2204] gi|18633541|dbj|E50836.1|[18633541]
[2205] 852: E50835
[2206] Novel G protein-coupled receptor
[2207] gi|18633540|dbj|E50835.1|[18633540]
[2208] 853: E50834
[2209] Novel G protein-coupled receptor
[2210] gi|18633539|dbj|E50834.1|[18633539]
[2211] 854: E50833
[2212] Novel G protein-coupled receptor
[2213] gi|18633538|dbj|E50833.1|[18633538]
[2214] 873: BD003056
[2215] Novel G protein-coupled receptor protein and DNA thereof
[2216] gi|18631017|dbj|BD003056.1|[18631017]
[2217] 874: E55122
[2218] Novel G protein-coupled receptor and the G protein-coupled receptor gene
[2219] gi|18629753|dbj|E55122.1|[18629753]
[2220] 875: E55121
[2221] Novel G protein-coupled receptor and the G protein-coupled receptor gene
[2222] gi|18629752|dbj|E55121.1|[18629752]
[2223] 876: E55120
[2224] Novel G protein-coupled receptor and the G protein-coupled receptor gene
[2225] gi|18629751|dbj|E55120.1|[18629751]
[2226] 877: E55119
[2227] Novel G protein-coupled receptor and the G protein-coupled receptor gene
[2228] gi|18629750|dbj|E55119.1|[18629750]
[2229] 878: E55118
[2230] Novel G protein-coupled receptor and the G protein-coupled receptor gene
[2231] gi|18629749|dbj|E55118.1|[18629749]
[2232] 879: E55117
[2233] Novel G protein-coupled receptor and the G protein-coupled receptor gene
[2234] gi|18629748|dbj|E55117.1|[18629748]
[2235] 880: E49128
[2236] Novel G protein-conjugated receptor protein
[2237] gi|18629265|dbj|E49128.1|[18629265]
[2238] 881: E49127
[2239] Novel G protein-conjugated receptor protein
[2240] gi|18629264|dbj|E49127.1|[18629264]
[2241] 882: E49126
[2242] Novel G protein-conjugated receptor protein
[2243] gi|18629263|dbj|E49126.1|[18629263]
[2244] 883: E49125
[2245] Novel G protein-conjugated receptor protein
[2246] gi|18629262|dbj|E49125.1|[18629262]
[2247] 884: E49124
[2248] Novel G protein-conjugated receptor protein
[2249] gi|18629261|dbj|E49124.1|[18629261]
[2250] 885: E49123
[2251] Novel G protein-conjugated receptor protein
[2252] gi|18629260|dbj|E49123.1|[18629260]
[2253] 887: E58499
[2254] Novel G protein-coupled receptor protein, DNA and utilization thereof
[2255] gi|18628416|dbj|E58499.1|[18628416]
[2256] 888: E58495
[2257] Novel G protein-coupled receptor protein, DNA and utilization thereof
[2258] gi|18628412|dbj|E58495.1|[18628412]
[2259] 889: E58494
[2260] Novel G protein-coupled receptor protein, DNA and utilization thereof
[2261] gi|18628411|dbj|E58494.1|[18628411]
[2262] 890: E58488
[2263] Novel G protein-coupled receptor protein, DNA and utilization thereof
[2264] gi|18628405|dbj|E58488.1|[18628405]
[2265] 891: E58485
[2266] Novel G protein-coupled receptor protein, DNA and utilization thereof
[2267] gi|18628402|dbj|E58485.1|[18628402]
[2268] 892: E58484
[2269] Novel G protein-coupled receptor protein, DNA and utilization thereof
[2270] gi|18628401|dbj|E58484.1|[18628401]
[2271] 893: E58479
[2272] Novel G protein-coupled receptor protein, DNA and utilization thereof
[2273] gi|18628396|dbj|E58479.1|[18628396]
[2274] 902: E43451
[2275] Novel protein G-coupled receptor protein and DNA thereof
[2276] gi|18627717|dbj|E43451.1|[18627717]
[2277] 903: E43450
[2278] Novel protein G-coupled receptor protein and DNA thereof
[2279] gi|18627716|dbj|E43450.1|[18627716]
[2280] 904: E41270
[2281] Novel G protein-conjugate receptor protein and its DNA
[2282] gi|18627502|dbj|E41270.1|[18627502]
[2283] 905: E41269
[2284] Novel G protein-conjugate receptor protein and its DNA
[2285] gi|18627501|dbj|E41269.1|[18627501]
[2286] 906: E41268
[2287] Novel G protein-conjugate receptor protein and its DNA
[2288] gi|18627500|dbj|E41268.1|[18627500]
[2289] 907: E40003
[2290] Novel G protein-conjugate receptor protein and its DNA
[2291] gi|18627119|dbj|E40003.1|[18627119]
[2292] 908: E40000
[2293] Novel G protein-conjugate receptor protein and its DNA
[2294] gi|18627116|dbj|E40000.1|[18627116]
[2295] 909: E39999
[2296] Novel G protein-conjugate receptor protein and its DNA
[2297] gi|18627115|dbj|E39999.1|[18627115]
[2298] 910: E39824
[2299] Novel guanosine triphospate (GTP)-binding protein-conjugate receptor protein
[2300] gi|18627105|dbj|E39824.1|[18627105]
[2301] 911: E39817
[2302] Novel guanosine triphospate (GTP)-binding protein-conjugate receptor protein
[2303] gi|18627098|dbj|E39817.1|[18627098]
[2304] 912: E39816
[2305] Novel guanosine triphospate (GTP)-binding protein-conjugate receptor protein
[2306] gi|18627097|dbj|E39816.1|[18627097]
[2307] 913: E39815
[2308] Novel guanosine triphospate (GTP)-binding protein-conjugate receptor protein
[2309] gi|18627096|dbj|E39815.1|[18627096]
[2310] 929: E34464
[2311] Novel Toll-like receptor and gene thereof
[2312] gi|18624350|dbj|E34464.1|[18624350]
[2313] 930: E33807
[2314] Human splice mutant CXCR4B of CXCR4 chemokine receptor
[2315] gi|18624164|dbj|E33807.1|[18624164]
[2316] 931: E33806
[2317] Human splice mutant CXCR4B of CXCR4 chemokine receptor
[2318] gi|18624163|dbj|E33806.1)[18624163]
[2319] 941: E63757
[2320] Human nurse cell receptor gene
[2321] gi|18622844|dbj|E63757.1|[18622844]
[2322] 942: E63756
[2323] Human nurse cell receptor gene
[2324] gi|18622843|dbj|E63756.1|[18622843]
[2325] 943: E63754
[2326] Human nurse cell receptor gene
[2327] gi|18622841|dbj|E63754.1|[18622841]
[2328] 944: E49275
[2329] Novel G protein-conjugated receptor protein and DNA thereof
[2330] gi|18622037|dbj|E49275.1|[18622037]
[2331] 945: E44151
[2332] Novel G protein-coupled receptor protein and DNA thereof
[2333] gi|18622012|dbj|E44151.1|[18622012]
[2334] 946: E44032
[2335] Novel G protein-coupled receptor protein and DNA and ligand of the same
[2336] gi|18621998|dbj|E44032.1|[18621998]
[2337] 947: AX350990
[2338] Sequence 24 from Patent WO0190358
[2339] gi|18616366|emb|AX350990.1|[18616366]
[2340] 948: AX350988
[2341] Sequence 22 from Patent WO0190358
[2342] gi|18616364|emb|AX350988.1|[18616364]
[2343] 949: AX350984
[2344] Sequence 18 from Patent WO0190358
[2345] gi|18616360|emb|AX350984.1|[18616360]
[2346] 950: AX350982
[2347] Sequence 16 from Patent WO0190358
[2348] gi|18616358|emb|AX350982.1|[18616358]
[2349] 951: AX350981
[2350] Sequence 15 from Patent WO0190358
[2351] gi|18616357|emb|AX350981.1|[18616357]
[2352] 952: AX350979
[2353] Sequence 13 from Patent WO0190358
[2354] gi|18616355|emb|AX350979.1|[18616355]
[2355] 953: AX350975
[2356] Sequence 9 from Patent WO0190358-
[2357] gi|18616351|emb|AX350975.1|[18616351]
[2358] 954: AX350973
[2359] Sequence 7 from Patent WO0190358
[2360] gi|18616349|emb|AX350973.1|[18616349]
[2361] 955: AX350969
[2362] Sequence 3 from Patent WO0190358
[2363] gi|18616345|emb|AX350969.1|[18616345]
[2364] 956: AX350967
[2365] Sequence 1 from Patent WO0190358
[2366] gi|18616343|emb|AX350967.1|[18616343]
[2367] 957: NM—005608
[2368] Homo sapiens protein tyrosine phosphatase, receptor type, C-associated protein
[2369] (PTPRCAP), mRNA
[2370] gi|5032004|ref|NM—005608.1|[5032004]
[2371] 958: XM—012097
[2372] Homo sapiens olfactory receptor, family 6, subfamily A, member 1 (OR6A1), mRNA
[2373] gi|18605332|ref|XM—012097.3|[18605332]
[2374] 959: XM—090173
[2375] Homo sapiens olfactory receptor, family 5, subfamily L, member 2 (OR5L2), mRNA
[2376] gi|1860518|ref|XM—090173.1|[18605181]
[2377] 960: XM—055369
[2378] Homo sapiens pro-oncosis receptor inducing membrane injury gene (PORIMIN), mRNA
[2379] gi|18604484|ref|XM—055369.2|[18604484]
[2380] 961: XM—041961
[2381] Homo sapiens PYK2 N-terminal domain-interacting receptor 1 (NIR1), mRNA
[2382] gi|18604126|ref|XM—041961.2|[18604126]
[2383] 962: XM—040037
[2384] Homo sapiens adrenergic, beta, receptor kinase 1 (ADRBK1), mRNA
[2385] gi|18604053|ref|XM—040037.3|[18604053]
[2386] 963: XM—045532
[2387] Homo sapiens olfactory receptor, family 51, subfamily E, member 2 (OR51E2), mRNA
[2388] gi|18603788|ref|XM—045532.2|[18603788]
[2389] 964: XM—091465
[2390] Homo sapiens olfactory receptor, family 4, subfamily D, member 1 (OR4D1), mRNA
[2391] gi|18603196|ref|XM—091465.1|[18603196]
[2392] 965: XM—036784
[2393] Homo sapiens phosphatidylserine receptor (KIAA0585), mRNA
[2394] gi|18603024|ref|XM—036784.3|[18603024]
[2395] 966: XM—036728
[2396] Homo sapiens ryanodine receptor 3 (RYR3), mRNA
[2397] gi|18602746|ref|XM—036728.3|[18602746]
[2398] 967: XM—084025
[2399] Homo sapiens complement component 5 receptor 1 (C5a ligand) (C5R1), mRNA
[2400] gi|18601827|ref|XM—084025.1|[18601827]
[2401] 968: XM—009107
[2402] Homo sapiens KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 (KDELR1), mRNA
[2403] gi|18601740|ref|XM—009107.6|[18601740]
[2404] 969: XM—027883
[2405] Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF),
[2406] interacting protein (liprin), alpha 3 (PPFIA3), mRNA
[2407] gi|18601690|ref|XM—027883.2|[18601690]
[2408] 970: XM—027904
[2409] Homo sapiens Fc fragment of IgG, receptor, transporter, alpha (FCGRT), mRNA
[2410] gi|18601656|ref|XM—027904.4|[18601656]
[2411] 971: XM—049229
[2412] Homo sapiens dopamine receptor interacting protein (DRIP78), mRNA
[2413] gi|18601498|ref|XM—049229.3|[18601498]
[2414] 972: XM—040709
[2415] Homo sapiens prostaglandin F2 receptor negative regulator (PTGFRN), mRNA
[2416] gi|186011300ref|XM—040709.2|[18601130]
[2417] 973: XM—003091
[2418] Homo sapiens G protein-coupled receptor 105 (GPR105), mRNA
[2419] gi|18600688|ref|XM—003091.5|[18600688]
[2420] 975: XM—010533
[2421] Homo sapiens interleukin 12 receptor, beta 2 (IL12RB2), mRNA
[2422] gi|18600602|ref |XM—010533.4|[18600602]
[2423] 976: NT—006318
[2424] Homo sapiens chromosome 4 working draft sequence segment
[2425] gi|18600353|ref|NT—006318.7|Hs4—6475[18600353]
[2426] 977: XM—039145
[2427] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 3 (CHRNA3), mRNA
[2428] gi|18597785|ref|XM—039145.3|[18597785]
[2429] 978: XM—039151
[2430] Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 4 (CHRNB4), mRNA
[2431] gi|18597777|ref|XM—039151.2|[18597777]
[2432] 979: XM—007392
[2433] Homo sapiens G protein-coupled receptor 65 (GPR65), mRNA
[2434] gi|8597722|ref|XM—007392.4|[18597722]
[2435] 980: XM—007315
[2436] Homo sapiens receptor-interacting serine-threonine kinase 3 (RIPK3), mRNA
[2437] gi|18597625|ref|XM—007315.2|[18597625]
[2438] 981: NT—024675
[2439] Homo sapiens chromosome 15 working draft sequence segment
[2440] gi|18597616|ref|NT—024675.7|Hs15—24831[18597616]
[2441] 982: XM—051711
[2442] Homo sapiens prostaglandin D2 receptor (DP) (PTGDR), mRNA
[2443] gi|18597012|ref|XM—051711.2|[18597012]
[2444] 983: XM—007337
[2445] Homo sapiens kinectin 1 (kinesin receptor) (KTN1), mRNA
[2446] gi|18596970|ref|XM—007337.7|[18596970]
[2447] 984: XM—096782
[2448] Homo sapiens putative leukocyte platelet-activating factor receptor (HUMNPIIY20), mRNA
[2449] gi|18596920|ref|XM—096782.1|[18596920]
[2450] 985: XM—055898
[2451] Homo sapiens nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), mRNA
[2452] gi|18596422|ref|XM—055898.3|[18596422]
[2453] 986: XM—018505
[2454] Homo sapiens G protein-coupled receptor 23 (GPR23), mRNA
[2455] gi|18594906|ref|XM—018505.3|[18594906]
[2456] 987: XM—096288
[2457] Homo sapiens G protein-coupled receptor 64 (GPR64), mRNA
[2458] gi|18594854|ref|XM—096288.1|[18594854]
[2459] 988: XM—096154
[2460] Homo sapiens angiotensin receptor-like 2 (AGTRL2), mRNA
[2461] gi|18593950|ref|XM—096154.1|[18593950]
[2462] 989: XM—015620
[2463] Homo sapiens nogo receptor (NOGOR), mRNA
[2464] gi|18593698|ref|XM—015620.5|[18593698]
[2465] 990: XM—048563
[2466] Homo sapiens interferon gamma receptor 2 (interferon gamma transducer 1) (IFNGR2), mRNA
[2467] gi|18593096|ref|XM—048563.2|[18593096]
[2468] 991: XM—086754
[2469] Homo sapiens coxsackie virus and adenovirus receptor (CXADR), mRNA
[2470] gi|18592977|ref|XM—086754.1|[18592977]
[2471] 992: XM—056242
[2472] Homo sapiens protein C receptor, endothelial (EPCR) (PROCR), mRNA
[2473] gi|18592822|ref|XM—056242.3|[18592822]
[2474] 993: XM—097415
[2475] Homo sapiens leukocyte receptor cluster (LRC) member 8 (LENG8), mRNA
[2476] gi|18591238|ref|XM—097415.1|[18591238]
[2477] 994: XM—044314
[2478] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 4 (ILT7), mRNA
[2479] gi|18591234|ref|XM—044314.4|[18591234]
[2480] 995: XM—092068
[2481] Homo sapiens olfactory receptor, family 7, subfamily C, member 1 (OR7C1), mRNA
[2482] gi|18591224|ref|XM—092068.1|[18591224]
[2483] 996: XM—084042
[2484] Homo sapiens egf-like module containing, mucin-like, hormone receptor-like sequence 2 (EMR2), mRNA
[2485] gi|18591222|ref|XM—084042.1|[18591222]
[2486] 997: XM—012893
[2487] Homo sapiens endothelial differentiation, lysophosphatidic acid
[2488] G-protein-coupled receptor, 4 (EDG4), mRNA
[2489] gi|18591032|ref|XM—012893.5|[18591032]
[2490] 998: XM—103288
[2491] Homo sapiens polycythemia rubra vera 1; cell surface receptor (PRV1), mRNA
[2492] gi|18590882|ref|XM—103288.1|[18590882]
[2493] 999: XM—046103
[2494] Homo sapiens protein tyrosine phosphatase, receptor type, S (PTPRS), mRNA
[2495] gi|18590850|ref|XM—046103.3|[18590850]
[2496] 1000: XM—047633
[2497] Homo sapiens thromboxane A2 receptor (TBXA2R), mRNA
[2498] gi|18590817|ref|XM—047633.2|[18590817]
[2499] 1001: XM—030637
[2500] Homo sapiens G protein-coupled receptor kinase 7 (GPRK7), mRNA
[2501] gi|18590749|ref|XM—030637.3|[18590749]
[2502] 1002: XM—086017
[2503] Homo sapiens plasminogen activator, urokinase receptor (PLAUR), mRNA
[2504] gi|18590707|ref|XM—086017.1|[18590707]
[2505] 1003: XM—029455
[2506] Homo sapiens ryanodine receptor 1 (skeletal) (RYR1), mRNA
[2507] gi|18590460|ref|XM—029455.2|[18590460]
[2508] 1004: XM—085976
[2509] Homo sapiens leukocyte receptor cluster (LRC) member 3 (LENG3), mRNA
[2510] gi|18590428|ref|XM—085976.1|[18590428]
[2511] 1005: XM—084028
[2512] Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 (KIR3DL1), mRNA
[2513] gi|18590419|ref|XM—084028.1|[18590419]
[2514] 1006: XM—097304
[2515] Homo sapiens leukocyte receptor cluster (LRC) member 1 (LENG1), mRNA
[2516] gi|18590235|ref|XM—097304.1|[18590235]
[2517] 1007: XM—050582
[2518] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM, domains), member 3 (LILRB3), mRNA
[2519] gi|18590233|ref|XM—050582.3|[18590233]
[2520] 1008: XM—041258
[2521] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), mRNA
[2522] gi|18590231|ref|XM—041258.3|[18590231]
[2523] 1009: XM—050236
[2524] Homo sapiens leukocyte receptor cluster (LRC) member 4 (LENG4), mRNA
[2525] gi|18590224|ref|XM—050236.3|[18590224]
[2526] 1010: XM—048346
[2527] Homo sapiens insulin receptor (INSR), mRNA
[2528] gi|18590185|ref|XM—048346.3|[18590185]
[2529] 1011: XM—044591
[2530] Homo sapiens G protein-coupled receptor 108 (GPR108), mRNA
[2531] gi|18590160|ref|XM—044591.3|[18590160]
[2532] 1012: XM—085864
[2533] Homo sapiens endothelial differentiation, sphingolipid G-protein-coupled receptor, 8 (EDG8), mRNA
[2534] gi|18589990|ref|XM—085864.1|[18589990]
[2535] 1013: XM—044320
[2536] Homo sapiens poliovirus receptor-related 2 (herpesvirus entry mediator B) (PVRL2), mRNA
[2537] gi|18589873|ref|XM—044320.4|[18589873]
[2538] 1014: XM—012671
[2539] Homo sapiens olfactory receptor, family 1, subfamily E, member 2 (OR1E2), mRNA
[2540] gi|18588331|ref|XM—012671.5|[18588331]
[2541] 1015: XM—085745
[2542] Homo sapiens somatostatin receptor 2 (SSTR2), mRNA
[2543] gi|18588314|ref|XM—085745.1|[18588314]
[2544] 1016: XM—008646
[2545] Homo sapiens cytokine receptor-like factor 3 (CRLF3), mRNA
[2546] gi|18588105|ref|XM—008646.5|[18588105]
[2547] 1017: XM—008509
[2548] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 5 (P2RX5), mRNA
[2549] gi|18587692|ref|XM—008509.6|[18587692]
[2550] 1018: XM—030851
[2551] Homo sapiens G protein-coupled receptor kinase-interactor 1 (GIT1), mRNA
[2552] gi|18587652|ref|XM—030851.2|[18587652]
[2553] 1019: XM—048233
[2554] Homo sapiens autocrine motility factor receptor (AMFR), mRNA
[2555] gi|18585872|ref|XM—048233.3|[18585872]
[2556] 1020: NT—010280
[2557] Homo sapiens chromosome 15 working draft sequence segment
[2558] gi|18584150|ref|NT—010280.8|Hs15—10437[18584150]
[2559] 1021: XM—039208
[2560] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), mRNA
[2561] gi|18584141|ref|XM—039208.5|[18584141]
[2562] 1022: XM—030709
[2563] Homo sapiens transient receptor potential cation channel, subfamily M, member 7
[2564] (TRPM7), mRNA
[2565] gi|18583756|ref|XM—030709.3|[18583756]
[2566] 1023: XM—085103
[2567] Homo sapiens G protein-coupled receptor (G2A), mRNA
[2568] gi|18583332|ref|XM—085103.1|[18583332]
[2569] 1024: XM—040854
[2570] Homo sapiens bradykinin receptor B2 (BDKRB2), mRNA
[2571] gi|18582977|ref|XM—040854.2|[18582977]
[2572] 1025: XM—007275
[2573] Homo sapiens bradykinin receptor B1 (BDKRB1), mRNA
[2574] gi|18582976|ref|XM—007275.4|[18582976]
[2575] 1027: XM—083897
[2576] Homo sapiens Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor) (EBI2), mRNA
[2577] gi|18581588|ref|XM—083897.1|[18581588]
[2578] 1029: XM—062656
[2579] Homo sapiens C-type lectin-like receptor (CLEC-6), mRNA
[2580] gi|18580484|ref|XM—062656.2|[18580484]
[2581] 1031: XM—084785
[2582] Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF),
[2583] interacting protein (liprin), alpha 2 (PPFIA2), mRNA
[2584] gi|18579245|ref|XM—084785.1|[18579245]
[2585] 1032: XM—043322
[2586] Homo sapiens peroxisome receptor 1 (PXR1), mRNA
[2587] gi|18579222|ref|XM—043322.3|[18579222]
[2588] 1033: XM—090117
[2589] Homo sapiens olfactory receptor, family 8, subfamily G, member 2 (OR8G2), mRNA
[2590] gi|18578560|ref|XM—090117.1|[18578560]
[2591] 1034: XM—090109
[2592] Homo sapiens olfactory receptor, family 8, subfamily G, member 1 (OR8G1), mRNA
[2593] gi|18578546|ref|XM—090109.1[18578546]
[2594] 1035: XM—035095
[2595] Homo sapiens cortical thymocyte receptor (X. laevis CTX) like (CTXL), mRNA
[2596] gi|18578508|ref|XM—035095.4|[18578508]
[2597] 1036: XM—084690
[2598] Homo sapiens olfactory receptor, family 8, subfamily B, member 8 (OR8B8), mRNA
[2599] gi|18578501|ref|XM—084690.1|[18578501]
[2600] 1037: XM—012064
[2601] Homo sapiens glutamate receptor, ionotropic, kainate 4 (GRIK4), mRNA
[2602] gi|18578454|ref|XM—012064.6|[18578454]
[2603] 1039: XM—031348
[2604] Homo sapiens glutamate receptor, metabotropic 5 (GRM5), mRNA
[2605] gi|18577875|ref|XM—031348.2|[18577875]
[2606] 1040: XM—089965
[2607] Homo sapiens olfactory receptor, family 10, subfamily A, member 3 (OR10A3), mRNA
[2608] gi|18577828|ref|XM—089965.1|[18577828]
[2609] 1041: NT—030791
[2610] Homo sapiens chromosome 11 working draft sequence segment
[2611] gi|18577645|ref|NT—030791.2|Hs11—31047[18577645]
[2612] 1042: XM—006549
[2613] Homo sapiens G protein-coupled receptor 48 (GPR48), mRNA
[2614] gi|18577644|ref|XM—006549.5|[18577644]
[2615] 1043: XM—054215
[2616] Homo sapiens purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), mRNA
[2617] gi|18577261|ref|XM—054215.4|[18577261]
[2618] 1044: XM—038024
[2619] Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA
[2620] gi|18577179|ref|XM—038024.4|[18577179]
[2621] 1045: XM—049296
[2622] Homo sapiens GDNF family receptor alpha 1 (GFRA1), mRNA
[2623] gi|18576832|ref|XM—049296.4|[18576832]
[2624] 1046: XM—005781
[2625] Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), mRNA
[2626] gi|18576581|ref|XM—005781.5|[18576581]
[2627] 1047: XM—011904
[2628] Homo sapiens cubilin (intrinsic factor-cobalamin receptor) (CUBN), mRNA
[2629] gi|18576082|ref|XM—011904.6|[18576082]
[2630] 1048: XM—005969
[2631] Homo sapiens G protein-coupled receptor kinase 5 (GPRK5), mRNA
[2632] gi|18575440|ref|XM—005969.6|[18575440]
[2633] 1049: XM—089569
[2634] Homo sapiens VPS10 domain receptor protein SORCS1 (SORCS1), mRNA
[2635] gi|18574995|ref|XM—089569.1|[18574995]
[2636] 1050: XM—005830
[2637] Homo sapiens mannose receptor, C type 1 (MRC1), mRNA
[2638] gi|18574297|ref|XM—005830.7|[18574297]
[2639] 1051: XM—005747
[2640] Homo sapiens tachykinin receptor 2 (TACR2), mRNA
[2641] gi|18574167|ref |XM—005747.5|[18574167]
[2642] 1052: XM—043613
[2643] Homo sapiens glutamate receptor, ionotropic, delta 1 (GRID1), mRNA
[2644] gi|18574031|ref|XM—043613.4|[18574031]
[2645] 1053: XM—028830
[2646] Homo sapiens transient receptor potential cation channel, subfamily M, member 6
[2647] (TRPM6), mRNA
[2648] gi|18573768|ref|XM—028830.3|[18573768]
[2649] 1054: XM—095961
[2650] Homo sapiens olfactory receptor, family 2, subfamily K, member 2 (OR2K2), mRNA
[2651] gi|18573486|ref|XM—095961.1|[18573486]
[2652] 1055: XM—096286
[2653] Homo sapiens receptor tyrosine kinase-like orphan receptor 2 (ROR2), mRNA
[2654] gi|18573067|ref|XM—096286.1|[18573067]
[2655] 1056: XM—095815
[2656] Homo sapiens olfactory receptor, family 1, subfamily J, member 5 (OR1J5), mRNA
[2657] gi|18572435|ref|XM—095815.1|[18572435]
[2658] 1057: XM—095814
[2659] Homo sapiens olfactory receptor, family 1, subfamily J, member 4 (OR1J4), mRNA
[2660] gi|18572433|ref|XM—095814.1|[18572433]
[2661] 1059: XM—011695
[2662] Homo sapiens leptin receptor overlapping transcript-like 1 (LEPROTL1), mRNA
[2663] gi|18570296|ref|XM—011695.3|[18570296]
[2664] 1061: XM—088035
[2665] Homo sapiens transient receptor potential cation channel, subfamily V, member 6
[2666] (TRPV6), mRNA
[2667] gi|18565882|ref|XM—088035.1|[18565882]
[2668] 1062: XM—004696
[2669] Homo sapiens EphB6 (EPHB6), mRNA
[2670] gi|18565881|ref|XM—004696.5|[18565881]
[2671] 1063: XM—096245
[2672] Homo sapiens olfactory receptor, family 2, subfamily H, member 3 (OR2H3), mRNA
[2673] gi|18564780|ref|XM—096245.1|[18564780]
[2674] 1064: XM—084200
[2675] Homo sapiens olfactory receptor, family 11, subfamily A, member 1 (OR11A1), mRNA
[2676] gi|18563692|ref|XM—084200.1|[18563692]
[2677] 1065: XM—084190
[2678] Homo sapiens olfactory receptor, family 2, subfamily A, member 4 (OR2A4), mRNA
[2679] gi|18563106|ref|XM—084190.1|[18563106]
[2680] 1066: XM—004341
[2681] Homo sapiens opioid receptor, mu 1 (OPRM1), mRNA
[2682] gi|18562969|ref|XM—004341.6|[18562969]
[2683] 1067: XM—084185
[2684] Homo sapiens dopamine receptor D1 (DRD1), mRNA
[2685] gi|18561988|ref|XM—084185.1|[18561988]
[2686] 1069: XM—049570
[2687] Homo sapiens dioxin receptor repressor (AHRR), mRNA
[2688] gi|18560847|ref|XM—049570.4|[18560847]
[2689] 1070: XM—084176
[2690] Homo sapiens coagulation factor II (thrombin) receptor-like 1 (F2RL1), mRNA
[2691] gi|18560787|ref|XM—084176.1|[18560787]
[2692] 1071: NT—029289
[2693] Homo sapiens chromosome 5 working draft sequence segment
[2694] gi|18560495|ref|NT—029289.4|Hs5—29448[18560495]
[2695] 1072: XR—000069
[2696] Homo sapiens neuropeptide Y receptor Y6 (psuedogene) (NPY6R), misc RNA
[2697] gi|18560235|ref|XR—000069.1|[18560235]
[2698] 1073: NT—025716
[2699] Homo sapiens chromosome 5 working draft sequence segment
[2700] gi|18560224|ref|NT—025716.6|Hs5—25872[18560224]
[2701] 1074: XM—094306
[2702] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), mRNA
[2703] gi|18560222|ref|XM—094306.1|[18560222]
[2704] 1075: XM—096226
[2705] Homo sapiens interleukin 7 receptor (IL7R), mRNA
[2706] gi|18560176|ref|XM—096226.1|[18560176]
[2707] 1076: XM—031131
[2708] Homo sapiens leukemia inhibitory factor receptor (LIFR), mRNA
[2709] gi|18559952|ref|XM—031131.2|[18559952]
[2710] 1077: XM—011222
[2711] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 2 (GABRB2), mRNA
[2712] gi|18559788|ref|XM—011222.6|[18559788]
[2713] 1078: XM—003519
[2714] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 1 (GABRB1), mRNA
[2715] gi|18558473|ref|XM—003519.3|[18558473]
[2716] 1079: XM—038446
[2717] Homo sapiens melatonin receptor 1A (MTNR1A), mRNA
[2718] gi|18558343|ref|XM—038446.2|[18558343]
[2719] 1080: XM—084160
[2720] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 2 (GABRA2), mRNA
[2721] gi|18558328|ref|XM—084160.1|[18558328]
[2722] 1081: XM—011169
[2723] Homo sapiens neuropeptide Y receptor Y2 (NPY2R), mRNA
[2724] gi|18558281|ref|XM—011169.3|[18558281]
[2725] 1082: XM—044120
[2726] Homo sapiens fibroblast growth factor receptor 3 (achondroplasia, thanatophoric
[2727] dwarfism) (FGFR3), mRNA
[2728] gi|18558241|ref|XM—044120.2|[18558241]
[2729] 1083: NT—030654
[2730] Homo sapiens chromosome 4 working draft sequence segment
[2731] gi|18557828|ref|NT—030654.2|Hs4—30910[18557828]
[2732] 1084: NT—030650
[2733] Homo sapiens chromosome 4 working draft sequence segment
[2734] gi|18557822|ref|NT—030650.2|Hs4—30906[18557822]
[2735] 1085: XM—011173
[2736] Homo sapiens glutamate receptor, ionotropic, delta 2 (GRID2), mRNA
[2737] gi|18557816|ref|XM—011173.4|[18557816]
[2738] 1086: NT—029955
[2739] Homo sapiens chromosome 4 working draft sequence segment
[2740] gi|18557687|ref|NT—029955.3|Hs4—30210[18557687]
[2741] 1087: NT—025693
[2742] Homo sapiens chromosome 4 working draft sequence segment
[2743] gi|18557505|ref|NT—025693.3|Hs4—25849[18557505]
[2744] 1088: NM—019841
[2745] Homo sapiens transient receptor potential nation channel, subfamily V, member 5
[2746] (TRPV5), mRNA
[2747] gi|17505199|ref|NM—019841.2|[17505199]
[2748] 1089: NT—030778
[2749] Homo sapiens chromosome 10 working draft sequence segment
[2750] gi|17489667|ref|NT—030778.1|Hs10—31034[17489667]
[2751] 1090: NT—010591
[2752] Homo sapiens chromosome 16 working draft sequence segment
[2753] gi|17487829|ref|NT—010591.6|Hs16—10748[17487829]
[2754] 1091: NT—030889
[2755] Homo sapiens chromosome X working draft sequence segment
[2756] gi|17486981|ref|NT—030889.1|HsX—31145[17486981]
[2757] 1092: XM—066104
[2758] Homo sapiens G protein-coupled receptor 73-like 1 (GPR73L1), mA
[2759] gi|17484462|ref|XM—066104.1|[17484462]
[2760] 1093: XM—056414
[2761] Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), mRNA
[2762] gi|17483039|ref|XM—056414.2|[17483039]
[2763] 1094: XM—053166
[2764] Homo sapiens somatostatin receptor-interacting protein (SSTRIP), mRNA
[2765] gi|17482811|ref|XM—053166.3|[17482811]
[2766] 1096: XM—008489
[2767] Homo sapiens acetyl LDL receptor; SREC=scavenger receptor expressed by endothelial cells (SREC), mRNA
[2768] gi|17481055|ref|XM—008489.7|[17481055]
[2769] 1097: XM—044091
[2770] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 7 (CHRNA7), mRNA
[2771] gi|17477913|ref|XM—044091.2|[17477913]
[2772] 1098: NT—010258
[2773] Homo sapiens chromosome 15 working draft sequence segment
[2774] gi|17477780|ref|NT—010258.7|Hs15—10415[17477780]
[2775] 1099: XM—038336
[2776] Homo sapiens neurotrophic tyrosine kinase, receptor, type 3 (NTRK3), mRNA
[2777] gi|17477779|ref|XM—038336.2|[17477779]
[2778] 1101: XM—027181
[2779] Homo sapiens transient receptor potential cation channel, subfamily V, member 4
[2780] (TRPV4), mRNA
[2781] gi|17475007|ref|XM—027181.2|[17475007]
[2782] 1102: XM—047362
[2783] Homo sapiens Glutamate receptor interacting protein (GRIP1), mRNA
[2784] gi|17474492|ref|XM—047362.3|[17474492]
[2785] 1104: XM—006372
[2786] Homo sapiens aryl hydrocarbon receptor interacting protein (AIP), mRNA
[2787] gi|17472888|ref|XM—006372.4|[17472888]
[2788] 1105: XM—004893
[2789] Homo sapiens receptor (calcitonin) activity modifying protein 3 (RAMP3), mRNA
[2790] gi|17464777|ref|XM—004893.4|[17464777]
[2791] 1107: XM—004559
[2792] Homo sapiens discoidin domain receptor family, member 1 (DDR1), mRNA
[2793] gi|17464405|ref|XM—004559.5|[17464405]
[2794] 1108: XM—004237
[2795] Homo sapiens insulin-like growth factor 2 receptor (IGF2R), mRNA
[2796] gi|17463326|ref|XM—004237.4|[17463326]
[2797] 1109: XM—051214
[2798] Homo sapiens type 1 tumor necrosis factor receptor shedding aminopeptidase regulator (ARTS-1), mRNA
[2799] gi|17462792|ref|XM—051214.2|[17462792]
[2800] 1110: XM—059645
[2801] Homo sapiens neuropeptide Y receptor Y1 (NPY1R), mRNA
[2802] gi|17462720|ref|XM—059645.1|[17462720]
[2803] 1111: XM—044493
[2804] Homo sapiens cholecystokinin B receptor (CCKBR), mRNA
[2805] gi|17461537|ref|XM—044493.2|[17461537]
[2806] 1112: XM—048562
[2807] Homo sapiens interferon (alpha, beta and omega) receptor 1 (IFNAR1), mRNA
[2808] gi|17460140|ref|XM—048562.3|[17460140]
[2809] 1113: XM—040307
[2810] Homo sapiens low density lipoprotein receptor defect B complementing (LDLB), mRNA
[2811] gi|17459160|ref|XM—040307.2|[17459160]
[2812] 1114: XM—046949
[2813] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2C (GRIN2C),
[2814] mRNA
[2815] gi|17457940|ref|XM—046949.3|[17457940]
[2816] 1115: XM—050937
[2817] Homo sapiens galanin receptor 1 (GALR1), mRNA
[2818] gi|17457665|ref|XM—050937.2|[17457665]
[2819] 1116: XM—058224
[2820] Homo sapiens protein tyrosine phosphatase, receptor type, M (PTPRM), mRNA
[2821] gi|17457059|ref|XM—058224.1|[17457059]
[2822] 1117: XM—059877
[2823] Homo sapiens scavenger receptor cysteine rich domain containing, group B (4 domains) (SRCRB4D), mRNA
[2824] gi|17452620|ref|XM—059877.1|[17452620]
[2825] 1118: XM—030074
[2826] Homo sapiens corticotropin releasing hormone receptor 2 (CRHR2), mRNA
[2827] gi|17451624|ref|XM—030074.2|[17451624]
[2828] 1119: XM—036899
[2829] Homo sapiens paired immunoglobulin-like receptor alpha (PILR(ALPHA)), mRNA
[2830] gi|17450024|ref|XM—036899.2|[17450024]
[2831] 1120: XM—040292
[2832] Homo sapiens glutamate receptor, ionotropic, AMPA 1 (GRIA1), mRNA
[2833] gi|17447971|ref|XM—040292.3|[17447971]
[2834] 1121: XM—003913
[2835] Homo sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA
[2836] gi|17447767|ref|XM—003913.5|[17447767]
[2837] 1122: XM—052621
[2838] Homo sapiens VPS10 domain receptor protein (SORCS2), mRNA
[2839] gi|17447359|ref|XM—052621.2|[17447359]
[2840] 1123: XM—011186
[2841] Homo sapiens platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), mRNA
[2842] gi|17446713|ref|XM—011186.5|[17446713]
[2843] 1124: XM—037260
[2844] Homo sapiens coagulation factor II (thrombin) receptor (F2R), mRNA
[2845] gi|17446698|ref|XM—037260.3|[17446698]
[2846] 1125: XM—068231
[2847] Homo sapiens G protein-coupled receptor 78 (GPR78), mRNA
[2848] gi|17446518|ref|XM—068231.1|[17446518]
[2849] 1126: XM—003896
[2850] Homo sapiens growth hormone receptor (GHR), mRNA
[2851] gi|17446516|ref|XM—003896.5|[17446516]
[2852] 1127: XM—003883
[2853] Homo sapiens prolactin receptor (PRLR), mRNA
[2854] gi|17446302|ref|XM—003883.4|[17446302]
[2855] 1128: XM—003423
[2856] Homo sapiens toll-like receptor 6 (TLR6), mRNA
[2857] gi|17443462|ref|XM—003423.5|[17443462]
[2858] 1129: XM—050674
[2859] Homo sapiens kinase insert domain receptor (a type III receptor tyrosine kinase)
[2860] (KDR), mRNA
[2861] gi|17443063|ref|XM—050674.2|[17443063]
[2862] 1130: XM—016537
[2863] Homo sapiens low density lipoprotein receptor-related protein 8, apolipoprotein
[2864] e receptor (LRP8), mRNA
[2865] gi|17438001|ref|XM—016537.4|[17438001]
[2866] 1131: XM—050512
[2867] Homo sapiens activin A receptor, type I (ACVR1), mRNA
[2868] gi|17437640|ref|XM—050512.3|[17437640]
[2869] 1132: XM—011248
[2870] Homo sapiens adrenergic, alpha-1B-, receptor (ADRA1B), mRNA
[2871] gi|17437111|ref|XM—011248.5|[17437111]
[2872] 1133: XM—057299
[2873] Homo sapiens very large G protein-coupled receptor 1 (VLGR1), mRNA
[2874] gi|17436651|ref|XM—057299.2|[17436651]
[2875] 1134: XM—042825
[2876] Homo sapiens luteinizing hormone/choriogonadotropin receptor (LHCGR), mRNA
[2877] gi|17433844|ref|XM—042825.3|[17433844]
[2878] 1135: XM—039993
[2879] Homo sapiens fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) (FLT1), mRNA
[2880] gi|16188964|ref|XM—039993.2|[16188964]
[2881] 1136: XM—028642
[2882] Homo sapiens integrin, alpha 5 (fibronectin receptor, alpha polypeptide) (ITGA5), mRNA
[2883] gi|16186750|ref|XM—028642.2|[16186750]
[2884] 1137: XM—057337
[2885] Homo sapiens cholinergic receptor, muscarinic 1 (CHRM1), mRNA
[2886] gi|16184321|ref|XM—057337.1|[16184321]
[2887] 1138: XM—006447
[2888] Homo sapiens interleukin 10 receptor, alpha (IL10RA), mRNA
[2889] gi|16183626|ref|XM—006447.5|[16183626]
[2890] 1139: XM—057984
[2891] Homo sapiens G protein-coupled receptor 51 (GPR51), mRNA
[2892] gi|16181083|ref|XM—057984.1|[16181083]
[2893] 1140: XM—057452
[2894] Homo sapiens toll-like receptor 4 (TLR4), mRNA
[2895] gi|16179752|ref|XM—057452.1|[16179752]
[2896] 1141: XM—051505
[2897] Homo sapiens opioid receptor, kappa 1 (OPRK1), mRNA
[2898] gi|16179331|ref|XM—051505.2|[16179331]
[2899] 1142: XM—027651
[2900] Homo sapiens tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B),
[2901] mRNA
[2902] gi|16178146|ref|XM—027651.2|[16178146]
[2903] 1144: XM—028141
[2904] Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), mRNA
[2905] gi|16176785|ref|XM—028141.2|[16176785]
[2906] 1145: XM—004872
[2907] Homo sapiens atrophin-1 interacting protein 1; activin receptor interacting protein 1 (KIAA0705), mRNA
[2908] gi|16175845|ref|XM—004872.6|[16175845]
[2909] 1146: XM—057372
[2910] Homo sapiens tumor necrosis factor receptor superfamily, member 5 (TNFRSF5), mRNA
[2911] gi|16174074|ref|XM—057372.1|[16174074]
[2912] 1147: XM—056391
[2913] Homo sapiens BAFF receptor (BAFFR), mRNA
[2914] gi|16168558|ref|XM—056391.1|[16168558]
[2915] 1148: XM—054949
[2916] Homo sapiens transient receptor potential cation channel, subfamily V, member 2
[2917] (TRPV2), mRNA
[2918] gi|16165271|ref|XM—054949.1|[16165271]
[2919] 1149: XM—009219
[2920] Homo sapiens endothelial differentiation, G-protein-coupled receptor 6 (EDG6),
[2921] mRNA
[2922] gi|16163259|ref|XM—009219.5|[16163259]
[2923] 1150: XM—057188
[2924] Homo sapiens transient receptor potential cation channel, subfamily M, member 4
[2925] (TRPM4), mRNA
[2926] gi|16162857|ref|XM—057188.1|[16162857]
[2927] 1151: XM—033762
[2928] Homo sapiens growth factor receptor-bound protein 10 (GRB10), mRNA
[2929] gi|16162156|ref|XM—033762.2|[16162156]
[2930] 1152: XM—037256
[2931] Homo sapiens protein tyrosine phosphatase, receptor type, N polypeptide 2 (PTPRN2), mRNA
[2932] gi|16162004|ref|XM—037256.2|[16162004]
[2933] 1153: XM—007662
[2934] Homo sapiens transient receptor potential cation channel, subfamily M, member 1
[2935] (TRPM1), mRNA
[2936] gi|16161643|ref|XM—007662.6|[16161643]
[2937] 1154: XM—011327
[2938] Homo sapiens hepatitis A virus cellular receptor 1 (HAVCR-1), mRNA
[2939] gi|16159892|ref|XM—011327.4|[16159892]
[2940] 1155: XM—034331
[2941] Homo sapiens endothelin receptor type A (EDNRA), mRNA
[2942] gi|16158485|ref|XM—034331.2|[16158485]
[2943] 1156: XM—002212
[2944] Homo sapiens follicle stimulating hormone receptor (FSHR), mRNA
[2945] gi|16158251|ref|XM—002212.4|[16158251]
[2946] 1157: XM—003736
[2947] Homo sapiens G protein-coupled receptor kinase 6 (GPRK6), mRNA
[2948] gi|16157601|ref|XM—003736.4|[16157601]
[2949] 1158: XM—038350
[2950] Homo sapiens platelet-derived growth factor receptor, beta polypeptide (PDGFRB),
[2951] mRNA
[2952] gi|16157449|ref|XM—038350.21[16157449]
[2953] 1159: XM—003789
[2954] Homo sapiens colony stimulating factor 1 receptor, formerly McDonough feline sarcoma viral (v-fms) oncogene homolog (CSF1R), mRNA
[2955] gi|16157447|ref|XM—003789.4|[16157447]
[2956] 1160: XM—054659
[2957] Homo sapiens olfactory receptor, family 3, subfamily A, member 3 (OR3A3), mRNA
[2958] gi|15314104|ref|XM—054659.1|[15314104]
[2959] 1161: XM—054658
[2960] Homo sapiens olfactory receptor, family 1, subfamily E, member 1 (OR1E1), mRNA
[2961] gi|15314100|ref|XM—054658.1|[15314100]
[2962] 1162: XM—006275
[2963] Homo sapiens membrane-spanning 4-domains, subfamily A, member 1 (MS4A2), mRNA
[2964] gi|15311761|ref|XM—006275.4|[15311761]
[2965] 1163: XM—012695
[2966] Homo sapiens growth factor receptor-bound protein 7 (GRB7), mRNA
[2967] gi|15310219|ref|XM—012695.4|[15310219]
[2968] 1164: XM—045812
[2969] Homo sapiens G protein-coupled receptor 72 (GPR72), mRNA
[2970] gi|15308293|ref|XM—045812.2|[15308293]
[2971] 1165: XM—033995
[2972] Homo sapiens histamine H4 receptor (HRH4), mRNA
[2973] gi|15305825|ref|XM—033995.2|[15305825]
[2974] 1166: XM—036978
[2975] Homo sapiens tumor necrosis factor receptor superfamily, member 11a, activator
[2976] of NFKB (TNFRSF11A), mRNA
[2977] gi|15305343|ref|XM—036978.2|[15305343]
[2978] 1167: XM—015355
[2979] Homo sapiens protein tyrosine phosphatase, receptor type, R (PTPRR), mRNA
[2980] gi|15304370|ref|XM—015355.2|[15304370]
[2981] 1168: XM—006738
[2982] Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1 (CD36L1), mRNA
[2983] gi|15303296|ref|XM—006738.5|[15303296]
[2984] 1169: XM—049255
[2985] Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23A) (FCER2),
[2986] mRNA
[2987] gi|15302967|ref|XM—049255.2|[15302967]
[2988] 1170: XM—008930
[2989] Homo sapiens coagulation factor II (thrombin) receptor-like 3 (F2RL3), mRNA
[2990] gi|15302724|ref|XM—008930.4|[15302724]
[2991] 1171: NT—029418
[2992] Homo sapiens chromosome 12 working draft sequence segment
[2993] gi|15302021|ref|NT—029418.1|Hs12—29577[15302021]
[2994] 1173: XM—054004
[2995] Homo sapiens glutamate receptor, metabotropic 1 (GRM1), mRNA
[2996] gi|15299786|ref|XM—054004.1|[15299786]
[2997] 1174: XM—046588
[2998] Homo sapiens G protein-coupled receptor slt (SLT), mRNA
[2999] gi|15299770|ref|XM—046588.2|[15299770]
[3000] 1175: XM—032592
[3001] Homo sapiens VPS10 domain receptor protein SORCS 3 (SORCS3), mRNA
[3002] gi|15299687|ref|XM—032592.2|[15299687]
[3003] 1176: XM—054157
[3004] Homo sapiens G protein-coupled receptor 35 (GPR35), mRNA
[3005] gi|15298180|ref|XM—054157.1|[15298180]
[3006] 1177: XM—042907
[3007] Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), mRNA
[3008] gi|15296528|ref|XM—042907.2|[15296528]
[3009] 1178: XM—033031
[3010] Homo sapiens peroxisome proliferative activated receptor, gamma, coactivator 1
[3011] (PPARGC1), mRNA
[3012] gi|15295682|ref|XM—033031.2|[15295682]
[3013] 1179: XM—003708
[3014] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, pi (GABRP), mRNA
[3015] gi|15294866|ref|XM—003708.5|[15294866]
[3016] 1180: XM—008189
[3017] Homo sapiens CMRF35 leukocyte immunoglobulin-like receptor (CMRF35), mRNA
[3018] gi|14785569|ref|XM—008189.4|[14785569]
[3019] 1182: XM—033305
[3020] Homo sapiens lymphotoxin beta receptor (TNFR superfamily, member 3) (LTBR), mRNA
[3021] gi|14784387|ref|XM—033305.1|[14784387]
[3022] 1183: XM—004350
[3023] Homo sapiens cannabinoid receptor 1 (brain) (CNR1), mRNA
[3024] gi|14783266|ref|XM—004350.4|[14783266]
[3025] 1184: XM—004285
[3026] Homo sapiens peroxisome proliferative activated receptor, delta (PPARD), mRNA
[3027] gi|14782955|ref|XM—004285.4|[14782955]
[3028] 1185: XM—042636
[3029] Homo sapiens inositol 1,4,5-triphosphate receptor, type 3 (ITPR3), mRNA
[3030] gi|14782869|ref|XM—042636.1|[14782869]
[3031] 1187: XM—050142
[3032] Homo sapiens integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide) (ITGAM), mRNA
[3033] gi|14779440|ref|XM—050142.1|[14779440]
[3034] 1188: XM—037826
[3035] Homo sapiens adrenergic, beta, receptor kinase 2 (ADRBK2), mRNA
[3036] gi|14777914|ref|XM—037826.1|[14777914]
[3037] 1189: XM—036497
[3038] Homo sapiens olfactory receptor, family 1, subfamily F, member 2 (OR1F2), mRNA
[3039] gi|14777865|ref|XM—036497.1|[14777865]
[3040] 1190: XM—036891
[3041] Homo sapiens purinergic receptor P2X-like 1, orphan receptor (P2RXL1), mRNA
[3042] gi|14777537|ref|XM—036891.1|[14777537]
[3043] 1191: XM—007986
[3044] Homo sapiens apolipoprotein B48 receptor (APOB48R), mRNA
[3045] gi|14777420|ref|XM—007986.4|[14777420]
[3046] 1192: XM—047456
[3047] Homo sapiens melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) (MC1R), mRNA
[3048] gi|14776693|ref|XM—047456.1|[14776693]
[3049] 1193: XM—030214
[3050] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A),
[3051] mRNA
[3052] gi|14776459|ref|XM—030214.1|[14776459]
[3053] 1194: XM—049959
[3054] Homo sapiens chemokine (C-C motif) receptor 7 (CCR7), mRNA
[3055] gi|14775963|ref|XM—049959.1|[14775963]
[3056] 1196: XM—048049
[3057] Homo sapiens G protein-coupled receptor 56 (GPR56), mRNA
[3058] gi|14775189|ref|XM—048049.1|[14775189]
[3059] 1197: XM—046488
[3060] Homo sapiens glucagon receptor (GCGR), mRNA
[3061] gi|14775175|ref|XM—046488.1|[14775175]
[3062] 1198: XM—040635
[3063] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 1 (P2RX1), mRNA
[3064] gi|14774341|ref|XM—040635.1|[14774341]
[3065] 1199: XM—018451
[3066] Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) (CHRNB1), mRNA
[3067] gi|14773487|ref|XM—018451.2|[14773487]
[3068] 1201: XM—008432
[3069] Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), mRNA
[3070] gi|14773206|ref|XM—008432.4|[14773206]
[3071] 1202: XM—047339
[3072] Homo sapiens opiate receptor-like 1 (OPRL1), mRNA
[3073] gi|14772199|ref|XM—047339.1|[14772199]
[3074] 1203: XM—006349
[3075] Homo sapiens angiotensin receptor-like 1 (AGTRL1), mRNA
[3076] gi|14771894|ref|XM—006349.2|[14771894]
[3077] 1204: XM—046182
[3078] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 3 (P2RX3), mRNA
[3079] gi|14771633|ref|XM—046182.1|[14771633]
[3080] 1205: XM—006312
[3081] Homo sapiens sortilin-related receptor, L (DLR class) A repeats-containing (SORL1), mRNA
[3082] gi|14771251|ref|XM—006312.4|[14771251]
[3083] 1206: XM—012936
[3084] Homo sapiens protein tyrosine phosphatase, receptor type, T (PTPRT), mRNA
[3085] gi|14770881|ref|XM—012936.3|[14770881]
[3086] 1207: XM—040842
[3087] Homo sapiens cullin 5 (CUL5), mRNA
[3088] gi|14770334|ref|XM—040842.1|[14770334]
[3089] 1208: XM—045103
[3090] Homo sapiens G protein coupled receptor interacting protein, complement-c1q tumor necrosis factor-related (ZSIG37), mRNA
[3091] gi|14770190|ref|XM—045103.1|[14770190]
[3092] 1209: XM—040699
[3093] Homo sapiens transient receptor potential cation channel, subfamily C, member 6
[3094] (TRPC6), mRNA
[3095] gi|14770156|ref|XM—040699.1|[14770156]
[3096] 1210: XM—040922
[3097] Homo sapiens interleukin 13 receptor, alpha 2 (IL13RA2), mRNA
[3098] gi|14769890|ref|XM—040922.1|[14769890]
[3099] 1211: XM—028854
[3100] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 4 (CHRNA4), mRNA
[3101] gi|14769881|ref|XM—028854.1|[14769881]
[3102] 1212: XM—028783
[3103] Homo sapiens opioid growth factor receptor (OGFR), mRNA
[3104] gi|14769761|ref|XM—028783.1|[14769761]
[3105] 1213: XM—050577
[3106] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 7 (ILT11), mRNA
[3107] gi|14769454|ref|XM—050577.1|[14769454]
[3108] 1215: XM—045929
[3109] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 4 (P2RX4), mRNA
[3110] gi|14768232|ref|XM—045929.1|[14768232]
[3111] 1216: XM—006929
[3112] Homo sapiens complement component 3a receptor 1 (C3AR1), mRNA
[3113] gi|14765892|ref|XM—006929.2|[14765892]
[3114] 1217: XM—030897
[3115] Homo sapiens angiotensin receptor 2 (AGTR2), mRNA
[3116] gi|14765825|ref|XM—030897.1|[14765825]
[3117] 1218: XM—037563
[3118] Homo sapiens G protein-coupled receptor 54 (GPR54), mRNA
[3119] gi|14765555|ref|XM—037563.1|[14765555]
[3120] 1219: XM—045549
[3121] Homo sapiens FGF receptor activating protein 1 (FRAG1), mRNA
[3122] gi|4765112|ref|XM—045549.1|[14765112]
[3123] 1220: XM—045706
[3124] Homo sapiens toll-like receptor 8 (TLR8), mRNA
[3125] gi|14764423|ref|XM—045706.1|[14764423]
[3126] 1221: XM—013100
[3127] Homo sapiens G protein-coupled receptor 34 (GPR34), mRNA
[3128] gi|14764061|ref|XM—013100.3|[14764061]
[3129] 1222: XM—012862
[3130] Homo sapiens cargo selection protein (mannose 6 phosphate receptor binding protein) (TIP47), mRNA
[3131] gi|14764025|ref|XM—012862.3|[14764025]
[3132] 1223: XM—035037
[3133] Homo sapiens low density lipoprotein receptor-related protein 4 (LRP4), mRNA
[3134] gi|14763920|ref|XM—035037.1|[14763920]
[3135] 1224: XM—050707
[3136] Homo sapiens activin A receptor type II-like 1 (ACVRL1), mRNA
[3137] gi|14763806|ref|XM—050707.1|[14763806]
[3138] 1225: XM—036573
[3139] Homo sapiens low density lipoprotein receptor-related protein 3 (LRP3), mRNA
[3140] gi|14763070|ref|XM—036573.1|[14763070]
[3141] 1226: XM—012843
[3142] Homo sapiens protein tyrosine phosphatase, receptor type, H (PTPRH), mRNA
[3143] gi|14762603|ref|XM—012843.3|[14762603]
[3144] 1227: XM—006789
[3145] Homo sapiens protein tyrosine phosphatase, receptor type, B (PTPRB), mRNA
[3146] gi|14762249|ref|XM—006789.4|[14762249]
[3147] 1229: XM—034808
[3148] Homo sapiens interleukin 1 receptor accessory protein-like 2 (IL1RAPL2), mRNA
[3149] gi|14760985|ref|XM—034808.1|[14760985]
[3150] 1230: XM—006747
[3151] Homo sapiens inositol 1,4,5-triphosphate receptor, type 2 (ITPR2), mRNA
[3152] gi|14760648|ref|XM—006747.4|[14760648]
[3153] 1231: XM—015921
[3154] Homo sapiens putative chemokine receptor; GTP-binding protein (HM74), mRNA
[3155] gi|14760439|ref|XM—015921.2|[14760439]
[3156] 1232: XM—009008
[3157] Homo sapiens egf-like module containing, mucin-like, hormone receptor-like sequence 1 (EMR1), mRNA
[3158] gi|14759169|ref|XM—009008.4|[14759169]
[3159] 1233: XM—028274
[3160] Homo sapiens prostaglandin 12 (prostacyclin) receptor (IP) (PTGIR), mRNA
[3161] gi|14758807|ref|XM—028274.1|[14758807]
[3162] 1234: XM—007123
[3163] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), mRNA
[3164] gi|14757796|ref|XM—007123.4|[14757796]
[3165] 1235: XM—049518
[3166] Homo sapiens intercellular adhesion molecule 1 (CD54), human rhinovirus receptor
[3167] (ICAM1), mRNA
[3168] gi|14756651|ref|XM—049518.1|[14756651]
[3169] 1236: XM—049496
[3170] Homo sapiens purinergic receptor P2Y, G-protein coupled, 11 (P2RY11), mRNA
[3171] gi|14756601|ref|XM—049496.1|[14756601]
[3172] 1237: XM—007577
[3173] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 5 (CHRNA5), mRNA
[3174] gi|14756537|ref|XM—007577.2|[14756537]
[3175] 1238: XM—006636
[3176] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B),
[3177] mRNA
[3178] gi|14756111|ref|XM—006636.4|[14756111]
[3179] 1239: XM—044309
[3180] Homo sapiens poliovirus receptor (PVR), mRNA
[3181] gi|14755769|ref|XM—044309.1|[14755769]
[3182] 1240: XM—004134
[3183] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1E (HTR1E), mRNA
[3184] gi|14755675|ref|XM—004134.4|[14755675]
[3185] 1241: XM—033838
[3186] Homo sapiens chemokine (C-C motif) receptor 6 (CCR6), mRNA
[3187] gi|14755122|ref|XM—033838.1|[14755122]
[3188] 1242: XM—031082
[3189] Homo sapiens formyl peptide receptor-like 1 (FPRL1), mRNA
[3190] gi|14754918|ref|XM—031082.1|[14754918]
[3191] 1243: XM—028205
[3192] Homo sapiens glucagon-like peptide 1 receptor (GLP1R), mRNA
[3193] gi|14754205|ref|XM—028205.1|[14754205]
[3194] 1244: XM—051710
[3195] Homo sapiens prostaglandin E receptor 2 (subtype EP2), 53 kD (PTGER2), mRNA
[3196] gi|14753577|ref|XM—051710.1|[14753577]
[3197] 1245: XM—048918
[3198] Homo sapiens met proto-oncogene (hepatocyte growth factor receptor) (MET), mRNA
[3199] gi|14753543|ref|XM—048918.1|[14753543]
[3200] 1246: XM—045352
[3201] Homo sapiens receptor-interacting serine-threonine kinase 2 (RIPK2), mRNA
[3202] gi|14751723|ref|XM—045352.1|[14751723]
[3203] 1247: XM—049463
[3204] Homo sapiens fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2,
[3205] Pfeiffer syndrome) (FGFR1), mRNA
[3206] gi|14750712|ref|XM—049463.1|[14750712]
[3207] 1248: XM—033240
[3208] Homo sapiens leukotriene b4 receptor (chemokine receptor-like 1) (LTB4R), mRNA
[3209] gi|14750696|ref|XM—033240.1|[14750696]
[3210] 1249: XM—046720
[3211] Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1), mRNA
[3212] gi|14750531|ref|XM—046720.1|[14750531]
[3213] 1250: XM—050434
[3214] Homo sapiens interferon gamma receptor 1 (IFNGR1), mRNA
[3215] gi|14750131|ref|XM—050434.1|[14750131]
[3216] 1251: XM—035832
[3217] Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 3 (CHRNB3), mRNA
[3218] gi|14749978|ref|XM—035832.1|[14749978]
[3219] 1252: XM—034142
[3220] Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor) (CD36), mRNA
[3221] gi|14749875|ref|XM—034142.1|[14749875]
[3222] 1253: XM—030066
[3223] Homo sapiens growth hormone releasing hormone receptor (GHRHR), mRNA
[3224] gi|14749610|ref|XM—030066.1|[14749610]
[3225] 1254: XM—007383
[3226] Homo sapiens G protein-coupled receptor 68 (GPR68), mRNA
[3227] gi|14748827|ref|XM—007383.2|[14748827]
[3228] 1255: XM—004117
[3229] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1B (HTR1B), mRNA
[3230] gi|14747779|ref|XM—004117.2|[14747779]
[3231] 1256: XM—036123
[3232] Homo sapiens transient receptor potential cation channel, subfamily M, member 3
[3233] (TRPM3), mRNA
[3234] gi|14743665|ref|XM—036123.1|[14743665]
[3235] 1257: XM—011817
[3236] Homo sapiens muscle, skeletal, receptor tyrosine kinase (MUSK), mRNA
[3237] gi|14742818|ref|XM—011817.3|[14742818]
[3238] 1258: XM—044653
[3239] Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) (EGFR), mRNA
[3240] gi|14741797|ref|XM—044653.1|[14741797]
[3241] 1259: XM—033529
[3242] Homo sapiens G protein-coupled receptor 85 (GPR85), mRNA
[3243] gi|14741568|ref|XM—033529.1|[14741568]
[3244] 1260: XM—011916
[3245] Homo sapiens pancreatic polypeptide receptor 1 (PPYR1), mRNA
[3246] gi|14740172|ref|XM—011916.2|[14740172]
[3247] 1261: XM—005486
[3248] Homo sapiens neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), mRNA
[3249] gi|14740022|ref|XM—005486.4|[14740022]
[3250] 1262: XM—042740
[3251] Homo sapiens region containing Sulfonylurea receptor; KIAA1674 (LOC142781), mRNA
[3252] gi|14739341|ref|XM—042740.1|[14739341]
[3253] 1263: XM—045386
[3254] Homo sapiens very low density lipoprotein receptor (VLDLR), mRNA
[3255] gi|14736403|ref|XM—045386.1|[14736403]
[3256] 1264: XM—004002
[3257] Homo sapiens hyaluronan-mediated motility receptor (RHAMM) (HMMR), mRNA
[3258] gi|14734503|ref|XM—004002.4|[14734503]
[3259] 1265: XM—034451
[3260] Homo sapiens olfactory receptor, family 7, subfamily A, member 120 (OR7E120), mRNA
[3261] gi|14733406|ref|XM—034451.1|[14733406]
[3262] 1266: XM—029284
[3263] Homo sapiens cholecystokinin A receptor (CCKAR), mRNA
[3264] gi|14733138|ref|XM—029284.1|[14733138]
[3265] 1267: XM—052171
[3266] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), mRNA
[3267] gi|14732310|ref|XM—052171.1|[14732310]
[3268] 1268: XM—042695
[3269] Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), mRNA
[3270] gi|14728655|ref|XM—042695.1|[14728655]
[3271] 1269: XM—041933
[3272] Homo sapiens Ig superfamily receptor LNIR (LNIR), mRNA
[3273] gi|14723974|ref|XM—041933.1|[14723974]
[3274] 1270: XM—032738
[3275] Homo sapiens glycine receptor, alpha 1 (startle disease/hyperekplexia, stiff man
[3276] syndrome) (GLRA1), mRNA
[3277] gi|14722750|ref|XM—032738.1|[14722750]
[3278] 1271: XM—032682
[3279] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 6 (GABRA6), mRNA
[3280] gi|14722636|ref|XM—032682.1|[14722636]
[3281] 1272: XM—017228
[3282] Homo sapiens low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) (LRP1), mRNA
[3283] gi|13654580|ref|XM—017228.1|[13654580]
[3284] 1273: XM—008538
[3285] Homo sapiens aryl hydrocarbon receptor interacting protein-like 1 (AIPL1), mRNA
[3286] gi|13653245|ref|XM—008538.3|[13653245]
[3287] 1274: XM—007046
[3288] Homo sapiens vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR), mRNA
[3289] gi|13653215|ref|XM—007046.3|[13653215]
[3290] 1275: XM—007751
[3291] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 3 (GABRB3), mRNA
[3292] gi|13653090|ref|XM—007751.3|[13653090]
[3293] 1276: XM—007719
[3294] Homo sapiens paired basic amino acid cleaving enzyme (furin, membrane associated
[3295] receptor protein) (PACE), mRNA
[3296] gi|1365250|ref|XM—007719.2|[13652501]
[3297] 1277: XM—010296
[3298] Homo sapiens transient receptor potential cation channel, subfamily C, member 5
[3299] (TRPC5), mRNA
[3300] gi|13652451|ref|XM—010296.2|[13652451]
[3301] 1278: XM—006950
[3302] Homo sapiens tumor necrosis factor receptor superfamily, member 1A (TNFRSF1A),
[3303] mRNA
[3304] gi|13652420|ref|XM—006950.3|[13652420]
[3305] 1279: XM—008206
[3306] Homo sapiens receptor (calcitonin) activity modifying protein 2 (RAMP2), mRNA
[3307] gi|13652390|ref|XM—008206.3|[13652390]
[3308] 1280: XM—013114
[3309] Homo sapiens interleukin 1 receptor accessory protein-like 1 (IL1RAPL1), mRNA
[3310] gi|13652318|ref|XM—013114.2|[13652318]
[3311] 1281: XM—015989
[3312] Homo sapiens interleukin 9 receptor (IL9R), mRNA
[3313] gi|13652206|ref|XM—015989.1|[13652206]
[3314] 1282: XM—006934
[3315] Homo sapiens arginine vasopressin receptor 1A (AVPR1A), mRNA
[3316] gi|13652044|ref|XM—006934.3|[13652044]
[3317] 1283: XM—012441
[3318] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 5 (GABRA5), mRNA
[3319] gi|13651536|ref|XM—012441.2|[13651536]
[3320] 1284: XM—008193
[3321] Homo sapiens putative receptor protein (PMI), mRNA
[3322] gi|13650873|ref|XM—008193.2|[13650873]
[3323] 1285: XM—009108
[3324] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2D (GRIN2D),
[3325] mRNA
[3326] gi|13650682|ref|XM—009108.3|[13650682]
[3327] 1286: XM—015505
[3328] Homo sapiens AXL receptor tyrosine kinase (AXL), mRNA
[3329] gi|13650099|ref|XM—015505.1|[13650099]
[3330] 1287: XM—006145
[3331] Homo sapiens dopamine receptor D4 (DRD4), mRNA
[3332] gi|13647063|ref|XM—006145.2|[13647063]
[3333] 1288: XM—009803
[3334] Homo sapiens transient receptor potential cation channel, subfamily M, member 2
[3335] (TRPM2), mRNA
[3336] gi|13646881|ref|XM—009803.3|[13646881]
[3337] 1289: XM—004030
[3338] Homo sapiens adrenergic, beta-2-, receptor, surface (ADRB2), mRNA
[3339] gi|13645597|ref|XM—004030.2|[13645597]
[3340] 1290: XM—011703
[3341] Homo sapiens tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A),
[3342] mRNA
[3343] gi|13644652|ref|XM—011703.2|[13644652]
[3344] 1291: XM—003986
[3345] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 2 (GABRG2), mRNA
[3346] gi|13643024|ref|XM—003986.2|[13643024]
[3347] 1292: XM—004253
[3348] Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 2 (GABRR2), mRNA
[3349] gi|13642452|ref|XM—004253.2|[13642452]
[3350] 1293: XM—006233
[3351] Homo sapiens glutamate receptor, ionotrophic, AMPA 4 (GRIA4), mRNA
[3352] gi|13639643|ref|XM—006233.3|[13639643]
[3353] 1294: XM—005384
[3354] Homo sapiens RAR-related orphan receptor B (RORB), mRNA
[3355] gi|13639481|ref|XM—005384.3|[13639481]
[3356] 1295: XM—004988
[3357] Homo sapiens aryl hydrocarbon receptor (AHR), mRNA
[3358] gi|13631520|ref|XM—004988.2|[13631520]
[3359] 1296: XM—011364
[3360] Homo sapiens lymphocyte antigen 95 (activating NK-receptor; NK-p44) (LY95), mRNA
[3361] gi|3630600|ref|XM—011364.2|[13630600]
[3362] 1297: XM—009612
[3363] Homo sapiens neurotensin receptor 1 (high affinity) (NTSR1), mRNA
[3364] gi|13630500|ref|XM—009612.2|[13630500]
[3365] 1298: XM—003417
[3366] Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II) (CD36L2), mRNA
[3367] gi|13630130|ref|XM—003417.3|[13630130]
[3368] 1299: XM—007817
[3369] Homo sapiens tumor necrosis factor receptor superfamily, member 17 (TNFRSF17),
[3370] mRNA
[3371] gi|13627219|ref|XM—007817.3|[13627219]
[3372] 1300: XM—012949
[3373] Homo sapiens complement component 1, q subcomponent, receptor 1 (C1QR1), mRNA
[3374] gi|12742414|ref|XM—012949.1|[12742414]
[3375] 1301: XM—009594
[3376] Homo sapiens somatostatin receptor 4 (SSTR4), mRNA
[3377] gi|12742412|ref|XM—009594.2|[12742412]
[3378] 1302: XM—008512
[3379] Homo sapiens vanilloid receptor subtype 1 (VR1), mRNA
[3380] gi|12740624|ref|XM—008512.2|[12740624]
[3381] 1303: XM—006931
[3382] Homo sapiens oxidised low density lipoprotein (lectin-like) receptor 1 (OLR1),
[3383] mRNA
[3384] gi|12737735|ref|XM—006931.2|[12737735]
[3385] 1304: XM—006933
[3386] Homo sapiens C-type lectin-like receptor-1 (LOC51267), mRNA
[3387] gi|12737731|ref|XM—006933.2|[12737731]
[3388] 1305: XM—004438
[3389] Homo sapiens interleukin 20 receptor, alpha (IL20RA), mRNA
[3390] gi|12732139|ref|XM—004438.2|[12732139]
[3391] 1306: XM—003692
[3392] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1A (HTR1A), mRNA
[3393] gi|12731011|ref|XM—003692.2|[12731011]
[3394] 1307: XM—010228
[3395] Homo sapiens G protein-coupled receptor 50 (GPR50), mRNA
[3396] gi|12719157|ref|XM—010228.2|[12719157]
[3397] 1308: XM—009082
[3398] Homo sapiens low density lipoprotein receptor (familial hypercholesterolemia) (LDLR), mRNA
[3399] gi|1525992|ref|XM—009082.1|[11525992]
[3400] 1309: XM—006296
[3401] Homo sapiens cholinergic receptor, muscarinic 4 (CHRM4), mRNA
[3402] gi|11437838|ref|XM—006296.1|[11437838]
[3403] 1310: NT—009784
[3404] Homo sapiens chromosome 12 working draft sequence segment
[3405] gi|11436706|ref|NT—009784.1|Hs12—9941[11436706] 131I: XM—003386
[3406] Homo sapiens gonadotropin-releasing hormone receptor (GNRHR), mRNA
[3407] gi|11435615|ref|XM—003386.1|[11435615]
[3408] 1312: NT—024131
[3409] Homo sapiens chromosome 10 working draft sequence segment
[3410] gi|11430625|ref|NT—024131.1|Hs10—24287[11430625]
[3411] 1313: XM—009373
[3412] Homo sapiens formyl peptide receptor-like 2 (FPRL2), mRNA
[3413] gi|11426996|ref|XM—009373.1|[11426996]
[3414] 1314: XM—008520
[3415] Homo sapiens cholinergic receptor, nicotinic, epsilon polypeptide (CHRNE), mRNA
[3416] gi|11426945|ref|XM—008520.1|[11426945]
[3417] 1315: XM—009140
[3418] Homo sapiens G protein-coupled receptor 4 (GPR4), mRNA
[3419] gi|11425489|ref|XM—009140.1|[11425489]
[3420] 1316: XM—008279
[3421] Homo sapiens adenosine A2b receptor (ADORA2B), mRNA
[3422] gi|11425432|ref|XM—008279.1|[11425432]
[3423] 1317: XM—010321
[3424] Homo sapiens glycine receptor, alpha 2 (GLRA2), mRNA
[3425] gi|11421007|ref|XM—010321.1|[11421007]
[3426] 1318: XM—004808
[3427] Homo sapiens taste receptor, type 2, member 4 (TAS2R4), mRNA
[3428] gi|11420322|ref|XM—004808.1|[11420322]
[3429] 1319: XM—004807
[3430] Homo sapiens taste receptor, type 2, member 5 (TAS2R5), mRNA
[3431] gi|11420320|ref|XM—004807.1|[11420320]
[3432] 1320: XM—011092
[3433] Homo sapiens glycine receptor, alpha 3 (GLRA3), mRNA
[3434] gi|18556859|ref|XM—011092.4|[18556859]
[3435] 1321: XM—003324
[3436] Homo sapiens transient receptor potential cation channel, subfamily C, member 3
[3437] (TRPC3), mRNA
[3438] gi|18556760|ref|XM—003324.5|[18556760]
[3439] 1322: XM—011068
[3440] Homo sapiens macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
[3441] (MST1R), mRNA
[3442] gi|18556611|ref|XM—011068.4|[18556611]
[3443] 1323: XM—011064
[3444] Homo sapiens protein tyrosine phosphatase, receptor type, G (PTPRG), mRNA
[3445] gi|18556526|ref|XM—011064.7|[18556526]
[3446] 1324: XM—003207
[3447] Homo sapiens glutamate receptor, metabotropic 2 (GRM2), mRNA
[3448] gi|18556346|ref|XM—003207.5|[18556346]
[3449] 1325: XM—036436
[3450] Homo sapiens interleukin 1 receptor accessory protein (IL1RAP), mRNA
[3451] gi|18555803|ref|XM—036436.4|[18555803]
[3452] 1326: XM—031246
[3453] Homo sapiens roundabout, axon guidance receptor, homolog 2 (Drosophila) (ROBO2),
[3454] mRNA
[3455] gi|18555796|ref|XM—031246.2|[18555796]
[3456] 1327: XM—003226
[3457] Homo sapiens vasoactive intestinal peptide receptor 1 (VIPR1), mRNA
[3458] gi|18555693|ref|XM—003226.7|[18555693]
[3459] 1328: NT—005824
[3460] Homo sapiens chromosome 3 working draft sequence segment
[3461] gi|18555677|ref|NT—005824.7|Hs3—5981[18555677]
[3462] 1329: XM—093692
[3463] Homo sapiens RYK receptor-like tyrosine kinase (RYK), mRNA
[3464] gi|18555675|ref|XM—093692.1|[18555675]
[3465] 1332: NT—005564
[3466] Homo sapiens chromosome 3 working draft sequence segment
[3467] gi|18555104|ref|NT—005564.8|Hs3—5721[18555104]
[3468] 1333: XM—010943
[3469] Homo sapiens inositol 1,4,5-triphosphate receptor, type 1 (ITPR1), mRNA
[3470] gi|18554594|ref|XM—010943.7|[18554594]
[3471] 1334: XM—052730
[3472] Homo sapiens transferrin receptor (p90, CD71) (TFRC), mRNA
[3473] gi|18553906|ref|XM—052730.3|[18553906]
[3474] 1335: XM—032666
[3475] Homo sapiens calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism) (CASR), mRNA
[3476] gi|18553576|ref|XM—032666.3|[18553576]
[3477] 1336: XM—002686
[3478] Homo sapiens interleukin 1 receptor, type I (IL1R1), mRNA
[3479] gi|18553052|ref|XM—002686.6|[18553052]
[3480] 1337: XM—002596
[3481] Homo sapiens protein tyrosine phosphatase, receptor type, N (PTPRN), mRNA
[3482] gi|18552617|ref|XM—002596.6|[18552617]
[3483] 1338: XM—087110
[3484] Homo sapiens macrophage receptor with collagenous structure (MARCO), mRNA
[3485] gi|18552038|ref|XM—087110.1|[18552038]
[3486] 1340: XM—087047
[3487] Homo sapiens G protein-coupled receptor 66 (GPR66), mRNA
[3488] gi|18551251|ref|XM—087047.1|[18551251]
[3489] 1341: XM—086954
[3490] Homo sapiens G protein-coupled receptor 45 (GPR45), mRNA
[3491] gi|18549982|ref|XM—086954.1|[18549982]
[3492] 1342: XM—029434
[3493] Homo sapiens toll-like receptor 5 (TLR5), mRNA
[3494] gi|18549454|ref|XM—029434.2|[18549454]
[3495] 1344: XM—089355
[3496] Homo sapiens LDL receptor adaptor protein (ARH), mRNA
[3497] gi|18549097|ref|XM—089355.1|[18549097]
[3498] 1346: XM—086483
[3499] Homo sapiens Fc fragment of IgG, low affinity IIa, receptor for (CD32) (FCGR2A),
[3500] mRNA
[3501] gi|18548731|ref|XM—086483.1|[18548731]
[3502] 1347: XM—046751
[3503] Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF),
[3504] interacting protein (liprin), alpha 4 (PPFIA4), mRNA
[3505] gi|18548679|ref|XM—046751.3|[18548679]
[3506] 1348: XM—001821
[3507] Homo sapiens glutamate receptor, ionotropic, kainate 3 (GRIK3), mRNA
[3508] gi|18548332|ref|XM—001821.7|[18548332]
[3509] 1349: XM—002205
[3510] Homo sapiens colony stimulating factor 3 receptor (granulocyte) (CSF3R), mRNA
[3511] gi|18548330|ref|XM—002205.2|[18548330]
[3512] 1350: XM—033690
[3513] Homo sapiens protein tyrosine phosphatase, receptor type, U (PTPRU), mRNA
[3514] gi|18548204|ref|XM—033690.2|[18548204]
[3515] 1351: XM—001795
[3516] Homo sapiens lamin B receptor (LBR), mRNA
[3517] gi|18548051|ref|XM—001795.6|[18548051]
[3518] 1352: XM—058179
[3519] Homo sapiens natural killer cell receptor 2B4 (CD244), mRNA
[3520] gi|18547600|ref|XM—058179.3|[18547600]
[3521] 1353: XM—086356
[3522] Homo sapiens cannabinoid receptor 2 (macrophage) (CNR2), mRNA
[3523] gi|18547399|ref|XM—086356.1|[18547399]
[3524] 1354: XM—001499
[3525] Homo sapiens endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 (EDG1), mRNA
[3526] gi|18547249|ref|XM—001499.1|[18547249]
[3527] 1355: NT—031737
[3528] Homo sapiens chromosome 1 working draft sequence segment
[3529] gi|18547126|ref|NT—031737.1|Hs1—31908[18547126]
[3530] 1356: XM—010608
[3531] Homo sapiens G-protein coupled receptor 88 (GPR88), mRNA
[3532] gi|18547116|ref|XM—010608.6|[18547116]
[3533] 1357: XM—089029
[3534] Homo sapiens olfactory receptor, family 2, subfamily L, member 2 (OR2L2), mRNA
[3535] gi|18547000|ref|XM—089029.1|[18547000]
[3536] 1358: XM—089028
[3537] Homo sapiens olfactory receptor, family 2, subfamily L, member 1 (OR2L1), mRNA
[3538] gi|18546996|ref|XM—089028.1|[18546996]
[3539] 1359: XM—089016
[3540] Homo sapiens olfactory receptor, family 1, subfamily C, member 1 (OR1C1), mRNA
[3541] gi|18546895|ref|XM—089016.1|[18546895]
[3542] 1360: XM—001289
[3543] Homo sapiens xenotropic and polytropic retrovirus receptor (XPR1), mRNA
[3544] gi|18546688|ref|XM—001289.7|[18546688]
[3545] 1361: XM—049849
[3546] Homo sapiens tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) (TNFRSF14), mRNA
[3547] gi|18546661|ref|XM—049849.3|[18546661]
[3548] 1362: XM—001667
[3549] Homo sapiens natural killer cell receptor, immunoglobulin superfamily member (BY55), mRNA
[3550] gi|18546631|ref|XM—001667.5|[18546631]
[3551] 1364: XM—086285
[3552] Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 6 (LGR6),
[3553] mRNA
[3554] gi|18546477|ref|XM—086285.1|[18546477]
[3555] 1365: XM—016748
[3556] Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), mRNA
[3557] gi|18546353|ref|XM—016748.4|[18546353]
[3558] 1366: XM—088942
[3559] Homo sapiens olfactory receptor, family 2, subfamily M, member 4 (OR2M4), mRNA
[3560] gi|18546222|ref|XM—088942.1|[18546222]
[3561] 1367: XM—086242
[3562] Homo sapiens receptor tyrosine kinase-like orphan receptor 1 (ROR1), mRNA
[3563] gi|18546174|ref|XM—086242.1|[18546174]
[3564] 1368: XM—086232
[3565] Homo sapiens G protein-coupled receptor 61 (GPR61), mRNA
[3566] gi|18546070|ref|XM—086232.1|[18546070]
[3567] 1369: XM—042739
[3568] Homo sapiens cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog,
[3569] Drosophila) (CELSR2), mRNA
[3570] gi|18546045|ref|XM—042739.2|[18546045]
[3571] 1370: XM—002008
[3572] Homo sapiens complement component (3d/Epstein Barr virus) receptor 2 (CR2), mRNA
[3573] gi|18545768|ref|XM—002008.6|[18545768]
[3574] 1371: XM—052013
[3575] Homo sapiens polymeric immunoglobulin receptor (PIGR), mRNA
[3576] gi|18545758|ref|XM—052013.2|[18545758]
[3577] 1372: XM—001320
[3578] Homo sapiens low density lipoprotein receptor defect C complementing (LDLC), mRNA
[3579] gi|18545223|ref|XM—001320.4|[18545223]
[3580] 1373: NT—030585
[3581] Homo sapiens chromosome 1 working draft sequence segment
[3582] gi|18544898|ref|NT—030585.2|Hs1—30841[18544898]
[3583] 1374: XM—084053
[3584] Homo sapiens complement component (3b/4b) receptor 1, including Knops blood group system (CR1), mRNA
[3585] gi|18544845|ref|XM—084053.1|[18544845]
[3586] 1376: XM—039685
[3587] Homo sapiens putative G-protein coupled receptor (SH120), mRNA
[3588] gi|17488963|ref|XM—039685.3|[17488963]
[3589] 1377: XM—001687
[3590] Homo sapiens adenosine A1 receptor (ADORA1), mRNA
[3591] gi|17488879|ref|XM—001687.5|[17488879]
[3592] 1378: XM—002700
[3593] Homo sapiens cytochrome c oxidase subunit VIIa polypeptide 2 like (COX7A2L), mRNA
[3594] gi|17462137|ref|XM—002700.3|[17462137]
[3595] 1379: XM—002673
[3596] Homo sapiens calcitonin receptor-like (CALCRL), mRNA
[3597] gi|17447546|ref|XM—002673.5|[17447546]
[3598] 1380: XM—001924
[3599] Homo sapiens transforming growth factor, beta receptor III (betaglycan, 300 kD)
[3600] (TGFBR3), mRNA
[3601] gi|17446897|ref|XM—001924.6|[17446897]
[3602] 1381: XM—001744
[3603] Homo sapiens tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), mRNA
[3604] gi|17444362|ref|XM—001744.6|[17444362]
[3605] 1382: XM—054837
[3606] Homo sapiens tumor necrosis factor receptor superfamily, member 1B, (TNFRSF1B),
[3607] mRNA
[3608] gi|17444359|ref|XM—054837.2|[17444359]
[3609] 1383: XM—037011
[3610] Homo sapiens T-cell receptor interacting molecule (TRIM), mRNA
[3611] gi|17438759|ref|XM—037011.2|[17438759]
[3612] 1384: NT—022773
[3613] Homo sapiens chromosome 4 working draft sequence segment
[3614] gi|17438611|ref|NT—022773.6|Hs4—22929[17438611]
[3615] 1385: XM—051522
[3616] Homo sapiens G protein-coupled receptor (RDC1), mRNA
[3617] gi|17437231|ref|XM—051522.2|[17437231]
[3618] 1386: NT—029249
[3619] Homo sapiens chromosome 2 working draft sequence segment
[3620] gi|17436701|ref|NT—029249.2|Hs2—29408[17436701]
[3621] 1387: XM—050043
[3622] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 4 (GABRA4), mRNA
[3623] gi|17436698|ref|XM—050043.2|[17436698]
[3624] 1388: XM—001857
[3625] Homo sapiens platelet-activating factor receptor (PTAFR), mRNA
[3626] gi|17435918|ref|XM—001857.3|[17435918]
[3627] 1389: XM—001630
[3628] Homo sapiens prostaglandin F receptor (FP) (PTGFR), mRNA
[3629] gi|17434349|ref|XM—001630.5|[17434349]
[3630] 1390: XM—058183
[3631] Homo sapiens activating NK receptor (KALI), mRNA
[3632] gi|16165765|ref|XM—058183.1|[16165765]
[3633] 1391: XM—003177
[3634] Homo sapiens oxytocin receptor (OXTR), mRNA
[3635] gi|16164840|ref|XM—003177.5|[16164840]
[3636] 1392: XM—001778
[3637] Homo sapiens ryanodine receptor 2 (cardiac) (RYR2), mRNA
[3638] gi|16161568|ref|XM—001778.6|[16161568]
[3639] 1393: XM—039118
[3640] Homo sapiens phospholipase A2 receptor 1, 180 kD (PLA2R1), mRNA
[3641] gi|16160858|ref|XM—039118.2|[16160858]
[3642] 1394: NT—005791
[3643] Homo sapiens chromosome 3 working draft sequence segment
[3644] gi|16159942|ref|NT—005791.5|Hs3—5948[16159942]
[3645] 1395: NT—029941
[3646] Homo sapiens chromosome 3 working draft sequence segment
[3647] gi|16158541|ref|NT—029941.1|Hs3—30196[16158541]
[3648] 1396: XM—056760
[3649] Homo sapiens tumor necrosis factor receptor superfamily, member 9 (TNFRSF9), mRNA
[3650] gi|16158007|ref|XM—056760.1|[16158007]
[3651] 1397: XM—010871
[3652] Homo sapiens adrenergic, alpha-2B-, receptor (ADRA2B), mRNA
[3653] gi|16157882|ref|XM—010871.5|[16157882]
[3654] 1398: XM—055737
[3655] Homo sapiens interleukin 6 receptor (IL6R), mRNA
[3656] gi|16157271|ref|XM—055737.1|[16157271]
[3657] 1399: XM—043563
[3658] Homo sapiens insulin receptor-related receptor (INSRR), mRNA
[3659] gi|15299156|ref|XM—043563.2|[15299156]
[3660] 1400: XM—001466
[3661] Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), mRNA
[3662] gi|15299050|ref|XM—001466.5|[15299050]
[3663] 1401: XM—002888
[3664] Homo sapiens activin A receptor, type IIB (ACVR2B), mRNA
[3665] gi|15298060|ref|XM—002888.3|[15298060]
[3666] 1402: XM—049427
[3667] Homo sapiens interleukin 5 receptor, alpha (IL5RA), mRNA
[3668] gi|15297287|ref|XM—049427.2|[15297287]
[3669] 1404: XM—047502
[3670] Homo sapiens chemokine (C-X3-C) receptor 1 (CX3CR1), mRNA
[3671] gi|15295593|ref|XM—047502.2|[15295593]
[3672] 1405: XM—041048
[3673] Homo sapiens chemokine (C-C motif) receptor 8 (CCR8), mRNA
[3674] gi|15295589|ref|XM—041048.2|[15295589]
[3675] 1406: XM—052155
[3676] Homo sapiens adenosine A3 receptor (ADORA3), mRNA
[3677] gi|14739381|ref|XM—052155.1|[14739381]
[3678] 1407: XM—002926
[3679] Homo sapiens chemokine (C-C motif) receptor-like 2 (CCRL2), mRNA
[3680] gi|14736663|ref|XM—002926.3|[14736663]
[3681] 1408: XM—030397
[3682] Homo sapiens chemokine (C-C motif) receptor 5 (CCR5), mRNA
[3683] gi|14736645|ref|XM—030397.1|[14736645]
[3684] 1409: XM—040605
[3685] Homo sapiens interleukin 17B receptor (IL17BR), mRNA
[3686] gi|14735848|ref|XM—040605.1|[14735848]
[3687] 1410: XM—033199
[3688] Homo sapiens growth hormone secretagogue receptor (GHSR), mRNA
[3689] gi|14735283|ref|XM—003199.4|[14735283]
[3690] 1411: XM—041399
[3691] Homo sapiens glutamate receptor, metabotropic 7 (GRM7), mRNA
[3692] gi|14734683|ref|XM—041399.1|[14734683]
[3693] 1412: XM—039011
[3694] Homo sapiens integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) (ITGA4), mRNA
[3695] gi|14733147|ref|XM—039011.1|[14733147]
[3696] 1413: XM—033709
[3697] Homo sapiens opioid receptor, delta 1 (OPRD1), mRNA
[3698] gi|14732044|ref|XM—033709.1|[14732044]
[3699] 1414: XM—033469
[3700] Homo sapiens transforming growth factor, beta receptor II (70-80 kD) (TGFBR2), mRNA
[3701] gi|14732004|ref|XM—033469.1|[14732004]
[3702] 1415: XM—017782
[3703] Homo sapiens ectodysplasin 1, anhidrotic receptor (EDAR), mRNA
[3704] gi|14731094|ref|XM—017782.2|[14731094]
[3705] 1416: XM—002475
[3706] Homo sapiens insulin receptor substrate 1 (IRS1), mRNA
[3707] gi|14730385|ref|XM—002475.4|[14730385]
[3708] 1417: XM—051470
[3709] Homo sapiens angiotensin receptor 1 (AGTR1), mRNA
[3710] gi|14729512|ref|XM—051470.1|[14729512]
[3711] 1418: XM—001542
[3712] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1D (HTR1D), mRNA
[3713] gi|14726872|ref|XM—001542.4|[14726872]
[3714] 1419: XM—052382
[3715] Homo sapiens histamine receptor H1 (HRH1), mRNA
[3716] gi|14726259|ref|XM—052382.1|[14726259]
[3717] 1420: XM—032349
[3718] Homo sapiens interleukin 22 receptor (IL22R), mRNA
[3719] gi|14725224|ref|XM—032349.1|[14725224]
[3720] 1421: XM—002792
[3721] Homo sapiens APMCF1 protein (APMCF1), mRNA
[3722] gi|14720925|ref|XM—002792.4|[14720925]
[3723] 1422: XM—045070
[3724] Homo sapiens immunoglobulin superfamily receptor translocation associated 2 (IRTA2), mRNA
[3725] gi|14720460|ref|XM—045070.1|[14720460]
[3726] 1423: XM—045067
[3727] Homo sapiens immunoglobulin superfamily receptor translocation associated 1 (IRTA1), mRNA
[3728] gi|14720452|ref|XM—045067.1|[14720452]
[3729] 1425: XM—002685
[3730] Homo sapiens interleukin 1 receptor-like 2 (IL1RL2), mRNA
[3731] gi|12728885|ref|XM—002685.2|[12728885]
[3732] 1426: XM—002624
[3733] Homo sapiens G protein-coupled receptor 75 (GPR75), mRNA
[3734] gi|11430331|ref|XM—002624.1|[11430331]
[3735] 1427: XM—001907
[3736] Homo sapiens G protein-coupled receptor 25 (GPR25), mRNA
[3737] gi|11425714|ref|XM—001907.1|[11425714]
[3738] 1428: XM—001543
[3739] Homo sapiens G protein-coupled receptor 52 (GPR52), mRNA
[3740] gi|11423045|ref|XM—001543.1|[11423045]
[3741] 1429: NM—016113
[3742] Homo sapiens transient receptor potential cation channel, subfamily V, member 2
[3743] (TRPV2), mRNA
[3744] gi|7706766|ref|NM—016113.1|[7706766]
[3745] 1430: NM—002837
[3746] Homo sapiens protein tyrosine phosphatase, receptor type, B (PTPRB), mRNA
[3747] gi|18491009|ref|NM—002837.2|[18491009]
[3748] 1431: NM—017625
[3749] Homo sapiens intelectin (ITLN), mRNA
[3750] gi|8923027|ref|NM—017625.1|[8923027]
[3751] 1432: NM—000651
[3752] Homo sapiens complement component (3b/4b) receptor 1, including Knops blood group system (CR1), transcript variant S, mRNA
[3753] gi|18490997|ref|NM—000651.2|[18490997]
[3754] 1433: NM—000573
[3755] Homo sapiens complement component (3b/4b) receptor 1, including Knops blood group system (CR1), transcript variant F, mRNA
[3756] gi|18490996|ref|NM—000573.2|[18490996]
[3757] 1435: BC022501
[3758] Homo sapiens, neurotensin receptor 2, clone MGC:26447 IMAGE:4792730, mRNA, complete cds
[3759] gi|18490911|gb|BC022501.1)[18490911]
[3760] 1436: BC022447
[3761] Homo sapiens, angiotensin receptor 1, clone MGC:25987 IMAGE:4799755, mRNA, complete cds
[3762] gi|18490885|gb|BC022447.1|[18490885]
[3763] 1437: BC022317
[3764] Homo sapiens, T cell receptor delta diversity 3, clone MGC:22624 IMAGE:4732634, mRNA, complete cds
[3765] gi|18490613|gb|BC022317.1|[18490613]
[3766] 1438: BC022304
[3767] Homo sapiens, receptor (calcitonin) activity modifying protein 3, clone MGC:22548 IMAGE:4717934, mRNA, complete cds
[3768] gi|18490610|gb|BC022304.1|[18490610]
[3769] 1439: BC022496
[3770] Homo sapiens, glutamate receptor, metabotropic 3, clone MGC:26392 IMAGE:4792430,
[3771] mRNA, complete cds
[3772] gi|18490393|gb|BC022496.1|[18490393]
[3773] 1440: BC022511
[3774] Homo sapiens, endothelin receptor type A, clone MGC:26548 IMAGE:4812050, mRNA,
[3775] complete cds
[3776] gi|18490297|gb|BC022511.1|[18490297]
[3777] 1441: BC022502
[3778] Homo sapiens, glycine receptor, beta, clone IMAGE:4792516, mRNA
[3779] gi|18490294|gb|BC022502.1|[18490294]
[3780] 1442: BC022449
[3781] Homo sapiens, gamma-aminobutyric acid (GABA) A receptor, beta 1, clone MGC:25991
[3782] IMAGE:4797401, mRNA, complete cds
[3783] gi|18490266|gb|BC022449.1|[18490266]
[3784] 1443: BC022295
[3785] Homo sapiens, oxidised low density lipoprotein (lectin-like) receptor 1, clone
[3786] MGC:22491 IMAGE:4722086, mRNA, complete cds
[3787] gi|18490152|gb|BC022295.1|[18490152]
[3788] 1444: BC022279
[3789] Homo sapiens, CMRF35 leukocyte immunoglobulin-like receptor, clone MGC:22395 IMAGE:4692025, mRNA, complete cds
[3790] gi|18490142|gb|BC022279.1|[18490142]
[3791] 1448: AH011463
[3792] Homo sapiens chromosome 7 map 7q22
[3793] gi|18483169|gb|AH011463.1|SEG_AF461188S[18483169]
[3794] 1449: AF453828
[3795] Homo sapiens G protein-coupled receptor affecting testicular descent (GREAT) mRNA, complete cds
[3796] gi|18483167|gb|AF453828.1|[18483167]
[3797] 1450: AY072912
[3798] Homo sapiens coxsackie-adenovirus-receptor isoform CAR4/7 (CXADR) mRNA, complete
[3799] cds; alternatively spliced
[3800] gi|18482481|gb|AY072912.1|[18482481]
[3801] 1451: AY072911
[3802] Homo sapiens coxsackie-adenovirus-receptor isoform CAR3/7 (CXADR) mRNA, complete
[3803] cds; alternatively spliced
[3804] gi|18482479|gb|AY072911.1|[18482479]
[3805] 1452: AY072910
[3806] Homo sapiens soluble coxsackie-adenovirus-receptor isoform CAR2/7 (CXADR) mRNA,
[3807] complete cds; alternatively spliced
[3808] gi|18482477|gb|AY072910.1|[18482477]
[3809] 1453: NM—020399
[3810] Homo sapiens PDZ/coiled-coil domain binding partner for the rho-family GTPase TC10 (PIST), mRNA
[3811] gi|9966876|ref|NM—020399.1|[9966876]
[3812] 1454: NM—017935
[3813] Homo sapiens hypothetical protein FLJ20706 (BANK), mRNA
[3814] gi|8923635|ref|NM—017935.1|[8923635]
[3815] 1455: NM—002438
[3816] Homo sapiens mannose receptor, C type 1 (MRC1), mRNA
[3817] gi|4505244|ref|NM—002438.1|[4505244]
[3818] 1456: AF321913
[3819] Homo sapiens histamine H3 receptor isoform 4 (HRH3) mRNA, complete cds, alternatively spliced
[3820] gi|18461386|gb|AF321913.1|[18461386]
[3821] 1457: AF321912
[3822] Homo sapiens histamine H3 receptor isoform 3 (HRH3) mRNA, complete cds, alternatively spliced
[3823] gi|18461384|gb|AF321912.1|[18461384]
[3824] 1458: AF321911
[3825] Homo sapiens histamine H3 receptor isoform 2 (HRH3) mRNA, complete cds, alternatively spliced
[3826] gi|18461382|gb|AF321911.1|[18461382]
[3827] 1459: AF321910
[3828] Homo sapiens histamine H3 receptor isoform 1 (HRH3) mRNA, complete cds, alternatively spliced
[3829] gi|18461380|gb|AF321910.1|[18461380]
[3830] 1460: NM—080841
[3831] Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript
[3832] variant 3, mRNA
[3833] gi|18450370|ref|NM—080841.1|[18450370]
[3834] 1461: NM—080840
[3835] Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript
[3836] variant 2, mRNA
[3837] gi|18450368|ref|NM—080840.1|[18450368]
[3838] 1462: NM—002836
[3839] Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript
[3840] variant 1, mRNA
[3841] gi|18450367|ref|NM—002836.2|[18450367]
[3842] 1463: NM—023915
[3843] Homo sapiens G protein-coupled receptor 87 (GPR87), mRNA
[3844] gi|13236505|ref|NM—023915.1|[13236505]
[3845] 1464: NM—003029
[3846] Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), mRNA
[3847] gi|10835030|ref|NM—003029.1|[10835030]
[3848] 1465: NM—018490
[3849] Homo sapiens G protein-coupled receptor 48 (GPR48), mRNA
[3850] gi|8923700|ref|NM—018490.1|[8923700]
[3851] 1466: NM—006065
[3852] Homo sapiens signal-regulatory protein beta 1 (SIRPB1), mRNA
[3853] gi|5174678|ref|NM—006065.1|[5174678]
[3854] 1467: NM—003667
[3855] Homo sapiens G protein-coupled receptor 49 (GPR49), mRNA
[3856] gi|4504378|ref|NM—003667.1|[4504378]
[3857] 1468: NM—080816
[3858] Homo sapiens signal-regulatory protein beta 2 (SIRPB2), transcript variant 2, mRNA
[3859] gi|18426908|ref|NM—080816.1|[18426908]
[3860] 1469: NM—018556
[3861] Homo sapiens signal-regulatory protein beta 2 (SIRPB2), transcript variant 1, mRNA
[3862] gi|18426907|ref|NM—018556.2|[18426907]
[3863] 1470: NM—080914
[3864] Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant 3, mRNA
[3865] gi|18426876|ref|NM—080914.1|[18426876]
[3866] 1471: NM—080913
[3867] Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant 2, mRNA
[3868] gi|18426874|ref|NM—080913.1|[18426874]
[3869] 1472: NM—080912
[3870] Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant H2′, mRNA
[3871] gi|18426872|ref|NM—080912.1|[18426872]
[3872] 1473: NM—001181
[3873] Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant 1, mRNA
[3874] gi|18426871|ref|NM—001181.2|[18426871]
[3875] 1474: NM—001671
[3876] Homo sapiens asialoglycoprotein receptor 1 (ASGR1), mRNA
[3877] gi|18426870|ref|NM—001671.2|[18426870]
[3878] 1475: NM—014978
[3879] Homo sapiens VPS10 domain receptor protein SORCS 3 (SORCS3), mRNA
[3880] gi|18379345|ref|NM—014978.1|[18379345]
[3881] 1476: NM—021625
[3882] Homo sapiens transient receptor potential cation channel, subfamily V, member 4
[3883] (TRPV4), mRNA
[3884] gi|13699862|ref|NM—021625.2|[13699862]
[3885] 1477: NM—020960
[3886] Homo sapiens G protein-coupled receptor 107 (GPR107), mRNA
[3887] gi|13470087|ref|NM—020960.1|[13470087]
[3888] 1478: NM—021634
[3889] Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 7 (LGR7),
[3890] mRNA
[3891] gi|11056007|ref|NM—021634.1|[11056007]
[3892] 1479: NM—016179
[3893] Homo sapiens transient receptor potential cation channel, subfamily C, member 4
[3894] (TRPC4), mRNA
[3895] gi|7706746|ref|NM—016179.1|[7706746]
[3896] 1480: NM—004621
[3897] Homo sapiens transient receptor potential cation channel, subfamily C, member 6
[3898] (TRPC6), mRNA
[3899] gi|5730101|ref|NM—004621.21[5730101]
[3900] 1481: NM—003304
[3901] Homo sapiens transient receptor potential cation channel, subfamily C, member 1
[3902] (TRPC1), mRNA
[3903] gi|4507684|ref|NM—003304.1|[4507684]
[3904] 1485: NM—016235
[3905] Homo sapiens G protein-coupled receptor, family C, group 1, member B (GPRC5B),
[3906] mRNA
[3907] gi|7706450|ref|NM—016235.1|[7706450]
[3908] 1487: AF024642
[3909] Homo sapiens luteinizing hormone receptor gene, exon 1 and partial cds
[3910] gi|2655113|gb|AF024642.1|AF024642[2655113]
[3911] 1488: NM—007128
[3912] Homo sapiens pre-B lymphocyte gene 1 (VPREB1), mRNA
[3913] gi|18379350|ref|NM—007128.2|[18379350]
[3914] 1489: NM—020777
[3915] Homo sapiens VPS10 domain receptor protein (SORCS2), mRNA
[3916] gi|18379343|ref|NM—020777.1|[18379343]
[3917] 1490: NM—052918
[3918] Homo sapiens VPS10 domain receptor protein SORCS 1 (SORCS1), mRNA
[3919] gi|8379341|ref|NM—052918.2|[18379341]
[3920] 1491: AF391164
[3921] Homo sapiens osteoclast-associated receptor hOSCAR-M3 (OSCAR) mRNA, complete cds
[3922] gi|18376830|gb|AF391164.1|AF391164[18376830]
[3923] 1492: AF391163
[3924] Homo sapiens osteoclast-associated receptor hOSCAR-M2 (OSCAR) mRNA, complete cds
[3925] gi|18376828|gb|AF391163.1|AF391163[18376828]
[3926] 1493: AF391162
[3927] Homo sapiens osteoclast-associated receptor hOSCAR-M1 (OSCAR) mRNA, complete cds
[3928] gi|18376826|gb|AF391162.1|AF391162[18376826]
[3929] 1494: AJ421783
[3930] Homo sapiens mRNA for short transient receptor potential channel 7 (TRP7 gene)
[3931] gi|18376628|emb|AJ421783.1|HSA421783[18376628]
[3932] 1497: AF410902
[3933] Homo sapiens neurotrophin receptor tyrosine kinase type 2 (NTRK2) gene, promoter
[3934] region and partial cds; alternatively spliced
[3935] gi|18369868|gb|AF410902.1|AF410902[18369868]
[3936] 1498: AF410901
[3937] Homo sapiens neurotrophin receptor tyrosine kinase type 2 truncated isoform (NTRK2) mRNA, complete cds; alternatively spliced
[3938] gi|18369866|gb|AF410901.1|AF410901[18369866]
[3939] 1499: AF410900
[3940] Homo sapiens neurotrophin receptor tyrosine kinase type 2 truncated isoform (NTRK2) mRNA, complete cds; alternatively spliced
[3941] gi|18369864|gb|AF410900.1|AF410900[18369864]
[3942] 1500: AF410899
[3943] Homo sapiens neurotrophin receptor tyrosine kinase type 2 (NTRK2) mRNA, complete
[3944] cds; alternatively spliced
[3945] gi|18369862|gb|AF410899.1|AF410899[18369862]
[3946] 1501: AF410898
[3947] Homo sapiens clone DKFZp547L014 neurotrophin receptor tyrosine kinase type 2 truncated isoform (NTRK2) mRNA, partial cds; alternatively spliced
[3948] gi|18369860|gb|AF410898.1|AF410898[18369860]
[3949] 1502: AY071830
[3950] Homo sapiens interleukin 9 receptor (IL9R) gene, complete cds
[3951] gi|18071671|gb|AY071830.1|[18071671]
[3952] 1503: AF421362
[3953] Homo sapiens transient receptor potential channel 4 zeta splice variant (TRPC4)
[3954] mRNA, complete cds; alternatively spliced
[3955] gi|16517177|gb|AF421362.1|AF421362[16517177]
[3956] 1504: AF421361
[3957] Homo sapiens transient receptor potential channel 4 eta splice variant (TRPC4)
[3958] mRNA, complete cds; alternatively spliced
[3959] gi|16517175|gb|AF421361.1|AF421361[16517175]
[3960] 1505: AF421360
[3961] Homo sapiens transient receptor potential channel 4 epsilon splice variant (TRPC4) mRNA, complete cds; alternatively spliced
[3962] gi|16517173|gb|AF421360.1|AF421360[16517173]
[3963] 1506: AF421359
[3964] Homo sapiens transient receptor potential channel 4 beta splice variant (TRPC4)
[3965] mRNA, complete cds; alternatively spliced
[3966] gi|16517171|gb|AF421359.1|AF421359[16517171]
[3967] 1507: AF421358
[3968] Homo sapiens transient receptor potential channel 4 alpha splice variant (TRPC4)
[3969] mRNA, complete cds; alternatively spliced
[3970] gi|16517169|gb|AF421358.1|AF421358[16517169]
[3971] 1508: AF359246
[3972] Homo sapiens fibroblast growth factor receptor 4 variant mRNA, complete cds
[3973] gi|13991617|gb|AF359246.1|AF359246[13991617]
[3974] 1509: NM—022349
[3975] Homo sapiens membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), mRNA
[3976] gi|11641258|ref|NM—022349.1|[11641258]
[3977] 1510: NM—006055
[3978] Homo sapiens LanC lantibiotic synthetase component C-like 1 (bacterial) (LANCL1), mRNA
[3979] gi|5174444|ref|NM—006055.1|[5174444]
[3980] 1511: NM—005716
[3981] Homo sapiens regulator of G-protein signalling 19 interacting protein 1 (RGS19IP1), mRNA
[3982] gi|5031714|ref|NM—005716.1|[5031714]
[3983] 1512: NM—003307
[3984] Homo sapiens transient receptor potential cation channel, subfamily M, member 2
[3985] (TRPM2), mRNA
[3986] gi|4507688|ref|NM—003307.1|[4507688]
[3987] 1513: NM—003807
[3988] Homo sapiens tumor necrosis factor (ligand) superfamily, member 14 (TNFSF14), mRNA
[3989] gi|4507600|ref|NM—003807.1|[4507600]
[3990] 1514: NM—002984
[3991] Homo sapiens small inducible cytokine A4 (SCYA4), mRNA
[3992] gi|4506844|ref|NM—002984.1|[4506844]
[3993] 1515: NM—021181
[3994] Homo sapiens 19A24 protein (CRACC), mRNA
[3995] gi|12711663|ref|NM—021181.2|[12711663]
[3996] 1516: BC021892
[3997] Homo sapiens, CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II), clone MGC:9392 IMAGE:3872778, mRNA, complete cds
[3998] gi|18257311|gb|BC021892.1|BC021892[18257311]
[3999] 1517: AF459285
[4000] Homo sapiens 5-hydroxytryptamine receptor 3 subunit C (HTR3C) mRNA, complete cds
[4001] gi|18251965|gb|AF459285.1|AF459285[18251965]
[4002] 1518: BC021553
[4003] Homo sapiens, G protein coupled receptor interacting protein, complement-c1q tumor necrosis factor-related, clone MGC:31795 IMAGE:4622952, mRNA, complete cds
[4004] gi|18204860|gb|BC021553.1|BC021553[18204860]
[4005] 1519: BC021195
[4006] Homo sapiens, dopamine receptor D2, clone MGC:10521 IMAGE:3939741, mRNA, complete cds
[4007] gi|18203702|gb|BC021195.1|BC021195[18203702]
[4008] 1520: BC020752
[4009] Homo sapiens, Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor), clone MGC:22599 IMAGE:4722289, mRNA, complete cds
[4010] gi|18089130|gb|BC020752.1|BC020752[18089130]
[4011] 1521: BC020614
[4012] Homo sapiens, G protein-coupled receptor 84, clone MGC:22224 IMAGE:4279185, mRNA, complete cds
[4013] gi|18089044|gb|BC020614.1|BC020614[18089044]
[4014] 1522: BC021104
[4015] Homo sapiens, apelin; peptide ligand for APJ receptor, clone MGC:31846 IMAGE:4586949, mRNA, complete cds
[4016] gi|18088893|gb|BC021104.1|BC021104[18088893]
[4017] 1523: BC020805
[4018] Homo sapiens, leukocyte receptor cluster (LRC) member 5, clone MGC:23828 IMAGE:4277870, mRNA, complete cds
[4019] gi|18088780|gb|BC020805.1|BC020805[18088780]
[4020] 1524: BC020742
[4021] Homo sapiens, complement component 3a receptor 1, clone MGC:22570 IMAGE:4690283,
[4022] mRNA, complete cds
[4023] gi|18088764|gb|BC020742.1|BC020742[18088764]
[4024] 1525: BC020815
[4025] Homo sapiens, putative receptor protein, clone MGC:23860 IMAGE:4296149, mRNA, complete cds
[4026] gi|18088747|gb|BC020815.1|BC020815[18088747]
[4027] 1526: BC020768
[4028] Homo sapiens, olfactory receptor, family 51, subfamily E, member 2, clone MGC:22638 IMAGE:4249775, mRNA, complete cds
[4029] gi|18088468|gb|BC020768.1|BC020768[18088468]
[4030] 1527: BC020739
[4031] Homo sapiens, interleukin 13 receptor, alpha 2, clone MGC:22566 IMAGE:4807603,
[4032] mRNA, complete cds
[4033] gi|18088440|gb|BC020739.1|BC020739[18088440]
[4034] 1528: BC020678
[4035] Homo sapiens, G protein-coupled receptor 34, clone MGC:22389 IMAGE:4770479, mRNA, complete cds
[4036] gi|18088371|gb|BC020678.1|BC020678[18088371]
[4037] 1529: BC020669
[4038] Homo sapiens, advanced glycosylation end product-specific receptor, clone MGC:22357 IMAGE:4718076, mRNA, complete cds
[4039] gi|18088362|gb|BC020669.1|BC020669[18088362]
[4040] 1530: BC020968
[4041] Homo sapiens, chemokine (C-X-C motif), receptor 4 (fusin), clone MGC:9199 IMAGE:3846345, mRNA, complete cds
[4042] gi|18088082|gb|BC020968.1|BC020968[18088082]
[4043] 1531: BC019610
[4044] Homo sapiens, somatostatin receptor 2, clone MGC:24950 IMAGE:3875163, mRNA, complete cds
[4045] gi|18043108|gb|BC019610.1|BC019610[18043108]
[4046] 1532: BC020079
[4047] Homo sapiens, lamin B receptor, clone MGC:9041 IMAGE:3925138, mRNA, complete cds
[4048] gi|18042833|gb|BC020079.1|BC020079[18042833]
[4049] 1715: NM—001364
[4050] Homo sapiens discs, large homolog 2, chapsyn-110 (Drosophila) (DLG2), mRNA
[4051] gi|4557526|ref|NM—001364.1|[4557526]
[4052] 1716: NM—080744
[4053] Homo sapiens scavenger receptor cysteine rich domain containing, group B (4 domains) (SRCRB4D), mRNA
[4054] gi|18152778|ref|NM—080744.1|[18152778]
[4055] 1717: AB063170
[4056] Homo sapiens mRNA for BANK, complete cds
[4057] gi|17646091|dbj|AB063170.1|AB063170[17646091]
[4058] 1718: NM—022760
[4059] Homo sapiens chromosome 20 open reading frame 81 (C20orf81), mRNA
[4060] gi|16163672|ref|NM—022760.2|[16163672]
[4061] 1719: NM—032554
[4062] Homo sapiens G protein-coupled receptor 81 (GPR81), mRNA
[4063] gi|14211850|ref|NM—032554.1|[14211850]
[4064] 1720: AB054004
[4065] Homo sapiens DR5 gene for death receptor 5, promoter and partial cds
[4066] gi|13429873|dbj|AB054004.1|AB054004[13429873]
[4067] 1721: NM—000668
[4068] Homo sapiens alcohol dehydrogenase IB (class I), beta polypeptide (ADH1B), mRNA
[4069] gi|11496887|ref|NM—000668.2|[11496887]
[4070] 1722: NM—018697
[4071] Homo sapiens LanC lantibiotic synthetase component C-like 2 (bacterial) (LANCL2), mRNA
[4072] gi|8923910|ref|NM—018697.1|[8923910]
[4073] 1723: NM—016610
[4074] Homo sapiens toll-like receptor 8 (TLR8), mRNA
[4075] gi|7706147|ref|NM—016610.1|[7706147]
[4076] 1725: NM—015833
[4077] Homo sapiens adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) (ADARB1),
[4078] transcript variant DRABA2b, mRNA
[4079] gi|7669476|ref|NM—015833.1|[7669476]
[4080] 1727: NM—007184
[4081] Homo sapiens nischarin (NISCH), mRNA
[4082] gi|6005787|ref|NM—007184.1|[6005787]
[4083] 1728: NM—000139
[4084] Homo sapiens membrane-spanning 4-domains, subfamily A, member 1 (MS4A2), mRNA
[4085] gi|4503676|ref|NM—000139.1|[4503676]
[4086] 1730: NM—080681
[4087] Homo sapiens collagen, type XI, alpha 2 (COL11A2), transcript variant 2, mRNA
[4088] gi|18201918|ref|NM—080681.1|[18201918]
[4089] 1731: NM—080680
[4090] Homo sapiens collagen, type XI, alpha 2 (COL11A2), transcript variant 1, mRNA
[4091] gi|18201916|ref|NM—080680.1|[18201916]
[4092] 1732: NM—080679
[4093] Homo sapiens collagen, type XI, alpha 2 (COL11A2), transcript variant 3, mRNA
[4094] gi|18201914|ref|NM—080679.1|[18201914]
[4095] 1733: NM—006115
[4096] Homo sapiens preferentially expressed antigen in melanoma (PRAME), mRNA
[4097] gi|18201906|ref|NM—006115.2|[18201906]
[4098] 1734: NM—020526
[4099] Homo sapiens EphA8 (EPHA8), mRNA
[4100] gi|18201903|ref|NM—020526.2|[18201903]
[4101] 1735: NM—080818
[4102] Homo sapiens G protein-coupled receptor 80 (GPR80), mRNA
[4103] gi|18201871|ref|NM—080818.1[18201871]
[4104] 1736: NM—080817
[4105] Homo sapiens G protein-coupled receptor 82 (GPR82), mRNA
[4106] gi|18201869|ref|NM—080817.1|[18201869]
[4107] 1737: AF400075
[4108] Homo sapiens coagulation factor II (thrombin) receptor-like 1 (F2RL1) gene, complete cds
[4109] gi|15021772|gb|AF400075.1|AF400075[15021772]
[4110] 1738: NM—024021
[4111] Homo sapiens membrane-spanning 4-domains, subfamily A, member 4 (MS4A4A), mRNA
[4112] gi|13430865|ref|NM—024021.1|[13430865]
[4113] 1739: A1B066218
[4114] Homo sapiens RYR1 gene for ryanodine receptor type1, partial cds, clone: 4-101
[4115] gi|18181961|dbj|AB066218.1|AB066218[18181961]
[4116] 1740: AB066217
[4117] Homo sapiens RYR1 gene for ryanodine receptor type1, partial cds, clone: 4-96
[4118] gi|18181959|dbj|AB066217.1|AB066217[18181959]
[4119] 1741: NM—021950
[4120] Homo sapiens membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of
[4121] IgE, high affinity I, receptor for; beta polypeptide) (MS4A1), mRNA
[4122] gi|11386186|ref|NM—021950.1|[11386186]
[4123] 1742: NM—012323
[4124] Homo sapiens v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), mRNA
[4125] gi|6912489|ref|NM—012323.1|[6912489]
[4126] 1743: AJ298292
[4127] Homo sapiens mRNA for histamine receptor H4 (HRH4 gene)
[4128] gi|18152452|emb|AJ298292.1|HSA298292[18152452]
[4129] 1744: AB070621
[4130] Homo sapiens HTR4 gene for 5-hydroxytryptamine 4 receptor, promoter and exon 1
[4131] gi|18149171|dbj|AB070621.1|AB070621[18149171]
[4132] 1745: AB070620
[4133] Homo sapiens HTR4 mRNA for 5-hydroxytryptamine 4 receptor, partial cds
[4134] gi|18149169|dbj|AB070620.1|AB070620[18149169]
[4135] 1746: AB050774
[4136] Homo sapiens N27C7-4 gene, complete cds
[4137] gi|8147104|dbj|AB050774.1|AB050774[18147104]
[4138] 1747: AB048946
[4139] Homo sapiens PrRPR gene for prolactin releasing peptide receptor, complete cds
[4140] gi|18147078|dbj|AB048946.1|AB048946[18147078]
[4141] 1748: NM—030760
[4142] Homo sapiens endothelial differentiation, sphingolipid G-protein-coupled receptor, 8 (EDG8), mRNA
[4143] gi|18141314|ref|NM—030760.2|[18141314]
[4144] 1749: NM—032556
[4145] Homo sapiens interleukin-1 HY2 (IL1HY2), mRNA
[4146] gi|18141307|ref|NM—032556.2|[18141307]
[4147] 1750: AF459634
[4148] Homo sapiens immunoglobulin superfamily receptor translocation associated 5 mRNA, complete cds
[4149] gi|18140080|gb|AF459634.1|AF459634[18140080]
[4150] 1751: AF459633
[4151] Homo sapiens immunoglobulin superfamily receptor translocation associated 4 mRNA, complete cds
[4152] gi|18140078|gb|AF459633.1|AF459633[18140078]
[4153] 1752: AY046529
[4154] Homo sapiens melanocortin 1 receptor mutant V122M (MC1R) gene, complete cds
[4155] gi|1813824|gb|AY046529.1|[18138241]
[4156] 1753: AY046528
[4157] Homo sapiens melanocortin 1 receptor mutant 140T (MC1R) gene, complete cds
[4158] gi|18138239|gb|AY046528.1|[18138239]
[4159] 1754: AX338549
[4160] Sequence 1 from Patent WO0185790
[4161] gi|18128949|emb|AX338549.1|AX338549[18128949]
[4162] 1755: NM—001745
[4163] Homo sapiens calcium modulating ligand (CAMLG), mRNA
[4164] gi|18105008|ref|NM—001745.2|[18105008]
[4165] 1756: NM—001128
[4166] Homo sapiens adaptor-related protein complex 1, gamma 1 subunit (AP1G1), mRNA
[4167] gi|18104997|ref|NM—001128.2|[18104997]
[4168] 1757: NM—080545
[4169] Homo sapiens adaptor-related protein complex 1, gamma 2 subunit (AP1G2), transcript variant 2, mRNA
[4170] gi|18104995|ref|NM—080545.1|[18104995]
[4171] 1758: NM—003917
[4172] Homo sapiens adaptor-related protein complex 1, gamma 2 subunit (AP1G2), transcript variant 1, mRNA
[4173] gi|18104994|ref|NM—003917.2|[18104994]
[4174] 1759: AF459027
[4175] Homo sapiens immunoglobulin superfamily receptor translocation associated protein 3 mRNA, complete cds
[4176] gi|18092654|gb|AF459027.1|AF459027[18092654]
[4177] 1760: AY069943
[4178] Homo sapiens TCP11b protein mRNA, complete cds
[4179] gi|18091790|gb|AY069943.1|[18091790]
[4180] 1761: AY063126
[4181] Homo sapiens Fc alpha/mu receptor mRNA, partial cds; alternatively spliced
[4182] gi|18032043|gb|AY063126.1[18032043]
[4183] 1762: AY063125
[4184] Homo sapiens Fc alpha/mu receptor mRNA, complete cds; alternatively spliced
[4185] gi|18032041|gb|AY063125.1|[18032041]
[4186] 1763: AF395264
[4187] Homo sapiens clone EIII48 bpVNTR55 dopamine receptor D4 (DRD4) gene, partial cds
[4188] gi|17063763|gb|AF395264.1|AF395264[17063763]
[4189] 1764: AF395263
[4190] Homo sapiens clone EIII48 bpVNTR54 dopamine receptor D4 (DRD4) gene, partial cds
[4191] gi|1706376|gb|AF395263.1|AF395263[17063761]
[4192] 1765: AF395262
[4193] Homo sapiens clone EIII48 bpVNTR53 dopamine receptor D4 (DRD4) gene, partial cds
[4194] gi|17063759|gb|AF395262.1|AF395262[17063759]
[4195] 1766: AF395261
[4196] Homo sapiens clone EIII48 bpVNTR52 dopamine receptor D4 (DRD4) gene, partial cds
[4197] gi|17063757|gb|AF395261.1|AF395261[17063757]
[4198] 1767: AF395260
[4199] Homo sapiens clone EIII48 bpVNTR51 dopamine receptor D4 (DRD4) gene, partial cds
[4200] gi|17063755|gb|AF395260.1|AF395260[17063755]
[4201] 1768: AF395259
[4202] Homo sapiens clone EIII48 bpVNTR50 dopamine receptor D4 (DRD4) gene, partial cds
[4203] gi|17063753|gb|AF395259.1|AF395259[17063753]
[4204] 1769: AF395258
[4205] Homo sapiens clone EIII48 bpVNTR49 dopamine receptor D4 (DRD4) gene, partial cds
[4206] gi|1706375|gb|AF395258.1|AF395258[17063751]
[4207] 1770: AF395257
[4208] Homo sapiens clone EIII48 bpVNTR48 dopamine receptor D4 (DRD4) gene, partial cds
[4209] gi|17063749|gb|AF395257.1|AF395257[17063749]
[4210] 1771: AF395256
[4211] Homo sapiens clone EIII48 bpVNTR47 dopamine receptor D4 (DRD4) gene, partial cds
[4212] gi|17063747|gb|AF395256.1|AF395256[17063747]
[4213] 1772: AF395255
[4214] Homo sapiens clone EIII48 bpVNTR46 dopamine receptor D4 (DRD4) gene, partial cds
[4215] gi|17063745|gb|AF395255.1|AF395255[17063745]
[4216] 1773: AF395254
[4217] Homo sapiens clone EIII48 bpVNTR45 dopamine receptor D4 (DRD4) gene, partial cds
[4218] gi|7063743|gb|AF395254.1|AF395254[17063743]
[4219] 1774: AF395253
[4220] Homo sapiens clone EIII48 bpVNTR44 dopamine receptor D4 (DRD4) gene, partial cds
[4221] gi|17063741|gb|AF395253.1|AF395253[17063741]
[4222] 1775: AF395252
[4223] Homo sapiens clone EIII48 bpVNTR43 dopamine receptor D4 (DRD4) gene, partial cds
[4224] gi|17063739|gb|AF395252.1|AF395252[17063739]
[4225] 1776: AF395251
[4226] Homo sapiens clone EIII48 bpVNTR42 dopamine receptor D4 (DRD4) gene, partial cds
[4227] gi|17063737|gb|AF395251.1|AF395251[17063737]
[4228] 1777: AF395250
[4229] Homo sapiens clone EIII48 bpVNTR41 dopamine receptor D4 (DRD4) gene, partial cds
[4230] gi|17063735|gb|AF395250.1|AF395250[17063735]
[4231] 1778: AF395249
[4232] Homo sapiens clone EIII48 bpVNTR40 dopamine receptor D4 (DRD4) gene, partial cds
[4233] gi|17063733|gb|AF395249.1|AF395249[17063733]
[4234] 1779: AF395248
[4235] Homo sapiens clone EIII48 bpVNTR39 dopamine receptor D4 (DRD4) gene, partial cds
[4236] gi|17063731|gb|AF395248.1|AF395248[17063731]
[4237] 1780: AF395247
[4238] Homo sapiens clone EIII48 bpVNTR38 dopamine receptor D4 (DRD4) gene, partial cds
[4239] gi|17063729|gb|AF395247.1|AF395247[17063729]
[4240] 1781: AF395246
[4241] Homo sapiens clone EIII48 bpVNTR37 dopamine receptor D4 (DRD4) gene, partial cds
[4242] gi|17063727|gb|AF395246.1|AF395246[17063727]
[4243] 1782: AF395245
[4244] Homo sapiens clone EIII48 bpVNTR36 dopamine receptor D4 (DRD4) gene, partial cds
[4245] gi|17063725|gb|AF395245.1|AF395245[17063725]
[4246] 1783: AF395244
[4247] Homo sapiens clone EIII48 bpVNTR35 dopamine receptor D4 (DRD4) gene, partial cds
[4248] gi|7063723|gb|AF395244.1|AF395244[17063723]
[4249] 1784: AF395243
[4250] Homo sapiens clone EIII48 bpVNTR34 dopamine receptor D4 (DRD4) gene, partial cds
[4251] gi|17063721|gb|AF395243.1|AF395243[17063721]
[4252] 1785: AF395242
[4253] Homo sapiens clone EIII48 bpVNTR33 dopamine receptor D4 (DRD4) gene, partial cds
[4254] gi|17063719|gb|AF395242.1|AF395242[17063719]
[4255] 1786: AF395241
[4256] Homo sapiens clone EIII48 bpVNTR32 dopamine receptor D4 (DRD4) gene, partial cds
[4257] gi|17063717|gb|AF395241.1|AF395241[17063717]
[4258] 1787: AF395240
[4259] Homo sapiens clone EIII48 bpVNTR31 dopamine receptor D4 (DRD4) gene, partial cds
[4260] gi|7063715|gb|AF395240.1|AF395240[17063715]
[4261] 1788: AF395239
[4262] Homo sapiens clone EIII48 bpVNTR30 dopamine receptor D4 (DRD4) gene, partial cds
[4263] gi|17063713|gb|AF395239.1|AF395239[17063713]
[4264] 1789: AF395238
[4265] Homo sapiens clone EIII48 bpVNTR29 dopamine receptor D4 (DRD4) gene, partial cds
[4266] gi|1706371|gb|AF395238.1|AF395238[17063711]
[4267] 1790: AF395237
[4268] Homo sapiens clone EIII48 bpVNTR28 dopamine receptor D4 (DRD4) gene, partial cds
[4269] gi|17063709|gb|AF395237.1|AF395237[17063709]
[4270] 1791: AF395236
[4271] Homo sapiens clone EIII48 bpVNTR27 dopamine receptor D4 (DRD4) gene, partial cds
[4272] gi|17063707|gb|AF395236.1|AF395236[17063707]
[4273] 1792: AF395235
[4274] Homo sapiens clone EIII48 bpVNTR26 dopamine receptor D4 (DRD4) gene, partial cds
[4275] gi|17063705|gb|AF395235.1|AF395235[17063705]
[4276] 1793: AF395234
[4277] Homo sapiens clone EIII48 bpVNTR25 dopamine receptor D4 (DRD4) gene, partial cds
[4278] gi|17063703|gb|AF395234.1|AF395234[17063703]
[4279] 1794: AF395233
[4280] Homo sapiens clone EIII48 bpVNTR24 dopamine receptor D4 (DRD4) gene, partial cds
[4281] gi|17063701|gb|AF395233.1|AF395233[17063701]
[4282] 1795: AF395232
[4283] Homo sapiens clone EIII48 bpVNTR23 dopamine receptor D4 (DRD4) gene, partial cds
[4284] gi|17063699|gb|AF395232.1|AF395232[17063699]
[4285] 1796: AF395231
[4286] Homo sapiens clone EIII48 bpVNTR22 dopamine receptor D4 (DRD4) gene, partial cds
[4287] gi|17063697|gb|AF395231.1|AF395231[17063697]
[4288] 1797: AF395230
[4289] Homo sapiens clone EIII48 bpVNTR21 dopamine receptor D4 (DRD4) gene, partial cds
[4290] gi|17063695|gb|AF395230.1|AF395230[17063695]
[4291] 1798: AF395229
[4292] Homo sapiens clone EIII48 bpVNTR20 dopamine receptor D4 (DRD4) gene, partial cds
[4293] gi|17063693|gb|AF395229.1|AF395229[17063693]
[4294] 1799: AF395228
[4295] Homo sapiens clone EIII48 bpVNTR19 dopamine receptor D4 (DRD4) gene, partial cds
[4296] gi|17063691|gb|AF395228.1|AF395228[17063691]
[4297] 1800: AF395227
[4298] Homo sapiens clone EIII48 bpVNTR18 dopamine receptor D4 (DRD4) gene, partial cds
[4299] gi|17063689|gb|AF395227.1|AF395227[170636891]
[4300] 1801: AF395226
[4301] Homo sapiens clone EIII48 bpVNTR17 dopamine receptor D4 (DRD4) gene, partial cds
[4302] gi|17063687|gb|AF395226.1|AF395226[17063687]
[4303] 1802: AF395225
[4304] Homo sapiens clone EIII48 bpVNTR16 dopamine receptor D4 (DRD4) gene, partial cds
[4305] gi|17063685|gb|AF395225.1|AF395225[17063685]
[4306] 1803: AF395224
[4307] Homo sapiens clone EIII48 bpVNTR15 dopamine receptor D4 (DRD4) gene, partial cds
[4308] gi|17063683|gb|AF395224.1|AF395224[17063683]
[4309] 1804: AF395223
[4310] Homo sapiens clone EIII48 bpVNTR14 dopamine receptor D4 (DRD4) gene, partial cds
[4311] gi|17063681|gb|AF395223.1|AF395223[17063681]
[4312] 1805: AF395222
[4313] Homo sapiens clone EIII48 bpVNTR13 dopamine receptor D4 (DRD4) gene, partial cds
[4314] gi|7063679|gb|AF395222.1|AF395222[17063679]
[4315] 1806: AF395221
[4316] Homo sapiens clone EIII48 bpVNTR12 dopamine receptor D4 (DRD4) gene, partial cds
[4317] gi|17063677|gb|AF395221.1|AF395221[17063677]
[4318] 1807: AF395220
[4319] Homo sapiens clone EIII48 bpVNTR11 dopamine receptor D4 (DRD4) gene, partial cds
[4320] gi|17063675|gb|AF395220.1|AF395220[17063675]
[4321] 1808: AF395219
[4322] Homo sapiens clone EIII48 bpVNTR10 dopamine receptor D4 (DRD4) gene, partial cds
[4323] gi|17063673|gb|AF395219.1|AF395219[17063673]
[4324] 1809: AF395218
[4325] Homo sapiens clone EIII48 bpVNTR9 dopamine receptor D4 (DRD4) gene, partial cds
[4326] gi|17063671|gb|AF395218.1|AF395218[17063671]
[4327] 1810: AF395217
[4328] Homo sapiens clone EIII48 bpVNTR8 dopamine receptor D4 (DRD4) gene, partial cds
[4329] gi|17063669|gb|AF395217.1|AF395217[17063669]
[4330] 1811: AF395216
[4331] Homo sapiens clone EIII48 bpVNTR7 dopamine receptor D4 (DRD4) gene, partial cds
[4332] gi|17063667|gb|AF395216.1|AF395216[17063667]
[4333] 1812: AF395215
[4334] Homo sapiens clone EIII48 bpVNTR6 dopamine receptor D4 (DRD4) gene, partial cds
[4335] gi|17063665|gb|AF395215.1|AF395215[17063665]
[4336] 1813: AF395214
[4337] Homo sapiens clone EIII48 bpVNTR5 dopamine receptor D4 (DRD4) gene, partial cds
[4338] gi|17063663|gb|AF395214.1|AF395214[17063663]
[4339] 1814: AF395213
[4340] Homo sapiens clone EIII48 bpVNTR4 dopamine receptor D4 (DRD4) gene, partial cds
[4341] gi|17063661|gb|AF395213.1|AF395213[17063661]
[4342] 1815: AF395212
[4343] Homo sapiens clone EIII48 bpVNTR3 dopamine receptor D4 (DRD4) gene, partial cds
[4344] gi|17063659|gb|AF395212.1|AF395212[17063659]
[4345] 1816: AF395211
[4346] Homo sapiens clone EIII48 bpVNTR2 dopamine receptor D4 (DRD4) gene, partial cds
[4347] gi|17063657|gb|AF395211.1|AF395211[17063657]
[4348] 1817: AF395210
[4349] Homo sapiens clone EIII48 bpVNTR1 dopamine receptor D4 (DRD4) gene, partial cds
[4350] gi|7063655|gb|AF395210.1|AF395210[17063655]
[4351] 1818: AF258342
[4352] Homo sapiens biogenic amine receptor-like protein mRNA, complete cds
[4353] gi|15428321|gb|AF258342.1|AF258342[15428321]
[4354] 1819: AJ278982
[4355] Homo sapiens mRNA for 5-hydroxytryptamine4 receptor (HTR4 gene), splice variant
[4356] h5-HT4(n)
[4357] gi|12274905|emb|AJ278982.1|HSA278982[12274905]
[4358] 1820: AJ278981
[4359] Homo sapiens mRNA for 5-hydroxytryptamine4 receptor (HTR4 gene), splice variant
[4360] h5-HT4(g)
[4361] gi|12274903|emb|AJ278981.1|HSA278981[12274903]
[4362] 1821: AJ278980
[4363] Homo sapiens mRNA for 5-hydroxytryptamine4 receptor (HTR4 gene), splice variant
[4364] h5-HT4(b)
[4365] gi|12274901|emb|AJ278980.1|HSA278980[12274901]
[4366] 1822: AJ278979
[4367] Homo sapiens mRNA for 5-hydroxytryptamine4 receptor (HTR4 gene), splice variant
[4368] h5-HT4(a)
[4369] gi|12274899|emb|AJ278979.1|HSA278979[12274899]
[4370] 1823: NM—014555
[4371] Homo sapiens transient receptor potential cation channel, subfamily M, member 5
[4372] (TRPM5), mA
[4373] gi|11225265|ref|NM—014555.1|[11225265]
[4374] 1824: AF200627
[4375] Homo sapiens putative catecholamine receptor gene, complete cds
[4376] gi|10441576|gb|AF200627.1|AF200627[10441576]
[4377] 1825: AF257789
[4378] Homo sapiens urokinase-type plasminogen activator receptor mRNA, partial cds
[4379] gi|8050814|gb|AF257789.1|AF257789[8050814]
[4380] 1826: NM—002335
[4381] Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5), mRNA
[4382] gi|4505018|ref|NM—002335.1|[4505018]
[4383] 1827: Y00508
[4384] H. sapiens M1 gene for muscarinic acetylcholine receptor
[4385] gi|297405|emb|Y00508.1|HSMIMAR[297405]
[4386] 1828: AF457599
[4387] Homo sapiens killer cell immunoglobulin-like receptor (KIR3DL1) gene, KIR3DL1-NKB1-like allele, promoter region and exon 1
[4388] gi|18087432|gb|AF457599.1|AF457599[18087432]
[4389] 1829: AF457598
[4390] Homo sapiens killer cell immunoglobulin-like receptor (KIR3DL1) gene, KIR3DL1-NKB1-like allele, promoter region and exon 1
[4391] gi|18087431|gb|AF457598.1|AF457598[18087431]
[4392] 1830: AF457597
[4393] Homo sapiens killer cell immunoglobulin-like receptor (KIR3DL1) gene, KIR3DL1-NKAT3-like allele, promoter region and exon 1
[4394] gi|18087430|gb|AF457597.1|AF457597[18087430]
[4395] 1831: AJ312755
[4396] Homo sapiens mRNA for scavenger receptor cysteine-rich protein SRCRB-S4D, (SRCRB-S4D gene)
[4397] gi|18073905|emb|AJ312755.1|HSA312755[18073905]
[4398] 1832: AF331842
[4399] Homo sapiens SPPR-2 mRNA, complete cds, alternatively spliced
[4400] gi|18033260|gb|AF331842.1|AF331842[18033260]
[4401] 1833: AF331841
[4402] Homo sapiens SPPR-1 mRNA, complete cds, alternatively spliced
[4403] gi|18033258|gb|AF331841.1|AF331841[18033258]
[4404] 1834: AF331840
[4405] Homo sapiens SPPR mRNA, complete cds, alternatively spliced
[4406] gi|18033256|gb|AF331840.1|AF331840[18033256]
[4407] 1835: AF284756
[4408] Homo sapiens VPS10 domain receptor S or CS mRNA, complete cds
[4409] gi|18032274|gb|AF284756.1|AF284756[18032274]
[4410] 1836: AF328684
[4411] Homo sapiens Fc-epsilon receptor III mRNA, complete cds
[4412] gi|8028292|gb|AF328684.1|AF328684[18028292]
[4413] 1837: AY029413
[4414] Homo sapiens interleukin-1 receptor antagonist-like FIL1 theta (FIL1-theta) mRNA, complete cds
[4415] gi|18025343|gb|AY029413.1|[18025343]
[4416] 1838: AF126470
[4417] Homo sapiens KOR-3D (KOR-3) mRNA, complete cds
[4418] gi|18000078|gb|AF126470.1|AF126470[18000078]
[4419] 1839: AF435925
[4420] Homo sapiens very large G protein-coupled receptor 1b (VLGR1) mRNA, complete cds
[4421] gi|16904207|gb|AF435925.1|AF435925[16904207]
[4422] 1840: G67431
[4423] D7S3125 GRB10 Homo sapiens STS genomic, sequence tagged site
[4424] gi|12025489|gb|G67431.1|G67431[12025489]
[4425] 1841: AF260136
[4426] Homo sapiens NK cell receptor D (NKG2-D) mRNA, NKG2-D*03 allele, complete cds
[4427] gi|9295444|gb|AF260136.1|AF260136[9295444]
[4428] 1842: AF260135
[4429] Homo sapiens NK cell receptor D (NKG2-D) mRNA, NKG2-D*02 allele, complete cds
[4430] gi|9295442|gb|AF260135.1|AF260135[9295442]
[4431] 1843: AF260134
[4432] Homo sapiens NK cell receptor C (NKG2-C) mRNA, NKG2-C*02 allele, complete cds
[4433] gi|9295440|gb|AF260134.1|AF260134[9295440]
[4434] 1844: NM—015891
[4435] Homo sapiens pre-mRNA splicing factor 17 (PRP17), mRNA
[4436] gi|7706656|ref|NM—015891.1|[7706656]
[4437] 1845: L12397
[4438] Homo sapiens Dopamine D4 receptor (DRD4) gene, partial cds
[4439] gi|291947|gb|L12397.1|HUMD4G[291947]
[4440] 1846: NM—019888
[4441] Homo sapiens melanocortin 3 receptor (MC3R), mRNA
[4442] gi|17986278|ref|NM—019888.2|[17986278]
[4443] 1847: NM—000795
[4444] Homo sapiens dopamine receptor D2 (DRD2), transcript variant 1, mRNA
[4445] gi|17986271|ref|NM—000795.2|[17986271]
[4446] 1848: NM—016574
[4447] Homo sapiens dopamine receptor D2 (DRD2), transcript variant 2, mRNA
[4448] gi|17986269|ref|NM—016574.2|[17986269]
[4449] 1849: AY070269
[4450] Homo sapiens hypocretin receptor 1 (HCRTR1) gene, complete cds
[4451] gi|17979217|gb|AY070269.1|[17979217]
[4452] 1850: NM—052945
[4453] Homo sapiens BAFF receptor (BAFFR), mRNA
[4454] gi|17978517|ref|NM—052945.2|[17978517]
[4455] 1851: NM—054026
[4456] Homo sapiens CCR4—NOT transcription complex, subunit 7 (CNOT7), transcript variant 2, mRNA
[4457] gi|17978499|ref|NM—054026.1|[17978499]
[4458] 1852: NM—013354
[4459] Homo sapiens CCR4—NOT transcription complex, subunit 7 (CNOT7), transcript variant 1, mRNA
[4460] gi|17978498|ref|NM—013354.3|[17978498]
[4461] 1853: NM—004444
[4462] Homo sapiens EphB4 (EPHB4), mRNA
[4463] gi|17975769|ref|NM—004444.2|[17975769]
[4464] 1854: NM—004443
[4465] Homo sapiens EphB3 (EPHB3), mRNA
[4466] gi|17975767|ref|NM—004443.2|[17975767]
[4467] 1855: NM—004442
[4468] Homo sapiens EphB2 (EPHB2), transcript variant 1, mRNA
[4469] gi|17975766|ref|NM—004442.2|[17975766]
[4470] 1856: NM—017449
[4471] Homo sapiens EphB2 (EPHB2), transcript variant 2, mRNA
[4472] gi|17975764|ref|NM—017449.1|[17975764]
[4473] 1857: BC019278
[4474] Homo sapiens, cargo selection protein (mannose 6 phosphate receptor binding protein), clone MGC:3816 IMAGE:2905275, mRNA, complete cds
[4475] gi|17939468|gb|BC019278.1|BC019278[17939468]
[4476] 1858: NM—080387
[4477] Homo sapiens C-type lectin-like receptor (CLEC-6), mRNA
[4478] gi|17933769|ref|NM—080387.1|[17933769]
[4479] 1859: NM—007200
[4480] Homo sapiens A kinase (PRKA) anchor protein 13 (AKAP13), mRNA
[4481] gi|17933491|ref|NM—007200.1|[17933491]
[4482] 1861: AF373878
[4483] Homo sapiens herpesvirus entry mediator (TNFRSF14) mRNA, TNFRSF14-V241I allele,
[4484] complete cds
[4485] gi|17901872|gb|AF373878.1|AF373878[17901872]
[4486] 1862: AF373877
[4487] Homo sapiens herpesvirus entry mediator (TNFRSF14) mRNA, TNFRSF14-R17K allele,
[4488] complete cds
[4489] gi|17901869|gb|AF373877.1|AF373877[17901869]
[4490] 1863: AF373876
[4491] Homo sapiens nectin-1 (PVRL1) gene, PVRL1-R199W allele, partial cds
[4492] gi|17901866|gb|AF373876.1|AF373876[17901866]
[4493] 1864: AY065844
[4494] Homo sapiens truncated receptor tyrosine kinase TrkC mRNA, partial cds
[4495] gi|17887448|gb|AY065844.1|[17887448]
[4496] 1865: AY062295
[4497] Homo sapiens prolactin receptor (PRLR) mRNA, partial cds; alternatively spliced
[4498] gi|7887307|gb|AY062295.1|[17887307]
[4499] 1866: NM—078474
[4500] Homo sapiens BBP-like protein 2 (BLP2), transcript variant 1, mRNA
[4501] gi|17865799|ref|NM—078474.1|[17865799]
[4502] 1867: NM—025141
[4503] Homo sapiens BBP-like protein 2 (BLP2), transcript variant 2, mRNA
[4504] gi|17865798|ref|NM—025141.2|[17865798]
[4505] 1868: NM—078473
[4506] Homo sapiens BBP-like protein 1 (BLP1), transcript variant 1, mRNA
[4507] gi|17865796|ref|NM—078473.1|[17865796]
[4508] 1869: NM—020749
[4509] Homo sapiens AT2 receptor-interacting protein 1 (ATIP1), mRNA
[4510] gi|17865631|ref|NM—020749.1|[17865631]
[4511] 1870: NM—002088
[4512] Homo sapiens glutamate receptor, ionotropic, kainate 5 (GRIK5), mRNA
[4513] gi|17864085|ref|NM—002088.2|[17864085]
[4514] 1871: AY064474
[4515] Homo sapiens interleukin 21 receptor (IL21R) gene, complete cds
[4516] gi|17863086|gb|AY064474.1|[17863086]
[4517] 1872: AY036093
[4518] Homo sapiens lysyl oxidase-like 4 mRNA, complete cds
[4519] gi|1786137|gb|AY036093.1|[17861371]
[4520] 1873: AF369653
[4521] Homo sapiens corticotropin releasing hormone receptor variant 1 g (CRHR1) mRNA,
[4522] partial cds, alternatively spliced
[4523] gi|17834100|gb|AF369653.1|AF369653[17834100]
[4524] 1874: AF369652
[4525] Homo sapiens corticotropin releasing hormone receptor variant lf (CRHR1) mRNA,
[4526] partial cds, alternatively spliced
[4527] gi|17834097|gb|AF369652.1|AF369652[17834097]
[4528] 1875: AF369651
[4529] Homo sapiens corticotropin releasing hormone receptor variant le (CRHRL) mRNA,
[4530] partial cds, alternatively spliced
[4531] gi|17834094|gb|AF369651.1|AF369651[17834094]
[4532] 1876: NM—001239
[4533] Homo sapiens cyclin H(CCNH), mRNA
[4534] gi|17738313|ref|NM—001239.2|[17738313]
[4535] 1877: NM—014286
[4536] Homo sapiens frequenin homolog (Drosophila) (FREQ), mRNA
[4537] gi|17738307|ref|NM—014286.2|[17738307]
[4538] 1878: NM—006650
[4539] Homo sapiens complexin 2 (CPLX2), mRNA
[4540] gi|17738306|ref|NM—006650.2|[17738306]
[4541] 1879: NM—006651
[4542] Homo sapiens complexin 1 (CPLX1), mRNA
[4543] gi|17738305|ref|NM—006651.2|[17738305]
[4544] 1880: AF416558
[4545] Homo sapiens N-methyl-D-aspartate receptor 3A (GRIN3A) mRNA, complete cds
[4546] gi|17530176|gb|AF416558.1|AF416558[17530176]
[4547] 1882: BC018926
[4548] Homo sapiens, vanilloid receptor-like protein, clone MGC:12549 IMAGE:4298484, mRNA, complete cds
[4549] gi|17511937|gb|BC018926.1|BC018926[17511937]
[4550] 1883: BC018778
[4551] Homo sapiens, KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1, clone MGC:32075 IMAGE:4870476, mRNA, complete cds
[4552] gi|17511855|gb|BC018778.1|BC018778[17511855]
[4553] 1884: NM—004625
[4554] Homo sapiens wingless-type MMTV integration site family, member 7A (WNT7A), mRNA
[4555] gi|17505190|ref|NM—004625.2|[17505190]
[4556] 1885: L78805
[4557] Homo sapiens G protein-coupled receptor gene, partial cds
[4558] gi|17466993|gb|L78805.1|HUMGPCRE[17466993]
[4559] 1886: NM—003602
[4560] Homo sapiens FK506 binding protein 6 (36 kD) (FKBP6), mRNA
[4561] gi|17149848|ref|NM—003602.2|[17149848]
[4562] 1887: NM—000801
[4563] Homo sapiens FK506 binding protein 1A (12 kD) (FKBP1A), transcript variant 12B,
[4564] mRNA
[4565] gi|17149837|ref|NM—000801.2|[17149837]
[4566] 1888: NM—054014
[4567] Homo sapiens FK506 binding protein 1A (12 kD) (FKBP1A), transcript variant 12A,
[4568] mRNA
[4569] gi|17149835|ref|NM—054014.1|[17149835]
[4570] 1889: AF411044
[4571] Homo sapiens DnaJ protein Tid-1 mRNA, complete cds
[4572] gi|17066574|gb|AF411044.1|AF411044[17066574]
[4573] 1890: NM—003728
[4574] Homo sapiens unc-5 homolog B (C. elegans) (UNC5C), mRNA
[4575] gi|16933524|ref|NM—003728.2|[16933524]
[4576] 1891: NM—005633
[4577] Homo sapiens son of sevenless homolog 1 (Drosophila) (SOS1), mRNA
[4578] gi|15529995|ref|NM—005633.2|[15529995]
[4579] 1892: AJ308539
[4580] Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV7BJ2S4 gene)
[4581] gi|4787781|emb|AJ308539.1|HSA308539[14787781]
[4582] 1893: AJ308538
[4583] Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV14BJ1S1 gene)
[4584] gi|14787779|emb|AJ308538.1|HSA308538[14787779]
[4585] 1894: AJ308537
[4586] Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV17BJ2S7 gene)
[4587] gi|14787777|emb|AJ308537.1|HSA308537[14787777]
[4588] 1895: AJ308536
[4589] Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV23BJ2S2 gene)
[4590] gi|14787775|emb|AJ308536.1|HSA308536[14787775]
[4591] 1896: AJ308535
[4592] Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV12BJ1S5 gene)
[4593] gi|14787773|emb|AJ308535.1|HSA308535[14787773]
[4594] 1897: AJ308534
[4595] Homo sapiens partial mRNA for T-cell receptor beta chain, V-D-J region (TCRBV1BJ2S1 gene)
[4596] gi|14787771|emb|AJ308534.1|HSA308534[14787771]
[4597] 1898: AJ308533
[4598] Homo sapiens partial mRNA for T-cell receptor beta chain, V-D-J region (TCRBV25BJ2S7 gene)
[4599] gi|14787769|emb|AJ308533.1|HSA308533[14787769]
[4600] 1899: AJ308532
[4601] Homo sapiens partial mRNA for T-cell receptor beta chain, V-D-J region (TCRBV22BJ2S7 gene)
[4602] gi|14787767|emb|AJ308532.1|HSA308532[14787767]
[4603] 1900: NM—014459
[4604] Homo sapiens protocadherin 17 (PCDH17), mRNA
[4605] gi|14589926|ref|NM—014459.2|[14589926]
[4606] 1901: NM—032961
[4607] Homo sapiens protocadherin 10 (PCDH10), transcript variant 1, mRNA
[4608] gi|14589915|ref|NM—032961.1|[14589915]
[4609] 1902: NM—020815
[4610] Homo sapiens protocadherin 10 (PCDH10), transcript variant 2, mRNA
[4611] gi|14589913|ref|NM—020815.1|[14589913]
[4612] 1903: NM—032966
[4613] Homo sapiens Burkitt lymphoma receptor 1, GTP binding protein (BLR1), transcript
[4614] variant 2, mRNA
[4615] gi|145
[4616] 2001: AF011513
[4617] Homo sapiens isolate MwCCR5-1553 CCR5 receptor (CCR5) mRNA, partial cds
[4618] gi|2305143|gb|AF011513.1|AF011513[2305143]
[4619] 2002: AF011512
[4620] Homo sapiens isolate MwCCR5-107 CCR5 receptor (CCR5) mRNA, partial cds
[4621] gi|2305141|gb|AF011512.1|AF011512[2305141]
[4622] 2003: AF011511
[4623] Homo sapiens isolate KeCCR5-3b CCR5 receptor (CCR5) mRNA, partial cds
[4624] gi|2305139|gb|AF011511.1|AF011511[2305139]
[4625] 2004: AF011510
[4626] Homo sapiens isolate KeCCR5-3a CCR5 receptor (CCR5) mRNA, partial cds
[4627] gi|2305137|gb|AF011510.1|AF011510[2305137]
[4628] 2005: AF011509
[4629] Homo sapiens isolate KeCCR5-116 CCR5 receptor (CCR5) mRNA, partial cds
[4630] gi|2305135|gb|AF011509.1|AF011509[2305135]
[4631] 2006: AF011508
[4632] Homo sapiens isolate KeCCR5-111 CCR5 receptor (CCR5) mRNA, partial cds
[4633] gi|2305133|gb|AF011508.1|AF011508[2305133]
[4634] 2007: AF011507
[4635] Homo sapiens isolate InCCR5-72a CCR5 receptor (CCR5) mRNA, partial cds
[4636] gi|2305131|gb|AF011507.1|AF011507[2305131]
[4637] 2008: AF011506
[4638] Homo sapiens isolate InCCR5-71b CCR5 receptor (CCR5) mRNA, partial cds
[4639] gi|2305129|gb|AF011506.1|AF011506[2305129]
[4640] 2009: AF011505
[4641] Homo sapiens isolate InCCR5-71a CCR5 receptor (CCR5) mRNA, partial cds
[4642] gi|2305127|gb|AF0115050.1|AF011505[2305127]
[4643] 2010: AF011504
[4644] Homo sapiens isolate InCCR5-46 CCR5 receptor (CCR5) mRNA, partial cds
[4645] gi|2305125|gb|AF011504.1|AF011504[2305125]
[4646] 2011: AF011503
[4647] Homo sapiens isolate InCCR5-467 CCR5 receptor (CCR5) mRNA, partial cds
[4648] gi|2305123|gb|AF011503.1|AF011503[2305123]
[4649] 2012: AF011502
[4650] Homo sapiens isolate InCCR5-463 CCR5 receptor (CCR5) mRNA, partial cds
[4651] gi|2305121|gb|AF011502.1|AF011502[2305121]
[4652] 2013: AF011501
[4653] Homo sapiens isolate InCCR5-45c CCR5 receptor (CCR5) mRNA, partial cds
[4654] gi|2305119|gb|AF011501.1|AF011501[2305119]
[4655] 2014: AF011500
[4656] Homo sapiens isolate HtCCR5-104 CCR5 receptor (CCR5) mRNA, partial cds
[4657] gi|2305117|gb|AF011500.1|AF011500[2305117]
[4658] 2015: U77732
[4659] Homo sapiens glycine receptor alpha 1 subunit gene, partial cds
[4660] gi|1718390|gb|U77732.1|HSU77732[1718390]
[4661] 2016: NM—033519
[4662] Homo sapiens olfactory receptor sdolf (sdolf), mRNA
[4663] gi|15723373|ref|NM—033519.1|[15723373]
[4664] 2017: NM—032192
[4665] Homo sapiens hypothetical protein FLJ20940 (FLJ20940), mRNA
[4666] gi|14149882|ref|NM—032192.1|[14149882]
[4667] 2018: NM—032152
[4668] Homo sapiens PRAM-1 protein (PRAM-1), mRNA
[4669] gi|14149826|ref|NM—032152.1|[14149826]
[4670] 2019: NM—032142
[4671] Homo sapiens hypothetical protein FLJ10352 (FLJ10352), mRNA
[4672] gi|14149808|ref|NM—032142.1|[14149808]
[4673] 2020: NM—004801
[4674] Homo sapiens neurexin 1 (NRXN1), mRNA
[4675] gi|14149612|ref|NM—004801.1|[14149612]
[4676] 2021: NM—031936
[4677] Homo sapiens G protein-coupled receptor 61 (GPR61), mRNA
[4678] gi|13994319|ref|NM—031936.1|[13994319]
[4679] 2022: NM—030901
[4680] Homo sapiens olfactory receptor, family 7, subfamily A, member 17 (OR7A17), mRNA
[4681] gi|13775161|ref|NM—030901.1|[13775161]
[4682] 2023: NM—024681
[4683] Homo sapiens hypothetical protein FLJ12242 (FLJ12242), mRNA
[4684] gi|13489098|ref|NM—024681.1|[13489098]
[4685] 2024: NM—022571
[4686] Homo sapiens putative leukocyte platelet-activating factor receptor (HUMNPIIY20), mRNA
[4687] gi|12007653|ref|NM—022571.1|[12007653]
[4688] 2025: NM—022065
[4689] Homo sapiens hypothetical protein FLJ21877 (FLJ21877), mRNA
[4690] gi|11545774|ref|NM—022065.1|[11545774]
[4691] 2026: NM—020806
[4692] Homo sapiens gephyrin (GPHN), mRNA
[4693] gi|10880982|ref|NM—020806.1|[10880982]
[4694] 2027: NM—021258
[4695] Homo sapiens interleukin 22 receptor (IL22R), mRNA
[4696] gi|10864066|ref|NM—021258.1|[10864066]
[4697] 2029: NM—020400
[4698] Homo sapiens G protein-coupled receptor 92 (GPR92), mRNA
[4699] gi|9966878|ref|NM—020400.1|[9966878]
[4700] 2030: NM—000888
[4701] Homo sapiens integrin, beta 6 (ITGB6), mRNA
[4702] gi|9966771|ref|NM—000888.31[9966771]
[4703] 2032: NM—018113
[4704] Homo sapiens lipocalin-interacting membrane receptor (LIMR), mRNA
[4705] gi|8922462|ref|NM—018113.1|[8922462]
[4706] 2033: NM—018423
[4707] Homo sapiens hypothetical protein DKFZp761P1010 (DKFZp761P1010), mRNA
[4708] gi|8922178|ref|NM—018423.1|[8922178]
[4709] 2034: AF257182
[4710] Homo sapiens G-protein-coupled receptor 48 (GPR48) mRNA, complete cds
[4711] gi|7739736|gb|AF257182.1|AF257182[7739736]
[4712] 2035: NM—016442
[4713] Homo sapiens type 1 tumor necrosis factor receptor shedding aminopeptidase regulator (ARTS-1), mRNA
[4714] gi|7706544|ref|NM—016442.1|[7706544]
[4715] 2036: NM—015364
[4716] Homo sapiens MD-2 protein (MD-2), mRNA
[4717] gi|7702503|ref|NM—015364.1|[7702503]
[4718] 2037: NM—014380
[4719] Homo sapiens nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), mRNA
[4720] gi|7657043|ref|NM—014380.1|[7657043]
[4721] 2038: NM—013308
[4722] Homo sapiens platelet activating receptor homolog (H963), mRNA
[4723] gi|7019400|ref|NM—013308.1|[7019400]
[4724] 2039: NM—013333
[4725] Homo sapiens EH domain-binding mitotic phosphoprotein (EPSIN), mRNA
[4726] gi|7019368|ref|NM—013333.1|[7019368]
[4727] 2040: NM—007369
[4728] Homo sapiens G-protein coupled receptor (RE2), mRNA
[4729] gi|6677700|ref|NM—007369.1|[6677700]
[4730] 2041: NM—002673
[4731] Homo sapiens plexin B1 (PLXNB1), mRNA
[4732] gi|6631105|ref|NM—002673.1|[6631105]
[4733] 2042: NM—007115
[4734] Homo sapiens tumor necrosis factor, alpha-induced protein 6 (TNFAIP6), mRNA
[4735] gi|6005905|ref|NM—007115.1|[6005905]
[4736] 2044: NM—007223
[4737] Homo sapiens putative G protein coupled receptor (GPR), mRNA
[4738] gi|6005771|ref|NM—007223.1|[6005771]
[4739] 2045: NM—006748
[4740] Homo sapiens Src-like-adaptor (SLA), mRNA
[4741] gi|5803170|ref|NM—006748.1|[5803170]
[4742] 2046: NM—006681
[4743] Homo sapiens neuromedin U (NMU), mRNA
[4744] gi|5729946|ref|NM—006681.1|[5729946]
[4745] 2047: NM—006068
[4746] Homo sapiens toll-like receptor 6 (TLR6), mRNA
[4747] gi|5174720|ref|NM—006068.1|[5174720]
[4748] 2048: NM—006018
[4749] Homo sapiens putative chemokine receptor; GTP-binding protein (HM74), mRNA
[4750] gi|5174460|ref|NM—006018.1|[5174460]
[4751] 2049: NM—006098
[4752] Homo sapiens guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 (GNB2L1), mRNA
[4753] gi|5174446|ref|NM—006098.1|[5174446]
[4754] 2050: NM—005879
[4755] Homo sapiens TRAF interacting protein (TRIP), mRNA
[4756] gi|5032194|ref|NM—005879.1|[5032194]
[4757] 2051: NM—005843
[4758] Homo sapiens signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
[4759] (STAM2), mRNA
[4760] gi|5032126|ref|NM—005843.1|[5032126]
[4761] 2052: NM—005505
[4762] Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1 (CD36L1), mRNA
[4763] gi|5031628|ref|NM—005505.1|[5031628]
[4764] 2053: NM—005795
[4765] Homo sapiens calcitonin receptor-like (CALCRL), mRNA
[4766] gi|5031620|ref|NM—005795.1|[5031620]
[4767] 2054: NM—005400
[4768] Homo sapiens protein kinase C, epsilon (PRKCE), mRNA
[4769] gi|4885562|ref|NM—005400.1|[4885562]
[4770] 2057: NM—004488
[4771] Homo sapiens glycoprotein V (platelet) (GP5), mRNA
[4772] gi|4758459|ref|NM—004488.1|[4758459]
[4773] 2058: NM—004122
[4774] Homo sapiens growth hormone secretagogue receptor (GHSR), mRNA
[4775] gi|4758433|ref|NM—004122.1|[4758433]
[4776] 2059: NM—004438
[4777] Homo sapiens EphA4 (EPHA4), mRNA
[4778] gi|4758279|ref|NM—004438.1|[4758279]
[4779] 2060: NM—004198
[4780] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 6 (CHRNA6), mRNA
[4781] gi|4757981|ref|NM—004198.1|[4757981]
[4782] 2061: NM—004054
[4783] Homo sapiens complement component 3a receptor 1 (C3AR1). mRNA
[4784] gi|4757887|ref|NM—004054.1|[4757887]
[4785] 2062: NM—003955
[4786] Homo sapiens STAT induced STAT inhibitor 3 (SSI-3), mRNA
[4787] gi|4507234|ref|NM—003955.1|[4507234]
[4788] 2063: NM—003693
[4789] Homo sapiens acetyl LDL receptor; SREC=scavenger receptor expressed by endothelial cells (SREC), mRNA
[4790] gi|4507202|ref|NM—003693.1|[4507202]
[4791] 2064: NM—003625
[4792] Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF),
[4793] interacting protein (liprin), alpha 2 (PPFIA2), mRNA
[4794] gi|4505984|ref|NM—003625.1|[4505984]
[4795] 2065: NM—000286
[4796] Homo sapiens peroxisomal biogenesis factor 12 (PEX12), mRNA
[4797] gi|4505720|ref|NM—000286.1|[4505720]
[4798] 2066: NM—002563
[4799] Homo sapiens purinergic receptor P2Y, G-protein coupled, 1 (P2RY1), mRNA
[4800] gi|4505556|ref|NM—002563.1|[4505556]
[4801] 2067: NM—000913
[4802] Homo sapiens opiate receptor-like 1 (OPRL1), mRNA
[4803] gi|4505512|ref|NM—000913.1|[4505512]
[4804] 2068: NM—002333
[4805] Homo sapiens low density lipoprotein receptor-related protein 3 (LRP3), mRNA
[4806] gi|4505014|ref|NM—002333.1|[4505014]
[4807] 2069: NM—001957
[4808] Homo sapiens endothelin receptor type A (EDNRA), mRNA
[4809] gi|4503464|ref|NM—001957.1|[4503464]
[4810] 2070: L34726
[4811] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4812] gi|1100206|gb|L34726.1|HUMTCRBZ[1100206]
[4813] 2071: L34725
[4814] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds
[4815] gi|1100204|gb|L34725.1|HUMTCRBY[1100204]
[4816] 2072: L34724
[4817] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4818] gi|1100202|gb|L34724.1|HUMTCRBU[1100202]
[4819] 2073: L34723
[4820] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4821] gi|1100200|gb|L34723.1|HUMTCRBT[1100200]
[4822] 2074: L34722
[4823] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds
[4824] gi|1100198|gb|L34722.1|HUMTCRBS[1100198]
[4825] 2075: L34721
[4826] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7). partial cds
[4827] gi|1100196|gb|L34721.1|HUMTCRBQ[1100196]
[4828] 2076: L34719
[4829] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds
[4830] gi|1100192|gb|L34719.1|H1MTCRBO[1100192]
[4831] 2077: L34737
[4832] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR2, 7), partial cds
[4833] gi|1100188|gb|L34737.1|HUMTCRBAO[1100188]
[4834] 2078: L34736
[4835] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR2, 7), partial cds
[4836] gi|1100186|gb|L34736.1|HUMTCRBAN[1100186]
[4837] 2079: L34735
[4838] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds
[4839] gi|1100184|gb|L34735.1|HUMTCRBAM[1100184]
[4840] 2080: L34733
[4841] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4842] gi|1001179|gb|L34733.1|HUMTCRBAK[1100179]
[4843] 2081: L34732
[4844] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29: B7, 44; DR 2, 7), partial cds
[4845] gi|1100177|gb|L34732.1|HUMTCRBAJ[1100177]
[4846] 2082: L34731
[4847] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4848] gi|1100175|gb|L34731.1|HUMTCRBAI[1100175]
[4849] 2083: L34730
[4850] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds
[4851] gi|1100173|gb|L34730.1|HUMTCRBAH[1100173]
[4852] 2084: L34728
[4853] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4854] gi|1100169|gb|L34728.1|HUMTCRBAF[1100169]
[4855] 2085: L34727
[4856] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4857] gi|1100167|gb|L34727.1|HUMTCRBAE[1100167]
[4858] 2086: L34703
[4859] Homo sapiens T-cell receptor alpha chain (TCRA) mRNA (HLA-A1, 24; B7, 8; DR 1,
[4860] 3), complete cds
[4861] gi|110065|gb|L34703.1|HUMTCRAZ[1100165]
[4862] 2087: L34702
[4863] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4864] gi|1100163|gb|L34702.1|HUMTCRAY[1100163]
[4865] 2088: L34701
[4866] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4867] gi|1100161|gb|L34701.1|HUMTCRAV[1100161]
[4868] 2089: L34700
[4869] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4870] gi|1001159|gb|L34700.1|HUMTCRAU[1100159]
[4871] 2090: L34699
[4872] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; C7; DR 1, 3),
[4873] partial cds
[4874] gi|1001157|gb|L34699.1|HUMTCRAT[1100157]
[4875] 2091: L34698
[4876] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), complete cds
[4877] gi|1100155|gb|L34698.1|HUMTCRAQ[1100155]
[4878] 2092: L34695
[4879] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR2, 7), partial cds
[4880] gi|1001153|gb|L34695.1|HUMTCRAP[1100153]
[4881] 2093: L34694
[4882] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; C7; DR 1, 3),
[4883] partial cds
[4884] gi|1100151|gb|L34694.1|HUMTCRAO[1100151]
[4885] 2094: L34738
[4886] Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; C7; DR 1, 3),
[4887] partial cds
[4888] gi|1100149|gb|L34738.1|HUMTCRAAX[1100149]
[4889] 2095: L34718
[4890] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4891] gi|1100147|gb|L34718.1|HUMTCRAAW[1100147]
[4892] 2096: L34717
[4893] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4894] gi|100145|gb|L34717.1|HUMTCRAAV[1100145]
[4895] 2097: L34716
[4896] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds
[4897] gi|100143|gb|L34716.1|HUMTCRAAU[1100143]
[4898] 2098: L34715
[4899] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds
[4900] gi|1100141|gb|L34715.1|HUMTCRAAT[1100141]
[4901] 2099: L34714
[4902] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds
[4903] gi|1100139|gb|L34714.1|HUMTCRAAT[1100139]
[4904] 2100: L34713
[4905] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4906] gi|1100137|gb|L34713.1|HUMTCRAAR[1100137]
[4907] 2101: L34712
[4908] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4909] gi|1100135|gb|L34712.1|HUMTCRAAQ[1100135]
[4910] 2102: L34711
[4911] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4912] gi|1100133|gb|L34711.1|HUMTCRAAP[1100133]
[4913] 2103: L34710
[4914] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4915] gi|1100131|gb|L34710.1|HUMTCRAAO[1100131]
[4916] 2104: L34709
[4917] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4918] gi|1100129|gb|L34709.1|HUMTCRAAN[1100129]
[4919] 2105: L34708
[4920] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; DR1, 3), partial cds
[4921] gi|1100127|gb|L34708.1|HUMTCRAAM[1100127]
[4922] 2106: L34707
[4923] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4924] gi|1100125|gb|L34707.1|HUMTCRAAL[1100125]
[4925] 2107: L34706
[4926] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4927] gi|1100123|gb|L34706.1HUMTCRAAK[1100123]
[4928] 2108: L34705
[4929] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4930] gi|1100121|gb|L34705.1|HUMTCRAAJ[1100121]
[4931] 2109: L34704
[4932] Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds
[4933] gi|1100119|gb|L34704.1|HUMTCRAAI[1100119]
[4934] 2110: L29037
[4935] Human T-cell antigen receptor mRNA
[4936] gi|517066|gb|L29037.1|HUMTCRBW[517066]
[4937] 2111: L29038
[4938] Human T-cell antigen receptor mRNA
[4939] gi|456432|gb|L29038.1|HUMTCRBX[456432]
[4940] 2112: L29036
[4941] Human T-cell antigen receptor mRNA
[4942] gi|456431|gb|L29036.1|HUMTCRAX[456431]
[4943] 2113: L29035
[4944] Human T-cell antigen receptor mRNA
[4945] gi|456430|gb|L29035.1|HUMTCRAW[456430]
[4946] 2114: AF106913
[4947] Homo sapiens CRL3 protein (CRL3) mRNA, complete cds
[4948] gi|7221662|gb|AF106913.1|AF106913[17221662]
[4949] 2115: AB055881
[4950] Homo sapiens NKp30 mRNA for natural killer cell receptor, complete cds
[4951] gi|17221621|dbj|AB055881.1|AB055881[17221621]
[4952] 2116: AJ417149
[4953] Homo sapiens partial mRNA for T cell receptor beta chain (TCRB gene), clone 21
[4954] gi|17154680|emb|AJ417149.1|HSA417149[17154680]
[4955] 2117: AJ417148
[4956] Homo sapiens partial mRNA for T cell receptor beta chain (TCRB gene), clone 17
[4957] gi|17148484|emb|AJ417148.1|HSA417148[17148484]
[4958] 2118: NM—054021
[4959] Homo sapiens G protein-coupled receptor 101 (GPR101), mRNA
[4960] gi|16876434|ref|NM—054021.1|[16876434]
[4961] 2119: NM—052939
[4962] Homo sapiens Fc receptor-like protein 3 (FCRH3), mRNA
[4963] gi|16418420|ref|NM—052939.1|[16418420]
[4964] 2120: NM—052938
[4965] Homo sapiens Fc receptor-like protein 1 (FCRH1), mRNA
[4966] gi|16418418|ref|NM—052938.1|[16418418]
[4967] 2121: NM—003823
[4968] Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant M68E, mRNA
[4969] gi|14790166|ref|NM—003823.2|[14790166]
[4970] 2122: NM—006470
[4971] Homo sapiens tripartite motif-containing 16 (TRIM16), mRNA
[4972] gi|14577927|ref|NM—006470.2|[14577927]
[4973] 2123: NM—031918
[4974] Homo sapiens Kruppel-like factor 16 (KLF16), mRNA
[4975] gi|13994286|ref|NM—031918.1|[13994286]
[4976] 2124: NM—023945
[4977] Homo sapiens membrane-spanning 4-domains, subfamily A, member 5 (MS4A5), mRNA
[4978] gi|12965204|ref|NM—023945.1|[12965204]
[4979] 2125: NM—018485
[4980] Homo sapiens G protein-coupled receptor C5L2 (LOC55868), mRNA
[4981] gi|8923872|ref|NM—018485.1|[8923872]
[4982] 2126: NM—016562
[4983] Homo sapiens toll-like receptor 7 (TLR7), mRNA
[4984] gi|7706092|ref|NM—016562.1|[7706092]
[4985] 2130: NM—006138
[4986] Homo sapiens membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) (MS4A3), mRNA
[4987] gi|5453608|ref|NM—006138.1|[5453608]
[4988] 2131: AF447176
[4989] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 20 and complete cds
[4990] gi|17432420|gb|AF447176.1|F447157S11[17432420]
[4991] 2132: AF447175
[4992] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 19
[4993] gi|17432419|gb|AF447175.1|F447157S10[17432419]
[4994] 2133: AF447174
[4995] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 18
[4996] gi|17432418|gb|AF447174.1|F447157S09[17432418]
[4997] 2134: AF447173
[4998] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 17
[4999] gi|17432417|gb|AF447173.1|F447157S08[17432417]
[5000] 2135: AF447171
[5001] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 15 and 16
[5002] gi|17432416|gb|AF447171.1|F447157S07[17432416]
[5003] 2136: AF447170
[5004] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 14
[5005] gi|174324155gb|AF447170.1|F447157S06[17432415]
[5006] 2137: AF447167
[5007] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 11, 12, and 13
[5008] gi|17432414|gb|AF447167.1|F447157S05[17432414]
[5009] 2138: AF447164
[5010] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 8, 9, and 10
[5011] gi|17432413|gb|AF447164.1|F447157S04[17432413]
[5012] 2139: AF447162
[5013] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 6 and 7
[5014] gi|17432412|gb|AF447162.1|F447157S03[17432412]
[5015] 2140: AF447158
[5016] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 2, 3, 4, and 5
[5017] gi|17432411|gb|AF447158.1F447157S02[17432411]
[5018] 2141: AF447157
[5019] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 1
[5020] gi|17432410|gb|AF447157.1|F447157S01[17432410]
[5021] 2142: AH011239
[5022] Homo sapiens protein tyrosine kinase-7 (PTK7) gene, complete cds
[5023] gi|17432409|gb|AH011239.1|SEG_F447157S[17432409]
[5024] 2143: AF374231
[5025] Homo sapiens corticotropin releasing hormone receptor variant 1 h mRNA, partial
[5026] cds, alternatively spliced
[5027] gi|17432316|gb|AF374231.1|AF374231[17432316]
[5028] 2145: AY013309
[5029] Homo sapiens clone FM1-3.3.12A immunoglobulin heavy chain variable region gene,
[5030] partial cdc
[5031] gi|17220530|gb|AY013309.1|[17220530]
[5032] 2146: AY013308
[5033] Homo sapiens clone FL1-2.4.2G immunoglobulin heavy chain variable region gene,
[5034] partial cds
[5035] gi|17220528|gb|AY013308.1|[17220528]
[5036] 2147: AY013307
[5037] Homo sapiens clone FL1-2.4.12A immunoglobulin heavy chain variable region gene,
[5038] partial cds
[5039] gi|17220526|gb|AY013307.1|[17220526]
[5040] 2148: AY013306
[5041] Homo sapiens clone FL3-3.4.4G immunoglobulin heavy chain variable region gene,
[5042] partial cds
[5043] gi|17220524|gb|AY013306.1|[17220524]
[5044] 2149: AB062787
[5045] Homo sapiens mRNA for triggering receptor TREM-2V, complete cds
[5046] gi|17425161|dbj|AB062787.1|AB062787[17425161]
[5047] 2150: NM—003392
[5048] Homo sapiens wingless-type MMTV integration site family, member 5A (WNT5A), mRNA
[5049] gi|17402917|ref|NM—003392.2|[17402917]
[5050] 2152: AJ421518
[5051] Homo sapiens mRNA for tumor necrosis factor-stimulated gene 6 (TSG-6) protein,
[5052] G431 allele
[5053] gi|17402491|emb|A1|AJ421518.1|HSA421518[17402491]
[5054] 2153: NM—053049
[5055] Homo sapiens stresscopin (SPC), mRNA
[5056] gi|16596691|ref|NM—053049.1|[16596691]
[5057] 2154: AF430697
[5058] Homo sapiens T cell receptor beta variable region, Vbeta 13S3-KRGAYETQYF-Jbeta
[5059] 2.5 mRNA, partial cds
[5060] gi|16566919|gb|AF430697.1|AF430697[16566919]
[5061] 2155: AF430696
[5062] Homo sapiens T cell receptor beta variable region, Vbeta 13S2A1T-SEVRETQYF-Jbeta
[5063] 2.5 mRNA, partial cds
[5064] gi|16566916|gb|AF430696.1|AF430696[16566916]
[5065] 2156: AF430695
[5066] Homo sapiens T cell receptor beta variable region, Vbeta 13S3-EKVTGGETQYF-Jbeta
[5067] 2.5 mRNA, partial cds
[5068] gi|16566913|gb|AF430695.1|AF430695[16566913]
[5069] 2157: AF430694
[5070] Homo sapiens T cell receptor beta variable region, Vbeta
[5071] 13S2A1T-QGRTSVIETQYF-Jbeta 2.5 mRNA, partial cds
[5072] gi|16566910|gb|AF430694.1|AF430694[16566910]
[5073] 2158: AF430693
[5074] Homo sapiens T cell receptor beta variable region, Vbeta
[5075] 13S2A1T-RSDRRKTRYF-Jbeta2.5 mRNA, partial cds
[5076] gi|16566907|gb|AF430693.1|AF430693[16566907]
[5077] 2159: AF430692
[5078] Homo sapiens T cell receptor beta variable region, Vbeta 13S3-GRGAQETQYF-Jbeta
[5079] 2.5 mRNA, partial cds
[5080] gi|16566904|gb|AF430692.1|AF430692[16566904]
[5081] 2160: AF430691
[5082] Homo sapiens T cell receptor beta variable region, Vbeta 13S2A1T-GGQTYF-Jbeta 2.5 mRNA, partial cds
[5083] gi|1656690|gb|AF430691.1|AF430691[16566901]
[5084] 2161: AF430690
[5085] Homo sapiens T cell receptor beta variable region, Vbeta 1S1A1N1-SGLTPNTGELFF-Jbeta 2.2 mRNA, partial cds
[5086] gi|16566898|gb|AF430690.1|AF430690[16566898]
[5087] 2162: AF430689
[5088] Homo sapiens T cell receptor beta variable region, Vbeta 13S6A1N1-TSPVPIGTDTQYF-Jbeta 2.3 mRNA, partial cds
[5089] gi|16566895|gb|AF430689.1|AF430689[16566895]
[5090] 2163: AF430688
[5091] Homo sapiens T cell receptor beta variable region, Vbeta 13S3-MFGGSTGELFF-Jbeta
[5092] 2.2 mRNA, partial cds
[5093] gi|16566892|gb|AF430688.1|AF430688[16566892]
[5094] 2164: AF430687
[5095] Homo sapiens T cell receptor beta variable region, Vbeta 13S3-AQGKGTQYF-Jbeta 2.5 mRNA, partial cds
[5096] gi|16566889|gb|AF430687.1|AF430687[16566889]
[5097] 2165: AF430686
[5098] Homo sapiens T cell receptor beta variable region, Vbeta 13 S3-EQGLLSTDTQYF-Jbeta 2.3 mRNA, partial cds
[5099] gi|16566886|gb|AF430686.1|AF430686[16566886]
[5100] 2166: AF430685
[5101] Homo sapiens T cell receptor beta variable region, Vbeta 13S5-ETPGQGAGELFF-Jbeta
[5102] 2.2 mRNA, partial cds
[5103] gi|16566883|gb|AF430685.1|AF430685[16566883]
[5104] 2167: AF430684
[5105] Homo sapiens T cell receptor beta variable region, Vbeta 13S5-RLAGASYNEQYF-Jbeta
[5106] 2.1 mRNA, partial cds
[5107] gi|16566880|gb|AF430684.1|AF430684[16566880]
[5108] 2168: AF430683
[5109] Homo sapiens T cell receptor beta variable region, Vbeta 13S5-DTAGSTDTQYF-Jbeta
[5110] 2.3 mRNA, partial cds
[5111] gi|16566877|gb|AF430683.1|AF430683[16566877]
[5112] 2169: AF430682
[5113] Homo sapiens T cell receptor beta variable region, Vbeta 13S5-EVASGTDTQYF-Jbeta
[5114] 2.3 mRNA, partial cds
[5115] gi|16566874|gb|AF430682.1|AF430682[16566874]
[5116] 2170: AF430681
[5117] Homo sapiens T cell receptor beta variable region, Vbeta S6A3N2T-ASSGGYEQYF-Jbeta 2.7 mRNA, partial cds
[5118] gi|16566871|gb|AF430681.1|AF430681[16566871]
[5119] 2171: AF430680
[5120] Homo sapiens T cell receptor beta variable region, Vbeta 5 S3A1T/S1A1T-RRSDTQYF-Jbeta 2.3 mRNA, partial cds
[5121] gi|16566868|gb|AF430680.1|AF430680[16566868]
[5122] 2172: AF430679
[5123] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-FGGEDTDTQYF-Jbeta 2.3 mRNA, partial cds
[5124] gi|16566865|gb|AF430679.1|AF430679[16566865]
[5125] 2173: AF430678
[5126] Homo sapiens T cell receptor beta variable region, Vbeta 5 S2-FGTRGNEQFF-Jbeta
[5127] 2.7 mRNA, partial cds
[5128] gi|16566862|gb|AF430678.1|AF430678[16566862]
[5129] 2174: AF430677
[5130] Homo sapiens T cell receptor beta variable region, Vbeta 5-FQGARETQYF-Jbeta 2.5
[5131] mRNA, partial cds
[5132] gi|16566859|gb|AF430677.1|AF430677[16566859]
[5133] 2175: AF430676
[5134] Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-FTGTGIYGYTF-Jbeta 1.2 mRNA, partial cds
[5135] gi|16566856|gb|AF430676.1|AF430676[16566856]
[5136] 2176: AF430675
[5137] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-APLTGDSGNTIYF-Jbeta 1.3 mRNA, partial cds
[5138] gi|16566853|gb|AF430675.1|AF430675[16566853]
[5139] 2177: AF430674
[5140] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1TSDLSGANVLTF-Jbeta
[5141] 2.6 mRNA, partial cds
[5142] gi|16566850|gb|AF430674.1|AF430674[16566850]
[5143] 2178: AF430673
[5144] Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-GQGKGTF-Jbeta
[5145] 1.2 mRNA, partial cds
[5146] gi|16566847|gb|AF430673.1|AF430673[16566847]
[5147] 2179: AF430672
[5148] Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-YTGGVWRNQYF-Jbeta 2.5 mRNA, partial cds
[5149] gi|16566844|gb|AF430672.1|AF430672[16566844]
[5150] 2180: AF430671
[5151] Homo sapiens T cell receptor beta variable region, Vbeta 5S2-FSGGAHTQYF-Jbeta 2.3 mRNA, partial cds
[5152] gi|16566841|gb|AF430671.1|AF430671[16566841]
[5153] 2181: AF430670
[5154] Homo sapiens T cell receptor beta variable region, Vbeta 5S2/S6A3N2T-SGQGKTEAFF-Jbeta 1.1 mRNA, partial cds
[5155] gi|16566838|gb|AF430670.1|AF430670[16566838]
[5156] 2182: AF430669
[5157] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-FSKGVTEAFF-Jbeta
[5158] 1.1 mRNA, partial cds
[5159] gi|16566835|gb|AF430669.1|AF430669[16566835]
[5160] 2183: AF430668
[5161] Homo sapiens T cell receptor beta variable region, Vbeta 5S2-SSPTGRSGNTIYF-Jbeta
[5162] 1.3 mRNA, partial cds
[5163] gi|16566832|gb|AF430668.1|AF430668[16566832]
[5164] 2184: AF430667
[5165] Homo sapiens T cell receptor beta variable region, Vbeta 5S4A2T-PLLGQGRDEQFF-Jbeta 2.1 mRNA, partial cds
[5166] gi|16566829|gb|AF430667.1|AF430667[16566829]
[5167] 2185: AF430666
[5168] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-FDFPGELFF-Jbeta
[5169] 2.2 mRNA, partial cds
[5170] gi|16566827|gb|AF430666.1|AF430666[16566827]
[5171] 2186: AF430665
[5172] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-DPSGGYNEQFF-Jbeta 2.1 mRNA, partial cds
[5173] gi|16566824|gb|AF430665.1|AF430665[16566824]
[5174] 2187: AF430664
[5175] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-DATGNLNEQYF-Jbeta 2.7 mRNA, partial cds
[5176] gi|16566821|gb|AF430664.1|AF430664[16566821]
[5177] 2188: AF430663
[5178] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-SGQVTGELFF-Jbeta
[5179] 2.2 mRNA, partial cds
[5180] gi|16566818|gb|AF430663.1|AF430663[16566818]
[5181] 2189: AF430662
[5182] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-AWWGAGYEGYF-Jbeta 2.7 mRNA, partial cds
[5183] gi|16566815|gb|AF430662.1|AF430662[16566815]
[5184] 2190: AF430661
[5185] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-RRLAGVYNEQFF-Jbeta 2.1 mRNA, partial cds
[5186] gi|16566812|gb|AF430661.1|AF430661[16566812]
[5187] 2191: AF430660
[5188] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-EFQAPYGYTF-Jbeta 1.2 mRNA, partial cds
[5189] gi|6566809|gb|AF430660.1|AF430660[16566809]
[5190] 2192: AF430659
[5191] Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-TGTESPDTQYF-Jbeta 2.3 mRNA, partial cds
[5192] gi|16566806|gb|AF430659.1|AF430659[16566806]
[5193] 2193: AF430658
[5194] Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-TFGTPTYNEQFF-Jbeta 2.1 mRNA, partial cds
[5195] gi|16566803|gb|AF430658.1|AF430658[16566803]
[5196] 2194: AF430657
[5197] Homo sapiens T cell receptor beta variable region, Vbeta 5-SGPSTDTQYF-Jbeta 2.3
[5198] mRNA, partial cds
[5199] gi|16566800|gb|AP430657.1|AF430657[16566800]
[5200] 2195: AF430656
[5201] Homo sapiens T cell receptor beta variable region, Vbeta 5S2-NPGGNYGYTF-Jbeta 1.2 mRNA, partial cds
[5202] gi|16566797|gb|AF430656.1|AF430656[16566797]
[5203] 2196: AF430655
[5204] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-VIGTYEQYF-Jbeta
[5205] 2.7 mRNA, partial cds
[5206] gi|6566794|gb|AF430655.1|AF430655[16566794]
[5207] 2197: AF430654
[5208] Homo sapiens T cell receptor beta variable region, Vbeta 5S2-AGGETQYF-J beta
[5209] 2.5
[5210] mRNA, partial cds
[5211] gi|16566791|gb|AF430654.1|AF430654[16566791]
[5212] 2198: AF430653
[5213] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-VSGRGSYEQYF-Jbeta 2.7 mRNA, partial cds
[5214] gi|16566788|gb|AF430653.1|AF430653[16566788]
[5215] 2199: AF430652
[5216] Homo sapiens T cell receptor beta variable region, Vbeta 5S2-VRSEAFF-JBeta 1.1
[5217] mRNA, partial cds
[5218] gi|16566785|gb|AF430652.1|AF430653[16566785]
[5219] 2200: AF430651
[5220] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-RTRTGETNTGELFF-JBeta2.2 mRNA, partial cds
[5221] gi|16566782|gb|AF430651.1|AF430651[16566782]
[5222] 2201: AF430650
[5223] Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-GAGPSGELFF-JBeta 2.2 mRNA, partial cds
[5224] gi|16566779|gb|AF430650.1|AF430650[16566779]
[5225] 2202: AF430649
[5226] Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-GGGTGELFF-Jbeta2.2 mRNA, partial cds
[5227] gi|16566776(gb|AF430649.1|AF430649[16566776]
[5228] 2203: AF430648
[5229] Homo sapiens T cell receptor beta variable region, Vbeta 5S1AT-PGQGAYEQYF-2.7 mRNA, partial cds
[5230] gi|16566773|gb|AF430648.1|AF430648[16566773]
[5231] 2204: AF430647
[5232] Homo sapiens T cell receptor beta variable region, Vbeta 5S2-RPDSGYTF-Jeta1.2 mRNA, partial cds
[5233] gi|6566770|gb|AF430647.1|AF430647[16566770]
[5234] 2205: AF411117
[5235] Homo sapiens G protein-coupled receptor (GPR103) mRNA, complete cds
[5236] gi|16566346|gb|AF411117.1|AF411117[16566346]
[5237] 2206: AF411116
[5238] Homo sapiens G protein-coupled receptor (GPR102) gene, complete cds
[5239] gi|16566343|gb|AF411116.1|AF411116[16566343]
[5240] 2207: AF411115
[5241] Homo sapiens G protein-coupled receptor (GPR101) gene, complete cds
[5242] gi|16566340|gb|AF411115.1|AF411115[16566340]
[5243] 2208: AF411114
[5244] Homo sapiens G protein-coupled receptor (GPR95) mRNA, complete cds
[5245] gi|16566337|gb|AF411114.1|AF411114[16566337]
[5246] 2209: AF411113
[5247] Homo sapiens G protein-coupled receptor (GPR94) gene, complete cds
[5248] gi|16566334|gb|AF411113.1|AF411113[16566334]
[5249] 2210: AF411112
[5250] Homo sapiens G protein-coupled receptor (GPR93) gene, complete cds
[5251] gi|16566331|gb|AF411112.1|AF411112[16566331]
[5252] 2211: AF411111
[5253] Homo sapiens G protein-coupled receptor (GPR82) gene, complete cds
[5254] gi|16566328|gb|AF411111.1|AF411111[16566328]
[5255] 2212: AF411110
[5256] Homo sapiens G protein-coupled receptor (GPR81) gene, complete cds
[5257] gi|16566325|gb|AF411110.1|AF411110[16566325]
[5258] 2213: AF411109
[5259] Homo sapiens G protein-coupled receptor (GPR80) gene, complete cds
[5260] gi|16566322|gb|AF411109.1|AF411109[16566322]
[5261] 2215: AF411107
[5262] Homo sapiens G protein-coupled receptor (GPR78) mRNA, complete cds
[5263] gi|1656631B|gb|AF411107.1|AF411107[16566318]
[5264] 2216: AF406692
[5265] Homo sapiens G protein-coupled receptor GPR86 mRNA, complete cds
[5266] gi|5487985|gb|AF406692.1|AF406692[15487985]
[5267] 2217: NM—019035
[5268] Homo sapiens protocadherin 18 (PCDH18), mRNA
[5269] gi|14589928|ref|NM—019035.1|[14589928]
[5270] 2218: AF214012
[5271] Homo sapiens prolactin receptor gene, exon 11 and partial sequence
[5272] gi|14328908|gb|AF214012.1|AF214012[14328908]
[5273] 2219: NM—030943
[5274] Homo sapiens amnionless protein (AMN), mRNA
[5275] gi|13569914|ref|NM—030943.1|[13569914]
[5276] 2220: NM—023922
[5277] Homo sapiens taste receptor, type 2, member 14 (TAS2R14), mRNA
[5278] gi|12965181|ref|NM—023922.1|[12965181]
[5279] 2221: NM—023921
[5280] Homo sapiens taste receptor, type 2, member 10 (TAS2R10), mRNA
[5281] gi|12965179|ref|NM—023921.1|[12965179]
[5282] 2222: NM—023920
[5283] Homo sapiens taste receptor, type 2, member 13 (TAS2R13), mRNA
[5284] gi|12965177|ref|NM—023920.1|[12965177]
[5285] 2223: NM—023919
[5286] Homo sapiens taste receptor, type 2, member 7 (TAS2R7), mRNA
[5287] gi|12965175|ref|NM—023919.1|[12965175]
[5288] 2224: NM—023918
[5289] Homo sapiens taste receptor, type 2, member 8 (TAS2R8), mRNA
[5290] gi|12965173|ref|NM—023918.1|[12965173]
[5291] 2225: NM—023917
[5292] Homo sapiens taste receptor, type 2, member 9 (TAS2R9), mRNA
[5293] gi|12965171|ref|NM—023917.1|[12965171]
[5294] 2226: AF206696
[5295] Homo sapiens interleukin-1 epsilon (IL1E) mRNA, complete cds
[5296] gi|11493847|gb|AF206696.1|AF206696[11493847]
[5297] 2227: AF230377
[5298] Homo sapiens interleukin-1 delta mRNA, complete cds
[5299] gi|9651788|gb|AF230377.1|AF230377[9651788]
[5300] 2228: BC018284
[5301] Homo sapiens, triggering receptor expressed on myeloid cells 2, clone IMAGE:4151400, mRNA
[5302] gi|17390669|gb|BC018284.1|BC018284[17390669]
[5303] 2229: BC018130
[5304] Homo sapiens, coagulation factor II (thrombin) receptor-like 1, clone MGC:9298
[5305] IMAGE:3895653, mRNA, complete cds
[5306] gi|17390291|gb|BC018130.1|BC018130[17390291]
[5307] 2230: BC017898
[5308] Homo sapiens, Purinergic receptor P2Y, G protein-coupled, 12, clone MGC:23802 IMAGE:4251263, mRNA, complete cds
[5309] gi|17389766|gb|BC017898.1|BC017898[17389766]
[5310] 2231: BC017865
[5311] Homo sapiens, Fc fragment of IgG, low affinity 111a, receptor for (CD16), clone
[5312] MGC:22630 IMAGE:4690249, mRNA, complete cds
[5313] gi|17389687|gb|BC017865.1|BC017865[17389687]
[5314] 2232: BC017852
[5315] Homo sapiens, tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain, clone IMAGE:4700855, mRNA
[5316] gi|17389657|gb|BC017852.1|BC017852[17389657]
[5317] 2233: BC017784
[5318] Homo sapiens, killer cell lectin-like receptor subfamily C, member 4, clone MGC:22279 IMAGE:4619154, mRNA, complete cds
[5319] gi|17389488|gb|BC017784.1|BC017784[17389488]
[5320] 2234: BC017773
[5321] Homo sapiens, triggering receptor expressed on myeloid cells 1, clone MGC:22242
[5322] IMAGE:4692680, mRNA, complete cds
[5323] gi|17389458|gb|BC017773.1|BC017773[17389458]
[5324] 2235: BC017730
[5325] Homo sapiens, tumor necrosis factor receptor superfamily, member 21, clone MGC:21476 IMAGE:3847246, mRNA, complete cds
[5326] gi|17389378|gb|BC017730.1|BC017730[17389378]
[5327] 2237: AJ252246
[5328] Homo sapiens mRNA for kainate receptor subunit (GRIK2 gene)
[5329] gi|17384623|emb|AJ252246.1|HSA252246[17384623]
[5330] 2238: AJ249210
[5331] Homo sapiens mRNA for glutamate/kainate receptor subtype GluR7 (GRIK3 gene)
[5332] gi|17384612|emb|AJ249210.1|HSA249210[17384612]
[5333] 2239: AJ249209
[5334] Homo sapiens mRNA for glutamate/kainate receptor subunit KA2a (GRIK5 gene)
[5335] gi|17384610|emb|AJ249209.1|HSA249209[17384610]
[5336] 2240: AJ249208
[5337] Homo sapiens mRNA for glutamate receptor subunit GluR5 (GRIK1 gene)
[5338] gi|17384608|emb|AJ249208.1|HSA249208[17384608]
[5339] 2241: AJ415410
[5340] Homo sapiens partial IGVK1-O14 gene for immunoglobulin kappa chain variable region, donor MF, cell24
[5341] gi|17384019|emb|AJ415410.2|HSA415410[17384019]
[5342] 2242: AJ415291
[5343] Homo sapiens partial IGVH3-33 gene for immunoglobulin heavy chain variable region, donor TG, cell46
[5344] gi|17384018|emb|AJ415291.2|HSA415291[17384018]
[5345] 2243: AJ414840
[5346] Homo sapiens partial IGVKA30 gene for immunoglobulin kappa chain variable region, donor MF, cell2
[5347] gi|17384017|emb|AJ414840.2|HSA414840[17384017]
[5348] 2244: NM—000623
[5349] Homo sapiens bradykinin receptor B2 (BDKRB2), mRNA
[5350] gi|17352499|ref|NM—000623.2|[17352499]
[5351] 2246: AJ347709
[5352] Homo sapiens mRNA for FKBP-associated protein
[5353] gi|15620770|emb|AJ347709.1|HSA347709[15620770]
[5354] 2247: AF356518
[5355] Homo sapiens junctional adhesion molecule 3 precursor, mRNA, complete cds
[5356] gi|13448824|gb|AF356518.1|AF356518[13448824]
[5357] 2248: NM—021201
[5358] Homo sapiens membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), mRNA
[5359] gi|11139298|ref|NM—021201.1|[11139298]
[5360] 2249: NM—015344
[5361] Homo sapiens leptin receptor overlapping transcript-like 1 (LEPROTL1), mRNA
[5362] gi|7662509|ref|NM—015344.1|[7662509]
[5363] 2250: AF411850
[5364] Homo sapiens C-type lectin-like receptor CLEC-6 mRNA, complete cds
[5365] gi|17226267|gb|AF411850.1|AF411850[17226267]
[5366] 2251: AF325460
[5367] Homo sapiens dendritic lectin b isoform (CLECSF11) mRNA, complete cds, alternatively spliced
[5368] gi|17225338|gb|AF325460.1|AF325460[17225338]
[5369] 2252: AF325459
[5370] Homo sapiens dendritic lectin (CLECSF11) mRNA, complete cds, alternatively spliced
[5371] gi|17225336|gb|AF325459.1|AF325459[17225336]
[5372] 2253: AF293357
[5373] Homo sapiens AT2 receptor-interacting protein 1 mRNA, complete cds
[5374] gi|17224595|gb|AF293357.1|AF293357[17224595]
[5375] 2254: AF283988
[5376] Homo sapiens leukocyte immunoglobulin-like receptor-5 (LILRB5) mRNA, LILRB5-v1
[5377] allele, complete cds
[5378] gi|17224473|gb|AF283988.1|AF283988[17224473]
[5379] 2255: AF283987
[5380] Homo sapiens leukocyte immunoglobulin-like receptor-2 (LILRB2) mRNA, LILRB2-v2
[5381] allele, complete cds
[5382] gi|17224471|gb|AF283987.1|AF283987[17224471]
[5383] 2256: AF283986
[5384] Homo sapiens leukocyte immunoglobulin-like receptor-2 (LILRB2) mRNA, LILRB2-v1
[5385] allele, complete cds
[5386] gi|17224469|gb|AF283986.1|AF283986[17224469]
[5387] 2257: AF283985
[5388] Homo sapiens leukocyte immunoglobulin-like receptor-1 (LILRB1) mRNA, LILRB1-v2
[5389] allele, complete cds
[5390] gi|17224467|gb|AF283985.1|AF283985[17224467]
[5391] 2258: AF283984
[5392] Homo sapiens leukocyte immunoglobulin-like receptor-1 (LILRB1) mRNA, LILRB1-v1
[5393] allele, complete cds
[5394] gi|17224465|gb|AF283984.1|AF283984[17224465]
[5395] 2259: NM—057170
[5396] Homo sapiens G protein-coupled receptor kinase-interactor 2 (GIT2), transcript
[5397] variant 2, mRNA
[5398] gi|17149831|ref|NM—057170.1|[17149831]
[5399] 2260: NM—057169
[5400] Homo sapiens G protein-coupled receptor kinase-interactor 2 (GIT2), transcript
[5401] variant 1, mRNA
[5402] gi|17149829|ref|NM—057169.1|[17149829]
[5403] 2261: AJ417151
[5404] Homo sapiens partial mRNA for T cell receptor beta chain (TCRB gene), clone 25
[5405] gi|17148488|emb|AJ417151.1|HSA417151[17148488]
[5406] 2262: AJ417150
[5407] Homo sapiens partial mRNA for T cell receptor beta chain (TCRB gene), clone 27
[5408] gi|17148486|emb|AJ417150.1|HSA417150[17148486]
[5409] 2263: NM—014776
[5410] Homo sapiens G protein-coupled receptor kinase-interactor 2 (GIT2), transcript
[5411] variant 3, mRNA
[5412] gi|7661943|ref|NM—014776.1|[7661943]
[5413] 2264: AJ239326
[5414] Homo sapiens chromosome 21 clone cosmid LLNLc116 32E2 map 21q22.3, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces
[5415] gi|6982097|emb|AJ239326.3|HSS171M[6982097]
[5416] 2265: NM—000675
[5417] Homo sapiens adenosine A2a receptor (ADORA2A), mRNA
[5418] gi|17136146|ref|NM—000675.3|[17136146]
[5419] 2266: AF035374
[5420] Homo sapiens Cys-rich protein (RAMP) mRNA, complete cds
[5421] gi|2665702|gb|AF035374.1|AF035374[2665702]
[5422] 2267: AF282269
[5423] Homo sapiens G protein-coupled receptor kinase 7 mRNA, complete cds
[5424] gi|17026317|gb|AF282269.1|AF282269[17026317]
[5425] 2268: AF437510
[5426] Homo sapiens T-cell receptor beta-chain mRNA, partial cds
[5427] gi|16974744|gb|AF437510.1|AF437510[16974744]
[5428] 2269: AX286800
[5429] Sequence 35 from Patent WO0178796
[5430] gi|17048833|emb|AX286800.1|AX286800[17048833]
[5431] 2270: AX286799
[5432] Sequence 34 from Patent WO0178796
[5433] gi|17048832|emb|AX286799.1|AX286799[17048832]
[5434] 2271: AB005145
[5435] Homo sapiens CL-P1 mRNA for collectin placenta 1, complete cds
[5436] gi|17026100|dbj|AB005145.1|AB005145[17026100]
[5437] 2272: SEG_HUMIL3RA
[5438] Homo sapiens gene for interleukin 3 receptor alpha subunit
[5439] gi|1345401|dbj||SEG_HUMIL3RA[1345401]
[5440] 2273: L34720
[5441] Homo sapiens T-cell receptor beta (TCRB) mRNA, partial cds
[5442] gi|1100194|gb|L34720.1|HUMTCRBP[1100194]
[5443] 2274: L34734
[5444] Homo sapiens T-cell receptor beta (TCRB) mRNA, complete cds
[5445] gi|1100181|gb|L34734.1|HUMTCRBAL[1100181]
[5446] 2275: L34729
[5447] Homo sapiens T-cell receptor beta (TCRB) mRNA, partial cds
[5448] gi|110017|gb|L34729.1|HUMTCRBAG[1100171]
[5449] 2276: D49412
[5450] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 11
[5451] gi|684969|dbj|D49412.1|HUMIL3RA11[684969]
[5452] 2277: D49410
[5453] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 12 and partial
[5454] cds
[5455] gi|684968|dbj|D49410.1|HUMIL3RA12[684968]
[5456] 2278: D49408
[5457] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 10
[5458] gi|684967|dbj|D49408.1|HUMIL3RA10[684967]
[5459] 2279: D49409
[5460] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 6
[5461] gi|684966|dbj|D549409.1|HUMIL3RA06[684966]
[5462] 2280: D49407
[5463] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 4
[5464] gi|684965|dbj|D549407.1|HUMIL3RA04[684965]
[5465] 2281: D49406
[5466] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 2
[5467] gi|684964|dbj|D549406.1|HUMIL3RA02[684964]
[5468] 2282: D49404
[5469] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 7
[5470] gi|684963|dbj|D549404.1|HUMIL3RA07[684963]
[5471] 2283: D49403
[5472] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 5
[5473] gi|684962|dbj|D549403.1|HUMIL3RA05[684962]
[5474] 2284: D49402
[5475] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 3
[5476] gi|684961|dbj|D549402.1|HUMIL3RA03[684961]
[5477] 2285: D49401
[5478] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 1
[5479] gi|684960|dbj|D549401.1|HUMIL3RA01[684960]
[5480] 2286: D49411
[5481] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 9
[5482] gi|684959|dbj|D549411.1|HUMIL3RA09[684959]
[5483] 2287: D49405
[5484] Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 8
[5485] gi|684958|dbj|D49405.1|HUMIL3RA08[684958]
[5486] 2288: SEG_HUMGRAS
[5487] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5488] receptor alpha subunit
[5489] gi|522101|dbj||SEG_HUMGRAS[522101]
[5490] 2289: D26625
[5491] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5492] receptor alpha subunit, exon 10
[5493] gi|467508|dbj|D526625.1|HUMGRAS10[467508]
[5494] 2290: D26624
[5495] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5496] receptor alpha subunit, exon 9
[5497] gi|467507|dbj|D526624.1|HUMGRAS09[467507]
[5498] 2291: D26623
[5499] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5500] receptor alpha subunit, exon 8
[5501] gi|467506|dbj|D526623.1|HUMGRAS08[467506]
[5502] 2292: D26622
[5503] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5504] receptor alpha subunit, exon 7
[5505] gi|467505|dbj|D526622.1|HUMGRAS07[467505]
[5506] 2293: D26621
[5507] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5508] receptor alpha subunit, exon 6
[5509] gi|467504|dbj|D526621.1|HUMGRAS06[467504]
[5510] 2294: D26628
[5511] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5512] receptor alpha subunit, exon 13 and partial cds
[5513] gi|456594|dbj|D526628.1|HUMGRAS13[456594]
[5514] 2295: D26627
[5515] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5516] receptor alpha subunit, exon 12
[5517] gi|456593|dbj|D526627.1|HUMGRAS12[456593]
[5518] 2296: D26626
[5519] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5520] receptor alpha subunit, exon 11
[5521] gi|456592|dbj|D526626.1|HUMGRAS11[456592]
[5522] 2297: D26620
[5523] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5524] receptor alpha subunit, exon 5
[5525] gi|456591|dbj|D526620.1|HUMGRAS05[456591]
[5526] 2298: D26619
[5527] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5528] receptor alpha subunit, exon 4
[5529] gi|456590|dbj|D526619.1|HUMGRAS04[456590]
[5530] 2299: D26618
[5531] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5532] receptor alpha subunit, exon 3
[5533] gi|456589|dbj|D526618.1|HUMGRAS03[456589]
[5534] 2300: D26617
[5535] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5536] receptor alpha subunit, exon 2
[5537] gi|456588|dbj|D526617.1|HUMGRAS02[456588]
[5538] 2301: D26616
[5539] Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF)
[5540] receptor alpha subunit, exon 1
[5541] gi|456587|dbj|D526616.1|HUMGRAS01[456587]
[5542] 2307; AF324499
[5543] Homo sapiens olfactory-like receptor mRNA, complete cds
[5544] gi|17016397|gb|AF324499.1|AF324499[17016397]
[5545] 2308: AF308814
[5546] Homo sapiens olfactory receptor-like protein (JCG10) mRNA, partial cds
[5547] gi|17016395|gb|AF308814.1|AF308814[17016395]
[5548] 2309: AF238488
[5549] Homo sapiens olfactory-like receptor JCG8 (JCG8) mRNA, complete cds
[5550] gi|17016318|gb|AF238488.1JAF238488[17016318]
[5551] 2310: AF238487
[5552] Homo sapiens olfactory-like receptor PJCG2 (PJCG2) mRNA, partial cds
[5553] gi|17016316|gb|AF238487.1|AF238487[17016316]
[5554] 2311: AF220494
[5555] Homo sapiens olfactory receptor-like protein JCG4 (JCG4) mRNA, partial cds
[5556] gi|17016314|gb|AF220494.1|AF220494[17016314]
[5557] 2312: AF220493
[5558] Homo sapiens olfactory receptor-like protein PJCG1 (PJCG1) mRNA, partial cds
[5559] gi|17016312|gb|AF220493.1|AF220493[17016312]
[5560] 2313: AF209507
[5561] Homo sapiens olfactory receptor-like protein mRNA, complete sequence
[5562] gi|17016311|gb|AF209507.1|AF209507[17016311]
[5563] 2314: AF403014
[5564] Homo sapiens type II gonadotropin-releasing hormone receptor gene, partial cds
[5565] gi|16589055|gb|AF403014.1|AF403014[16589055]
[5566] 2316: AF403012
[5567] Homo sapiens ribonucleoprotein RBM8 gene, complete cds
[5568] gi|1658905|gb|AF403012.1|AF403012[16589051]
[5569] 2317: AY011601
[5570] Homo sapiens cannabinoid receptor 1 (CNR1) gene, partial cds
[5571] gi|12699807|gb|AY011601.1|[12699807]
[5572] 2318: AY011231
[5573] Homo sapiens adenosine A3 receptor (ADORA3) gene, partial cds
[5574] gi|12699245|gb|AY011231.1|[12699245]
[5575] 2319: AF400602
[5576] Homo sapiens beta-glucan receptor isoform H (BGR) mRNA, complete cds, alternatively spliced
[5577] gi|15986713|gb|AF400602.1|AF400602[15986713]
[5578] 2320: AF400601
[5579] Homo sapiens beta-glucan receptor isoform G (BGR) mRNA, complete cds, alternatively spliced
[5580] gi|15986711|gb|AF400601.1|AF400601[15986711]
[5581] 2321: AF400600
[5582] Homo sapiens beta-glucan receptor isoform F (BGR) mRNA, complete cds, alternatively spliced
[5583] gi|15986709|gb|AF400600.1|AF400600[15986709]
[5584] 2322: AF400599
[5585] Homo sapiens beta-glucan receptor isoform E (BGR) mRNA, complete cds, alternatively spliced
[5586] gi|15986707|gb|AF400599.1|AF400599[15986707]
[5587] 2323: AF400598
[5588] Homo sapiens beta-glucan receptor isoform D (BGR) mRNA, complete cds, alternatively spliced
[5589] gi|15986705|gb|AF400598.1|AF400598[15986705]
[5590] 2324: AF400597
[5591] Homo sapiens beta-glucan receptor isoform C (BGR) mRNA, complete cds, alternatively spliced
[5592] gi|15986703|gb|AF400597.1|AF400597[15986703]
[5593] 2325: AF400596
[5594] Homo sapiens beta-glucan receptor isoform B (BGR) mRNA, complete cds, alternatively spliced
[5595] gi|15986701|gb|AF400596.1|AF400596[15986701]
[5596] 2326: AF400595
[5597] Homo sapiens beta-glucan receptor isoform A (BGR) mRNA, complete cds, alternatively spliced
[5598] gi|15986699|gb|AF400595.1|AF400595[15986699]
[5599] 2329: AF162669
[5600] Homo sapiens olfactory receptor-like protein JCG2 (JCG2) gene, complete cds
[5601] gi|12002783|gb|AF162669.1|AF162669[12002783]
[5602] 2330: NM—004895
[5603] Homo sapiens cold autoinflammatory syndrome 1 (CIAS1), mRNA
[5604] gi|4757727|ref|NM—004895.1|[4757727]
[5605] 2331: AF409103
[5606] Homo sapiens T-cell receptor VB3 CDR3 region mRNA, partial cds
[5607] gi|15425973|gb|AF409103.1|AF409103[15425973]
[5608] 2332: NM—033181
[5609] Homo sapiens cannabinoid receptor 1 (brain) (CNR1), transcript variant 3, mRNA
[5610] gi|15208647|ref|NM—033181.1|[15208647]
[5611] 2333: AF373846
[5612] Homo sapiens BAFF receptor mRNA, complete cds
[5613] gi|15208474|gb|AF373846.1|AF373846[15208474]
[5614] 2334: AF361108
[5615] Homo sapiens CRHF2 receptor beta-isoform mRNA, partial sequence, aberrantly spliced
[5616] gi|14586959|gb|AF361108.1|AF361108[14586959]
[5617] 2335: NM—005755
[5618] Homo sapiens Epstein-Barr virus induced gene 3 (EBI3), mRNA
[5619] gi|14577916|ref|NM—005755.2|[14577916]
[5620] 2336: AF369794
[5621] Homo sapiens B cell crosslinked IgM-activating sequence protein (BXMAS1) mRNA,
[5622] complete cds
[5623] gi|14278718|gb|AF369794.2|AF369794[14278718]
[5624] 2337: AF376725
[5625] Homo sapiens lung seven transmembrane receptor 1 (LUSTR1) mRNA, complete cds
[5626] gi|14248996|gb|AF376725.1|AF376725[14248996]
[5627] 2343: AF352324
[5628] Homo sapiens killer cell Ig-like receptor KIR3DL7 (KIRC1) mRNA, complete cds
[5629] gi|13560903|gb|AF352324.1|AF352324[13560903]
[5630] 2344: AJ249131
[5631] Homo sapiens partiel mPR gene for progesterone membrane binding protein
[5632] gi|6688178|emb|AJ249131.1|HSA249131[6688178]
[5633] 2345: S73474
[5634] Homo sapiens folate receptor alpha isoform mRNA, partial cds
[5635] gi|688233|gb|S73474.1|S73490S2[688233]
[5636] 2346: S73490
[5637] Homo sapiens folate receptor alpha isoform mRNA, partial cds
[5638] gi|688232|gb|S73490.1|S73490S1[688232]
[5639] 2347: S69142
[5640] Homo sapiens T-cell receptor alpha-chain (TcR V alpha) mRNA, partial cds
[5641] gi|545977|gb|S69142.1|S69142[545977]
[5642] 2348: S67401
[5643] Homo sapiens T-cell receptor beta chain VDJ region (TCR Vbeta 7.1 Jbeta 2.3) mRNA, partial cds
[5644] gi|455870gb|S67401.1|S67401[455870]
[5645] 2349: S62797
[5646] Homo sapiens T cell receptor beta chain VDJ region (TcrVbeta 6) mRNA, TcrVbeta
[5647] 6.7a allele, partial cds
[5648] gi|385951|gb|S62797.1|S62797[385951]
[5649] 2350: AF310685
[5650] Homo sapiens ADP-glucose receptor gene, complete cds
[5651] gi|16973448|gb|AF310685.1|AF310685[16973448]
[5652] 2351: NM—057160
[5653] Homo sapiens artemin (ARTN), transcript variant 3, mRNA
[5654] gi|16950644|ref|NM—057160.1|[16950644]
[5655] 2352: NM—057091
[5656] Homo sapiens artemin (ARTN), transcript variant 2, mRNA
[5657] gi|16950642|ref|NM—057091.1|[16950642]
[5658] 2353: NM—057090
[5659] Homo sapiens artemin (ARTN), transcript variant 4, mRNA
[5660] gi|16950640|ref|NM—057090.1|[16950640]
[5661] 2354: NM—003976
[5662] Homo sapiens artemin (ARTN), transcript variant 1, mRNA
[5663] gi|16950639|ref|NM—003976.2|[16950639]
[5664] 2355: NM—053032
[5665] Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 8, mRNA
[5666] gi|16950624|ref|NM—053032.1|[16950624]
[5667] 2356: NM—053031
[5668] Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 7, mRNA
[5669] gi|16950622|ref|NM—053031.1|[16950622]
[5670] 2357: NM—053030
[5671] Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 5, mRNA
[5672] gi|16950620|ref|NM—053030.1|[16950620]
[5673] 2358: NM—053029
[5674] Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 4, mRNA
[5675] gi|16950618|ref|NM—053029.1|[16950618]
[5676] 2359: NM—053028
[5677] Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 3B, mRNA
[5678] gi|16950616|ref|NM—053028.1|[16950616]
[5679] 2360: NM—053027
[5680] Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 3A, mRNA
[5681] gi|16950614|ref|NM—053027.1|[16950614]
[5682] 2361: NM—053026
[5683] Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 2, mRNA
[5684] gi|16950612|ref|NM—053026.1|[16950612]
[5685] 2362: NM—053025
[5686] Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 1, mRNA
[5687] gi|16950610|ref|NM—053025.1|[16950610]
[5688] 2363: NM—005965
[5689] Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 6, mRNA
[5690] gi|16950600|ref|NM—005965.2|[16950600]
[5691] 2364: AF106202
[5692] Homo sapiens endothelial cell protein C receptor precursor (EPCR) gene, promoter
[5693] region and complete cds
[5694] gi|16950557|gb|AF106202.2|AF106202[16950557]
[5695] 2365: AY033942
[5696] Homo sapiens prostate-specific G protein-coupled receptor (PSGR) mRNA, complete
[5697] cds
[5698] gi|16943640|gb|AY033942.1|[16943640]
[5699] 2366: AF369708
[5700] Homo sapiens prostate-specific G-protein coupled receptor mRNA, complete cds
[5701] gi|13752563|gb|AF369708.1|AF369708[13752563]
[5702] 2368: AJ276204
[5703] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-8
[5704] gi|9968287|emb|AJ276204.1|HSA276204[9968287]
[5705] 2369: AJ276203
[5706] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-7
[5707] gi|9968285|emb|AJ276203.1|HSA276203[9968285]
[5708] 2370: AJ276202
[5709] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-6
[5710] gi|9968266|emb|AJ276202.1|HSA276202[9968266]
[5711] 2371: AJ276201
[5712] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-5
[5713] gi|9968264|emb|AJ276201.1|HSA276201[9968264]
[5714] 2372: AJ276200
[5715] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-4
[5716] gi|9968262|emb|AJ276200.1|HSA276200[9968262]
[5717] 2373: AJ276199
[5718] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-3
[5719] gi|9968260|emb|AJ276199.1|HSA276199[9968260]
[5720] 2374: AJ276198
[5721] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-2
[5722] gi|9968258|emb|AJ276198.1|HSA276198[9968258]
[5723] 2375: AJ276197
[5724] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-1
[5725] gi|9968256|emb|AJ276197.1|HSA276197[9968256]
[5726] 2376: AJ276196
[5727] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Gel-C
[5728] gi|9968254|emb|AJ276196.1|HSA276196[9968254]
[5729] 2377: AJ276195
[5730] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-11
[5731] gi|9968252|emb|AJ276195.1|HSA276195[9968252]
[5732] 2378: AJ276194
[5733] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-10
[5734] gi|9968250|emb|AJ276194.1|HSA276194[9968250]
[5735] 2379: AJ276193
[5736] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-9
[5737] gi|9968248|emb|AJ276193.1|HSA276193[9968248]
[5738] 2380: AJ276192
[5739] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-8
[5740] gi|9968246|emb|AJ276192.1|HSA276192[9968246]
[5741] 2381: AJ276191
[5742] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-7
[5743] gi|9968244|emb|AJ276191.1|HSA276191[9968244]
[5744] 2382: AJ276190
[5745] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-6
[5746] gi|9968242|emb|AJ276190.1|HSA276190[9968242]
[5747] 2383: AJ276189
[5748] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-5
[5749] gi|9968240|emb|AJ276189.1|HSA276189[9968240]
[5750] 2384: AJ276188
[5751] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-4
[5752] gi|9968238|emb|AJ276188.1|HSA276188[9968238]
[5753] 2385: AJ276187
[5754] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-3
[5755] gi|9968236|emb|AJ276187.1|HSA276187[9968236]
[5756] 2386: AJ276186
[5757] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-2
[5758] gi|9968234|emb|AJ276186.1|HSA276186[9968234]
[5759] 2387: AJ276185
[5760] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-1
[5761] gi|9968232|emb|AJ276185.1|HSA276185[9968232]
[5762] 2388: AJ276184
[5763] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Gel-A2
[5764] gi|9968230|emb|AJ276184.1|HSA276184[9968230]
[5765] 2389: AJ276183
[5766] Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Gel-A1
[5767] gi|9968228|emb|AJ276183.1|HSA276183[9968228]
[5768] 2390: NM—005086
[5769] Homo sapiens sarcospan (Kras oncogene-associated gene) (SSPN), mRNA
[5770] gi|16933560|ref|NM—005086.3|[16933560]
[5771] 2391: NM—018153
[5772] Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 3, mRNA
[5773] gi|16933552|ref|NM—018153.2|[16933552]
[5774] 2392: NM—053034
[5775] Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 2, mRNA
[5776] gi|16933550|ref|NM—053034.1|[16933550]
[5777] 2393: NM—005929
[5778] Homo sapiens antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 1, mRNA
[5779] gi|16933549|ref|NM—005929.3|[16933549]
[5780] 2394: NM—033316
[5781] Homo sapiens antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 2, mRNA
[5782] gi|16933548|ref|NM—033316.2|[16933548]
[5783] 2395: AF361473
[5784] Homo sapiens magic roundabout mRNA, complete cds
[5785] gi|16930357|gb|AF361473.1|AF361473[16930357]
[5786] 2396: NM—032208
[5787] Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 1, mRNA
[5788] gi|14149903|ref|NM—032208.1|[14149903]
[5789] 2397: NM—007346
[5790] Homo sapiens opioid growth factor receptor (OGFR), mRNA
[5791] gi|6671492|ref|NM—007346.1|[6671492]
[5792] 2398: BC017412
[5793] Homo sapiens, leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2, clone MGC:27265 IMAGE:4618777, mRNA, complete cds
[5794] gi|16924270|gb|BC017412.1|BC017412[16924270]
[5795] 2401: AF435588
[5796] Homo sapiens melatonin receptor Me11a (MTNR1A) mRNA, partial cds
[5797] gi|16904202|gb|AF435588.1|AF435588[16904202]
[5798] 2402: AF421380
[5799] Homo sapiens anthrax toxin receptor mRNA, complete cds
[5800] gi|16566412|gb|AF421380.1|AF421380[16566412]
[5801] 2403: AF291815
[5802] Homo sapiens NK cell receptor (CS1) mRNA, complete cds
[5803] gi|113021809 gb|AF291815.1|AF291815[13021809]
[5804] 2404: AF117899
[5805] Homo sapiens LDLR-FUT fusion protein (LDLR-FUT) mRNA, complete cds
[5806] gi|6739499|gb|AF117899.1|AF117899[6739499]
[5807] 2405: AF054013
[5808] Homo sapiens lipoxin A4 receptor mRNA, complete cds
[5809] gi|3047268|gb|AF054013.1|AF054013[3047268]
[5810] 2406: AF013250
[5811] Homo sapiens leukocyte-associated Ig-like receptor-2 (LAIR-2) mRNA, complete cds
[5812] gi|2352942|gb|AF013250.1|AF013250[2352942]
[5813] 2407: AF013249
[5814] Homo sapiens leukocyte-associated Ig-like receptor-1 (LAIR-1) mRNA, complete cds
[5815] gi|2352940gb|AF013249.1|AF013249[2352940]
[5816] 2409: AF326353
[5817] Homo sapiens Src-like adapter protein-2 mRNA, complete cds
[5818] gi|16797891|gb|AF326353.1|AF326353[16797891]
[5819] 2411: BC017065
[5820] Homo sapiens, tumor necrosis factor receptor superfamily, member 6b, decoy, clone MGC:9587 IMAGE:3886635, mRNA, complete cds
[5821] gi|16877637|gb|BC017065.1|BC017065[16877637]
[5822] 2412: BC016938
[5823] Homo sapiens, neuromedin U receptor 2, clone MGC:21396 IMAGE:3852151, mRNA, complete cds
[5824] gi|16877376|gb|BC016938.1|BC016938[16877376]
[5825] 2413: BC016860
[5826] Homo sapiens, G protein-coupled receptor, family C, group 5, member C, clone MGC:17384 IMAGE:3904655, mRNA, complete cds
[5827] gi|16877192|gb|BC016860.1|BC016860[16877192]
[5828] 2414: BC016692
[5829] Homo sapiens, progesterone receptor membrane component 2, clone MGC:22407 IMAGE:4067832, mRNA, complete cds
[5830] gi|16876813|gb|BC016692.1|BC016692[16876813]
[5831] 2415: AY026949
[5832] Homo sapiens stresscopin mRNA, complete cds
[5833] gi|15026913|gb|AY026949.1|[15026913]
[5834] 2416: AF285092
[5835] Homo sapiens Bcl-2-like protein 10 mRNA, complete cds
[5836] gi|9837265|gb|AF285092.1|AF285092[9837265]
[5837] 2417: D78579
[5838] Homo sapiens NOR-1 mRNA for neuron derived orphan receptor, complete cds
[5839] gi|1651190|dbj|D78579.1|D78579[1651190]
[5840] 2418: D38044
[5841] Homo sapiens gene for Ah-receptor, partial cds, exons 7-9
[5842] gi|532672|dbj|D538044.1|HUMAHRA[532672]
[5843] 2419: NM—053278
[5844] Homo sapiens G protein-coupled receptor 102 (GPR102), mRNA
[5845] gi|16751916|ref|NM—053278.1|[16751916]
[5846] 2420: NM—030916
[5847] Homo sapiens Ig superfamily receptor LNIR (LNIR), mRNA
[5848] gi|16716338|ref|NM—030916.1|[16716338]
[5849] 2421: AF403479
[5850] Homo sapiens EWS/FLI1 activated transcript 2 protein mRNA, complete cds
[5851] gi|16611777|gb|AF403479.1|AF403479[16611777]
[5852] 2422: NM—053036
[5853] Homo sapiens G protein-coupled receptor 74 (GPR74), mRNA
[5854] gi|16604257|gb|BC053036.1|BC016004[16604257]
[5855] 2431: BC016004
[5856] Homo sapiens, macrophage receptor with collagenous structure, clone MGC:27263 IMAGE:4618447, mRNA, complete cds
[5857] gi|16359078|gb|BC016004.1|BC016004[16359078]
[5858] 2432: BC013827
[5859] Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:17122
[5860] IMAGE:3446816, mRNA, complete cds
[5861] gi|16307601|gb|BC013827.1|BC013827[16307601]
[5862] 2433: BC001590
[5863] Homo sapiens, cargo selection protein (mannose 6 phosphate receptor binding protein), clone MGC:2012 IMAGE:2987965, mRNA, complete cds
[5864] gi|16306788|gb|BC001590.1|BC001590[16306788]
[5865] 2434: BC001492
[5866] Homo sapiens, ciliary neurotrophic factor receptor, clone MGC:1774 IMAGE:3510004, mRNA, complete cds
[5867] gi|16306633|gb|BC001492.1|BC001492[16306633]
[5868] 2435: BC015768
[5869] Homo sapiens, interleukin 13 receptor, alpha 1, clone MGC:23204 IMAGE:4868206,
[5870] mRNA, complete cds
[5871] gi|16041774|gb|BC015768.1|BC015768[16041774]
[5872] 2436: BC015731
[5873] Homo sapiens, leukocyte immunoglobulin-like receptor, subfamily B (with TM and
[5874] ITIM domains), member 1, clone MGC:22968 IMAGE:4878915, mRNA, complete cds
[5875] gi|16041710|gb|BC015731.1|BC015731[16041710]
[5876] 2437: BC015542
[5877] Homo sapiens, poliovirus receptor, clone MGC:9603 IMAGE:3902226, mRNA, complete
[5878] cds
[5879] gi|15930222|gb|BC015542.1|BC015542[15930222]
[5880] 2439: BC015195
[5881] Homo sapiens, Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide, clone MGC:14717 IMAGE:4251469, mRNA, complete cds
[5882] gi|15929529|gb|BC015195.1|BC015195[15929529]
[5883] 2440: BC014972
[5884] Homo sapiens, interleukin 2 receptor, gamma (severe combined immunodeficiency),
[5885] clone MGC:23116 IMAGE:4878734, mRNA, complete cds
[5886] gi|15929027|gb|BC014972.1|BC014972[15929027]
[5887] 2441: BC014962
[5888] Homo sapiens, GDNF family receptor alpha 1, clone MGC:23045 IMAGE:4874042, mRNA,
[5889] complete cds
[5890] gi|15929001|gb|BC014962.1|BC014962[15929001]
[5891] 2442: BC014960
[5892] Homo sapiens, low density lipoprotein receptor defect C complementing, clone MGC:23019 IMAGE:4876271, mRNA, complete cds
[5893] gi|15928995|gb|BC014960.1|BC014960[15928995]
[5894] 2443: BC013816
[5895] Homo sapiens, platelet-activating factor receptor, clone MGC:17210 IMAGE:4343214, mRNA, complete cds
[5896] gi|15489458|gb|BC013816.1|BC013816[15489458]
[5897] 2444: BC013780
[5898] Homo sapiens, adenosine A2a receptor, clone MGC:21342 IMAGE:4385637, mRNA, complete cds
[5899] gi|15489369|gb|BC013780.1|BC013780[15489369]
[5900] 2445: NM—032551
[5901] Homo sapiens G protein-coupled receptor 54 (GPR54), mRNA
[5902] gi|14211846|ref|NM—032551.1|[14211846]
[5903] 2446: AF329490
[5904] Homo sapiens IFGP2 mRNA, complete cds
[5905] gi|16506260|gb|AF329490.1|AF329490[16506260]
[5906] 2447: AF329488
[5907] Homo sapiens IFGP1 mRNA, complete cds
[5908] gi|16506256|gb|AF329488.1|AF329488[16506256]
[5909] 2448: NM—000798
[5910] Homo sapiens dopamine receptor D5 (DRD5), mRNA
[5911] gi|16445405|ref|NM—000798.2|[16445405]
[5912] 2449: NM—000794
[5913] Homo sapiens dopamine receptor D1 (DRD1), mRNA
[5914] gi|16445404|ref|NM—000794.2|[16445404]
[5915] 2450: NM—000796
[5916] Homo sapiens dopamine receptor D3 (DRD3), transcript variant a, mRNA
[5917] gi|16445403|ref|NM—000796.2|[16445403]
[5918] 2451: NM—033663
[5919] Homo sapiens dopamine receptor D3 (DRD3), transcript variant e, mRNA
[5920] gi|16445401|ref|NM—033663.1|[16445401]
[5921] 2452: NM—033660
[5922] Homo sapiens dopamine receptor D3 (DRD3), transcript variant d, mRNA
[5923] gi|16445399|ref|NM—033660.1|[16445399]
[5924] 2453: NM—033659
[5925] Homo sapiens dopamine receptor D3 (DRD3), transcript variant c, mRNA
[5926] gi|16445397|ref|NM—033659.1|[16445397]
[5927] 2454: NM—033658
[5928] Homo sapiens dopamine receptor D3 (DRD3), transcript variant b, mRNA
[5929] gi|16445395|ref|NM—033658.1|[16445395]
[5930] 2455: AJ298918
[5931] Homo sapiens t(8;22) (p11;q11) translocation breakpoint, BCR/FGFR gene
[5932] gi|16444915|emb|AJ298918.1|HSA298918[16444915]
[5933] 2456: AJ298917
[5934] Homo sapiens partial mRNA for FGFR1/BCR chimaeric fusion peptide
[5935] gi|16444913|emb|AJ298917.1|HSA298917[16444913]
[5936] 2457: AJ298916
[5937] Homo sapiens partial mRNA for BCR/FGFR1 chimaeric fusion protein
[5938] gi|16444911|emb|AJ298916.1|HSA298916[16444911]
[5939] 2458: AF325925
[5940] Homo sapiens tandem motif downstream of INSRR gene, allele 2
[5941] gi|13374363|gb|AF325925.1|AF325925[13374363]
[5942] 2459: AF325924
[5943] Homo sapiens tandem motif downstream of INSRR gene, allele 1
[5944] gi|13374362|gb|AF325924.1|AF325924[13374362]
[5945] 2460: NM—014879
[5946] Homo sapiens G protein-coupled receptor 105 (GPR105), mRNA
[5947] gi|7661847|ref|NM—014879.1|[7661847]
[5948] 2461: NM—000797
[5949] Homo sapiens dopamine receptor D4 (DRD4), mRNA
[5950] gi|4503388|ref|NM—000797.1|[4503388]
[5951] 2462: NM—052962
[5952] Homo sapiens class II cytokine receptor (IL22RA2), mRNA
[5953] gi|16418458|ref|NM—052962.1|[16418458]
[5954] 2463: NM—052932
[5955] Homo sapiens pro-oncosis receptor inducing membrane injury gene (PORIMIN), mRNA
[5956] gi|16418408|ref|NM—052932.1|[16418408]
[5957] 2464: NM—052887
[5958] Homo sapiens Toll-interleukin 1 receptor (TIR) domain-containing adapter protein
[5959] (TIRAP), mRNA
[5960] gi|16418398|ref|NM—052887.1|[16418398]
[5961] 2465: NM—018835
[5962] Homo sapiens olfactory receptor, family 1, subfamily K, member 1 (OR1K1), mRNA
[5963] gi|9256536|ref|NM—018835.1|[9256536]
[5964] 2466: BC016141
[5965] Homo sapiens, interleukin 1 receptor accessory protein, clone IMAGE:3920152, mRNA
[5966] gi|16359373|gb|BC016141.1|BC016141[16359373]
[5967] 2467: AF177765
[5968] Homo sapiens toll-like receptor 4 (TLR4) gene, TLR4A allele, complete cds
[5969] gi|6175872|gb|AF177765.1|AF177765[6175872]
[5970] 2468: U11813
[5971] Homo sapiens hepatocyte growth factor receptor precursor, mRNA, partial cds; alternatively spliced
[5972] gi|530799|gb|U11813.1|HSU11813[530799]
[5973] 2469: BC009540
[5974] Homo sapiens, G protein-coupled receptor 87, clone MGC:10065 IMAGE:3894333, mRNA, complete cds
[5975] gi|16306940 gb|BC009540.1|BC009540[16306940]
[5976] 2474: AJ313162
[5977] Homo sapiens mRNA for soluble cytokine class II receptor, long isoform (CRF2-S1
[5978] gene)
[5979] gi|16304592|emb|AJ313162.1|HSA313162[16304592]
[5980] 2475: AJ313161
[5981] Homo sapiens mRNA for soluble cytokine class II receptor, short isoform (CRF2-S1
[5982] gene)
[5983] gi|16304590|emb|AJ313161.1|HSA313161[16304590]
[5984] 2476: AY048757
[5985] Homo sapiens ATP-binding cassette transporter G1 (ABCG1) mRNA, complete cds, alternatively spliced
[5986] gi|16304310|gb|AY048757.1|[16304310]
[5987] 2501: AJ313161
[5988] Homo sapiens mRNA for soluble cytokine class II receptor, short isoform (CRF2-S1 gene)
[5989] gi|16304590|emb|AJ313161.1|HSA313161[16304590]
[5990] 2502: AY048757
[5991] Homo sapiens ATP-binding cassette transporter G1 (ABCG1) mRNA, complete cds, alternatively spliced
[5992] gi|16304310|gb|AY048757.1|[16304310]
[5993] 2626: NM—012068
[5994] Homo sapiens activating transcription factor 5 (ATF5), mRNA
[5995] gi|12597624|ref|NM—012068.2|[12597624]
[5996] 2627: AF055084
[5997] Homo sapiens very large G-protein coupled receptor-1 (VLGR1) mRNA, complete cds
[5998] gi|5902965|gb|AF055084.1|AF055084[5902965]
[5999] 2629: AJ414821
[6000] Homo sapiens partial IGVKL12 gene for immunoglobulin kappa chain variable region, donor TG, cell84
[6001] gi|16215495|emb|AJ414821.2|HSA414821[16215495]
[6002] 2630: AY056048
[6003] Homo sapiens receptor protein tyrosine kinase variant EphB4v1 (EPHB4) mRNA, complete cds, alternatively spliced
[6004] gi|16209619|gb|AY056048.1|[16209619]
[6005] 2631: AY056047
[6006] Homo sapiens receptor protein tyrosine kinase EphB4 (EPHB4) gene, complete cds,
[6007] alternatively spliced
[6008] gi|16209617|gb|AY056047.1|[16209617]
[6009] 2632: AY052490
[6010] Homo sapiens NK cell receptor (KIR2DL4) mRNA, KIR2DL4-10A allele, partial cds
[6011] gi|16209550|gb|AY052498.1|[16209550]
[6012] 2633: AY052497
[6013] Homo sapiens NK cell receptor (KIR2DL4) mRNA, KIR2DL4-9A allele, partial cds
[6014] gi|16209510|gb|AY052497.1|[16209510]
[6015] 2634: AY052496
[6016] Homo sapiens truncated NK cell receptor (KIR2DL4) mRNA, KIR2DL4-9A allele, partial cds
[6017] gi|16209507|gb|AY052496.1|[16209507]
[6018] 2635: AF267245
[6019] Homo sapiens killer cell lectin-like receptor KLRF1-S3 (KLRF1) mRNA, complete cds., alternatively spliced
[6020] gi|16151842|gb|AF267245.1|AF267245[16151842]
[6021] 2636: AF267244
[6022] Homo sapiens killer cell lectin-like receptor KLRF1-S2 (KLRF1) mRNA, complete cds., alternatively spliced
[6023] gi|16151840|gb|AF267244.1|AF267244[16151840]
[6024] 2637: NM—033637
[6025] Homo sapiens beta-transducin repeat containing (BTRC), transcript variant 1, mRNA
[6026] gi|16117782|ref|NM—033637.1|[16117782]
[6027] 3563: NM—033050
[6028] Homo sapiens G protein-coupled receptor 91 (GPR91), mRNA
[6029] gi|14780893|ref|NM—033050.1|[14780893]
[6030] 3564: NM—023914
[6031] Homo sapiens G protein-coupled receptor 86 (GPR86), mRNA
[6032] gi|13194202|ref|NM—023914.1|[13194202]
[6033] 3565: NM—020402
[6034] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 10 (CHRNA10), mRNA
[6035] gi|11138122|ref|NM—020402.2|[11138122]
[6036] 3566: NM—020370
[6037] Homo sapiens G protein-coupled receptor 84 (GPR84), mRNA
[6038] gi|9966838|ref|NM—020370.1|[9966838]
[6039] 3567: NM—012301
[6040] Homo sapiens atrophin-1 interacting protein 1; activin receptor interacting protein 1 (KIAA0705), mRNA
[6041] gi|6912461|ref|NM—012301.1|[6912461]
[6042] 3568: AF208541
[6043] Homo sapiens V1-vascular vasopressin receptor AVPRLA gene, promoter region and
[6044] partial cds
[6045] gi|658112|gb|AF208541.1|AF208541[6581121]
[6046] 3569: NM—005756
[6047] Homo sapiens G protein-coupled receptor 64 (GPR64), mRNA
[6048] gi|5031732|ref|NM—005756.1|[5031732]
[6049] 3570: NM—003939
[6050] Homo sapiens beta-transducin repeat containing (BTRC), transcript variant 2, mRNA
[6051] gi|4502476|ref|NM—003939.1|[4502476]
[6052] 3571: AH003597
[6053] Homo sapiens A3 adenosine receptor (ADORA3) gene
[6054] gi|1387984|gb|AH003597.1|SEG_HUMADOR0[1387984]
[6055] 3572: L77730
[6056] Homo sapiens A3 adenosine receptor (ADORA3) gene, exon 2
[6057] gi|387983|gb|L77730.1[HUMADOR02[1387983]
[6058] 3573: L77729
[6059] Homo sapiens A3 adenosine receptor (ADORA3) gene, exon 1
[6060] gi|1387982|gb|L77729.1|HUMADOR01[1387982]
[6061] 3574: AF000381
[6062] Homo sapiens folate binding protein mRNA, partial cds
[6063] gi|16041647|gb|AF000381.2|AF000381[16041647]
[6064] 3583: AY054974
[6065] Homo sapiens RAE-1-like transcript 4 mRNA, complete cds
[6066] gi|15990603|gb|AY054974.1|[15990603]
[6067] 3584: AF421855
[6068] Homo sapiens interleukin 4 receptor (IL4R) gene, complete cds
[6069] gi|15987825|gb|AF421855.1|AF421855[15987825]
[6070] 3585: AF359241
[6071] Homo sapiens soluble truncated fibroblast growth factor receptor 4 (FGFR4) mRNA,
[6072] complete cds
[6073] gi|3877134|gb|AF359241.1|AF359241[13877134]
[6074] 3586: NM—022148
[6075] Homo sapiens cytokine receptor-like factor 2 (CRLF2), mRNA
[6076] gi|13375623|ref|NM—022148.1|[13375623]
[6077] 3587: AF179770
[6078] Homo sapiens olfactory receptor (HSA8) gene, partial cds
[6079] gi|7211542|gb|AF179770.1|AF179770[7211542]
[6080] 3590: AF179767
[6081] Homo sapiens olfactory receptor (HSA5) gene, partial cds
[6082] gi|7211538|gb|AF179767.1|AF179767[7211538]
[6083] 3591: AF179766
[6084] Homo sapiens olfactory receptor (HSA3) gene, partial cds
[6085] gi|7211536|gb|AF179766.1|AF179766[7211536]
[6086] 3596: AF179761
[6087] Homo sapiens olfactory receptor (HSA12) gene, partial cds
[6088] gi|7211530|gb|AF179761.1|AF179761[7211530]
[6089] 3597: AF179760
[6090] Homo sapiens olfactory receptor (HSA10) gene, partial cds
[6091] gi|7211528|gb|AF179760.1|AF179760[7211528]
[6092] 3598: AF179759
[6093] Homo sapiens olfactory receptor (HSA1) gene, partial cds
[6094] gi|7211526|gb|AF179759.1|AF179759[7211526]
[6095] 3599: D86962
[6096] Human mRNA for KIAA0207 gene, complete cds
[6097] gi|1503997|dbj|D86962.1D86962[1503997]
[6098] 3600: D13626
[6099] Human mRNA for KIAA0001 gene, complete cds
[6100] gi|285994|dbj|D13626.1|HUMRSC338[285994]
[6101] 3601: AY026770
[6102] Homo sapiens lectin-like receptor 1B (DECTIN1) mRNA, complete cds, alternatively
[6103] spliced
[6104] gi|15967098|gb|AY026770.2|[15967098]
[6105] 3602: AY026769
[6106] Homo sapiens lectin-like receptor 1 (DECTIN1) mRNA, complete cds
[6107] gi|15967096|gb|AY026769.2|[15967096]
[6108] 3605: AJ344142
[6109] Homo sapiens mRNA for putative MCP-1 chemokine receptor (CCR11 gene)
[6110] gi|15919090|emb|AJ344142.1|HSA344142[15919090]
[6111] 3606: AY029770
[6112] Homo sapiens CCK-B/gastrin receptor variant mRNA, complete cds, alternatively spliced
[6113] gi|15911832|gb|AY029770.1|[15911832]
[6114] 3607: NM—002821
[6115] Homo sapiens PTK7 protein tyrosine kinase 7 (PTK7), mRNA
[6116] gi|15826839|ref|NM—002821.2|[15826839]
[6117] 3608: AF303576
[6118] Homo sapiens G protein-coupled receptor 75 (GPR75) gene, exon 1
[6119] gi|15824419|gb|AF303576.1|AF303576[15824419]
[6120] 3609: AB032427
[6121] Homo sapiens VRL-2 mRNA for vanilloid receptor like channel-2, complete cds
[6122] gi|15822824|dbj|AB032427.1|AB032427[15822824]
[6123] 3610: AY008280
[6124] Homo sapiens histamine receptor H4 (H4) mRNA, complete cds
[6125] gi|15822540|gb|AY008280.1|[15822540]
[6126] 3611: U40271
[6127] Homo sapiens transmembrane receptor precursor (PTK7) mRNA, complete cds
[6128] gi|15808058|gb|U40271.2|HSU40271[15808058]
[6129] 3612: NM—000575
[6130] Homo sapiens interleukin 1, alpha (IL1A), mRNA
[6131] gi|13236493|ref|NM—000575.1|[13236493]
[6132] 3615: NM—014312
[6133] Homo sapiens cortical thymocyte receptor (X. laevis CTX) like (CTXL), mRNA
[6134] gi|7657000|ref|NM—014312.1|[7657000]
[6135] 3616: AB032738
[6136] Homo sapiens gene for chemokine receptor CXCR3, partial cds
[6137] gi|7209698|dbj|AB032738.1|AB032738[7209698]
[6138] 3617: AB032737
[6139] Homo sapiens gene for chemokine receptor CXCR3, partial cds
[6140] gi|7209696|dbj|AB032737.1|AB032737[7209696]
[6141] 3618: AB032736
[6142] Homo sapiens gene for chemokine receptor CXCR3, partial cds
[6143] gi|7209694|dbj|AB032736.1|AB032736[7209694]
[6144] 3619: AB032735
[6145] Homo sapiens gene for chemokine receptor CXCR3, partial cds
[6146] gi|7209692|dbj|AB032735.1|AB032735[7209692]
[6147] 3620: AB032734
[6148] Homo sapiens CXCR2 gene for IL-8 receptor type B, partial cds
[6149] gi|7209690|dbj|AB032734.1|AB032734[7209690]
[6150] 3621: AB032733
[6151] Homo sapiens CXCR2 gene for IL-8 receptor type B, partial cds
[6152] gi|7209688|dbj|AB032733.1|AB032733[7209688]
[6153] 3622: AB032732
[6154] Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds
[6155] gi|7209686|dbj|AB032732.1|AB032732[7209686]
[6156] 3623: AB032731
[6157] Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds
[6158] gi|7209684|dbj|AB032731.1|AB032731[7209684]
[6159] 3624: AB032730
[6160] Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds
[6161] gi|7209682|dbj|AB032730.1|AB032730[7209682]
[6162] 3625: AB032729
[6163] Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds
[6164] gi|7209680|dbj|AB032729.1|AB032729[7209680]
[6165] 3626: AB032728
[6166] Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds
[6167] gi|7209678|dbj|AB032728.1|A]B032728[7209678]
[6168] 3628: AB030952
[6169] Homo sapiens TNFR2 gene for tumor necrosis factor receptor 2, partial cds
[6170] gi|6683135|dbj|AB030952.1|AB030952[6683135]
[6171] 3629: AB030951
[6172] Homo sapiens TNFR2 gene for tumor necrosis factor receptor 2, partial cds
[6173] gi|6683133|dbj|AB030951.1|AB030951[6683133]
[6174] 3630: AB030950
[6175] Homo sapiens TNFR2 gene for tumor necrosis factor receptor 2, partial cds
[6176] gi|6683131|dbj|AB030950.1|AB030950[6683131]
[6177] 3631: AB030949
[6178] Homo sapiens TNFR2 gene for tumor necrosis factor receptor 2, partial cds
[6179] gi|6683129|dbj|AB030949.1|AB030949[6683129]
[6180] 3632: AB023892
[6181] Homo sapiens gene for b-chemokine receptor CCR4, complete cds
[6182] gi|6467142|dbj|AB023892.1|AB023892[6467142]
[6183] 3633: AB023891
[6184] Homo sapiens gene for b-chemokine receptor CCR4, complete cds
[6185] gi|6467140|dbj|AB023891.1|AB023891[6467140]
[6186] 3634: AB023890
[6187] Homo sapiens gene for b-chemokine receptor CCR4, complete cds
[6188] gi|6467138|dbj|AB023890.1|AB023890[6467138]
[6189] 3635: AB023889
[6190] Homo sapiens gene for b-chemokine receptor CCR4, complete cds
[6191] gi|6467136|dbj|AB023889.1|AB023889[6467136]
[6192] 3636: AB023888
[6193] Homo sapiens gene for b-chemokine receptor CCR4, complete cds
[6194] gi|6467134|dbj|AB023888.1|AB023888[6467134]
[6195] 3637: AB023887
[6196] Homo sapiens gene for b-chemokine receptor CCR3, complete cds
[6197] gi|6467132|dbj|AB023887.1|AB023887[6467132]
[6198] 3638: AH008153
[6199] Homo sapiens IL-1RI gene, complete sequence
[6200] gi|5823144|gb|AH008153.1|SEG_HSAIL1R[5823144]
[6201] 3639: AF146427
[6202] Homo sapiens interleukin-1 receptor type I (IL1R1) gene, exon 1c
[6203] gi|5823143|gb|AF146427.1|HSAIL1R2[5823143]
[6204] 3640: AF146426
[6205] Homo sapiens interleukin-1 receptor type I (IL1R1) gene, exon 1b and intron 1b
[6206] gi|5823142|gb|AF146426.1|HSAIL1R1[5823142]
[6207] 3641: NM—006691
[6208] Homo sapiens extracellular link domain-containing 1 (XLKD1), mRNA
[6209] gi|5729910|ref|NM—006691.1|[5729910]
[6210] 3642: Z99761
[6211] Homo sapiens gonadotrophin-releasing hormone receptor gene exon 2
[6212] gi|5514748|emb|Z99761.2|HSGRHRX2[5514748]
[6213] 3643: Z99760
[6214] Homo sapiens gonadotropin-releasing hormone receptor gene exon 1 variant 1
[6215] gi|5514747|emb|Z99760.2|HSGRHRX1[5514747]
[6216] 3644: NM—001250
[6217] Homo sapiens tumor necrosis factor receptor superfamily, member 5 (TNFRSF5), mRNA
[6218] gi|4507580|ref|NM—001250.1|[4507580]
[6219] 3645: NM—000406
[6220] Homo sapiens gonadotropin-releasing hormone receptor (GNRHR), mRNA
[6221] gi|4504058|ref|NM—000406.1|[4504058]
[6222] 3646: Z99995
[6223] Homo sapiens partial gonadotropin releasing hormone receptor gene
[6224] gi|3334762|emb|Z99995.1|HSZ99995[3334762]
[6225] 3647: G16069
[6226] 928H1R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 928H1 right arm, sequence tagged site
[6227] gi|1825444|gb|G16069.1|G16069[1825444]
[6228] 3648: G16077
[6229] 817D6L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 817D6 left arm, sequence tagged site
[6230] gi|1592357|gb|G16077.1|G16077[1592357]
[6231] 3649: G16076
[6232] 807B6L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 807B6 left arm, sequence tagged site
[6233] gi|1592356|gb|G16076.1|G16076[1592356]
[6234] 3650: G16075
[6235] 940H12L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 940H12 left arm, sequence tagged site
[6236] gi|1592355|gb|G16075.1|G16075[1592355]
[6237] 3651: G16074
[6238] 706A2L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 706A2 left arm, sequence tagged site
[6239] gi|1592354|gb|G16074.1G16074[1592354]
[6240] 3652: G16073
[6241] 967A10L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 967A10 left arm, sequence tagged site
[6242] gi|1592353|gb|G16073.1|G16073[1592353]
[6243] 3653: G16072
[6244] 816C10L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 816C10 left arm, sequence tagged site
[6245] gi|1592352|gb|G16072.1G16072[1592352]
[6246] 3654: G16071
[6247] 765B8R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 765B8 right arm, sequence tagged site
[6248] gi|1592351|gb|G16071.1G16071[1592351]
[6249] 3655: G16070
[6250] 622F2R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 622F2 right arm, sequence tagged site
[6251] gi|1592350|gb|G16070.1|G16070[1592350]
[6252] 3656: G16068
[6253] 868H11L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 868H11 left arm, sequence tagged site
[6254] gi|1592349|gb|G16068.1|G16068[1592349]
[6255] 3657: G16067
[6256] 662F2L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 662F2 left arm, sequence tagged site
[6257] gi|1592348|gb|G16067.1|G16067[1592348]
[6258] 3658: G16066
[6259] 918D7R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 918D7 right arm, sequence tagged site
[6260] gi|1592347|gb|G16066.1|G16066[1592347]
[6261] 3659: G16065
[6262] 758C4R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 758C4 right arm, sequence tagged site
[6263] gi|1592346|gb|G16065.1|G16065[1592346]
[6264] 3660: G16064
[6265] 677D7L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 677D7 left arm, sequence tagged site
[6266] gi|1592345|gb|G16064.1|G16064[1592345]
[6267] 3663: L11238
[6268] Homo sapiens platelet membrane glycoprotein V mRNA; complete cds
[6269] gi|388759|gb|L11238.1|HUMGLYCOPR[388759]
[6270] 3665: AF406652
[6271] Homo sapiens MyD88 adapter-like protein mRNA, complete cds
[6272] gi|15528826|gb|AF406652.1|AF406652[15528826]
[6273] 4053: NM—022059
[6274] Homo sapiens chemokine (C-X-C motif) ligand 16 (CXCL16), mRNA
[6275] gi|11545764|ref|NM—022059.1|[11545764]
[6276] 4054: NM—030956
[6277] Homo sapiens toll-like receptor 10 (TLR10), mRNA
[6278] gi|13569929|ref|NM—030956.1|[13569929]
[6279] 4055: NM—033358
[6280] Homo sapiens caspase 8, apoptosis-related cysteine protease (CASP8), transcript
[6281] variant E, mRNA
[6282] gi|15718711|ref|NM—033358.1|[15718711]
[6283] 4056: NM—033357
[6284] Homo sapiens caspase 8, apoptosis-related cysteine protease (CASP8), transcript
[6285] variant D, mRNA
[6286] gi|15718709|ref|NM—033357.1|[15718709]
[6287] 4057: NM—033356
[6288] Homo sapiens caspase 8, apoptosis-related cysteine protease (CASP8), transcript
[6289] variant C, mRNA
[6290] gi|15718707|ref|NM—033356.1|[15718707]
[6291] 4058: NM—033355
[6292] Homo sapiens caspase 8, apoptosis-related cysteine protease (CASP8), transcript
[6293] variant B, mRNA
[6294] gi|15718705|ref|NM—033355.1|[15718705]
[6295] 4059: NM—001228
[6296] Homo sapiens caspase 8, apoptosis-related cysteine protease (CASP8), transcript
[6297] variant A, mRNA
[6298] gi|15718703|ref|NM—001228.2|[15718703]
[6299] 4061: NM—000024
[6300] Homo sapiens adrenergic, beta-2-, receptor, surface (ADRB2), mRNA
[6301] gi|15718673|ref|NM—000024.3|[15718673]
[6302] 4062: NM—000683
[6303] Homo sapiens adrenergic, alpha-2C—, receptor (ADRA2C), mRNA
[6304] gi|15718672|ref|NM—000683.2|[15718672]
[6305] 4063: NM—000682
[6306] Homo sapiens adrenergic, alpha-2B-, receptor (ADRA2B), mRNA
[6307] gi|5718671|ref|NM—000682.2|[15718671]
[6308] 4064: NM—000681
[6309] Homo sapiens adrenergic, alpha-2A-, receptor (ADRA2A), mRNA
[6310] gi|15718669|ref|NM—000681.2|[15718669]
[6311] 4065: NM—006179
[6312] Homo sapiens neurotrophin 5 (neurotrophin 4/5) (NTF5), mRNA
[6313] gi|15718666|ref|NM—006179.2|[15718666]
[6314] 4066: L26458
[6315] Homo sapiens T-cell receptor mRNA, partial sequence
[6316] gi|432477|gb|L26458.1|HUMEBSH[432477]
[6317] 4067: L26457
[6318] Homo sapiens T-cell receptor mRNA, partial sequence
[6319] gi|432476|gb|L26457.1|HUMEBSG[432476]
[6320] 4068: L26456
[6321] Homo sapiens T-cell receptor mRNA, partial sequence
[6322] gi|432475|gb|L26456.1|HUMEBSF[432475]
[6323] 4069: L26455
[6324] Homo sapiens T-cell receptor mRNA, partial sequence
[6325] gi|432474|gb|L26455.1|HUMEBSE[432474]
[6326] 4070: L26454
[6327] Homo sapiens T-cell receptor mRNA, partial sequence
[6328] gi|432473|gb|L26454.1|HUMEBSD[432473]
[6329] 4071: L26453
[6330] Homo sapiens T-cell receptor mRNA, partial sequence
[6331] gi|432472|gb|L26453.1|HUMEBSC[432472]
[6332] 4072: L26452
[6333] Homo sapiens T-cell receptor mRNA, partial sequence
[6334] gi|432471|gb|L26452.1|HUMEBSB[432471]
[6335] 4073: L26451
[6336] Homo sapiens T-cell receptor mRNA, partial sequence
[6337] gi|432470|gb|L26451.1|HUMEBSA[432470]
[6338] 4074: AH009839
[6339] Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene,
[6340] partial cds, alternatively spliced
[6341] gi|15706245|gb|AH009839.2|[15706245]
[6342] 4075: AJ301610
[6343] Homo sapiens mRNA for GluR6 kainate receptor (GRIK2 gene), isoform-b
[6344] gi|15485591|emb|AJ301610.1|HSA301610[15485591]
[6345] 4076: AJ301609
[6346] Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene), exons 10, and 13
[6347] gi|15485589|emb|AJ301609.1|HSA301609[15485589]
[6348] 4077: AJ301608
[6349] Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene), exons 11, and 14
[6350] gi|15485587|emb|AJ301608.1|HSA301608[15485587]
[6351] 4078: AF196774
[6352] Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene,
[6353] exon 8 and partial cds, alternatively spliced
[6354] gi|10312084|gb|AF196774.1|AH009839S8[10312084]
[6355] 4079: AF196773
[6356] Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene,
[6357] exon 7
[6358] gi|10312083|gb|AF196773.1|AH009839S7[10312083]
[6359] 4080: AF196772
[6360] Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene,
[6361] exon 6
[6362] gi|10312082|gb|AF196772.1|AH009839S6[10312082]
[6363] 4081: AF252867
[6364] Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene,
[6365] exon 6A and partial cds, alternatively spliced
[6366] gi|10312081|gb|AF252867.1|AH009839S5[10312081]
[6367] 4082: AF196771
[6368] Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene,
[6369] exon 5
[6370] gi|10312080|gb|AF196771.1|AH009839S4[10312080]
[6371] 4083: AF196770
[6372] Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene,
[6373] exon 4
[6374] gi|10312079|gb|AF196770.1|AH009839S3[10312079]
[6375] 4084: AF196769
[6376] Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene,
[6377] exon 3
[6378] gi|10312078|gb|AF196769.1|AH009839S2[10312078]
[6379] 4085: AF196768
[6380] Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene,
[6381] exon 2
[6382] gi|10312077|gb|AF196768.1|AH009839S1[10312077]
[6383] 4086: AF399937
[6384] Homo sapiens melanin-concentrating hormone receptor MCH-R2 mRNA, complete cds
[6385] gi|15667842|gb|AF399937.1|AF399937[15667842]
[6386] 4087: NM—032405
[6387] Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant D,
[6388] mRNA
[6389] gi|14602456|ref|NM—032405.1|[14602456]
[6390] 4088: NM—032404
[6391] Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant C,
[6392] mRNA
[6393] gi|14602454|ref|NM—032404.1|[14602454]
[6394] 4089: NM—032401
[6395] Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant B,
[6396] mRNA
[6397] gi|14602452|ref|NM—032401.1|[14602452]
[6398] 4090: NM—024022
[6399] Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant A,
[6400] mRNA
[6401] gi|13173470|ref|NM—024022.1|[13173470]
[6402] 4091: AY046418
[6403] Homo sapiens brain immunoglobulin receptor precursor, mRNA, complete cds
[6404] gi|15636797|gb|AY046418.1|[15636797]
[6405] 4092: AF069333
[6406] Homo sapiens insulin-like growth factor II receptor (IGF2R) gene, partial cds
[6407] gi|15628184|gb|AF069333.2|AF069333115628184]
[6408] 4093: AY029541
[6409] Homo sapiens putative G protein-coupled receptor mRNA, complete cds
[6410] gi|15626067|gb|AY029541.1|[15626067]
[6411] 4094: AF117819
[6412] Homo sapiens bradykinin B1 receptor mRNA, partial cds and 3′-untranslated region
[6413] gi|4325046|gb|AF117819.1|AF117819[4325046]
[6414] 4095: NM—004624
[6415] Homo sapiens vasoactive intestinal peptide receptor 1 (VIPR1), mRNA
[6416] gi|15619005|ref|NM—004624.2|[15619005]
[6417] 4096: AY042216
[6418] Homo sapiens G protein-coupled receptor (MRGX4) gene, complete cds
[6419] gi|15546067|gb|AY042216.1|[15546067]
[6420] 4097: AY042215
[6421] Homo sapiens G protein-coupled receptor (MRGX3) gene, complete cds
[6422] gi|15546065|gb|AY042215.1|[15546065]
[6423] 4098: AY042214
[6424] Homo sapiens G protein-coupled receptor (MRGX2) gene, complete cds
[6425] gi|15546063|gb|AY042214.1|[15546063]
[6426] 4099: AY042213
[6427] Homo sapiens G protein-coupled receptor (MRGX1) gene, complete cds
[6428] gi|1554606|gb|AY042213.1|[15546061]
[6429] 4100: Y11395
[6430] Homo sapiens mRNA for lanthionine synthetase C-like protein 1 (LANCL1 gene)
[6431] gi|2894085|emb|Y11395.1|HSRNAP40[2894085]
[6432] 4101: BC014108
[6433] Homo sapiens, Fc fragment of IgE, low affinity II, receptor for (CD23A), clone
[6434] MGC:20696 IMAGE:4309266, mRNA, complete cds
[6435] gi|15559484|gb|BC014108.1|BC014108[15559484]
[6436] 4102: AF306329
[6437] Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4)
[6438] gene, exon 6 and complete cds
[6439] gi|15558964|gb|AF306329.1|AF306325S5[15558964]
[6440] 4103: AF306328
[6441] Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4)
[6442] gene, exon 5
[6443] gi|15558963|gb|AF306328.1|AF306325S4[15558963]
[6444] 4104: AF306327
[6445] Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4)
[6446] gene, exons 3, 4, and 4a, alternatively spliced
[6447] gi|15558962|gb|AF306327.1|AF306325S3[15558962]
[6448] 4105: AF306326
[6449] Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4)
[6450] gene, exon 2
[6451] gi|15558961|gb|AF306326.1|AF306325S2[15558961]
[6452] 4106: AF306325
[6453] Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4)
[6454] gene, exon 1
[6455] gi|15558960|gb|AF306325.1|AF306325S1[15558960]
[6456] 4107: AH011061
[6457] Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4)
[6458] gene, complete cds
[6459] gi|15558959|gb|AH011061.1|SEG_AF306325S[15558959]
[6460] 4108: AJ316282
[6461] Homo sapiens partial TCRB gene for T cell receptor beta chain, allele TCRBV1J2S3, isolate P15SF, clone 9
[6462] gi|15558855|emb|AJ316282.1|HSA316282[15558855]
[6463] 4109: AJ316281
[6464] Homo sapiens partial TCRB gene for T cell receptor beta chain, allele TCRBV1J2S3, patient P22SF, clone 3
[6465] gi|5558853|emb|AJ316281.1|HSA316281[15558853]
[6466] 4110: AJ316280
[6467] Homo sapiens partial TCRB gene for T cell receptor beta chain, allele TCRBV1J2S3, patient P14SF, clone 1
[6468] gi|15558851|emb|AJ316280.1|HSA316280[15558851]
[6469] 4111: NM—001954
[6470] Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 2, mRNA
[6471] gi|7669486|ref|NM—001954.21[7669486]
[6472] 4112: NM—013994
[6473] Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 3, mRNA
[6474] gi|7669484|ref|NM—013994.1|[7669484]
[6475] 4113: NM—013993
[6476] Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 1, mRNA
[6477] gi|7669482|ref|NM—013993.1|[7669482]
[6478] 4114: AF325356
[6479] Homo sapiens histamine receptor H4 (AXOR35) mRNA, complete cds
[6480] gi|15553202|gb|AF325356.1|AF325356[15553202]
[6481] 4115: AF349574
[6482] Homo sapiens interleukin 12 receptor beta 2 (IL12RB2) gene, partial sequence
[6483] gi|15088551|gb|AF349574.1|AF349574[15088551]
[6484] 4116: NM—014395
[6485] Homo sapiens dual adaptor of phosphotyrosine and 3-phosphoinositides (DAPP1), mRNA
[6486] gi|7657006|ref|NM—014395.1|[7657006]
[6487] 4117: AY043466
[6488] Homo sapiens Fc receptor-like protein 3 (FCRH3) mRNA, complete cds
[6489] gi|15528834|gb|AY043466.1|[15528834]
[6490] 4118: AY043465
[6491] Homo sapiens Fc receptor-like protein 2 (FCRH2) mRNA, complete cds
[6492] gi|15528832|gb|AY043465.1|[15528832]
[6493] 4119: AY043464
[6494] Homo sapiens Fc receptor-like protein 1 (FCRH1) mRNA, complete cds
[6495] gi|15528830|gb|AY043464.1|[15528830]
[6496] 4120: AJ344350
[6497] Homo sapiens partial IGDH3-9 gene segment, isolate case6-cell520
[6498] gi|15528515|emb|AJ344350.1|HSA344350[15528515]
[6499] 4121: AJ344349
[6500] Homo sapiens partial IGDH3-9 gene segment, isolate case5-cell49
[6501] gi|15528514|emb|AJ344349.1|HSA344349[15528514]
[6502] 4122: AJ344348
[6503] Homo sapiens partial IGDH6-25 gene segment, isolate case4-cell89
[6504] gi|15528513|emb|AJ344348.1|HSA344348[15528513]
[6505] 4125: NM—033135
[6506] Homo sapiens spinal cord-derived growth factor-B (SCDGF-B), transcript variant
[6507] 2, mRNA
[6508] gi|15451920|ref|NM—033135.1|[15451920]
[6509] 4126: NM—025208
[6510] Homo sapiens spinal cord-derived growth factor-B (SCDGF-B), transcript variant
[6511] 1, mRNA
[6512] gi|15451919|ref|NM—025208.2|[15451919]
[6513] 4127: NM—033346
[6514] Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2), transcript variant 2, mRNA
[6515] gi|15451917|ref|NM—033346.1|[15451917]
[6516] 4128: NM—001204
[6517] Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2), transcript variant 1, mRNA
[6518] gi|15451915|ref|NM—001204.3|[15451915]
[6519] 4129: NM—003933
[6520] Homo sapiens BA11-associated protein 3 (BAIAP3), mRNA
[6521] gi|15451913|ref|NM—003933.3|[15451913]
[6522] 4130: NM—002006
[6523] Homo sapiens fibroblast growth factor 2 (basic) (FGF2), mRNA
[6524] gi|15451897|ref|NM—002006.2|[15451897]
[6525] 4131: NM—000647
[6526] Homo sapiens chemokine (C-C motif) receptor 2 (CCR2), transcript variant A, mRNA
[6527] gi|15451896|ref|NM—000647.2|[15451896]
[6528] 4132: NM—004631
[6529] Homo sapiens low density lipoprotein receptor-related protein 8, apolipoprotein
[6530] e receptor (LRP8), transcript variant 1, mRNA
[6531] gi|15451869|ref|NM—004631.2|[15451869]
[6532] 4133: NM—033300
[6533] Homo sapiens low density lipoprotein receptor-related protein 8, apolipoprotein
[6534] e receptor (LRP8), transcript variant 2, mRNA
[6535] gi|15451867|ref|NM—033300.1|[15451867]
[6536] 4134: NM—017522
[6537] Homo sapiens low density lipoprotein receptor-related protein 8, apolipoprotein
[6538] e receptor (LRP8), transcript variant 3, mRNA
[6539] gi|15451865|ref|NM—017522.2|[15451865]
[6540] 4135: NM—033337
[6541] Homo sapiens caveolin 3 (CAV3), transcript variant 1, mRNA
[6542] gi|15451859|ref|NM—033337.1|[15451859]
[6543] 4136: NM—001234
[6544] Homo sapiens caveolin 3 (CAV3), transcript variant 2, mRNA
[6545] gi|15451858|ref|NM—001234.3|[15451858]
[6546] 4137: NM—002609
[6547] Homo sapiens platelet-derived growth factor receptor, beta polypeptide (PDGFRB),
[6548] mRNA
[6549] gi|15451788|ref|NM—002609.2|[15451788]
[6550] 4138: NM—006206
[6551] Homo sapiens platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), mRNA
[6552] gi|15451787|ref|NM—006206.2|[15451787]
[6553] 4139: NM—000679
[6554] Homo sapiens adrenergic, alpha-1B-, receptor (ADRA1B), mRNA
[6555] gi|15451783|ref|NM—000679.2|[15451783]
[6556] 4140: AY026771
[6557] Homo sapiens lectin-like receptor 1C (DECTIN1) mRNA, complete cds, alternatively
[6558] spliced
[6559] gi|14278822|gb|AY026771.1|[14278822]
[6560] 4142: NM—000648
[6561] Homo sapiens chemokine (C-C motif) receptor 2 (CCR2), transcript variant B, mRNA
[6562] gi|4757937|ref|NM—000648.1|[4757937]
[6563] 4143: AB041403
[6564] Homo sapiens HTR1A gene for serotonin receptor 1A, complete cds
[6565] gi|7592996|dbj|AB041403.1|AB041403[7592996]
[6566] 4144: NM—015722
[6567] Homo sapiens calcyon; D1 dopamine receptor-interacting protein (CALCYON), mRNA
[6568] gi|9257200|ref|NM—015722.2|[9257200]
[6569] 4145: AY044429
[6570] Homo sapiens class II cytokine receptor (IL22RA2) mRNA, complete cds
[6571] gi|15419022|gb|AY044429.1|[15419022]
[6572] 4148: AJ306388
[6573] Homo sapiens mRNA for NTB-A receptor (KALI b gene)
[6574] gi|15384842|emb|AJ306388.1|HSA306388[15384842]
[6575] 4149: AJ277141
[6576] Homo sapiens mRNA for activating NK receptor (KALI gene)
[6577] gi|15384840|emb|AJ277141.1|HSA277141[15384840]
[6578] 4150: NM—033199
[6579] Homo sapiens stresscopin-related peptide (SRP), mRNA
[6580] gi|15082239|ref|NM—033199.1|[15082239]
[6581] 4151: AB052684
[6582] Homo sapiens mRNA for G1-coupled ADP receptor HORK3, complete cds
[6583] gi|14422409|dbj|AB052684.1|AB052684[14422409]
[6584] 4152: AF227732
[6585] Homo sapiens nicotinic acetylcholine receptor alpha 9 subunit mRNA, partial cds
[6586] gi|7407124|gb|AF227732.1|AF227732[7407124]
[6587] 4153: NM—005849
[6588] Homo sapiens immunoglobulin superfamily, member 6 (IGSF6), mRNA
[6589] gi|5031672|ref|NM—005849.1|[5031672]
[6590] 4154: AF317654
[6591] Homo sapiens G protein-coupled receptor (GPR63) gene, complete cds
[6592] gi|15321723|gb|AF317654.2|AF317654[15321723]
[6593] 4155: AF399637
[6594] Homo sapiens clone OR5B16 olfactory receptor gene, partial cds
[6595] gi|15293858|gb|AF399637.1|AF399637[15293858]
[6596] 4156: AF399636
[6597] Homo sapiens clone OR5B2 olfactory receptor gene, partial cds
[6598] gi|15293856|gb|AF399636.1|AF399636[15293856]
[6599] 4157: AF399635
[6600] Homo sapiens clone OR5AU1 olfactory receptor gene, partial cds
[6601] gi|15293854|gb|AF399635.1|AF399635[15293854]
[6602] 4158: AF399634
[6603] Homo sapiens clone OR10A3 olfactory receptor gene, partial cds
[6604] gi|15293852|gb|AF399634.1|AF399634[15293852]
[6605] 4159: AF399633
[6606] Homo sapiens clone OR13H1 olfactory receptor gene, partial cds
[6607] gi|15293850|gb|AF399633.1|AF399633[15293850]
[6608] 4160: AF399632
[6609] Homo sapiens clone OR2B3 olfactory receptor gene, partial cds
[6610] gi|15293848|gb|AF399632.1|AF399632[15293848]
[6611] 4161: AF399631
[6612] Homo sapiens clone OR2H2 olfactory receptor gene, partial cds
[6613] gi|15293846|gb|AF399631.1|AF399631[15293846]
[6614] 4162: AF399630
[6615] Homo sapiens clone OR2J3 olfactory receptor gene, partial cds
[6616] gi|15293844|gb|AF399630.1|AF399630[15293844]
[6617] 4163: AF399629
[6618] Homo sapiens clone OR2Y1 olfactory receptor gene, partial cds
[6619] gi|15293842|gb|AF399629.1|AF399629[15293842]
[6620] 4164: AF399628
[6621] Homo sapiens clone OR2W1 olfactory receptor gene, partial cds
[6622] gi|15293840 gb|AF399628.1|AF399628[15293840]
[6623] 4165: AF399627
[6624] Homo sapiens clone OR10C2 olfactory receptor gene, partial cds
[6625] gi|5293838|gb|AF399627.1|AF399627[15293838]
[6626] 4166: AF399626
[6627] Homo sapiens clone OR10A7 olfactory receptor gene, partial cds
[6628] gi|15293836|gb|AF399626.1|AF399626[15293836]
[6629] 4167: AF399625
[6630] Homo sapiens clone OR10A4 olfactory receptor gene, partial cds
[6631] gi|15293834|gb|AF399625.1|AF399625[15293834]
[6632] 4168: AF399624
[6633] Homo sapiens clone OR10A1 olfactory receptor gene, partial cds
[6634] gi|15293832|gb|AF399624.1|AF399624[15293832]
[6635] 4169: AF399623
[6636] Homo sapiens clone OR10A5 olfactory receptor gene, partial cds
[6637] gi|15293830 gb|AF399623.1|AF399623[15293830]
[6638] 4170: AF399622
[6639] Homo sapiens clone OR1K1 olfactory receptor gene, partial cds
[6640] gi|15293828|gb|AF399622.1|AF399622[15293828]
[6641] 4171: AF399621
[6642] Homo sapiens clone OR3A4 olfactory receptor gene, partial cds
[6643] gi|5293826|gb|AF399621.1|AF399621[15293826]
[6644] 4172: AF399620
[6645] Homo sapiens clone OR3A3 olfactory receptor gene, partial cds
[6646] gi|15293824|gb|AF399620.1|AF399620[15293824]
[6647] 4173: AF399619
[6648] Homo sapiens clone OR2Z2 olfactory receptor gene, partial cds
[6649] gi|5293822|gb|AF399619.1|AF399619[15293822]
[6650] 4174: AF399618
[6651] Homo sapiens clone OR2AG1 olfactory receptor gene, partial cds
[6652] gi|15293820|gb|AF399618.1|AF399618[15293820]
[6653] 4175: AF399617
[6654] Homo sapiens clone OR2M4 olfactory receptor gene, partial cds
[6655] gi|5293818|gb|AF399617.1|AF399617[15293818]
[6656] 4176: AF399616
[6657] Homo sapiens clone OR2M2 olfactory receptor gene, partial cds
[6658] gi|15293816|gb|AF399616.1|AF399616[15293816]
[6659] 4177: AF399615
[6660] Homo sapiens clone OR2M2 olfactory receptor gene, partial cds
[6661] gi|15293814|gb|AF399615.1|AF399615[15293814]
[6662] 4178: AF399614
[6663] Homo sapiens clone OR2V2 olfactory receptor gene, partial cds
[6664] gi|15293812|gb|AF399614.1|AF399614[15293812]
[6665] 4179: AF399613
[6666] Homo sapiens clone OR2T1 olfactory receptor gene, partial cds
[6667] gi|15293810|gb|AF399613.1|AF399613[15293810]
[6668] 4180: AF399612
[6669] Homo sapiens clone OR2T3 olfactory receptor gene, partial cds
[6670] gi|15293808|gb|AF399612.1|AF399612[15293808]
[6671] 4181: AF399611
[6672] Homo sapiens clone OR11H1 olfactory receptor gene, partial cds
[6673] gi|5293806|gb|AF399611.1|AF399611[15293806]
[6674] 4182: AF399610
[6675] Homo sapiens clone OR11G2 olfactory receptor gene, partial cds
[6676] gi|15293804|gb|AF399610.1|AF399610[15293804]
[6677] 4183: AF399609
[6678] Homo sapiens clone OR6Q1 olfactory receptor gene, partial cds
[6679] gi|15293802|gb|AF399609.1|AF399609[15293802]
[6680] 4184: AF399608
[6681] Homo sapiens clone OR6N1 olfactory receptor gene, partial cds
[6682] gi|5293800|gb|AF399608.1|AF399608[15293800]
[6683] 4185: AF399607
[6684] Homo sapiens clone OR6W1 olfactory receptor gene, partial cds
[6685] gi|15293798|gb|AF399607.1|AF399607[15293798]
[6686] 4186: AF399606
[6687] Homo sapiens clone OR6M1 olfactory receptor gene, partial cds
[6688] gi|15293796|gb|AF399606.1|AF399606[15293796]
[6689] 4187: AF399605
[6690] Homo sapiens clone OR6B1 olfactory receptor gene, partial cds
[6691] gi|5293794|gb|AF399605.1|AF399605[15293794]
[6692] 4188: AF399604
[6693] Homo sapiens clone OR6F1 olfactory receptor gene, partial cds
[6694] gi|15293792|gb|AF399604.1|AF399604[15293792]
[6695] 4189: AF399603
[6696] Homo sapiens clone OR13J1 olfactory receptor gene, partial cds
[6697] gi|15293790|gb|AF399603.1|AF399603[15293790]
[6698] 4190: AF399602
[6699] Homo sapiens clone OR13C4 olfactory receptor gene, partial cds
[6700] gi|15293788|gb|AF399602.1|AF399602[15293788]
[6701] 4191: AF399601
[6702] Homo sapiens clone OR2S2 olfactory receptor gene, partial cds
[6703] gi|15293786|gb|AF399601.1|AF399601[15293786]
[6704] 4192: AF399600
[6705] Homo sapiens clone OR13C7 olfactory receptor gene, partial cds
[6706] gi|15293784|gb|AF399600.1|AF399600[15293784]
[6707] 4193: AF399599
[6708] Homo sapiens clone OR13C8 olfactory receptor gene, partial cds
[6709] gi|15293782|gb|AF399599.1|AF399599[15293782]
[6710] 4194: AF399598
[6711] Homo sapiens clone OR2A7 olfactory receptor gene, partial cds
[6712] gi|15293780|gb|AF399598.1|AF399598[15293780]
[6713] 4195: AF399597
[6714] Homo sapiens clone OR2A1 olfactory receptor gene, partial cds
[6715] gi|15293778|gb|AF399597.1|AF399597[15293778]
[6716] 4196: AF399596
[6717] Homo sapiens clone OR2A6 olfactory receptor gene, partial cds
[6718] gi|15293776|gb|AF399596.1|AF399596[15293776]
[6719] 4197: AF399595
[6720] Homo sapiens clone OR2A5 olfactory receptor gene, partial cds
[6721] gi|15293774|gb|AF399595.1|AF399595[15293774]
[6722] 4198: AF399594
[6723] Homo sapiens clone OR2F1 olfactory receptor gene, partial cds
[6724] gi|15293772|gb|AF399594.1|AF399594[15293772]
[6725] 4199: AF399593
[6726] Homo sapiens clone OR10V1 olfactory receptor gene, partial cds
[6727] gi|15293770|gb|AF399593.1|AF399593[15293770]
[6728] 4200: AF399592
[6729] Homo sapiens clone OR2D3 olfactory receptor gene, partial cds
[6730] gi|15293768|gb|AF399592.1|AF399592[15293768]
[6731] 4201: AF399591
[6732] Homo sapiens clone OR2D2 olfactory receptor gene, partial cds
[6733] gi|15293766|gb|AF399591.1|AF399591[15293766]
[6734] 4202: AF399590
[6735] Homo sapiens clone OR5AY1 olfactory receptor gene, partial cds
[6736] gi|15293764|gb|AF399590.1|AF399590[15293764]
[6737] 4203: AF399589
[6738] Homo sapiens clone OR5AX1 olfactory receptor gene, partial cds
[6739] gi|15293762|gb|AF399589.1|AF399589[15293762]
[6740] 4204: AF399588
[6741] Homo sapiens clone OR10J6 olfactory receptor gene, partial cds
[6742] gi|15293760|gb|AF399588.1|AF399588[15293760]
[6743] 4205: AF399587
[6744] Homo sapiens clone OR10J1 olfactory receptor gene, partial cds
[6745] gi|15293758|gb|AF399587.1|AF399587[15293758]
[6746] 4206: AF399586
[6747] Homo sapiens clone OR10H4 olfactory receptor gene, partial cds
[6748] gi|15293756|gb|AF399586.1|AF399586[15293756]
[6749] 4207: AF399585
[6750] Homo sapiens clone OR10H2 olfactory receptor gene, partial cds
[6751] gi|15293754|gb|AF399585.1|AF399585[15293754]
[6752] 4208: AF399584
[6753] Homo sapiens clone OR10H1 olfactory receptor gene, partial cds
[6754] gi|15293752|gb|AF399584.1|AF399584[15293752]
[6755] 4209: AF399583
[6756] Homo sapiens clone OR10H5 olfactory receptor gene, partial cds
[6757] gi|15293750|gb|AF399583.1|AF399583[15293750]
[6758] 4210: AF399582
[6759] Homo sapiens clone OR10R2 olfactory receptor gene, partial cds
[6760] gi|15293748|gb|AF399582.1|AF399582[15293748]
[6761] 4211: AF399581
[6762] Homo sapiens clone OR4E2 olfactory receptor gene, partial cds
[6763] gi|15293746|gb|AF399581.1|AF399581[15293746]
[6764] 4212: AF399580
[6765] Homo sapiens clone OR4X2 olfactory receptor gene, partial cds
[6766] gi|15293744|gb|AF399580.1|AF399580[15293744]
[6767] 4213: AF399579
[6768] Homo sapiens clone OR4B1 olfactory receptor gene, partial cds
[6769] gi|5293742|gb|AF399579.1|AF399579[15293742]
[6770] 4214: AF399578
[6771] Homo sapiens clone OR4A15 olfactory receptor gene, partial cds
[6772] gi|15293740|gb|AF399578.1|AF399578[15293740]
[6773] 4215: AF399577
[6774] Homo sapiens clone OR4A4 olfactory receptor gene, partial cds
[6775] gi|15293738|gb|AF399577.1|AF399577[15293738]
[6776] 4216: AF399576
[6777] Homo sapiens clone OR4C12 olfactory receptor gene, partial cds
[6778] gi|15293736|gb|AF399576.1|AF399576[15293736]
[6779] 4217: AF399575
[6780] Homo sapiens clone OR4C13 olfactory receptor gene, partial cds
[6781] gi|15293734|gb|AF399575.1|AF399575[15293734]
[6782] 4218: AF399574
[6783] Homo sapiens clone OR4F4 olfactory receptor gene, partial cds
[6784] gi|15293732|gb|AF399574.1|AF399574[15293732]
[6785] 4219: AF399573
[6786] Homo sapiens clone OR4F15 olfactory receptor gene, partial cds
[6787] gi|15293730|gb|AF399573.1|AF399573[15293730]
[6788] 4220: AF399572
[6789] Homo sapiens clone OR4K14 olfactory receptor gene, partial cds
[6790] gi|5293728|gb|AF399572.1|AF399572[15293728]
[6791] 4221: AF399571
[6792] Homo sapiens clone OR4K3 olfactory receptor gene, partial cds
[6793] gi|15293726|gb|AF399571.1|AF399571[15293726]
[6794] 4222: AF399570
[6795] Homo sapiens clone OR4K1 olfactory receptor gene, partial cds
[6796] gi|15293724|gb|AF399570.1|AF399570[15293724]
[6797] 4223: AF399569
[6798] Homo sapiens clone OR4D6 olfactory receptor gene, partial cds
[6799] gi|15293722|gb|AF399569.1|AF399569[15293722]
[6800] 4224: AF399568
[6801] Homo sapiens clone OR4D2 olfactory receptor gene, partial cds
[6802] gi|15293720|gb|AF399568.1|AF399568[15293720]
[6803] 4225: AF399567
[6804] Homo sapiens clone OR4D1 olfactory receptor gene, partial cds
[6805] gi|15293718|gb|AF399567.1|AF399567[15293718]
[6806] 4226: AF399566
[6807] Homo sapiens clone OR10G3 olfactory receptor gene, partial cds
[6808] gi|15293716|gb|AF399566.1|AF399566[15293716]
[6809] 4227: AF399565
[6810] Homo sapiens clone OR10S1 olfactory receptor gene, partial cds
[6811] gi|15293714|gb|AF399565.1|AF399565[15293714]
[6812] 4228: AF399564
[6813] Homo sapiens clone OR1L8 olfactory receptor gene, partial cds
[6814] gi|5293712|gb|AF399564.1|AF399564[15293712]
[6815] 4229: AF399563
[6816] Homo sapiens clone OR1L6 olfactory receptor gene, partial cds
[6817] gi|15293710|gb|AF399563.1|AF399563[15293710]
[6818] 4230: AF399562
[6819] Homo sapiens clone OR1L4 olfactory receptor gene, partial cds
[6820] gi|15293708|gb|AF399562.1|AF399562[15293708]
[6821] 4231: AF399561
[6822] Homo sapiens clone ORIQI olfactory receptor gene, partial cds
[6823] gi|15293706|gb|AF399561.1|AF399561[15293706]
[6824] 4232: AF399560
[6825] Homo sapiens clone OR1C1 olfactory receptor gene, partial cds
[6826] gi|15293704|gb|AF399560.1|AF399560[15293704]
[6827] 4233: AF399559
[6828] Homo sapiens clone OR1F1 olfactory receptor gene, partial cds
[6829] gi|15293702|gb|AF399559.1|AF399559[15293702]
[6830] 4234: AF399558
[6831] Homo sapiens clone OR1F2 olfactory receptor gene, partial cds
[6832] gi|15293700|gb|AF399558.1|AF399558[15293700]
[6833] 4235: AF399557
[6834] Homo sapiens clone OR1S2 olfactory receptor gene, partial cds
[6835] gi|15293698|gb|AF399557.1|AF399557[15293698]
[6836] 4236: AF399556
[6837] Homo sapiens clone OR1A2 olfactory receptor gene, partial cds
[6838] gi|15293696|gb|AF399556.1|AF399556[15293696]
[6839] 4237: AF399555
[6840] Homo sapiens clone OR1A1 olfactory receptor gene, partial cds
[6841] gi|15293694|gb|AF399555.1|AF399555[15293694]
[6842] 4238: AF399554
[6843] Homo sapiens clone OR1J1 olfactory receptor gene, partial cds
[6844] gi|15293692|gb|AF399554.1|AF399554[15293692]
[6845] 4239: AF399553
[6846] Homo sapiens clone OR1J4 olfactory receptor gene, partial cds
[6847] gi|5293690|gb|AF399553.1|AF399553[15293690]
[6848] 4240: AF399552
[6849] Homo sapiens clone OR1J2 olfactory receptor gene, partial cds
[6850] gi|15293688|gb|AF399552.1|AF399552[15293688]
[6851] 4241: AF399551
[6852] Homo sapiens clone OR1E2 olfactory receptor gene, partial cds
[6853] gi|15293686|gb|AF399551.1|AF399551[15293686]
[6854] 4242: AF399550
[6855] Homo sapiens clone OR1E1 olfactory receptor gene, partial cds
[6856] gi|15293684|gb|AF399550.1|AF399550[15293684]
[6857] 4243: AF399549
[6858] Homo sapiens clone OR1M1 olfactory receptor gene, partial cds
[6859] gi|15293682|gb|AF399549.1|AF399549[15293682]
[6860] 4244: AF399548
[6861] Homo sapiens clone OR1I1 olfactory receptor gene, partial cds
[6862] gi|5293680|gb|AF399548.1|AF399548[15293680]
[6863] 4245: AF399547
[6864] Homo sapiens clone OR1N3 olfactory receptor gene, partial cds
[6865] gi|15293678|gb|AF399547.1|AF399547[15293678]
[6866] 4246: AF399546
[6867] Homo sapiens clone OR7C1 olfactory receptor gene, partial cds
[6868] gi|15293676|gb|AF399546.1|AF399546[15293676]
[6869] 4247: AF399545
[6870] Homo sapiens clone OR7C2 olfactory receptor gene, partial cds
[6871] gi|15293674|gb|AF399545.1|AF399545[15293674]
[6872] 4248: AF399544
[6873] Homo sapiens clone OR7A2 olfactory receptor gene, partial cds
[6874] gi|15293672|gb|AF399544.1|AF399544[15293672]
[6875] 4249: AF399543
[6876] Homo sapiens clone OR7A5 olfactory receptor gene, partial cds
[6877] gi|15293670|gb|AF399543.1|AF399543[15293670]
[6878] 4250: AF399542
[6879] Homo sapiens clone OR7A10 olfactory receptor gene, partial cds
[6880] gi|15293668|gb|AF399542.1|AF399542[15293668]
[6881] 4251: AF399541
[6882] Homo sapiens clone OR7A17 olfactory receptor gene, partial cds
[6883] gi|15293666|gb|AF399541.1|AF399541[15293666]
[6884] 4252: AF399540
[6885] Homo sapiens clone OR7G3 olfactory receptor gene, partial cds
[6886] gi|15293664|gb|AF399540.1|AF399540[15293664]
[6887] 4253: AF399539
[6888] Homo sapiens clone OR7G2 olfactory receptor gene, partial cds
[6889] gi|15293662|gb|AF399539.1|AF399539[15293662]
[6890] 4254: AF399538
[6891] Homo sapiens clone OR7G1 olfactory receptor gene, partial cds
[6892] gi|15293660|gb|AF399538.1|AF399538[15293660]
[6893] 4255: AF399537
[6894] Homo sapiens clone OR7D2 olfactory receptor gene, partial cds
[6895] gi|15293658|gb|AF399537.1|AF399537[15293658]
[6896] 4256: AF399536
[6897] Homo sapiens clone OR1N2 olfactory receptor gene, partial cds
[6898] gi|15293656|gb|AF399536.1|AF399536[15293656]
[6899] 4257: AF399535
[6900] Homo sapiens clone OR1D2 olfactory receptor gene, partial cds
[6901] gi|15293654|gb|AF399535.1|AF399535[15293654]
[6902] 4258: AF399534
[6903] Homo sapiens clone OR1D4 olfactory receptor gene, partial cds
[6904] gi|15293652|gb|AF399534.1|AF399534[15293652]
[6905] 4259: AF399533
[6906] Homo sapiens clone OR1D5 olfactory receptor gene, partial cds
[6907] gi|15293650|gb|AF399533.1|AF399533[15293650]
[6908] 4260: AF399532
[6909] Homo sapiens clone OR9Q1 olfactory receptor gene, partial cds
[6910] gi|15293648|gb|AF399532.1|AF399532[15293648]
[6911] 4261: AF399531
[6912] Homo sapiens clone OR9I1 olfactory receptor gene, partial cds
[6913] gi|15293646|gb|AF399531.1|AF399531[15293646]
[6914] 4262: AF399530
[6915] Homo sapiens clone OR9G4 olfactory receptor gene, partial cds
[6916] gi|15293644|gb|AF399530.1|AF399530[15293644]
[6917] 4263: AF399529
[6918] Homo sapiens clone OR5A2 olfactory receptor gene, partial cds
[6919] gi|15293642|gb|AF399529.1|AF399529[15293642]
[6920] 4264: AF399528
[6921] Homo sapiens clone OR5A1 olfactory receptor gene, partial cds
[6922] gi|15293640|gb|AF399528.1|AF399528[15293640]
[6923] 4265: AF399527
[6924] Homo sapiens clone OR5F1 olfactory receptor gene, partial cds
[6925] gi|15293638|gb|AF399527.1|AF399527[15293638]
[6926] 4266: AF399526
[6927] Homo sapiens clone OR5L2 olfactory receptor gene, partial cds
[6928] gi|15293636|gb|AF399526.1|AF399526[15293636]
[6929] 4267: AF399525
[6930] Homo sapiens clone OR5D18 olfactory receptor gene, partial cds
[6931] gi|15293634|gb|AF399525.1|AF399525[15293634]
[6932] 4268: AF399524
[6933] Homo sapiens clone OR5D16 olfactory receptor gene, partial cds
[6934] gi|15293632|gb|AF399524.1|AF399524[15293632]
[6935] 4269: AF399523
[6936] Homo sapiens clone OR5D14 olfactory receptor gene, partial cds
[6937] gi|15293630|gb|AF399523.1|AF399523[15293630]
[6938] 4270: AF399522
[6939] Homo sapiens clone OR5M1 olfactory receptor gene, partial cds
[6940] gi|15293628|gb|AF399522.1|AF399522[15293628]
[6941] 4271: AF399521
[6942] Homo sapiens clone OR5M11 olfactory receptor gene, partial cds
[6943] gi|15293626|gb|AF399521.1|AF399521[15293626]
[6944] 4272: AF399520
[6945] Homo sapiens clone OR5 MB olfactory receptor gene, partial cds
[6946] gi|15293624|gb|AF399520.1|AF399520[15293624]
[6947] 4273: AF399519
[6948] Homo sapiens clone OR5M9 olfactory receptor gene, partial cds
[6949] gi|15293622|gb|AF399519.1|AF399519[15293622]
[6950] 4274: AF399518
[6951] Homo sapiens clone OR5M3 olfactory receptor gene, partial cds
[6952] gi|15293620|gb|AF399518.1|AF399518[15293620]
[6953] 4275: AF399517
[6954] Homo sapiens clone OR8K1 olfactory receptor gene, partial cds
[6955] gi|15293618|gb|AF399517.1|AF399517[15293618]
[6956] 4276: AF399516
[6957] Homo sapiens clone OR8J3 olfactory receptor gene, partial cds
[6958] gi|15293616|gb|AF399516.1|AF399516[15293616]
[6959] 4277: AF399515
[6960] Homo sapiens clone OR8J1 olfactory receptor gene, partial cds
[6961] gi|15293614|gb|AF399515.1|AF399515[15293614]
[6962] 4278: AF399514
[6963] Homo sapiens clone OR5C1 olfactory receptor gene, partial cds
[6964] gi|15293612|gb|AF399514.1|AF399514[15293612]
[6965] 4279: AF399513
[6966] Homo sapiens clone OR8I2 olfactory receptor gene, partial cds
[6967] gi|15293610|gb|AF399513.1|AF399513[15293610]
[6968] 4280: AF399512
[6969] Homo sapiens clone OR8A1 olfactory receptor gene, partial cds
[6970] gi|15293608|gb|AF399512.1|AF399512[15293608]
[6971] 4281: AF399511
[6972] Homo sapiens clone OR8B12 olfactory receptor gene, partial cds
[6973] gi|15293606|gb|AF399511.1|AF399511[15293606]
[6974] 4282: AF399510
[6975] Homo sapiens clone OR8B8 olfactory receptor gene, partial cds
[6976] gi|15293604|gb|AF399510.1|AF399510[15293604]
[6977] 4283: AF399509
[6978] Homo sapiens clone OR8B4 olfactory receptor gene, partial cds
[6979] gi|15293602|gb|AF399509.1|AF399509[15293602]
[6980] 4284: AF399508
[6981] Homo sapiens clone OR8B2 olfactory receptor gene, partial cds
[6982] gi|15293600|gb|AF399508.1|AF399508[15293600]
[6983] 4285: AF399507
[6984] Homo sapiens clone OR8G1 olfactory receptor gene, partial cds
[6985] gi|15293598|gb|AF399507.1|AF399507[15293598]
[6986] 4286: AF399506
[6987] Homo sapiens clone OR6C1 olfactory receptor gene, partial cds
[6988] gi|15293596|gb|AF399506.1|AF399506[15293596]
[6989] 4287: AF399505
[6990] Homo sapiens clone OR52B2 olfactory receptor gene, partial cds
[6991] gi|15293594|gb|AF399505.1|AF399505[15293594]
[6992] 4288: AF399504
[6993] Homo sapiens clone OR52E6 olfactory receptor gene, partial cds
[6994] gi|15293592|gb|AF399504.1|AF399504[15293592]
[6995] 4289: AF399503
[6996] Homo sapiens clone OR51B2 olfactory receptor gene, partial cds
[6997] gi|15293590|gb|AF399503.1|AF399503[15293590]
[6998] 4290: AF244813
[6999] Homo sapiens platelet-derived growth factor C mRNA, complete cds
[7000] gi|8886883|gb|AF244813.1|AF244813[8886883]
[7001] 4291: AF169650
[7002] Homo sapiens high mobility group 1 protein (HMG1) gene, exon 5
[7003] gi|14522864|gb|AF169650.1|AF169650[14522864]
[7004] 4451: AF330055
[7005] Homo sapiens neuropeptide NPVF receptor mRNA, complete cds
[7006] gi|15281399|gb|AF330055.1|AF330055[15281399]
[7007] 4452: AF330053
[7008] Homo sapiens neuropeptide NPFF receptor mRNA, complete cds
[7009] gi|15281395|gb|AF330053.1|AF330053[15281395]
[7010] 4453: AF402318
[7011] Homo sapiens differentiation-related DIF14 long form (DIF14) mRNA, complete cds,
[7012] alternatively spliced
[7013] gi|15278166|gb|AF402318.1|AF402318[15278166]
[7014] 4454: AF397453
[7015] Homo sapiens Fc receptor-like protein 5 (FCRH5) mRNA, complete cds
[7016] gi|15277745|gb|AF397453.1|AF397453[15277745]
[7017] 4455: AF397452
[7018] Homo sapiens Fc receptor-like protein 4 (FCRH4) mRNA, complete cds
[7019] gi|15277740|gb|AF397452.1|AF397452[15277740]
[7020] 4456: AF400441
[7021] Homo sapiens neurotrophic tyrosine kinase receptor type 2 (NTRK2) mRNA, complete
[7022] cds
[7023] gi|15217076|gb|AF400441.1|AF400441[15217076]
[7024] 4462: NM—020535
[7025] Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5 (KIR2DL5), mRNA
[7026] gi|11968153|ref|NM—020535.1|[11968153]
[7027] 4463: AP000511
[7028] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 10/20
[7029] gi|5926698|dbj|AP000511.1|AP000511[5926698]
[7030] 4465: L20295
[7031] Homo sapiens vasoactive intestinal peptide receptor mRNA, partial cds
[7032] gi|403461|gb|L20295.1|HUMVAIPR[403461]
[7033] 4466: AY040568
[7034] Homo sapiens interleukin 22-binding protein CRF2-10S (IL22BP) mRNA, complete cds, alternatively spliced
[7035] gi|5212829|gb|AY040568.1|[15212829]
[7036] 4467: AY040567
[7037] Homo sapiens interleukin 22-binding protein CRF2-10L (IL22BP) mRNA, complete cds, alternatively spliced
[7038] gi|15212827|gb|AY040567.1|[15212827]
[7039] 4468: AY040566
[7040] Homo sapiens interleukin 22-binding protein CRF2-10 (IL22BP) mRNA, complete cds
[7041] gi|15212825|gb|AY040566.1|[15212825]
[7042] 4471: AX193708
[7043] Sequence 30 from Patent WO0136467
[7044] gi|15211557|emb|AX193708.1|AX193708[15211557]
[7045] 4472: AX193705
[7046] Sequence 27 from Patent WO0136467
[7047] gi|15211554|emb|AX193705.1|AX193705[15211554]
[7048] 4473: AX193702
[7049] Sequence 24 from Patent WO0136467
[7050] gi|15211551|emb|AX193702.1|AX193702[15211551]
[7051] 4474: AX193682
[7052] Sequence 4 from Patent WO0136467
[7053] gi|15211548|emb|AX193682.1|AX193682[15211548]
[7054] 4475: AX193679
[7055] Sequence 1 from Patent WO0136467
[7056] gi|15211545|emb|AX193679.1|AX193679[15211545]
[7057] 4476: NM—005675
[7058] Homo sapiens DiGeorge syndrome critical region gene 6 (DGCR6), mRNA
[7059] gi|15208653|ref|NM—005675.2|[15208653]
[7060] 4477: NM—016083
[7061] Homo sapiens cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, mRNA
[7062] gi|15208646|ref|NM—016083.2|[15208646]
[7063] 4478: NM—016205
[7064] Homo sapiens platelet derived growth factor C (PDGFC), mRNA
[7065] gi|9994186|ref|NM—016205.1|[9994186]
[7066] 4479: AF159056
[7067] Homo sapiens T-cell gamma receptor locus, complete sequence
[7068] gi|5566238|gb|AF159056.1|AF159056[5566238]
[7069] 4480: NM—006207
[7070] Homo sapiens platelet-derived growth factor receptor-like (PDGFRL), mRNA
[7071] gi|5453871|ref|NM—006207.1|[5453871]
[7072] 4481: NM—004986
[7073] Homo sapiens kinectin 1 (kinesin receptor) (KTN1), mRNA
[7074] gi|4826813|ref|NM—004986.1|[4826813]
[7075] 4482: NM—001840
[7076] Homo sapiens cannabinoid receptor 1 (brain) (CNR1), transcript variant 1, mRNA
[7077] gi|4502926|ref|NM—001840.1|[4502926]
[7078] 4483: NM—033223
[7079] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), mRNA
[7080] gi|15193297|ref|NM—033223.1|[15193297]
[7081] 4484: AY008283
[7082] Homo sapiens porimin mRNA, complete cds
[7083] gi|15192138|gb|AY008283.1|[15192138]
[7084] 4485: NM—015906
[7085] Homo sapiens tripartite motif-containing 33 (TRIM33), transcript variant alpha,
[7086] mRNA
[7087] gi|14971412|ref|NM—015906.2|[14971412]
[7088] 4486: NM—033020
[7089] Homo sapiens tripartite motif-containing 33 (TRIM33), transcript variant beta,
[7090] mRNA
[7091] gi|14971410|ref|NM—033020.1|[14971410]
[7092] 4487: AH006431
[7093] Homo sapiens glycine receptor alpha 2 subunit, complete cds
[7094] gi|3598700|gb|AH006431.1|SEG_HSGLRA2G[3598700]
[7095] 4488: AF053495
[7096] Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 9 and complete
[7097] cds
[7098] gi|3598699|gb|AF053495.1|HSGLRA2G9[3598699]
[7099] 4489: AF053494
[7100] Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 8
[7101] gi|3598698|gb|AF053494.1|HSGLRA2G8[3598698]
[7102] 4490: AF053493
[7103] Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 7
[7104] gi|3598697|gb|AF053493.1|HSGLRA2G7[3598697]
[7105] 4491: AF053492
[7106] Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 6
[7107] gi|3598696|gb|AF053492.1|HSGLRA2G6[3598696]
[7108] 4492: AF053491
[7109] Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 5
[7110] gi|3598695|gb|AF053491.1|HSGLRA2G5[3598695]
[7111] 4493: AF053490
[7112] Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 4
[7113] gi|3598694|gb|AF053490.1|HSGLRA2G4[3598694]
[7114] 4494: AF053489
[7115] Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exons 3a and 3b
[7116] gi|3598693|gb|AF053489.1|HSGLRA2G3[3598693]
[7117] 4495: AF053488
[7118] Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 2
[7119] gi|3598692|gb|AF053488.1|HSGLRA2G2[3598692]
[7120] 4496: AF053487
[7121] Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 1
[7122] gi|3598691|gb|AF053487.1|HSGLRA2G1[3598691]
[7123] 4499: AF344654
[7124] Homo sapiens growth hormone receptor variant gene, partial cds
[7125] gi|15186845|gb|AF344654.1|[15186845]
[7126] 4501: AF179680
[7127] Homo sapiens apelin gene, complete cds
[7128] gi|6708145|gb|AF179680.1|AF179680[6708145]
[7129] 4502: AJ296652
[7130] Homo sapiens HRH3 gene for histamine h3 receptor, exons 1-3
[7131] gi|15149878|emb|AJ296652.1|HSA296652[15149878]
[7132] 4503: NM—006707
[7133] Homo sapiens butyrophilin-like 3 (BTNL3), mRNA
[7134] gi|5729747|ref|NM—006707.1|[5729747]
[7135] 4504: NM—002009
[7136] Homo sapiens fibroblast growth factor 7 (keratinocyte growth factor) (FGF7), mRNA
[7137] gi|15147344|ref|NM—002009.2|[15147344]
[7138] 4505: AF190501
[7139] Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 6 (LGR6)
[7140] mRNA, partial cds
[7141] gi|10441731|gb|AF190501.1|AF190501[10441731]
[7142] 4506: AF190500
[7143] Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 7 (LGR7)
[7144] mRNA, complete cds
[7145] gi|10441729|gb|AF190500.1|AF190500[10441729]
[7146] 4507: NM—016543
[7147] Homo sapiens sialic acid binding Ig-like lectin 7 (SIGLEC7), mRNA
[7148] gi|7706570|ref|NM—016543.1|[7706570]
[7149] 4508: NM—014385
[7150] Homo sapiens sialic acid binding Ig-like lectin 7 (SIGLEC7), mRNA
[7151] gi|7657569|ref|NM—014385.1|[7657569]
[7152] 4509: AC005153
[7153] Homo sapiens PAC clone RP4-537P9 from 7p11.2-p12, complete sequence
[7154] gi|3242766|gb|AC005153.1|AC005153[3242766]
[7155] 4528: AJ309020
[7156] Homo sapiens mRNA for G protein-coupled receptor (AXOR12 gene)
[7157] gi|14330412|emb|AJ309020.1|HSA309020[14330412]
[7158] 4529: AJ243297
[7159] Homo sapiens partial RET gene, exons 2 to 20
[7160] gi|5419752|emb|AJ243297.1|HSA243297[5419752]
[7161] 4530: X57019
[7162] H. sapiens mRNA for tyrosine kinase receptor
[7163] gi|37592|emb|X57019.1|HSUF025[37592]
[7164] 4585: AF166361
[7165] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 9 and complete cds
[7166] gi|10086249|gb|AF166361.1|AF165901S9[10086249]
[7167] 4586: AF166360
[7168] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 8
[7169] gi|10086248|gb|AF166360.1|AF165901S8[10086248]
[7170] 4587: AF166359
[7171] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 7
[7172] gi|10086247|gb|AF166359.1|AF165901S7[10086247]
[7173] 4588: AF165906
[7174] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 6
[7175] gi|10086246|gb|AF165906.1|AF165901S6[10086246]
[7176] 4589: AF165905
[7177] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 5
[7178] gi|10086245|gb|AF165905.1|AF165901S5[10086245]
[7179] 4590: AF165904
[7180] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 4
[7181] gi|10086244|gb|AF165904.1|AF165901S4[10086244]
[7182] 4591: AF165903
[7183] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 3
[7184] gi|0086243|gb|AF165903.1|AF165901S3[10086243]
[7185] 4592: AF165902
[7186] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 2
[7187] gi|10086242|gb|AF165902.1|AF165901S2[10086242]
[7188] 4593: AF165901
[7189] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 1
[7190] gi|10086241|gb|AF165901.1|AF165901S1[10086241]
[7191] 4594: AH009803
[7192] Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, complete cds
[7193] gi|10086240|gb|AH009803.1|SEG_AF165901S[10086240]
[7194] 4595: AF167332
[7195] Homo sapiens glutamate receptor subunit 3 flip and flop isoforms (GRIA3) gene,
[7196] exon 16 and partial cds, alternatively spliced
[7197] gi|9738978|gb|AF167332.1|F166362S15[9738978]
[7198] 4596: AF166375
[7199] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 15
[7200] gi|9738977|gb|AF166375.1|F166362S14[9738977]
[7201] 4597: AF166374
[7202] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 14
[7203] gi|9738976|gb|AF166374.1|F166362S13[9738976]
[7204] 4598: AF166373
[7205] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 13
[7206] gi|9738975|gb|AF166373.1F166362S12[9738975]
[7207] 4599: AF166372
[7208] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 12
[7209] gi|9738974|gb|AF166372.1|F166362S11[9738974]
[7210] 4600: AF166371
[7211] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 11
[7212] gi|9738973|gb|AF166371.1|F166362S10[9738973]
[7213] 4601: AF166370
[7214] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 10
[7215] gi|9738972|gb|AF166370.1|F166362S09[9738972]
[7216] 4602: AF166369
[7217] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 9
[7218] gi|9738971|gb|AF166369.1F166362S08[9738971]
[7219] 4603: AF166368
[7220] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 8
[7221] gi|9738970|gb|AF166368.1|F166362S07[9738970]
[7222] 4604: AF166367
[7223] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 7
[7224] gi|9738969|gb|AF166367.1|F166362S06[9738969]
[7225] 4605: AF166366
[7226] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 6
[7227] gi|9738968|gb|AF166366.1|F166362S05[9738968]
[7228] 4606: AF166365
[7229] Homo sapiens glutamate receptor subunit 3 flip and flop isoforms (GRIA3) gene,
[7230] exon 4 and partial cds
[7231] gi|9738967|gb|AF166365.1|F166362S04[9738967]
[7232] 4607: AF166364
[7233] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 3
[7234] gi|9738966|gb|AF166364.1|F166362S03[9738966]
[7235] 4608: AF166363
[7236] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 2
[7237] gi|9738965|gb|AF166363.1|F166362S02[9738965]
[7238] 4609: AF166362
[7239] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 1
[7240] gi|9738964|gb|AF166362.1|F166362S01[9738964]
[7241] 4610: AH009704
[7242] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, partial cds; and glutamate receptor subunit 3 (GRIA3) gene, partial cds, alternatively spliced
[7243] gi|9738963|gb|AH009704.1|SEG_F166362S[9738963]
[7244] 4611: AF272389
[7245] Homo sapiens natural killer cell immunoglobulin-like receptor (KIR2D55) mRNA, partial cds
[7246] gi|15080894|gb|AF272389.1|AF272389[15080894]
[7247] 4612: BC011847
[7248] Homo sapiens, fibroblast growth factor receptor 4, clone MGC:20292 IMAGE:4121396, mRNA, complete cds
[7249] gi|15080147|gb|BC011847.1|BC011847[15080147]
[7250] 4613: BC011787
[7251] Homo sapiens, nogo receptor, clone MGC:19831 IMAGE:4040540, mRNA, complete cds
[7252] gi|15080004|gb|BC011787.1|BC011787[15080004]
[7253] 4614: AF353942
[7254] Homo sapiens lantibiotic synthetase C-like protein 2 (LANCL2) mRNA, complete cds
[7255] gi|15077638|gb|AF353942.1|AF353942[15077638]
[7256] 4615: AF343725
[7257] Homo sapiens G-protein-coupled receptor GPR54 (GPR54) mRNA, complete cds
[7258] gi|15077535|gb|AF343725.1|AF343725[15077535]
[7259] 4617: AJ272063
[7260] Homo sapiens mRNA for vanilloid receptor 1 (VR1 gene)
[7261] gi|15028818|emb|AJ272063.2|HSA272063[15028818]
[7262] 4618: AF133266
[7263] Homo sapiens cysteinyl leukotriene receptor mRNA, complete cds
[7264] gi|5359717|gb|AF133266.1|AF133266[5359717]
[7265] 4619: NM—033130
[7266] Homo sapiens sialic acid binding Ig-like lectin 10 (SIGLEC10), mRNA
[7267] gi|15055512|ref|NM—033130.1|[15055512]
[7268] 4620: NM—033180
[7269] Homo sapiens olfactory receptor, family 51, subfamily B, member 2 (OR51B2), mRNA
[7270] gi|15042966|ref|NM—033180.1|[15042966]
[7271] 4621: NM—033179
[7272] Homo sapiens olfactory receptor, family 51, subfamily B, member 4 (OR51B4), mRNA
[7273] gi|15042964|ref|NM—033179.1|[15042964]
[7274] 4622: AF380193
[7275] Homo sapiens trace amine receptor 5 (TA5) gene, complete cds
[7276] gi|14600089|gb|AF380193.1|AF380193[14600089]
[7277] 4623: AF380192
[7278] Homo sapiens trace amine receptor 4 (TA4) gene, complete cds
[7279] gi|14600087|gb|AF380192.1|AF380192[14600087]
[7280] 4624: AF380189
[7281] Homo sapiens trace amine receptor 3 (TA3) gene, complete cds
[7282] gi|14600081|gb|AF380189.1|AF380189[14600081]
[7283] 4625: AF380185
[7284] Homo sapiens trace amine receptor 1 (TA1) gene, complete cds
[7285] gi|14600073|gb|AF380185.1|AF380185[14600073]
[7286] 4626: AF313468
[7287] Homo sapiens dendritic cell-associated C-type lectin-1 mRNA, complete cds
[7288] gi|13649707|gb|AF313468.1|AF313468[13649707]
[7289] 4627: NM—007096
[7290] Homo sapiens clathrin, light polypeptide (Lca) (CLTA), transcript variant brain-specific, mRNA
[7291] gi|6005992|ref|NM—007096.1|[6005992]
[7292] 4628: NM—001833
[7293] Homo sapiens clathrin, light polypeptide (Lca) (CLTA), transcript variant nonbrain, mRNA
[7294] gi|4502898|ref|NM—001833.1|[4502898]
[7295] 4629: NM—005292
[7296] Homo sapiens G protein-coupled receptor 18 (GPR18), mRNA
[7297] gi|15029527|ref|NM—005292.1|[15029527]
[7298] 4630: NM—012276
[7299] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 4 (ILT7), mRNA
[7300] gi|15029521|ref|NM—012276.1|[15029521]
[7301] 4631: AJ299451
[7302] Homo sapiens mRNA for glutamate receptor 7 (GRIK3 gene)
[7303] gi|5028906|emb|AJ299451.1|HSA299451[15028906]
[7304] 4632: AY033606
[7305] Homo sapiens fused in glioblastoma mRNA, complete cds
[7306] gi|14289128|gb|AY033606.1|[14289128]
[7307] 4633: AF190696
[7308] Homo sapiens bile salt export pump (ABCB11) gene, promoter region and partial sequence
[7309] gi|14280234|gb|AF190696.1|AF190696[14280234]
[7310] 4634: NM—018558
[7311] Homo sapiens gamma-aminobutyric acid (GABA) receptor, theta (GABRQ), mRNA
[7312] gi|8924257|ref|NM—018558.1|[8924257]
[7313] 4635: NM—014452
[7314] Homo sapiens tumor necrosis factor receptor superfamily, member 21 (TNFRSF21),
[7315] mRNA
[7316] gi|7657038|ref|NM—014452.1|[7657038]
[7317] 4637: AF320560
[7318] Homo sapiens stresscopin-related protein mRNA, complete cds
[7319] gi|14029393|gb|AF320560.1|AF320560[14029393]
[7320] 4638: NM—007368
[7321] Homo sapiens RAS p21 protein activator (GTPase activating protein) 3 (Ins(1,3,4,5)P4-binding protein) (GAP1IP4BP), mRNA
[7322] gi|12545409|ref|NM—007368.1|[12545409]
[7323] 4639: NM—016109
[7324] Homo sapiens angiopoietin-like 4 (ANGPTL4), mRNA
[7325] gi|7705828|ref|NM—016109.1|[7705828]
[7326] 4640: NM—006667
[7327] Homo sapiens progesterone receptor membrane component 1 (PGRMC1), mRNA
[7328] gi|6857798|ref|NM—006667.2|[6857798]
[7329] 4641: NM—006320
[7330] Homo sapiens progesterone receptor membrane component 2 (PGRMC2), mRNA
[7331] gi|5453915|ref|NM—006320.1|[5453915]
[7332] 4662: AF319553
[7333] Homo sapiens TNFRSF19L mRNA, complete cds
[7334] gi|15011026|gb|AF319553.1|AF319553[15011026]
[7335] 4663: AF395806
[7336] Homo sapiens adrenergic receptor alpha-1a (ADRA1A) mRNA, complete cds
[7337] gi|15004693|gb|AF395806.1|AF395806[15004693]
[7338] 4664: AF388194
[7339] Homo sapiens PML/RARA fusion mRNA, partial sequence
[7340] gi|15004544|gb|AF388194.1|AF388194[15004544]
[7341] 4665: AF388193
[7342] Homo sapiens PML/RARA fusion mRNA, partial sequence
[7343] gi|15004543|gb|AF388193.1|AF388193[15004543]
[7344] 4666: AF334818
[7345] Homo sapiens sodium-dependent neutral amino acid transporter type 2 truncated isoform (ASCT2) mRNA, partial cds
[7346] gi|15004316|gb|AF334818.1|AF334818[15004316]
[7347] 4667: NM—022788
[7348] Homo sapiens Purinergic receptor P2Y, G protein-coupled, 12 (P2RY12), mRNA
[7349] gi|12232482|ref|NM—022788.1|[12232482]
[7350] 4668: NM—016523
[7351] Homo sapiens killer cell lectin-like receptor subfamily F, member 1 (KLRF1), mRNA
[7352] gi|7705573|ref|NM—016523.1|[7705573]
[7353] 4669: NM—002558
[7354] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 1 (P2RX1), mRNA
[7355] gi|4505544|ref|NM—002558.1|[4505544]
[7356] 4670: AF391809
[7357] Homo sapiens coagulation factor II (thrombin) receptor (F2R) gene, complete cds
[7358] gi|14971463|gb|AF391809.2|AF391809[14971463]
[7359] 4671: NM—016930
[7360] Homo sapiens syntaxin 18 (STX18), mRNA
[7361] gi|8394375|ref|NM—016930.1|[8394375]
[7362] 4672: NM—032957
[7363] Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant 1, mRNA
[7364] gi|14790173|ref|NM—032957.1|[14790173]
[7365] 4673: NM—032945
[7366] Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant M68C, mRNA
[7367] gi|14790169|ref|NM—032945.1|[14790169]
[7368] 4674: NM—015647
[7369] Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant 3, mRNA
[7370] gi|14790156|ref|NM—015647.2|[14790156]
[7371] 4675: NM—005409
[7372] Homo sapiens small inducible cytokine subfamily B (Cys-X-Cys), member 11 (SCYB11), mRNA
[7373] gi|14790145|ref|NM—005409.3|[14790145]
[7374] 4676: NM—001305
[7375] Homo sapiens claudin 4 (CLDN4), mRNA
[7376] gi|14790131|ref|NM—001305.2|[14790131]
[7377] 4677: NM—004346
[7378] Homo sapiens caspase 3, apoptosis-related cysteine protease (CASP3), transcript
[7379] variant alpha, mRNA
[7380] gi|14790118|ref|NM—004346.2|[14790118]
[7381] 4678: NM—032991
[7382] Homo sapiens caspase 3, apoptosis-related cysteine protease (CASP3), transcript
[7383] variant beta, mRNA
[7384] gi|14790114|ref|NM—032991.1|[14790114]
[7385] 4679: NM—033057
[7386] Homo sapiens olfactory receptor, family 2, subfamily B, member 2 (OR2B2), mRNA
[7387] gi|14780899|ref|NM—033057.1|[14780899]
[7388] 4680: NM—020137
[7389] Homo sapiens GRIP-associated protein 1 (GRASP1), mRNA
[7390] gi|14719405|ref|NM—020137.1|[14719405]
[7391] 4681: NM—032503
[7392] Homo sapiens G protein-coupled receptor slt (SLT), mRNA
[7393] gi|14210483|ref|NM—032503.1|[14210483]
[7394] 4682: AF260738
[7395] Homo sapiens platelet-derived growth factor C (PDGFC) mRNA, complete cds
[7396] gi|14009503|gb|AF260738.1|AF260738[14009503]
[7397] 4683: AF326275
[7398] Homo sapiens melanocortin 1 receptor (MC1R) gene, complete cds
[7399] gi|12658397|gb|AF326275.1|AF326275[12658397]
[7400] 4684: NM—016434
[7401] Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant 2, mRNA
[7402] gi|7706540|ref|NM—016434.1|[7706540]
[7403] 4685: NM—013314
[7404] Homo sapiens B-cell linker (BLNK), mRNA
[7405] gi|7019534|ref|NM—013314.1|[7019534]
[7406] 4686: NM—005817
[7407] Homo sapiens cargo selection protein (mannose 6 phosphate receptor binding protein) (TIP47), mRNA
[7408] gi|5032182|ref|NM—005817.1|[5032182]
[7409] 4687: NM—003110
[7410] Homo sapiens Sp2 transcription factor (SP2), mRNA
[7411] gi|4507166|ref|NM—003110.1|[4507166]
[7412] 4688: NM—002704
[7413] Homo sapiens pro-platelet basic protein (includes platelet basic protein, beta-thromboglobulin, connective tissue-activating peptide III, neutrophil-activating peptide-2) (PPBP), mRNA
[7414] gi|4505980|ref|NM—002704.1|[4505980]
[7415] 4689: AF064083
[7416] Homo sapiens T-cell receptor beta chain variable region (TCRBV28) mRNA, TCRBV28*S2 allele, partial cds
[7417] gi|3859856|gb|AF064083.1|AF064083[3859856]
[7418] 4690: BC010641
[7419] Homo sapiens, gamma-aminobutyric acid (GABA) A receptor, beta 3, clone MGC:9051
[7420] IMAGE:3871111, mRNA, complete cds
[7421] gi|14714964|gb|BC010641.1|BC010641[14714964]
[7422] 4691: BC010574
[7423] Homo sapiens, glutamate receptor, ionotropic, AMPA2 (alpha 2), clone MGC:17079
[7424] IMAGE:4215347, mRNA, complete cds
[7425] gi|14714845|gb|BC010574.1|BC010574[14714845]
[7426] 4692: BC010536
[7427] Homo sapiens, coxsackie virus and adenovirus receptor, clone MGC:17118 IMAGE:3456544, mRNA, complete cds
[7428] gi|14714774|gb|BC010536.1|BC010536[14714774]
[7429] 4693: BC010423
[7430] Homo sapiens, Ig superfamily receptor LNIR, clone MGC:15117 IMAGE:3610849, mRNA,
[7431] complete cds
[7432] gi|14714573|gb|BC010423.1|BC010423[14714573]
[7433] 4694: BC010418
[7434] Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:16557
[7435] IMAGE:4079845, mRNA, complete cds
[7436] gi|14714563|gb|BC010418.1|BC010418[14714563]
[7437] 4695: NM—020168
[7438] Homo sapiens p21(CDKN1A)-activated kinase 6 (PAK6), mRNA
[7439] gi|14670348|ref|NM—020168.2|[14670348]
[7440] 4696: BC010140
[7441] Homo sapiens, tumor necrosis factor receptor superfamily, member 1A, clone MGC:19588 IMAGE:4131360, mRNA, complete cds
[7442] gi|14603367|gb|BC010140.1|BC010140[14603367]
[7443] 4697: BC010054
[7444] Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:19795
[7445] IMAGE:3845335, mRNA, complete cds
[7446] gi|14603183|gb|BC010054.1|BC010054[14603183]
[7447] 4698: BC009974
[7448] Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:16607
[7449] IMAGE:4110990, mRNA, complete cds
[7450] gi|14602973|gb|BC009974.1|BC009974[14602973]
[7451] 4699: BC009960
[7452] Homo sapiens, interleukin 13 receptor, alpha 1, clone MGC:15228 IMAGE:4300487, mRNA, complete cds
[7453] gi|14602931|gb|BC009960.1|BC009960[14602931]
[7454] 4701: BC009877
[7455] Homo sapiens, purinergic receptor P2Y, G-protein coupled, 11, clone MGC:16468 IMAGE:3953307, mRNA, complete cds
[7456] gi|14602717|gb|BC009877.1|BC009877[14602717]
[7457] 4702: BC009861
[7458] Homo sapiens, super conserved receptor expressed in brain 3, clone MGC:16375 IMAGE:3936037, mRNA, complete cds
[7459] gi|14602675|gb|BC009861.1|BC009861[14602675]
[7460] 4703: BC009748
[7461] Homo sapiens, dopamine receptor D5, clone MGC:10601 IMAGE:3928370, mRNA, complete cds
[7462] gi|14602484|gb|BC009748.1|BC009748[14602484]
[7463] 4705: BC009391
[7464] Homo sapiens, pyrimidinergic receptor P2Y, G-protein coupled, 6, clone MGC:15335
[7465] IMAGE:4128941, mRNA, complete cds
[7466] gi|14424757|gb|BC009391.1|BC009391[14424757]
[7467] 4707: BC009237
[7468] Homo sapiens, thyroid stimulating hormone receptor, clone MGC:2216 IMAGE:2989823, mRNA, complete cds
[7469] gi|14328043|gb|3BC009237.1|BC009237[14328043]
[7470] 4708: BC008982
[7471] Homo sapiens, complement component 5 receptor 1 (C5a ligand), clone MGC:17119 IMAGE:4177114, mRNA, complete cds
[7472] gi|14290435|gb|BC008982.1|BC008982[14290435]
[7473] 4709: BC008867
[7474] Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:16750
[7475] IMAGE:4130936, mRNA, complete cds
[7476] gi|14250793|gb|BC008867.1|BC008867[14250793]
[7477] 4710: BC008786
[7478] Homo sapiens, integrin, alpha 5 (fibronectin receptor, alpha polypeptide), clone
[7479] MGC:3697 IMAGE:3629647, mRNA, complete cds
[7480] gi|14250643|gb|BC008786.1|BC008786[14250643]
[7481] 4711: BC008770
[7482] Homo sapiens, G protein-coupled receptor 56, clone MGC:1409 IMAGE:3139174, mRNA,
[7483] complete cds
[7484] gi|14250619|gb|BC008770.1|BC008770[14250619]
[7485] 4712: BC008734
[7486] Homo sapiens, Fc fragment of IgG, receptor, transporter, alpha, clone MGC:1506
[7487] IMAGE:3163446, mRNA, complete cds
[7488] gi|14250560|gb|BC008734.1|BC008734[14250560]
[7489] 4714: BC008716
[7490] Homo sapiens, discoidin domain receptor family, member 1, clone MGC:8681 IMAGE:2964574, mRNA, complete cds
[7491] gi|14250529|gb|BC008716.1|BC008716[14250529]
[7492] 4715: BC008406
[7493] Homo sapiens, CD36 antigen (collagen type I receptor, thrombospondin receptor),
[7494] clone MGC:14530 IMAGE:4244251, mRNA, complete cds
[7495] gi|14250019|gb|BC008406.1|BC008406[14250019]
[7496] 4716: NM—032571
[7497] Homo sapiens EGF-like module-containing mucin-like receptor EMR3 (EMR3), mRNA
[7498] gi|14211882|ref|NM—032571.1|[14211882]
[7499] 4717: AF345568
[7500] Homo sapiens putative chemokine receptor (FKSG80) mRNA, complete cds
[7501] gi|13517963|gb|AF345568.1|AF345568[13517963]
[7502] 4718: AF345567
[7503] Homo sapiens putative purinergic receptor (FKSG79) mRNA, complete cds
[7504] gi|13517961|gb|AF345567.1|AF345567[13517961]
[7505] 4719: AF345566
[7506] Homo sapiens putative G-protein-coupled receptor FKSG78 (FKSG78) mRNA, complete
[7507] cds
[7508] gi|3517959|gb|AF345566.1|AF345566[13517959]
[7509] 4720: AF345565
[7510] Homo sapiens putative G-protein-coupled receptor FKSG77 (FKSG77) mRNA, complete
[7511] cds
[7512] gi|13517957|gb|AF345565.1|AF345565[13517957]
[7513] 4722: NM—013447
[7514] Homo sapiens egf-like module containing, mucin-like, hormone receptor-like sequence 2 (EMR2), mRNA
[7515] gi|7305024|ref|NM—013447.1|[7305024]
[7516] 4724: BC007720
[7517] Homo sapiens, 5-hydroxytryptamine (serotonin) receptor 1D, clone MGC:12645 IMAGE:4299633, mRNA, complete cds
[7518] gi|14043458|gb|BC007720.1|BC007720[14043458]
[7519] 4725: BC007713
[7520] Homo sapiens, protein tyrosine phosphatase, receptor type, N, clone MGC:12646 IMAGE:4130827, mRNA, complete cds
[7521] gi|14043446|gb|BC007713.1|BC007713[14043446]
[7522] 4727: BC007566
[7523] Homo sapiens, cargo selection protein (mannose 6 phosphate receptor binding protein), clone MGC:15516 IMAGE:3028104, mRNA, complete cds
[7524] gi|14043156|gb|BC007566.1|BC007566[14043156]
[7525] 4728: BC007408
[7526] Homo sapiens, low density lipoprotein receptor-related protein 3, clone MGC:2428
[7527] IMAGE:3009711, mRNA, complete cds
[7528] gi|13938518|gb|BC007408.1|BC007408[13938518]
[7529] 4729: BC006196
[7530] Homo sapiens, tumor necrosis factor receptor superfamily, member 9, clone MGC:2172 IMAGE:2924109, mRNA, complete cds
[7531] gi|13623200|gb|BC006196.1|BC006196[13623200]
[7532] 4730: BC005912
[7533] Homo sapiens, Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide, clone MGC:14507 IMAGE:4294467, mRNA, complete cds
[7534] gi|13543505|gb|BC005912.1|BC005912[13543505]
[7535] 4731: BC005818
[7536] Homo sapiens, cargo selection protein (mannose 6 phosphate receptor binding protein), clone MGC:11117 IMAGE:3833411, mRNA, complete cds
[7537] gi|13543306|gb|BC005818.1|BC005818[13543306]
[7538] 4732: BC005391
[7539] Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:12521
[7540] IMAGE:3997019, mRNA, complete cds
[7541] gi|13529268|gb|BC005391.1|BC005391[13529268]
[7542] 4733: BC005333
[7543] Homo sapiens, interferon gamma receptor 1, clone MGC:12420 IMAGE:3950528, mRNA,
[7544] complete cds
[7545] gi|13529118|gb|BC005333.1|BC005333[13529118]
[7546] 4734: BC005315
[7547] Homo sapiens, formyl peptide receptor 1, clone MGC:12392 IMAGE:3829614, mRNA, complete cds
[7548] gi|13529064|gb|BC005315.1|BC005315[13529064]
[7549] 4735: BC005268
[7550] Homo sapiens, putative receptor protein, clone MGC:12310 IMAGE:4051155, mRNA, complete cds
[7551] gi|13528953|gb|BC005268.1|BC005268[13528953]
[7552] 4737: BC004555
[7553] Homo sapiens, G protein-coupled receptor, clone MGC:10314 IMAGE:4054377, mRNA,
[7554] complete cds
[7555] gi|13528716|gb|BC004555.1|BC004555[13528716]
[7556] 4738: BC004553
[7557] Homo sapiens, receptor-interacting serine-threonine kinase 2, clone MGC:10684 IMAGE:4026156, mRNA, complete cds
[7558] gi|13528713|gb|BC004553.1|BC004553[13528713]
[7559] 4739: BC004545
[7560] Homo sapiens, leukotriene b4 receptor (chemokine receptor-like 1), clone MGC:10388 IMAGE:3946189, mRNA, complete cds
[7561] gi|13528695|gb|BC004545.1|BC004545[13528695]
[7562] 4740: BC004899
[7563] Homo sapiens, sigma receptor (SR31747 binding protein 1), clone MGC:3851 IMAGE:3529352, mRNA, complete cds
[7564] gi|13436169|gb|BC004899.1|BC004899[13436169]
[7565] 4741: BC004348
[7566] Homo sapiens, interleukin 21 receptor, clone MGC:10967 IMAGE:3634520, mRNA, complete cds
[7567] gi|13279298|gb|BC004348.1|BC004348[13279298]
[7568] 4742: BC003684
[7569] Homo sapiens, coxsackie virus and adenovirus receptor, clone MGC:5086 IMAGE:3463613, mRNA, complete cds
[7570] gi|13277551|gb|BC003684.1|BC003684[13277551]
[7571] 4743: BC003624
[7572] Homo sapiens, interferon gamma receptor 2 (interferon gamma transducer 1), clone
[7573] MGC:2193 IMAGE:2967074, mRNA, complete cds
[7574] gi|13177681|gb|BC003624.1|BC003624[13177681]
[7575] 4744: BC003187
[7576] Homo sapiens, putative G-protein coupled receptor, clone MGC:688 IMAGE:3537949, mRNA, complete cds
[7577] gi|13112026|gb|BC003187.1|BC003187[13112026]
[7578] 4745: BC003142
[7579] Homo sapiens, vesicle-associated soluble NSF attachment protein receptor (v-SNARE; homolog of S. cerevisiae VTI1), clone MGC:3767 IMAGE:2958320, mRNA, complete cds
[7580] gi|13111940|gb|BC003142.1|BC003142[13111940]
[7581] 4746: BC003110
[7582] Homo sapiens, interleukin 11 receptor, alpha, clone MGC:2146 IMAGE:3502059, mRNA, complete cds
[7583] gi|13111884|gb|BC003110.1|BC003110[13111884]
[7584] 4747: BC003091
[7585] Homo sapiens, poliovirus receptor-related 2 (herpesvirus entry mediator B), clone MGC:1349 IMAGE:3503222, mRNA, complete cds
[7586] gi|13111848|gb|BC003091.1|BC003091[13111848]
[7587] 4748: BC000181
[7588] Homo sapiens, putative G protein-coupled receptor, clone MGC:5003 IMAGE:3048193,
[7589] mRNA, complete cds
[7590] gi|13111815|gb|BC000181.2|BC000181[13111815]
[7591] 4751: BC003005
[7592] Homo sapiens, unactive progesterone receptor, 23 kD, clone MGC:4004 IMAGE:2821965, mRNA, complete cds
[7593] gi|12804292|gb|BC003005.1|BC003005[12804292]
[7594] 4752: BC002996
[7595] Homo sapiens, cholinergic receptor, nicotinic, alpha polypeptide 3, clone MGC:3862 IMAGE:2822768, mRNA, complete cds
[7596] gi|12804274|gb|BC002996.1|BC002996[12804274]
[7597] 4753: BC002947
[7598] Homo sapiens, folate receptor 1 (adult), clone MGC:10473 IMAGE:3956659, mRNA, complete cds
[7599] gi|12804178|gb|BC002947.1|BC002947[12804178]
[7600] 4754: BC002819
[7601] Homo sapiens, putative receptor protein, clone MGC:3676 IMAGE:3636199, mRNA, complete cds
[7602] gi|12803944|gb|BC002819.1|BC002819[12803944]
[7603] 4755: BC002794
[7604] Homo sapiens, tumor necrosis factor receptor superfamily, member 14 (herpesvirus
[7605] entry mediator), clone MGC:3753 IMAGE:3614650, mRNA, complete cds
[7606] gi|12803894|gb|BC002794.1|BC002794[12803894]
[7607] 4756: BC002793
[7608] Homo sapiens, interferon (alpha, beta and omega) receptor 2, clone MGC:3873 IMAGE:3626374, mRNA, complete cds
[7609] gi|12803892|gb|BC002793.1|BC002793[12803892]
[7610] 4757: BC002788
[7611] Homo sapiens, plasminogen activator, urokinase receptor, clone MGC:3905 IMAGE:3617894, mRNA, complete cds
[7612] gi|12803884|gb|BC002788.1|BC002788[12803884]
[7613] 4758: BC002635
[7614] Homo sapiens, colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage), clone MGC:3848 IMAGE:3606186, mRNA, complete cds
[7615] gi|12803600|gb|BC002635.1|BC002635[12803600]
[7616] 4759: BC002537
[7617] Homo sapiens, fibroblast growth factor receptor-like 1, clone IMAGE:3140874, mRNA
[7618] gi|12803426|gb|BC002537.1|BC002537[12803426]
[7619] 4760: BC002464
[7620] Homo sapiens, coagulation factor II (thrombin) receptor, clone MGC:1197 IMAGE:3343051, mRNA, complete cds
[7621] gi|12803296|gb|BC002464.1|BC002464[12803296]
[7622] 4761: BC002443
[7623] Homo sapiens, putative T1/ST2 receptor binding protein, clone MGC:1270 IMAGE:3346273, mRNA, complete cds
[7624] gi|12803256|gb|BC002443.1|BC002443[12803256]
[7625] 4762: BC002354
[7626] Homo sapiens, 5-hydroxytryptamine (serotonin) receptor 3A, clone MGC:8469 IMAGE:2821710, mRNA, complete cds
[7627] gi|12803100|gb|BC002354.1|BC002354[12803100]
[7628] 4763: BC001379
[7629] Homo sapiens, G protein-coupled receptor kinase-interactor 2, clone MGC:760 IMAGE:3051069, mRNA, complete cds
[7630] gi|12655058|gb|BC001379.1|BC001379[12655058]
[7631] 4764: BC001281
[7632] Homo sapiens, tumor necrosis factor receptor superfamily, member lob, clone MGC:5144 IMAGE:3458466, mRNA, complete cds
[7633] gi|12654874|gb|BC001281.1|BC001281[12654874]
[7634] 4766: BC001188
[7635] Homo sapiens, transferrin receptor (p90, CD71), clone MGC:3151 IMAGE:3354176, mRNA, complete cds
[7636] gi|12654696|gb|BC001188.1|BC001188[12654696]
[7637] 4769: BC001110
[7638] Homo sapiens, benzodiazapine receptor (peripheral), clone MGC:1184 IMAGE:2989070, mRNA, complete cds
[7639] gi|12654552|gb|BC001110.1|BC001110[12654552]
[7640] 4770: BC000740
[7641] Homo sapiens, cholecystokinin B receptor, clone MGC:2199 IMAGE:3504160, mRNA, complete cds
[7642] gi|12653894|gb|BC000740.1|BC000740[12653894]
[7643] 4772: BC000571
[7644] Homo sapiens, pyrimidinergic receptor P2Y, G-protein coupled, 6, clone MGC:2067
[7645] IMAGE:3162734, mRNA, complete cds
[7646] gi|12653590|gb|BC000571.1|BC000571[12653590]
[7647] 4773: BC000548
[7648] Homo sapiens, receptor (calcitonin) activity modifying protein 1, clone MGC:1996
[7649] IMAGE:3163522, mRNA, complete cds
[7650] gi|12653550|gb|BC000548.1|BC000548[12653550]
[7651] 4774: BC000513
[7652] Homo sapiens, cholinergic receptor, nicotinic, alpha polypeptide 3, clone MGC:8545 IMAGE:2822768, mRNA, complete cds
[7653] gi|12653482|gb|BC000513.1|BC000513[12653482]
[7654] 4776: BC000254
[7655] Homo sapiens, activin A receptor, type IB, clone MGC:2177 IMAGE:3352720, mRNA,
[7656] complete cds
[7657] gi|12652986|gb|BC000254.1|BC000254[12652986]
[7658] 4780: AF037351
[7659] Homo sapiens macrophage scavenger receptor type III (SR-A) mRNA, complete cds
[7660] gi|3004959|gb|AF037351.1|AF037351[3004959]
[7661] 4781: BC009277
[7662] Homo sapiens, G protein-coupled receptor kinase 6, clone IMAGE:4053197, mRNA
[7663] gi|14627273|gb1BC009277.1|BC009277[14627273]
[7664] 4782: AF369786
[7665] Homo sapiens growth hormone secretagogue receptor gene, complete cds, alternatively spliced
[7666] gi|14625865|gb|AF369786.1|AF369786[14625865]
[7667] 4784: U35877
[7668] Homo sapiens (−) genotype B2 bradykinin receptor gene, exon 1
[7669] gi|1353393|gb|U35877.1|HSU35877[1353393]
[7670] 4785: U35876
[7671] Homo sapiens (+) genotype B2 bradykinin receptor gene, exon 1
[7672] gi|1353392|gb|U35876.1|HSU35876[1353392]
[7673] 4786: NM—005656
[7674] Homo sapiens transmembrane protease, serine 2 (TMPRSS2), mRNA
[7675] gi|14602458|ref|NM—005656.2|[14602458]
[7676] 4787: NM—004167
[7677] Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 15 (SCYA15),
[7678] transcript variant 2, mRNA
[7679] gi|14602450|ref|NM—004167.2|[14602450]
[7680] 4788: NM—032965
[7681] Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 15 (SCYA15),
[7682] transcript variant 3, mRNA
[7683] gi|14602448|ref|NM—032965.1|[14602448]
[7684] 4789: NM—032964
[7685] Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 15 (SCYA15),
[7686] transcript variant 1, mRNA
[7687] gi|14602446|ref|NM—032964.1|[14602446]
[7688] 4790: AJ312373
[7689] Homo sapiens mRNA for DECTIN-1 receptor, splice variant 2
[7690] gi|14599395|emb|AJ312373.1|HSA312373[14599395]
[7691] 4791: AJ312372
[7692] Homo sapiens mRNA for DECTIN-1 receptor, splice variant 1
[7693] gi|14599393|emb|AJ312372.1|HSA312372[14599393]
[7694] 4792: AJ307885
[7695] Homo sapiens mRNA for T-cell receptor beta chain, clone 83
[7696] gi|14595016|emb|AJ307885.1|HSA307885[14595016]
[7697] 4793: NM—001987
[7698] Homo sapiens ets variant gene 6 (TEL oncogene) (ETV6), mRNA
[7699] gi|14589947|ref|NM—001987.2|[14589947]
[7700] 4794: NM—020403
[7701] Homo sapiens protocadherin 9 (PCDH9), mRNA
[7702] gi|14589940|ref|NM—020403.2|[14589940]
[7703] 4795: NM—022843
[7704] Homo sapiens protocadherin 20 (PCDH20), mRNA
[7705] gi|14589938|ref|NM—022843.1|[14589938]
[7706] 4797: NM—020164
[7707] Homo sapiens aspartate beta-hydroxylase (ASPH), transcript variant 5, mRNA
[7708] gi|14589858|ref|NM—020164.2|[14589858]
[7709] 4798: AF361107
[7710] Homo sapiens CRHF2 receptor beta-isoform mRNA, partial sequence, aberrantly spliced
[7711] gi|14586958|gb|AF361107.1|AF361107[14586958]
[7712] 4799: AF361106
[7713] Homo sapiens CRHF2 receptor beta-isoform mRNA, partial sequence, aberrantly spliced
[7714] gi|14586957|gb|AF361106.1|AF361106[14586957]
[7715] 4800: AF284768
[7716] Homo sapiens laminin receptor-like protein LAMRL5 mRNA, complete cds
[7717] gi|14583013|gb|AF284768.1|AF284768[14583013]
[7718] 4801: AF343090
[7719] Homo sapiens HSF-27 protein mRNA, complete cds
[7720] gi|14582809|gb|AF343090.1|AF343090[14582809]
[7721] 4802: AF286696
[7722] Homo sapiens olfactory receptor sdolf mRNA, complete cds
[7723] gi|14582606|gb|AF286696.1|AF286696[14582606]
[7724] 4803: AF279673
[7725] Homo sapiens vanilloid receptor-like protein 2 (VRL2) mRNA, complete cds
[7726] gi|14582397|gb|AF279673.1|AF279673[14582397]
[7727] 4804: AF279611
[7728] Homo sapiens cysteinyl leukotriene receptor type 2 (CYSLT2) gene, complete cds
[7729] gi|14582393|gb|AF2796711.1|AF279611[14582393]
[7730] 4806: NM—005111
[7731] Homo sapiens crystallin, zeta (quinone reductase)-like 1 (CRYZL1), mRNA
[7732] gi|14577924|ref|NM—005111.2|[14577924]
[7733] 4807: NM—000592
[7734] Homo sapiens complement component 4B (C4B), mRNA
[7735] gi|14577920|ref|NM—000592.3|[14577920]
[7736] 4809: NM—016557
[7737] Homo sapiens orphan seven-transmembrane receptor, chemokine related (VSHK1), mRNA
[7738] gi|7706768|ref|NM—016557.1|[7706768]
[7739] 4810: NM—006850
[7740] Homo sapiens interleukin 24 (IL24), mRNA
[7741] gi|5803085|ref|NM—006850.1|[5803085]
[7742] 4811: NM—000029
[7743] Homo sapiens angiotensinogen (serine (or cysteine) proteinase inhibitor, clade A
[7744] (alpha-1 antiproteinase, antitrypsin), member 8) (AGT), mRNA
[7745] gi|4557286|ref|NM—000029.1|[4557286]
[7746] 4812: AF385591
[7747] Homo sapiens m5 muscarinic cholinergic receptor (CHRM5) mRNA, complete cds
[7748] gi|14573544|gb|AF385591.1|AF385591[14573544]
[7749] 4813: AF385590
[7750] Homo sapiens m4 muscarinic cholinergic receptor (CHRM4) mRNA, complete cds
[7751] gi|14573542|gb|AF385590.1|AF385590[14573542]
[7752] 4814: AF385589
[7753] Homo sapiens m3 muscarinic cholinergic receptor (CHRM3) mRNA, partial cds
[7754] gi|14573540|gb|AF385589.1|AF385589[14573540]
[7755] 4815: AF385588
[7756] Homo sapiens m2 muscarinic cholinergic receptor (CHRM2) mRNA, complete cds
[7757] gi|14573538|gb|AF385588.1|AF385588[14573538]
[7758] 4816: AF385587
[7759] Homo sapiens ml muscarinic cholinergic receptor (CHRM1) mRNA, complete cds
[7760] gi|14573536|gb|AF385587.1|AF385587[14573536]
[7761] 4817: AF385585
[7762] Homo sapiens nicotinic cholinergic receptor alpha 7 (CHRNA7) mRNA, complete cds
[7763] gi|14573533|gb|AF385585.1|AF385585[14573533]
[7764] 4818: AF385584
[7765] Homo sapiens nicotinic cholinergic receptor alpha 3 (CHRNA3) mRNA, partial cds
[7766] gi|4573531|gb|AF385584.1|AF385584[14573531]
[7767] 4819: AF361943
[7768] Homo sapiens urocortin III (UCNIII) gene, complete cds
[7769] gi|14571921|gb|AF361943.1|AF361943[14571921]
[7770] 4825: NM—031282
[7771] Homo sapiens immunoglobulin superfamily receptor translocation associated 1 (IRTA1), mRNA
[7772] gi|14550415|ref|NM—031282.1|[14550415]
[7773] 4826: NM—031281
[7774] Homo sapiens immunoglobulin superfamily receptor translocation associated 2 (IRTA2), mRNA
[7775] gi|14550413|ref|NM—031281.1|[14550413]
[7776] 4827: NM—020404
[7777] Homo sapiens tumor endothelial marker 1 precursor (TEM1), mRNA
[7778] gi|9966884|ref|NM—020404.1|[9966884]
[7779] 4830: AF338733
[7780] Homo sapiens thymic stromal lymphopoietin protein receptor TSLPR mRNA, complete
[7781] cds
[7782] gi|14335439|gb|AF338733.1|AF338733[14335439]
[7783] 4831: AF338732
[7784] Homo sapiens thymic stromal lymphopoietin protein TSLP mRNA, complete cds
[7785] gi|14335437|gb|AF338732.1|AF338732[14335437]
[7786] 4832: AJ272324
[7787] Homo sapiens mRNA for PRAM-1 protein
[7788] gi|11558108|emb|AJ272324.1|HSA272324[11558108]
[7789] 4833: AF281043
[7790] Homo sapiens high mobility group 1 protein (HMG1) gene, promoter and partial cds
[7791] gi|14522873|gb|AF281043.1|AF281043[14522873]
[7792] 4834: NM—024298
[7793] Homo sapiens malignant cell expression-enhanced gene/tumor progression-enhance (LENG4), mRNA
[7794] gi|13236521|ref|NM—024298.1|[13236521]
[7795] 4835: AB051580
[7796] Homo sapiens gene for IgG receptor IIIB, complete cds
[7797] gi|11344590|dbj|AB051580.1|AB051580[11344590]
[7798] 4836: NM—006134
[7799] Homo sapiens chromosome 21 open reading frame 4 (C21orf4), mRNA
[7800] gi|8659558|ref|NM—006134.2|[8659558]
[7801] 4837: NM—015927
[7802] Homo sapiens transforming growth factor beta 1 induced transcript 1 (TGFB1I1),
[7803] mRNA
[7804] gi|7706249|ref|NM—015927.1|[7706249]
[7805] 4838: NM—000956
[7806] Homo sapiens prostaglandin E receptor 2 (subtype EP2), 53 kD (PTGER2), mRNA
[7807] gi|4506254|ref|NM—000956.1|[4506254]
[7808] 4839: AF019381
[7809] Homo sapiens corticotropin releasing hormone receptor type 2 gamma isoform (CRH2R) mRNA, complete cds
[7810] gi|2738888|gb|AF019381.1|AF019381[2738888]
[7811] 4840: AB043702
[7812] Homo sapiens FZD5 mRNA for seven-transmembrane receptor Frizzled-5, complete cds
[7813] gi|14495150|dbj|AB043702.1|AB043702[14495150]
[7814] 4841: AF384819
[7815] Homo sapiens coagulation factor II receptor-like 3 (F2RL3) gene, complete cds
[7816] gi|14488403|gb|AF384819.2|AF384819[14488403]
[7817] 4842: AF343666
[7818] Homo sapiens translocation associated fusion protein IRTA1/IGA1 (IRTA1/IGHA1) mRNA, complete cds
[7819] gi|13591717|gb|AF343666.1|AF343666[13591717]
[7820] 4843: AF343665
[7821] Homo sapiens immunoglobulin superfamily receptor translocation associated protein 2d (IRTA2) mRNA, partial cds, alternatively spliced
[7822] gi|13591715|gb|AF343665.1|AF343665[13591715]
[7823] 4844: AF343664
[7824] Homo sapiens immunoglobulin superfamily receptor translocation associated protein 2c (IRTA2) mRNA, complete cds, alternatively spliced
[7825] gi|13591713|gb|AF343664.1|AF343664[13591713]
[7826] 4845: AF343663
[7827] Homo sapiens immunoglobulin superfamily receptor translocation associated protein 2b (IRTA2) mRNA, complete cds, alternatively spliced
[7828] gi|13591711|gb|AF343663.1|AF343663[13591711]
[7829] 4846: AF343662
[7830] Homo sapiens immunoglobulin superfamily receptor translocation associated protein 2a (IRTA2) mRNA, complete cds, alternatively spliced
[7831] gi|13591709|gb|AF343662.1|AF343662[13591709]
[7832] 4847: AF343661
[7833] Homo sapiens immunoglobulin superfamily receptor translocation associated protein 1a (IRTA1) mRNA, complete cds, alternatively spliced
[7834] gi|13591707|gb|AF343661.1|AF343661[13591707]
[7835] 4848: AF343660
[7836] Homo sapiens immunoglobulin superfamily receptor translocation associated protein 1b (IRTA1) mRNA, complete cds, alternatively spliced
[7837] gi|13591705|gb|AF343660.1|AF343660[13591705]
[7838] 4849: AF343659
[7839] Homo sapiens immunoglobulin superfamily receptor translocation associated protein 1c (IRTA1) mRNA, complete cds, alternatively spliced
[7840] gi|13591703|gb|AF343659.1|AF343659[13591703]
[7841] 4850: AF321237
[7842] Homo sapiens chromosome 11p15.4 clone RPC11-610i20 P2-containing olfactory receptor gene cluster, complete sequence
[7843] gi|12007433|gb|AF321237.1|AF321237[12007433]
[7844] 4851: NM—005567
[7845] Homo sapiens lectin, galactoside-binding, soluble, 3 binding protein (LGALS3BP),
[7846] mRNA
[7847] gi|6006016|ref|NM—005567.21[6006016]
[7848] 4852: AF351620
[7849] Homo sapiens lipocalin-1 interacting membrane receptor (LIMR) gene, complete cds
[7850] gi|14485746|gb|AF351620.1|AF351620[14485746]
[7851] 4853: AF366519
[7852] 4890: AB063174
[7853] Homo sapiens SLC-1 mRNA for somatostatin receptor-like protein, complete cds
[7854] gi|14475646|dbj|AB063174.1|AB063174[14475646]
[7855] 4891: AF238470
[7856] Homo sapiens natural killer cell receptor NKG2F gene, partial cds
[7857] gi|11023178|gb|AF238470.1|AF238470[11023178]
[7858] 4892: AF238469
[7859] Homo sapiens natural killer cell receptor NKG2E gene, partial cds
[7860] gi|11023176|gb|AF238469.1|AF238469[11023176]
[7861] 4893: AF238468
[7862] Homo sapiens natural killer cell receptor NKG2C gene, partial cds
[7863] gi|11023174|gb|AF238468.1|AF238468[11023174]
[7864] 4894: AE000662
[7865] Homo sapiens T-cell receptor alpha delta locus from bases 1000498 to 1071650 (section 5 of 5) of the Complete Nucleotide Sequence
[7866] gi|2358068|gb|AE000662.1|HUAE000662[2358068]
[7867] 4895: AE000661
[7868] Homo sapiens T-cell receptor alpha delta locus from bases 752679 to 1000555 (section 4 of 5) of the Complete Nucleotide Sequence
[7869] gi|2358060|gb|AE000661.1|HUAE000661[2358060]
[7870] 4896: AE000660
[7871] Homo sapiens T-cell receptor alpha delta locus from bases 501613 to 752736 (section 3 of 5) of the Complete Nucleotide Sequence
[7872] gi|2358042|gb|AE000660.1|HUAE000660[2358042]
[7873] 4897: AE000659
[7874] Homo sapiens T-cell receptor alpha delta locus from bases 250472 to 501670 (section 2 of 5) of the Complete Nucleotide Sequence
[7875] gi|2358025|gb|AE000659.1|HUAE000659[2358025]
[7876] 4898: AE000658
[7877] Homo sapiens T-cell receptor alpha delta locus from bases 1 to 250529 (section 1 of 5) of the Complete Nucleotide Sequence
[7878] gi|2358019|gb|AE000658.1|HUAE000658[2358019]
[7879] 4899: AF364129
[7880] Homo sapiens tandem repeat region 76.3 kb upstream of BMPR1A exon 1
[7881] gi|14423333|gb|AF364129.1|AF364129[14423333]
[7882] 4900: AF364128
[7883] Homo sapiens tandem repeat region 49.4 kb upstream of BMPR1A exon 1
[7884] gi|14423332|gb|AF364128.1|AF364128[14423332]
[7885] 4901: AF261083
[7886] Homo sapiens polymeric immunoglobulin receptor (PIGR) gene, partial cds
[7887] gi|8099662|gb|AF261083.1|AF261083[8099662]
[7888] 4902: AF243129
[7889] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 67 and partial cds
[7890] gi|14388671|gb|AF243129.1|F243081S49[14388671]
[7891] 4903: AF243128
[7892] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 66
[7893] gi|14388670 gb|AF243128.1|F243081S48[14388670]
[7894] 4904: AF243127
[7895] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 65
[7896] gi|14388669|gb|AF243127.1|F243081S47[14388669]
[7897] 4905: AF243126
[7898] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 63 and
[7899] gi|14388668|gb|AF243126.1|F243081S46[14388668]
[7900] 4906: AF243125
[7901] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 61 and
[7902] gi|14388667|gb|AF243125.1|F243081S45[14388667]
[7903] 4907: AF243124
[7904] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 60
[7905] gi|14388666|gb|AF243124.1|F243081S44[14388666]
[7906] 4908: AF243123
[7907] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 59
[7908] gi|14388665|gb|AF243123.1|F243081S43[14388665]
[7909] 4909: AF243122
[7910] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 58
[7911] gi|14388664|gb|AF243122.1|F243081S42[14388664]
[7912] 4910: AF243121
[7913] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 57
[7914] gi|14388663|gb|AF243121.1|F243081S41[14388663]
[7915] 4911: AF243120
[7916] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 56
[7917] gi|14388662|gb|AF243120.1|F243081S40[14388662]
[7918] 4912: AF243119
[7919] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 55
[7920] gi|4388661|gb|AF243119.1F243081S39[14388661]
[7921] 4913: AF243118
[7922] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 54
[7923] gi|14388660|gb|AF243118.1F243081S38[14388660]
[7924] 4914: AF243117
[7925] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 52 and
[7926] gi|14388659|gb|AF243117.1|F243081S37[14388659]
[7927] 4915: AF243116
[7928] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 51
[7929] gi|14388658|gb|AF243116.1|F243081S36[14388658]
[7930] 4916: AF243115
[7931] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 49 and
[7932] gi|14388657|gb|AF243115.1|F243081S35[14388657]
[7933] 4917: AF243114
[7934] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 48
[7935] gi|14388656|gb|AF243114.1|F243081S34[14388656]
[7936] 4918: AF243113
[7937] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 47
[7938] gi|14388655|gb|AF243113.1F243081S33[14388655]
[7939] 4919: AF243112
[7940] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 46
[7941] gi|14388654|gb|AF243112.1F243081S32[14388654]
[7942] 4920: AF243111
[7943] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 45
[7944] gi|4388653|gb|AF243111.1F243081S31[14388653]
[7945] 4921: AF243110
[7946] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 44
[7947] gi|14388652|gb|AF243110.1|F243081S30[14388652]
[7948] 4922: AF243109
[7949] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 42 and
[7950] gi|14388651|gb|AF243109.1|F243081S29[14388651]
[7951] 4923: AF243108
[7952] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 41
[7953] gi|14388650|gb|AF243108.1|F243081S28[14388650]
[7954] 4924: AF243107
[7955] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 40
[7956] gi|14388649|gb|AF243107.1F243081S27[14388649]
[7957] 4925: AF243106
[7958] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 39
[7959] gi|4388648|gb|AF243106.1F243081S26[14388648]
[7960] 4926: AF243105
[7961] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 37 and
[7962] gi|14388647|gb|AF243105.1|F243081S25[14388647]
[7963] 4927: AF243104
[7964] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 35 and
[7965] gi|14388646|gb|AF243104.1|F243081S24[14388646]
[7966] 4928: AF243103
[7967] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 34
[7968] gi|14388645|gb|AF243103.1F243081S23[14388645]
[7969] 4929: AF243102
[7970] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 33
[7971] gi|14388644|gb|AF243102.1F243081S22[14388644]
[7972] 4930: AF243101
[7973] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 32
[7974] gi|14388643|gb|AF243101.1F243081S21[14388643]
[7975] 4931: AF243100
[7976] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 31
[7977] gi|14388642|gb|AF243100.1F243081S20[14388642]
[7978] 4932: AF243099
[7979] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 30
[7980] gi|1438864|gb|AF243099.1F243081S19[14388641]
[7981] 4933: AF243098
[7982] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 29
[7983] gi|14388640|gb|AF243098.1F243081S18[14388640]
[7984] 4934: AF243097
[7985] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 28
[7986] gi|14388639|gb|AF243097.1F243081S17[14388639]
[7987] 4935: AF243096
[7988] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 27
[7989] gi|14388638|gb|AF243096.1F243081S16[14388638]
[7990] 4936: AF243095
[7991] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 26
[7992] gi|14388637|gb|AF243095.1|F243081S15[14388637]
[7993] 4937: AF243094
[7994] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 23, 24, and 25
[7995] gi|14388636|gb|AF243094.1|F243081S14[14388636]
[7996] 4938: AF243093
[7997] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 22
[7998] gi|14388635|gb|AF243093.1|F243081S13[14388635]
[7999] 4939: AF243092
[8000] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 20 and
[8001] gi|14388634|gb|AF243092.1|F243081S12[14388634]
[8002] 4940: AF243091
[8003] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 18 and
[8004] gi|4388633|gb|AF243091.1|F243081S11[14388633]
[8005] 4941: AF243090
[8006] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 16 and
[8007] gi|14388632|gb|AF243090.1|F243081S10[14388632]
[8008] 4942: AF243089
[8009] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 15
[8010] gi|14388631|gb|AF243089.1|F243081S09[14388631]
[8011] 4943: AF243088
[8012] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 14
[8013] gi|14388630|gb|AF243088.1|F243081S08[14388630]
[8014] 4944: AF243087
[8015] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 11, 12, and 13
[8016] gi|14388629|gb|AF243087.1|F243081S07[14388629]
[8017] 4945: AF243086
[8018] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 9 and
[8019] gi|14388628|gb|AF243086.1|F243081S06[14388628]
[8020] 4946: AF243085
[8021] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 8
[8022] gi|14388627|gb|AF243085.1|F243081S05[14388627]
[8023] 4947: AF243084
[8024] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 7
[8025] gi|14388626|gb|AF243084.1|F243081S04[14388626]
[8026] 4948: AF243083
[8027] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 5 and 6
[8028] gi|14388625|gb|AF243083.1|F243081S03[14388625]
[8029] 4949: AF243082
[8030] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 3 and partial cds
[8031] gi|14388624|gb|AF243082.1|F243081S02[14388624]
[8032] 4950: AF243081
[8033] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 1 and 2
[8034] gi|14388623|gb|AF243081.1|F243081S01[14388623]
[8035] 4951: AH010855
[8036] Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) and intrinsic factor-vitamin B12 receptor (CUBN) genes, partial cds
[8037] gi|14388622|gb|AH010855.1|SEG_F243081S[14388622]
[8038] 4952: AY029596
[8039] Homo sapiens melanin-concentrating hormone 2 receptor mRNA, complete cds
[8040] gi|14388165|gb|AY029596.1|[14388165]
[8041] 4953: AF233349
[8042] Homo sapiens neuronal phosphoprotein DARPP-32 mRNA, partial cds
[8043] gi|7243754|gb|AF233349.1|AF233349[7243754]
[8044] 4954: AF208690
[8045] Homo sapiens clone 24 p70 killer cell inhibitory receptor mRNA, partial cds
[8046] gi|6851353|gb|AF208690.1|AF208690[6851353]
[8047] 4955: AF208689
[8048] Homo sapiens clone 22 p70 killer cell inhibitory receptor mRNA, partial cds
[8049] gi|6851351|gb|AF208689.1|AF208689[6851351]
[8050] 4956: AF208688
[8051] Homo sapiens clone 3 p70 killer cell inhibitory receptor mRNA, partial cds
[8052] gi|6851349|gb|AF208688.1|AF208688[6851349]
[8053] 4957: AF208687
[8054] Homo sapiens clone 25 p70 killer cell inhibitory receptor mRNA, partial cds
[8055] gi|6851347|gb|AF208687.1|AF208687[6851347]
[8056] 4958: AF208686
[8057] Homo sapiens clone 23 p70 killer cell inhibitory receptor mRNA, partial cds
[8058] gi|6851345|gb|AF208686.1|AF208686[6851345]
[8059] 4959: AF208685
[8060] Homo sapiens clone 21 p70 killer cell inhibitory receptor mRNA, partial cds
[8061] gi|6851343|gb|AF208685.1|AF208685[6851343]
[8062] 4960: AF208684
[8063] Homo sapiens clone 6 p70 killer cell inhibitory receptor mRNA, partial cds
[8064] gi|6851341|gb|AF208684.1|AF208684[6851341]
[8065] 4961: AF208683
[8066] Homo sapiens clone 1 p70 killer cell inhibitory receptor mRNA, partial cds
[8067] gi|6851339|gb|AF208683.1|AF208683[6851339]
[8068] 4962: AB052639
[8069] Homo sapiens mRNA for IL-XR, complete cds
[8070] gi|14349288|dbj|AB052639.1|AB052639[14349288]
[8071] 4963: AF366364
[8072] Homo sapiens interleukin-1 receptor type 1 (IL1R1) gene, exon 1A, partial sequence
[8073] gi|1434887|gb|AF366364.1|AF366364[14348871]
[8074] 4967: AF260728
[8075] Homo sapiens lipocalin-interacting protein mRNA, complete cds
[8076] gi|14335227|gb|AF260728.1|AF260728[14335227]
[8077] 4968: AJ308526
[8078] Homo sapiens partial GRIK3 gene for glutamate receptor 7, exon 18
[8079] gi|14329723|emb|AJ308526.1|HSA308526[14329723]
[8080] 4969: AJ308525
[8081] Homo sapiens partial GRIK3 gene for glutamate receptor 7, exon 16
[8082] gi|14329720|emb|AJ308525.1|HSA308525[14329720]
[8083] 4970: AF165124
[8084] Homo sapiens chromosome 5q31.1-q33.1 clone BAC djn082c10 containing GABRG2 gene,
[8085] complete sequence
[8086] gi|5738137|gb|AF165124.1|AF165124[5738137]
[8087] 4971: AF353733
[8088] Homo sapiens leukocyte immunoglobulin-like receptor A3 (LILRA3) gene, exon 3 and
[8089] partial cds
[8090] gi|4280086|gb|AF353733.1|AF353733[14280086]
[8091] 4972: AF236083
[8092] Homo sapiens G-protein-coupled receptor 74 (GPR74) mRNA, complete cds
[8093] gi|14279164|gb|AF236083.1|AF236083[14279164]
[8094] 4973: AF375468
[8095] Homo sapiens endothelial protein C receptor (PROCR) gene, complete cds
[8096] gi|1427871|gb|AF375468.2|AF375468[14278711]
[8097] 4974: AF374726
[8098] Homo sapiens coagulation factor II receptor-like 2 (F2RL2) gene, complete cds
[8099] gi|14278710|gb|AF374726.2|AF374726[14278710]
[8100] 4975: AF378542
[8101] Homo sapiens bradykinin receptor B2 (BDKRB2) gene, complete cds
[8102] gi|14278705|gb|AF378542.2|AF378542[14278705]
[8103] 4976: AB051065
[8104] Homo sapiens hot7t175 mRNA for G protein-coupled receptor, complete cds
[8105] gi|14041797|dbj|AB051065.1|AB051065[14041797]
[8106] 4977: AF347063
[8107] Homo sapiens G protein-coupled receptor MCH2 mRNA, complete cds
[8108] gi|13604341|gb|AF347063.1|AF347063[13604341]
[8109] 4978: AJ278250
[8110] Homo sapiens HRH3 gene for histamine H3 receptor, exons 1-3
[8111] gi|14270360|emb|AJ278250.1|HSA278250[14270360]
[8112] 4979: AF297616
[8113] Homo sapiens natural killer cell receptor 2B4 gene, partial cds
[8114] gi|14268841|gb|AF297616.1|AF297616[14268841]
[8115] 4980: AJ271068
[8116] Homo sapiens mRNA for transient receptor potential channel 6, variant delta377-431 (TRP6 gene)
[8117] gi|9716912|emb|AJ271068.1|HSA271068[9716912]
[8118] 4981: AJ271067
[8119] Homo sapiens mRNA for transient receptor potential channel 6, variant delta316-431 (TRP6 gene)
[8120] gi|9716910|emb|AJ271067.1|HSA271067[9716910]
[8121] 4982: AJ271066
[8122] Homo sapiens mRNA for transient receptor potential channel 6 (TRP6 gene)
[8123] gi|9716908|emb|AJ271066.1|HSA271066[9716908]
[8124] 4983: X91852
[8125] H. sapiens P2Y4 gene
[8126] gi|1124904|emb|X91852.1|HSP2Y4[1124904]
[8127] 4984: NM—032565
[8128] Homo sapiens emopamil binding related protein, delta8-delta7 sterol isomerase related protein (EBRP), mRNA
[8129] gi|4211872|ref|NM—032565.1|[14211872]
[8130] 4986: AY029539
[8131] Homo sapiens soluble nectin1 gamma mRNA, complete cds
[8132] gi|1419622|gb|AY029539.1|[14196221]
[8133] 4987: NM—006986
[8134] Homo sapiens melanoma antigen, family D, 1 (MAGED1), mRNA
[8135] gi|14195633|ref|NM—006986.2|[14195633]
[8136] 4988: AF351784
[8137] Homo sapiens dopamine receptor interacting protein mRNA, partial cds
[8138] gi|14194056|gb|AF351784.1|AF351784[14194056]
[8139] 4989: AF336376
[8140] Homo sapiens platelet-derived growth factor D (PDGFD) mRNA, complete cds
[8141] gi|14193795|gb|AF336376.1|AF336376[14193795]
[8142] 4992: AH010778
[8143] Homo sapiens CHRNA3 gene, partial sequence
[8144] gi|14190789|gb|AH010778.1|SEG_AY027913S[14190789]
[8145] 4995: AH010779
[8146] Homo sapiens CHRNB4 gene, partial sequence
[8147] gi|14190786|gb|AH010779.1|SEG_AY027915S[14190786]
[8148] 4996: AF310234
[8149] Homo sapiens sialic acid binding immunoglobulin-like lectin 8 (SIGLEC8) mRNA, complete cds, alternatively spliced
[8150] gi|14164614|gb|AF310234.1|AF310234[14164614]
[8151] 4997: AF310233
[8152] Homo sapiens sialic acid binding immunoglobulin-like lectin 10 (SIGLEC10) mRNA,
[8153] complete cds
[8154] gi|14164612|gb|AF310233.1|AF310233[14164612]
[8155] 4998: AB060151
[8156] Homo sapiens slt mRNA for G protein-coupled receptor, complete cds
[8157] gi|14164382|dbj|AB060151.1|AB060151[14164382]
[8158] 4999: AF239764
[8159] Homo sapiens EGF-like module-containing mucin-like receptor EMR3 mRNA, complete
[8160] cds
[8161] gi|13183148|gb|AF239764.1|AF239764[13183148]
[8162] 5000: AF199235
[8163] Homo sapiens nicotinic acetylcholine receptor subunit alpha 10 mRNA, complete cds
[8164] gi|11128455|gb|AF199235.2|AF199235[11128455]
[8165] 5001: AF054176
[8166] Homo sapiens angiotensin/vasopressin receptor AII/AVP mRNA, complete cds
[8167] gi|3341995|gb|AF054176.1|AF054176[3341995]
[8168] 5002: AF369213
[8169] Homo sapiens fibroblast growth factor receptor 3 IIIc isoform (FGFR3) mRNA, partial cds
[8170] gi|14161391|gb|AF369213.1|AF369213[14161391]
[8171] 5003: AF369212
[8172] Homo sapiens fibroblast growth factor receptor 3 IIIc isoform (FGFR3) mRNA, partial cds
[8173] gi|14161389|gb|AF369212.1|AF369212[14161389]
[8174] 5004: AF369211
[8175] Homo sapiens fibroblast growth factor receptor 3 IIIc isoform (FGFR3) mRNA, partial cds
[8176] gi|14161387|gb|AF369211.1|AF369211[14161387]
[8177] 5005: AF274714
[8178] Homo sapiens oxysterol-binding protein-related protein (ORP1) mRNA, complete cds
[8179] gi|13183326|gb|AF274714.1|AF274714[13183326]
[8180] 5034: NM—005959
[8181] Homo sapiens melatonin receptor 1B (MTNR1B), mRNA
[8182] gi|14141172|ref|NM—005959.2|[14141172]
[8183] 5035: NM—005958
[8184] Homo sapiens melatonin receptor 1A (MTNR1A), mRNA
[8185] gi|14141171|ref|NM—005958.2|[14141171]
[8186] 5036: AF366903
[8187] Homo sapiens MER receptor tyrosine kinase gene, exon 1 and partial cds
[8188] gi|14133725|gb|AF366903.1|AF366903[14133725]
[8189] 5037: NM—002226
[8190] Homo sapiens jagged 2 (JAG2), mRNA
[8191] gi|4504800|ref|NM—002226.1|[4504800]
[8192] 5039: NM—009585
[8193] Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 2, mRNA
[8194] gi|14043067|ref|NM—009585.2|[14043067]
[8195] 5040: NM—032049
[8196] Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 5, mRNA
[8197] gi|14043065|ref|NM—032049.1|[14043065]
[8198] 5041: NM—031850
[8199] Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 4, mRNA
[8200] gi|14043063|ref|NM—031850.1|[14043063]
[8201] 5042: NM—004835
[8202] Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 3, mRNA
[8203] gi|14043061|ref|NM—004835.2|[14043061]
[8204] 5043: NM—000685
[8205] Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 1, mRNA
[8206] gi|14043060|ref|NM—000685.3|[14043060]
[8207] 5044: NM—003965
[8208] Homo sapiens chemokine (C-C motif) receptor-like 2 (CCRL2), mRNA
[8209] gi|14043058|ref|NM—003965.2|[14043058]
[8210] 5045: AJ298334
[8211] Homo sapiens mRNA for P2Y11 receptor (P2Y11 gene)
[8212] gi|12964589|emb|AJ298334.1|HSA298334[12964589]
[8213] 5046: NM—000323
[8214] Homo sapiens ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) (RET), transcript variant 1, mRNA
[8215] gi|10862704|ref|NM—000323.1|[10862704]
[8216] 5047: NM—020975
[8217] Homo sapiens ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) (RET), transcript variant 2, mRNA
[8218] gi|10862702|ref|NM—020975.1|[10862702]
[8219] 5048: NM—020630
[8220] Homo sapiens ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) (RET), transcript variant 4, mRNA
[8221] gi|10862700|ref|NM—020630.1|[10862700]
[8222] 5049: NM—020629
[8223] Homo sapiens ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) (RET), transcript variant 3, mRNA
[8224] gi|10862698|ref|NM—020629.1|[10862698]
[8225] 5050: NM—002342
[8226] Homo sapiens lymphotoxin beta receptor (TNFR superfamily, member 3) (LTBR), mRNA
[8227] gi|4505038|ref|NM—002342.1|[4505038]
[8228] 5051: AY032736
[8229] Homo sapiens alpha-2A adrenergic receptor (ADR2AR) gene, complete cds
[8230] gi|14029162|gb|AY032736.1|[14029162]
[8231] 5052: AF322014
[8232] Homo sapiens growth hormone receptor gene, partial sequence
[8233] gi|14028657|gb|AF322014.1|AF322014S1[14028657]
[8234] 5053: AF283321
[8235] Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5) gene, exons 10 through 23 and complete cds
[8236] gi|14028617|gb|AF283321.1|AF283320S2[14028617]
[8237] 5054: AF283320
[8238] Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5) gene, exons 1 through 9
[8239] gi|14028616|gb|AF283320.1|AF283320S1[14028616]
[8240] 5055: AH010745
[8241] Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5) gene, complete cds
[8242] gi|14028615|gb|AH010745.1|SEG_AF283320S[14028615]
[8243] 5056: NM—017934
[8244] Homo sapiens pleckstrin homology domain interacting protein (PHIP), mRNA
[8245] gi|8923633|ref|NM—017934.1|[8923633]
[8246] 5057: AF203386
[8247] Homo sapiens beta-2 adrenergic receptor (ADRB2) gene, complete cds
[8248] gi|6636495|gb|AF203386.1|AF203386[6636495]
[8249] 5058: AF202305
[8250] Homo sapiens beta-2 andrenergic receptor gene, complete cds
[8251] gi|6573152|gb|AF202305.1|AF202305[6573152]
[8252] 5059: AF169225
[8253] Homo sapiens beta-2-adrenergic receptor gene, complete cds
[8254] gi|5714687|gb|AF169225.1|AF169225[5714687]
[8255] 5060: AF063657
[8256] Homo sapiens vascular endothelial growth factor receptor (FLT1) mRNA, complete
[8257] cds
[8258] gi|3132830|gb|AF063657.1|AF063657[3132830]
[8259] 5061: AF022049
[8260] Homo sapiens natural killer cell inhibitory receptor KIR3DL1 variant mRNA, complete cds
[8261] gi|2760898|gb|AF022049.1|AF022049[2760898]
[8262] 5062: AF022048
[8263] Homo sapiens natural killer cell inhibitory receptor KIR2DL3 variant mRNA, complete cds
[8264] gi|2760896|gb|AF022048.1|AF022048[2760896]
[8265] 5066: AF361880
[8266] Homo sapiens neurokinin-2 receptor gene, partial cds
[8267] gi|1400294|gb|AF361880.1|AF361880[14010294]
[8268] 5068: AF209923
[8269] Homo sapiens orphan G-protein coupled receptor (GPRC5D) mRNA, complete cds
[8270] gi|8118039|gb|AF209923.1|AF209923[8118039]
[8271] 5069: AF207989
[8272] Homo sapiens orphan G-protein coupled receptor (GPRC5C) mRNA, complete cds
[8273] gi|8118031|gb|AF207989.1|AF207989[8118031]
[8274] 5070: AB018076
[8275] Homo sapiens hedgehog gene, exon 3 and complete cds
[8276] gi|13990993|dbj|AB018076.2|AB010092S3[13990993]
[8277] 5071: SEG_AB010092S
[8278] Homo sapiens hedgehog gene
[8279] gi|13990992|dbj|SEG_AB010092S[13990992]
[8280] 5072: NM—018980
[8281] Homo sapiens taste receptor, type 2, member 5 (TAS2R5), mRNA
[8282] gi|9507172|ref|NM—018980.1|[9507172]
[8283] 5073: NM—016945
[8284] Homo sapiens taste receptor, type 2, member 16 (TAS2R16), mRNA
[8285] gi|8394394|ref|NM—016945.1|[8394394]
[8286] 5074: AB018075
[8287] Homo sapiens hedgehog gene, exon 2
[8288] gi|3702725|dbj|AB018075.1|AB010092S2[3702725]
[8289] 5075: AB010092
[8290] Homo sapiens hedgehog gene, exon 1
[8291] gi|2810977|dbj|AB010092.1|AB010092S1[2810977]
[8292] 5076: AF130867
[8293] Homo sapiens smoothened mRNA, partial cds
[8294] gi|4732138|gb|AF130867.1|AF130867[4732138]
[8295] 5077: AF363791
[8296] Homo sapiens histamine receptor H3S(HRH3) mRNA, complete cds
[8297] gi|13937081|gb|AF363791.1|AF363791[13937081]
[8298] 5078: AF363452
[8299] Homo sapiens NK cell type I receptor protein 2B4 (CD244) mRNA, partial cds, alternatively spliced
[8300] gi|13937022|gb|AF363452.1|AF363452[13937022]
[8301] 5079: AY029486
[8302] Homo sapiens G protein gamma subunit 13 mRNA, complete cds
[8303] gi|13936268|gb|AY029486.1|[13936268]
[8304] 5080: AF224497
[8305] Homo sapiens CC chemokine receptor 3 (CCR3) gene, exon 2 and partial cds
[8306] gi|13924486|gb|AF224497.1|AF224496S2[13924486]
[8307] 5081: AF224496
[8308] Homo sapiens CC chemokine receptor 3 (CCR3) gene, exon 1
[8309] gi|13924485|gb|AF224496.1|AF224496S1[13924485]
[8310] 5082: AH010691
[8311] Homo sapiens CC chemokine receptor 3 (CCR3) gene, partial cds
[8312] gi|13924484|gb|AH010691.1|SEG_AF224496S[13924484]
[8313] 5083: AF224495
[8314] Homo sapiens CC chemokine receptor 3 (CCR3) mRNA, partial cds
[8315] gi|13924481|gb|AF224495.1|AF224495[13924481]
[8316] 5084: AF251120
[8317] Homo sapiens interleukin-1-related protein short isoform mRNA, complete cds; alternatively spliced
[8318] gi|10185739|gb|AF251120.1|AF251120[10185739]
[8319] 5085: AF251119
[8320] Homo sapiens interleukin-1-related protein long isoform mRNA, complete cds; alternatively spliced
[8321] gi|10185737|gb|AF251119.1|AF251119[10185737]
[8322] 5086: AF251118
[8323] Homo sapiens interleukin-1-related protein long isoform a mRNA, complete cds; alternatively spliced
[8324] gi|10185735|gb|AF251118.1|AF251118[10185735]
[8325] 5087: AF103013
[8326] Homo sapiens JME clone 4 KIR3DL1-like natural killer cell receptor mRNA, complete cds
[8327] gi|3983423|gb|AF103013.1|AF103013[3983423]
[8328] 5088: AF103012
[8329] Homo sapiens JME clone 3 KIR3DL1-like natural killer cell receptor mRNA, complete cds
[8330] gi|3983421|gb|AF103012.1|AF103012[3983421]
[8331] 5089: AF103011
[8332] Homo sapiens JME clone 2 KIR3DL1-like natural killer cell receptor mRNA, complete cds
[8333] gi|3983419|gb|AF103011.1|AF103011[3983419]
[8334] 5090: AF103010
[8335] Homo sapiens JME clone 1 KIR3DL1-like natural killer cell receptor mRNA, complete cds
[8336] gi|3983417|gb|AF103010.1|AF103010[3983417]
[8337] 5091: AF353183
[8338] Homo sapiens discoidin domain receptor DDR1e (DDR1) mRNA, partial cds, alternatively spliced
[8339] gi|13898644|gb|AF353183.1|AF353183[13898644]
[8340] 5092: AF353182
[8341] Homo sapiens discoidin domain receptor DDR1d (DDR1) mRNA, partial cds, alternatively spliced
[8342] gi|13898642|gb|AF353182.1|AF353182[13898642]
[8343] 5096: AF014112
[8344] Homo sapiens phenol UDP-glucuronosyltransferase (UGT1A6) gene, partial cds
[8345] gi|2645490|gb|AF014112.1|AF014112[2645490]
[8346] 5097: AJ293654
[8347] Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11,
[8348] ARSPRV allele
[8349] gi|12054061|emb|AJ293654.1|HSA293654[12054061]
[8350] 5098: AJ293653
[8351] Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11,
[8352] ACSPRV allele
[8353] gi|12054059|emb|AJ293653.1|HSA293653[12054059]
[8354] 5099: AJ293652
[8355] Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11,
[8356] ACSSRI allele
[8357] gi|12054057|emb|AJ293652.1|HSA293652[12054057]
[8358] 5100: AJ293651
[8359] Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11,
[8360] ECLPRV allele
[8361] gi|12054055|emb|AJ293651.1|HSA293651[12054055]
[8362] 5101: AJ293650
[8363] Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11,
[8364] ECSPRV allele
[8365] gi|12054053|emb|AJ293650.1|HSA293650[12054053]
[8366] 5102: AJ293649
[8367] Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11,
[8368] ECSSRV allele
[8369] gi|12054051|emb|AJ293649.1|HSA293649[12054051]
[8370] 5103: AJ293648
[8371] Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11,
[8372] ECSPQV allele
[8373] gi|12054049|emb|AJ293648.1|HSA293648[12054049]
[8374] 5104: AJ293647
[8375] Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11,
[8376] ECSSQV allele
[8377] gi|12054047|emb|AJ293647.1|HSA293647[12054047]
[8378] 5105: AF329449
[8379] Homo sapiens histamine receptor H4 mRNA, complete cds
[8380] gi|13876643|gb|AF329449.1|AF329449[13876643]
[8381] 5106: AF276893
[8382] Homo sapiens p21-activated protein kinase 6 (PAK6) mRNA, complete cds
[8383] gi|9082305|gb|AF276893.1|AF276893[9082305]
[8384] 5107: AY029324
[8385] Homo sapiens mRNA sequence
[8386] gi|13752242|gb|AY029324.1|[13752242]
[8387] 5108: AF307337
[8388] Homo sapiens ALPP, ALPPL2, ALPI, XCE, CHRND, and CHRNG genes, complete sequence
[8389] gi|10732831|gb|AF307337.1|AF307337[10732831]
[8390] 5109: Z75190
[8391] H. sapiens mRNA for apolipoprotein E receptor 2
[8392] gi|1834533|emb|Z75190.1|HSZ75190[1834533]
[8393] 5110: NM—004523
[8394] Homo sapiens kinesin-like 1 (KNSL1), mRNA
[8395] gi|13699823|ref|NM—004523.2|[13699823]
[8396] 5111: NM—006646
[8397] Homo sapiens WAS protein family, member 3 (WASF3), mRNA
[8398] gi|13699802|ref|NM—006646.2|[13699802]
[8399] 5112: NM—030667
[8400] Homo sapiens protein tyrosine phosphatase, receptor type, O (PTPRO), transcript
[8401] variant 1, mRNA
[8402] gi|13677213|ref|NM—030667.1|[13677213]
[8403] 5113: NM—002848
[8404] Homo sapiens protein tyrosine phosphatase, receptor type, O (PTPRO), transcript
[8405] variant 2, mRNA
[8406] gi|13677212|ref|NM—002848.2|[13677212]
[8407] 5114: NM—006990
[8408] Homo sapiens WAS protein family, member 2 (WASF2), mRNA
[8409] gi|11386182|ref|NM—006990.1|[11386182]
[8410] 5115: AF250309
[8411] Homo sapiens putative cytokine receptor CRL4 precusor mRNA, complete cds
[8412] gi|13649476|gb|AF250309.1|AF250309[13649476]
[8413] 5116: AY029180
[8414] Homo sapiens soluble urokinase plasminogen activator receptor precursor (SUPAR)
[8415] mRNA, complete cds
[8416] gi|13641308|gb|AY029180.1|[13641308]
[8417] 5117: AF346711
[8418] Homo sapiens G-protein couple receptor (GPR48) gene, exons 3 through 18, and complete cds
[8419] gi|13569576|gb|AF346711.1|AF346709S3[13569576]
[8420] 5118: AF346710
[8421] Homo sapiens G-protein couple receptor (GPR48) gene, exon 2
[8422] gi|13569575|gb|AF346710.1|AF346709S2[13569575]
[8423] 5119: AF346709
[8424] Homo sapiens G-protein couple receptor (GPR48) gene, exon 1
[8425] gi|13569574|gb|AF346709.1|AF346709S1[13569574]
[8426] 5120: AH010608
[8427] Homo sapiens G-protein couple receptor (GPR48) gene, complete cds
[8428] gi|13569573|gb|AH010608.1|SEG_AF346709S[13569573]
[8429] 5121: AF251059
[8430] Homo sapiens FGF receptor 4b mRNA, complete cds
[8431] gi|13625179|gb|AF251059.1|AF251059[13625179]
[8432] 5122: AF251055
[8433] Homo sapiens 5-HT receptor mRNA, complete cds
[8434] gi|1362517|gb|AF251055.1|AF251055[13625171]
[8435] 5123: NM—030905
[8436] Homo sapiens olfactory receptor, family 2, subfamily J, member 2 (OR2J2), mRNA
[8437] gi|13624330|ref|NM—030905.1|[13624330]
[8438] 5124: NM—012377
[8439] Homo sapiens olfactory receptor, family 7, subfamily C, member 2 (OR7C2), mRNA
[8440] gi|13624324|ref|NM—012377.1|[13624324]
[8441] 5125: AB043703
[8442] Homo sapiens FZD8 mRNA for seven-transmembrane receptor Frizzled-8, complete cds
[8443] gi|13623798|dbj|AB043703.1|AB043703[13623798]
[8444] 5126: AB051851
[8445] Homo sapiens DR3 gene for death receptor 3, complete cds, mutant DR3 sequnce
[8446] gi|13537362|dbj|AB051851.1|AB051851[13537362]
[8447] 5127: AB051850
[8448] Homo sapiens DR3 gene for death receptor 3, complete cds
[8449] gi|13537360|dbj|AB051850.1|AB051850[13537360]
[8450] 5128: AF349939
[8451] Homo sapiens prolactin receptor isoform delta S1 precursor, mRNA, complete cds
[8452] gi|13605397|gb|AF349939.1|AF349939[13605397]
[8453] 5130: AF346629
[8454] Homo sapiens channel-kinase 1 (CHAK1) mRNA, complete cds
[8455] gi|13562152|gb|AP346629.2|AF346629[13562152]
[8456] 5131: NM—012373
[8457] Homo sapiens olfactory receptor, family 3, subfamily A, member 3 (OR3A3), mRNA
[8458] gi|13562103|ref|NM—012373.1|[13562103]
[8459] 5132: AF056979
[8460] Homo sapiens clone YAN1 interferon-gamma receptor mRNA, complete cds
[8461] gi|13562048|gb|AF056979.1|AF056979[13562048]
[8462] 5133: NM—017506
[8463] Homo sapiens olfactory receptor family 7, subfamily C, member 1 (OR7C1), mRNA
[8464] gi|9506798|ref|NM—017506.1|[9506798]
[8465] 5134: AF222689
[8466] Homo sapiens protein arginine N-methyltransferase 1 (HRMT1L2) gene, complete cds, alternatively spliced
[8467] gi|7453574|gb|AF222689.1|AF222689[7453574]
[8468] 5135: NM—005137
[8469] Homo sapiens DiGeorge syndrome critical region gene 2 (DGCR2), mRNA
[8470] gi|4826693|ref|NM—005137.1|[4826693]
[8471] 5136: AC002533
[8472] Homo sapiens clone SCb-24C13 from 7q31.3, complete sequence
[8473] gi|2388587|gb|AC002533.1|AC002533[2388587]
[8474] 5139: AF263617
[8475] Homo sapiens killer cell immunoglobulin-like receptor 3DL2 (KIR3DL2) mRNA, KIR3DL2*00901 allele, complete cds
[8476] gi|13560454|gb|AF263617.1|AF263617[13560454]
[8477] 5140: AF262974
[8478] Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00801 allele, complete cds
[8479] gi|13560452|gb|AF262974.1|AF262974[13560452]
[8480] 5141: AF262973
[8481] Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00701 allele, complete cds
[8482] gi|13560450|gb|AF262973.1|AF262973[13560450]
[8483] 5142: AF262972
[8484] Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00601 allele, partial cds
[8485] gi|13560448|gb|AF262972.1|AF262972[13560448]
[8486] 5143: AF262971
[8487] Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00501 allele, partial cds
[8488] gi|13560446|gb|AF262971.1|AF262971[13560446]
[8489] 5144: AF262970
[8490] Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00402 allele, partial cds
[8491] gi|13560444|gb|AF262970.1|AF262970[13560444]
[8492] 5145: AF262969
[8493] Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00401 allele, partial cds
[8494] gi|13560442|gb|AF262969.1|AF262969[13560442]
[8495] 5146: AF262968
[8496] Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00102 allele, partial cds
[8497] gi|13560440|gb|AF262968.1|AF262968[13560440]
[8498] 5147: AF262967
[8499] Homo sapiens killer cell immunoglobulin-like receptor 3DL2 (KIR3DL2) mRNA, KIR3DL2*00801 allele, complete cds
[8500] gi|13560438|gb|AF262967.1|AF262967[13560438]
[8501] 5148: AF262966
[8502] Homo sapiens killer cell immunoglobulin-like receptor 3DL2 (KIR3DL2) mRNA, KIR3DL2*00601 allele, partial cds
[8503] gi|13560436|gb|AF262966.1|AF262966[13560436]
[8504] 5149: AF262965
[8505] Homo sapiens killer cell immunoglobulin-like receptor 3DL2 (KIR3DL2) mRNA, KIR3DL2*00701 allele, partial cds
[8506] gi|13560434|gb|AF262965.1|AF262965[13560434]
[8507] 5150: AF348491
[8508] Homo sapiens chemokine receptor CXCR4 mRNA, complete cds
[8509] gi|13549089|gb|AF348491.1|AF348491[13549089]
[8510] 5151: AF295368
[8511] Homo sapiens G-protein coupled receptor GPR86 (GPR86) mRNA, complete cds
[8512] gi|12711484|gb|AF295368.1|AF295368[12711484]
[8513] 5152: AF237763
[8514] Homo sapiens orphan G protein-coupled receptor 87 (GPR87) mRNA, complete cds
[8515] gi|12711472|gb|AF237763.1|AF237763[12711472]
[8516] 5153: AF237762
[8517] Homo sapiens orphan G protein-coupled receptor 84 (GPR84) mRNA, complete cds
[8518] gi|12711470|gb|AF237762.1|AF237762[12711470]
[8519] 5154: NM—004248
[8520] Homo sapiens G protein-coupled receptor 10 (GPR10), mRNA
[8521] gi|4758473|ref|NM—004248.1|[4758473]
[8522] 5155: AC000099
[8523] Homo sapiens chromosome 7 map 7q31.3 cosmid g0771a003, complete sequence
[8524] gi|1764159|emb|AC99.1|HSAC000099[1764159]
[8525] 5156: NM—030784
[8526] Homo sapiens brain expressed G-protein-coupled receptor PSP24 beta (PSP24B), mRNA
[8527] gi|13540556|ref|NM—030784.1|[13540556]
[8528] 5157: NM—030774
[8529] Homo sapiens prostate specific G-protein coupled receptor (PSGR), mRNA
[8530] gi|13540538|ref|NM—030774.1|[13540538]
[8531] 5158: NM—030764
[8532] Homo sapiens SH2 domain-containing phosphatase anchor protein 1 (SPAP1), mRNA
[8533] gi|13540524|ref|NM—030764.1)[13540524]
[8534] 5160: AJ249921
[8535] Homo sapiens intergenic region between apoE and apoCI genes
[8536] gi|6006507|emb|AJ249921.1|HSA249921[6006507]
[8537] 5161: AF050737
[8538] Homo sapiens dopamine D2 receptor (DRD2) gene, complete cds
[8539] gi|382049|gb|AF050737.1|AF050737[3820491]
[8540] 5162: NM—004987
[8541] Homo sapiens LIM and senescent cell antigen-like domains 1 (LIMS1), mRNA
[8542] gi|13518025|ref|NM—004987.2|[13518025]
[8543] 5163: AF348078
[8544] Homo sapiens G-protein coupled receptor 91 (GPR91) mRNA, complete cds
[8545] gi|13517982|gb|AF348078.1|AF348078[13517982]
[8546] 5164: AJ276125
[8547] Homo sapiens mRNA for inhibitory NK receptor (kir3d gene)
[8548] gi|13516222|emb|AJ276125.1|HSA276125[13516222]
[8549] 5165: AF246999
[8550] Homo sapiens TRADEbeta mRNA, complete cds
[8551] gi|13506909|gb|AF246999.1|AF246999[13506909]
[8552] 5166: AF246998
[8553] Homo sapiens TRADEalpha mRNA, complete cds
[8554] gi|13506907|gb|AF246998.1|AF246998[13506907]
[8555] 5167: AF263450
[8556] Homo sapiens dopamine D3 receptor (DRD3) gene, exon 2 and partial cds
[8557] gi|13506728|gb|AF263450.1|AF148807S2[13506728]
[8558] 5168: AF148807
[8559] Homo sapiens dopamine D3 receptor (DRD3) gene, exon 1
[8560] gi|13506727|gb|AF148807.1|AF148807S1[13506727]
[8561] 5169: AH010591
[8562] Homo sapiens dopamine D3 receptor (DRD3) gene, partial cds
[8563] gi|13506726|gb|AH010591.1|SEG_AF148807S[13506726]
[8564] 5170: Y18388
[8565] Homo sapiens CD163 gene, exon 1 and joined CDS
[8566] gi|5107944|emb|Y18388.1|HSA118388[5107944]
[8567] 5171: NM—002183
[8568] Homo sapiens interleukin 3 receptor, alpha (low affinity) (IL3RA), mRNA
[8569] gi|13324709|ref|NM—002183.1|[13324709]
[8570] 5172: AF142570
[8571] Homo sapiens cytokine receptor CRL2 precusor (CRL2) mRNA, complete cds
[8572] gi|11055018|gb|AF142570.1|AF142570[11055018]
[8573] 5173: NM—006140
[8574] Homo sapiens colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), mRNA
[8575] gi|5453626|ref|NM—006140.1|[5453626]
[8576] 5174: NM—002186
[8577] Homo sapiens interleukin 9 receptor (IL9R), mRNA
[8578] gi|4504684|ref|NM—002186.1|[4504684]
[8579] 5175: AF296673
[8580] Homo sapiens toll-like receptor 10 mRNA, complete cds
[8581] gi|13447752|gb|AF296673.1|AF296673[13447752]
[8582] 5176: AF284095
[8583] Homo sapiens alpha-2A adrenergic receptor mRNA, complete cds
[8584] gi|13447750|gb|AF284095.1|AF284095[13447750]
[8585] 5177: AF279689
[8586] Homo sapiens fibroblast growth factor receptor 5 (FGFR5) mRNA, complete cds
[8587] gi|13447748|gb|AF279689.1|AF279689[13447748]
[8588] 5178: NM—000861
[8589] Homo sapiens histamine receptor H1 (HRH1), mRNA
[8590] gi|13435403|ref|NM—000861.2|[13435403]
[8591] 5179: NM—001514
[8592] Homo sapiens general transcription factor IIB (GTF2B), mRNA
[8593] gi|13435384|ref|NM—001514.2|[13435384]
[8594] 5180: NM—022845
[8595] Homo sapiens core-binding factor, beta subunit (CBFB), transcript variant 1, mRNA
[8596] gi|13124880|ref|NM—022845.1|[13124880]
[8597] 5181: AF213460
[8598] Homo sapiens ephrin receptor EPHA3 secreted form (EPHA3) mRNA, complete cds
[8599] gi|12003436|gb|AF213460.1|AF213460[12003436]
[8600] 5182: AF213459
[8601] Homo sapiens ephrin receptor EPHA3 complete form (EPHA3) mRNA, complete cds
[8602] gi|12003434|gb|AF213459.1|AF213459[12003434]
[8603] 5183: NM—019599
[8604] Homo sapiens taste receptor, type 2, member 1 (TAS2R1), mRNA
[8605] gi|9625042|ref|NM—019599.1|[9625042]
[8606] 5184: NM—017579
[8607] Homo sapiens deleted in malignant brain tumors 1 (DMBT1), transcript variant 3,
[8608] mRNA
[8609] gi|8923739|ref|NM—017579.1|[8923739]
[8610] 5185: AJ306481
[8611] Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor
[8612] alpha-5 subunit, exon 1 and joined CDS
[8613] gi|13400975|emb|AJ306481.1|HSA306481[13400975]
[8614] 5186: AJ306454
[8615] Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor
[8616] beta-4 subunit, exon 1 and joined CDS
[8617] gi|13400963|emb|AJ306454.1|HSA306454[13400963]
[8618] 5187: NM—024317
[8619] Homo sapiens immunoglobulin-like transcript 10 (ILT10), mRNA
[8620] gi|13399319|ref|NM—024317.1|[13399319]
[8621] 5188: NM—020070
[8622] Homo sapiens immunoglobulin lambda-like polypeptide 1 (IGLL1), mRNA
[8623] gi|13399297|ref|NM—020070.1|[13399297]
[8624] 5189: NM—002383
[8625] Homo sapiens MYC-associated zinc finger protein (purine-binding transcription factor) (MAZ), mRNA
[8626] gi|13399295|ref|NM—002383.1|[13399295]
[8627] 5190: AJ306486
[8628] Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor
[8629] alpha-5 subunit, exon 6
[8630] gi|13399189|emb|AJ306486.1|HSA306486[13399189]
[8631] 5191: AJ306485
[8632] Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor
[8633] alpha-5 subunit, exon 5
[8634] gi|13399188|emb|AJ306485.1|HSA306485[13399188]
[8635] 5192: AJ306484
[8636] Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor
[8637] alpha-5 subunit, exon 4
[8638] gi|13399187|emb|AJ306484.1|HSA306484[13399187]
[8639] 5193: AJ306483
[8640] Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor
[8641] alpha-5 subunit, exon 3
[8642] gi|13399186|emb|AJ306483.1|HSA306483[13399186]
[8643] 5194: AJ306482
[8644] Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor
[8645] alpha-5 subunit, exon 2
[8646] gi|13399185|emb|AJ306482.1|HSA306482[13399185]
[8647] 5195: AJ306459
[8648] Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor
[8649] beta-4 subunit, exon 6
[8650] gi|13399184|emb|AJ306459.1|HSA306459[13399184]
[8651] 5196: AJ306458
[8652] Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor
[8653] beta-4 subunit, exon 5
[8654] gi|13399183|emb|AJ306458.1|HSA306458[13399183]
[8655] 5197: AJ306457
[8656] Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor
[8657] beta-4 subunit, exon 4
[8658] gi|13399182|emb|AJ306457.1|HSA306457[13399182]
[8659] 5198: AJ306456
[8660] Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor
[8661] beta-4 subunit, exon 3
[8662] gi|13399181|emb|AJ306456.1|HSA306456[13399181]
[8663] 5199: AJ306455
[8664] Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor
[8665] beta-4 subunit, exon 2
[8666] gi|13399180|emb|AJ306455.1|HSA306455[13399180]
[8667] 5200: AJ291675
[8668] Homo sapiens mRNA for putative GDNF family receptor alpha 4, secreted isoform c
[8669] (GFRA4 gene)
[8670] gi|12038960|emb|AJ291675.1|HSA291675[12038960]
[8671] 5201: AJ291674
[8672] Homo sapiens mRNA for putative GDNF family receptor alpha 4, GPI anchored isoform b (GFRA4 gene)
[8673] gi|12038958|emb|AJ291674.1|HSA291674[12038958]
[8674] 5202: AJ291673
[8675] Homo sapiens mRNA for GDNF family receptor alpha 4, GPI anchored isoform (GFRA4 gene)
[8676] gi|12038956|emb|AJ291673.1|HSA291673[12038956]
[8677] 5203: AF245704
[8678] Homo sapiens toll-like receptor 9 (TLR9) mRNA, complete cds
[8679] gi|8575528|gb|AF245704.1|AF245704[8575528]
[8680] 5204: AF245703
[8681] Homo sapiens toll-like receptor 8 (TLR8) mRNA, complete cds
[8682] gi|8575526|gb|AF245703.1|AF245703[8575526]
[8683] 5205: AF245702
[8684] Homo sapiens toll-like receptor 7 (TLR7) mRNA, complete cds
[8685] gi|8575524|gb|AF245702.1|AF245702[8575524]
[8686] 5206: NM—016944
[8687] Homo sapiens taste receptor, type 2, member 4 (TAS2R4), mRNA
[8688] gi|8394401|ref|NM—016944.1|[8394401]
[8689] 5207: NM—016943
[8690] Homo sapiens taste receptor, type 2, member 3 (TAS2R3), mRNA
[8691] gi|8394397|ref|NM—016943.1|[8394397]
[8692] 5209: AF307776
[8693] Homo sapiens beta-1 adrenergic receptor gene, 5′ UTR and partial cds
[8694] gi|11837864|gb|AF307776.1|AF307776[11837864]
[8695] 5210: AB026043
[8696] Homo sapiens mRNA for MS4A7, complete cds
[8697] gi|11559249|dbj|AB026043.1|AB026043[11559249]
[8698] 5211: AB013104
[8699] Homo sapiens mRNA for MS4A6, complete cds
[8700] gi|11559215|dbj|AB013104.1|AB013104[11559215]
[8701] 5212: AB013103
[8702] Homo sapiens mRNA for MS4A5, complete cds
[8703] gi|11559213|dbj|AB013103.1|AB013103[11559213]
[8704] 5213: AB013102
[8705] Homo sapiens mRNA for MS4A4, complete cds
[8706] gi|11559211|dbj|AB013102.1|AB013102[11559211]
[8707] 5215: NM—003789
[8708] Homo sapiens TNFRSF1A-associated via death domain (TRADD), mRNA
[8709] gi|13378136|ref|NM—003789.1|[13378136]
[8710] 5216: NM—025218
[8711] Homo sapiens UL16-binding protein 1 (ULBP1), mRNA
[8712] gi|13376825|ref|NM—025218.1|[13376825]
[8713] 5217: NM—025217
[8714] Homo sapiens UL16-binding protein 2 (ULBP2), mRNA
[8715] gi|13376823|ref|NM—025217.1|[13376823]
[8716] 5218: NM—024518
[8717] Homo sapiens UL16-binding protein 3 (ULBP3), mRNA
[8718] gi|13375655|ref|NM—024518.1|[13375655]
[8719] 5220: AB052103
[8720] Homo sapiens SRCL mRNA for scavenger receptor with C-type lectin type II, complete cds
[8721] gi|13365552|dbj|AB052103.1|AB052103[13365552]
[8722] 5221: AB038518
[8723] Homo sapiens SRCL mRNA for scavenger receptor with C-type lectin type I, complete cds
[8724] gi|13365514|dbj|AB038518.1|AB038518[13365514]
[8725] 5222: NM—021708
[8726] Homo sapiens leukocyte-associated Ig-like receptor 1 (LAIR1), transcript variant
[8727] d, mRNA
[8728] gi|11231178|ref|NM—021708.1|[11231178]
[8729] 5223: NM—021706
[8730] Homo sapiens leukocyte-associated Ig-like receptor 1 (LAIR1), transcript variant
[8731] b, mRNA
[8732] gi|11231176|ref|NM—021706.1|[11231176]
[8733] 5224: NM—002287
[8734] Homo sapiens leukocyte-associated Ig-like receptor 1 (LAIR1), transcript variant
[8735] a, mRNA
[8736] gi|11231175|ref|NM—002287.2|[11231175]
[8737] 5225: AB038237
[8738] Homo sapiens mRNA for G protein-coupled receptor C5L2, complete cds
[8739] gi|7707800|dbj|AB038237.1|AB038237[7707800]
[8740] 5226: S82756
[8741] Homo sapiens T cell receptor (Vbeta8.2-N1DbetaN2-Jbeta1.6) mRNA, partial cds
[8742] gi|1835847|gb|S82756.1|S82756[1835847]
[8743] 5227: S82754
[8744] Homo sapiens T cell receptor mRNA, partial cds
[8745] gi|1835843|gb|S82754.1|S82754[1835843]
[8746] 5233: NM—024318
[8747] Homo sapiens immunoglobulin-like transcript 8 (ILT8), mRNA
[8748] gi|13324689|ref|NM—024318.1|[13324689]
[8749] 5234: AF178982
[8750] Homo sapiens putative G protein-coupled receptor GPCR1 precursor, mRNA, complete
[8751] cds
[8752] gi|13324450|gb|AF178982.1|AF178982[13324450]
[8753] 5236: NM—021956
[8754] Homo sapiens glutamate receptor, ionotropic, kainate 2 (GRIK2), mRNA
[8755] gi|11386136|ref|NM—021956.1|[11386136]
[8756] 5237: NM—018724
[8757] Homo sapiens interleukin 20 (IL20), mRNA
[8758] gi|11036633|ref|NM—018724.1|[11036633]
[8759] 5238: AJ295846
[8760] Homo sapiens mRNA for endosialin protein
[8761] gi|13277300|emb|AJ295846.1|HSA295846[13277300]
[8762] 5242: AF310249
[8763] Homo sapiens peroxisome proliferator activated receptor gamma 2 gene, upstream
[8764] sequence
[8765] gi|13274397|gb|AF310249.1|AF310249[13274397]
[8766] 5243: AF321815
[8767] Homo sapiens G-protein coupled receptor SP1999 mRNA, complete cds
[8768] gi|12656597|gb|AF321815.1|AF321815[12656597]
[8769] 5244: AL136818
[8770] Homo sapiens mRNA; cDNA DKFZp434F1726 (from clone DKFZp434F1726)
[8771] gi|12053146|emb|AL136818.1|HSM801786[12053146]
[8772] 5245: AF285440
[8773] Homo sapiens clone KIR2D54v1 killer-cell Ig-like receptor mRNA, complete cds
[8774] gi|11385699|gb|AF285440.1|AF285440[11385699]
[8775] 5246: AF285439
[8776] Homo sapiens clone KIR2D52v2 killer-cell Ig-like receptor mRNA, complete cds
[8777] gi|11385697|gb|AF285439.1|AF285439[11385697]
[8778] 5247: AF285438
[8779] Homo sapiens clone KIR2D52v1 killer-cell Ig-like receptor mRNA, partial cds
[8780] gi|11385695|gb|AF285438.1|AF285438[11385695]
[8781] 5248: AF285437
[8782] Homo sapiens clone KIR2DS1v2 killer-cell Ig-like receptor mRNA, partial cds
[8783] gi|11385693|gb|AF285437.1|AF285437[11385693]
[8784] 5249: AF285436
[8785] Homo sapiens clone KIR2DL4v4 killer-cell Ig-like receptor mRNA, complete cds
[8786] gi|11385691|gb|AF285436.1|AF285436[11385691]
[8787] 5250: AF285435
[8788] Homo sapiens clone KIR2DL3v2 killer-cell Ig-like receptor mRNA, partial cds
[8789] gi|11385689|gb|AF285435.1|AF285435[11385689]
[8790] 5251: AF285434
[8791] Homo sapiens clone KIR2DL2v2 killer-cell Ig-like receptor mRNA, partial cds
[8792] gi|11385687|gb|AF285434.1|AF285434[11385687]
[8793] 5252: AF285433
[8794] Homo sapiens clone KIR2DL2v1 killer-cell Ig-like receptor mRNA, partial cds
[8795] gi|11385685|gb|AF285433.1|AF285433[11385685]
[8796] 5253: AF285432
[8797] Homo sapiens clone KIR2DL1v3 killer-cell Ig-like receptor mRNA, partial cds
[8798] gi|11385683|gb|AF285432.1|AF285432[11385683]
[8799] 5254: AF285431
[8800] Homo sapiens clone KIR2DL1v2 killer-cell Ig-like receptor mRNA, complete cds
[8801] gi|11385681|gb|AF285431.1|AF285431[11385681]
[8802] 5255: AJ245872
[8803] Homo sapiens mRNA for putative truncated metabotropic glutamatereceptor 6 form
[8804] b, partial (tr-mGluR6 b)
[8805] gi|6688173|emb|AJ245872.1|HSA245872[6688173]
[8806] 5256: AJ245871
[8807] Homo sapiens mRNA for putative truncated metabotropic glutamatereceptor 6 form
[8808] a, partial (tr-mGluR6 a)
[8809] gi|6688171|emb|AJ245871.1|HSA245871[6688171]
[8810] 5258: AL050262
[8811] Homo sapiens mRNA; cDNA DKFZp56410682 (from clone DKFZp56410682); complete cds
[8812] gi|4886482|emb|AL050262.1|HSM800268[4886482]
[8813] 5259: AF308820
[8814] Homo sapiens adrenocorticotropin receptor gene, upstream sequence
[8815] gi|13272368|gb|AF308820.1|AF308820[13272368]
[8816] 5260: NM—014432
[8817] Homo sapiens interleukin 20 receptor, alpha (IL20RA), mRNA
[8818] gi|7657690|ref|NM—014432.1|[7657690]
[8819] 5261: NM—004967
[8820] Homo sapiens integrin-binding sialoprotein (bone sialoprotein, bone sialoprotein
[8821] II) (IBSP), mRNA
[8822] gi|13259536|ref|NM—004967.2|[13259536]
[8823] 5270: AF348323
[8824] Homo sapiens nociceptin receptor (ORL1) mRNA, complete cds
[8825] gi|13022242|gb|AF348323.1|AF348323[13022242]
[8826] 5272: S79217
[8827] Homo sapiens Ca(2+)-sensing receptor mRNA, partial cds
[8828] gi|1050985|gb|S79217.1|S79217[1050985]
[8829] 5273: S78723
[8830] Homo sapiens serotonin 5-HT2A receptor (5-HT2A R) gene, partial cds
[8831] gi|1042173|gb|S78723.1|S78723[1042173]
[8832] 5274: S78505
[8833] Homo sapiens prolactin receptor mRNA, partial cds
[8834] gi|999114|gb|S78505.1S78505[999114]
[8835] 5277: S77555
[8836] Homo sapiens corticotropin receptor/ACTH receptor gene, partial cds
[8837] gi|957294|gb|S77555.1|S77555[957294]
[8838] 5278: NM—024012
[8839] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 5A (HTR5A), mRNA
[8840] gi|13236496|ref|NM—024012.1|[13236496]
[8841] 5279: NM—021904
[8842] Homo sapiens gamma-aminobutyric acid (GABA) B receptor, 1 (GABBR1), transcript
[8843] variant 3, mRNA
[8844] gi|11497613|ref|NM—021904.1|[11497613]
[8845] 5280: NM—021903
[8846] Homo sapiens gamma-aminobutyric acid (GABA) B receptor, 1 (GABBR1), transcript
[8847] variant 2, mRNA
[8848] gi|11497611|ref|NM—021903.1|[11497611]
[8849] 5281: NM—001470
[8850] Homo sapiens gamma-aminobutyric acid (GABA) B receptor, 1 (GABBR1), transcript
[8851] variant 1, mRNA
[8852] gi|10835014|ref|NM—001470.1|[10835014]
[8853] 5282: NM—007329
[8854] Homo sapiens deleted in malignant brain tumors 1 (DMBT1), transcript variant 2,
[8855] mRNA
[8856] gi|6633800|ref|NM—007329.1|[6633800]
[8857] 5283: S71404
[8858] Homo sapiens interleukin-9 receptor mRNA, partial cds
[8859] gi|551356|gb|S71404.1|S71404[551356]
[8860] 5356: NM—023031
[8861] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8862] 13, mRNA
[8863] gi|13186272|ref|NM—023031.1|[13186272]
[8864] 5357: NM—023030
[8865] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8866] 12, mRNA
[8867] gi|13186270|ref|NM—023030.1|[13186270]
[8868] 5358: NM—023028
[8869] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8870] 10, mRNA
[8871] gi|13186268|ref|NM—023028.1|[13186268]
[8872] 5359: NM—022976
[8873] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8874] 9, mRNA
[8875] gi|13186266|ref|NM—022976.1|[13186266]
[8876] 5360: NM—022975
[8877] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8878] 8, mRNA
[8879] gi|13186264|ref|NM—022975.1|[13186264]
[8880] 5361: NM—022974
[8881] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8882] 7, mRNA
[8883] gi|13186262|ref|NM—022974.1|[13186262]
[8884] 5362: NM—022973
[8885] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8886] 6, mRNA
[8887] gi|13186260|ref|NM—022973.1|[13186260]
[8888] 5363: NM—022972
[8889] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8890] 5, mRNA
[8891] gi|13186258|ref|NM—022972.1|[13186258]
[8892] 5364: NM—022971
[8893] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8894] 4, mRNA
[8895] gi|13186256|ref|NM—022971.1|[13186256]
[8896] 5365: NM—022970
[8897] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8898] 3, mRNA
[8899] gi|13186254|ref|NM—022970.1|[13186254]
[8900] 5366: NM—022969
[8901] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8902] 2, mRNA
[8903] gi|13186252|ref|NM—022969.1|[13186252]
[8904] 5367: NM—023029
[8905] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8906] 11, mRNA
[8907] gi|13186242|ref|NM—023029.1|[13186242]
[8908] 5368: NM—000141
[8909] Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant
[8910] 1, mRNA
[8911] gi|13186239|ref|NM—000141.2|[13186239]
[8912] 5369: AF312678
[8913] Homo sapiens FGF homologous factor receptor (FHFR) mRNA, complete cds
[8914] gi|13183617|gb|AF312678.1|AF312678[13183617]
[8915] 5370: AF243385
[8916] Homo sapiens beta-2 syntrophin mRNA, complete cds, alternatively spliced
[8917] gi|13183299|gb|AF243385.1|AF243385[13183299]
[8918] 5371: M97191
[8919] Homo sapiens Sp3 protein mRNA, partial cds
[8920] gi|13162672|gb|M97191.2|HUMSP3A[13162672]
[8921] 5474: NM—024075
[8922] Homo sapiens LENG5 protein (LENG5), mRNA
[8923] gi|13129061|ref|NM—024075.1|[13129061]
[8924] 5475: AF304379
[8925] Homo sapiens ULBP3 protein mRNA, complete cds
[8926] gi|13128926|gb|AF304379.1|AF304379[13128926]
[8927] 5476: AF304378
[8928] Homo sapiens ULBP2 protein mRNA, complete cds
[8929] gi|13128924|gb|AF304378.1|AF304378[13128924]
[8930] 5477: AF304377
[8931] Homo sapiens ULBP1 protein mRNA, complete cds
[8932] gi|13128922|gb|AF304377.1|AF304377[13128922]
[8933] 5481: AF000549
[8934] AF000549 Human Homo sapiens genomic clone P1 clone DMPC-HFF#1-1075-D9, genomic
[8935] survey sequence
[8936] gi|2232072|gb|AF000549.1|AF000549[2232072]
[8937] 5482: NM—001755
[8938] Homo sapiens core-binding factor, beta subunit (CBFB), transcript variant 2, mRNA
[8939] gi|13124872|ref|NM—001755.1|[13124872]
[8940] 5483: AF172398
[8941] Homo sapiens junctional adhesion molecule-1 mRNA, complete cds
[8942] gi|13124448|gb|AF172398.2|AF172398[13124448]
[8943] 5484: AF317655
[8944] Homo sapiens G protein-coupled receptor (GPR77) gene, complete cds
[8945] gi|13122466|gb|AF317655.1|AF317655[13122466]
[8946] 5485: AF317653
[8947] Homo sapiens G protein-coupled receptor (GPR62) gene, complete cds
[8948] gi|13122462|gb|AF317653.1|AF317653[13122462]
[8949] 5486: AF317652
[8950] Homo sapiens G protein-coupled receptor (GPR61) mRNA, complete cds
[8951] gi|13122460|gb|AF317652.1|AF317652[13122460]
[8952] 5487: NM—022036
[8953] Homo sapiens G protein-coupled receptor, family C, group 5, member C (GPRC5C),
[8954] transcript variant 1, mRNA
[8955] gi|13112058|ref|NM—022036.1|[13112058]
[8956] 5488: NM—018653
[8957] Homo sapiens G protein-coupled receptor, family C, group 5, member C (GPRC5C),
[8958] transcript variant 2, mRNA
[8959] gi|13112056|ref|NM—018653.2|[13112056]
[8960] 5489: NM—000707
[8961] Homo sapiens arginine vasopressin receptor 1B (AVPR1B), mRNA
[8962] gi|13112055|ref|NM—000707.2|[13112055]
[8963] 5490: NM—000706
[8964] Homo sapiens arginine vasopressin receptor 1A (AVPR1A), mRNA
[8965] gi|13112054|ref|NM—000706.2|[13112054]
[8966] 5491: NM—021923
[8967] Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), mRNA
[8968] gi|13112053|ref|NM—021923.2|[13112053]
[8969] 5492: NM—002011
[8970] Homo sapiens fibroblast growth factor receptor 4 (FGFR4), transcript variant 1,
[8971] mRNA
[8972] gi|13112051|ref|NM—002011.2|[13112051]
[8973] 5493: NM—022963
[8974] Homo sapiens fibroblast growth factor receptor 4 (FGFR4), transcript variant 2,
[8975] mRNA
[8976] gi|13112049|ref|NM—022963.1|[13112049]
[8977] 5494: NM—022965
[8978] Homo sapiens fibroblast growth factor receptor 3 (achondroplasia, thanatophoric
[8979] dwarfism) (FGFR3), transcript variant 2, mRNA
[8980] gi|13112047|ref|NM—022965.1|[13112047]
[8981] 5495: NM—000142
[8982] Homo sapiens fibroblast growth factor receptor 3 (achondroplasia, thanatophoric
[8983] dwarfism) (FGFR3), transcript variant 1, mRNA
[8984] gi|13112046|ref|NM—000142.2|[13112046]
[8985] 5496: NM—022336
[8986] Homo sapiens ectodysplasin 1, anhidrotic receptor (EDAR), mRNA
[8987] gi|11641230|ref|NM—022336.1|[11641230]
[8988] 5497: NM—018654
[8989] Homo sapiens G protein-coupled receptor, family C, group 5, member D (GPRC5D),
[8990] mRNA
[8991] gi|8923704|ref|NM—018654.1|[8923704]
[8992] 5498: AF312230
[8993] Homo sapiens histamine receptor H4 subtype mRNA, complete cds
[8994] gi|13094918|gb|AF312230.1|AF312230[13094918]
[8995] 5504: AY016370
[8996] Homo sapiens hnRNPA1 pseudogene, complete sequence; and CC chemokine receptor 8
[8997] (CCR8) and CX3C chemokine receptor 1 (CX3CR1) genes, complete cds
[8998] gi|13027668|gb|AY016370.1|[13027668]
[8999] 5505: E32517
[9000] Scavenger receptor-like protein
[9001] gi|13026764|dbj|E32517.1E32517[13026764]
[9002] 5506: E32511
[9003] Scavenger receptor-like protein
[9004] gi|13026758|dbj|E32511.1|E32511[13026758]
[9005] 5507: E32510
[9006] Scavenger receptor-like protein
[9007] gi|3026757|dbj|E32510.1|E32510[13026757]
[9008] 5508: E32509
[9009] Scavenger receptor-like protein
[9010] gi|13026756|dbj|E32509.1|E32509[13026756]
[9011] 5509: E32504
[9012] Scavenger receptor-like protein
[9013] gi|13026751|dbj|E32504.1|E32504[13026751]
[9014] 5510: E32503
[9015] Scavenger receptor-like protein
[9016] gi|13026750|dbj|E32503.1|E32503[13026750]
[9017] 5511: E60222
[9018] Melatonin receptor expressing cell and utilization thereof
[9019] gi|13025812|dbj|E60222.1|E60222[13025812]
[9020] 5512: E36078
[9021] cDNA clone HNEAA81 encoding human seven-pass transmembrane receptor
[9022] gi|13022480|dbj|E36078.1|E36078[13022480]
[9023] 5522: AJ309545
[9024] Homo sapiens mRNA for T-cell receptor alpha chain, clone 57LSK10 (Va2, Ja45)
[9025] gi|13016702|emb|AJ309545.1|HSA309545[13016702]
[9026] 5523: AF323176
[9027] Homo sapiens death receptor-interacting protein mRNA, complete cds
[9028] gi|12964787|gb|AF323176.1|AF323176[12964787]
[9029] 5524: AF329496
[9030] Homo sapiens immunoglobulin kappa light chain gene, partial cds
[9031] gi|12963392|gb|AF329496.1|AF329496[12963392]
[9032] 5529: NM—015717
[9033] Homo sapiens Langerhans cell specific c-type lectin (LANGERIN), mRNA
[9034] gi|7657290|ref|NM—015717.1|[7657290]
[9035] 5530: NM—012329
[9036] Homo sapiens monocyte to macrophage differentiation-associated (MMD), mRNA
[9037] gi|6912507|ref|NM—012329.1|[6912507]
[9038] 5571: AH009956
[9039] Homo sapiens chromosome 12 clone pacHRARg map 12q13
[9040] gi|12746591|gb|AH009956.2|SEG_AF311283S[12746591]
[9041] 5573: AF230330
[9042] Homo sapiens angiopoietin-related protein 5 (ARP5) mRNA, complete cds
[9043] gi|12743935|gb|AF230330.1|AF230330[12743935]
[9044] 5574: AF316895
[9045] Homo sapiens alpha 2B adrenergic receptor (ADRA2B) gene, complete cds
[9046] gi|12698669|gb|AF316895.1|AF316895[12698669]
[9047] 5575: NM—021905
[9048] Homo sapiens gamma-aminobutyric acid (GABA) B receptor, 1 (GABBR1), transcript
[9049] variant 4, mRNA
[9050] gi|11497615|ref|NM—021905.1|[11497615]
[9051] 5578: NM—016730
[9052] Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 3, mRNA
[9053] gi|9257214|ref|NM—016730.1|[9257214]
[9054] 5579: NM—016729
[9055] Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 4, mRNA
[9056] gi|9257212|ref|NM—016729.1|[9257212]
[9057] 5580: NM—016725
[9058] Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 1, mRNA
[9059] gi|9257206|ref|NM—016725.1|[9257206]
[9060] 5581: NM—016724
[9061] Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 7, mRNA
[9062] gi|9257204|ref|NM—016724.1|[9257204]
[9063] 5582: NM—004406
[9064] Homo sapiens deleted in malignant brain tumors 1 (DMBT1), transcript variant 1,
[9065] mRNA
[9066] gi|4758169|ref|NM—004406.1|[4758169]
[9067] 5583: L27609
[9068] Homo sapiens T-cell receptor beta gene, partial cds
[9069] gi|457265|gb|L27609.1|HUMTCRBD[457265]
[9070] 5584: U65905
[9071] U65905 Human Homo sapiens genomic, genomic survey sequence
[9072] gi|1743863|gb|U65905.1|U65905[1743863]
[9073] 5585: U65904
[9074] U65904 Human Homo sapiens genomic, genomic survey sequence
[9075] gi|1743862|gb|U65904.1|U65904[1743862]
[9076] 5586: U65903
[9077] U65903 Human Homo sapiens genomic, genomic survey sequence
[9078] gi|1743861|gb|U65903.1|U65903[1743861]
[9079] 5587: NM—016731
[9080] Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 8, mRNA
[9081] gi|12719454|ref|NM—016731.2|[12719454]
[9082] 5588: AF316870
[9083] Homo sapiens T cell receptor beta chain variable region mRNA, partial cds
[9084] gi|12711595|gb|AF316870.1|AF316870[12711595]
[9085] 5589: AX074315
[9086] Sequence 29 from Patent WO0104310
[9087] gi|12710501|emb|AX074315.1|AX074315[12710501]
[9088] 5590: AX074314
[9089] Sequence 28 from Patent WO0104310
[9090] gi|12710500|emb|AX074314.1|AX074314[12710500]
[9091] 5591: NM—022113
[9092] Homo sapiens kinesin family member 13A (KIF13A), mRNA
[9093] gi|11545828|ref|NM—022113.1|[11545828]
[9094] 5592: AF283296
[9095] Homo sapiens interleukin-15 receptor alpha gene, 5′ regulatory region and exon
[9096] 1, partial sequence
[9097] gi|9965299|gb|AF283296.1|AF283296[9965299]
[9098] 5593: NM—014688
[9099] Homo sapiens related to the N terminus of tre (RNTRE), mRNA
[9100] gi|7661863|ref|NM—014688.1|[7661863]
[9101] 5594: NM—000916
[9102] Homo sapiens oxytocin receptor (OXTR), mRNA
[9103] gi|12707575|ref|NM—000916.2|[12707575]
[9104] 5595: NM—000915
[9105] Homo sapiens oxytocin, prepro-(neurophysin I) (OXT), mRNA
[9106] gi|12707574|ref|NM—000915.2|[12707574]
[9107] 5596: NM—004961
[9108] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, epsilon (GABRE), transcript variant 1, mRNA
[9109] gi|12707559|ref|NM—004961.2|[12707559]
[9110] 5597: NM—021990
[9111] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, epsilon (GABRE), transcript variant 4, mRNA
[9112] gi|12707557|ref|NM—021990.1|[12707557]
[9113] 5598: NM—021987
[9114] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, epsilon (GABRE), transcript variant 3, mRNA
[9115] gi|12707555|ref|NM—021987.1|[12707555]
[9116] 5599: NM—021984
[9117] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, epsilon (GABRE), transcript variant 2, mRNA
[9118] gi|12707553|ref|NM—021984.1|[12707553]
[9119] 5600: AY011291
[9120] Homo sapiens beta-2 adrenergic receptor (ADRB2) gene, partial cds
[9121] gi|12699005|gb|AY011291.1|[12699005]
[9122] 5601: AF316894
[9123] Homo sapiens alpha 2A adrenergic receptor (ADRA2A) gene, complete cds
[9124] gi|12698667|gb|AF316894.1|AF316894[12698667]
[9125] 5602: AJ300340
[9126] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 1 and joined complete CDS
[9127] gi|11878410|emb|AJ300340.1|HSA300340[11878410]
[9128] 5603: AF063605
[9129] Homo sapiens brain my047 protein mRNA, complete cds
[9130] gi|4071360|gb|AF063605.1|AF063605[4071360]
[9131] 5604: AF319440
[9132] Homo sapiens SH2 domain-containing phosphatase anchor protein 1c (SPAP1) mRNA,
[9133] complete cds, alternatively spliced
[9134] gi|12667355|gb|AF319440.1|AF319440[12667355]
[9135] 5605: AF319439
[9136] Homo sapiens SH2 domain-containing phosphatase anchor protein 1b (SPAP1) mRNA,
[9137] complete cds, alternatively spliced
[9138] gi|12667353|gb|AF319439.1|AF319439[12667353]
[9139] 5606: AF319438
[9140] Homo sapiens SH2 domain-containing phosphatase anchor protein 1a (SPAP1) mRNA,
[9141] complete cds, alternatively spliced
[9142] gi|12667351|gb|AF319438.1|AF319438[12667351]
[9143] 5607: NM—021912
[9144] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 3 (GABRB3), transcript variant 2, mRNA
[9145] gi|12548787|ref|NM—021912.1|[12548787]
[9146] 5608: NM—021911
[9147] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 2 (GABRB2), transcript variant 1, mRNA
[9148] gi|12548784|ref|NM—021911.1|[12548784]
[9149] 5609: NM—000814
[9150] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 3 (GABRB3), transcript variant 1, mRNA
[9151] gi|12548782|ref|NM—000814.2|[12548782]
[9152] 5610: NM—000812
[9153] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 1 (GABRB1), mRNA
[9154] gi|12548775|ref|NM—000812.2|[12548775]
[9155] 5611: NM—006786
[9156] Homo sapiens urotensin 2 (UTS2), transcript variant 2, mRNA
[9157] gi|12056480|ref|NM—006786.2|[12056480]
[9158] 5612: NM—021995
[9159] Homo sapiens urotensin 2 (UTS2), transcript variant 1, mRNA
[9160] gi|12056478|ref|NM—021995.1|[12056478]
[9161] 5613: AJ300444
[9162] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 105
[9163] gi|1863669|emb|AJ300444.1|HSA300444[11863669]
[9164] 5614: AJ300443
[9165] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 104
[9166] gi|11863668|emb|AJ300443.1|HSA300443[11863668]
[9167] 5615: AJ300442
[9168] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 103
[9169] gi|11863667|emb|AJ300442.1|HSA300442[11863667]
[9170] 5616: AJ300441
[9171] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 102
[9172] gi|11863666|emb|AJ300441.1|HSA300441[11863666]
[9173] 5617: AJ300440
[9174] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 101
[9175] gi|11863665|emb|AJ300440.1|HSA300440[11863665]
[9176] 5618: AJ300439
[9177] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 100
[9178] gi|11863664|emb|AJ300439.1|HSA300439[11863664]
[9179] 5619: AJ300438
[9180] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 99
[9181] gi|11863663|emb|AJ300438.1|HSA300438[11863663]
[9182] 5620: AJ300437
[9183] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 98
[9184] gi|11863662|emb|AJ300437.1|HSA300437[11863662]
[9185] 5621: AJ300436
[9186] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 97
[9187] gi|11863661|emb|AJ300436.1|HSA300436[11863661]
[9188] 5622: AJ300435
[9189] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 96
[9190] gi|11863660|emb|AJ300435.1|HSA300435[11863660]
[9191] 5623: AJ300434
[9192] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 95
[9193] gi|11863659|emb|AJ300434.1|HSA300434[11863659]
[9194] 5624: AJ300433
[9195] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 94
[9196] gi|11863658|emb|AJ300433.1|HSA300433[11863658]
[9197] 5625: AJ300432
[9198] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 93
[9199] gi|11863657|emb|AJ300432.1|HSA300432[11863657]
[9200] 5626: AJ300431
[9201] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 92
[9202] gi|11863656|emb|AJ300431.1|HSA300431[11863656]
[9203] 5627: AJ300430
[9204] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 91
[9205] gi|11863655|emb|AJ300430.1|HSA300430[11863655]
[9206] 5628: AJ300429
[9207] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 90
[9208] gi|11863654|emb|AJ300429.1|HSA300429[11863654]
[9209] 5629: AJ300428
[9210] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 89
[9211] gi|11863653|emb|AJ300428.1|HSA300428[11863653]
[9212] 5630: AJ300427
[9213] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 88
[9214] gi|11863652|emb|AJ300427.1|HSA300427[11863652]
[9215] 5631: AJ300426
[9216] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 87
[9217] gi|11863651|emb|AJ300426.1|HSA300426[11863651]
[9218] 5632: AJ300425
[9219] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 86
[9220] gi|11863650|emb|AJ300425.1|HSA300425[11863650]
[9221] 5633: AJ300424
[9222] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 85
[9223] gi|11863649|emb|AJ300424.1|HSA300424[11863649]
[9224] 5634: AJ300423
[9225] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 84
[9226] gi|11863648|emb|AJ300423.1|HSA300423[11863648]
[9227] 5635: AJ300422
[9228] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 83
[9229] gi|11863647|emb|AJ300422.1|HSA300422[11863647]
[9230] 5636: AJ300421
[9231] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 82
[9232] gi|11863646|emb|AJ300421.1|HSA300421[11863646]
[9233] 5637: AJ300420
[9234] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 81
[9235] gi|11863645|emb|AJ300420.1|HSA300420[11863645]
[9236] 5638: AJ300419
[9237] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 80
[9238] gi|11863644|emb|AJ300419.1|HSA300419[11863644]
[9239] 5639: AJ300418
[9240] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 79
[9241] gi|11863643|emb|AJ300418.1|HSA300418[11863643]
[9242] 5640: AJ300417
[9243] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 78
[9244] gi|11863642|emb|AJ300417.1|HSA300417[11863642]
[9245] 5641: AJ300416
[9246] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 77
[9247] gi|11863641|emb|AJ300416.1|HSA300416[11863641]
[9248] 5642: AJ300415
[9249] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 76
[9250] gi|1863640|emb|AJ300415.1|HSA300415[11863640]
[9251] 5643: AJ300414
[9252] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 75
[9253] gi|11863639|emb|AJ300414.1|HSA300414[11863639]
[9254] 5644: AJ300413
[9255] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 74
[9256] gi|11863638|emb|AJ300413.1|HSA300413[11863638]
[9257] 5645: AJ300412
[9258] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 73
[9259] gi|11863637|emb|AJ300412.1|HSA300412[11863637]
[9260] 5646: AJ300411
[9261] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 72
[9262] gi|11863636|emb|AJ300411.1|HSA300411[11863636]
[9263] 5647: AJ300410
[9264] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 71
[9265] gi|11863635|emb|AJ300410.1|HSA300410[11863635]
[9266] 5648: AJ300409
[9267] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 70
[9268] gi|11863634|emb|AJ300409.1|HSA300409[11863634]
[9269] 5649: AJ300408
[9270] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 69
[9271] gi|11863633|emb|AJ300408.1|HSA300408[11863633]
[9272] 5650: AJ300407
[9273] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 68
[9274] gi|11863632|emb|AJ300407.1|HSA300407[11863632]
[9275] 5651: AJ300406
[9276] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 67
[9277] gi|11863631|emb|AJ300406.1|HSA300406[11863631]
[9278] 5652: AJ300405
[9279] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 66
[9280] gi|11863630|emb|AJ300405.1|HSA300405[11863630]
[9281] 5653: AJ300404
[9282] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 65
[9283] gi|11863629|emb|AJ300404.1|HSA300404[11863629]
[9284] 5654: AJ300403
[9285] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 64
[9286] gi|11863628|emb|AJ300403.1|HSA300403[11863628]
[9287] 5655: AJ300402
[9288] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 63
[9289] gi|11863627|emb|AJ300402.1|HSA300402[11863627]
[9290] 5656: AJ300401
[9291] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 62
[9292] gi|11863626|emb|AJ300401.1|HSA300401[11863626]
[9293] 5657: AJ300400
[9294] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 61
[9295] gi|11863625|emb|AJ300400.1|HSA300400[11863625]
[9296] 5658: AJ300399
[9297] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 60
[9298] gi|11863624|emb|AJ300399.1|HSA300399[11863624]
[9299] 5659: AJ300398
[9300] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 59
[9301] gi|11863623|emb|AJ300398.1|HSA300398[11863623]
[9302] 5660: AJ300397
[9303] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 58
[9304] gi|11863622|emb|AJ300397.1|HSA300397[11863622]
[9305] 5661: AJ300396
[9306] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 57
[9307] gi|11863621|emb|AJ300396.1|HSA300396[11863621]
[9308] 5662: AJ300395
[9309] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 56
[9310] gi|11863620|emb|AJ300395.1|HSA300395[11863620]
[9311] 5663: AJ300394
[9312] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 55
[9313] gi|11863619|emb|AJ300394.1|HSA300394[11863619]
[9314] 5664: AJ300393
[9315] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 54
[9316] gi|11863618|emb|AJ300393.1|HSA300393[11863618]
[9317] 5665: AJ300392
[9318] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 53
[9319] gi|11863617|emb|AJ300392.1|HSA300392[11863617]
[9320] 5666: AJ300391
[9321] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 52
[9322] gi|11863616|emb|AJ300391.1|HSA300391[11863616]
[9323] 5667: AJ300390
[9324] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 51
[9325] gi|11863615|emb|AJ300390.1|HSA300390[11863615]
[9326] 5668: AJ300389
[9327] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 50
[9328] gi|11863614|emb|AJ300389.1|HSA300389[11863614]
[9329] 5669: AJ300388
[9330] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 49
[9331] gi|11863613|emb|AJ300388.1|HSA300388[11863613]
[9332] 5670: AJ300387
[9333] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 48
[9334] gi|11863612|emb|AJ300387.1|HSA300387[11863612]
[9335] 5671: AJ300386
[9336] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 47
[9337] gi|11863611|emb|AJ300386.1|HSA300386[11863611]
[9338] 5672: AJ300385
[9339] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 46
[9340] gi|11863610|emb|AJ300385.1|HSA300385[11863610]
[9341] 5673: AJ300384
[9342] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 45
[9343] gi|11863609|emb|AJ300384.1HSA300384[11863609]
[9344] 5674: AJ300383
[9345] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 44
[9346] gi|11863608|emb|AJ300383.1|HSA300383[11863608]
[9347] 5675: AJ300382
[9348] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 43
[9349] gi|11863607|emb|AJ300382.1|HSA300382[11863607]
[9350] 5676: AJ300381
[9351] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 42
[9352] gi|11863606|emb|AJ300381.1|HSA300381[11863606]
[9353] 5677: AJ300380
[9354] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 41
[9355] gi|11863605|emb|AJ300380.1|HSA300380[11863605]
[9356] 5678: AJ300379
[9357] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 40
[9358] gi|11863604|emb|AJ300379.1|HSA300379[11863604]
[9359] 5679: AJ300378
[9360] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 39
[9361] gi|1863603|emb|AJ300378.1|HSA300378[11863603]
[9362] 5680: AJ300377
[9363] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 38
[9364] gi|11863602|emb|AJ300377.1|HSA300377[11863602]
[9365] 5681: AJ300376
[9366] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 37
[9367] gi|1863601|emb|AJ300376.1|HSA300376[11863601]
[9368] 5682: AJ300375
[9369] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 36
[9370] gi|1863600|emb|AJ300375.1|HSA300375[11863600]
[9371] 5683: AJ300374
[9372] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 35
[9373] gi|11863599|emb|AJ300374.1|HSA300374[11863599]
[9374] 5684: AJ300373
[9375] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 34
[9376] gi|11863598|emb|AJ300373.1|HSA300373[11863598]
[9377] 5685: AJ300372
[9378] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 33
[9379] gi|11863597|emb|AJ300372.1|HSA300372[11863597]
[9380] 5686: AJ300371
[9381] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 32
[9382] gi|11863596|emb|AJ300371.1|HSA300371[11863596]
[9383] 5687: AJ300370
[9384] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 31
[9385] gi|11863595|emb|AJ300370.1|HSA300370[11863595]
[9386] 5688: AJ300369
[9387] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 30
[9388] gi|11863594|emb|AJ300369.1|HSA300369[11863594]
[9389] 5689: AJ300368
[9390] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 29
[9391] gi|11863593|emb|AJ300368.1|HSA300368[11863593]
[9392] 5690: AJ300367
[9393] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 28
[9394] gi|11863592|emb|AJ300367.1|HSA300367[11863592]
[9395] 5691: AJ300366
[9396] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 27
[9397] gi|11863591|emb|AJ300366.1|HSA300366[11863591]
[9398] 5692: AJ300365
[9399] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 26
[9400] gi|11863590|emb|AJ300365.1|HSA300365[11863590]
[9401] 5693: AJ300364
[9402] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 25
[9403] gi|11863589|emb|AJ300364.1|HSA300364[11863589]
[9404] 5694: AJ300363
[9405] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 24
[9406] gi|11863588|emb|AJ300363.1|HSA300363[11863588]
[9407] 5695: AJ300362
[9408] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 23
[9409] gi|11863587|emb|AJ300362.1|HSA300362[11863587]
[9410] 5696: AJ300361
[9411] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 22
[9412] gi|11863586|emb|AJ300361.1|HSA300361[11863586]
[9413] 5697: AJ300360
[9414] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 21
[9415] gi|11863585|emb|AJ300360.1|HSA300360[11863585]
[9416] 5698: AJ300359
[9417] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 20
[9418] gi|11863584|emb|AJ300359.1|HSA300359[11863584]
[9419] 5699: AJ300358
[9420] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 19
[9421] gi|11863583|emb|AJ300358.1|HSA300358[11863583]
[9422] 5700: AJ300357
[9423] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 18
[9424] gi|11863582|emb|AJ300357.1|HSA300357[11863582]
[9425] 5701: AJ300356
[9426] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 17
[9427] gi|11863581|emb|AJ300356.1|HSA300356[11863581]
[9428] 5702: AJ300355
[9429] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 16
[9430] gi|11863580|emb|AJ300355.1|HSA300355[11863580]
[9431] 5703: AJ300354
[9432] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 15
[9433] gi|11863579|emb|AJ300354.1|HSA300354[11863579]
[9434] 5704: AJ300353
[9435] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 14
[9436] gi|11863578|emb|AJ300353.1|HSA300353[11863578]
[9437] 5705: AJ300352
[9438] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 13
[9439] gi|11863577|emb|AJ300352.1|HSA300352[11863577]
[9440] 5706: AJ300351
[9441] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 12
[9442] gi|11863576|emb|AJ300351.1|HSA300351[11863576]
[9443] 5707: AJ300350
[9444] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 11
[9445] gi|11863575|emb|AJ300350.1|HSA300350[11863575]
[9446] 5708: AJ300349
[9447] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 10
[9448] gi|11863574|emb|AJ300349.1|HSA300349[11863574]
[9449] 5709: AJ300348
[9450] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 9
[9451] gi|11863573|emb|AJ300348.1|HSA300348[11863573]
[9452] 5710: AJ300347
[9453] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 8
[9454] gi|11863572|emb|AJ300347.1|HSA300347[11863572]
[9455] 5711: AJ300346
[9456] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 7
[9457] gi|11863571|emb|AJ300346.1|HSA300346[11863571]
[9458] 5712: AJ300345
[9459] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 6
[9460] gi|11863570|emb|AJ300345.1|HSA300345[11863570]
[9461] 5713: AJ300344
[9462] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 5
[9463] gi|11863569|emb|AJ300344.1|HSA300344[11863569]
[9464] 5714: AJ300343
[9465] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 4
[9466] gi|11863568|emb|AJ300343.1|HSA300343[11863568]
[9467] 5715: AJ300342
[9468] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 3
[9469] gi|11863567|emb|AJ300342.1|HSA300342[11863567]
[9470] 5716: AJ300341
[9471] Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 2
[9472] gi|11863566|emb|AJ300341.1|HSA300341[11863566]
[9473] 5717: NM—000832
[9474] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 1 (GRIN1), transcript variant NR1-1, mRNA
[9475] gi|11496970|ref|NM—000832.4|[11496970]
[9476] 5718: NM—021709
[9477] Homo sapiens CD27-binding (Siva) protein (SIVA), transcript variant 2, mRNA
[9478] 5719: NM—006427
[9479] Homo sapiens CD27-binding (Siva) protein (SIVA), transcript variant 1, mRNA
[9480] gi|11277467|ref|NM—006427.2|[11277467]
[9481] 5720: NM—016232
[9482] Homo sapiens interleukin 1 receptor-like 1 (IL1RL1), mRNA
[9483] gi|11136631|ref|NM—016232.2|[11136631]
[9484] 5721: AF202091
[9485] Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 7 and complete cds
[9486] gi|11055242|gb|AF202091.1|F202078S14[11055242]
[9487] 5722: AF202090
[9488] Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 6
[9489] gi|11055241|gb|AF202090.1|F202078S13[11055241]
[9490] 5723: AF202089
[9491] Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 5
[9492] gi|110552400gb|AF202089.1|F202078S12[11055240]
[9493] 5724: AF202088
[9494] Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 4
[9495] gi|11055239|gb|AF202088.1|F202078S11[11055239]
[9496] 5725: AF202087
[9497] Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 3
[9498] gi|11055238|gb|AF202087.1|F202078S10[11055238]
[9499] 5726: AF202086
[9500] Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 2
[9501] gi|11055237|gb|AF202086.1|F202078S09[11055237]
[9502] 5727: AF202085
[9503] Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 1
[9504] gi|11055236|gb|AF202085.1|F202078S08[11055236]
[9505] 5728: AF202084
[9506] Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 7 and complete cds
[9507] gi|11055235|gb|AF202084.1|F202078S07[11055235]
[9508] 5729: AF202083
[9509] Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 6
[9510] gi|11055234|gb|AF202083.1|F202078S06[11055234]
[9511] 5730: AF202082
[9512] Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 5
[9513] gi|11055233|gb|AF202082.1|F202078S05[11055233]
[9514] 5731: AF202081
[9515] Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 4
[9516] gi|11055232|gb|AF202081.1|F202078S04[11055232]
[9517] 5732: AF202080
[9518] Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 3
[9519] gi|11055231|gb|AF202080.1|F202078S03[11055231]
[9520] 5733: AF202079
[9521] Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 2
[9522] gi|110552300gb|AF202079.1|F202078S02[11055230]
[9523] 5734: AF202078
[9524] Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 1
[9525] gi|11055229|gb|AF202078.1|F202078S01[11055229]
[9526] 5735: AH009943
[9527] Homo sapiens hypocretin receptor-1 (HCRTR1) and hypocretin receptor-2 (HCRTR2)
[9528] genes, complete cds
[9529] gi|11055228|gb|AH009943.1|SEG_F202078S[11055228]
[9530] 5736: NM—021602
[9531] Homo sapiens CD79B antigen (immunoglobulin-associated beta) (CD79B), transcript
[9532] variant 2, mRNA
[9533] gi|11038675|ref|NM—021602.1|[11038675]
[9534] 5737: NM—000626
[9535] Homo sapiens CD79B antigen (immunoglobulin-associated beta) (CD79B), transcript
[9536] variant 1, mRNA
[9537] gi|11038673|ref|NM—000626.1|[11038673]
[9538] 5738: NM—021601
[9539] Homo sapiens CD79A antigen (immunoglobulin-associated alpha) (CD79A), transcript
[9540] variant 2, mRNA
[9541] gi|11038671|ref|NM—021601.1|[11038671]
[9542] 5739: NM—007327
[9543] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 1 (GRIN1), transcript variant NR1-3, mRNA
[9544] gi|11038636|ref|NM—007327.1|[11038636]
[9545] 5740: NM—021569
[9546] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 1 (GRIN1), transcript variant NR1-2, mRNA
[9547] gi|11038634|ref|NM—021569.1|[11038634]
[9548] 5743: NM—021270
[9549] Homo sapiens leukocyte-associated Ig-like receptor 2 (LAIR2), transcript variant
[9550] 2, mRNA
[9551] gi|10947102|ref|NM—021270.1|[10947102]
[9552] 5744: NM—002288
[9553] Homo sapiens leukocyte-associated Ig-like receptor 2 (LAIR2), transcript variant
[9554] 1, mRNA
[9555] gi|10947100|ref|NM—002288.2|[10947100]
[9556] 5745: NM—004041
[9557] Homo sapiens arrestin, beta 1 (ARRB1), transcript variant 1, mRNA
[9558] gi|10880135|ref|NM—004041.2|[10880135]
[9559] 5746: NM—020251
[9560] Homo sapiens arrestin, beta 1 (ARRB1), transcript variant 2, mRNA
[9561] gi|10880133|ref|NM—020251.1|[10880133]
[9562] 5747: NM—000872
[9563] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) (HTR7), transcript variant a, mRNA
[9564] gi|10880132|ref|NM—000872.2|[10880132]
[9565] 5748: NM—019860
[9566] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) (HTR7), transcript variant b, mRNA
[9567] gi|10880130|ref|NM—019860.1|[10880130]
[9568] 5749: NM—019859
[9569] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) (HTR7), transcript variant d, mRNA
[9570] gi|10880128|ref|NM—019859.1|[10880128]
[9571] 5750: NM—004302
[9572] Homo sapiens activin A receptor, type IB (ACVR1B), transcript variant 1, mRNA
[9573] gi|10862695|ref|NM—004302.2|[10862695]
[9574] 5751: NM—020328
[9575] Homo sapiens activin A receptor, type IB (ACVR1B), transcript variant 3, mRNA
[9576] gi|10862693|ref|NM—020328.1|[10862693]
[9577] 5752: NM—020327
[9578] Homo sapiens activin A receptor, type IB (ACVR1B), transcript variant 2, mRNA
[9579] gi|10862691|ref|NM—020327.1|[10862691]
[9580] 5753: NM—020525
[9581] Homo sapiens interleukin 22 (IL22), mRNA
[9582] gi|10092624|ref|NM—020525.1|[10092624]
[9583] 5754: NM—000407
[9584] Homo sapiens glycoprotein Ib (platelet), beta polypeptide (GP1BB), mRNA
[9585] gi|9945387|ref|NM—000407.31[9945387]
[9586] 5755: NM—018971
[9587] Homo sapiens G protein-coupled receptor 27 (GPR27), mRNA
[9588] gi|9506746|ref|NM—018971.1|[9506746]
[9589] 5756: NM—017455
[9590] Homo sapiens stromal cell derived factor receptor 1 (SDFR1), transcript variant
[9591] alpha, mRNA
[9592] gi|9257239|ref|NM—017455.1|[9257239]
[9593] 5757: NM—002197
[9594] Homo sapiens aconitase 1, soluble (ACO1), mRNA
[9595] gi|8659554|ref|NM—002197.1|[8659554]
[9596] 5758: NM—005242
[9597] Homo sapiens coagulation factor II (thrombin) receptor-like 1 (F2RL1), mRNA
[9598] gi|8051581|ref|NM—005242.2|[8051581]
[9599] 5759: NM—016388
[9600] Homo sapiens T-cell receptor interacting molecule (TRIM), mRNA
[9601] gi|7706744|ref|NM—016388.1|[7706744]
[9602] 5760: NM—016334
[9603] Homo sapiens putative G-protein coupled receptor (SH120), mRNA
[9604] gi|7706703|ref|NM—016334.1|[7706703]
[9605] 5761: NM—016318
[9606] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), mRNA
[9607] gi|7706628|ref|NM—016318.1|[7706628]
[9608] 5762: NM—016602
[9609] Homo sapiens G protein-coupled receptor 2 (GPR2), mRNA
[9610] gi|7705315|ref|NM—016602.1|[7705315]
[9611] 5763: NM—013964
[9612] Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-alpha, mRNA
[9613] gi|7669525|ref|NM—013964.1|[7669525]
[9614] 5764: NM—013962
[9615] Homo sapiens neuregulin 1 (NRG1), transcript variant GGF2, mRNA
[9616] gi|7669523|ref|NM—013962.1|[7669523]
[9617] 5765: NM—013961
[9618] Homo sapiens neuregulin 1 (NRG1), transcript variant GGF, mRNA
[9619] gi|7669521|ref|NM—013961.1|[7669521]
[9620] 5766: NM—013960
[9621] Homo sapiens neuregulin 1 (NRG1), transcript variant ndf43, mRNA
[9622] gi|7669519|ref|NM—013960.1|[7669519]
[9623] 5767: NM—013959
[9624] Homo sapiens neuregulin 1 (NRG1), transcript variant SMDF, mRNA
[9625] gi|7669517|ref|NM—013959.1|[7669517]
[9626] 5768: NM—013958
[9627] Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-beta3, mRNA
[9628] gi|7669515|ref|NM—013958.1|[7669515]
[9629] 5769: NM—013957
[9630] Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-beta2, mRNA
[9631] gi|7669513|ref|NM—013957.1|[7669513]
[9632] 5770: NM—013956
[9633] Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-beta1, mRNA
[9634] gi|7669511|ref|NM—013956.1|[7669511]
[9635] 5771: NM—007334
[9636] Homo sapiens killer cell lectin-like receptor subfamily D, member 1 (KLRD1), transcript variant 2, mRNA
[9637] gi|7669498|ref|NM—007334.1|[7669498]
[9638] 5772: NM—002262
[9639] Homo sapiens killer cell lectin-like receptor subfamily D, member 1 (KLRD1), transcript variant 1, mRNA
[9640] gi|7669497|ref|NM—002262.21[7669497]
[9641] 5773: NM—007319
[9642] Homo sapiens presenilin 1 (Alzheimer disease 3) (PSEN1), transcript variant I-374., mRNA
[9643] gi|7549814|ref|NM—007319.1|[7549814]
[9644] 5774: NM—007318
[9645] Homo sapiens presenilin 1 (Alzheimer disease 3) (PSEN1), transcript variant I-463, mRNA
[9646] gi|7549812|ref|NM—007318.1|[7549812]
[9647] 5775: NM—007333
[9648] Homo sapiens killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant NKG2-H, mRNA
[9649] gi|7262385|ref|NM—007333.1|[7262385]
[9650] 5776: NM—007328
[9651] Homo sapiens killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant NKG2-B, mRNA
[9652] gi|7262383|ref|NM—007328.1|[7262383]
[9653] 5777: NM—002259
[9654] Homo sapiens killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant NKG2-A, mRNA
[9655] gi|7262382|ref|NM—002259.2|[7262382]
[9656] 5778: NM—006350
[9657] Homo sapiens follistatin (FST), transcript variant FST317, mRNA
[9658] gi|7242223|ref|NM—006350.2|[7242223]
[9659] 5779: NM—013409
[9660] Homo sapiens follistatin (FST), transcript variant FST344, mRNA
[9661] gi|7242221|ref|NM—013409.1|[7242221]
[9662] 5780: NM—012486
[9663] Homo sapiens presenilin 2 (Alzheimer disease 4) (PSEN2), transcript variant 2,
[9664] mRNA
[9665] gi|7108359|ref|NM—012486.1|[7108359]
[9666] 5781: NM—012485
[9667] Homo sapiens hyaluronan-mediated motility receptor (RHAMM) (HMMR), transcript variant 2, mRNA
[9668] gi|7108350|ref|NM—012485.1|[7108350]
[9669] 5782: NM—012484
[9670] Homo sapiens hyaluronan-mediated motility receptor (RHAMM) (HMMR), transcript variant 1, mRNA
[9671] gi|7108348|ref|NM—012484.1|[7108348]
[9672] 5783: NM—012428
[9673] Homo sapiens stromal cell derived factor receptor 1 (SDFR1), transcript variant
[9674] beta, mRNA
[9675] gi|6912645|ref|NM—012428.1|[6912645]
[9676] 5784: NM—012226
[9677] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), mRNA
[9678] gi|6912565|ref|NM—012226.1|[6912565]
[9679] 5785: NM—012369
[9680] Homo sapiens olfactory receptor, family 2, subfamily F, member 1 (OR2F1), mRNA
[9681] gi|6912557|ref|NM—012369.1|[6912557]
[9682] 5786: NM—007325
[9683] Homo sapiens glutamate receptor, ionotrophic, AMPA 3 (GRIA3), transcript variant
[9684] flip, mRNA
[9685] gi|6598324|ref|NM—007325.1|[6598324]
[9686] 5787: NM—000632
[9687] Homo sapiens integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide) (ITGAM), mRNA
[9688] gi|6006013|ref|NM—000632.21[6006013]
[9689] 5788: NM—007097
[9690] Homo sapiens clathrin, light polypeptide (Lcb) (CLTB), mRNA
[9691] gi|6005994|ref|NM—007097.1|[6005994]
[9692] 5789: NM—000655
[9693] Homo sapiens selectin L (lymphocyte adhesion molecule 1) (SELL), mRNA
[9694] gi|5713320|ref|NM—000655.2|[5713320]
[9695] 5790: NM—005751
[9696] Homo sapiens A kinase (PRKA) anchor protein (yotiao) 9 (AKAP9), mRNA
[9697] gi|5032230|ref|NM—005751.1|[5032230]
[9698] 5791: NM—005691
[9699] Homo sapiens ATP-binding cassette, sub-family C(CFTR/MRP), member 9 (ABCC9), transcript variant SUR2A, mRNA
[9700] gi|5032134|ref|NM—005691.1|[5032134]
[9701] 5792: NM—005534
[9702] Homo sapiens interferon gamma receptor 2 (interferon gamma transducer 1) (IFNCR2), mRNA
[9703] gi|5031782|ref|NM—005534.1|[5031782]
[9704] 5793: NM—005682
[9705] Homo sapiens G protein-coupled receptor 56 (GPR56), mRNA
[9706] gi|5031724|ref|NM—005682.1|[5031724]
[9707] 5794: NM—005446
[9708] Homo sapiens purinergic receptor P2X-like 1, orphan receptor (P2RXL1), mRNA
[9709] gi|4885534|ref|NM—005446.1|[4885534]
[9710] 5795: NM—004958
[9711] Homo sapiens FK506 binding protein 12-rapamycin associated protein 1 (FRAP1), mRNA
[9712] gi|4826729|ref|NM—004958.1|[4826729]
[9713] 5796: NM—004495
[9714] Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-gamma, mRNA
[9715] gi|4758525|ref|NM—004495.1|[4758525]
[9716] 5797: NM—003995
[9717] Homo sapiens natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B) (NPR2), mRNA
[9718] gi|4580421|ref|NM—003995.2|[4580421]
[9719] 5798: NM—003994
[9720] Homo sapiens KIT ligand (KITLG), mRNA
[9721] gi|4580419|ref|NM—003994.2|[4580419]
[9722] 5799: NM—000115
[9723] Homo sapiens endothelin receptor type B (EDNRB), transcript variant 1, mRNA
[9724] gi|4557546|ref|NM—000115.1|[4557546]
[9725] 5800: NM—000734
[9726] Homo sapiens CD3Z antigen, zeta polypeptide (TiT3 complex) (CD3Z), mRNA
[9727] gi|4557430|ref|NM—000734.1|[4557430]
[9728] 5801: NM—003856
[9729] Homo sapiens interleukin 1 receptor-like 1 (IL1RL1), mRNA
[9730] gi|4507244|ref|NM—003856.1|[4507244]
[9731] 5802: NM—002980
[9732] Homo sapiens secretin receptor (SCTR), mRNA
[9733] gi|4506824|ref|NM—002980.1|[4506824]
[9734] 5803: NM—000447
[9735] Homo sapiens presenilin 2 (Alzheimer disease 4) (PSEN2), transcript variant 1,
[9736] mRNA
[9737] gi|4506164|ref|NM—000447.1|[4506164]
[9738] 5804: NM—000021
[9739] Homo sapiens presenilin 1 (Alzheimer disease 3) (PSEN1), transcript variant I-467, mRNA
[9740] gi|4506162|ref|NM—000021.1|[4506162]
[9741] 5805: NM—000907
[9742] Homo sapiens natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B) (NPR2), mRNA
[9743] gi|4505436|ref|NM—000907.1|[4505436]
[9744] 5806: NM—000899
[9745] Homo sapiens KIT ligand (KITLG), mRNA
[9746] gi|4505174|ref|NM—000899.1|[4505174]
[9747] 5807: NM—002353
[9748] Homo sapiens tumor-associated calcium signal transducer 2 (TACSTD2), mRNA
[9749] gi|4505056|ref|NM—002353.1|[4505056]
[9750] 5808: NM—002261
[9751] Homo sapiens killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant NKG2-E, mRNA
[9752] gi|4504884|ref|NM—002261.1|[4504884]
[9753] 5809: NM—000836
[9754] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2D (GRIN2D),
[9755] mRNA
[9756] gi|4504130|ref|NM—000836.1|[4504130]
[9757] 5810: NM—000828
[9758] Homo sapiens glutamate receptor, ionotrophic, AMPA 3 (GRIA3), transcript variant
[9759] flop, mRNA
[9760] gi|4504114|ref|NM—000828.1|[4504114]
[9761] 5811: NM—000813
[9762] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 2 (GABRB2), transcript variant 2, mRNA
[9763] gi|4503864|ref|NM—000813.1|[4503864]
[9764] 5812: NM—003991
[9765] Homo sapiens endothelin receptor type B (EDNRB), transcript variant 2, mRNA
[9766] gi|4503466|ref|NM—003991.1|[4503466]
[9767] 5813: NM—001337
[9768] Homo sapiens chemokine (C-X3-C) receptor 1 (CX3CR1), mRNA
[9769] gi|4503170|ref|NM—001337.1|[4503170]
[9770] 5814: NM—001834
[9771] Homo sapiens clathrin, light polypeptide (Lcb) (CLTB), transcript variant nonbrain, mRNA
[9772] gi|4502900|ref|NM—001834.1|[4502900]
[9773] 5815: NM—001783
[9774] Homo sapiens CD79A antigen (immunoglobulin-associated alpha) (CD79A), transcript
[9775] variant 1, mRNA
[9776] gi|4502684|ref|NM—001783.1|[4502684]
[9777] 5816: AF277897
[9778] Homo sapiens truncated epidermal growth factor receptor (EGFR) mRNA, partial cds; alternatively spliced
[9779] gi|12658300|gb|AF277897.1|AF277897[12658300]
[9780] 5817: AF192403
[9781] Homo sapiens ETL protein (ETL) mRNA, complete cds
[9782] gi|11225482|gb|AF192403.1|AF192403[11225482]
[9783] 5818: AF259263
[9784] Homo sapiens toll-like receptor 9 form B (TLR9) mRNA, complete cds; alternatively spliced
[9785] gi|8099653|gb|AF259263.1|AF259263[8099653]
[9786] 5819: AF259262
[9787] Homo sapiens toll-like receptor 9 form A (TLR9) mRNA, complete cds; alternatively spliced
[9788] gi|8099651|gb|AF259262.1|AF259262[8099651]
[9789] 5820: AF246971
[9790] Homo sapiens Toll-like receptor 8 (TLR8) mRNA, complete cds
[9791] gi|7576932|gb|AF246971.1|AF246971[7576932]
[9792] 5821: AF240467
[9793] Homo sapiens toll-like receptor 7 (TLR7) mRNA, complete cds
[9794] gi|7330280|gb|AF240467.1|AF240467[7330280]
[9795] 5822: AF230073
[9796] Homo sapiens sialoadhesin mRNA, complete cds
[9797] gi|12656129|gb|AF230073.1|AF230073[12656129]
[9798] 5823: BC000783
[9799] Homo sapiens, calcitonin gene-related peptide-receptor component protein, clone
[9800] MGC:804, mRNA, complete cds
[9801] gi|12653974|gb|BC000783.1|BC000783[12653974]
[9802] 5824: NM—016184
[9803] Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin,
[9804] superfamily member 6 (CLECSF6), mRNA
[9805] gi|7705337|ref|NM—016184.1|[7705337]
[9806] 5825: AF242540
[9807] Homo sapiens NK cell type I receptor protein 2B4 (2B4) mRNA, complete cds, alternatively spliced
[9808] gi|12642415|gb|AF242540.1|AF242540[12642415]
[9809] 5826: NM—020979
[9810] Homo sapiens adaptor protein with pleckstrin homology and src homology 2 domains
[9811] (APS), mRNA
[9812] gi|10280625|ref|NM—020979.1|[10280625]
[9813] 5827: NM—018557
[9814] Homo sapiens low density lipoprotein-related protein 1B (deleted in tumors) (LRP1B), mRNA
[9815] gi|9055269|ref|NM—018557.1|[9055269]
[9816] 5828: NM—012452
[9817] Homo sapiens transmembrane activator and CAML interactor (TACI), mRNA
[9818] gi|6912693|ref|NM—012452.1|[6912693]
[9819] 5829: NM—005338
[9820] Homo sapiens huntingtin interacting protein 1 (HIP1), mRNA
[9821] gi|12545385|ref|NM—005338.3|[12545385]
[9822] 5830: AF321238
[9823] Homo sapiens T-cell receptor variable beta-chain 15 mRNA, partial cds
[9824] gi|2484115|gb|AF321238.1|AF321238[12484115]
[9825] 5831: AF125253
[9826] Homo sapiens truncated epidermal growth factor receptor precursor (EGFR) mRNA,
[9827] complete cds
[9828] gi|1200221|gb|AF125253.1|AF125253[12002211]
[9829] 5832: NM—014211
[9830] Homo sapiens gamma aminobutyric acid (GABA) A receptor, pi (GABRP), mRNA
[9831] gi|7657105|ref|NM—014211.1|[7657105]
[9832] 5833: AF283463
[9833] Homo sapiens Nogo receptor mRNA, complete cds
[9834] gi|12407652|gb|AF283463.1|AF283463[12407652]
[9835] 5834: AF224266
[9836] Homo sapiens four alpha helix cytokine (ZCYTO10) mRNA, ZCYTO10-1 allele,
[9837] complete cds
[9838] gi|7109206|gb|AF224266.1|AF224266[7109206]
[9839] 5837: AB045370
[9840] Homo sapiens mRNA for histamine H4 receptor HH4R, complete cds
[9841] gi|12248411|dbj|AB045370.1|AB045370[12248411]
[9842] 5838: AB045369
[9843] Homo sapiens mRNA for histamine H3 receptor HH3R, complete cds
[9844] gi|12248409|dbj|AB045369.1|AB045369[12248409]
[9845] 5840: NM—016363
[9846] Homo sapiens glycoprotein VI (platelet) (GP6), mRNA
[9847] gi|7705956|ref|NM—016363.1|[7705956]
[9848] 5841: NM—022139
[9849] Homo sapiens GDNF family receptor alpha 4 (GFRA4), mRNA
[9850] gi|11545874|ref|NM—022139.1|[11545874]
[9851] 5842: NM—004403
[9852] Homo sapiens deafness, autosomal dominant 5 (DFNA5), mRNA
[9853] gi|4758153|ref|NM—004403.1|[4758153]
[9854] 5847: AF308156
[9855] Homo sapiens HERV-E LTR/leader long terminal repeat, complete sequence; and endothelin B receptor mRNA, partial cds
[9856] gi|12239519|gb|AF308156.1|AF308156[12239519]
[9857] 5850: NM—022789
[9858] Homo sapiens interleukin 17E (IL17E), mRNA
[9859] gi|12232484|ref|NM—022789.1|[12232484]
[9860] 5851: AX054991
[9861] Sequence 3 from Patent WO0073451
[9862] gi|12228357|emb|AX054991.1|AX054991[12228357]
[9863] 5852: AX054989
[9864] Sequence 1 from Patent WO0073451
[9865] gi|12228355|emb|AX054989.1|AX054989[12228355]
[9866] 5853: AJ278581
[9867] Homo sapiens DREV gene and IGSF6 gene for immunoglobulin superfamily 6 protein
[9868] gi|12053852|emb|AJ278581.1|HSA278581[12053852]
[9869] 5854: AJ302556
[9870] Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line OLGA olfactory receptor
[9871] gi|12140483|emb|AJ302556.1|HSA302556[12140483]
[9872] 5855: AJ302555
[9873] Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line SA olfactory receptor
[9874] gi|12140479|emb|AJ302555.1|HSA302555[12140479]
[9875] 5856: AJ302554
[9876] Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line KR3598 olfactory receptor
[9877] gi|12140476|emb|AJ302554.1|HSA302554[12140476]
[9878] 5857: AJ302553
[9879] Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line BM19.7 olfactory receptor
[9880] gi|12140472|emb|AJ302553.1|HSA302553[12140472]
[9881] 5858: AJ302552
[9882] Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line BM28.7 olfactory receptor
[9883] gi|12140468|emb|AJ302552.1|HSA302552[12140468]
[9884] 5859: AF209481
[9885] Homo sapiens probable mannose binding C-type lectin DC-SIGNR gene, exons 3-8, and complete cds
[9886] gi|12084794|gb|AF209481.2|AF209480S2[12084794]
[9887] 5860: AH009824
[9888] Homo sapiens chromosome 19 probable mannose binding C-type lectin DC-SIGNR (abc)
[9889] gene, complete cds
[9890] gi|12084793|gb|AH009824.2|SEG_AF209480S[12084793]
[9891] 5861: AF313449
[9892] Homo sapiens P2Y12 platelet ADP receptor mRNA, complete cds
[9893] gi|1208390|gb|AF313449.1|AF313449[12083901]
[9894] 5884: AH009659
[9895] Homo sapiens RON gene, partial sequence
[9896] gi|9621821|gb|AH009659.1|SEG_HSRONPO[9621821]
[9897] 5885: NM—002351
[9898] Homo sapiens SH2 domain protein 1A, Duncan's disease (lymphoproliferative syndrome) (SH2D1A), mRNA
[9899] gi|4506922|ref|NM—002351.1|[4506922]
[9900] 5886: NM—000171
[9901] Homo sapiens glycine receptor, alpha 1 (startle disease/hyperekplexia, stiff man
[9902] syndrome) (GLRA1), mRNA
[9903] gi|4504018|ref|NM—000171.1|[4504018]
[9904] 5887: NM—000569
[9905] Homo sapiens Fc fragment of IgG, low affinity 111a, receptor for (CD16) (FCGR3A), mRNA
[9906] gi|12056966|ref|NM—000569.2|[12056966]
[9907] 5888: NM—000802
[9908] Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 2, mRNA
[9909] gi|12056965|ref|NM—000802.2|[12056965]
[9910] 5889: NM—003979
[9911] Homo sapiens retinoic acid induced 3 (RA13), mRNA
[9912] gi|12056470|ref|NM—003979.2|[12056470]
[9913] 5900: AJ302633
[9914] Homo sapiens 6M1-02P*02 gene for olfactory receptor, cell line BM28.7
[9915] gi|12054481|emb|AJ302633.1|HSA302633[12054481]
[9916] 5910: AJ302623
[9917] Homo sapiens 6M1-18*02 gene for olfactory receptor, cell line KR3598
[9918] gi|12054470|emb|AJ302623.1|HSA302623[12054470]
[9919] 5911: AJ302622
[9920] Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line AMAI
[9921] gi|12054468|emb|AJ302622.1|HSA302622[12054468]
[9922] 5912: AJ302621
[9923] Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line OLGA
[9924] gi|12054466|emb|AJ302621.1|HSA302621[12054466]
[9925] 5913: AJ302620
[9926] Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line YAR
[9927] gi|12054464|emb|AJ302620.1|HSA302620[12054464]
[9928] 5914: AJ302619
[9929] Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line SA
[9930] gi|2054462|emb|AJ302619.1|HSA302619[12054462]
[9931] 5915: AJ302618
[9932] Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line WT51
[9933] gi|12054460|emb|AJ302618.1|HSA302618[12054460]
[9934] 5916: AJ302617
[9935] Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line H2LCL
[9936] gi|12054458|emb|AJ302617.1|HSA302617[12054458]
[9937] 5917: AJ302616
[9938] Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line LG2
[9939] gi|2054456|emb|AJ302616.1|HSA302616[12054456]
[9940] 5918: AJ302615
[9941] Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line BM19.7
[9942] gi|12054454|emb|AJ302615.1|HSA302615[12054454]
[9943] 5919: AJ302614
[9944] Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line BM28.7
[9945] gi|12054452|emb|AJ302614.1|HSA302614[12054452]
[9946] 5920: AJ302613
[9947] Homo sapiens 6M1-16*03 gene for olfactory receptor, cell line AMAI
[9948] gi|12054450|emb|AJ302613.1|HSA302613[12054450]
[9949] 5921: AJ302612
[9950] Homo sapiens 6M1-16*03 gene for olfactory receptor, cell line BM19.7
[9951] gi|12054448|emb|AJ302612.1|HSA302612[12054448]
[9952] 5922: AJ302611
[9953] Homo sapiens 6M1-16*02 gene for olfactory receptor, cell line BM28.7
[9954] gi|12054446|emb|AJ302611.1|HSA302611[12054446]
[9955] 5923: AJ302610
[9956] Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line OLGA
[9957] gi|12054444|emb|AJ302610.1|HSA302610[12054444]
[9958] 5924: AJ302609
[9959] Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line YAR
[9960] gi|12054442|emb|AJ302609.1|HSA302609[12054442]
[9961] 5925: AJ302608
[9962] Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line SA
[9963] gi|12054440|emb|AJ302608.1|HSA302608[12054440]
[9964] 5926: AJ302607
[9965] Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line WT51
[9966] gi|12054438|emb|AJ302607.1|HSA302607[12054438]
[9967] 5927: AJ302606
[9968] Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line H2LCL
[9969] gi|12054436|emb|AJ302606.1|HSA302606[12054436]
[9970] 5928: AJ302605
[9971] Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line KR3598
[9972] gi|12054434|emb|AJ302605.1|HSA302605[12054434]
[9973] 5929: AJ302604
[9974] Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line LG2
[9975] gi|2054432|emb|AJ302604.1|HSA302604[12054432]
[9976] 5930: AJ302603
[9977] Homo sapiens 6M1-15*03 gene for olfactory receptor, cell line AMAI
[9978] gi|12054430|emb|AJ302603.1|HSA302603[12054430]
[9979] 5931: AJ302602
[9980] Homo sapiens 6M1-15*02 gene for olfactory receptor, cell line WT51
[9981] gi|12054428|emb|AJ302602.1|HSA302602[12054428]
[9982] 5932: AJ302601
[9983] Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line OLGA
[9984] gi|12054426|emb|AJ302601.1|HSA302601[12054426]
[9985] 5933: AJ302600
[9986] Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line YAR
[9987] gi|12054424|emb|AJ302600.1|HSA302600[12054424]
[9988] 5934: AJ302599
[9989] Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line SA
[9990] gi|12054422|emb|AJ302599.1|HSA302599[12054422]
[9991] 5935: AJ302598
[9992] Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line H2LCL
[9993] gi|12054420|emb|AJ302598.1|HSA302598[12054420]
[9994] 5936: AJ302597
[9995] Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line KR3598
[9996] gi|12054418|emb|AJ302597.1|HSA302597[12054418]
[9997] 5937: AJ302596
[9998] Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line LG2
[9999] gi|12054416|emb|AJ302596.1|HSA302596[12054416]
[10000] 5938: AJ302595
[10001] Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line BM19.7
[10002] gi|12054414|emb|AJ302595.1|HSA302595[12054414]
[10003] 5939: AJ302594
[10004] Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line BM28.7
[10005] gi|12054412|emb|AJ302594.1|HSA302594[12054412]
[10006] 5940: AJ302593
[10007] Homo sapiens 6M1-10*02 gene for olfactory receptor, cell line KR3598
[10008] gi|12054410|emb|AJ302593.1|HSA302593[12054410]
[10009] 5941: AJ302592
[10010] Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line AMAI
[10011] gi|12054408|emb|AJ302592.1|HSA302592[12054408]
[10012] 5942: AJ302591
[10013] Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line OLGA
[10014] gi|12054406|emb|AJ302591.1|HSA302591[12054406]
[10015] 5943: AJ302590
[10016] Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line YAR
[10017] gi|12054404|emb|AJ302590.1|HSA302590[12054404]
[10018] 5944: AJ302589
[10019] Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line SA
[10020] gi|12054402|emb|AJ302589.1|HSA302589[12054402]
[10021] 5945: AJ302588
[10022] Homo sapiens 6M-10*01 gene for olfactory receptor, cell line WT51
[10023] gi|12054400|emb|AJ302588.1|HSA302588[12054400]
[10024] 5946: AJ302587
[10025] Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line H2LCL
[10026] gi|12054398|emb|AJ302587.1|HSA302587[12054398]
[10027] 5947: AJ302586
[10028] Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line LG2
[10029] gi|12054396|emb|AJ302586.1|HSA302586[12054396]
[10030] 5948: AJ302585
[10031] Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line BM19.7
[10032] gi|12054394|emb|AJ302585.1|HSA302585[12054394]
[10033] 5949: AJ302584
[10034] Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line BM28.7
[10035] gi|12054392|emb|AJ302584.1|HSA302584[12054392]
[10036] 5950: AJ302583
[10037] Homo sapiens 6M1-6*03 gene for olfactory receptor, cell line WT51
[10038] gi|12054390|emb|AJ302583.1|HSA302583[12054390]
[10039] 5951: AJ302582
[10040] Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line OLGA
[10041] gi|12054388|emb|AJ302582.1|HSA302582[12054388]
[10042] 5952: AJ302581
[10043] Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line KR3598
[10044] gi|12054386|emb|AJ3025810.1HSA302581[12054386]
[10045] 5953: AJ302580
[10046] Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line SA
[10047] gi|12054384|emb|AJ302580.1|HSA302580[12054384]
[10048] 5954: AJ302579
[10049] Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line AMAI
[10050] gi|12054382|emb|AJ302579.1|HSA302579[12054382]
[10051] 5955: AJ302578
[10052] Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line BM28.7
[10053] gi|12054380|emb|AJ302578.1|HSA302578[12054380]
[10054] 5956: AJ302577
[10055] Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line BM19.7
[10056] gi|112054378|emb|AJ302577.1|HSA302577[12054378]
[10057] 5957: AJ302576
[10058] Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line OLGA
[10059] gi|12054376|emb|AJ302576.1|HSA302576[12054376]
[10060] 5958: AJ302575
[10061] Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line YAR
[10062] gi|2054374|emb|AJ302575.1|HSA302575[12054374]
[10063] 5959: AJ302574
[10064] Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line SA
[10065] gi|12054372|emb|AJ302574.1|HSA302574[12054372]
[10066] 5960: AJ302573
[10067] Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line H2LCL
[10068] gi|12054370|emb|AJ302573.1|HSA302573[12054370]
[10069] 5961: AJ302572
[10070] Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line KR3598
[10071] gi|12054368|emb|AJ302572.1|HSA302572[12054368]
[10072] 5962: AJ302571
[10073] Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line LG2
[10074] gi|12054366|emb|AJ302571.1|HSA302571[12054366]
[10075] 5963: AJ302570
[10076] Homo sapiens 6M1-4P*05 gene for olfactory receptor, cell line BM19.7
[10077] gi|12054364|emb|AJ302570.1|HSA302570[12054364]
[10078] 5964: AJ302569
[10079] Homo sapiens 6M1-4P*05 gene for olfactory receptor, cell line BM28.7
[10080] gi|12054362|emb|AJ302569.1|HSA302569[12054362]
[10081] 5965: AJ302568
[10082] Homo sapiens 6M1-4P*04 gene for olfactory receptor, cell line AMAI
[10083] gi|12054360|emb|AJ302568.1|HSA302568[12054360]
[10084] 5966: AJ302567
[10085] Homo sapiens 6M1-4P*03 gene for olfactory receptor, cell line WT51
[10086] gi|12054358|emb|AJ302567.1|HSA302567[12054358]
[10087] 5967: AJ302566
[10088] Homo sapiens 6M1-4P*02 gene for olfactory receptor, cell line OLGA
[10089] gi|2054356|emb|AJ302566.1|HSA302566[12054356]
[10090] 5968: AJ302565
[10091] Homo sapiens 6M1-4P*02 gene for olfactory receptor, cell line KR3598
[10092] gi|12054354|emb|AJ302565.1|HSA302565[12054354]
[10093] 5975: AJ302558
[10094] Homo sapiens 6M1-3*04 gene for olfactory receptor, cell line AMAI
[10095] gi|12054346|emb|AJ302558.1|HSA302558[12054346]
[10096] 5976: AJ302557
[10097] Homo sapiens 6M1-3*03 gene for olfactory receptor, cell line WT51
[10098] gi|12054344|emb|AJ302557.1|HSA302557[12054344]
[10099] 5977: AJ302551
[10100] Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line OLGA
[10101] gi|12054342|emb|AJ302551.1|HSA302551[12054342]
[10102] 5978: AJ302550
[10103] Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line YAR
[10104] gi|12054340|emb|AJ302550.1|HSA302550[12054340]
[10105] 5979: AJ302549
[10106] Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line SA
[10107] gi|12054338|emb|AJ302549.1|HSA302549[12054338]
[10108] 5980: AJ302548
[10109] Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line H2LCL
[10110] gi|12054336|emb|AJ302548.1|HSA302548[12054336]
[10111] 5981: AJ302547
[10112] Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line LG2
[10113] gi|2054334|emb|AJ302547.1|HSA302547[12054334]
[10114] 5982: AJ302546
[10115] Homo sapiens 6M1-1*02 gene for olfactory receptor, cell line BM19.7
[10116] gi|12054332|emb|AJ302546.1|HSA302546[12054332]
[10117] 5983: AJ302545
[10118] Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line KR3598
[10119] gi|12054330|emb|AJ302545.1|HSA302545[12054330]
[10120] 5984: AJ302544
[10121] Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line YAR
[10122] gi|12054328|emb|AJ302544.1|HSA302544[12054328]
[10123] 5985: AJ302543
[10124] Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line OLGA
[10125] gi|12054326|emb|AJ302543.1|HSA302543[12054326]
[10126] 5986: AJ302542
[10127] Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line SA
[10128] gi|12054324|emb|AJ302542.1|HSA302542[12054324]
[10129] 5987: AJ302541
[10130] Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line AMAI
[10131] gi|12054322|emb|AJ302541.1|HSA302541[12054322]
[10132] 5988: AJ302540
[10133] Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line WT51
[10134] gi|12054320|emb|AJ302540.1|HSA302540[12054320]
[10135] 5989: AJ302539
[10136] Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line H2LCL
[10137] gi|12054318|emb|AJ302539.1|HSA302539[12054318]
[10138] 5990: AJ302538
[10139] Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line BM28.7
[10140] gi|12054316|emb|AJ302538.1|HSA302538[12054316]
[10141] 5991: AJ302537
[10142] Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line LG2
[10143] gi|12054314|emb|AJ302537.1|HSA302537[12054314]
[10144] 5993: AJ131724
[10145] Homo sapiens mRNA for serotonin receptor 5-HT4 (splice variant h5-HT4(b))
[10146] gi|12053629|emb|AJ131724.1|HSA131724[12053629]
[10147] 5994: AF305200
[10148] Homo sapiens interleukin 17E (IL17E) mRNA, complete cds
[10149] gi|11878209|gb|AF305200.1|AF305200[11878209]
[10150] 5995: AH003378
[10151] Homo sapiens ciliary neurotrophic factor alpha receptor gene
[10152] gi|608655|gb|AH003378.1|SEG_HUMCNFAR0[608655]
[10153] 5996: L38025
[10154] Homo sapiens ciliary neurotrophic factor alpha receptor gene, exons 8-10, complete cds
[10155] gi|608654|gb|L38025.1|HUMCNFAR06[608654]
[10156] 5997: L38024
[10157] Homo sapiens ciliary neurotrophic factor alpha receptor gene, exons 5-7
[10158] gi|608653|gb|L38024.1|HUMCNFAR05[608653]
[10159] 5998: L38023
[10160] Homo sapiens ciliary neurotrophic factor alpha receptor gene, exon 4
[10161] gi|608652|gb|L38023.1|HUMCNFAR04[608652]
[10162] 5999: L38022
[10163] Homo sapiens ciliary neurotrophic factor alpha receptor gene, exon 3
[10164] gi|608651|gb|L380220.1HUMCNFAR03[608651]
[10165] 6000: L38021
[10166] Homo Sapiens ciliary neurutrophic factor alpha receptor gene, exon 2
[10167] gi|608650|gb|L38021.1|HUMCNFAR02[608650]
[10168] 6001: L38020
[10169] Homo sapiens ciliary neurotrophic factor alpha receptor gene, exon 1
[10170] gi|608649|gb|L380200.1HUMCNFAR01[608649]
[10171] 6050: NM—012152
[10172] Homo sapiens endothelial differentiation, lysophosphatidic acid
[10173] G-protein-coupled receptor, 7 (EDG7), mRNA
[10174] gi|6912347|ref|NM—012152.1|[6912347]
[10175] 6051: NM—007360
[10176] Homo sapiens DNA segment on chromosome 12 (unique) 2489 expressed sequence (D12S2489E), mRNA
[10177] gi|6679051|ref|NM—007360.1|[6679051]
[10178] 6054: AF263029
[10179] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 14
[10180] and complete cds
[10181] gi|12043771|gb|AF263029.1|F263016S14[12043771]
[10182] 6055: AF263028
[10183] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 13
[10184] gi|12043770|gb|AF263028.1|F263016S13[12043770]
[10185] 6056: AF263027
[10186] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 12
[10187] gi|12043769|gb|AF263027.1|F263016S12[12043769]
[10188] 6057: AF263026
[10189] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 11----
[10190] gi|12043768|gb|AF263026.1|F263016S11[12043768]
[10191] 6058: AF263025
[10192] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 10
[10193] gi|12043767|gb|AF263025.1|F263016S10[12043767]
[10194] 6059: AF263024
[10195] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 9
[10196] gi|12043766|gb|AF263024.1|F263016S09[12043766]
[10197] 6060: AF263023
[10198] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 8
[10199] gi|12043765|gb|AF263023.1|F263016S08[12043765]
[10200] 6061: AF263022
[10201] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 7
[10202] gi|12043764|gb|AF263022.1|F263016S07[12043764]
[10203] 6062: AF263021
[10204] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 6
[10205] gi|12043763|gb|AF263021.1F263016S06[12043763]
[10206] 6063: AF263020
[10207] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 5
[10208] gi|12043762|gb|AF263020.1|F263016S05[12043762]
[10209] 6064: AF263019
[10210] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon
[10211] gi|12043761|gb|AF263019.1|F263016S04[12043761]
[10212] 6065: AF263018
[10213] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 3
[10214] gi|12043760|gb|AF263018.1|F263016S03[12043760]
[10215] 6066: AF263017
[10216] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 2
[10217] gi|12043759|gb|AF263017.1|F263016S02[12043759]
[10218] 6067: AF263016
[10219] Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 1
[10220] gi|12043758|gb|AF263016.1|F263016S01[12043758]
[10221] 6068: AH010208
[10222] Homo sapiens chromosome 12 map 12q15
[10223] gi|12043757|gb|AH010208.1|SEG_F263016S[12043757]
[10224] 6069: AF310676
[10225] Homo sapiens E3 ubiquitin ligase SMURF2 mRNA, complete cds
[10226] gi|112018150gb|AF310676.1|AF310676[12018150]
[10227] 6070: AF310250
[10228] Homo sapiens IRS-1 PH domain binding protein PHIP mRNA, complete cds
[10229] gi|12007333|gb|AF310250.1|AF310250[12007333]
[10230] 6071: AF276292
[10231] Homo sapiens killer cell immunoglobulin-like receptor KIR2DL4 mRNA, complete cds
[10232] gi|12006296|gb|AF276292.1|AF276292[12006296]
[10233] 6072: AF272157
[10234] Homo sapiens killer cell immunoglobulin-like receptor precursor (KIR2DLX) gene,
[10235] complete cds
[10236] gi|12006228|gb|AF272157.1|AF272157[12006228]
[10237] 6073: AF271608
[10238] Homo sapiens clone 3 killer cell immunoglobulin-like receptor KIR2DLX (KIR2DLX)
[10239] mRNA, complete cds
[10240] gi|12006190|gb|AF271608.1|AF271608[12006190]
[10241] 6074: AF271607
[10242] Homo sapiens clone 13 killer cell immunoglobulin-like receptor KIR2DLX (KIR2DLX)
[10243] mRNA, complete cds
[10244] gi|2006188|gb|AF271607.1|AF271607[12006188]
[10245] 6075: AF223941
[10246] Homo sapiens complement receptor 2 (CR2) gene, promoter region and partial sequence
[10247] gi|12004993|gb|AF223941.1|AF223941[12004993]
[10248] 6076: AF196176
[10249] Homo sapiens capsaicin receptor variant mRNA, complete cds
[10250] gi|12003147|gb|AF196176.1|AF196176[12003147]
[10251] 6077: AF196175
[10252] Homo sapiens capsaicin receptor mRNA, complete cds
[10253] gi|12003145|gb|AF196175.1|AF196175[12003145]
[10254] 6078: AF125539
[10255] Homo sapiens epidermal growth factor receptor (EGFR) gene, alternative exons, exons 16 and 17 and partial cds, alternatively spliced
[10256] gi|12002219|gb|AF125539.1|AF125538S2[12002219]
[10257] 6079: AF125538
[10258] Homo sapiens epidermal growth factor receptor (EGFR) gene, exon 15
[10259] gi|2002218|gb|AF125538.1|AF125538S1[12002218]
[10260] 6080: AH010139
[10261] Homo sapiens epidermal growth factor receptor (EGFR) gene, partial cds, alternatively spliced
[10262] gi|12002217|gb|AH010139.1|SEG_AF125538S[12002217]
[10263] 6081: AF308571
[10264] Homo sapiens hepatointestinal leukotriene B4 receptor mRNA, complete cds
[10265] gi|11878227|gb|AF308571.1|AF308571[11878227]
[10266] 6082: AF275260
[10267] Homo sapiens SRPSOX (SRPSOX) mRNA, complete cds
[10268] gi|11139543|gb|AF275260.1|AF275260[11139543]
[10269] 6083: NM—007161
[10270] Homo sapiens DNA segment on chromosome 6 (unique) 49 expressed sequence, NK cell
[10271] triggering receptor, p30 (D6S49E), mRNA
[10272] gi|6005740|ref|NM—007161.1|[6005740]
[10273] 6090: AF289204
[10274] Homo sapiens odorant receptor HOR3′beta4 and odorant receptor HOR3′beta5 genes,
[10275] complete cds
[10276] gi|1991862|gb|AF289204.1|AF289203S2[11991862]
[10277] 6091: AF289203
[10278] Homo sapiens odorant receptor HOR3′beta1, odorant receptor HOR3′beta2, and odorant receptor HOR3′beta3 genes, complete cds
[10279] gi|11991861|gb|AF289203.1|AF289203S1[11991861]
[10280] 6092: AH010109
[10281] Homo sapiens odorant receptor HOR3′beta1, odorant receptor HOR3′beta4, odorant
[10282] receptor HOR3′beta2, odorant receptor HOR3′beta5, and odorant receptor HOR3′beta3 genes, complete cds
[10283] gi|11991860|gb|AH010109.1|SEG_AF289203S[11991860]
[10284] 6093: AF217689
[10285] Homo sapiens nociceptin receptor ORL1 (ORL1) gene, exons 1b and 2, and partial
[10286] cds, alternatively spliced
[10287] gi|11991833|gb|AF217689.1|AF217688S2[11991833]
[10288] 6094: AF217688
[10289] Homo sapiens G alpha interacting protein (GAIP) gene, partial cds, alternatively
[10290] spliced; and nociceptin receptor ORL1 (ORL1) gene, exon 1a
[10291] gi|11991832|gb|AF217688.1|AF217688S1[11991832]
[10292] 6095: AH010108
[10293] Homo sapiens G alpha interacting protein (GAIP) and nociceptin receptor ORL1 (ORL1) genes, partial cds
[10294] gi|1199183|gb|AH010108.1|SEG_AF217688S[11991831]
[10295] 6096: AB045011
[10296] Homo sapiens hmGluR2 gene for metabotropic glutamate receptor type 2, complete
[10297] cds
[10298] gi|11990938|dbj|AB045011.1|AB045011[11990938]
[10299] 6097: AF281074
[10300] Homo sapiens neuropilin 2 (NRP2) gene, complete cds, alternatively spliced
[10301] gi|11934947|gb|AF281074.1|AF281074[11934947]
[10302] 6098: AJ400846
[10303] Homo sapiens mRNA for immunoglobulin-like cell surface receptor FDFACT1, activating counterpart allele 1
[10304] gi|11932154|emb|AJ400846.1|HSA400846[11932154]
[10305] 6099: AJ400845
[10306] Homo sapiens mRNA for immunoglobulin-like cell surface receptor FDFACT2, activating counterpart allele 2
[10307] gi|11932151|emb|AJ400845.1|HSA400845[11932151]
[10308] 6100: AB024327
[10309] Homo sapiens pt-wd mRNA for WD-40 repeat protein, complete cds
[10310] gi|4519416|dbj|AB024327.1|AB024327[4519416]
[10311] 6102: AF280547
[10312] Homo sapiens neuropilin-1 soluble isoform 11 (NRP1) mRNA, complete cds, alternatively spliced
[10313] gi|11907931|gb|AF280547.1|AF280547[11907931]
[10314] 6103: AF280546
[10315] Homo sapiens neuropilin-2 soluble isoform 9 (NRP2) mRNA, complete cds, alternatively spliced
[10316] gi|11907929|gb|AF280546.1|AF280546[11907929]
[10317] 6104: AF280545
[10318] Homo sapiens neuropilin-2b(5) (NRP2) mRNA, complete cds, alternatively spliced
[10319] gi|11907927|gb|AF280545.1|AF280545[11907927]
[10320] 6105: AF280544
[10321] Homo sapiens neuropilin-2b(O) (NRP2) mRNA, complete cds, alternatively spliced
[10322] gi|11907925|gb|AF280544.1|AF280544[11907925]
[10323] 6106: AF268899
[10324] Homo sapiens neuropeptide FF receptor 2 (NPFF2) mRNA, complete cds
[10325] gi|11907914|gb|AF268899.1|AF268899[11907914]
[10326] 6107: AF268898
[10327] Homo sapiens neuropeptide FF receptor 1 (NPFF1) mRNA, complete cds
[10328] gi|11907912|gb|AF268898.1|AF268898[11907912]
[10329] 6111: Y19228
[10330] Homo sapiens partial GIR gene for glucocorticoid induced receptor, exons and joined CDS
[10331] gi|11878425|emb|Y19228.1|HSY19228[11878425]
[10332] 6118: Y19231
[10333] Homo sapiens partial GIR gene for glucocorticoid induced receptor, exon 4
[10334] gi|11877264|emb|Y19231.1|HSY19231[11877264]
[10335] 6119: Y19230
[10336] Homo sapiens partial GIR gene for glucocorticoid induced receptor, exon 3
[10337] gi|11877263|emb|Y19230.1|HSY19230[11877263]
[10338] 6120: Y19229
[10339] Homo sapiens partial GIR gene for glucocorticoid induced receptor, exon 2
[10340] gi|11877262|emb|Y19229.1|HSY19229[11877262]
[10341] 6121: AX047952
[10342] Sequence 19 from Patent WO0070045
[10343] gi|11876875|emb|AX047952.1|AX047952[11876875]
[10344] 6122: AX047940
[10345] Sequence 7 from Patent WO0070045
[10346] gi|11876863|emb|AX047940.1|AX047940[11876863]
[10347] 6123: AX047936
[10348] Sequence 3 from Patent WO0070045
[10349] gi|11876859|emb|AX047936.1|AX047936[11876859]
[10350] 6124: AJ272207
[10351] Homo sapiens mRNA for putative G protein-coupled receptor 92 (GPR92 gene)
[10352] gi|9843745|emb|AJ272207.1|HSA272207[9843745]
[10353] 6125: AF311306
[10354] Homo sapiens prostate specific G-protein coupled receptor gene, complete cds
[10355] gi|11875777|gb|AF311306.1|AF311306[11875777]
[10356] 6126: NM—022146
[10357] Homo sapiens neuropeptide FF 1; RFamide-related peptide receptor (OT7T022), mRNA
[10358] gi|11545886|ref|NM—022146.1|[11545886]
[10359] 6127: NM—004885
[10360] Homo sapiens neuropeptide G protein-coupled receptor; neuropeptide FF 2 (NPGPR),
[10361] mRNA
[10362] gi|4758819|ref|NM—004885.1|[4758819]
[10363] 6128: NM—002958
[10364] Homo sapiens RYK receptor-like tyrosine kinase (RYK), mRNA
[10365] gi|11863158|ref|NM—002958.1|[11863158]
[10366] 6129: AF217485
[10367] Homo sapiens KIR3D51 gene, partial sequence; and killer cell Ig-like receptor KIR2DL5.1 (KIR2DL5.1) gene, complete cds
[10368] gi|1761705|gb|AF217485.1|AF217485[11761705]
[10369] 6130: NM—005856
[10370] Homo sapiens receptor (calcitonin) activity modifying protein 3 (RAMP3), mRNA
[10371] gi|5032022|ref|NM—005856.1|[5032022]
[10372] 6131: NM—005854
[10373] Homo sapiens receptor (calcitonin) activity modifying protein 2 (RAMP2), mRNA
[10374] gi|5032020|ref|NM—005854.1|[5032020]
[10375] 6132: NM—005855
[10376] Homo sapiens receptor (calcitonin) activity modifying protein 1 (RAMP1), mRNA
[10377] gi|5032018|ref|NM—005855.1|[5032018]
[10378] 6133: NM—000025
[10379] Homo sapiens adrenergic, beta-3-, receptor (ADRB3), mRNA
[10380] gi|4557266|ref|NM—000025.1|[4557266]
[10381] 6134: AF245390
[10382] Homo sapiens GREB1c (GREB1) mRNA, complete cds, alternatively spliced
[10383] gi|11611737|gb|AF245390.1|AF245390[11611737]
[10384] 6135: AF245389
[10385] Homo sapiens GREB1b (GREB1) mRNA, complete cds, alternatively spliced
[10386] gi|11611735|gb|AF245389.1|AF245389[11611735]
[10387] 6136: AF245388
[10388] Homo sapiens GREB1a (GREB1) mRNA, partial cds, alternatively spliced
[10389] gi|11611733|gb|AF245388.1|AF245388[11611733]
[10390] 6137: AF292402
[10391] Homo sapiens neuromedin U receptor-type 2 mRNA, complete cds
[10392] gi|9944989|gb|AF292402.1|AF292402[9944989]
[10393] 6138: NM—002855
[10394] Homo sapiens poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin) (PVRL1), mRNA
[10395] gi|11602905|ref|NM—002855.2|[11602905]
[10396] 6143: AH010043
[10397] Homo sapiens
[10398] gi|1155957|gb|AH010043.1|SEG_AF260138S[11559571]
[10399] 6144: AF260137
[10400] Homo sapiens killer-cell immunoglobulin-like receptor KIR2DL5.3 (KIR2DL5) gene,
[10401] exon 1 and partial cds
[10402] gi|11559569|gb|AF260137.1|AF260137[11559569]
[10403] 6145: X76400
[10404] Homo sapiens mRNA for nectin 1 (PRR1 gene)
[10405] gi|11558774|emb|X76400.2|HSPRR[11558774]
[10406] 6147: NM—022159
[10407] Homo sapiens ETL protein (ETL), mRNA
[10408] gi|11545907|ref|NM—022159.1|[11545907]
[10409] 6148: NM—022150
[10410] Homo sapiens RFamide-related peptide precursor (RFRP), mRNA
[10411] gi|11545893|ref|NM—022150.1|[11545893]
[10412] 6149: NM—022049
[10413] Homo sapiens G-protein coupled receptor 88 (GPR88), mRNA
[10414] gi|11545752|ref|NM—022049.1|[11545752]
[10415] 6219: AF281308
[10416] Homo sapiens alpha 2A adrenergic receptor (ADRA2A) gene, complete cds
[10417] gi|9652209|gb|AF281308.1|AF281308[9652209]
[10418] 6241: AF217487
[10419] Homo sapiens killer cell Ig-like receptor KIR2DL5.3 (KIR2DL5.3) mRNA, complete
[10420] cds
[10421] gi|11528059|gb|AF217487.1|AF217487[11528059]
[10422] 6242: NM—003553
[10423] Homo sapiens olfactory receptor, family 1, subfamily E, member 1 (OR1E1), mRNA
[10424] gi|11496274|ref|NM—003553.1|[11496274]
[10425] 6243: AF208054
[10426] Homo sapiens non-inhibitory killer-cell Ig-like receptor KIR (KIR2D55) mRNA, complete cds
[10427] gi|11493968|gb|AF208054.1|AF208054[11493968]
[10428] 6244: NM—018690
[10429] Homo sapiens apolipoprotein B48 receptor (APOB48R), mRNA
[10430] gi|8922078|ref|NM—018690.1|[8922078]
[10431] 6245: AB044934
[10432] Homo sapiens H4R mRNA for histamine H4 receptor, complete cds
[10433] gi|10241846|dbj|AB044934.1|AB044934[10241846]
[10434] 6246: NM—003555
[10435] Homo sapiens olfactory receptor, family 1, subfamily G, member 1 (OR1G1), mRNA
[10436] gi|11415033|ref|NM—003555.1|[11415033]
[10437] 6247: NM—003552
[10438] Homo sapiens olfactory receptor, family 1, subfamily D, member 4 (OR1D4), mRNA
[10439] gi|11415031|ref|NM—003552.1|[11415031]
[10440] 6248: NM—003554
[10441] Homo sapiens olfactory receptor, family 1, subfamily E, member 2 (OR1E2), mRNA
[10442] gi|11386152|ref|NM—003554.1|[11386152]
[10443] 6390: AF264014
[10444] Homo sapiens scavenger receptor cysteine-rich type 1 protein M160 precursor, mRNA, complete cds, alternatively spliced
[10445] gi|9652086|gb|AF264014.1|AF264014[9652086]
[10446] 6391: AF169007
[10447] Homo sapiens beta-1-adrenergic receptor (ADRB1) gene, complete cds
[10448] gi|5833816|gb|AF169007.1|AF169007[5833816]
[10449] 6392: AF169006
[10450] Homo sapiens beta-1-adrenergic receptor (ADRB1) gene, complete cds
[10451] gi|5833814|gb|AF169006.1|AF169006[5833814]
[10452] 6393: AF159854
[10453] Homo sapiens cytokine signaling suppressor (SOCS3) mRNA, complete cds
[10454] gi|5353755|gb|AF159854.1|AF159854[5353755]
[10455] 6394: AF032124
[10456] Homo sapiens RET proto-oncogene (RET) gene, 5′ flanking region and partial cds
[10457] gi|2795879|gb|AF032124.1|AF032124[2795879]
[10458] 6395: NM—002644
[10459] Homo sapiens polymeric immunoglobulin receptor (PIGR), mRNA
[10460] gi|11342673|ref|NM—002644.1|[11342673]
[10461] 6396: AJ249248
[10462] Homo sapiens mRNA for putative G protein-coupled Receptor
[10463] gi|5834594|emb|AJ249248.1|HSA249248[5834594]
[10464] 6397: AJ277028
[10465] Homo sapiens mRNA for vanilloid receptor 1 (VR1 gene)
[10466] gi|8977865|emb|AJ277028.1|HSA277028[8977865]
[10467] 6398: AF072872
[10468] Homo sapiens frizzled 1 mRNA, complete cds
[10469] gi|5305406|gb|AF072872.1|AF072872[5305406]
[10470] 6399: AF073727
[10471] Homo sapiens EH domain-binding mitotic phosphoprotein (EPSIN) mRNA, complete cds
[10472] gi|5051635|gb|AF073727.1|AF073727[5051635]
[10473] 6400: NM—002551
[10474] Homo sapiens olfactory receptor, family 3, subfamily A, member 2 (OR3A2), mRNA
[10475] gi|11321568|ref|NM—002551.1|[11321568]
[10476] 6401: NM—000870
[10477] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), mRNA
[10478] gi|11321562|ref|NM—000870.1|[11321562]
[10479] 6419: AB042411
[10480] Homo sapiens strg gene for striatum-specific G potein-coupled receptor, complete
[10481] cds
[10482] gi|11275369|dbj|AB042411.1|AB042411[11275369]
[10483] 6420: AB042410
[10484] Homo sapiens strg mRNA for striatum-specific G protein-coupled receptor, complete cds
[10485] gi|1275367|dbj|AB042410.1|AB042410[11275367]
[10486] 6434: AJ289159
[10487] Homo sapiens CD30 gene for cytokine receptor CD30, exons 1-8
[10488] gi|11230634|emb|AJ289159.1|HSA289159[11230634]
[10489] 6435: AF279762
[10490] Homo sapiens ROR2 (ROR2) gene, exon 9 and partial cds
[10491] gi|11228720|gb|AF279762.1|AF279755S8[11228720]
[10492] 6436: AF279761
[10493] Homo sapiens ROR2 (ROR2) gene, exon 8
[10494] gi|11228719|gb|AF279761.1|AF279755S7[11228719]
[10495] 6437: AF279760
[10496] Homo sapiens ROR2 (ROR2) gene, exon 7
[10497] gi|11228718|gb|AF279760.1|AF279755S6[11228718]
[10498] 6438: AF279759
[10499] Homo sapiens ROR2 (ROR2) gene, exon 6
[10500] gi|11228717|gb|AF279759.1|AF279755S5[11228717]
[10501] 6439: AF279758
[10502] Homo sapiens ROR2 (ROR2) gene, exon 5
[10503] gi|11228716|gb|AF279758.1|AF279755S4[11228716]
[10504] 6440: AF279757
[10505] Homo sapiens ROR2 (ROR2) gene, exon 4
[10506] gi|11228715|gb|AF279757.1|AF279755S3[11228715]
[10507] 6441: AF279756
[10508] Homo sapiens ROR2 (ROR2) gene, exon 3
[10509] gi|11228714|gb|AF279756.1|AF279755S2[11228714]
[10510] 6442: AF279755
[10511] Homo sapiens ROR2 (ROR2) gene, exon 2
[10512] gi|11228713|gb|AF279755.1|AF279755S1[11228713]
[10513] 6443: AH010002
[10514] Homo sapiens ROR2 (ROR2) gene, partial cds
[10515] gi|11228712|gb|AH010002.1|SEG AF279755S[11228712]
[10516] 6444: AF260529
[10517] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 19 and partial cds
[10518] gi|11228705|gb|AF260529.1|F260514S16[11228705]
[10519] 6445: AF260528
[10520] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exons 17 and 18
[10521] gi|11228704|gb|AF260528.1|F260514S15[11228704]
[10522] 6446: AF260527
[10523] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 16
[10524] gi|11228703|gb|AF260527.1|F260514S14[11228703]
[10525] 6447: AF260526
[10526] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 15
[10527] gi|11228702|gb|AF260526.1|F260514S13[11228702]
[10528] 6448: AF260525
[10529] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 14
[10530] gi|11228701|gb|AF260525.1|F260514S12[11228701]
[10531] 6449: AF260524
[10532] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exons 12 and 13
[10533] gi|11228700|gb|AF260524.1|F260514S11[11228700]
[10534] 6450: AF260523
[10535] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 11
[10536] gi|11228699|gb|AF260523.1|F260514S10[11228699]
[10537] 6451: AF260522
[10538] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 10
[10539] gi|11228698|gb|AF260522.1|F260514S09[11228698]
[10540] 6452: AF260521
[10541] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 9
[10542] 6453: AF260520
[10543] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 8
[10544] gi|11228696|gb|AF260520.1|F260514S07[11228696]
[10545] 6454: AF260519
[10546] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 7
[10547] gi|11228695|gb|AF260519.1|F260514S06[11228695]
[10548] 6455: AF260518
[10549] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 6
[10550] gi|11228694|gb|AF260518.1|F260514S05[11228694]
[10551] 6456: AF260517
[10552] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 5
[10553] gi|11228693|gb|AF260517.1|F260514S04[11228693]
[10554] 6457: AF260516
[10555] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 4
[10556] gi|11228692|gb|AF260516.1|F260514S03[11228692]
[10557] 6458: AF260515
[10558] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 3
[10559] gi|11228691|gb|AF260515.1|F260514S02[11228691]
[10560] 6459: AF260514
[10561] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 2
[10562] gi|11228690|gb|AF260514.1|F260514S01[11228690]
[10563] 6460: AH010001
[10564] Homo sapiens MER receptor tyrosine kinase (MERTK) gene, partial cds
[10565] gi|11228689|gb|AH010001.1|SEG_F260514S[11228689]
[10566] 6461: AF175406
[10567] Homo sapiens transient receptor potential 4 (TRP4) mRNA, complete cds
[10568] gi|5802614|gb|AF175406.1|AF175406[5802614]
[10569] 6462: NM—017416
[10570] Homo sapiens interleukin 1 receptor accessory protein-like 2 (IL1RAPL2), mRNA
[10571] gi|11225606|ref|NM—017416.1|[11225606]
[10572] 6463: AJ295237
[10573] Homo sapiens mRNA for neuronal nicotinic acetylcholine receptor subunit alpha 10
[10574] (NACHR alpha 10 gene)
[10575] gi|11182127|emb|AJ295237.1|HSA295237[11182127]
[10576] 6464: NM—004720
[10577] Homo sapiens endothelial differentiation, lysophosphatidic acid
[10578] G-protein-coupled receptor, 4 (EDG4), mRNA
[10579] gi|11038657|ref|NM—004720.3|[11038657]
[10580] 6465: AF298770
[10581] Homo sapiens Smac/DIABLO-S protein mRNA, complete cds
[10582] gi|107196531|gb|AF298770.1|AF298770[10719653]
[10583] 6562: NM—005226
[10584] Homo sapiens endothelial differentiation, sphingolipid G-protein-coupled receptor, 3 (EDG3), mRNA
[10585] gi|4885194|ref|NM—005226.1|[4885194]
[10586] 6563: NM—021803
[10587] Homo sapiens interleukin 21 (IL21), mRNA
[10588] gi|11141874|ref|NM—021803.1|[11141874]
[10589] 6564: NM—021798
[10590] Homo sapiens interleukin 21 receptor (IL21R), mRNA
[10591] gi|11141868|ref|NM—021798.1|[11141868]
[10592] 6565: AF307973
[10593] Homo sapiens histamine H4 receptor mRNA, complete cds
[10594] gi|11141732|gb|AF307973.1|AF307973[11141732]
[10595] 6566: X06026
[10596] Homo sapiens partial CD3G gene, exon 1 (and joined CDS)
[10597] gi|36809|emb|X06026.1|HSTCR3G1[36809]
[10598] 6567: AF200220
[10599] Homo sapiens FcRn alpha chain (FCGRT) gene, exons 5, 6, 7, and complete cds
[10600] gi|11138512|gb|AF200220.1|AF200219S2[11138512]
[10601] 6568: AF200219
[10602] Homo sapiens FcRn alpha chain (FCGRT) gene, exons 1 through 4
[10603] gi|11138511|gb|AF200219.1|AF200219S1[1113851l]
[10604] 6569: AH009974
[10605] Homo sapiens FcRn alpha chain (FCGRT) gene, exons 1 through 4
[10606] gi|11138510|gb|AH009974.1|SEG_AF200219S[11138510]
[10607] 6570: NM—017581
[10608] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 9 (CHRNA9), mRNA
[10609] gi|8923741|ref|NM—017581.1|[8923741]
[10610] 6571: AB040290
[10611] Homo sapiens RFRP mRNA for RFamide-related peptide precursor, complete cds
[10612] gi|11125707|dbj|AB040290.1|AB040290[11125707]
[10613] 6572: AB040104
[10614] Homo sapiens OT7T022 mRNA for RFamide-related peptide receptor, complete cds
[10615] gi|11125701|dbj|AB040104.1|AB040104[11125701]
[10616] 6598: AF308542
[10617] Homo sapiens clone ST1L_G11 immunoglobulin heavy chain mRNA, partial cds
[10618] gi|11119124|gb|AF308542.1|AF308542[11119124]
[10619] 6599: AJ271338
[10620] Homo sapiens IL1L1 gene for interleukin-1 like protein 1, exons 1-6
[10621] gi|6729586|emb|AJ271338.1|HSA271338[6729586]
[10622] 6600: AJ242738
[10623] Homo sapiens mRNA for interleukin-1-like protein 1 (IL1L1 gene) transcript 2
[10624] gi|6165335|emb|AJ242738.1|HSA242738[6165335]
[10625] 6601: AJ242737
[10626] Homo sapiens mRNA for interleukin-1-like protein-1 (IL1L gene), transcript 1
[10627] gi|6165333|emb|AJ242737.1|HSA242737[6165333]
[10628] 6602: NM—005508
[10629] Homo sapiens chemokine (C-C motif) receptor 4 (CCR4), mRNA
[10630] gi|5031626|ref|NM—005508.1|[5031626]
[10631] 6603: NM—005283
[10632] Homo sapiens chemokine (C motif) XC receptor 1 (CCXCR1), mRNA
[10633] gi|4885338|ref|NM—005283.1|[4885338]
[10634] 6604: AJ238419
[10635] Homo sapiens mRNA for HIV-specific T-cell receptor beta chain, clone R1, partial
[10636] gi|4691321|emb|AJ238419.1|HSA238419[4691321]
[10637] 6605: AJ238418
[10638] Homo sapiens mRNA for HIV-specific T-cell receptor beta chain, clone MA, partial
[10639] gi|4691319|emb|AJ238418.1|HSA238418[4691319]
[10640] 6606: AJ238417
[10641] Homo sapiens mRNA for HIV-specific T-cell receptor beta chain, clone HA, partial
[10642] gi|4691317|emb|AJ238417.1|HSA238417[4691317]
[10643] 6607: AJ238416
[10644] Homo sapiens mRNA for HIV-specific T-cell receptor alpha chain, clone R1, partial
[10645] gi|4691315|emb|AJ238416.1|HSA238416[4691315]
[10646] 6608: AJ238415
[10647] Homo sapiens mRNA for HIV-specific T-cell receptor alpha chain, clone MA, partial
[10648] gi|4691313|emb|AJ238415.1|HSA238415[4691313]
[10649] 6609: AJ238414
[10650] Homo sapiens mRNA for HIV-specific T-cell receptor alpha chain, clone HA, partial
[10651] gi|4691311|emb|AJ238414.1|HSA238414[4691311]
[10652] 6610: AF074042
[10653] AF074042 Human Homo sapiens genomic clone pTWB15.69 T7, genomic survey sequence
[10654] gi|3342086|gb|AF074042.1|AF074042[3342086]
[10655] 6611: AF074041
[10656] AF074041 Human Homo sapiens genomic clone pTWB15.69 SP6, genomic survey sequence
[10657] gi|3342085|gb|AF074041.1|AF074041[3342085]
[10658] 6612: AF074040
[10659] AF074040 Human Homo sapiens genomic clone pTWB15.53 T7, genomic survey sequence
[10660] gi|3342084|gb|AF074040.1|AF074040[3342084]
[10661] 6613: AF074039
[10662] AF074039 Human Homo sapiens genomic clone pTWB15.53 SP6, genomic survey sequence
[10663] gi|3342083|gb|AF074039.1|AF074039[3342083]
[10664] 6614: AF074038
[10665] AF074038 Human Homo sapiens genomic clone pTWB15.43 T7, genomic survey sequence
[10666] gi|3342082|gb|AF074038.1|AF074038[3342082]
[10667] 6615: AF074037
[10668] AF074037 Human Homo sapiens genomic clone pTWB15.43 SP6, genomic survey sequence
[10669] gi|3342081|gb|AF074037.1|AF074037[3342081]
[10670] 6616: AF074036
[10671] AF074036 Human Homo sapiens genomic clone pTWB15.42, genomic survey sequence
[10672] gi|3342080|gb|AF074036.1|AF074036[3342080]
[10673] 6617: AF074034
[10674] AF074034 Human Homo sapiens genomic clone pTWB15.32 T7, genomic survey sequence
[10675] gi|3342079|gb|AF074034.1|AF074034[3342079]
[10676] 6618: AF074033
[10677] AF074033 Human Homo sapiens genomic clone pTWB15.32 SP6, genomic survey sequence
[10678] gi|3342078|gb|AF074033.1|AF074033[3342078]
[10679] 6619: AF074032
[10680] AF074032 Human Homo sapiens genomic clone pTWB15.31 T7, genomic survey sequence
[10681] gi|3342077|gb|AF074032.1|AF074032[3342077]
[10682] 6620: AF074031
[10683] AF074031 Human Homo sapiens genomic clone pTWB15.31 SP6, genomic survey sequence
[10684] gi|3342076|gb|AF074031.1|AF074031[3342076]
[10685] 6621: AF074030
[10686] AF074030 Human Homo sapiens genomic clone pTWB15.28 T7, genomic survey sequence
[10687] gi|3342075|gb|AF074030.1|AF074030[3342075]
[10688] 6622: AF074028
[10689] AF074028 Human Homo sapiens genomic clone pTWB15.21, genomic survey sequence
[10690] gi|3342074|gb|AF074028.1|AF074028[3342074]
[10691] 6623: AF074027
[10692] AF074027 Human Homo sapiens genomic clone pTWB15.12, genomic survey sequence
[10693] gi|3342073|gb|AF074027.1|AF074027[3342073]
[10694] 6624: AF074026
[10695] AF074026 Human Homo sapiens genomic clone pTWB15.09, genomic survey sequence
[10696] gi|3342072|gb|AF074026.1|AF074026[3342072]
[10697] 6625: AF074025
[10698] AF074025 Human Homo sapiens genomic clone pTWB15.08, genomic survey sequence
[10699] gi|3342071|gb|AF074025.1|AF074025[3342071]
[10700] 6626: AF074024
[10701] AF074024 Human Homo sapiens genomic clone pTWB15.07, genomic survey sequence
[10702] gi|3342070|gb|AF074024.1|AF074024[3342070]
[10703] 6627: AF074023
[10704] AF074023 Human Homo sapiens genomic clone pTWB15.04, genomic survey sequence
[10705] gi|3342069|gb|AF074023.1|AF074023[3342069]
[10706] 6628: AF074022
[10707] AF074022 Human Homo sapiens genomic clone pTWB15.04 SP6, genomic survey sequence
[10708] gi|3342068|gb|AF074022.1|AF074022[3342068]
[10709] 6629: NM—000450
[10710] Homo sapiens selectin E (endothelial adhesion molecule 1) (SELE), mRNA
[10711] gi|4506870|ref|NM—000450.1|[4506870]
[10712] 6630: AF254069
[10713] Homo sapiens interleukin 21 (IL21) mRNA, complete cds
[10714] gi|11093535|gb|AF254069.1|AF254069[11093535]
[10715] 6631: AF254067
[10716] Homo sapiens interleukin 21 receptor (IL21R) mRNA, complete cds
[10717] gi|1093531|gb|AF254067.1|AF254067[11093531]
[10718] 6632: AF251510
[10719] Homo sapiens leukocyte-associated Ig-like receptor 1D isoform mRNA, complete cds
[10720] gi|1090865|gb|AF251510.2|AF251510[11090865]
[10721] 6633: AF251509
[10722] Homo sapiens leukocyte-associated Ig-like receptor 1C isoform mRNA, complete cds
[10723] gi|11090859|gb|AF251509.2|AF251509[11090859]
[10724] 6634: AB3043943
[10725] Homo sapiens GPVI gene for platelet glycoprotein VI, partial cds
[10726] gi|9955915|dbj|AB043943.1|AB043943[9955915]
[10727] 6635: AB043821
[10728] Homo sapiens GPVI mRNA for platelet glycoprotein VI-3, complete cds
[10729] gi|9955913|dbj|AB3043821.1|AB043821[9955913]
[10730] 6636: AB043820
[10731] Homo sapiens GPVI mRNA for platelet glycoprotein VI-2, complete cds
[10732] gi|9955911|dbj|AB043820.1|AB043820[9955911]
[10733] 6637: AB043819
[10734] Homo sapiens GPVI mRNA for platelet glycoprotein VI-1, complete cds
[10735] gi|9955909|dbj|AB043819.1|AB043819[9955909]
[10736] 6638: NM—000527
[10737] Homo sapiens low density lipoprotein receptor (familial hypercholesterolemia) (LDLR), mRNA
[10738] gi|8051613|ref|NM—000527.2|[8051613]
[10739] 6639: NM—012407
[10740] Homo sapiens protein kinase C, alpha binding protein (PRKCABP), mRNA
[10741] gi|7110696|ref|NM—012407.1|[7110696]
[10742] 6640: NM—005232
[10743] Homo sapiens EphA1 (EPHA1), mRNA
[10744] gi|4885208|ref|NM—005232.1|[4885208]
[10745] 6641: NM—000214
[10746] Homo sapiens jagged 1 (Alagille syndrome) (JAG1), mRNA
[10747] gi|4557678|ref|NM—000214.1|[4557678]
[10748] 6642: NM—000875
[10749] Homo sapiens insulin-like growth factor 1 receptor (IGF1R), mRNA
[10750] gi|11068002|ref|NM—000875.2|[11068002]
[10751] 6643: AF298812
[10752] Homo sapiens X-linked ectodysplasin-A2 receptor (XEDAR) mRNA, complete cds
[10753] gi|11066914|gb|AF298812.1|AF298812[11066914]
[10754] 6644: AF197929
[10755] Homo sapiens short form lysophosphatidic acid receptor EDG4 (EDG4) mRNA, complete cds
[10756] gi|11066253|gb|AF197929.1|AF197929[11066253]
[10757] 6645: NM—021642
[10758] Homo sapiens Fc fragment of IgG, low affinity IIa, receptor for (CD32) (FCGR2A),
[10759] mRNA
[10760] gi|11056051|ref|NM—021642.1|[11056051]
[10761] 6646: AF280400
[10762] Homo sapiens alpha 2C adrenergic receptor variant (ADRA2C) gene, complete cds
[10763] gi|11055420|gb|AF280400.1|AF280400[11055420]
[10764] 6647: AF280399
[10765] Homo sapiens alpha 2C adrenergic receptor (ADRA2C) gene, complete cds
[10766] gi|11055418|gb|AF280399.1|AF280399[11055418]
[10767] 6648: AF263523
[10768] Homo sapiens vanilloid receptor-related osmotically activated channel (VROAC) mRNA, complete cds
[10769] gi|11055321|gb|AF263523.1|AF263523[11055321]
[10770] 6649: NM—001117
[10771] Homo sapiens adenylate cyclase activating polypeptide 1 (pituitary) (ADCYAP1),
[10772] mRNA
[10773] gi|10947062|ref|NM—001117.2|[10947062]
[10774] 6650: NM—002355
[10775] Homo sapiens mannose-6-phosphate receptor (cation dependent) (M6PR), mRNA
[10776] gi|10947032|ref|NM—002355.2|[10947032]
[10777] 6651: NM—000541
[10778] Homo sapiens S-antigen; retina and pineal gland (arrestin) (SAG), mRNA
[10779] gi|10880124|ref|NM—000541.2|[10880124]
[10780] 6652: NM—021130
[10781] Homo sapiens peptidylprolyl isomerase A (cyclophilin A) (PPIA), mRNA
[10782] gi|10863926|ref|NM—021130.1|[10863926]
[10783] 6653: NM—001106
[10784] Homo sapiens activin A receptor, type IIB (ACVR2B), mRNA
[10785] gi|10862697|ref|NM—001106.2|[10862697]
[10786] 6654: NM—001616
[10787] Homo sapiens activin A receptor, type II (ACVR2), mRNA
[10788] gi|10862696|ref|NM—001616.2|[10862696]
[10789] 6655: NM—001105
[10790] Homo sapiens activin A receptor, type I (ACVR1), mRNA
[10791] gi|10862690|ref|NM—001105.2|[10862690]
[10792] 6656: NM—001136
[10793] Homo sapiens advanced glycosylation end product-specific receptor (AGER), mRNA
[10794] gi|10835202|ref|NM—001136.1|[10835202]
[10795] 6657: NM—000866
[10796] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1F (HTR1F), mRNA
[10797] gi|10835196|ref|NM—000866.1|[10835196]
[10798] 6658: NM—000629
[10799] Homo sapiens interferon (alpha, beta and omega) receptor 1 (IFNAR1), mRNA
[10800] gi|10835182|ref|NM—000629.1|[10835182]
[10801] 6659: NM—000621
[10802] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), mRNA
[10803] gi|10835174|ref|NM—000621.1|[10835174]
[10804] 6660: NM—000610
[10805] Homo sapiens CD44 antigen (homing function and Indian blood group system) (CD44), mRNA
[10806] gi|10835162|ref|NM—000610.1|[10835162]
[10807] 6661: NM—000585
[10808] Homo sapiens interleukin 15 (IL15), mRNA
[10809] gi|10835152|ref|NM—000585.1|[10835152]
[10810] 6662: NM—000586
[10811] Homo sapiens interleukin 2 (IL2), mRNA
[10812] gi|10835148|ref|NM—000586.1|[10835148]
[10813] 6663: NM—000577
[10814] Homo sapiens interleukin 1 receptor antagonist (IL1RN), mRNA
[10815] gi|10835146|ref|NM—000577.1|[10835146]
[10816] 6664: NM—000576
[10817] Homo sapiens interleukin 1, beta (IL1B), mRNA
[10818] gi|10835144|ref|NM—000576.1|[10835144]
[10819] 6665: NM—000570
[10820] Homo sapiens Fc fragment of IgG, low affinity 111b, receptor for (CD16) (FCGR3B), mRNA
[10821] gi|10835138|ref|NM—000570.1|[10835138]
[10822] 6666: NM—000566
[10823] Homo sapiens Fc fragment of IgG, high affinity Ia, receptor for (CD64) (FCGR1A),
[10824] mRNA
[10825] gi|10835132|ref|NM—000566.1|[10835132]
[10826] 6667: NM—000564
[10827] Homo sapiens interleukin 5 receptor, alpha (IL5RA), mRNA
[10828] gi|10835130|ref|NM—000564.1|[10835130]
[10829] 6668: NM—000525
[10830] Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 11
[10831] gi|10835116|ref|NM—000525.1|[10835116]
[10832] 6669: NM—003841
[10833] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain (TNFRSF10C), mRNA
[10834] gi|10835042|ref|NM—003841.1|[10835042]
[10835] 6672: NM—001307
[10836] Homo sapiens claudin 7 (CLDN7), mRNA
[10837] gi|10835007|ref|NM—001307.1[10835007]
[10838] 6673: NM—000640
[10839] Homo sapiens interleukin 13 receptor, alpha 2 (IL13RA2), mRNA
[10840] gi|10834991|ref|NM—000640.1|[10834991]
[10841] 6674: NM—001993
[10842] Homo sapiens coagulation factor III (thromboplastin, tissue factor) (F3), mRNA
[10843] gi|10518499|ref|NM—001993.2|[10518499]
[10844] 6675: NM—013252
[10845] Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin,
[10846] superfamily member 5 (CLECSF5), mRNA
[10847] gi|10281668|ref|NM—013252.1|[10281668]
[10848] 6676: NM—020547
[10849] Homo sapiens anti-Mullerian hormone receptor, type II (AMHR2), mRNA
[10850] gi|10198655|ref|NM—020547.1|[10198655]
[10851] 6677: NM—018970
[10852] Homo sapiens G protein-coupled receptor 85 (GPR85), mRNA
[10853] gi|10190654|ref|NM—018970.2|[10190654]
[10854] 6678: NM—014292
[10855] Homo sapiens chromobox homolog 6 (CBX6), mRNA
[10856] gi|10140848|ref|NM—014292.1|[10140848]
[10857] 6679: NM—019897
[10858] Homo sapiens olfactory receptor, family 2, subfamily S, member 2 (OR2S2), mRNA
[10859] gi|10092668|ref|NM—019897.1|[10092668]
[10860] 6680: NM—014499
[10861] Homo sapiens putative purinergic receptor (P2Y10), mRNA
[10862] gi|10092632|ref|NM—014499.1|[10092632]
[10863] 6681: NM—017572
[10864] Homo sapiens G protein-coupled receptor kinase 7 (GPRK7), mRNA
[10865] gi|9994196|ref|NM—017572.1|[9994196]
[10866] 6682: NM—020406
[10867] Homo sapiens polycythemia rubra vera 1; cell surface receptor (PRV1), mRNA
[10868] gi|9966888|ref|NM—020406.1|[9966888]
[10869] 6683: NM—020377
[10870] Homo sapiens cysteinyl leukotriene CysLT2 receptor; cDNA: PSEC0146 from clone PLACE1006979 (LOC57105), mRNA
[10871] gi|9966850|ref|NM—020377.1|[9966850]
[10872] 6686: NM—002295
[10873] Homo sapiens laminin receptor 1 (67 kD, ribosomal protein SA) (LAMR1), mRNA
[10874] gi|9845501|ref|NM—002295.2|[9845501]
[10875] 6687: NM—019839
[10876] Homo sapiens seven transmembrane receptor BLTR2; leukotriene B4 receptor BLT2 (BLTR2), mRNA
[10877] gi|9789896|ref|NM—019839.1|[9789896]
[10878] 6688: NM—018969
[10879] Homo sapiens super conserved receptor expressed in brain 3 (SREB3), mRNA
[10880] gi|9507142|ref|NM—018969.1|[9507142]
[10881] 6689: NM—018949
[10882] Homo sapiens G protein-coupled receptor 14 (GPR14), mRNA
[10883] gi|9506744|ref|NM—018949.1|[9506744]
[10884] 6690: NM—000804
[10885] Homo sapiens folate receptor 3 (gamma) (FOLR3), mRNA
[10886] gi|9257219|ref|NM—000804.2|[9257219]
[10887] 6691: NM—000803
[10888] Homo sapiens folate receptor 2 (fetal) (FOLR2), mRNA
[10889] gi|9257218|ref|NM—000803.2|[9257218]
[10890] 6692: NM—017526
[10891] Homo sapiens leptin receptor gene-related protein (HSOBRGRP), mRNA
[10892] gi|8923784|ref|NM—017526.1|[8923784]
[10893] 6693: NM—017532
[10894] Homo sapiens p65 protein (HSAJ2425), mRNA
[10895] gi|8923776|ref|NM—017532.1|[8923776]
[10896] 6694: NM—017442
[10897] Homo sapiens toll-like receptor 9 (TLR9), mRNA
[10898] gi|8394455|ref|NM—017442.1|[8394455]
[10899] 6695: NM—016946
[10900] Homo sapiens junctional adhesion molecule (JAM), mRNA
[10901] gi|8393637|ref|NM—016946.1|[8393637]
[10902] 6697: NM—013280
[10903] Homo sapiens fibronectin leucine rich transmembrane protein 1 (FLRT1), mRNA
[10904] gi|8051591|ref|NM—013280.2|[8051591]
[10905] 6698: NM—013431
[10906] Homo sapiens killer cell lectin-like receptor subfamily C, member 4 (KLRC4), mRNA
[10907] gi|7710123|ref|NM—013431.1|[7710123]
[10908] 6699: NM—016568
[10909] Homo sapiens G-protein coupled receptor SALPR; somatostatin and angiotensin-like
[10910] peptide receptor (LOC51289), mRNA
[10911] gi|7706102|ref|NM—016568.1|[7706102]
[10912] 6700: NM—015863
[10913] Homo sapiens surfactant protein B (LOC51041), mRNA
[10914] gi|7705659|ref|NM—015863.1|[7705659]
[10915] 6702: NM—015868
[10916] Homo sapiens NK-receptor (KIR-023 GB), mRNA
[10917] gi|7705567|ref|NM—015868.1|[7705567]
[10918] 6703: NM—016540
[10919] Homo sapiens G protein-coupled receptor 72 (GPR72), mRNA
[10920] gi|7705384|ref|NM—016540.1|[7705384]
[10921] 6704: NM—001059
[10922] Homo sapiens tachykinin receptor 3 (TACR3), mRNA
[10923] gi|7669547|ref|NM—001059.1|[7669547]
[10924] 6705: NM—014030
[10925] Homo sapiens G protein-coupled receptor kinase-interactor 1 (GIT1), mRNA
[10926] gi|7661711|ref|NM—014030.1|[7661711]
[10927] 6706: NM—014521
[10928] Homo sapiens SH3-domain binding protein 4 (SH3BP4), mRNA
[10929] gi|7657561|ref|NM—014521.1|[7657561]
[10930] 6707: NM—014285
[10931] Homo sapiens homolog of Yeast RRP4 (ribosomal RNA processing 4), 3′-5′-exoribonuclease (RRP4), mRNA
[10932] gi|7657527|ref|NM—014285.1|[7657527]
[10933] 6708: NM—014566
[10934] Homo sapiens olfactory receptor, family 1, subfamily D, member 5 (OR1D5), mRNA
[10935] gi|7657422|ref|NM—014566.1|[7657422]
[10936] 6709: NM—014565
[10937] Homo sapiens olfactory receptor, family 1, subfamily A, member 1 (OR1A1), mRNA
[10938] gi|7657420|ref|NM—014565.1|[7657420]
[10939] 6710: NM—014221
[10940] Homo sapiens mature T-cell proliferation 1 (MTCP1), mRNA
[10941] gi|7657348|ref|NM—014221.1|[7657348]
[10942] 6711: NM—014387
[10943] Homo sapiens linker for activation of T cells (LAT), mRNA
[10944] gi|7657292|ref|NM—014387.1|[7657292]
[10945] 6712: NM—014514
[10946] Homo sapiens killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 (KIR3D51), mRNA
[10947] gi|7657280|ref|NM—014514.1|[7657280]
[10948] 6713: NM—014513
[10949] Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 (KIR2D55), mRNA
[10950] gi|7657278|ref|NM—014513.1|[7657278]
[10951] 6714: NM—014512
[10952] Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 1 (KIR2D51), mRNA
[10953] gi|7657276|ref|NM—014512.1|[7657276]
[10954] 6715: NM—014511
[10955] Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 (KIR2DL3), mRNA
[10956] gi|7657274|ref|NM—014511.1|[7657274]
[10957] 6716: NM—014219
[10958] Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2 (KIR2DL2), mRNA
[10959] gi|7657272|ref|NM—014219.1|[7657272]
[10960] 6717: NM—014218
[10961] Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 (KIR2DL1), mRNA
[10962] gi|7657270|ref|NM—014218.1|[7657270]
[10963] 6718: NM—014271
[10964] Homo sapiens interleukin 1 receptor accessory protein-like 1 (IL1RAPL1), mRNA
[10965] gi|7657231|ref|NM—014271.1|[7657231]
[10966] 6719: NM—014339
[10967] Homo sapiens interleukin 17 receptor (IL17R), mRNA
[10968] gi|7657229|ref|NM—014339.1|[7657229]
[10969] 6720: NM—014619
[10970] Homo sapiens glutamate receptor, ionotropic, kainate 4 (GRIK4), mRNA
[10971] gi|7657143|ref|NM—014619.1|[7657143]
[10972] 6721: NM—014626
[10973] Homo sapiens G protein-coupled receptor 58 (GPR58), mRNA
[10974] gi|7657141|ref|NM—014626.1|[7657141]
[10975] 6722: NM—014627
[10976] Homo sapiens G protein-coupled receptor 57 (GPR57), mRNA
[10977] gi|7657139|ref|NM—014627.1|[7657139]
[10978] 6723: NM—014373
[10979] Homo sapiens putative G protein-coupled receptor (GPCR150), mRNA
[10980] gi|7657135|ref|NM—014373.1|[7657135]
[10981] 6724: NM—005529
[10982] Homo sapiens heparan sulfate proteoglycan 2 (perlecan) (HSPG2), mRNA
[10983] gi|7427516|ref|NM—005529.2|[7427516]
[10984] 6727: NM—005415
[10985] Homo sapiens solute carrier family 20 (phosphate transporter), member 1 (SLC20A1), mRNA
[10986] gi|7382462|ref|NM—005415.2|[7382462]
[10987] 6728: NM—005199
[10988] Homo sapiens cholinergic receptor, nicotinic, gamma polypeptide (CHRNG), mRNA
[10989] gi|7382453|ref|NM—005199.3|[7382453]
[10990] 6729: NM—013940
[10991] Homo sapiens olfactory receptor, family 10, subfamily H, member 1 (OR10H1), mRNA
[10992] gi|7363438|ref|NM—013940.1|[7363438]
[10993] 6730: NM—013440
[10994] Homo sapiens paired immunoglobulin-like receptor beta (PILR(BETA)), mRNA
[10995] gi|7305386|ref|NM—013440.1|[7305386]
[10996] 6731: NM—013439
[10997] Homo sapiens paired immunoglobulin-like receptor alpha (PILR(ALPHA)), mRNA
[10998] gi|7305384|ref|NM—013439.1|[7305384]
[10999] 6732: NM—002260
[11000] Homo sapiens killer cell lectin-like receptor subfamily C, member 2 (KLRC2), mRNA
[11001] gi|7108353|ref|NM—002260.2|[7108353]
[11002] 6733: NM—012125
[11003] Homo sapiens cholinergic receptor, muscarinic 5 (CHRM5), mRNA
[11004] gi|7108335|ref|NM—012125.1|[7108335]
[11005] 6734: NM—013378
[11006] Homo sapiens pre-B lymphocyte gene 3 (VPREB3), mRNA
[11007] gi|7019566|ref|NM—013378.1|[7019566]
[11008] 6735: NM—013261
[11009] Homo sapiens peroxisome proliferative activated receptor, gamma, coactivator (PPARGC1), mRNA
[11010] gi|7019498|ref|NM—013261.1|[7019498]
[11011] 6736: NM—013269
[11012] Homo sapiens lectin-like NK cell receptor (LLT1), mRNA
[11013] gi|7019446|ref|NM—013269.1|[7019446]
[11014] 6737: NM—013289
[11015] Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 (KIR3DL1), mRNA
[11016] gi|7019440|ref|NM—013289.1|[7019440]
[11017] 6738: NM—013281
[11018] Homo sapiens fibronectin leucine rich transmembrane protein 3 (FLRT3), mRNA
[11019] gi|7019382|ref|NM—013281.1|[7019382]
[11020] 6739: NM—013231
[11021] Homo sapiens fibronectin leucine rich transmembrane protein 2 (FLRT2), mRNA
[11022] gi|7019380|ref|NM—013231.1|[7019380]
[11023] 6740: NM—012410
[11024] Homo sapiens type I transmembrane receptor (seizure-related protein) (PSK-1), mRNA
[11025] gi|6912611|ref|NM—012410.1|[6912611]
[11026] 6741: NM—012391
[11027] Homo sapiens prostate epithelium-specific Ets transcription factor (PDEF), mRNA
[11028] gi|6912579|ref|NM—012391.1|[6912579]
[11029] 6742: NM—012375
[11030] Homo sapiens olfactory receptor, family 52, subfamily A, member 1 (OR52A1), mRNA
[11031] gi|6912559|ref|NM—012375.1|[6912559]
[11032] 6743: NM—012368
[11033] Homo sapiens olfactory receptor, family 2, subfamily C, member 1 (OR2C1), mRNA
[11034] gi|6912555|ref|NM—012368.1|[6912555]
[11035] 6744: NM—012360
[11036] Homo sapiens olfactory receptor, family 1, subfamily F, member 8 (OR1F8), mRNA
[11037] gi|6912553|ref|NM—012360.1|[6912553]
[11038] 6745: NM—012352
[11039] Homo sapiens olfactory receptor, family 1, subfamily A, member 2 (OR1A2), mRNA
[11040] gi|6912551|ref|NM—012352.1|[6912551]
[11041] 6746: NM—012351
[11042] Homo sapiens olfactory receptor, family 10, subfamily J, member 1 (OR10J1), mRNA
[11043] gi|6912549|ref|NM—012351.1|[6912549]
[11044] 6747: NM—012344
[11045] Homo sapiens neurotensin receptor 2 (NTSR2), mRNA
[11046] gi|6912537|ref|NM—012344.1|[6912537]
[11047] 6748: NM—012314
[11048] Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2D54), mRNA
[11049] gi|6912475|ref|NM—012314.1|[6912475]
[11050] 6749: NM—012313
[11051] Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 3 (KIR2D53), mRNA
[11052] gi|6912473|ref|NM—012313.1|[6912473]
[11053] 6750: NM—012312
[11054] Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 (KIR2D52), mRNA
[11055] gi|6912471|ref|NM—012312.1|[6912471]
[11056] 6751: NM—012211
[11057] Homo sapiens integrin, alpha 11 (ITGA11), mRNA
[11058] gi|6912435|ref|NM—012211.1|[6912435]
[11059] 6752: NM—012275
[11060] Homo sapiens interleukin-1 receptor antagonist homolog 1 (IL1HY1), mRNA
[11061] gi|6912431|ref|NM—012275.1|[6912431]
[11062] 6753: NM—004525
[11063] Homo sapiens low density lipoprotein-related protein 2 (LRP2), mRNA
[11064] gi|6806918|ref|NM—004525.1|[6806918]
[11065] 6754: NM—004304
[11066] Homo sapiens anaplastic lymphoma kinase (Ki-1) (ALK), mRNA
[11067] gi|6715586|ref|NM—004304.2|[6715586]
[11068] 6755: NM—000686
[11069] Homo sapiens angiotensin receptor 2 (AGTR2), mRNA
[11070] gi|6715584|ref|NM—000686.2|[6715584]
[11071] 6756: NM—007366
[11072] Homo sapiens phospholipase A2 receptor 1, 180 kD (PLA2R1), mRNA
[11073] gi|6679370|ref|NM—007366.1|[6679370]
[11074] 6757: NM—005385
[11075] Homo sapiens natural killer-tumor recognition sequence (NKTR), mRNA
[11076] gi|6631099|ref|NM—005385.2|[6631099]
[11077] 6758: NM—005266
[11078] Homo sapiens gap junction protein, alpha 5, 40 kD (connexin 40) (GJA5), mRNA
[11079] gi|6631082|ref|NM—005266.2|[6631082]
[11080] 6759: NM—000827
[11081] Homo sapiens glutamate receptor, ionotropic, AMPA 1 (GRIA1), mRNA
[11082] gi|6552333|ref|NM—000827.21[6552333]
[11083] 6760: NM—001619
[11084] Homo sapiens adrenergic, beta, receptor kinase 1 (ADRBK1), mRNA
[11085] gi|6138971|ref|NM—001619.2|[6138971]
[11086] 6761: NM—000810
[11087] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 5 (GABRA5), mRNA
[11088] gi|6031207|ref|NM—000810.2|[6031207]
[11089] 6762: NM—003006
[11090] Homo sapiens selectin P ligand (SELPLG), mRNA
[11091] gi|6031197|ref|NM—003006.2|[6031197]
[11092] 6763: NM—001480
[11093] Homo sapiens galanin receptor 1 (GALR1), mRNA
[11094] gi|6031165|ref|NM—001480.21[6031165]
[11095] 6764: NM—001992
[11096] Homo sapiens coagulation factor II (thrombin) receptor (F2R), mRNA
[11097] gi|6031164|ref|NM—001992.2|[6031164]
[11098] 6765: NM—000677
[11099] Homo sapiens adenosine A3 receptor (ADORA3), mRNA
[11100] gi|6031156|ref|NM—000677.21[6031156]
[11101] 6766: NM—001526
[11102] Homo sapiens hypocretin (orexin) receptor 2 (HCRTR2), mRNA
[11103] gi|6006037|ref|NM—001526.2|[6006037]
[11104] 6767: NM—000885
[11105] Homo sapiens integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) (ITGA4), mRNA
[11106] gi|6006032|ref|NM—000885.2|[6006032]
[11107] 6768: NM—002377
[11108] Homo sapiens MAS1 oncogene (MAS1), mRNA
[11109] gi|6006022|ref|NM—002377.21[6006022]
[11110] 6769: NM—000887
[11111] Homo sapiens integrin, alpha X (antigen CD11C (p150), alpha polypeptide) (ITGAX), mRNA
[11112] gi|6006014|ref|NM—000887.2|[6006014]
[11113] 6770: NM—000419
[11114] Homo sapiens integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex,
[11115] antigen CD41B) (ITGA2B), mRNA
[11116] gi|6006009|ref|NM—000419.2|[6006009]
[11117] 6771: NM—002203
[11118] Homo sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA
[11119] gi|6006008|ref|NM—002203.21[6006008]
[11120] 6772: NM—000843
[11121] Homo sapiens glutamate receptor, metabotropic 6 (GRM6), mRNA
[11122] gi|6006006|ref|NM—000843.2|[6006006]
[11123] 6773: NM—000838
[11124] Homo sapiens glutamate receptor, metabotropic 1 (GRM1), mRNA
[11125] gi|6006005|ref|NM—000838.2|[6006005]
[11126] 6774: NM—000835
[11127] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2C (GRIN2C),
[11128] mRNA
[11129] gi|6006004|ref|NM—000835.2|[6006004]
[11130] 6775: NM—000834
[11131] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B),
[11132] mRNA
[11133] gi|6006003|ref|NM—000834.2|[6006003]
[11134] 6776: NM—000833
[11135] Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A),
[11136] mRNA
[11137] gi|6006002|ref|NM—000833.2|[6006002]
[11138] 6777: NM—007155
[11139] Homo sapiens zona pellucida glycoprotein 3A (sperm receptor) (ZP3A), mRNA
[11140] gi|6005983|ref|NM—007155.1|[6005983]
[11141] 6778: NM—007124
[11142] Homo sapiens utrophin (homologous to dystrophin) (UTRN), mRNA
[11143] gi|6005937|ref|NM—007124.1|[6005937]
[11144] 6779: NM—007114
[11145] Homo sapiens TATA element modulatory factor 1 (TMF1), mRNA
[11146] gi|6005903|ref|NM—007114.1|[6005903]
[11147] 6780: NM—007273
[11148] Homo sapiens B-cell associated protein (REA), mRNA
[11149] gi|6005853|ref|NM—007273.1|[6005853]
[11150] 6781: NM—007160
[11151] Homo sapiens olfactory receptor, family 2, subfamily H, mer-er 3 (OR2H3), mRNA
[11152] gi|6005821|ref|NM—007160.1|[6005821]
[11153] 6782: NM—007227
[11154] Homo sapiens G protein-coupled receptor 45 (GPR45), mRNA
[11155] gi|6005769|ref|NM—007227.1|[6005769]
[11156] 6783: NM—006934
[11157] Homo sapiens solute carrier family 6 (neurotransmitter transporter, glycine), member 9 (SLC6A9), mRNA
[11158] gi|5902093|ref|NM—006934.1|[5902093]
[11159] 6785: NM—007011
[11160] Homo sapiens putative transmembrane protein (HS1-2), mRNA
[11161] gi|5901977|ref|NM—007011.1|[5901977]
[11162] 6786: NM—007045
[11163] Homo sapiens FGFR1 oncogene partner (FOP), mRNA
[11164] gi|5901953|ref|NM—007045.1|[5901953]
[11165] 6787: NM—006889
[11166] Homo sapiens CD86 antigen (CD28 antigen ligand 2, B7-2 antigen) (CD86), mRNA
[11167] gi|5901919|ref|NM—006889.1|[5901919]
[11168] 6788: NM—006749
[11169] Homo sapiens solute carrier family 20 (phosphate transporter), member 2 (SLC20A2), mRNA
[11170] gi|5803172|ref|NM—006749.1|[5803172]
[11171] 6789: NM—006770
[11172] Homo sapiens macrophage receptor with collagenous structure (MARCO), mRNA
[11173] gi|5803079|ref|NM—006770.1|[5803079]
[11174] 6790: NM—006840
[11175] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 (LILRB5), mRNA
[11176] gi|5803069|ref|NM—006840.1|[5803069]
[11177] 6791: NM—006866
[11178] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 (LILRA2), mRNA
[11179] gi|5803067|ref|NM—006866.1|[5803067]
[11180] 6792: NM—006863
[11181] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1 (LILRA1), mRNA
[11182] gi|5803065|ref|NM—006863.1|[583065]
[11183] 6793: NM—006847
[11184] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 (LILRB4), mRNA
[11185] gi|5803063|ref|NM—006847.1|[5803063]
[11186] 6794: NM—006865
[11187] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 (LILRA3), mRNA
[11188] gi|5803061|ref|NM—006865.1|[5803061]
[11189] 6795: NM—006864
[11190] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 (LILRB3), mRNA
[11191] gi|5803059|ref|NM—006864.1|[5803059]
[11192] 6796: NM—006738
[11193] Homo sapiens lymphoid blast crisis oncogene (LBC), mRNA
[11194] gi|5803057|ref|NM—006738.1|[5803057]
[11195] 6797: NM—006737
[11196] Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), mRNA
[11197] gi|5803051|ref|NM—006737.1|[5803051]
[11198] 6799: NM—006564
[11199] Homo sapiens G protein-coupled receptor (TYMSTR), mRNA
[11200] gi|5730105|ref|NM—006564.1|[5730105]
[11201] 6800: NM—001561
[11202] Homo sapiens tumor necrosis factor receptor superfamily, member 9 (TNFRSF9), mRNA
[11203] gi|5730094|ref|NM—001561.2|[5730094]
[11204] 6801: NM—006664
[11205] Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 27 (SCYA27),
[11206] mRNA
[11207] gi|5730034|ref|NM—006664.1|[5730034]
[11208] 6802: NM—006583
[11209] Homo sapiens retinal pigment epithelium-derived rhodopsin homolog (RRH), mRNA
[11210] gi|5730018|ref|NM—006583.1|[5730018]
[11211] 6803: NM—006505
[11212] Homo sapiens poliovirus receptor (PVR), mRNA
[11213] gi|5729994ref|NM—006505.1|[5729994]
[11214] 6804: NM—006637
[11215] Homo sapiens olfactory receptor, family 5, subfamily I, member 1 (OR5I1), mRNA
[11216] gi|5729959|ref|NM—006637.1|[5729959]
[11217] 6805: NM—006669
[11218] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 (LILRB1), mRNA
[11219] gi|5729926|ref|NM—006669.1|[5729926]
[11220] 6806: NM—006611
[11221] Homo sapiens killer cell lectin-like receptor subfamily A, member 1 (KLRA1), mRNA
[11222] gi|5729898|ref|NM—006611.1|[5729898]
[11223] 6807: NM—006496
[11224] Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 (GNA13), mRNA
[11225] gi|5729849|ref|NM—006496.1|[5729849]
[11226] 6808: NM—006529
[11227] Homo sapiens glycine receptor, alpha 3 (GLRA3), mRNA
[11228] gi|5729843|ref|NM—006529.1|[5729843]
[11229] 6809: NM—006639
[11230] Homo sapiens cysteinyl leukotriene receptor 1 (CYSLT1), mRNA
[11231] gi|5729797|ref|NM—006639.1|[5729797]
[11232] 6810: NM—006293
[11233] Homo sapiens TYRO3 protein tyrosine kinase (TYRO3), mRNA
[11234] gi|5454141|ref|NM—006293.1|[5454141]
[11235] 6813: NM—006238
[11236] Homo sapiens peroxisome proliferative activated receptor, delta (PPARD), mRNA
[11237] gi|5453939|ref|NM—006238.1|[5453939]
[11238] 6814: NM—006189
[11239] Homo sapiens olfactory marker protein (OMP), mRNA
[11240] gi|5453827|ref|NM—006189.1|[5453827]
[11241] 6815: NM—006182
[11242] Homo sapiens discoidin domain receptor family, member 2 (DDR2), mRNA
[11243] gi|5453813|ref|NM—006182.1|[5453813]
[11244] 6816: NM—006180
[11245] Homo sapiens neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), mRNA
[11246] gi|5453811|ref|NM—006180.1|[5453811]
[11247] 6817: NM—006403
[11248] Homo sapiens enhancer of filamentation 1 (cas-like docking; Crk-associated substrate related) (HEF1), mRNA
[11249] gi|5453679|ref|NM—006403.1|[5453679]
[11250] 6818: NM—006143
[11251] Homo sapiens G protein-coupled receptor 19 (GPR19), mRNA
[11252] gi|5453665|ref|NM—006143.1|[5453665]
[11253] 6819: NM—006404
[11254] Homo sapiens protein C receptor, endothelial (EPCR) (PROCR), mRNA
[11255] gi|5453645|ref|NM—006404.1|[5453645]
[11256] 6820: NM—006419
[11257] Homo sapiens small inducible cytokine B subfamily (Cys-X-Cys motif), member (B-cell chemoattractant) (SCYB13), mRNA
[11258] gi|5453576|ref|NM—006419.1|[5453576]
[11259] 6821: NM—005954
[11260] Homo sapiens metallothionein 3 (growth inhibitory factor (neurotrophic)) (MT3),
[11261] mRNA
[11262] gi|5174761|ref|NM—005954.1|[5174761]
[11263] 6822: NM—006006
[11264] Homo sapiens zinc finger protein 145 (Kruppel-like, expressed in promyelocytic
[11265] leukemia) (ZNF145), mRNA
[11266] gi|5174752|ref|NM—006006.1|[5174752]
[11267] 6823: NM—006072
[11268] Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 26 (SCYA26),
[11269] mRNA
[11270] gi|5174670|ref|NM—006072.1|[5174670]
[11271] 6824: NM—005972
[11272] Homo sapiens pancreatic polypeptide receptor 1 (PPYR1), mRNA
[11273] gi|5174638|ref|NM—005972.1|[5174638]
[11274] 6825: NM—005913
[11275] Homo sapiens melanocortin 5 receptor (MC5R), mRNA
[11276] gi|5174534|ref|NM—005913.1|[5174534]
[11277] 6826: NM—005912
[11278] Homo sapiens melanocortin 4 receptor (MC4R), mRNA
[11279] gi|5174532|ref|NM—005912.1|[5174532]
[11280] 6827: NM—006028
[11281] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 3B (HTR3B), mRNA
[11282] gi|5174468|ref|NM—006028.1|[5174468]
[11283] 6828: NM—005628
[11284] Homo sapiens solute carrier family 1 (neutral amino acid transporter), member 5
[11285] (SLC1A5), mRNA
[11286] gi|5032092|ref|NM—005628.1|[5032092]
[11287] 6829: NM—005767
[11288] Homo sapiens purinergic receptor (family A group 5) (P2Y5), mRNA
[11289] gi|5031968|ref|NM—005767.1|[5031968]
[11290] 6830: NM—005592
[11291] Homo sapiens muscle, skeletal, receptor tyrosine kinase (MUSK), mRNA
[11292] gi|5031926|ref|NM—005592.1|[5031926]
[11293] 6831: NM—005874
[11294] Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), mRNA
[11295] gi|5031910|ref|NM—005874.1|[5031910]
[11296] 6832: NM—005810
[11297] Homo sapiens killer cell lectin-like receptor subfamily G, member 1 (KLRG1), mRNA
[11298] gi|5031900|ref|NM—005810.1|[5031900]
[11299] 6833: NM—005544
[11300] Homo sapiens insulin receptor substrate 1 (IRS1), mRNA
[11301] gi|5031804|ref|NM—005544.1|[5031804]
[11302] 6834: NM—005535
[11303] Homo sapiens interleukin 12 receptor, beta 1 (IL12RB1), mRNA
[11304] gi|5031784|ref|NM—005535.1|[5031784]
[11305] 6835: NM—005683
[11306] Homo sapiens G protein-coupled receptor 55 (GPR55), mRNA
[11307] gi|5031722|ref|NM—005683.1|[5031722]
[11308] 6836: NM—005684
[11309] Homo sapiens G protein-coupled receptor 52 (GPR52), mRNA
[11310] gi|5031720|ref|NM—005684.1|[5031720]
[11311] 6837: NM—001621
[11312] Homo sapiens aryl hydrocarbon receptor (AHR), mRNA
[11313] gi|5016091|ref|NM—001621.2|[5016091]
[11314] 6838: NM—005429
[11315] Homo sapiens vascular endothelial growth factor C (VEGFC), mRNA
[11316] gi|4885652|ref|NM—005429.1|[4885652]
[11317] 6839: NM—005424
[11318] Homo sapiens tyrosine kinase with immunoglobulin and epidermal growth factor homology domains (TIE), mRNA
[11319] gi|4885630|ref|NM—005424.1|[4885630]
[11320] 6840: NM—005408
[11321] Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 13 (SCYA13),
[11322] mRNA
[11323] gi|4885586|ref|NM—005408.1|[4885586]
[11324] 6841: NM—005328
[11325] Homo sapiens hyaluronan synthase 2 (HAS2), mRNA
[11326] gi|4885390|ref|NM—005328.1|[4885390]
[11327] 6842: NM—005314
[11328] Homo sapiens gastrin-releasing peptide receptor (GRPR), mRNA
[11329] gi|4885360|ref|NM—005314.1|[4885360]
[11330] 6843: NM—005311
[11331] Homo sapiens growth factor receptor-bound protein 10 (GRB10), mRNA
[11332] gi|4885352|ref|NM—005311.1|[4885352]
[11333] 6844: NM—005308
[11334] Homo sapiens G protein-coupled receptor kinase 5 (GPRK5), mRNA
[11335] gi|4885348|ref|NM—005308.1|[4885348]
[11336] 6845: NM—005286
[11337] Homo sapiens G protein-coupled receptor 8 (GPR8), mRNA
[11338] gi|4885344|ref|NM—005286.1|[4885344]
[11339] 6846: NM—005285
[11340] Homo sapiens G protein-coupled receptor 7 (GPR7), mRNA
[11341] gi|4885342|ref|NM—005285.1|[4885342]
[11342] 6847: NM—005284
[11343] Homo sapiens G protein-coupled receptor 6 (GPR6), mRNA
[11344] gi|4885340|ref|NM—005284.1|[4885340]
[11345] 6848: NM—005458
[11346] Homo sapiens G protein-coupled receptor 51 (GPR51), mRNA
[11347] gi|4885336|ref|NM—005458.1|[4885336]
[11348] 6849: NM—005282
[11349] Homo sapiens G protein-coupled receptor 4 (GPR4), mRNA
[11350] gi|4885334|ref|NM—005282.1|[4885334]
[11351] 6850: NM—005306
[11352] Homo sapiens G protein-coupled receptor 43 (GPR43), mRNA
[11353] gi|4885332|ref|NM—005306.1|[4885332]
[11354] 6851: NM—005305
[11355] Homo sapiens G protein-coupled receptor 42 (GPR42), mRNA
[11356] gi|4885330|ref|NM—005305.1|[4885330]
[11357] 6852: NM—005304
[11358] Homo sapiens G protein-coupled receptor 41 (GPR41), mRNA
[11359] gi|4885328|ref|NM—005304.1|[4885328]
[11360] 6853: NM—005303
[11361] Homo sapiens G protein-coupled receptor 40 (GPR40), mRNA
[11362] gi|4885326|ref|NM—005303.1|[4885326]
[11363] 6854: NM—005281
[11364] Homo sapiens G protein-coupled receptor 3 (GPR3), mRNA
[11365] gi|4885324|ref|NM—005281.1|[4885324]
[11366] 6855: NM—005302
[11367] Homo sapiens G protein-coupled receptor 37 (endothelin receptor type B-like) (GPR37), mRNA
[11368] gi|4885322|ref|NM—005302.1|[4885322]
[11369] 6856: NM—005301
[11370] Homo sapiens G protein-coupled receptor 35 (GPR35), mRNA
[11371] gi|4885320|ref|NM—005301.1|[4885320]
[11372] 6857: NM—005300
[11373] Homo sapiens G protein-coupled receptor 34 (GPR34), mRNA
[11374] gi|4885318|ref|NM—005300.1|[4885318]
[11375] 6858: NM—005299
[11376] Homo sapiens G protein-coupled receptor 31 (GPR31), mRNA
[11377] gi|4885316|ref|NM—005299.1|[4885316]
[11378] 6859: NM—005298
[11379] Homo sapiens G protein-coupled receptor 25 (GPR25), mRNA
[11380] gi|4885314|ref|NM—005298.1|[4885314]
[11381] 6860: NM—005297
[11382] Homo sapiens G protein-coupled receptor 24 (GPR24), mRNA
[11383] gi|4885312|ref|NM—005297.1|[4885312]
[11384] 6861: NM—005296
[11385] Homo sapiens G protein-coupled receptor 23 (GPR23), mRNA
[11386] gi|4885310|ref|NM—005296.1|[4885310]
[11387] 6862: NM—005295
[11388] Homo sapiens G protein-coupled receptor 22 (GPR22), mRNA
[11389] gi|4885308|ref|NM—005295.1|[4885308]
[11390] 6863: NM—005294
[11391] Homo sapiens G protein-coupled receptor 21 (GPR21), mRNA
[11392] gi|4885306|ref|NM—005294.1|[4885306]
[11393] 6864: NM—005293
[11394] Homo sapiens G protein-coupled receptor 20 (GPR20), mRNA
[11395] gi|4885304|ref|NM—005293.1|[4885304]
[11396] 6865: NM—005279
[11397] Homo sapiens G protein-coupled receptor 1 (GPR1), mRNA
[11398] gi|4885302|ref|NM—005279.1|[4885302]
[11399] 6866: NM—005291
[11400] Homo sapiens G protein-coupled receptor 17 (GPR17), mRNA
[11401] gi|4885300|ref|NM—005291.1|[4885300]
[11402] 6867: NM—005290
[11403] Homo sapiens G protein-coupled receptor 15 (GPR15), mRNA
[11404] gi|4885298|ref|NM—005290.1|[4885298]
[11405] 6868: NM—005288
[11406] Homo sapiens G protein-coupled receptor 12 (GPR12), mRNA
[11407] gi|4885294|ref|NM—005288.1|[4885294]
[11408] 6869: NM—005264
[11409] Homo sapiens GDNF family receptor alpha 1 (GFRA1), mRNA
[11410] gi|4885268|ref|NM—005264.1|[4885268]
[11411] 6870: NM—005246
[11412] Homo sapiens fer (fps/fes related) tyrosine kinase (phosphoprotein NCP94) (FER),
[11413] mRNA
[11414] gi|4885230|ref|NM—005246.1|[4885230]
[11415] 6871: NM—005233
[11416] Homo sapiens EphA3 (EPHA3), mRNA
[11417] gi|4885210|ref|NM—005233.1|[4885210]
[11418] 6872: NM—005227
[11419] Homo sapiens ephrin-A4 (EFNA4), mRNA
[11420] gi|4885196|ref|NM—005227.1|[4885196]
[11421] 6873: NM—005211
[11422] Homo sapiens colony stimulating factor 1 receptor, formerly McDonough feline sarcoma viral (v-fms) oncogene homolog (CSF1R), mRNA
[11423] gi|4885158|ref|NM—005211.1|[4885158]
[11424] 6875: NM—005161
[11425] Homo sapiens angiotensin receptor-like 1 (AGTRL1), mRNA
[11426] gi|4885056|ref|NM—005161.1|[4885056]
[11427] 6876: NM—005092
[11428] Homo sapiens tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18), mRNA
[11429] gi|4827033|ref|NM—005092.1|[4827033]
[11430] 6877: NM—005118
[11431] Homo sapiens tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), mRNA
[11432] gi|4827031|ref|NM—005118.1|[4827031]
[11433] 6878: NM—005048
[11434] Homo sapiens parathyroid hormone receptor 2 (PTHR2), mRNA
[11435] gi|4826953|ref|NM—005048.1|[4826953]
[11436] 6879: NM—004963
[11437] Homo sapiens guanylate cyclase 2C (heat stable enterotoxin receptor) (GUCY2C),
[11438] mRNA
[11439] gi|4826751|ref|NM—004963.1|[4826751]
[11440] 6880: NM—005145
[11441] Homo sapiens guanine nucleotide binding protein (G protein), gamma 7 (GNG7), mRNA
[11442] gi|4826745|ref|NM—005145.1|[4826745]
[11443] 6881: NM—004952
[11444] Homo sapiens ephrin-A3 (EFNA3), mRNA
[11445] gi|4826707|ref|NM—004952.1|[4826707]
[11446] 6882: NM—004736
[11447] Homo sapiens xenotropic and polytropic retrovirus receptor (XPR1), mRNA
[11448] gi|4759333|ref|NM—004736.1|[4759333]
[11449] 6883: NM—004664
[11450] Homo sapiens Vertebrate LIN7 homolog 1, Tax interaction protein 33 (VELI1), mRNA
[11451] gi|4759305|ref|NM—004664.1|[4759305]
[11452] 6884: NM—004195
[11453] Homo sapiens tumor necrosis factor receptor superfamily, member 18 (TNFRSF18),
[11454] mRNA
[11455] gi|4759245|ref|NM—004195.1|[4759245]
[11456] 6885: NM—004612
[11457] Homo sapiens transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53 kD) (TGFBR1), mRNA
[11458] gi|4759225|ref|NM—004612.1|[4759225]
[11459] 6887: NM—004154
[11460] Homo sapiens pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), mRNA
[11461] gi|4758863|ref|NM—004154.1|[4758863]
[11462] 6888: NM—004244
[11463] Homo sapiens CD163 antigen (CD163), mRNA
[11464] gi|4758721|ref|NM—004244.1|[4758721]
[11465] 6889: NM—002332
[11466] Homo sapiens low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) (LRP1), mRNA
[11467] gi|4758685|ref|NM—002332.1|[4758685]
[11468] 6890: NM—004514
[11469] Homo sapiens interleukin enhancer binding factor 1 (ILF1), mRNA
[11470] gi|4758599|ref|NM—004514.1|[4758599]
[11471] 6891: NM—004633
[11472] Homo sapiens interleukin 1 receptor, type II (IL1R2), mRNA
[11473] gi|4758597|ref|NM—004633.1|[4758597]
[11474] 6892: NM—004512
[11475] Homo sapiens interleukin 11 receptor, alpha (IL11RA), mRNA
[11476] gi|4758593|ref|NM—004512.1|[4758593]
[11477] 6894: NM—000826
[11478] Homo sapiens glutamate receptor, ionotropic, AMPA 2 (GRIA2), mRNA
[11479] gi|4758479|ref|NM—000826.1|[4758479]
[11480] 6896: NM—004224
[11481] Homo sapiens G protein-coupled receptor 50 (GPR50), mRNA
[11482] gi|4758467|ref|NM—004224.1|[4758467]
[11483] 6898: NM—004246
[11484] Homo sapiens glucagon-like peptide 2 receptor (GLP2R), mRNA
[11485] gi|4758437|ref|NM—004246.1|[4758437]
[11486] 6899: NM—004293
[11487] Homo sapiens guanine deaminase (GDA), mRNA
[11488] gi|4758425|ref|NM—004293.1|[4758425]
[11489] 6900: NM—002030
[11490] Homo sapiens formyl peptide receptor-like 2 (FPRL2), mRNA
[11491] gi|4758401|ref|NM—002030.2|[4758401]
[11492] 6901: NM—004469
[11493] Homo sapiens c-fos induced growth factor (vascular endothelial growth factor D)
[11494] (FIGF), mRNA
[11495] gi|4758377|ref|NM—004469.1|[4758377]
[11496] 6902: NM—004107
[11497] Homo sapiens Fc fragment of IgG, receptor, transporter, alpha (FCGRT), mRNA
[11498] gi|4758345|ref|NM—004107.1|[4758345]
[11499] 6903: NM—004101
[11500] Homo sapiens coagulation factor II (thrombin) receptor-like 2 (F2RL2), mRNA
[11501] gi|4758325|ref|NM—004101.1|[4758325]
[11502] 6904: NM—004447
[11503] Homo sapiens epidermal growth factor receptor pathway substrate 8 (EPS8), mRNA
[11504] gi|4758295|ref|NM—004447.1|[4758295]
[11505] 6905: NM—004431
[11506] Homo sapiens EphA2 (EPHA2), mRNA
[11507] gi|4758277|ref|NM—004431.1|[4758277]
[11508] 6906: NM—004093
[11509] Homo sapiens ephrin-B2 (EFNB2), mRNA
[11510] gi|4758249|ref|NM—004093.1|[4758249]
[11511] 6907: NM—004429
[11512] Homo sapiens ephrin-B1 (EFNB1), mRNA
[11513] gi|4758247|ref|NM—004429.1|[4758247]
[11514] 6908: NM—004428
[11515] Homo sapiens ephrin-A1 (EFNA1), mRNA
[11516] gi|4758245|ref|NM—004428.1|[4758245]
[11517] 6909: NM—004393
[11518] Homo sapiens dystroglycan 1 (dystrophin-associated glycoprotein 1) (DAG1), mRNA
[11519] gi|4758115|ref|NM—004393.1|[4758115]
[11520] 6910: NM—004383
[11521] Homo sapiens c-src tyrosine kinase (CSK), mRNA
[11522] gi|4758077|ref|NM—004383.1|[4758077]
[11523] 6911: NM—004778
[11524] Homo sapiens G protein-coupled receptor 44 (GPR44), mRNA
[11525] gi|4758069|ref|NM—004778.1|[4758069]
[11526] 6912: NM—004382
[11527] Homo sapiens corticotropin releasing hormone receptor 1 (CRHR1), mRNA
[11528] gi|4758059|ref|NM—004382.1|[4758059]
[11529] 6913: NM—004072
[11530] Homo sapiens chemokine-like receptor 1 (CMKLR1), mRNA
[11531] gi|4758013|ref|NM—004072.1|[4758013]
[11532] 6914: NM—004329
[11533] Homo sapiens bone morphogenetic protein receptor, type IA (BMPR1A), mRNA
[11534] gi|4757853|ref|NM—004329.1|[4757853]
[11535] 6915: NM—004313
[11536] Homo sapiens arrestin, beta 2 (ARRB2), mRNA
[11537] gi|4757779|ref|NM—004313.1|[4757779]
[11538] 6916: NM—004039
[11539] Homo sapiens annexin A2 (ANXA2), mRNA
[11540] gi|4757755|ref|NM—004039.1|[4757755]
[11541] 6917: NM—000806
[11542] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), mRNA
[11543] gi|4585862|ref|NM—000806.2|[4585862]
[11544] 6918: NM—002529
[11545] Homo sapiens neurotrophic tyrosine kinase, receptor, type 1 (NTRK1), mRNA
[11546] gi|4585711|ref|NM—002529.2|[4585711]
[11547] 6919: NM—000395
[11548] Homo sapiens colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) (CSF2RB), mRNA
[11549] gi|4559407|ref|NM—000395.1|[4559407]
[11550] 6920: NM—000211
[11551] Homo sapiens integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit) (ITGB2), mRNA
[11552] gi|4557885|ref|NM—000211.1|[4557885]
[11553] 6921: NM—000208
[11554] Homo sapiens insulin receptor (INSR), mRNA
[11555] gi|4557883|ref|NM—000208.1|[4557883]
[11556] 6922: NM—000206
[11557] Homo sapiens interleukin 2 receptor, gamma (severe combined immunodeficiency) (IL2RG), mRNA
[11558] gi|4557881|ref|NM—000206.1|[4557881]
[11559] 6923: NM—000416
[11560] Homo sapiens interferon gamma receptor 1 (IFNGR1), mRNA
[11561] gi|4557879|ref|NM—000416.1|[4557879]
[11562] 6924: NM—000201
[11563] Homo sapiens intercellular adhesion molecule 1 (CD54), human rhinovirus receptor
[11564] (ICAM1), mRNA
[11565] gi|4557877|ref|NM—000201.1|[4557877]
[11566] 6925: NM—000459
[11567] Homo sapiens TEK tyrosine kinase, endothelial (venous malformations, multiple cutaneous and mucosal) (TEK), mRNA
[11568] gi|4557868|ref|NM—000459.1|[4557868]
[11569] 6926: NM—001053
[11570] Homo sapiens somatostatin receptor 5 (SSTR5), mRNA
[11571] gi|4557864|ref|NM—001053.1|[4557864]
[11572] 6927: NM—001052
[11573] Homo sapiens somatostatin receptor 4 (SSTR4), mRNA
[11574] gi|4557862|ref|NM—001052.1|[4557862]
[11575] 6928: NM—001051
[11576] Homo sapiens somatostatin receptor 3 (SSTR3), mRNA
[11577] gi|4557860|ref|NM—001051.1|[4557860]
[11578] 6929: NM—001050
[11579] Homo sapiens somatostatin receptor 2 (SSTR2), mRNA
[11580] gi|4557858|ref|NM—001050.1|[4557858]
[11581] 6930: NM—001049
[11582] Homo sapiens somatostatin receptor 1 (SSTR1), mRNA
[11583] gi|4557856|ref|NM—001049.1|[4557856]
[11584] 6931: NM—000245
[11585] Homo sapiens met proto-oncogene (hepatocyte growth factor receptor) (MET), mRNA
[11586] gi|4557746|ref|NM—000245.1|[4557746]
[11587] 6932: NM—000242
[11588] Homo sapiens mannose-binding lectin (protein C) 2, soluble (opsonic defect) (MBL2), mRNA
[11589] gi|4557738|ref|NM—000242.1|[4557738]
[11590] 6933: NM—000237
[11591] Homo sapiens lipoprotein lipase (LPL), mRNA
[11592] gi|4557726|ref|NM—000237.1|[4557726]
[11593] 6934: NM—000236
[11594] Homo sapiens lipase, hepatic (LIPC), mRNA
[11595] gi|4557722|ref|NM—000236.1|[4557722]
[11596] 6935: NM—000233
[11597] Homo sapiens luteinizing hormone/choriogonadotropin receptor (LHCGR), mRNA
[11598] gi|4557716|ref|NM—000233.1|[4557716]
[11599] 6936: NM—000222
[11600] Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), mRNA
[11601] gi|4557694|ref|NM—000222.1|[4557694]
[11602] 6937: NM—000212
[11603] Homo sapiens integrin, beta 3 (platelet glycoprotein 111a, antigen CD61) (ITGB3), mRNA
[11604] gi|4557676|ref|NM—000212.1|[4557676]
[11605] 6939: NM—000418
[11606] Homo sapiens interleukin 4 receptor (IL4R), mRNA
[11607] gi|4557668|ref|NM—000418.1|[4557668]
[11608] 6940: NM—000417
[11609] Homo sapiens interleukin 2 receptor, alpha (IL2RA), mRNA
[11610] gi|4557666|ref|NM—000417.1|[4557666]
[11611] 6941: NM—001551
[11612] Homo sapiens immunoglobulin (CD79A) binding protein 1 (IGBP1), mRNA
[11613] gi|4557662|ref|NM—001551.1|[4557662]
[11614] 6942: NM—000859
[11615] Homo sapiens 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGCR), mRNA
[11616] gi|4557642|ref|NM—000859.1|[4557642]
[11617] 6943: NM—001525
[11618] Homo sapiens hypocretin (orexin) receptor 1 (HCRTR1), mRNA
[11619] gi|4557636|ref|NM—001525.1|[4557636]
[11620] 6944: NM—001510
[11621] Homo sapiens glutamate receptor, ionotropic, delta 2 (GRID2), mRNA
[11622] gi|4557632|ref|NM—001510.1|[4557632]
[11623] 6945: NM—000829
[11624] Homo sapiens glutamate receptor, ionotrophic, AMPA 4 (GRIA4), mRNA
[11625] gi|4557630|ref|NM—000829.1|[4557630]
[11626] 6946: NM—001496
[11627] Homo sapiens GDNF family receptor alpha 3 (GFRA3), mRNA
[11628] gi|4557622|ref|NM—001496.1|[4557622]
[11629] 6947: NM—000820
[11630] Homo sapiens growth arrest-specific 6 (GAS6), mRNA
[11631] gi|4557616|ref|NM—000820.1|[4557616]
[11632] 6948: NM—000155
[11633] Homo sapiens galactose-1-phosphate uridylyltransferase (GALT), mRNA
[11634] gi|4557614|ref|NM—000155.1|[4557614]
[11635] 6949: NM—000816
[11636] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 2 (GABRG2), mRNA
[11637] gi|4557610|ref|NM—000816.1|[4557611]
[11638] 6950: NM—000815
[11639] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, delta (GABRD), mRNA
[11640] gi|4557608|ref|NM—000815.1|[4557608]
[11641] 6951: NM—000811
[11642] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 6 (GABRA6), mRNA
[11643] gi|4557606|ref|NM—000811.1|[4557606]
[11644] 6952: NM—000809
[11645] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 4 (GABRA4), mRNA
[11646] gi|4557604|ref|NM—000809.1|[4557604]
[11647] 6953: NM—000808
[11648] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 3 (GABRA3), mRNA
[11649] gi|4557602|ref|NM—000808.1|[4557602]
[11650] 6954: NM—000807
[11651] Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 2 (GABRA2), mRNA
[11652] gi|4557600|ref|NM—000807.1|[4557600]
[11653] 6955: NM—000121
[11654] Homo sapiens erythropoietin receptor (EPOR), mRNA
[11655] gi|4557561|ref|NM—000121.2|[4557561]
[11656] 6956: NM—000118
[11657] Homo sapiens endoglin (Osler-Rendu-Weber syndrome 1) (ENG), mRNA
[11658] gi|4557554|ref|NM—000118.1|[4557554]
[11659] 6957: NM—000114
[11660] Homo sapiens endothelin 3 (EDN3), mRNA
[11661] gi|4557544|ref|NM—000114.1|[4557544]
[11662] 6958: NM—001365
[11663] Homo sapiens discs, large (Drosophila) homolog 4 (DLG4), mRNA
[11664] gi|4557528|ref|NM—001365.1|[4557528]
[11665] 6959: NM—000080
[11666] Homo sapiens cholinergic receptor, nicotinic, epsilon polypeptide (CHRNE), mRNA
[11667] gi|4557462|ref|NM—000080.1|[4557462]
[11668] 6960: NM—000751
[11669] Homo sapiens cholinergic receptor, nicotinic, delta polypeptide (CHRND), mRNA
[11670] gi|4557460|ref|NM—000751.1|[4557460]
[11671] 6961: NM—000747
[11672] Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) (CHRNB1), mRNA
[11673] gi|4557458|ref|NM—000747.1|[4557458) b6Y2: NM—000079
[11674] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) (CHRNA1), mRNA
[11675] gi|4557456|ref|NM—000079.1|[4557456]
[11676] 6963: NM—000074
[11677] Homo sapiens tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome) (TNFSF5), mRNA
[11678] gi|4557432|ref|NM—000074.1|[4557432]
[11679] 6964: NM—000073
[11680] Homo sapiens CD3G antigen, gamma polypeptide (TiT3 complex) (CD3G), mRNA
[11681] gi|4557428|ref|NM—000073.1|[4557428]
[11682] 6965: NM—000072
[11683] Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor) (CD36), mRNA
[11684] gi|4557418|ref|NM—000072.1|[4557418]
[11685] 6966: NM—000388
[11686] Homo sapiens calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism) (CASR), mRNA
[11687] gi|4557410|ref|NM—000388.1|[4557410]
[11688] 6967: NM—000069
[11689] Homo sapiens calcium channel, voltage-dependent, L type, alpha 1S subunit (CACNA1S), mRNA
[11690] gi|4557400|ref|NM—000069.1|[4557400]
[11691] 6968: NM—000041
[11692] Homo sapiens apolipoprotein E (APOE), mRNA
[11693] gi|4557324|ref|NM—000041.1|[4557324]
[11694] 6969: NM—000684
[11695] Homo sapiens adrenergic, beta-1-, receptor (ADRB1), mRNA
[11696] gi|4557264|ref|NM—000684.1|[4557264]
[11697] 6970: NM—001116
[11698] Homo sapiens adenylate cyclase 9 (ADCY9), mRNA
[11699] gi|4557258|ref|NM—001116.1|[4557258]
[11700] 6971: NM—001115
[11701] Homo sapiens adenylate cyclase 8 (brain) (ADCY8), mRNA
[11702] gi|4557256|ref|NM—001115.1|[4557256]
[11703] 6972: NM—004001
[11704] Homo sapiens Fc fragment of IgG, low affinity IIb, receptor for (CD32) (FCGR2B),
[11705] mRNA
[11706] gi|4557021|ref|NM—004001.1|[4557021]
[11707] 6975: NM—003931
[11708] Homo sapiens WAS protein family, member 1 (WASF1), mRNA
[11709] gi|4507912|ref|NM—003931.1|[4507912]
[11710] 6976: NM—003383
[11711] Homo sapiens very low density lipoprotein receptor (VLDLR), mRNA
[11712] gi|4507900|ref|NM—003383.1|[4507900]
[11713] 6977: NM—003382
[11714] Homo sapiens vasoactive intestinal peptide receptor 2 (VIPR2), mRNA
[11715] gi|4507898|ref|NM—003382.1|[4507898]
[11716] 6978: NM—000376
[11717] Homo sapiens vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR), mRNA
[11718] gi|4507882|ref|NM—000376.1|[4507882]
[11719] 6979: NM—003329
[11720] Homo sapiens thioredoxin (TXN), mRNA
[11721] gi|4507744|ref|NM—003329.1|[4507744]
[11722] 6980: NM—000369
[11723] Homo sapiens thyroid stimulating hormone receptor (TSHR), mRNA
[11724] gi|4507700|ref|NM—000369.1|[4507700]
[11725] 6981: NM—003301
[11726] Homo sapiens thyrotropin-releasing hormone receptor (TRHR), rRNA
[11727] gi|4507680|ref|NM—003301.1|[4507680]
[11728] 6982: NM—001244
[11729] Homo sapiens tumor necrosis factor (ligand) superfamily, member 8 (TNFSF8), mRNA
[11730] gi|4507606|ref|NM—001244.1|[4507606]
[11731] 6983: NM—003809
[11732] Homo sapiens tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), mRNA
[11733] gi|4507596|ref|NM—003809.1|[4507596]
[11734] 6984: NM—001243
[11735] Homo sapiens tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), mRNA
[11736] gi|4507588|ref|NM—001243.1|[4507588]
[11737] 6985: NM—001242
[11738] Homo sapiens tumor necrosis factor receptor superfamily, member 7 (TNFRSF7), mRNA
[11739] gi|4507586|ref|NM—001242.1|[4507586]
[11740] 6986: NM—000043
[11741] Homo sapiens tumor necrosis factor receptor superfamily, member 6 (TNFRSF6), mRNA
[11742] gi|4507582|ref|NM—000043.1|[4507582]
[11743] 6987: NM—003327
[11744] Homo sapiens tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), mRNA
[11745] gi|4507578|ref|NM—003327.1|[4507578]
[11746] 6988: NM—001065
[11747] Homo sapiens tumor necrosis factor receptor superfamily, member 1A (TNFRSF1A),
[11748] mRNA
[11749] gi|4507574|ref|NM—001065.1|[4507574]
[11750] 6989: NM—001192
[11751] Homo sapiens tumor necrosis factor receptor superfamily, member 17 (TNFRSF17),
[11752] mRNA
[11753] gi|4507572|ref|NM—001192.1|[4507572]
[11754] 6990: NM—003820
[11755] Homo sapiens tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) (TNFRSF14), mRNA
[11756] gi|4507570|ref|NM—003820.1|[4507570]
[11757] 6991: NM—003790
[11758] Homo sapiens tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein) (TNFRSF12), mRNA
[11759] gi|4507568|ref|NM—003790.1|[4507568]
[11760] 6992: NM—002546
[11761] Homo sapiens tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) (TNFRSF11B), mRNA
[11762] gi|4507566|ref|NM—002546.1|[4507566]
[11763] 6993: NM—003839
[11764] Homo sapiens tumor necrosis factor receptor superfamily, member lla, activator
[11765] of NFKB (TNFRSF11A), mRNA
[11766] gi|4507564|ref|NM—003839.1|[4507564]
[11767] 6994: NM—003840
[11768] Homo sapiens tumor necrosis factor receptor superfamily, member 10d, decoy with
[11769] truncated death domain (TNFRSF10D), mRNA
[11770] gi|4507562|ref|NM—003840.1|[4507562]
[11771] 6995: NM—003842
[11772] Homo sapiens tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B),
[11773] mRNA
[11774] gi|4507560|ref|NM—003842.1|[4507560]
[11775] 6996: NM—003844
[11776] Homo sapiens tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A),
[11777] mRNA
[11778] gi|4507558|ref|NM—003844.1|[4507558]
[11779] 6997: NM—003692
[11780] Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 1 (TMEFF1), mRNA
[11781] gi|4507548|ref|NM—003692.1|[4507548]
[11782] 6998: NM—003273
[11783] Homo sapiens transmembrane 7 superfamily member 2 (TM7SF2), mRNA
[11784] gi|4507546|ref|NM—003273.1|[4507546]
[11785] 6999: NM—003272
[11786] Homo sapiens transmembrane 7 superfamily member 1 (upregulated in kidney) (TM7SF1), mRNA
[11787] gi|4507544|ref|NM—003272.1|[4507544]
[11788] 7000: NM—000460
[11789] Homo sapiens thrombopoietin (myeloproliferative leukemia virus oncogene ligand,
[11790] megakaryocyte growth and development factor) (THPO), mRNA
[11791] gi|4507492|ref|NM—000460.1|[4507492]
[11792] 7001: NM—003844
[11793] Homo sapiens tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A),
[11794] mRNA
[11795] gi|4507558|ref|NM—003844.1|[4507558]
[11796] 7002: NM—003692
[11797] Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 1 (TMEFF1), mRNA
[11798] gi|4507548|ref|NM—003692.1|[4507548]
[11799] 7003: NM—003273
[11800] Homo sapiens transmembrane 7 superfamily member 2 (TM7SF2), mRNA
[11801] gi|4507546|ref|NM—003273.1|[4507546]
[11802] 7004: NM—003272
[11803] Homo sapiens transmembrane 7 superfamily member 1 (upregulated in kidney) (TM7SF1), mRNA
[11804] gi|4507544|ref|NM—003272.1|[4507544]
[11805] 7005: NM—000460
[11806] Homo sapiens thrombopoietin (myeloproliferative leukemia virus oncogene ligand,
[11807] megakaryocyte growth and development factor) (THPO), mRNA
[11808] gi|4507492|ref|NM—000460.1|[4507492]
[11809] 7006: NM—000361
[11810] Homo sapiens thrombomodulin (THBD), mRNA
[11811] gi|4507482|ref|NM—000361.1|[4507482]
[11812] 7007: NM—003243
[11813] Homo sapiens transforming growth factor, beta receptor III (betaglycan, 300 kD)
[11814] (TGFBR3), mRNA
[11815] gi|4507470|ref|NM—003243.1|[4507470]
[11816] 7008: NM—003234
[11817] Homo sapiens transferrin receptor (p90, CD71) (TFRC), mRNA
[11818] gi|4507456|ref|NM—003234.1|[4507456]
[11819] 7009: NM—003608
[11820] Homo sapiens G protein-coupled receptor 65 (GPR65), mRNA
[11821] gi|4507420|ref|NM—003608.1|[4507420]
[11822] 7010: NM—001060
[11823] Homo sapiens thromboxane A2 receptor (TBXA2R), mRNA
[11824] gi|4507380|ref|NM—001060.1|[4507380]
[11825] 7012: NM—001057
[11826] Homo sapiens tachykinin receptor 2 (TACR2), mRNA
[11827] gi|4507344|ref|NM—001057.1|[4507344]
[11828] 7013: NM—003177
[11829] Homo sapiens spleen tyrosine kinase (SYK), mRNA
[11830] gi|4507328|ref|NM—003177.1|[4507328]
[11831] 7015: NM—003070
[11832] Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), mRNA
[11833] gi|4507068|ref|NM—003070.1|[4507068]
[11834] 7016: NM—003045
[11835] Homo sapiens solute carrier family 7 (cationic amino acid transporter, y+system), member 1 (SLC7A1), mRNA
[11836] gi|4507046|ref|NM—003045.1|[4507046]
[11837] 7017: NM—003037
[11838] Homo sapiens signaling lymphocytic activation molecule (SLAM), mRNA
[11839] gi|4506968|ref|NM—003037.1|[4506968]
[11840] 7019: NM—001036
[11841] Homo sapiens ryanodine receptor 3 (RYR3), mRNA
[11842] gi|4506758|ref|NM—001036.1|[4506758]
[11843] 7020: NM—001035
[11844] Homo sapiens ryanodine receptor 2 (cardiac) (RYR2), mRNA
[11845] gi|4506756|ref|NM—001035.1|[4506756]
[11846] 7023: NM—002921
[11847] Homo sapiens retinal G protein coupled receptor (RGR), mRNA
[11848] gi|4506502|ref|NM—002921.1|[4506502]
[11849] 7026: NM—002852
[11850] Homo sapiens pentaxin-related gene, rapidly induced by IL-1 beta (PTX3), mRNA
[11851] gi|4506332|ref|NM—002852.1|[4506332]
[11852] 7027: NM—002851
[11853] Homo sapiens protein tyrosine phosphatase, receptor-type, Z polypeptide 1 (PTPRZ1), mRNA
[11854] gi|4506328|ref|NM—002851.1|[4506328]
[11855] 7028: NM—000316
[11856] Homo sapiens parathyroid hormone receptor 1 (PTHR1), mRNA
[11857] gi|4506270|ref|NM—000316.1|[4506270]
[11858] 7029: NM—000960
[11859] Homo sapiens prostaglandin 12 (prostacyclin) receptor (IP) (PTGIR), mRNA
[11860] gi|4506262|ref|NM—000960.1|[4506262]
[11861] 7030: NM—000959
[11862] Homo sapiens prostaglandin F receptor (FP) (PTGFR), mRNA
[11863] gi|4506260|ref|NM—000959.1|[4506260]
[11864] 7031: NM—000958
[11865] Homo sapiens prostaglandin E receptor 4 (subtype EP4) (PTGER4), mRNA
[11866] gi|4506258|ref|NM—000958.1|[4506258]
[11867] 7032: NM—000957
[11868] Homo sapiens prostaglandin E receptor 3 (subtype EP3) (PTGER3), mRNA
[11869] gi|4506256|ref|NM—000957.1|[4506256]
[11870] 7033: NM—000955
[11871] Homo sapiens prostaglandin E receptor 1 (subtype EP1), 42 kD (PTGER1), mRNA
[11872] gi|4506252|ref|NM—000955.1|[4506252]
[11873] 7034: NM—000952
[11874] Homo sapiens platelet-activating factor receptor (PTAFR), mRNA
[11875] gi|4506240|ref|NM—000952.1|[4506240]
[11876] 7035: NM—002769
[11877] Homo sapiens protease, serine, 1 (trypsin 1) (PRSS1), mRNA
[11878] gi|4506144|ref|NM—002769.1|[4506144]
[11879] 7036: NM—000949
[11880] Homo sapiens prolactin receptor (PRLR), mRNA
[11881] gi|4506106|ref|NM—000949.1|[4506106]
[11882] 7037: NM—002745
[11883] Homo sapiens mitogen-activated protein kinase 1 (MAPK1), mRNA
[11884] gi|4506086|ref|NM—002745.1|[4506086]
[11885] 7038: NM—002702
[11886] Homo sapiens POU domain, class 6, transcription factor 1 (POU6F1), mRNA
[11887] gi|4505968|ref|NM—002702.1|[4505968]
[11888] 7039: NM—003967
[11889] Homo sapiens putative neurotransmitter receptor (PNR), mRNA
[11890] gi|4505924|ref|NM—003967.1|[4505924]
[11891] 7040: NM—002659
[11892] Homo sapiens plasminogen activator, urokinase receptor (PLAUR), mRNA
[11893] gi|4505864|ref|NM—002659.1|[4505864]
[11894] 7041: NM—000926
[11895] Homo sapiens progesterone receptor (PGR), mRNA
[11896] gi|4505766|ref|NM—000926.1|[4505766]
[11897] 7042: NM—000288
[11898] Homo sapiens peroxisomal biogenesis factor 7 (PEX7), mRNA
[11899] gi|4505730|ref|NM—000288.1|[4505730]
[11900] 7043: NM—000287
[11901] Homo sapiens peroxisomal biogenesis factor 6 (PEX6), mRNA
[11902] gi|4505728|ref|NM—000287.1|[4505728]
[11903] 7044: NM—002618
[11904] Homo sapiens peroxisome biogenesis factor 13 (PEX13), mRNA
[11905] gi|4505722|ref|NM—002618.1|[4505722]
[11906] 7045: NM—002591
[11907] Homo sapiens phosphoenolpyruvate carboxykinase 1 (soluble) (PCK1), mRNA
[11908] gi|4505638|ref|NM—002591.1|[4505638]
[11909] 7046: NM—002586
[11910] Homo sapiens pre-B-cell leukemia transcription factor 2 (PBX2), mRNA
[11911] gi|4505624|ref|NM—002586.1|[4505624]
[11912] 7047: NM—002569
[11913] Homo sapiens paired basic amino acid cleaving enzyme (furin, membrane associated
[11914] receptor protein) (PACE), mRNA
[11915] gi|4505578|ref|NM—002569.11 4505578]
[11916] 7048: NM—002565
[11917] Homo sapiens pyrimidinergic receptor P2Y, G-protein coupled, 4 (P2RY4), mRNA
[11918] gi|4505560|ref|NM—002565.1)[4505560]
[11919] 7049: NM—002566
[11920] Homo sapiens purinergic receptor P2Y, G-protein coupled, 11 (P2RY11), mRNA
[11921] gi|4505554|ref|NM—002566.1|[4505554]
[11922] 7050: NM—002562
[11923] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 7 (P2RX7), mRNA
[11924] gi|4505552|ref|NM—002562.1|[4505552]
[11925] 7051: NM—002561
[11926] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 5 (P2RX5), mRNA
[11927] gi|4505550|ref|NM—002561.1|[4505550]
[11928] 7052: NM—002560
[11929] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 4 (P2RX4), mRNA
[11930] gi|4505548|ref|NM—002560.1|[4505548]
[11931] 7053: NM—002559
[11932] Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 3 (P2RX3), mRNA
[11933] gi|4505546|ref|NM—002559.1|[4505546]
[11934] 7054: NM—002556
[11935] Homo sapiens oxysterol binding protein (OSBP), mRNA
[11936] gi|4505530|ref|NM—002556.1|[4505530]
[11937] 7055: NM—003696
[11938] Homo sapiens olfactory receptor, family 6, subfamily A, member 1 (OR6A1), mRNA
[11939] gi|4505520|ref|NM—003696.1|[4505520]
[11940] 7056: NM—002550
[11941] Homo sapiens olfactory receptor, family 3, subfamily A, member 1 (OR3A1), mRNA
[11942] gi|4505518|ref|NM—002550.1|[4505518]
[11943] 7057: NM—002548
[11944] Homo sapiens olfactory receptor, family 1, subfamily D, member 2 (OR1D2), mRNA
[11945] gi|4505516|ref|NM—002548.1|[4505516]
[11946] 7058: NM—000914
[11947] Homo sapiens opioid receptor, mu 1 (OPRM1), mRNA
[11948] gi|4505514|ref|NM—000914.1|[4505514]
[11949] 7059: NM—000912
[11950] Homo sapiens opioid receptor, kappa 1 (OPRK1), mRNA
[11951] gi|4505510|ref|NM—000912.1|[4505510]
[11952] 7060: NM—000911
[11953] Homo sapiens opioid receptor, delta 1 (OPRD1), mRNA
[11954] gi|4505508|ref|NM—000911.1|[4505508]
[11955] 7061: NM—002543
[11956] Homo sapiens oxidised low density lipoprotein (lectin-like) receptor 1 (OLR1),
[11957] mRNA
[11958] gi|4505500|ref|NM—002543.1|[4505500]
[11959] 7062: NM—003485
[11960] Homo sapiens G protein-coupled receptor 68 (GPR68), mRNA
[11961] gi|4505496|ref|NM—003485.1|[4505496]
[11962] 7063: NM—002531
[11963] Homo sapiens neurotensin receptor 1 (high affinity) (NTSR1), mRNA
[11964] gi|4505476|ref|NM—002531.1|[4505476]
[11965] 7064: NM—002530
[11966] Homo sapiens neurotrophic tyrosine kinase, receptor, type 3 (NTRK3), mRNA
[11967] gi|4505474|ref|NM—002530.1|[4505474]
[11968] 7065: NM—003580
[11969] Homo sapiens neutral sphingomyelinase (N-SMase) activation associated factor (NSMAF), mRNA
[11970] gi|4505464|ref|NM—003580.1|[4505464]
[11971] 7066: NM—003872
[11972] Homo sapiens neuropilin 2 (NRP2), mRNA
[11973] gi|4505458|ref|NM—003872.1|[4505458]
[11974] 7067: NM—003873
[11975] Homo sapiens neuropilin 1 (NRP1), mRNA
[11976] gi|4505456|ref|NM—003873.1|[4505456]
[11977] 7068: NM—000910
[11978] Homo sapiens neuropeptide Y receptor Y2 (NPY2R), mRNA
[11979] gi|4505446|ref|NM—000910.1|[4505446]
[11980] 7069: NM—000909
[11981] Homo sapiens neuropeptide Y receptor Y1 (NPY1R), mRNA
[11982] gi|4505444|ref|NM—000909.1|[4505444]
[11983] 7070: NM—000908
[11984] Homo sapiens natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) (NPR3), mRNA
[11985] gi|4505440|ref|NM—000908.1|[4505440]
[11986] 7071: NM—000906
[11987] Homo sapiens natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) (NPR1), mRNA
[11988] gi|4505434|ref|NM—000906.1|[4505434]
[11989] 7072: NM—002511
[11990] Homo sapiens neuromedin B receptor (NMBR), mRNA
[11991] gi|4505406|ref|NM—002511.1|[4505406]
[11992] 7073: NM—003954
[11993] Homo sapiens mitogen-activated protein kinase kinase kinase 14 (MAP3K14), mRNA
[11994] gi|4505396|ref|NM—003954.1|[4505396]
[11995] 7074: NM—002507
[11996] Homo sapiens nerve growth factor receptor (TNFR superfamily, member 16) (NGFR),
[11997] mRNA
[11998] gi|4505392|ref|NM—002507.1|[4505392]
[11999] 7075: NM—002447
[12000] Homo sapiens macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
[12001] (MST1R), mRNA
[12002] gi|4505264|ref|NM—002447.1|[4505264]
[12003] 7076: NM—002445
[12004] Homo sapiens macrophage scavenger receptor 1 (MSR1), mRNA
[12005] gi|4505258|ref|NM—002445.1|[4505258]
[12006] 7077: NM—000529
[12007] Homo sapiens melanocortin 2 receptor (adrenocorticotropic hormone) (MC2R), mRNA
[12008] gi|4505126|ref|NM—000529.1|[4505126]
[12009] 7078: NM—002386
[12010] Homo sapiens melanocortin I receptor (alpha melanocyte stimulating hormone receptor) (MC1R), mRNA
[12011] gi|4505124|ref|NM—002386.1[4505124]
[12012] 7079: NM—002349
[12013] Homo sapiens lymphocyte antigen 75 (LY75), mRNA
[12014] gi|4505052|ref|NM—002349.1|[4505052]
[12015] 7080: NM—002344
[12016] Homo sapiens leukocyte tyrosine kinase (LTK), mRNA
[12017] gi|4505044|ref|NM—002344.1|[4505044]
[12018] 7081: NM—000752
[12019] Homo sapiens leukotriene b4 receptor (chemokine receptor-like 1) (LTB4R), mRNA
[12020] gi|4505032|ref|NM—000752.1[4505032]
[12021] 7082: NM—002336
[12022] Homo sapiens low density lipoprotein receptor-related protein 6 (LRP6), mRNA
[12023] gi|4505016|ref|NM—002336.1|[4505016]
[12024] 7083: NM—002319
[12025] Homo sapiens leucine-rich neuronal protein (LRN), mRNA
[12026] gi|4505012|ref|NM—002319.1|[4505012]
[12027] 7084: NM—002303
[12028] Homo sapiens leptin receptor (LEPR), mRNA
[12029] gi|4504978|ref|NM—002303.1|[4504978]
[12030] 7085: NM—002291
[12031] Homo sapiens laminin, beta 1 (LAMB1), mRNA
[12032] gi|4504950|ref|NM—002291.1[4504950]
[12033] 7086: NM—002258
[12034] Homo sapiens killer cell lectin-like receptor subfamily B, member 1 (KLRB1), mRNA
[12035] gi|4504878|ref|NM—002258.1|[4504878]
[12036] 7087: NM—002255
[12037] Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), mRNA
[12038] gi|4504870|ref|NM—002255.1|[4504870]
[12039] 7088: NM—002227
[12040] Homo sapiens Janus kinase 1 (a protein tyrosine kinase) (JAK1), mRNA
[12041] gi|4504802|ref|NM—002227.1|[4504802]
[12042] 7091: NM—002210
[12043] Homo sapiens integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen
[12044] CD51) (ITGAV), mRNA
[12045] gi|4504762|ref|NM—002210.1|[4504762]
[12046] 7092: NM—002205
[12047] Homo sapiens integrin, alpha 5 (fibronectin receptor, alpha polypeptide) (ITGA5), mRNA
[12048] gi|4504750|ref|NM—002205.1|[4504750]
[12049] 7094: NM—001565
[12050] Homo sapiens small inducible cytokine subfamily B (Cys-X-Cys), member 10 (SCYB10), mRNA
[12051] gi|4504700|ref|NM—001565.1|[4504700]
[12052] 7095: NM—001557
[12053] Homo sapiens interleukin 8 receptor, beta (IL8RB), mRNA
[12054] gi|4504682|ref|NM—001557.1|[4504682]
[12055] 7096: NM—000634
[12056] Homo sapiens interleukin 8 receptor, alpha (IL8RA), mRNA
[12057] gi|4504680|ref|NM—000634.1|[4504680]
[12058] 7097: NM—002185
[12059] Homo sapiens interleukin 7 receptor (IL7R), mRNA
[12060] gi|4504678|ref|NM—002185.1|[4504678]
[12061] 7098: NM—002184
[12062] Homo sapiens interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST), mRNA
[12063] gi|4504674|ref|NM—002184.1|[4504674]
[12064] 7099: NM—000565
[12065] Homo sapiens interleukin 6 receptor (IL6R), mRNA
[12066] gi|4504672|ref|NM—000565.1|[4504672]
[12067] 7100: NM—000878
[12068] Homo sapiens interleukin 2 receptor, beta (IL2RB), mRNA
[12069] gi|4504664|ref|NM—000878.1|[4504664]
[12070] 7101: NM—003854
[12071] Homo sapiens interleukin 1 receptor-like 2 (IL1RL2), mRNA
[12072] gi|4504662|ref|NM—003854.1|[4504662]
[12073] 7102: NM—000877
[12074] Homo sapiens interleukin 1 receptor, type I (IL1R1), mRNA
[12075] gi|4504658|ref|NM—000877.1|[4504658]
[12076] 7103: NM—003853
[12077] Homo sapiens interleukin 18 receptor accessory protein (IL18RAP), mRNA
[12078] gi|4504656|ref|NM—003853.1|[4504656]
[12079] 7104: NM—002189
[12080] Homo sapiens interleukin 15 receptor, alpha (IL15RA), mRNA
[12081] gi|4504648|ref|NM—002189.1|[4504648]
[12082] 7105: NM—001559
[12083] Homo sapiens interleukin 12 receptor, beta 2 (IL12RB2), mRNA
[12084] gi|4504642|ref|NM—001559.1|[4504642]
[12085] 7106: NM—001558
[12086] Homo sapiens interleukin 10 receptor, alpha (IL10RA), mRNA
[12087] gi|4504632|ref|NM—001558.1|[4504632]
[12088] 7107: NM—000876
[12089] Homo sapiens insulin-like growth factor 2 receptor (IGF2R), mRNA
[12090] gi|4504610|ref|NM—000876.1|[4504610]
[12091] 7108: NM—000871
[12092] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 6 (HTR6), mRNA
[12093] gi|4504544|ref|NM—000871.1|[4504544]
[12094] 7109: NM—000869
[12095] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 3A (HTR3A), mRNA
[12096] gi|4504542|ref|NM—000869.1|[4504542]
[12097] 7110: NM—000868
[12098] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2C (HTR2C), mRNA
[12099] gi|4504540|ref|NM—000868.1|[4504540]
[12100] 7111: NM—000867
[12101] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2B (HTR2B), mRNA
[12102] gi|4504538|ref|NM—000867.1|[4504538]
[12103] 7112: NM—000865
[12104] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1E (HTR1E), mRNA
[12105] gi|4504536|ref|NM—000865.1|[4504536]
[12106] 7113: NM—000863
[12107] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1B (HTR1B), mRNA
[12108] gi|4504532|ref|NM—000863.1|[4504532]
[12109] 7114: NM—000524
[12110] Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1A (HTR1A), mRNA
[12111] gi|4504530|ref|NM—000524.1|[4504530]
[12112] 7115: NM—000186
[12113] Homo sapiens H factor 1 (complement) (HF1), mRNA
[12114] gi|4504374|ref|NM—000186.1|[4504374]
[12115] 7116: NM—001523
[12116] Homo sapiens hyaluronan synthase 1 (HAS1), mRNA
[12117] gi|4504338|ref|NM—001523.1|[4504338]
[12118] 7117: NM—000845
[12119] Homo sapiens glutamate receptor, metabotropic 8 (GRM8), mRNA
[12120] gi|4504148|ref|NM—000845.1|[4504148]
[12121] 7118: NM—000844
[12122] Homo sapiens glutamate receptor, metabotropic 7 (GRM7), mRNA
[12123] gi|4504146|ref|NM—000844.1|[4504146]
[12124] 7119: NM—000841
[12125] Homo sapiens glutamate receptor, metabotropic 4 (GRM4), mRNA
[12126] gi|4504140|ref|NM—000841.1|[4504140]
[12127] 7120: NM—000840
[12128] Homo sapiens glutamate receptor, metabotropic 3 (GRM3), mRNA
[12129] gi|4504138|ref|NM—000840.1|[4504138]
[12130] 7121: NM—000831
[12131] Homo sapiens glutamate receptor, ionotropic, kainate 3 (GRIK3), mRNA
[12132] gi|4504118|ref|NM—000831.1|[4504118]
[12133] 7122: NM—000830
[12134] Homo sapiens glutamate receptor, ionotropic, kainate 1 (GRIK1), mRNA
[12135] gi|4504116|ref|NM—000830.1|[4504116]
[12136] 7123: NM—002086
[12137] Homo sapiens growth factor receptor-bound protein 2 (GRB2), mRNA
[12138] gi|4504110|ref|NM—002086.1|[4504110]
[12139] 7124: NM—002082
[12140] Homo sapiens G protein-coupled receptor kinase 6 (GPRK6), mRNA
[12141] gi|4504100|ref|NM—002082.1|[4504100]
[12142] 7125: NM—001504
[12143] Homo sapiens G protein-coupled receptor 9 (GPR9), mRNA
[12144] gi|4504098|ref|NM—001504.1|[4504098]
[12145] 7126: NM—001508
[12146] Homo sapiens G protein-coupled receptor 39 (GPR39), mRNA
[12147] gi|4504096|ref|NM—001508.1|[4504096]
[12148] 7127: NM—001507
[12149] Homo sapiens G protein-coupled receptor 38 (GPR38), mRNA
[12150] gi|4504094|ref|NM—001507.1|[4504094]
[12151] 7128: NM—001506
[12152] Homo sapiens G protein-coupled receptor 32 (GPR32), mRNA
[12153] gi|4504092|ref|NM—001506.1|[4504092]
[12154] 7129: NM—001505
[12155] Homo sapiens G protein-coupled receptor 30 (GPR30), mRNA
[12156] gi|4504090|ref|NM—001505.1|[4504090]
[12157] 7130: NM—000173
[12158] Homo sapiens glycoprotein Ib (platelet), alpha polypeptide (GP1BA) mRNA
[12159] gi|4504070|ref|NM—000173.1|[4504070]
[12160] 7131: NM—000824
[12161] Homo sapiens glycine receptor, beta (GLRB), mRNA
[12162] gi|4504022|ref|NM—000824.1|[4504022]
[12163] 7132: NM—002063
[12164] Homo sapiens glycine receptor, alpha 2 (GLRA2), mRNA
[12165] gi|4504020|ref|NM—002063.1|[4504020]
[12166] 7133: NM—000164
[12167] Homo sapiens gastric inhibitory polypeptide receptor (GIPR), mRNA
[12168] gi|4503998|ref|NM—000164.1|[4503998]
[12169] 7134: NM—000823
[12170] Homo sapiens growth hormone releasing hormone receptor (GHRHR), mRNA
[12171] gi|4503996|ref|NM—000823.1|[4503996]
[12172] 7135: NM—000163
[12173] Homo sapiens growth hormone receptor (GHR), mRNA
[12174] gi|4503992|ref|NM—000163.1|[4503992]
[12175] 7136: NM—000160
[12176] Homo sapiens glucagon receptor (GCGR), mRNA
[12177] gi|4503946|ref|NM—000160.1|[4503946]
[12178] 7137: NM—003614
[12179] Homo sapiens galanin receptor 3 (GALR3), mRNA
[12180] gi|4503906|ref|NM—003614.1|[4503906]
[12181] 7138: NM—002043
[12182] Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 2 (GABRR2), mRNA
[12183] gi|4503870|ref|NM—002043.1|[4503870]
[12184] 7139: NM—002042
[12185] Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1), mRNA
[12186] gi|4503868|ref|NM—002042.1|[4503868]
[12187] 7140: NM—002036
[12188] Homo sapiens Duffy blood group (FY), mRNA
[12189] gi|4503818|ref|NM—002036.1|[4503818]
[12190] 7141: NM—001462
[12191] Homo sapiens formyl peptide receptor-like 1 (FPRL1), mRNA
[12192] gi|4503780|ref|NM—001462.1|[4503780]
[12193] 7142: NM—002029
[12194] Homo sapiens formyl peptide receptor 1 (FPR1), mRNA
[12195] gi|4503778|ref|NM—002029.1|[4503778]
[12196] 7143: NM—001461
[12197] Homo sapiens flavin containing monooxygenase 5 (FMO5), mRNA
[12198] gi|4503760|ref|NM—001461.1|[4503760]
[12199] 7144: NM—002020
[12200] Homo sapiens fms-related tyrosine kinase 4 (FLT4), mRNA
[12201] gi|4503752|ref|NM—002020.1|[4503752]
[12202] 7145: NM—001459
[12203] Homo sapiens fms-related tyrosine kinase 3 ligand (FLT3LG), mRNA
[12204] gi|4503750|ref|NM—001459.1|[4503750]
[12205] 7146: NM—002019
[12206] Homo sapiens fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) (FLT1), mRNA
[12207] gi|4503748|ref|NM—002019.1|[4503748]
[12208] 7147: NM—002002
[12209] Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23A) (FCER2),
[12210] mRNA
[12211] gi|4503678|ref|NM—002002.1|[4503678]
[12212] 7148: NM—002001
[12213] Homo sapiens Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide (FCER1A), mRNA
[12214] gi|4503674|ref|NM—002001.1|[4503674]
[12215] 7149: NM—003950
[12216] Homo sapiens coagulation factor II (thrombin) receptor-like 3 (F2RL3), mRNA
[12217] gi|4503638|ref|NM—003950.1|[4503638]
[12218] 7150: NM—001981
[12219] Homo sapiens epidermal growth factor receptor pathway substrate 15 (EPS15), mRNA
[12220] gi|4503592|ref|NM—001981.1|[4503592]
[12221] 7151: NM—001974
[12222] Homo sapiens egf-like module containing, mucin-like, hormone receptor-like sequence 1 (EMR1), mRNA
[12223] gi|4503564|ref|NM—001974.1|[4503564]
[12224] 7152: NM—001423
[12225] Homo sapiens epithelial membrane protein 1 (EMP1), mRNA
[12226] gi|4503558|ref|NM—001423.1|[4503558]
[12227] 7153: NM—003757
[12228] Homo sapiens eukaryotic translation initiation factor 3, subunit 2 (beta, 36 kD)
[12229] (EIF3S2), mRNA
[12230] gi|4503512|ref|NM—003757.1|[4503512]
[12231] 7154: NM—001406
[12232] Homo sapiens ephrin-B3 (EFNB3), mRNA
[12233] gi|4503488|ref|NM—001406.1|[4503488]
[12234] 7155: NM—001962
[12235] Homo sapiens ephrin-A5 (EFNA5), mRNA
[12236] gi|4503486|ref|NM—001962.1|[4503486]
[12237] 7156: NM—001405
[12238] Homo sapiens ephrin-A2 (EFNA2), mRNA
[12239] gi|4503484|ref|NM—001405.1|[4503484]
[12240] 7157: NM—003775
[12241] Homo sapiens endothelial differentiation, G-protein-coupled receptor 6 (EDG6),
[12242] mRNA
[12243] gi|4503458|ref|NM—003775.1|[4503458]
[12244] 7158: NM—001945
[12245] Homo sapiens diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor) (DTR), mRNA
[12246] gi|4503412|ref|NM—001945.1|[4503412]
[12247] 7159: NM—001360
[12248] Homo sapiens 7-dehydrocholesterol reductase (DHCR7), mRNA
[12249] gi|4503320|ref|NM—001360.1|[4503320]
[12250] 7160: NM—003467
[12251] Homo sapiens chemokine (C-X-C motif), receptor 4 (fusin) (CXCR4), mRNA
[12252] gi|4503174|ref|NM—003467.1|[4503174]
[12253] 7161: NM—001338
[12254] Homo sapiens coxsackie virus and adenovirus receptor (CXADR), mRNA
[12255] gi|4503172|ref|NM—001338.1|[4503172]
[12256] 7162: NM—003478
[12257] Homo sapiens cullin 5 (CUL5), mRNA
[12258] gi|4503166|ref|NM—003478.1|[4503166]
[12259] 7163: NM—001330
[12260] Homo sapiens cardiotrophin 1 (CTF1), mRNA
[12261] gi|4503120|ref|NM—001330.1|[4503120]
[12262] 7164: NM—000760
[12263] Homo sapiens colony stimulating factor 3 receptor (granulocyte) (CSF3R), mRNA
[12264] gi|4503080|ref|NM—000760.1|[4503080]
[12265] 7165: NM—003805
[12266] Homo sapiens CASP2 and RIPK1 domain containing adaptor with death domain (CRADD), mRNA
[12267] gi|4503030|ref|NM—003805.1|[4503030]
[12268] 7166: NM—001877
[12269] Homo sapiens complement component (3d/Epstein Barr virus) receptor 2 (CR2), mRNA
[12270] gi|4503026|ref|NM—001877.1|[4503026]
[12271] 7167: NM—001842
[12272] Homo sapiens ciliary neurotrophic factor receptor (CNTFR), mRNA
[12273] gi|4502930|ref|NM—001842.1|[4502930]
[12274] 7168: NM—001281
[12275] Homo sapiens cytoskeleton-associated protein 1 (CKAP1), mRNA
[12276] gi|4502848|ref|NM—001281.1|[4502848]
[12277] 7169: NM—000750
[12278] Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 4 (CHRNB4), mRNA
[12279] gi|4502836|ref|NM—000750.1|[4502836]
[12280] 7170: NM—000749
[12281] Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 3 (CHRNB3), mRNA
[12282] gi|4502834|ref|NM—000749.1|[4502834]
[12283] 7171: NM—000748
[12284] Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) (CHRNB2), mRNA
[12285] gi|4502832|ref|NM—000748.1|[4502832]
[12286] 7172: NM—000746
[12287] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 7 (CHRNA7),
[12288] gi|4502830|ref|NM—000746.1|[4502830]
[12289] 7173: NM—000745
[12290] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 5 (CHRNA5), mRNA
[12291] gi|4502828|ref|NM—000745.1|[4502828]
[12292] 7174: NM—000744
[12293] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 4 (CHRNA4), mRNA
[12294] gi|4502826|ref|NM—000744.1|[4502826]
[12295] 7175: NM—000742
[12296] Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) (CHRNA2), mRNA
[12297] gi|4502822|ref|NM—000742.1|[4502822]
[12298] 7176: NM—000741
[12299] Homo sapiens cholinergic receptor, muscarinic 4 (CHRM4), mRNA
[12300] gi|4502820|ref|NM—000741.1|[4502820]
[12301] 7177: NM—000740
[12302] Homo sapiens cholinergic receptor, muscarinic 3 (CHRM3), mRNA
[12303] gi|4502818|ref|NM—000740.1|[4502818]
[12304] 7178: NM—000739
[12305] Homo sapiens cholinergic receptor, muscarinic 2 (CHRM2), mRNA
[12306] gi|4502816|ref|NM—000739.1|[4502816]
[12307] 7179: NM—000738
[12308] Homo sapiens cholinergic receptor, muscarinic 1 (CHRM1), mRNA
[12309] gi|4502814|ref|NM—000738.1|[4502814]
[12310] 7181: NM—001768
[12311] Homo sapiens CD8 antigen, alpha polypeptide (p32) (CD8A), mRNA
[12312] gi|4502688|ref|NM—001768.1|[4502688]
[12313] 7182: NM—001781
[12314] Homo sapiens CD69 antigen (p60, early T-cell activation antigen) (CD69), mRNA
[12315] gi|4502680|ref|NM—001781.1|[4502680]
[12316] 7183: NM—001779
[12317] Homo sapiens CD58 antigen, (lymphocyte function-associated antigen 3) (CD58), mRNA
[12318] gi|4502676|ref|NM—001779.1|[4502676]
[12319] 7184: NM—000733
[12320] Homo sapiens CD3E antigen, epsilon polypeptide (TiT3 complex) (CD3E), mRNA
[12321] gi|4502670|ref|NM—000733.1|[4502670]
[12322] 7185: NM—000732
[12323] Homo sapiens CD3D antigen, delta polypeptide (TiT3 complex) (CD3D), mRNA
[12324] gi|4502668|ref|NM—000732.1|[4502668]
[12325] 7186: NM—001775
[12326] Homo sapiens CD38 antigen (p45) (CD38), mRNA
[12327] gi|4502664|ref|NM—001775.1|[4502664]
[12328] 7187: NM—001767
[12329] Homo sapiens CD2 antigen (p50), sheep red blood cell receptor (CD2), mRNA
[12330] gi|4502652|ref|NM—001767.1|[4502652]
[12331] 7188: NM—001837
[12332] Homo sapiens chemokine (C-C motif) receptor 3 (CCR3), mRNA
[12333] gi|4502636|ref|NM—001837.1|[4502636]
[12334] 7189: NM—000731
[12335] Homo sapiens cholecystokinin B receptor (CCKBR), mRNA
[12336] gi|4502608|ref|NM—000731.1|[4502608]
[12337] 7190: NM—000730
[12338] Homo sapiens cholecystokinin A receptor (CCKAR), mRNA
[12339] gi|4502606|ref|NM—000730.1|[4502606]
[12340] 7191: NM—001742
[12341] Homo sapiens calcitonin receptor (CALCR), mRNA
[12342] gi|4502546|ref|NM—001742.1|[4502546]
[12343] 7192: NM—001737
[12344] Homo sapiens complement component 9 (C9), mRNA
[12345] gi|4502510|ref|NM—001737.1|[4502510]
[12346] 7193: NM—001736
[12347] Homo sapiens complement component 5 receptor 1 (C5a ligand) (C5R1), mRNA
[12348] gi|4502508|ref|NM—001736.1|[4502508]
[12349] 7194: NM—001732
[12350] Homo sapiens butyrophilin, subfamily 1, member A1 (BTN1A1), mRNA
[12351] gi|4502474|ref|NM—001732.1|[4502474]
[12352] 7195: NM—001729
[12353] Homo sapiens betacellulin (BTC), mRNA
[12354] gi|4502460|ref|NM—001729.1|[4502460]
[12355] 7196: NM—001727
[12356] Homo sapiens bombesin-like receptor 3 (BRS3), mRNA
[12357] gi|4502454|ref|NM—001727.1|[4502454]
[12358] 7197: NM—001203
[12359] Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), mRNA
[12360] gi|4502430|ref|NM—001203.1|[4502430]
[12361] 7198: NM—000710
[12362] Homo sapiens bradykinin receptor B1 (BDKRB1), mRNA
[12363] gi|4502390|ref|NM—000710.1|[4502390]
[12364] 7199: NM—003921
[12365] Homo sapiens B-cell CLL/lymphoma 10 (BCL10), mRNA
[12366] gi|4502378|ref|NM—003921.1|[4502378]
[12367] 7200: NM—001168
[12368] Homo sapiens baculoviral IAP repeat-containing 5 (survivin) (BIRC5), mRNA
[12369] gi|4502144|ref|NM—001168.1|[4502144]
[12370] 7201: NM—001150
[12371] Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase
[12372] M, microsomal aminopeptidase, CD13, p150) (ANPEP), mRNA
[12373] gi|4502094|ref|NM—001150.1|[4502094]
[12374] 7202: NM—001146
[12375] Homo sapiens angiopoietin 1 (ANGPT1), mRNA
[12376] gi|4502086|ref|NM—001146.1|[4502086]
[12377] 7203: NM—000676
[12378] Homo sapiens adenosine A2b receptor (ADORA2B), mRNA
[12379] gi|4501950|ref|NM—000676.1|[4501950]
[12380] 7204: NM—000674
[12381] Homo sapiens adenosine A1 receptor (ADORA1), mRNA
[12382] gi|4501946|ref|NM—000674.1-|[4501946]
[12383] 7205: NM—001118
[12384] Homo sapiens adenylate cyclase activating polypeptide 1 (pituitary) receptor type I (ADCYAP1R1), mRNA
[12385] gi|4501922|ref|NM—001118.1|[4501922]
[12386] 7206: AF287270
[12387] Homo sapiens mucolipin (MCOLN1) gene, complete cds
[12388] gi|9844925|gb|AF287270.1|AF287270[9844925]
[12389] 7207: AF287269
[12390] Homo sapiens mucolipin (MCOLN1) mRNA, complete cds
[12391] gi|9844923|gb|AF287269.1|AF287269[9844923]
[12392] 7208: AF307080
[12393] Homo sapiens lectomedin-3 (LEC3) mRNA, complete cds
[12394] gi|11037015|gb|AF307080.1|AF307080[11037015]
[12395] 7209: AF307079
[12396] Homo sapiens lectomedin-2 (LEC2) mRNA, complete cds
[12397] gi|1037013|gb|AF307079.1|AF307079[11037013]
[12398] 7216: AF265242
[12399] Homo sapiens type-I T cell cytokine receptor mRNA, complete cds
[12400] gi|103679|gb|AF265242.1|AF265242[11036791]
[12401] 7217: AF018284
[12402] Homo sapiens P2Y1 receptor (P2YR1) mRNA, partial cds
[12403] gi|2738815|gb|AF018284.1|AF018284[2738815]
[12404] 7218: AF017307
[12405] Homo sapiens Ets-related transcription factor (ERT) mRNA, complete cds
[12406] gi|2338755|gb|AF017307.1|AF017307[2338755]
[12407] 7219: AF106912
[12408] Homo sapiens CRL1 protein (CRL1) mRNA, complete cds
[12409] gi|1022746|gb|AF106912.1|AF106912[11022746]
[12410] 7220: AB042033
[12411] Homo sapiens FCER1B gene for high affinity IgE receptor beta subunit, 5′ flanking sequence and partial cds
[12412] gi|11022658|dbj|AB042033.1|AB042033[11022658]
[12413] 7221: AB019000
[12414] Homo sapiens mRNA for G-protein coupled receptor, complete cds
[12415] gi|11022652|dbj|AB019000.1|AB019000[11022652]
[12416] 7222: AH007076
[12417] Homo sapiens chromosome 13 map 13q34
[12418] gi|3955190|gb|AH007076.1|SEG_HSGRKIN[3955190]
[12419] 7223: AF019765
[12420] Homo sapiens G protein-coupled receptor kinase 1 and G protein-coupled receptor
[12421] kinase 1b (GRK1) gene, alternatively spliced, alternative exon 6, exon 7, and partial cds
[12422] gi|3955189|gb|AF019765.1|HSGRKIN2[3955189]
[12423] 7224: AF019764
[12424] Homo sapiens G protein-coupled receptor kinase 1 and G protein-coupled receptor
[12425] kinase 1b (GRK1) gene, alternatively spliced, exon 6, alternative exon 6, and partial cds
[12426] gi|3955188|gb|AF019764.1|HSGRKIN1[3955188]
[12427] 7225: AF035819
[12428] Homo sapiens macrophage receptor MARCO mRNA, complete cds
[12429] gi|3002790|gb|AF035819.1|AF035819[3002790]
[12430] 7227: AF253318
[12431] Homo sapiens GFR receptor alpha 4 protein (GFRA4) mRNA, complete cds
[12432] gi|10998399|gb|AF253318.1|AF253318[10998399]
[12433] 7228: AF077186
[12434] Homo sapiens neuronal nicotinic acetylcholine receptor beta 2 (CHRNB2) gene, complete cds
[12435] gi|10947140|gb|AF077186.2|[10947140]
[12436] 7229: AF272363
[12437] Homo sapiens neuromedin U receptor 2 (NMUR2) mRNA, complete cds
[12438] gi|10946202|gb|AF272363.1|AF272363[10946202]
[12439] 7230: AF272362
[12440] Homo sapiens neuromedin U receptor 1 (NMUR1) mRNA, complete cds
[12441] gi|10946200|gb|AF272362.1|AF272362[10946200]
[12442] 7231: AJ277437
[12443] Homo sapiens mRNA for fibroblast growth factor receptor-like protein 1, (FGFRL1 gene)
[12444] gi|10944886|emb|AJ277437.1|HSA277437[10944886]
[12445] 7232: G64264
[12446] Alk4/3′ Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site
[12447] gi|9802476|gb|G64264.1|G64264[9802476]
[12448] 7233: G64261
[12449] AMHR2/ex1-2 Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site
[12450] gi|9802473|gb|G64261.1|G64261[9802473]
[12451] 7234: G64251
[12452] Alk4/ex1 Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site
[12453] gi|9802463|gb|G64251.1|G64251[9802463]
[12454] 7235: G64250
[12455] Alk1/ex10 Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site
[12456] gi|9802462|gb|G64250.1|G64250[9802462]
[12457] 7236: G64249
[12458] Alk1/ex2 Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site
[12459] gi|9802461|gb|G64249.1|G64249[9802461]
[12460] 7237: AF301005
[12461] Homo sapiens gamma-aminobutyric acid receptor GABA-B1e mRNA, complete cds
[12462] gi|10863757|gb|AF301005.1|AF301005[10863757]
[12463] 7238: AF269133
[12464] Homo sapiens novel interleukin receptor (NILR) mRNA, complete cds
[12465] gi|10801191|gb|AF269133.1|AF269133[10801190]
[12466] 7239: AF127670
[12467] Homo sapiens hyaluronic acid receptor (HAR) mRNA, complete cds
[12468] gi|10800121|gb|AF127670.2|AF127670[10800121]
[12469] 7241: AF284436
[12470] Homo sapiens TIGIRR-1 mRNA, complete cds
[12471] gi|10644689|gb|AF284436.1|AF284436[10644689]
[12472] 7242: AF284435
[12473] Homo sapiens TIGIRR-2 mRNA, complete cds
[12474] gi|10644687|gb|AF284435.1|AF284435[10644687]
[12475] 7243: AF284434
[12476] Homo sapiens IL-1Rrp2 mRNA, complete cds
[12477] gi|10644685|gb|AF284434.1|AF284434[10644685]
[12478] 7244: M35198
[12479] Homo sapiens integrin beta-subunit mRNA, complete cds
[12480] gi|9961228|gb|M35198.3|HUMINTB6A[9961228]
[12481] 7245: AF302903
[12482] Homo sapiens vomeronasal receptor 1 (VNR19I1) mRNA, complete cds
[12483] gi|10732801|gb|AF302903.1|AF302903[10732801]
[12484] 7246: AF286095
[12485] Homo sapiens IL-22 receptor (IL22R) mRNA, complete cds
[12486] gi|10719607|gb|AF286095.1|AF286095[10719607]
[12487] 7248: AF239668
[12488] Homo sapiens CCK-B/gastrin receptor mRNA, complete cds; alternatively spliced
[12489] gi|7677459|gb|AF239668.1|AF239668[7677459]
[12490] 7249: AF029759
[12491] Homo sapiens mutant G protein-coupled receptor STRL33 (STRL33) gene, STRL33-3K allele, complete cds
[12492] gi|10716827|gb|AF029759.1|AF029759[10716827]
[12493] 7250: AB041644
[12494] Homo sapiens gene for cysteinyl leukotriene receptor like receptor, complete cds
[12495] gi|10716135|dbj|AB041644.1|AB041644[10716135]
[12496] 7251: AF237381
[12497] Homo sapiens CCR3 gene and exon 3
[12498] gi|10643653|gb|AF237381.1|AF237380S2[10643653]
[12499] 7252: AF237380
[12500] Homo sapiens CCR3 gene, promotor and exon 1
[12501] gi|10643652|gb|AF237380.1|AF237380S1[10643652]
[12502] 7253: AH009867
[12503] Homo sapiens
[12504] gi|10643651|gb|AH009867.1|SEG_AF237380S[10643651]
[12505] 7254: AF233516
[12506] Homo sapiens PD-1-ligand precursor, mRNA, complete cds
[12507] gi|10567621|gb|AF233516.1|AF233516[10567621]
[12508] 7255: AJ297688
[12509] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 1 and joined CDS
[12510] gi|0445329|emb|AJ297688.1|HSA297688[10445329]
[12511] 7256: AJ297701
[12512] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exons 16-gi|10443220|emb|AJ297701.1|HSA297701[10443220]
[12513] 7257: AJ297700
[12514] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 15
[12515] gi|10443219|emb|AJ297700.1|HSA297700[10443219]
[12516] 7258: AJ297699
[12517] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 14
[12518] gi|10443218|emb|AJ297699.1|HSA297699[10443218]
[12519] 7259: AJ297698
[12520] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 13
[12521] gi|0443217|emb|AJ297698.1HSA297698[10443217]
[12522] 7260: AJ297697
[12523] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 12
[12524] gi|10443216|emb|AJ297697.1|HSA297697[10443216]
[12525] 7261: AJ297696
[12526] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 11
[12527] gi|10443215|emb|AJ297696.1|HSA297696[10443215]
[12528] 7262: AJ297695
[12529] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 10
[12530] gi|10443214|emb|AJ297695.1|HSA297695[10443214]
[12531] 7263: AJ297694
[12532] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 9
[12533] gi|10443213|emb|AJ297694.1|HSA297694[10443213]
[12534] 7264: AJ297693
[12535] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 8
[12536] gi|10443212|emb|AJ297693.1|HSA297693[10443212]
[12537] 7265: AJ297692
[12538] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exons 6-7
[12539] gi|0443211|emb|AJ297692.1|HSA297692[10443211]
[12540] 7266: AJ297691
[12541] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 5
[12542] gi|0443210|emb|AJ297691.1|HSA297691[10443210]
[12543] 7267: AT2976910
[12544] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 4
[12545] gi|10443209|emb|AJ297690.1|HSA297690[10443209]
[12546] 7268: AJ297689
[12547] Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exons 2-3
[12548] gi|10443208|emb|AJ297689.1|HSA297689[10443208]
[12549] 7269: AJ276452
[12550] Homo sapiens partial pIgR gene for polymeric immunoglobulin receptor, partial intron 1 and partial exon 2
[12551] gi|10303247|emb|AJ276452.1|HSA276452[10303247]
[12552] 7271: AF254664
[12553] Homo sapiens cysteinyl leukotriene receptor CYSLT2 gene, complete cds
[12554] gi|10442007|gb|AF254664.1|AF254664[10442007]
[12555] 7273: AC005330
[12556] Homo sapiens chromosome 19, cosmid R34047 and overlapping PCR product, complete
[12557] sequence
[12558] gi|10305189|gb|AC005330.2|AC005330[10305189]
[12559] 7517: AF176039
[12560] Homo sapiens high mobility group protein-R mRNA, complete cds
[12561] gi|5834272|gb|AF176039.1|AF176039[5834272]
[12562] 7518: AB041228
[12563] Homo sapiens mRNA for G protein-coupled receptor TGR-1, complete cds
[12564] gi|10257380|dbj|AB041228.1|AB041228[10257380]
[12565] 7519: AF282262
[12566] Homo sapiens GHRH receptor splice variant 4 mRNA, complete cds
[12567] gi|10242297|gb|AF282262.1|AF282262[10242297]
[12568] 7520: AF282261
[12569] Homo sapiens GHRH receptor splice variant 3 mRNA, complete cds
[12570] gi|10242295|gb|AF282261.1|AF282261[10242295]
[12571] 7521: AF282260
[12572] Homo sapiens GHRH receptor splice variant 2 mRNA, complete cds
[12573] gi|10242293|gb|AF282260.1|AF282260[10242293]
[12574] 7522: AF282259
[12575] Homo sapiens GHRH receptor splice variant 1 mRNA, complete cds
[12576] gi|10242291|gb|AF282259.1|AF282259[10242291]
[12577] 7523: X80389
[12578] H. sapiens platelet-derived growth factor alpha receptor DNA
[12579] gi|10241726|emb|X80389.2|HSPDGFAD[10241726]
[12580] 7524: AF177761
[12581] Homo sapiens herstatin (HER-2) mRNA, alternatively spliced, complete cds
[12582] gi|10181232|gb|AF177761.2|AF177761[10181232]
[12583] 7525: AF005058
[12584] Homo sapiens chemokine receptor (CXCR-4) gene, complete cds
[12585] gi|2735718|gb|AF005058.1|AF005058[2735718]
[12586] 7526: AF264716
[12587] Homo sapiens complement receptor type 1 (CR1) gene, CR1*SCR25-HUM1 allele, partial cds
[12588] gi|10185787|gb|AF264716.1|AF264716[10185787]
[12589] 7527: AF264715
[12590] Homo sapiens complement receptor type 1 (CR1) gene, CR1*SCR25-HUM2 allele, partial cds
[12591] gi|10185785|gb|AF264715.1|AF264715[10185785]
[12592] 7528: AF250237
[12593] Homo sapiens orphan G protein-coupled receptor 85 (GPR85) mRNA, complete cds
[12594] gi|10181092|gb|AF250237.2|AF250237[10181092]
[12595] 7533: AF189277
[12596] Homo sapiens leukocyte immunoglobulin-like receptor 1 (LIR1) gene, complete cds
[12597] gi|9954209|gb|AF189277.1|AF189277[9954209]
[12598] 7534: AB010994
[12599] Homo sapiens hedgehog gene, exon 3 and complete cds
[12600] gi|10047225|dbj|AB010994.2|AB010581S3[10047225]
[12601] 7535: AB010993
[12602] Homo sapiens hedgehog gene, exon 2
[12603] gi|10047224|dbj|AB010993.2|AB010581S2[10047224]
[12604] 7536: AB010581
[12605] Homo sapiens hedgehog gene, exon 1
[12606] gi|10047223|dbj|AB010581.2|AB010581S1[10047223]
[12607] 7537: SEG_AB010581S
[12608] Homo sapiens hedgehog gene
[12609] gi|0047222|dbj|SEG_AB010581S[10047222]
[12610] 7538: AX015117
[12611] Sequence 8 from Patent WO9952943
[12612] gi|10041220|emb|AX015117.1|AX015117[10041220]
[12613] 7539: AX015116
[12614] Sequence 7 from Patent WO9952943
[12615] gi|10041219|emb|AX015116.1|AX015116[10041219]
[12616] 7540: AX015115
[12617] Sequence 6 from Patent WO9952943
[12618] gi|10041218|emb|AX015115.1|AX015115[10041218]
[12619] 7541: AX015114
[12620] Sequence 5 from Patent WO9952943
[12621] gi|10041217|emb|AX015114.1|AX015114[10041217]
[12622] 7542: AX015113
[12623] Sequence 4 from Patent WO9952943
[12624] gi|10041216|emb|AX015113.1|AX015113[10041216]
[12625] 7543: AX015112
[12626] Sequence 3 from Patent WO9952943
[12627] gi|10041215|emb|AX015112.1|AX015112[10041215]
[12628] 7544: AX015111
[12629] Sequence 2 from Patent WO9952943
[12630] gi|10041214|emb|AX015111.1|AX015111[10041214]
[12631] 7545: AX015110
[12632] Sequence 1 from Patent WO9952943
[12633] gi|10041213|emb|AX015110.1|AX015110[10041213]
[12634] 7546: AF042080
[12635] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[12636] mRNA, complete cds
[12637] gi|2801556|gb|AF042080.1|AF042080[2801556]
[12638] 7547: AF255342
[12639] Homo sapiens putative pheromone receptor V1RL1 long form (V1RL1) mRNA, complete
[12640] cds
[12641] gi|9988584|gb|AF255342.1|AF255342[9988584]
[12642] 7548: AF254747
[12643] Homo sapiens ROR2 protein (ROR2) gene, exon 2
[12644] gi|9664303|gb|AF254747.1|AF254747S1[9664303]
[12645] 7550: AJ295613
[12646] Homo sapiens partial GHR gene for growth hormone receptor, exon 2
[12647] gi|9968301|emb|AJ295613.1|HSA295613[9968301]
[12648] 7551: AJ278681
[12649] Homo sapiens partial GHR gene for growth hormone receptor, exons 8-10
[12650] gi|9968297|emb|AJ278681.1|HSA278681[9968297]
[12651] 7553: AF217963
[12652] Homo sapiens NRAGE mRNA, complete cds
[12653] gi|9963809|gb|AF217963.1|AF217963[9963809]
[12654] 7554: AF169970
[12655] Homo sapiens complement receptor 1 (CR1) gene, CR1*SCR25-HUM5 allele, exon 29 and partial cds
[12656] gi|9956947|gb|AF169970.1|AF169970[9956947]
[12657] 7555: AF169969
[12658] Homo sapiens complement receptor 1 (CR1) gene, CR1*SCR25-HUM4 allele, exon 29 and partial cds
[12659] gi|9956945|gb|AF169969.1|AF169969[9956945]
[12660] 7556: AB044402
[12661] Homo sapiens mRNA for LTB4 receptor JULF2, complete cds
[12662] gi|9081802|dbj|AB044402.1|AB044402[9081802]
[12663] 7557: U96190
[12664] Homo sapiens p58 NK cell inhibitory receptor NKR-K7 mRNA, partial cds
[12665] gi|2088618|gb|U96190.1|HSU96190[2088618]
[12666] 7558: U96189
[12667] Homo sapiens p58 NK cell inhibitory receptor NKR-K6 mRNA, partial cds
[12668] gi|2088616|gb|U96189.1|HSU96189[2088616]
[12669] 7559: U96188
[12670] Homo sapiens p50 cell activatory receptor NKR-K1 mRNA, partial cds
[12671] gi|2088614|gb|U96188.1|HSU96188[2088614]
[12672] 7560: AF251841
[12673] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 29, 30, and complete cds
[12674] gi|9944844|gb|AF251841.1|F251818S24[9944844]
[12675] 7561: AF251840
[12676] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 27 and
[12677] gi|9944843|gb|AF251840.1F251818S23[9944843]
[12678] 7562: AF251839
[12679] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 26
[12680] gi|99448421|gb|AF251839.1|F251818S22[9944842]
[12681] 7563: AF251838
[12682] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 25
[12683] gi|9944841|gb|AF251838.1|F251818S21[9944841]
[12684] 7564: AF251837
[12685] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 23 and
[12686] gi|9944840|gb|AF251837.1F251818S20[9944840]
[12687] 7565: AF251836
[12688] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 22
[12689] gi|9944839|gb|AF251836.1|F251818S19[9944839]
[12690] 7566: AF251835
[12691] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 20 and
[12692] gi|9944838|gb|AF251835.1|F251818S18[9944838]
[12693] 7567: AF251834
[12694] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 19
[12695] gi|9944837|gb|AF251834.1F251818S17[9944837]
[12696] 7568: AF251833
[12697] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 18
[12698] gi|9944836|gb|AF251833.1|F251818S16[9944836]
[12699] 7569: AF251832
[12700] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 17
[12701] gi|9944835|gb|AF251832.1|F251818S15[9944835]
[12702] 7570: AF251831
[12703] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 16
[12704] gi|9944834|gb|AF251831.1|F251818S14[9944834]
[12705] 7571: AF251830
[12706] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 15
[12707] gi|9944833|gb|AF251830.1|F251818S13[9944833]
[12708] 7572: AF251829
[12709] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 14
[12710] gi|9944832|gb|AF251829.1|F251818S12[9944832]
[12711] 7573: AF251828
[12712] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 13
[12713] gi|9944831|gb|AF251828.1|F251818S11[9944831]
[12714] 7574: AF251827
[12715] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 11 and
[12716] gi|9944830|gb|AF251827.1|F251818S10[9944830]
[12717] 7575: AF251826
[12718] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 9 and
[12719] gi|9944829|gb|AF251826.1|F251818S09[9944829]
[12720] 7576: AF251825
[12721] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 8
[12722] gi|9944828|gb|AF251825.1|F251818S08[9944828]
[12723] 7577: AF251824
[12724] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 7
[12725] gi|9944827|gb|AF251824.1F251818S07[9944827]
[12726] 7578: AF251823
[12727] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 6
[12728] gi|9944826|gb|AF251823.1|F251818S06[9944826]
[12729] 7579: AF251822
[12730] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 5
[12731] gi|9944825|gb|AF251822.1|F251818S05[9944825]
[12732] 7580: AF251821
[12733] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 4
[12734] gi|9944824|gb|AF251821.1|F251818S04[9944824]
[12735] 7581: AF251820
[12736] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 3
[12737] gi|9944823|gb|AF251820.1|F251818S03[9944823]
[12738] 7582: AF251819
[12739] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 2
[12740] gi|9944822|gb|AF251819.1|F251818S02[9944822]
[12741] 7583: AF251818
[12742] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, promoter region and exon 1
[12743] gi|9944821|gb|AF251818.1|F251818S01[9944821]
[12744] 7584: AH009773
[12745] Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, complete cds
[12746] gi|9944820|gb|AH009773.1|SEG_F251818S[9944820]
[12747] 7585: AF189768
[12748] Homo sapiens leukocyte immunoglobulin-like receptor 5 (LIR5) gene, complete cds
[12749] gi|9930102|gb|AF189768.1|AF189768[9930102]
[12750] 7600: AJ245377
[12751] Homo sapiens mRNA for 2B4 NK receptor homologue (h2B4 gene)
[12752] gi|9621661|emb|AJ245377.1|HSA245377[9621661]
[12753] 7601: X07206
[12754] H. sapiens TRGV10 gene, allele V10*A1
[12755] gi|1848182|emb|X07206.1|HSTRGV10[1848182]
[12756] 7603: AF246974
[12757] Homo sapiens toll-like receptor 9 (TLR9) mRNA, partial cds, alternatively spliced
[12758] gi|9887086|gb|AF246974.1|AF246974[9887086]
[12759] 7604: AF246973
[12760] Homo sapiens toll-like receptor 9 (TLR9) mRNA, partial cds, alternatively spliced
[12761] gi|9887084|gb|AF246973.1|AF246973[9887084]
[12762] 7605: AF246972
[12763] Homo sapiens toll-like receptor 9 (TLR9) mRNA, partial cds
[12764] gi|9887082|gb|AF246972.1|AF246972[9887082]
[12765] 7606: AF215826
[12766] Homo sapiens killer-cell Ig-like receptor KIR2DL4v1 (KIR2DL4) gene, KIR2DL4v1 allele, exon 3 and partial cds
[12767] gi|9886965|gb|AF215826.1|AF215826[9886965]
[12768] 7607: AF215825
[12769] Homo sapiens killer-cell Ig-like receptor KIR3DL1v (KIR3DL1) gene, KIR3DL1v allele, exon 3 and partial cds
[12770] gi|9886963|gb|AF215825.1|AF215825[9886963]
[12771] 7608: AB008193
[12772] Homo sapiens genes for leukotriene B4 receptor BLT2, leukotriene B4 receptor BLT1, complete cds
[12773] gi|9229835|gb|AF008193.1|AF008193[9229835]
[12774] 7609: AB029892
[12775] Homo sapiens hBLT2 mRNA for Leukotriene B4 receptor BLT2, complete cds
[12776] gi|9186899|dbj|AB029892.1|AB029892[9186899]
[12777] 7610: AF211978
[12778] Homo sapiens LENG11 mRNA, partial sequence
[12779] gi|9885308|gb|AF211978.1|AF211978[9885308]
[12780] 7611: AF211977
[12781] Homo sapiens LENG10 mRNA, partial sequence
[12782] gi|9885307|gb|AF211977.1|AF211977[9885307]
[12783] 7612: AF211976
[12784] Homo sapiens LENG9 mRNA, partial sequence
[12785] gi|9885306|gb|AF211976.1|AF211976[9885306]
[12786] 7613: AF211975
[12787] Homo sapiens LENG8 mRNA, variant C, partial sequence
[12788] gi|9885305|gb|AF211975.1|AF211975[9885305]
[12789] 7614: AF211974
[12790] Homo sapiens LENG8 mRNA, variant B, partial sequence
[12791] gi|9885304|gb |AF211974.1|AF211974[9885304]
[12792] 7615: AF211973
[12793] Homo sapiens LENG8 mRNA, variant A, partial sequence
[12794] gi|9885303|gb|AF211973.1|AF211973[9885303]
[12795] 7616: AF211972
[12796] Homo sapiens LENG7 mRNA, partial sequence
[12797] gi|9885302|gb|AF211972.1|AF211972[9885302]
[12798] 7617: AF211971
[12799] Homo sapiens LENG6 mRNA, partial sequence
[12800] gi|9885301|gb|AF211971.1|AF211971[9885301]
[12801] 7618: AF211970
[12802] Homo sapiens LENG5 mRNA, partial sequence
[12803] gi|9885300|gb|AF211970.1|AF211970[9885300]
[12804] 7619: AF211969
[12805] Homo sapiens LENG4 mRNA, partial sequence
[12806] gi|9885299|gb|AF211969.1|AF211969[9885299]
[12807] 7620: AF211968
[12808] Homo sapiens LENG3 mRNA, partial sequence
[12809] gi|9885298|gb|AF211968.1|AF211968[9885298]
[12810] 7621: AF211967
[12811] Homo sapiens LENG2 mRNA, partial sequence
[12812] gi|9885297|gb|AF211967.1|AF211967[9885297]
[12813] 7622: AF211966
[12814] Homo sapiens LENG1 protein (LENG1) mRNA, partial cds
[12815] gi|9885295|gb|AF211966.1|AF211966[9885295]
[12816] 7624: AF262016
[12817] Homo sapiens adrenergic receptor alpha-2A gene, complete cds
[12818] gi|986478|gb|AF262016.2|AF262016[9864781]
[12819] 7626: AF242865
[12820] Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene, exon 7 and complete cds
[12821] gi|9858570|gb|AF242865.1|AF242862S4[9858570]
[12822] 7627: AF242864
[12823] Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene, exons 2 through 6
[12824] gi|9858569|gb|AF242864.1|AF242862S3[9858569]
[12825] 7629: AF242862
[12826] Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene, exon 1
[12827] gi|9858567|gb|AF242862.1|AF242862S1[9858567]
[12828] 7630: AH009718
[12829] Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene, complete cds
[12830] gi|9858566|gb|AH009718.1|SEG_AF242862S[9858566]
[12831] 7631: AF257210
[12832] Homo sapiens G-protein coupled receptor HLWAR77 mRNA, complete cds
[12833] gi|9309468|gb|AF257210.1|AF257210[9309468]
[12834] 7632: AF292403
[12835] Homo sapiens type B natriuretic peptide receptor gene, promoter region and partial cds
[12836] gi|9858187|gb|AF292403.1|AF292403[9858187]
[12837] 7633: AF288571
[12838] Homo sapiens lymphoid enhancer factor-1 (LEF1) mRNA, complete cds
[12839] gi|9858157|gb|AF288571.1|AF288571[9858157]
[12840] 7634: AF146747
[12841] Homo sapiens cell surface receptor (PRV1) mRNA, complete cds
[12842] gi|9857660|gb|AF146747.1|AF146747[9857660]
[12843] 7862: AF233092
[12844] Homo sapiens lysophosphatidic acid G protein-coupled receptor 4 (EDG4) mRNA, complete cds
[12845] gi|7243675|gb|AF233092.1|AF233092[7243675]
[12846] 7863: AF269144
[12847] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 10 and complete
[12848] cds
[12849] gi|9802369|gb|AF269144.1|F269135S10[9802369]
[12850] 7864: AF269143
[12851] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 9
[12852] gi|9802368|gb|AF2691430.1F269135S09[9802368]
[12853] 7865: AF269142
[12854] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 8
[12855] gi|9802367|gb|AF269142.1|F269135S08[9802367]
[12856] 7866: AF269141
[12857] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 7
[12858] gi|9802366|gb|AF269141.1F269135S07[9802366]
[12859] 7867: AF269140
[12860] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 6
[12861] gi|9802365|gb|AF269140.1|F269135S06[9802365]
[12862] 7868: AF269139
[12863] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 5
[12864] gi|9802364|gb|AF269139.1|F269135S05[9802364]
[12865] 7869: AF269138
[12866] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 4
[12867] gi|9802363|gb|AF269138.1F269135S04[9802363]
[12868] 7870: AF269137
[12869] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 3
[12870] gi|9802362|gb|AF269137.1|F269135S03[9802362]
[12871] 7871: AF269136
[12872] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 2
[12873] gi|980236|gb|AF269136.1|F269135S02[9802361]
[12874] 7872: AF269135
[12875] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 1
[12876] gi|9802360|gb|AF269135.1|F269135S01[9802360]
[12877] 7873: AH009710
[12878] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, complete cds
[12879] gi|9802359|gb|AH009710.1|SEG_F269135S[9802359]
[12880] 7874: AF211942
[12881] Homo sapiens haplotype 1089 olfactory receptor (OR2H3) gene, partial cds
[12882] gi|9798923|gb|AF211942.1|AF211942[9798923]
[12883] 7875: AF211941
[12884] Homo sapiens haplotype 1037 olfactory receptor (OR2H3) gene, partial cds
[12885] gi|9798921|gb|AF211941.1|AF211941[9798921]
[12886] 7876: AF211940
[12887] Homo sapiens haplotype 1012 olfactory receptor (OR2H3) gene, partial cds
[12888] gi|9798919|gb|AF211940.1|AF211940[9798919]
[12889] 7877: AF211939
[12890] Homo sapiens haplotype 1013 olfactory receptor (OR2H3) gene, partial cds
[12891] gi|9798917|gb|AF211939.1|AF211939[9798917]
[12892] 7878: AJ272029
[12893] Homo sapiens partial CD30 gene for cytokine receptor CD30 and promoter region
[12894] gi|9798449|emb|AJ272029.1|HSA272029[9798449]
[12895] 7880: AF101726
[12896] Homo sapiens vasopressin receptor subtype 1b mRNA, complete cds
[12897] gi|4336681|gb|AF101726.1|AF101726[4336681]
[12898] 7881: AF101725
[12899] Homo sapiens vasopressin receptor subtype 1a mRNA, complete cds
[12900] gi|4336679|gb|AF101725.1|AF101725[4336679]
[12901] 7882: AF101728
[12902] Homo sapiens truncated vasopressin receptor type 2 mRNA, complete cds
[12903] gi|4323606|gb|AF101728.1|AF101728[4323606]
[12904] 7883: AF101727
[12905] Homo sapiens vasopressin receptor type 2 mRNA, complete cds
[12906] gi|4323604|gb|AF101727.1|AF101727[4323604]
[12907] 7884: AF064078
[12908] Homo sapiens insulin receptor-related receptor (INSRR) mRNA, partial cds
[12909] gi|3152883|gb|AF064078.1|AF064078[3152883]
[12910] 7885: S82307
[12911] Homo sapiens p65 mRNA, partial cds
[12912] gi|1839613|gb|S82307.1|S82307[1839613]
[12913] 7886: S83176
[12914] Homo sapiens calcium-sensing receptor long isoform (CASR) mRNA, partial cds
[12915] gi|1836093|gb|S83176.1|S83176[1836093]
[12916] 7887: S82755
[12917] Homo sapiens T cell receptor mRNA, partial cds
[12918] gi|1835845|gb|S82755.1|S82755[1835845]
[12919] 7888: S82612
[12920] Homo sapiens 5-hydroxytryptamine type 3AS receptor subunit mRNA, complete cds
[12921] gi|1699437|gb|S82612.1|S82612[1699437]
[12922] 7891: AF238374
[12923] Homo sapiens mutant fibroblast growth factor receptor 3 (FGFR3) mRNA, partial cds
[12924] gi|9719331|gb|AF2383740.1|AF238374[9719331]
[12925] 7894: AJ400843
[12926] Homo sapiens partial mRNA for immunoglobulin-like cell surface receptor FDF03-M14, soluble alternative form
[12927] gi|9715838|emb|AJ400843.1|HSA400843[9715838]
[12928] 7895: AJ400842
[12929] Homo sapiens partial mRNA for immunoglobulin-like cell surface receptor FDF03-dtm, soluble form
[12930] gi|9715835|emb|AJ400842.1|HSA400842[9715835]
[12931] 7896: AJ400841
[12932] Homo sapiens mRNA for immunoglobulin-like cell surface receptor FDF03
[12933] gi|9715833|emb|AJ400841.1|HSA400841[9715833]
[12934] 8061: AJ005205
[12935] Homo sapiens 5HT3 gene for serotonin 3 receptor
[12936] gi|7019744|emb|AJ005205.2|HSA005205[7019744]
[12937] 8062: AB038269
[12938] Homo sapiens mRNA for cysteinyl leukotriene CysLT2 receptor, complete cds; cDNA:
[12939] PSEC0146 from clone PLACE1006979
[12940] gi|9663957|dbj|AB038269.1|AB038269[9663957]
[12941] 8063: AJ278476
[12942] Homo sapiens partial mRNA for transport-secretion protein 2.2, (TTS-2.2 gene)
[12943] gi|9663152|emb|AJ278476.1|HSA278476[9663152]
[12944] 8064: AJ278475
[12945] Homo sapiens partial mRNA for transport-secretion protein 2.1 (TTS-2.1 gene)
[12946] gi|9663150|emb|AJ278475.1|HSA278475[9663150]
[12947] 8065: AF282693
[12948] Homo sapiens inflammation-related G protein-coupled receptor EX33 (EX33) mRNA,
[12949] complete cds
[12950] gi|9652260|gb|AF282693.1|AF282693[9652260]
[12951] 8066: AF254409
[12952] Homo sapiens scavenger receptor class B type III SR-BIII mRNA, partial cds
[12953] gi|9651987|gb|AF254409.1|AF254409[9651987]
[12954] 8067: AF236117
[12955] Homo sapiens G-protein coupled receptor EDG-7 mRNA, complete cds
[12956] gi|9651838|gb|AF236117.1|AF236117[9651838]
[12957] 8068: AF287008
[12958] Homo sapiens triggering receptor expressed on monocytes 1 (TREML) mRNA, complete
[12959] cds
[12960] gi|9624485|gb|AF287008.1|AF287008[9624485]
[12961] 8069: AF172171
[12962] Homo sapiens toll-like receptor 4 (TLR4) gene, exon 4 and complete cds
[12963] gi|9622356|gb|AF172171.1|HSTLR3[9622356]
[12964] 8070: AF172170
[12965] Homo sapiens toll-like receptor 4 (TLR4) genie, exons 2 and 3
[12966] gi|9622355|gb|AF172170.1|HSTLR2[9622355]
[12967] 8071: AF172169
[12968] Homo sapiens toll-like receptor 4 (TLR4) gene, exon 1
[12969] gi|9622354|gb|AF172169.1|HSTLR1[9622354]
[12970] 8072: AH009665
[12971] Homo sapiens toll-like receptor 4 (TLR4) gene, complete cds
[12972] gi|9622353|gb|AH009665.1|SEG_HSTLR[9622353]
[12973] 8073: AF165312
[12974] Homo sapiens pre-T-cell receptor alpha chain (PTA) mRNA, alternatively spliced,
[12975] complete cds
[12976] gi|9621867|gb|AF165312.1|AF165312[9621867]
[12977] 8074: AJ245375
[12978] Homo sapiens mRNA for PP35 act (h2B4 gene)
[12979] gi|9621657|emb|AJ245375.1|HSA245375[9621657]
[12980] 8075: AF277230
[12981] Homo sapiens seven transmembrane receptor BLTR2 (BLTR2) mRNA, complete cds
[12982] gi|8896158|gb|AF277230.1|AF277230[8896158]
[12983] 8076: AF114491
[12984] Homo sapiens EGF-like module EMR2 (EMR2) mRNA, complete cds
[12985] gi|6650688|gb|AF114491.1|AF114491[6650688]
[12986] 8077: AF107259
[12987] Homo sapiens chromosome 21q22.1 cosmid clone ICRFcA0552D2, complete sequence, containing part of the glutamate receptor gene GLUR5
[12988] gi|4154320|gb|AF107259.1|AF107259[4154320]
[12989] 8078: AF107257
[12990] Homo sapiens chromosome 21q22.1 PAC L12209, complete sequence
[12991] gi|4106881|gb|AF107257.1|AF107257[4106881]
[12992] 8079: AZ081535
[12993] p133B6#4 RPCI-6 Homo sapiens genomic, genomic survey sequence
[12994] gi|9587541|gb|AZ081535.1|AZ081535[9587541]
[12995] 8081: AF285168
[12996] Homo sapiens GABA-A receptor beta 1 subunit (GABRB1) gene, promoter and partial
[12997] cds
[12998] gi|9502261|gb|AF285168.1|AF285168[9502261]
[12999] 8126: AC018755
[13000] Homo sapiens chromosome 19, BAC BC330783 (CIT-HSPC—470E3), complete sequence
[13001] gi|9454515|gb|AC018755.3|AC018755[9454515]
[13002] 8159: AF246303
[13003] Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 9 and complete cds
[13004] gi|7417394|gb|AF246303.1|AF246296S8[7417394]
[13005] 8160: AF246302
[13006] Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exons 7 and 8
[13007] gi|7417393|gb|AF246302.1|AF246296S7[7417393]
[13008] 8161: AF246301
[13009] Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 6
[13010] gi|7417392|gb|AF246301.1|AF246296S6[7417392]
[13011] 8162: AF246300
[13012] Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 5
[13013] gi|741739|gb|AF246300.1|AF246296S5[7417391]
[13014] 8163: AF246299
[13015] Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 4
[13016] gi|7417390|gb|AF246299.1|AF246296S4[7417390]
[13017] 8164: AF246298
[13018] Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 3
[13019] gi|7417389|gb|AF246298.1|AF246296S3[7417389]
[13020] 8165: AF246297
[13021] Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 2
[13022] gi|7417388|gb|AF246297.1|AF246296S2[7417388]
[13023] 8166: AF246296
[13024] Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, promoter and exon 1
[13025] gi|7417387|gb|AF246296.1|AF246296S1[7417387]
[13026] 8167: AH009223
[13027] Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, complete cds
[13028] gi|7417386|gb|AH009223.1|SEG_AF246296S[7417386]
[13029] 8168: U94888
[13030] Homo sapiens CC-chemokine-binding receptor JAB61 mRNA, complete cds
[13031] gi|2213808|gb|U94888.1|HSU94888[2213808]
[13032] 8169: AB040434
[13033] Homo sapiens mRNA for hTROY, complete cds
[13034] gi|9392329|dbj|AB040434.1|AB040434[9392329]
[13035] 8170: AJ272427
[13036] Homo sapiens mRNA for frizzled homolog 3 (FZD3 gene)
[13037] gi|7649448|emb|AJ272427.1|HSA272427[7649448]
[13038] 8173: U88356
[13039] Homo sapiens receptor tyrosine kinase ErbB-3 (c-erbB-3) gene, exons 12, 13, 14, and partial cds
[13040] gi|9294704|gb|U88356.1|HSCERBR3[9294704]
[13041] 8174: U88355
[13042] Homo sapiens receptor tyrosine kinase ErbB-3 (c-erbB-3) gene, exon 10 and partial cds
[13043] gi|9294703|gb|U88355.1|HSCERBR2[9294703]
[13044] 8175: U88354
[13045] Homo sapiens receptor tyrosine kinase ErbB-3 (c-erbB-3) gene, exons 8 and 9
[13046] gi|9294702|gb|U88354.1|HSCERBR1[9294702]
[13047] 8176: AB037533
[13048] Homo sapiens HTR1F gene for 5-hydroxytryptamine (serotonin) receptor 1F, partial
[13049] cds
[13050] gi|6815236|dbj|AB037533.1|AB037533[6815236]
[13051] 8177: AB037513
[13052] Homo sapiens HTR2A gene for 5-hydroxytryptamine (serotonin) receptor 2A, partial
[13053] cds
[13054] gi|6815196|dbj|AB037513.1|AB037513[6815196]
[13055] 8178: AF180301
[13056] Homo sapiens corticotropin-releasing factor receptor variant id (CRHR1) mRNA, alternative splice product, complete cds
[13057] gi|5815472|gb|AF180301.1|AF180301[5815472]
[13058] 8181: AF208111
[13059] Homo sapiens truncated IL-17 receptor homolog precursor (EVI27) mRNA, complete
[13060] cds
[13061] gi|9246434|gb|AF208111.1|AF208111[9246434]
[13062] 8182: AF208110
[13063] Homo sapiens IL-17 receptor homolog precursor (EVI27) mRNA, complete cds
[13064] gi|9246432|gb|AF208110.1|AF208110[9246432]
[13065] 8183: M15222
[13066] Homo sapiens T-cell receptor (TCRB) mRNA, partial cds
[13067] gi|338893|gb|M15222.1|HUMTCBVO[338893]
[13068] 8189: AF263279
[13069] Homo sapiens CD164 mRNA, complete cds
[13070] gi|9230740|gb|AF263279.1|AF263279[9230740]
[13071] 8192: AF242874
[13072] Homo sapiens neuromedin U receptor 2 (NMU2R) mRNA, complete cds
[13073] gi|9082155|gb|AF242874.1|AF242874[9082155]
[13074] 8193: AF160477
[13075] Homo sapiens Ig superfamily receptor LNIR precursor, mRNA, complete cds
[13076] gi|9049507|gb|AF160477.1|AF160477[9049507]
[13077] 8194: AF058290
[13078] Homo sapiens imidazoline receptor antisera-selected protein mRNA, partial cds
[13079] gi|3493224|gb|AF058290.1|AF058290[3493224]
[13080] 8195: AF082516
[13081] Homo sapiens I-1 receptor candidate protein mRNA, complete cds
[13082] gi|3462806|gb|AF082516.1|AF082516[3462806]
[13083] 8211: X06031
[13084] Homo sapiens partial T-cell receptor CD3-gamma gene, exon 6
[13085] gi|36818|emb|X06031.1|HSTCR3G6[36818]
[13086] 8212: X06030
[13087] Homo sapiens partial T-cell receptor CD3-gamma gene, exon 5
[13088] gi|36816|emb|X06030.1|HSTCR3G5[36816]
[13089] 8213: X06029
[13090] Homo sapiens partial T-cell receptor CD3-gamma gene exon 4
[13091] gi|36814|emb|X06029.1|HSTCR3G4[36814]
[13092] 8214: X06027
[13093] Homo sapiens partial CD3G gene, exon 2 (and joined mature peptide)
[13094] gi|36811|emb|X06027.1|HSTCR3G2[36811]
[13095] 8216: Z30426
[13096] H. sapiens gene for early lymphocyte activation antigen CD69, exon 1
[13097] gi|525242|emb|Z30426.1|HSLACD691[525242]
[13098] 8302: AJ278605
[13099] Homo sapiens BLT-2R gene for leukotriene B4 receptor 2
[13100] gi|8919627|emb|AJ278605.1|HSA278605[8919627]
[13101] 8444: AF246925
[13102] Homo sapiens haplotype 28 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13103] gi|880984|gb|AF246925.1|AF246925[8809841]
[13104] 8445: AF246924
[13105] Homo sapiens haplotype 27 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13106] gi|8809840|gb|AF246924.1|AF246924[8809840]
[13107] 8446: AF246923
[13108] Homo sapiens haplotype 26 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13109] gi|8809839|gb|AF246923.1|AF246923[8809839]
[13110] 8447: AF246922
[13111] Homo sapiens haplotype 24 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13112] gi|8809838|gb|AF246922.1|AF246922[8809838]
[13113] 8448: AF246921
[13114] Homo sapiens haplotype 23 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13115] gi|8809837|gb|AF246921.1|AF246921[8809837]
[13116] 8449: AF246920
[13117] Homo sapiens haplotype 22 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13118] gi|8809836|gb|AF246920.1|AF246920[8809836]
[13119] 8450: AF246919
[13120] Homo sapiens haplotype 21 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13121] gi|8809835|gb|AF246919.1|AF246919[8809835]
[13122] 8451: AF246918
[13123] Homo sapiens haplotype 20 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13124] gi|8809834|gb|AF246918.1|AF246918[8809834]
[13125] 8452: AF246917
[13126] Homo sapiens haplotype 19 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13127] gi|8809833|gb|AF246917.1|AF246917[8809833]
[13128] 8452: AF246917
[13129] 8453: AF246916
[13130] Homo sapiens haplotype 18 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13131] gi|8809832|gb|AF246916.1|AF246916[8809832]
[13132] 8454: AF246915
[13133] Homo sapiens haplotype 17 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13134] gi|8809831|gb|AF246915.1|AF246915[8809831]
[13135] 8455: AF246914
[13136] Homo sapiens haplotype 16 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13137] gi|8809830|gb|AF246914.1|AF246914[8809830]
[13138] 8456: AF246913
[13139] Homo sapiens haplotype 15 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13140] gi|8809829|gb|AF246913.1|AF246913[8809829]
[13141] 8457: AF246912
[13142] Homo sapiens haplotype 14 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13143] gi|8809828|gb|AF246912.1|AF246912[8809828]
[13144] 8458: AF246911
[13145] Homo sapiens haplotype 13 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13146] gi|8809827|gb|AF246911.1|AF246911[8809827]
[13147] 8459: AF246910
[13148] Homo sapiens haplotype 12 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13149] gi|8809826|gb|AF246910.1|AF246910[8809826]
[13150] 8460: AF246909
[13151] Homo sapiens haplotype 11 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13152] gi|8809825|gb|AF246909.1|AF246909[8809825]
[13153] 8461: AF246908
[13154] Homo sapiens haplotype 10 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13155] gi|8809824|gb|AF246908.1|AF246908[8809824]
[13156] 8462: AF246907
[13157] Homo sapiens haplotype 9 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13158] gi|8809823|gb|AF246907.1|AF246907[8809823]
[13159] 8463: AF246906
[13160] Homo sapiens haplotype 8 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13161] gi|8809822|gb|AF246906.1|AF246906[8809822]
[13162] 8464: AF246905
[13163] Homo sapiens haplotype 7 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13164] gi|8809821|gb|AF246905.1|AF246905[8809821]
[13165] 8465: AF246904
[13166] Homo sapiens haplotype 6 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13167] gi|8809820|gb|AF246904.1|AF246904[8809820]
[13168] 8466: AF246903
[13169] Homo sapiens haplotype 5 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13170] gi|8809819|gb|AF246903.1|AF246903[8809819]
[13171] 8467: AF246902
[13172] Homo sapiens haplotype 4 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13173] gi|8809818|gb|AF246902.1|AF246902[8809818]
[13174] 8468: AF246901
[13175] Homo sapiens haplotype 1 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13176] gi|8809817|gb|AF246901.1|AF246901[8809817]
[13177] 8469: AF246900
[13178] Homo sapiens haplotype 2 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13179] gi|8809816|gb|AF246900.1|AF246900[8809816]
[13180] 8470: AF246899
[13181] Homo sapiens haplotype 3 CC chemokine receptor 5 (CCR5) gene, partial sequence
[13182] gi|8809815|gb|AF246899.1|AF246899[8809815]
[13183] 8471: AF210633
[13184] Homo sapiens growth hormone receptor (GHR) gene, GHR-d3 allele, partial sequence
[13185] gi|8809760|gb|AF210633.1|AF210633[8809760]
[13186] 8472: M22057
[13187] Homo sapiens T-cell receptor epsilon (CD3E) gene, exon 5 and partial cds
[13188] gi|339220|gb|M22057.1|HUMTCR3E[339220]
[13189] 8476: AF212311
[13190] Homo sapiens interleukin 20 (IL20) mRNA, complete cds
[13191] gi|8705219|gb|AF2123110.1|AF212311[8705219]
[13192] 8477: AF141334
[13193] Homo sapiens placenta apolipoprotein B48 receptor type 2 (APOB48R) mRNA, complete cds
[13194] gi|8699629|gb|AF141334.1|AF141334[8699629]
[13195] 8478: AF277379
[13196] Homo sapiens vitamin D receptor-interacting protein complex component DRIP100 (DRIP100) mRNA, complete cds
[13197] gi|8699627|gb|AF277379.1|AF277379[8699627]
[13198] 8480: AJ251962
[13199] Homo sapiens partial TGF-beta III receptor gene
[13200] gi|6634455|emb|AJ251962.1|HSA251962[6634455]
[13201] 8481: AJ251961
[13202] Homo sapiens partial mRNA for betaglycan (TBR III gene)
[13203] gi|6634453|emb|AJ251961.1|HSA251961[6634453]
[13204] 8483: AF062039
[13205] Homo sapiens integrin alpha-2 subunit (ITGA2) gene, ITGA2-1 allele, partial cds
[13206] gi|8574452|gb|AF062039.1|AF062039[8574452]
[13207] 8485: AF141333
[13208] Homo sapiens apolipoprotein B48 receptor (APOB48R) gene, complete cds
[13209] gi|8547065|gb|AF141333.1|AF141333[8547065]
[13210] 8486: AF141332
[13211] Homo sapiens apolipoprotein B48 receptor (APOB48R) mRNA, complete cds
[13212] gi|8547063|gb|AF141332.1|AF141332[8547063]
[13213] 8488: X56253
[13214] Homo sapiens partial MPR46 gene for 46 kd mannose 6-phosphate receptor, exon 1 and join mRNA
[13215] gi|34727|emb|X56253.1|HSMPR461[34727]
[13216] 8489: AF155912
[13217] Homo sapiens growth hormone receptor (GHR) gene, exon 3 and partial cds
[13218] gi|8037572|gb|AF155912.1|AF155912[8037572]
[13219] 8490: AF263744
[13220] Homo sapiens erbb2-interacting protein ERBIN mRNA, complete cds
[13221] gi|8572220|gb|AF263744.1|AF263744[8572220]
[13222] 8501: X56254
[13223] Homo sapiens partial MPR46 gene for 46 kd mannose 6-phosphate receptor, exon 2 join CDS
[13224] gi|34729|emb|X56254.1|HSMPR462[34729]
[13225] 8503: AB040801
[13226] Homo sapiens mRNA for SREB3, complete cds
[13227] gi|8467969|dbj|AB040801.1|AB040801[8467969]
[13228] 8504: AB040800
[13229] Homo sapiens mRNA for SREB2, complete cds
[13230] gi|8467967|dbj|AB040800.1|AB040800[8467967]
[13231] 8505: AB040799
[13232] Homo sapiens mRNA for SREB1, complete cds
[13233] gi|8467965|dbj|AB040799.1|AB040799[8467965]
[13234] 8506: AF187064
[13235] Homo sapiens p75NTR-associated cell death executor (NADE) mRNA, complete cds
[13236] gi|8452893|gb|AF187064.1|AF187064[8452893]
[13237] 8507: AF045606
[13238] Homo sapiens C21orf4 mRNA, complete cds
[13239] gi|8277249|gb|AF045606.2|AF045606[8277249]
[13240] 8508: AF204920
[13241] Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48b variant, exon 5
[13242] gi|8248132|gb|AF204920.1|AF204918S3[8248132]
[13243] 8509: AF204919
[13244] Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48b variant, exon 4
[13245] gi|8248131|gb|AF204919.1|AF204918S2[8248131]
[13246] 8510: AF204918
[13247] Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48b variant, exons 4
[13248] and 3
[13249] gi|8248130|gb|AF204918.1|AF204918S1[8248130]
[13250] 8511: AH009422
[13251] Homo sapiens
[13252] gi|8248129|gb|AH009422.1|SEG_AF204918S[8248129]
[13253] 8512: AF204917
[13254] Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48a variant, exon 5
[13255] gi|8248128|gb|AF204917.1|AF204915S3[8248128]
[13256] 8513: AF204916
[13257] Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48a variant, exon 4
[13258] gi|8248127|gb|AF204916.1|AF204915S2[8248127]
[13259] 8514: AF204915
[13260] Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48a variant, exons 2
[13261] and 3
[13262] gi|8248126|gb|AF204915.1|AF204915S1[8248126]
[13263] 8515: AH009421
[13264] Homo sapiens
[13265] gi|8248125|gb|AH009421.1|SEG_AF204915S[8248125]
[13266] 8516: AF204914
[13267] Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44b variant, exon 5
[13268] gi|8248124|gb|AF204914.1|AF204912S3[8248124]
[13269] 8517: AF204913
[13270] Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44b variant, exon 4
[13271] gi|8248123|gb|AF204913.1|AF204912S2[8248123]
[13272] 8518: AF204912
[13273] Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44b variant, exons 2
[13274] and 3
[13275] gi|8248122|gb|AF204912.1|AF204912S1[8248122]
[13276] 8519: AH009420
[13277] Homo sapiens
[13278] gi|8248121|gb|AH009420.1|SEG_AF204912S[8248121]
[13279] 8520: AF204911
[13280] Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44a variant, exon
[13281] 5
[13282] gi|8248120|gb|AF204911.1|AF204909S3[8248120]
[13283] 8521: AF204910
[13284] Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44a variant, exon 4
[13285] gi|8248119|gb|AF204910.1|AF204909S2[8248119]
[13286] 8522: AF204909
[13287] Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44a variant, exons
[13288] 2
[13289] and 3
[13290] gi|8248118|gb|AF204909.1|AF204909S1[8248118]
[13291] 8523: AH009419
[13292] Homo sapiens
[13293] gi|8248117|gb|AH009419.1|SEG_AF204909S[8248117]
[13294] 8524: AF204905
[13295] Homo sapiens killer cell Ig-like receptor (KIR2DL5) gene, KIR2DL5.2 variant, partial sequence
[13296] gi|8248112|gb|AF204905.1|AF204905[8248112]
[13297] 8525: AF204904
[13298] Homo sapiens killer cell Ig-like receptor (KIR2DL5) gene, KIR2DL5.1 variant, partial cds
[13299] gi|8248110|gb|AF204904.1|AF204904[8248110]
[13300] 8607: AF212842
[13301] Homo sapiens immunoglobulin-like transcript 11 protein (ILT11) mRNA, partial cds
[13302] gi|8163785|gb|AF212842.1|AF212842[8163785]
[13303] 8608: AF208237
[13304] Homo sapiens 7-transmembrane G-protein coupled receptor 2 (GPR2) mRNA, complete
[13305] cds
[13306] gi|8118034|gb|AF208237.1|AF208237[8118034]
[13307] 8609: AF204903
[13308] Homo sapiens killer-cell immunoglobulin-like receptor KIR2DL5.1 (KIR2DL5) mRNA,
[13309] complete cds
[13310] gi|8117976|gb|AF204903.1|AF204903[8117976]
[13311] 8610: AP001716
[13312] Homo sapiens genomic DNA, chromosome 21q, section 60/105
[13313] gi|7768717|dbj|AP001716.1|AP001716[7768717]
[13314] 8611: AP001705
[13315] Homo sapiens genomic DNA, chromosome 21q, section 49/105
[13316] gi|7768711|dbj|AP001705.1|AP001705[7768711]
[13317] 8612: AP001670
[13318] Homo sapiens genomic DNA, chromosome 21q, section 14/105
[13319] gi|7768690|dbj|AP001670.1|AP001670[7768690]
[13320] 8613: AP001717
[13321] Homo sapiens genomic DNA, chromosome 21q, section 61/105
[13322] gi|7768678|dbj|AP001717.1|AP001717[7768678]
[13323] 8616: AJ012074
[13324] Homo sapiens VPAC1 receptor gene, 5′ end and promoter region
[13325] gi|3758828|emb|AJ012074.1|HSA012074[3758828]
[13326] 8617: AF039906
[13327] Homo sapiens cosmid D16B8, chromosome 21 3′ of IFNGR2
[13328] gi|2914756|gb|AF039906.1|AF039906[2914756]
[13329] 8619: S77335
[13330] Homo sapiens growth hormone receptor gene, partial cds
[13331] gi|999143|gb|S77335.1|S77335[999143]
[13332] 8621: S75765
[13333] Homo sapiens delta CCK-B gene, partial cds
[13334] gi|913754|gb|S75765.1|S75765[913754]
[13335] 8624: S78717
[13336] Homo sapiens ryanodine receptor (RYR1) gene, partial cds
[13337] gi|244183|gb|S78717.1|S78717[244183]
[13338] 8625: X15266
[13339] Homo sapiens gene for muscarinic acetylcholine receptor HM3
[13340] gi|32323|emb|X15266.1|HSACM3[32323]
[13341] 8626: X15265
[13342] Homo sapiens gene for muscarinic acetylcholine receptor M4
[13343] gi|32321|emb|X15265.1|HSACM4[32321]
[13344] 8627: AF220542
[13345] Homo sapiens FCRN protein gene, complete cds
[13346] gi|8101614|gb|AF220542.1|AF220542[8101614]
[13347] 8629: AF073924
[13348] Homo sapiens putative taste receptor HTR2 mRNA, partial cds
[13349] gi|8100088|gb|AF073924.1|AF073924[8100088]
[13350] 8630: D88437
[13351] Homo sapiens mRNA for G-protein coupled receptor SALPR, complete cds
[13352] gi|7340885|dbj|D88437.1|D88437[7340885]
[13353] 8631: AB032369
[13354] Homo sapiens MIST mRNA, partial cds
[13355] gi|8099156|dbj|AB032369.1|AB032369[8099156]
[13356] 8632: AF167555
[13357] Homo sapiens TAJ-alpha mRNA, complete cds
[13358] gi|8071643|gb|AF167555.1|AF167555[8071643]
[13359] 8633: AF002982
[13360] Homo sapiens killer cell receptor (KIR103) mRNA, allele ASD2, complete cds
[13361] gi|2443483|gb|AF002982.1|AF002982[2443483]
[13362] 8634: AF002981
[13363] Homo sapiens killer cell receptor (KIR103) mRNA, allele ASD1, complete cds
[13364] gi|2443481|gb|AF002981.1|AF002981[2443481]
[13365] 8635: AF002980
[13366] Homo sapiens killer cell receptor (KIR103) mRNA, allele AS, complete cds
[13367] gi|2443479|gb|AF002980.1|AF002980[2443479]
[13368] 8636: AF002979
[13369] Homo sapiens killer cell receptor (KIR103) mRNA, allele LP, complete cds
[13370] gi|2443477|gb|AF002979.1|AF002979[2443477]
[13371] 8637: AH005453
[13372] Homo sapiens chromosome 19 clone 4 map 19q13.4
[13373] gi|2228790|gb|AH005453.1|SEG_HSKIR[2228790]
[13374] 8638: AF003123
[13375] Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 8 and complete cds
[13376] gi|2228789|gb|AF003123.1|HSKIR8[2228789]
[13377] 8639: AF003122
[13378] Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 7
[13379] gi|2228788|gb|AF003122.1|HSKIR7[2228788]
[13380] 8640: AF003121
[13381] Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 6
[13382] gi|2228787|gb|AF003121.1|HSKIR6[2228787]
[13383] 8641: AF003120
[13384] Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 5
[13385] gi|2228786|gb|AF003120.1|HSKIR5[2228786]
[13386] 8642: AF003119
[13387] Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 4
[13388] gi|2228785|gb|AF003119.1|HSKIR4[2228785]
[13389] 8643: AF003118
[13390] Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 3
[13391] gi|2228784|gb|AF003118.1|HSKIR3[2228784]
[13392] 8644: AF003117
[13393] Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 2
[13394] gi|2228783|gb|AF003117.1|HSKIR2[2228783]
[13395] 8645: AF003116
[13396] Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 1
[13397] gi|2228782|gb|AF003116.1|HSKIR1[2228782]
[13398] 8646: AF196329
[13399] Homo sapiens triggering receptor expressed on monocytes 1 mRNA, complete cds
[13400] gi|8050526|gb|AF196329.1|AF196329[8050526]
[13401] 8647: AF167342
[13402] Homo sapiens membrane interleukin 1 receptor accessory protein (IL1RAP) gene, exon 12 and complete cds, alternatively spliced
[13403] gi|8050498|gb|AF167342.1|F167333S10[8050498]
[13404] 8648: AF167341
[13405] Homo sapiens membrane interleukin 1 receptor accessory protein (IL1RAP) gene, exons 10 and 11
[13406] gi|8050497|gb|AF167341.1|F167333S09[8050497]
[13407] 8649: AF167340
[13408] Homo sapiens soluble interleukin 1 receptor accessory protein (IL1RAP) gene, exon 8, alternative exons 9 and complete cds, alternatively spliced
[13409] gi|8050496|gb|AF167340.1|F167333S08[8050496]
[13410] 8650: AF167339
[13411] Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 7
[13412] gi|8050495|gb|AF167339.1|F167333S07[8050495]
[13413] 8651: AF167338
[13414] Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 6
[13415] gi|8050494|gb|AF167338.1|F167333S06[8050494]
[13416] 8652: AF167337
[13417] Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 5
[13418] gi|8050493|gb|AF167337.1|F167333S05[8050493]
[13419] 8653: AF167336
[13420] Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 4
[13421] gi|8050492|gb|AF167336.1F167333S04[8050492]
[13422] 8654: AF167335
[13423] Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 3
[13424] gi|8050491|gb|AF167335.1|F167333S03[8050491]
[13425] 8655: AF167334
[13426] Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 2
[13427] gi|8050490|gb|AF167334.1|F167333S02[8050490]
[13428] 8656: AF167333
[13429] Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 1
[13430] gi|8050489|gb|AF167333.1|F167333S01[8050489]
[13431] 8657: AH009309
[13432] Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, complete cds, alternatively spliced
[13433] gi|8050488|gb|AH009309.1|SEG_F167333S[8050488]
[13434] 8658: AF167343
[13435] Homo sapiens soluble interleukin-1 receptor accessory protein (IL1RAP) mRNA, complete cds
[13436] gi|8050486|gb|AF167343.1|AF167343[8050486]
[13437] 8659: AF213457
[13438] Homo sapiens triggering receptor expressed on myeloid cells 2 mRNA, complete cds
[13439] gi|7800156|gb|AF213457.1|AF213457[7800156]
[13440] 8661: AF233281
[13441] Homo sapiens CC chemokine receptor (CCBP2) gene, complete cds
[13442] gi|7274391|gb|AF233281.1|AF233281[7274391]
[13443] 8662: AF189259
[13444] Homo sapiens GABA-A receptor theta subunit (THETA) mRNA, complete cds
[13445] gi|7861735|gb|AF189259.1|AF189259[7861735]
[13446] 8663: AF176832
[13447] Homo sapiens low density lipoprotein receptor related protein-deleted in tumor
[13448] (LRPDIT) mRNA, complete cds
[13449] gi|7861732|gb|AF176832.1|AF176832[7861732]
[13450] 8664: AH001455
[13451] Homo sapiens protooncogene protein (c-erb-2) gene, partial cds
[13452] gi|182164|gb|AH001455.1|SEG_HUMERB2[182164]
[13453] 8665: M11767
[13454] Homo sapiens protooncogene protein (c-erb-2) gene, exon 7 and partial cds
[13455] gi|182163|gb|M11767.1|HUMERB27[182163]
[13456] 8666: M11766
[13457] Homo sapiens protooncogene protein (c-erb-2) gene, exon 6
[13458] gi|182162|gb|M11766.1|HUMERB26[182162]
[13459] 8667: M11765
[13460] Homo sapiens protooncogene protein (c-erb-2) gene, exon 5
[13461] gi|118216|gb|M11765.1|HUMERB25[182161]
[13462] 8668: M11764
[13463] Homo sapiens protooncogene protein (c-erb-2) gene, exon 4
[13464] gi|182160|gb|M11764.1|HUMERB24[182160]
[13465] 8669: M11763
[13466] Homo sapiens protooncogene protein (c-erb-2) gene, exon 3
[13467] gi|182159|gb|M11763.1|HUMERB23[182159]
[13468] 8670: M11762
[13469] Homo sapiens protooncogene protein (c-erb-2) gene, exon 2
[13470] gi|182158|gb|M11762.1|HUMERB22[182158]
[13471] 8671: M11761
[13472] Homo sapiens protooncogene protein (c-erb-2) gene, exon 1
[13473] gi|182157|gb|M11761.1|HUMERB21[182157]
[13474] 8674: AC068948
[13475] Homo sapiens chromosome 19, cosmid R28371 (LLNL-R—244D7), complete sequence
[13476] gi|7798735|gb|AC068948.1|AC068948[7798735]
[13477] 8675: AF060231
[13478] Homo sapiens herpesvirus entry protein C (HVEC) mRNA, complete cds
[13479] gi|3242792|gb|AF060231.1|AF060231[3242792]
[13480] 8676: Z24459
[13481] H. sapiens MTCP1 gene, exons 2A to 7 (and joined mRNA)
[13482] gi|2252491|emb|Z24459.1|HSMTCP12A[2252491]
[13483] 8677: AB006200
[13484] Homo sapiens gene for parathyroid hormone/parathyroid hormone-related protein receptor, exon1, partial sequence
[13485] gi|7770088|dbj|AB006200.1|AB006200[7770088]
[13486] 8693: AB023493
[13487] Homo sapiens mRNA for preproapelin, complete cds
[13488] gi|6009585|dbj|AB023493.1|AB023493[6009585]
[13489] 8697: M55336
[13490] Homo sapiens oncogene tyrosine protein kinase receptor (trk2) mRNA, partial cds
[13491] gi|339913|gb|M55336.1|HUMTRK2[339913]
[13492] 8701: AB028741
[13493] Homo sapiens mRNA for syntaxin 18, complete cds
[13494] gi|7707423|dbj|AB028741.1|AB028741[7707423]
[13495] 8702: U27478
[13496] Homo sapiens angiotensin II type 2 receptor (AT2) gene, partial cds
[13497] gi|1143833|gb|U27478.1|HSU27478[1143833]
[13498] 8707: M81774
[13499] Homo sapiens T-cell receptor alpha (TCRB) mRNA, partial cds
[13500] gi|186224|gb|M81774.1|HUMIGTCACA[186224]
[13501] 8708: S70782
[13502] Homo sapiens alpha adrenergic receptor subtype alpha 1a mRNA, complete cds
[13503] gi|547219|gb|S70782.1|S70782[547219]
[13504] 8709: S70057
[13505] Homo sapiens cholecystokinin B receptor mRNA, complete cds
[13506] gi|546748|gb|S70057.1|S70057[546748]
[13507] 8711: S70123
[13508] Homo sapiens low density lipoprotein receptor mRNA, partial cds
[13509] gi|546107|gb|S70123.1|S70123[546107]
[13510] 8712: S56143
[13511] Homo sapiens A1 adenosine receptor mRNA, complete cds
[13512] gi|298327|gb|S56143.1|S56143[298327]
[13513] 8715: S57793
[13514] Homo sapiens luteinizing hormone receptor mRNA, complete cds
[13515] gi|236050|gb|S57793.1|S57793[236050]
[13516] 8722: AF202640
[13517] Homo sapiens orphan G-protein coupled receptor (GPRC5B) mRNA, complete cds
[13518] gi|7682556|gb|AF202640.1|AF202640[7682556]
[13519] 8723: AF211154
[13520] AF211154 Clontech HL1008b Homo sapiens cDNA, mRNA sequence
[13521] gi|7677996|gb|AF211154.1|AF211154[7677996]
[13522] 8724: AF211153
[13523] AF211153 Clontech HL1008b Homo sapiens cDNA, mRNA sequence
[13524] gi|7677995|gb|AF211153.1|AF211153[7677995]
[13525] 8729: AF145440
[13526] Homo sapiens CC chemokine receptor 9B (CCR9) mRNA, alternatively spliced, complete cds
[13527] gi|7673010|gb|AF145440.1|AF145440[7673010]
[13528] 8730: AF145439
[13529] Homo sapiens CC chemokine receptor 9A (CCR9) mRNA, alternatively spliced, complete cds
[13530] gi|7673008|gb|AF145439.1|AF145439[7673008]
[13531] 8731: AF129170
[13532] Homo sapiens apolipoprotein E receptor 2 gene, exon 6b and partial cds, alternatively spliced
[13533] gi|7672339|gb|AF129170.1|AF129169S2[7672339]
[13534] 8732: AF129169
[13535] Homo sapiens apolipoprotein E receptor 2 gene, exon 6a and partial cds, alternatively spliced
[13536] gi|7672338|gb|AF129169.1|AF129169S1[7672338]
[13537] 8733: AH009264
[13538] Homo sapiens apolipoprotein E receptor 2 and apolipoprotein E receptor 2 genes,
[13539] partial cds
[13540] gi|7672337|gb|AH009264.1|SEG_AF129169S[7672337]
[13541] 8812: AB039723
[13542] Homo sapiens FZD3 mRNA for WNT receptor frizzled-3, complete cds
[13543] gi|7670051|dbj|AB039723.1|AB039723[7670051]
[13544] 8813: AL353940
[13545] Homo sapiens mRNA; cDNA DKFZp761P1010 (from clone DKFZp761P1010)
[13546] gi|7669978|emb|AL353940.1|HSM802647[7669978]
[13547] 8814: AC067969
[13548] Homo sapiens chromosome 19, cosmid R26839 (LLNL-R—228D1), complete sequence
[13549] gi|7656699|gb|AC067969.1|AC067969[7656699]
[13550] 8815: AF236081
[13551] Homo sapiens orphan G-protein coupled receptor GPR72 (GPR72) mRNA, complete cds
[13552] gi|7248881|gb|AF236081.1|AF236081[7248881]
[13553] 8819: AC004416
[13554] Homo sapiens BAC clone CTB-13N12 from 7q31.2, complete sequence
[13555] gi|2979585|gb|AC004416.1|AC004416[2979585]
[13556] 8820: AF056020
[13557] Homo sapiens chemokine receptor CCR5 (CCR5) gene, CCR5-delta32 allele, partial
[13558] cds
[13559] gi|7648496|gb|AF056020.1|AF056020[7648496]
[13560] 8821: AF056019
[13561] Homo sapiens mutant chemokine receptor CCR5 (CCR5) gene, CCR5-delta32 allele, partial cds
[13562] gi|7648494|gb|AF056019.1|AF056019[7648494]
[13563] 8822: AF052244
[13564] Homo sapiens mutant chemokine receptor CCR5 (CCR5) gene, CCR5-delta32 allele, partial cds
[13565] gi|7648492|gb|AF052244.1|AF052244[7648492]
[13566] 8824: AF068288
[13567] Homo sapiens HDCME31P mRNA, complete cds
[13568] gi|7643783|gb|AF068288.1|AF068288[7643783]
[13569] 8825: AF186022
[13570] Homo sapiens B lymphocyte adapter protein BAM32 (BAM32) mRNA, complete cds
[13571] gi|6503077|gb|AF186022.1|AF186022[6503077]
[13572] 8826: AB002168
[13573] Homo sapiens gene for vitamin D receptor, exon 9 and complete cds
[13574] gi|5736651|dbj|AB002168.1|AB00215S12[5736651]
[13575] 8827: AB002167
[13576] Homo sapiens gene for vitamin D receptor, exon 8
[13577] gi|5736591|dbj|AB002167.1|AB00215S11[5736591]
[13578] 8828: AB002166
[13579] Homo sapiens gene for vitamin D receptor, exon 7
[13580] gi|5736588|dbj|AB002166.1|AB00215S10[5736588]
[13581] 8829: AB002165
[13582] Homo sapiens gene for vitamin D receptor, exon 6
[13583] gi|5736585|dbj|AB002165.1|AB00215S09[5736585]
[13584] 8830: AB002164
[13585] Homo sapiens gene for vitamin D receptor, exon 5
[13586] gi|5736582|dbj|AB002164.1|AB00215S08[5736582]
[13587] 8831: AB002163
[13588] Homo sapiens gene for vitamin D receptor, exon 4
[13589] gi|5736579|dbj|AB002163.1|AB00215S07[5736579]
[13590] 8832: AB002162
[13591] Homo sapiens gene for vitamin D receptor, exon 3
[13592] gi|5736575|dbj|AB002162.1|AB00215S06[5736575]
[13593] 8833: AB002161
[13594] Homo sapiens gene for vitamin D receptor, exon 2
[13595] gi|5736571|dbj|AB002161.1|AB00215S05[5736571]
[13596] 8834: AB002160
[13597] Homo sapiens gene for vitamin D receptor, exon 1c, 5′ non-coding region
[13598] gi|5736566|dbj|AB002160.1|AB00215S04[5736566]
[13599] 8835: AB002159
[13600] Homo sapiens gene for vitamin D receptor, exon 1b, 5′ non-coding region
[13601] gi|5736562|dbj|AB002159.1|AB00215S03[5736562]
[13602] 8839: AB005647
[13603] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 22 and complete cds
[13604] gi|5139788|dbj|AB005647.1|AB00562S23[5139788]
[13605] 8840: AB005646
[13606] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 21
[13607] gi|5139787|dbj|AB005646.1|AB00562S22[5139787]
[13608] 8841: AB005645
[13609] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 20
[13610] gi|5139786|dbj|AB005645.1|AB00562S21[5139786]
[13611] 8842: AB005644
[13612] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 19
[13613] gi|5139785|dbj|AB005644.1|AB00562S20[5139785]
[13614] 8843: AB005643
[13615] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 18
[13616] gi|5139784|dbj|AB005643.1|AB00562S19[5139784]
[13617] 8844: AB005642
[13618] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 17
[13619] gi|5139783|dbj|AB005642.1|AB00562S18[5139783]
[13620] 8845: AB005641
[13621] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 16
[13622] gi|5139782|dbj|AB005641.1|AB00562S17[5139782]
[13623] 8846: AB005640
[13624] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 15
[13625] gi|5139781|dbj||AB005640.1|AB00562S16[5139781]
[13626] 8847: AB005639
[13627] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 14
[13628] gi|5139780|dbj|AB005639.1|AB00562S15[5139780]
[13629] 8848: AB005638
[13630] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 13
[13631] gi|5139779|dbj|AB005638.1|AB00562S14[5139779]
[13632] 8849: AB005637
[13633] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 12
[13634] gi|5139778|dbj|AB005637.1|AB00562S13[5139778]
[13635] 8850: AB005636
[13636] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 11
[13637] gi|5139777|dbj|AB005636.1|AB00562S12[1L39777]
[13638] 8851: AB005635
[13639] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 10
[13640] gi|5139776|dbj|AB005635.1|AB00562S11[5139776]
[13641] 8852: AB005634
[13642] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 9
[13643] gi|5139775|dbj|AB005634.1|AB00562S10[5139775]
[13644] 8853: AB005633
[13645] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 8
[13646] gi|5139774|dbj|AB005633.1|AB00562S09[5139774]
[13647] 8854: AB005632
[13648] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 7
[13649] gi|5139773|dbj|AB005632.1|AB00562S08[5139773]
[13650] 8855: AB005631
[13651] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 6
[13652] gi|5139772|dbj|AB005631.1|AB00562S07[5139772]
[13653] 8856: AB005630
[13654] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 5
[13655] gi|5139771|dbj|AB005630.1|AB00562S06[5139771]
[13656] 8857: AB005629
[13657] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 4
[13658] gi|5139770|dbj|AB005629.1|AB00562S05[5139770]
[13659] 8858: AB005628
[13660] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 3
[13661] gi|5139769|dbj|AB005628.1|AB00562S04[5139769]
[13662] 8859: AB005627
[13663] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 2
[13664] gi|5139768|dbj|AB005627.1|AB00562S03[5139768]
[13665] 8860: AB005626
[13666] Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 1
[13667] gi|5139767|dbj|AB005626.1|AB00562S02[5139767]
[13668] 8862: AF030335
[13669] Homo sapiens purinergic P2Y11 receptor (P2Y11) mRNA, complete cds
[13670] gi|2674119|gb|AF030335.1|AF030335[2674119]
[13671] 8863: AF003522
[13672] Homo sapiens Delta mRNA, complete cds
[13673] gi|2197068|gb|AF003522.1|AF003522[2197068]
[13674] 8864: AF003521
[13675] Homo sapiens Jagged 2 mRNA, complete cds
[13676] gi|2197066|gb|AF003521.1|AF003521[2197066]
[13677] 8865: AF068292
[13678] Homo sapiens HDCMA39P mRNA, partial cds
[13679] gi|7634778|gb|AF068292.1|AF068292[7634778]
[13680] 8868: AH007819
[13681] Homo sapiens 5-hydroxytryptamine 2B receptor (HTR2B) gene, complete cds
[13682] gi|5442455|gb|AH007819.2|SEG_HSHTR2B[5442455]
[13683] 8869: AF156158
[13684] Homo sapiens 5-hydroxytryptamine 2B receptor (HTR2B) gene, exon 1
[13685] gi|5442454|gb|AF156158.2|HSHTR2B1[5442454]
[13686] 8870: AF156160
[13687] Homo sapiens 5-hydroxytryptamine 2B receptor (HTR2B) gene, exon 3 and complete
[13688] cds
[13689] gi|5070703|gb|AF156160.1|HSHTR2B3[5070703]
[13690] 8871: AF156159
[13691] Homo sapiens 5-hydroxytryptamine 2B receptor (HTR2B) gene, exon 2
[13692] gi|5070702|gb|AF156159.1|HSHTR2B2[5070702]
[13693] 8872: AB041713
[13694] Homo sapiens fp gene for prostaglandin F2alpha receptor, exon 1 and 2, partial
[13695] cds
[13696] gi|7619988|dbj|AB041713.1|AB041713[7619988]
[13697] 8873: AF041811
[13698] Homo sapiens ETS related protein-growth factor receptor tyrosine kinase fusion
[13699] proteins (ETV6-NTRK3 fusion) mRNA, partial cds
[13700] gi|6274523|gb|AF041811.2|AF041811[6274523]
[13701] 8874: AF172453
[13702] Homo sapiens opioid growth factor receptor mRNA, complete cds
[13703] gi|7595306|gb|AF172453.1|AF172453[7595306]
[13704] 8875: AF172452
[13705] Homo sapiens opioid growth factor receptor mRNA, complete cds
[13706] gi|7595304|gb|AF172452.1|AF172452[7595304]
[13707] 8876: AF172451
[13708] Homo sapiens opioid growth factor receptor mRNA, complete cds
[13709] gi|7595302|gb|AF172451.1|AF172451[7595302]
[13710] 8877: AF172450
[13711] Homo sapiens opioid growth factor receptor mRNA, complete cds
[13712] gi|7595300|gb|AF172450.1|AF172450[7595300]
[13713] 8878: AF172449
[13714] Homo sapiens clone 127 opioid growth factor receptor mRNA, complete cds
[13715] gi|7595298|gb|AF172449.1|AF172449[7595298]
[13716] 8879: D49394
[13717] Homo sapiens mRNA for serotonin 5-HT3 receptor, complete cds
[13718] gi|681913|dbj|D49394.1|HUMS5HT3RA[681913]
[13719] 8880: AB041395
[13720] Homo sapiens CHRM3 gene for muscarinic acetylcholine receptor m3, complete cds
[13721] gi|7592980|dbj|AB041395.1|AB041395[7592980]
[13722] 8881: AB041391
[13723] Homo sapiens CHRM2 gene for muscarinic acetylcholine receptor m2, partial cds
[13724] gi|7592971|dbj|AB041391.1|AB041391[7592971]
[13725] 8882: AB041384
[13726] Homo sapiens gene for histamine H2 receptor, complete cds
[13727] gi|7592957|dbj|AB041384.1|AB041384[7592957]
[13728] 8883: AB041380
[13729] Homo sapiens gene for histamine H1 receptor, complete cds
[13730] gi|7592949|dbj|AB041380.1|AB041380[7592949]
[13731] 8884: AB041373
[13732] Homo sapiens HTR1E gene for 5-hydroxytryptamine (serotonin) receptor 1E, partial
[13733] cds
[13734] gi|7592934|dbj|AB041373.1|AB041373[7592934]
[13735] 8885: AB041370
[13736] Homo sapiens HTR1B gene for 5-hydroxytryptamine (serotonin) receptor 1B, complete cds
[13737] gi|7592928|dbj|AB041370.1|AB041370[7592928]
[13738] 8887: AB033598
[13739] Homo sapiens gene for melatonin 1b receptor, exon 2 and complete cds
[13740] gi|7209599|dbj|AB033598.1|AB033597S2[7209599]
[13741] 8888: AB033597
[13742] Homo sapiens gene for melatonin 1b receptor, exon 1
[13743] gi|7209598|dbj|AB033597.1|AB033597S1[7209598]
[13744] 8889: SEG_AB033597S
[13745] Homo sapiens gene for melatonin 1b receptor
[13746] gi|7209597|dbj|SEG_AB033597S[7209597]
[13747] 8890: D85606
[13748] Homo sapiens gene for cholecystokinin type-A receptor, complete cds
[13749] gi|7008026|dbj|D85606.1D85606[7008026]
[13750] 8891: SEG_AB019480S
[13751] Homo sapiens NTRK1 gene for TRKA
[13752] gi|6492387|dbj|SEG_AB019480S[6492387]
[13753] 8892: AB019485
[13754] Homo sapiens NTRK1 gene for TRKA, exon 8-14
[13755] gi|6492386|dbj|AB019485.2|AB019480S6[6492386]
[13756] 8893: SEG_AB029932S
[13757] Homo sapiens hMel1a gene for melatonin 1a receptor
[13758] gi|6045084|dbj|SEG_AB029932S[6045084]
[13759] 8894: AB029933
[13760] Homo sapiens hMel1a gene for melatonin 1a receptor, exon 2 and complete cds
[13761] gi|6045083|dbj|AB029933.1|AB029932S2[6045083]
[13762] 8895: AB029932
[13763] Homo sapiens hMel1a gene for melatonin 1a receptor, exon 1
[13764] gi|6045082|dbj|AL029932.1|AB029932S1[6045082]
[13765] 8896: AB026584
[13766] Homo sapiens gene for endothelial protein C receptor, complete cds
[13767] gi|5837963|dbj|AB026584.2|AB026584[5837963]
[13768] 8897: AB017444
[13769] Homo sapiens gene for lectin-like oxidized LDL receptor, exon 6
[13770] gi|5821166|dbj|AB017444.1|AB017444[5821166]
[13771] 8898: AB017443
[13772] Homo sapiens gene for lectin-like oxidized LDL receptor, exon 5
[13773] gi|5821165|dbj|AB017443.1|AB017443[5821165]
[13774] 8899: AB017442
[13775] Homo sapiens gene for lectin-like oxidized LDL receptor, exon 4
[13776] gi|5821164|dbj|AB017442.1|AB017442[5821164]
[13777] 8900: AB017441
[13778] Homo sapiens gene for lectin-like oxidized LDL receptor, exon 3
[13779] gi|5821163|dbj|AB017441.1|AB017441[5821163]
[13780] 8901: AB017440
[13781] Homo sapiens gene for lectin-like oxidized LDL receptor, exon 2
[13782] gi|5821162|dbj|AB017440.1|AB017440[5821162]
[13783] 8902: AB017439
[13784] Homo sapiens gene for lectin-like oxidized LDL receptor, exon 1
[13785] gi|5821161|dbj|AB017439.1|AB017439[5821161]
[13786] 8903: AB019488
[13787] Homo sapiens NTRK1 gene for TRKA, exon 17 and complete cds
[13788] gi|3869111|dbj|AB019488.1|AB019480S9[3869111]
[13789] 8904: AB019487
[13790] Homo sapiens NTRK1 gene for TRKA, exon 16
[13791] gi|3869110|dbj|AB019487.1|AB019480S8[3869110]
[13792] 8905: AB019486
[13793] Homo sapiens NTRK1 gene for TRKA, exon 15
[13794] gi|3869109|dbj|AB019486.1|AB019480S7[3869109]
[13795] 8906: AB019484
[13796] Homo sapiens NTRK1 gene for TRKA, exon 7
[13797] gi|3869107|dbj|AB019484.1|AB019480S5[3869107]
[13798] 8907: AB019483
[13799] Homo sapiens NTRK1 gene for TRKA, exon 5 and 6
[13800] gi|3869106|dbj|AB019483.1|AB3019480S4[3869106]
[13801] 8908: AB019482
[13802] Homo sapiens NTRK1 gene for TRKA, exon 4
[13803] gi|3869105|dbj|AB019482.1|AB019480S3[3869105]
[13804] 8909: AB019481
[13805] Homo sapiens NTRK1 gene for TRKA, exon 2,3
[13806] gi|3869104|dbj|AB019481.1|AB019480S2[3869104]
[13807] 8910: AB019480
[13808] Homo sapiens NTRK1 gene for TRKA, exon 1
[13809] gi|3869103|dbj|AB019480.1|AB019480S1[3869103]
[13810] 8911: SEG_AB01471S
[13811] Homo sapiens DR5 gene
[13812] gi|3721877|dbj|SEG_AB01471S[3721877]
[13813] 8912: AB014718
[13814] Homo sapiens DR5 gene, exon 9 and complete cds
[13815] gi|3721876|dbj|AB014718.1|AB01471S9[3721876]
[13816] 8913: AB014717
[13817] Homo sapiens DR5 gene, exon 8
[13818] gi|3721875|dbj|AB014717.1|AB301471S8[3721875]
[13819] 8914: AB014716
[13820] Homo sapiens DR5 gene, exon 7
[13821] gi|3721874|dbj|AB014716.1|AB01471S7[3721874]
[13822] 8915: AB014715
[13823] Homo sapiens DR5 gene, exon 6
[13824] gi|3721873|dbj|AB014715.1|AB01471S6[3721873]
[13825] 8916: AB3014714
[13826] Homo sapiens DR5 gene, exon 5
[13827] gi|3721872|dbj|AB014714.1|AB01471S5[3721872]
[13828] 8917: AB014713
[13829] Homo sapiens DR5 gene, exon 4
[13830] gi|3721871|dbj|AB014713.1|AB01471S4[3721871]
[13831] 8918: AB014712
[13832] Homo sapiens DR5 gene, exon 3
[13833] gi|3721870|dbj|AB014712.1|AB01471S3[3721870]
[13834] 8919: AB014711
[13835] Homo sapiens DR5 gene, exon 2
[13836] gi|3721869|dbj|AB014711.1|AB01471S2[3721869]
[13837] 8920: AB014710
[13838] Homo sapiens DR5 gene, exon 1, partial sequence
[13839] gi|3721868|dbj|AB014710.1|AB01471S1[3721868]
[13840] 8921: SEG_AB01047S
[13841] Homo sapiens gene for natriuretic peptide A type receptor
[13842] gi|3297985|dbj|SEG_AB01047S[3297985]
[13843] 8922: AB010491
[13844] Homo sapiens gene for natriuretic peptide A type receptor, exon 22 and complete
[13845] cds
[13846] gi|3297984|dbj|AB010491.1|AB01047S22[3297984]
[13847] 8923: AB010490
[13848] Homo sapiens gene for natriuretic peptide A type receptor, exon 21
[13849] gi|3297983|dbj|AB010490.1|AB01047S21[3297983]
[13850] 8924: AB010489
[13851] Homo sapiens gene for natriuretic peptide A type receptor, exon 20
[13852] gi|3297982|dbj|AB010489.1|AB01047S20[3297982]
[13853] 8925: AB010488
[13854] Homo sapiens gene for natriuretic peptide A type receptor, exon 19
[13855] gi|3297981|dbj|AB010488.1|AB01047S19[3297981]
[13856] 8926: AB010487
[13857] Homo sapiens gene for natriuretic peptide A type receptor, exon 18
[13858] gi|3297980|dbj|AB010487.1|AB01047S18[3297980]
[13859] 8927: AB010486
[13860] Homo sapiens gene for natriuretic peptide A type receptor, exon 17
[13861] gi|3297979|dbj|AB010486.1|AB01047S17[3297979]
[13862] 8928: AB010485
[13863] Homo sapiens gene for natriuretic peptide A type receptor, exon 16
[13864] gi|3297978|dbj|AB010485.1|AB01047S16[3297978]
[13865] 8929: AB010484
[13866] Homo sapiens gene for natriuretic peptide A type receptor, exon 15
[13867] gi|3297977|dbj|AB010484.1|AB01047S15[3297977]
[13868] 8930: AB010483
[13869] Homo sapiens gene for natriuretic peptide A type receptor, exon 14
[13870] gi|3297976|dbj|AB010483.1|AB01047S14[3297976]
[13871] 8931: AB010482
[13872] Homo sapiens gene for natriuretic peptide A type receptor, exon 13
[13873] gi|3297975|dbj|AB010482.1|AB01047S13[3297975]
[13874] 8932: AB010481
[13875] Homo sapiens gene for natriuretic peptide A type receptor, exon 12
[13876] gi|3297974|dbj|AB010481.1|AB01047S12[3297974]
[13877] 8933: AB010480
[13878] Homo sapiens gene for natriuretic peptide A type receptor, exon 11
[13879] gi|3297973|dbj|AB010480.1|AB01047S11[3297973]
[13880] 8934: AB010479
[13881] Homo sapiens gene for natriuretic peptide A type receptor, exon 10
[13882] gi|3297972|dbj|AB010479.1|AB01047S10[3297972]
[13883] 8935: AB010478
[13884] Homo sapiens gene for natriuretic peptide A type receptor, exon 9
[13885] gi|3297971|dbj|AB010478.1|AB01047S09[3297971]
[13886] 8936: AB010477
[13887] Homo sapiens gene for natriuretic peptide A type receptor, exon 8
[13888] gi|3297970|dbj|AB010477.1|AB01047S08[3297970]
[13889] 8937: AB010476
[13890] Homo sapiens gene for natriuretic peptide A type receptor, exon 7
[13891] gi|3297969|dbj|AB010476.1|AB01047S07[3297969]
[13892] 8938: AB010475
[13893] Homo sapiens gene for natriuretic peptide A type receptor, exon 6
[13894] gi|3297968|dbj|AB010475.1|AB01047S06[3297968]
[13895] 8939: AB010474
[13896] Homo sapiens gene for natriuretic peptide A type receptor, exon 5
[13897] gi|3297967|dbj|AB010474.1|AB01047S05[3297967]
[13898] 8940: AB010473
[13899] Homo sapiens gene for natriuretic peptide A type receptor, exon 4
[13900] gi|3297966|dbj|AB010473.1|AB01047S04[3297966]
[13901] 8941: AB010472
[13902] Homo sapiens gene for natriuretic peptide A type receptor, exon 3
[13903] gi|3297965|dbj|AB010472.1|AB01047S03[3297965]
[13904] 8942: AB010471
[13905] Homo sapiens gene for natriuretic peptide A type receptor, exon 2
[13906] gi|3297964|dbj|AB010471.1|AB01047S02[3297964]
[13907] 8943: AB010470
[13908] Homo sapiens gene for natriuretic peptide A type receptor, exon 1, partial sequence
[13909] gi|3297963|dbj|AB010470.1|AB01047S01[3297963]
[13910] 8944: AB008681
[13911] Homo sapiens gene for activin receptor type IIB, complete cds
[13912] gi|2760152|dbj|AB008681.1|AB008681[2760152]
[13913] 8945: SEG_AB005521S
[13914] Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma
[13915] gi|2605496|dbj|SEG_AB005521S[2605496]
[13916] 8946: AB005526
[13917] Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, eoxn 6 and complete cds
[13918] gi|2605495|dbj|AB005526.1|AB005521S6[2605495]
[13919] 8947: AB005525
[13920] Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 5
[13921] gi|2605494|dbj|AB005525.1|AB005521S5[2605494]
[13922] 8948: AB005524
[13923] Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 4
[13924] gi|2605493|dbj|AB005524.1|AB005521S4[2605493]
[13925] 8949: AB005523
[13926] Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 3
[13927] gi|2605492|dbj|AB005523.1|AB005521S3[2605492]
[13928] 8950: AB005522
[13929] Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 2
[13930] gi|2605491|dbj|AB005522.1|AB005521S2[2605491]
[13931] 8951: AB005521
[13932] Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 1
[13933] gi|2605490|dbj|AB005521.1|AB005521S1[2605490]
[13934] 8954: AB002059
[13935] Homo sapiens DNA for Human P2XM, complete cds
[13936] gi|2350848|dbj|AB002059.1|AB002059[2350848]
[13937] 8955: SEG_D86389S
[13938] 8955: D86407
[13939] Homo sapiens DNA for apoER2
[13940] gi|2344801|dbj||SEG_D86389S[2344801]
[13941] 8956: D86407
[13942] Homo sapiens DNA for apoER2, complete cds, and exon 19
[13943] gi|2344800|dbj|D86407.1|D86389S19[2344800]
[13944] 8957: D86406
[13945] Homo sapiens DNA for apoER2, exon 18
[13946] gi|2344799|dbj|D86406.1|D86389S18[2344799]
[13947] 8958: D86405
[13948] Homo sapiens DNA for apoER2, exon 17
[13949] gi|2344798|dbj|D86405.1|D86389S17[2344798]
[13950] 8959: D86404
[13951] Homo sapiens DNA for apoER2, exon 16
[13952] gi|2344797|dbj|D586404.1|D8.6389S16[2344797]
[13953] 8960: D86403
[13954] Homo sapiens DNA for apoER2, exon 15
[13955] gi|2344796|dbj|D86403.1|D86389S15[2344796]
[13956] 8961: D86402
[13957] Homo sapiens DNA for apoER2, exon 14
[13958] gi|2344795|dbj|D586402.1D86389S14[2344795]
[13959] 8962: D86401
[13960] Homo sapiens DNA for apoER2, exon 13
[13961] gi|2344794|dbj|D586401.1|D86389S13[2344794]
[13962] 8963: D86400
[13963] Homo sapiens DNA apoER2, exon 12
[13964] gi|2344793|dbj|D86400.1|D86389S12[2344793]
[13965] 8964: D86399
[13966] Homo sapiens DNA for apoER2, exon 11
[13967] gi|2344792|dbj|D586399.1|D86389S11[2344792]
[13968] 8965: D86398
[13969] Homo sapiens DNA for apoER2, exon 10
[13970] gi|2344791|dbj|D586398.1|D86389S10[2344791]
[13971] 8966: D86397
[13972] Homo sapiens DNA for apoER2, exon 9
[13973] gi|2344790|dbj|D586397.1|D86389S09[2344790]
[13974] 8967: D86396
[13975] Homo sapiens DNA for apoER2, exon 8
[13976] gi|2344789|dbj|D86396.1|D86389S08[2344789]
[13977] 8968: D86395
[13978] Homo sapiens DNA for apoER2, exon 7
[13979] gi|2344788|dbj|D586395.1|D86389S07[2344788]
[13980] 8969: D86394
[13981] Homo sapiens DNA for apoER2, exon 6
[13982] gi|2344787|dbj|D86394.1|D86389S06[2344787]
[13983] 8970: D86393
[13984] Homo sapiens DNA for apoER2, exon 5
[13985] gi|2344786|dbj|D86393.1|D86389S05[2344786]
[13986] 8971: D86392
[13987] Homo sapiens DNA for apoER2, exon 4
[13988] gi|2344785|dbj|D86392.1|D86389S04[2344785]
[13989] 8972: D86391
[13990] Homo sapiens DNA for apoER2, exon 3
[13991] gi|2344784|dbj|D586391.1|D86389S03[2344784]
[13992] 8973: D86390
[13993] Homo sapiens DNA for apoER2, exon 2
[13994] gi|2344783|dbj|D86390.1|D86389S02[2344783]
[13995] 8974: D86389
[13996] Homo sapiens DNA for apoER2, exon 1
[13997] gi|2344782|dbj|D86389.1|D86389S01[2344782]
[13998] 8975: D86096
[13999] Human DNA for prostaglandin EP3 receptor subtype, complete cds
[14000] gi|2114186|dbj|D86096.1|D86087S10[2114186]
[14001] 8976: D86095
[14002] Human DNA for prostaglandin E receptor EP3 subtype, exon 9
[14003] gi|2114185|dbj|D86095.1|D86087S09[2114185]
[14004] 8977: D86094
[14005] Human DNA for prostaglandin E receptor EP3 subtype, exon 8
[14006] gi|2114184|dbj|D86094.1|D86087S08[2114184]
[14007] 8978: D86093
[14008] Human DNA for prostaglandin E receptor EP3 subtype, exon 7
[14009] gi|2114183|dbj|D586093.1|D86087S07[2114183]
[14010] 8979: D86092
[14011] Human DNA for prostaglandin E receptor EP3 subtype, exon 6
[14012] gi|2114182|dbj|D586092.1|D86087S06[2114182]
[14013] 8980: D86091
[14014] Human DNA for prostaglandin E receptor EP3 subtype, exon 5
[14015] gi|2114181|dbj|D86091.1|D86087S05[2114181]
[14016] 8981: D86090
[14017] Human DNA for prostaglandin E receptor EP3 subtype, exon 4
[14018] gi|21141800 dbj|D86090.1|D86087S04[2114180]
[14019] 8982: D86089
[14020] Human DNA for prostaglandin E receptor EP3 subtype, exon 3
[14021] gi|2114179|dbj|D86089.1|D86087S03[2114179]
[14022] 8983: D86088
[14023] Human DNA for prostaglandin E receptor EP3 subtype, exon 2
[14024] gi|2114178|dbj|D86088.1|D86087S02[2114178]
[14025] 8984: D86087
[14026] Human DNA for prostaglandin E receptor EP3 subtype, exon 1
[14027] gi|2114177|dbj|D586087.1|D86087S01[2114177]
[14028] 8985: SEG_D49555S
[14029] Homo sapiens DNA for gastric inhibitory polypeptide receptor
[14030] gi|1805368|dbj||SEG_D49555S[1805368]
[14031] 8986: D85376
[14032] Human DNA for thyrotropin-releasing hormone receptor, exon 3 and copmplete cds
[14033] gi|1616933|dbj|D585376.1|D85375S2[1616933]
[14034] 8987: D85375
[14035] Human DNA for thyrotropin-releasing hormon receptor, exon 1, 2
[14036] gi|1616932|dbj|D585375.1D85375S1[1616932]
[14037] 8988: D49559
[14038] Human DNA for gastric inhibitory polypeptide receptor, exon 13 and 14, complete
[14039] cds
[14040] gi|1088442|dbj|D549559.1|D49555S5[1088442]
[14041] 8989: D49558
[14042] Human DNA for gastric inhibitory polypeptide receptor, exon 5, 6, 7, 8, 9, 10,
[14043] 11 and 12
[14044] gi|1088441|dbj|D549558.1|D49555S4[1088441]
[14045] 8990: D49557
[14046] Human DNA for gastric inhibitory polypeptide receptor, exon 3 and 4
[14047] gi|1088440|dbj|D549557.1D49555S3[1088440]
[14048] 8991: D49556
[14049] Homo sapiens DNA for gastric inhibitory polypeptide receptor, exon 2
[14050] gi|1088439|dbj|D549556.1D49555S2[1088439]
[14051] 8992: D49555
[14052] Homo sapiens DNA for gastric inhibitory polypeptide receptor, exon 1
[14053] gi|1088438|dbj|D549555.1|D49555S1[1088438]
[14054] 8993: D64016
[14055] Human gene for vascular endothelial growth factor receptor, promoter and exon 1
[14056] gi|1088437|dbj|D564016.1|HUMES[1088437]
[14057] 8994: D38128
[14058] Homo sapiens IP gene for prostacyclin receptor, exon 3
[14059] gi|1019364|dbj|D538128.1|HUMIP2[1019364]
[14060] 8995: D38127
[14061] Human IP gene for prostacyclin receptor, exon 1 and exon 2
[14062] gi|1019362|dbj|D538127.1|HUMIP1[1019362]
[14063] 8996: D37965
[14064] Human mRNA for PDGF receptor beta-like tumor suppressor (PRLTS), complete cds
[14065] gi|807818|dbj|D537965.1|HUMPRLTS[807818]
[14066] 8997: D50017
[14067] Human DNA for alpha-platelet-derived growth factor receptor, exon 23
[14068] gi|767797|dbj|D550017.1|D50001S17[767797]
[14069] 8998: D50016
[14070] Human DNA for alpha-platelet-derived growth factor receptor, exon 22
[14071] gi|767796|dbj|D550016.1|D50001S16[767796]
[14072] 8999: DS0015
[14073] Human DNA for alpha-platelet-derived growth factor receptor, exon 20 and 21
[14074] gi|767795|dbj|D50015.1|D50001S15[767795]
[14075] 9000: D50014
[14076] Human DNA for alpha-platelet-derived growth factor receptor, exon 19
[14077] gi|767794|dbj|D550014.1|D50001S14[767794]
[14078] 9001: D50013
[14079] Human DNA for alpha-platelet-derived growth factor receptor, exon 18
[14080] gi|767793|dbj|D550013.1|D50001S13[767793]
[14081] 9002: D50012
[14082] Human DNA for alpha-platelet-derived growth factor receptor, exon 17
[14083] gi|767792|dbj|D550012.1D50001S12[767792]
[14084] 9003: D50011
[14085] Human DNA for alpha-platelet-derived growth factor receptor, exon 16
[14086] gi|767791|dbj|D550011.1|D50001S11[767791]
[14087] 9004: D50010
[14088] Human DNA for alpha-platelet-derived growth factor receptor, exon 15
[14089] gi|767790|dbj|D550010.1|D50001S10[767790]
[14090] 9005: D50009
[14091] Human DNA for alpha-platelet-derived growth factor receptor, exon 14
[14092] gi|767789|dbj|D550009.1|D50001S09[767789]
[14093] 9006: D50008
[14094] Human DNA for alpha-platelet-derived growth factor receptor, exon 13
[14095] gi|767788|dbj|D550008.1|D50001S08[767788]
[14096] 9007: D50007
[14097] Human DNA for alpha-platelet-derived growth factor receptor, exon 11 and 12
[14098] gi|767787|dbj|D550007.1|D50001S07[767787]
[14099] 9008: D50006
[14100] Human DNA for alpha-platelet-derived growth factor receptor, exon 6-10
[14101] gi|767786|dbj|D550006.1|D50001S06[767786]
[14102] 9009: D50005
[14103] Human DNA for alpha-platelet-derived growth factor receptor, exon 5
[14104] gi|767785|dbj|D550005.1|D50001S05[767785]
[14105] 9010: D50004
[14106] Human DNA for alpha-platelet-derived growth factor receptor, exon 4
[14107] gi|767784|dbj|D550004.1D50001S04[767784]
[14108] 9011: D50003
[14109] Human DNA for alpha-platelet-derived growth factor receptor, exon 3
[14110] gi|767783|dbj|D550003.1|D50001S03[767783]
[14111] 9012: D50002
[14112] Human DNA for alpha-platelet-derived growth factor receptor, exon 2
[14113] gi|767781|dbj|D550002.1D50001S02[767781]
[14114] 9013: D50001
[14115] Human DNA for alpha-platelet-derived growth factor receptor, exon 1
[14116] gi|767780|dbj|D550001.1|D50001S01[767780]
[14117] 9014: D31793
[14118] Human CD40 ligand (CD40L) gene, 5′ flanking region and exon 1
[14119] gi|662386|dbj|D531793.1|HUMCD40L1[662386]
[14120] 9015: D28768
[14121] Homo sapiens leukocyte DNA for Ah receptor, exon 1
[14122] gi|567941|dbj|D528768.1|HUMAHRP[567941]
[14123] 9016: D28769
[14124] Human HOX12 and RAGE genes, complete cds
[14125] gi|561657|dbj|D528769.1|HUMHOXRAGE[561657]
[14126] 9017: D31708
[14127] Human DNA for Ah-receptor, exon 1
[14128] gi|538228|dbj|D531708.1|HUMAHR[538228]
[14129] 9019: D26535
[14130] Human gene for dihydrolipoamide succinyltransferase, complete cds (exon 1-15)
[14131] gi|537349|dbj|D26535.1|HUMDS[537349]
[14132] 9020: SEG_HUMTA2R
[14133] Homo sapiens gene for thromboxane A2 receptor
[14134] gi|488600|dbj|SEGHUMTA2R[488600]
[14135] 9021: D15056
[14136] Homo sapiens gene for thromboxane A2 receptor, exon 3
[14137] gi|441173|dbj|D515056.1|HUMTA2R4[441173]
[14138] 9022: D15055
[14139] Homo sapiens gene for thromboxane A2 receptor, exon 2
[14140] gi|441172|dbj|D515055.1|HUMTA2R3[441172]
[14141] 9023: D15054
[14142] Homo sapiens gene for thromboxane A2 receptor, exon 1b (promoter region II)
[14143] gi|441171|dbj|D515054.1|HUMTA2R2[441171]
[14144] 9024: D15053
[14145] Homo sapiens gene for thromboxane A2 receptor, exon 1 (promoter region I)
[14146] gi|441170|dbj|D515053.1|HUMTA2R1[441170]
[14147] 9025: D21219
[14148] Human CCKBR gene for cholecystokinin-B receptor/gastrin receptor, exon 2-5, partial cds
[14149] gi|416225|dbj|D521219.1|HUMCCKBR2[416225]
[14150] 9026: D21218
[14151] Human CCKBR gene for cholecystokinin-B receptor/gastrin receptor, exon 1
[14152] gi|416224|dbj|D21218.1|HUMCCKBR1[416224]
[14153] 9027: D16532
[14154] Human gene for very low density lipoprotein receptor, exon 19
[14155] gi|407219|dbj|D16532.1|HUMVLDLR19[407219]
[14156] 9028: D16531
[14157] Human gene for very low density lipoprotein receptor, exon 18
[14158] gi|407218|dbj|D16531.1|HUMVLDLR18[407218]
[14159] 9029: D16530
[14160] Huma gene for very low density lipoprotein receptor, exon 17
[14161] gi|407217|dbj|D16530.1|HUMVLDLR17[407217]
[14162] 9030: D16529
[14163] Human gene for very low density lipoprotein receptor, exon 16
[14164] gi|407216|dbj|D516529.1|HUMVLDLR16[407216]
[14165] 9031: D16528
[14166] Human gene for very low density lipoprotein receptor, exon 15
[14167] gi|407215|dbj|D516528.1|HUMVLDLR15[407215]
[14168] 9032: D16527
[14169] Human gene for very low density lipoprotein receptor, exon 14
[14170] gi|407214|dbj|D516527.1|HUMVLDLR14[407214]
[14171] 9033: D16526
[14172] Human gene for very low density lipoprotein receptor, exon 13
[14173] gi|407213|dbj|D516526.1|HUMVLDLR13[407213]
[14174] 9034: D16525
[14175] Human gene for very low density lipoprotein receptor, exon 12
[14176] gi|407212|dbj|D516525.1|HUMVLDLR12[407212]
[14177] 9035: D16524
[14178] Human gene for very low density lipoprotein receptor, exon 11
[14179] gi|407211|dbj|D516524.1|HUMVLDLR11[407211]
[14180] 9036: D16523
[14181] Human gene for very low density lipoprotein receptor, exon 10
[14182] gi|407210|dbj|D516523.1|HUMVLDLR10[407210]
[14183] 9037: D16522
[14184] Human gene for very low density lipoprotein receptor, exon 9
[14185] gi|407209|dbj|D516522.1|HUMVLDLR09[407209]
[14186] 9038: D16520
[14187] Human gene for very low density lipoprotein receptor, exon 8
[14188] gi|407208|dbj|D516520.1|HUMVLDLR08[407208]
[14189] 9039: D16518
[14190] Human gene for very low density lipoprotein receptor, exon 7
[14191] gi|407207|dbj|D516518.1|HUMVLDLR07[407207]
[14192] 9040: D16516
[14193] Human gene for very low density lipoprotein receptor, exon 6
[14194] gi|407206|dbj|D516516.1|HUMVLDLR06[407206]
[14195] 9041: D16514
[14196] Human gene for very low density lipoprotein receptor, exon 5
[14197] gi|407205|dbj|D516514.1|HUMVLDLR05[407205]
[14198] 9042: D16512
[14199] Human gene for very low density lipoprotein receptor, exon 4
[14200] gi|407204|dbj|D516512.1|HUMVLDLR04[407204]
[14201] 9043: D16510
[14202] Human gene for very low density lipoprotein receptor, exon 3
[14203] gi|407203|dbj|D516510.1|HUMVLDLR03[407203]
[14204] 9044: D16508
[14205] Human gene for very low density lipoprotein receptor, exon 2
[14206] gi|407202|dbj|D516508.1|HUMVLDLR02[407202]
[14207] 9045: D16495
[14208] Human gene for very low density lipoprotein receptor, 5′flanking and exon 1
[14209] gi|407201|dbj|D516495.1|HUMVLDLR01[407201]
[14210] 9046: D13168
[14211] Human gene for endothelin-B receptor (hET-BR), exon 7
[14212] gi|285924|dbj|D513168.1|HUMHETBR7[285924]
[14213] 9047: D13167
[14214] Human gene for endothelin-B receptor (hET-BR), exon 6
[14215] gi|285923|dbj|D513167.1|HUMHETBR6[285923]
[14216] 9048: D13166
[14217] Human gene for endothelin-B receptor (hET-BR), exon 5
[14218] gi|285922|dbj|D513166.1|HUMHETBR5[285922]
[14219] 9049: D13165
[14220] Human gene for endothelin-B receptor (hET-BR), exon 4
[14221] gi|285921|dbj|D513165.1|HUMHETBR4[285921]
[14222] 9050: D13164
[14223] Human gene for endothelin-B receptor (hET-BR), exon 3
[14224] gi|285920|dbj|D513164.1|HUMHETBR3[285920]
[14225] 9051: D13163
[14226] Human gene for endothelin-B receptor (hET-BR), exon 2
[14227] gi|285919|dbj|D13163.1|HUMHETBR2[285919]
[14228] 9052: D13162
[14229] Human gene for endothelin-B receptor (hET-BR), exon 1
[14230] gi|285918|dbj|D13162.1|HUMHETBR1[285918]
[14231] 9053: D10604
[14232] Human midkine gene, complete cds
[14233] gi|219928|dbj|D10604.1|HUMMK[219928]
[14234] 9054: D11151
[14235] Human DNA for endothelin-A receptor, exon 8 and 3′ flanking region
[14236] gi|219628|dbj|D511151.1|HUMETAR8[219628]
[14237] 9055: D11150
[14238] Human DNA for endothelin-A receptor, exon 7
[14239] gi|219627|dbj|D511150.1|HUMETAR7[219627]
[14240] 9056: D11149
[14241] Human DNA for endothelin-A receptor, exon 6
[14242] gi|219626|dbj|D511149.1|HUMETAR6[219626]
[14243] 9057: D11148
[14244] Human DNA for endothelin-A receptor, exon 5
[14245] gi|219625|dbj|D511148.1|HUMETAR5[219625]
[14246] 9058: D11147
[14247] Human DNA for endothelin-A receptor, exon 4
[14248] gi|219624|dbj|D511147.1|HUMETAR4[219624]
[14249] 9059: D11146
[14250] Human DNA for endothelin-A receptor, exon 3
[14251] gi|219623|dbj|D511146.1|HUMETAR3[219623]
[14252] 9060: D11145
[14253] Human DNA for endothelin-A receptor, exon 2
[14254] gi|219622|dbj|D511145.1|HUMETAR2[219622]
[14255] 9061: D11144
[14256] Human DNA for endothelin-A receptor, 5′ flanking region and exon 1
[14257] gi|219621|dbj|D511144.1|HUMETAR1[219621]
[14258] 9063: AF215981
[14259] Homo sapiens CC chemokine receptor 10 (CCR10) mRNA, complete cds
[14260] gi|7546844|gb|AF215981.1|AF215981[7546844]
[14261] 9066: AF065440
[14262] Homo sapiens low density lipoprotein receptor-related protein II (LRP2) gene, exon 1 and partial cds
[14263] gi|7534311|gb|AF065440.2|AF065440[7534311]
[14264] 9068: AF228458
[14265] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 10 and partial
[14266] cds
[14267] gi|7530451|gb|AF228458.1|AF228450S9[7530451]
[14268] 9069: AF228457
[14269] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 9
[14270] gi|7530450|gb|AF228457.1|AF228450S8[7530450]
[14271] 9070: AF228456
[14272] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 8
[14273] gi|7530449|gb|AF228456.1|AF228450S7[7530449]
[14274] 9071: AF228455
[14275] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 7
[14276] gi|7530448|gb|AF228455.1|AF228450S6[7530448]
[14277] 9072: AF228454
[14278] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 6
[14279] gi|7530447|gb|AF228454.1|AF228450S5[7530447]
[14280] 9073: AF228453
[14281] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 5
[14282] gi|7530446|gb|AF228453.1|AF228450S4[7530446]
[14283] 9074: AF228452
[14284] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 4
[14285] gi|7530445|gb|AF228452.1|AF228450S3[7530445]
[14286] 9075: AF228451
[14287] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 3
[14288] gi|7530444|gb|AF228451.1|AF228450S2[7530444]
[14289] 9076: AF228450
[14290] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 2
[14291] gi|7530443|gb|AF228450.1|AF228450S1[7530443]
[14292] 9077: AH009226
[14293] Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, partial cds
[14294] gi|7530442|gb|AH009226.1|SEG_AF228450S[7530442]
[14295] 9078: AJ272208
[14296] Homo sapiens mRNA for IL-1 receptor accessory protein-like 2 (IL1RAPL-2 gene)
[14297] gi|7530096|emb|AJ272208.1|HSA272208[7530096]
[14298] 9081: AF056085
[14299] Homo sapiens GABA-B receptor mRNA, complete cds
[14300] gi|3719225|gb|AF056085.1|AF056085[3719225]
[14301] 9083: AF161081
[14302] Homo sapiens activating receptor PILRbeta mRNA, complete cds
[14303] gi|5817856|gb|AF161081.1|AF161081[5817856]
[14304] 9084: AF161080
[14305] Homo sapiens inhibitory receptor PILRalpha mRNA, complete cds
[14306] gi|5817854|gb|AF161080.1|AF161080[5817854]
[14307] 9085: AF228449
[14308] Homo sapiens gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5) gene, exon 10 and partial cds
[14309] gi|7417243|gb|AF228449.1|AF228447S3[7417243]
[14310] 9086: AF228448
[14311] Homo sapiens gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5) gene, exon 8 and partial cds
[14312] gi|7417242|gb|AF228448.1|AF228447S2[7417242]
[14313] 9087: AF228447
[14314] Homo sapiens gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5) gene, exons 5, 6, and partial cds
[14315] gi|7417241|gb|AF228447.1|AF228447S1[7417241]
[14316] 9088: AH009221
[14317] Homo sapiens gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5), gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5), and gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5) genes, partial cds
[14318] gi|7417240|gb|AH009221.1|SEG_AF228447S[7417240]
[14319] 9089: AF198052
[14320] Homo sapiens EVH1 domain binding protein mRNA, complete cds
[14321] gi|7416992|gb|AF198052.1|AF198052[7416992]
[14322] 9091: AF159278
[14323] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 17
[14324] gi|7406946|gb|AF159278.1F159262S17[7406946]
[14325] 9092: AF159277
[14326] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 16 and complete cds, alternatively spliced
[14327] gi|7406945|gb|AF159277.1|F159262S16[7406945]
[14328] 9093: AF159276
[14329] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 15
[14330] gi|7406944|gb|AF159276.1|F159262S15[7406944]
[14331] 9094: AF159275
[14332] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 14
[14333] gi|7406943|gb|AF159275.1|F159262S14[7406943]
[14334] 9095: AF159274
[14335] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 13
[14336] gi|7406942|gb|AF159274.1|F159262S13[7406942]
[14337] 9096: AF159273
[14338] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 12
[14339] gi|7406941|gb|AF159273.1F159262S12[7406941]
[14340] 9097: AF159272
[14341] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 11
[14342] gi|7406940|gb|AF159272.1|F159262S11[7406940]
[14343] 9098: AF159271
[14344] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 10
[14345] gi|7406939|gb|AF159271.1|F159262S10[7406939]
[14346] 9099: AF159270
[14347] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 9
[14348] gi|7406938|gb|AF159270.1|F159262S09[7406938]
[14349] 9100: AF159269
[14350] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 8
[14351] gi|7406937|gb|AF159269.1F159262S08[7406937]
[14352] 9101: AF159268
[14353] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 7
[14354] gi|7406936|gb|AF159268.1|F159262S07[7406936]
[14355] 9102: AF159267
[14356] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 6
[14357] gi|7406935|gb|AF159267.1|F159262S06[7406935]
[14358] 9103: AF159266
[14359] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 5
[14360] gi|7406934|gb|AF159266.1|F159262S05[7406934]
[14361] 9104: AF159265
[14362] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 4
[14363] gi|7406933|gb|AF159265.1|F159262S04[7406933]
[14364] 9105: AF159264
[14365] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 3
[14366] gi|7406932|gb|AF159264.1F159262S03[7406932]
[14367] 9106: AF159263
[14368] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 2
[14369] gi|7406931|gb|AF159263.1|F159262S02[7406931]
[14370] 9107: AF159262
[14371] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 1
[14372] gi|7406930|gb|AF159262.1|F159262S01[7406930]
[14373] 9108: AH009217
[14374] Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, complete cds, alternatively spliced
[14375] gi|7406929|gb|AH009217.1|SEG_F159262S[7406929]
[14376] 9109: AF176812
[14377] Homo sapiens dopamine receptor D2longer mRNA, complete cds
[14378] gi|7381415|gb|AF176812.1|AF176812[7381415]
[14379] 9112: AF193507
[14380] Homo sapiens chemokine receptor (CCR11) gene, complete cds
[14381] gi|736334|gb|AF193507.1|AF193507[7363341]
[14382] 9113: AF105239
[14383] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon 9
[14384] and complete cds
[14385] gi|7363319|gb|AF105239.1|KIR3DL9[7363319]
[14386] 9114: AF105238
[14387] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon 8
[14388] gi|7363318|gb|AF105238.1|KIR3DL8[7363318]
[14389] 9115: AF105237
[14390] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon 7
[14391] gi|7363317|gb|AF105237.1|KIR3DL7[7363317]
[14392] 9116: AF105236
[14393] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon 6
[14394] gi|7363316|gb|AF105236.1|KIR3DL6[7363316]
[14395] 9117: AF105235
[14396] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon 5
[14397] gi|7363315|gb|AF105235.1|KIR3DL5[7363315]
[14398] 9118: AF105234
[14399] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon 4
[14400] gi|7363314|gb|AF105234.1|KIR3DL4[7363314]
[14401] 9119: AF105233
[14402] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon 3
[14403] gi|7363313|gb|AF105233.1|KIR3DL3[7363313]
[14404] 9120: AF105232
[14405] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon 2
[14406] gi|7363312|gb|AF105232.1|KIR3DL2[7363312]
[14407] 9121: AF105231
[14408] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon 1
[14409] gi|736331|gb|AF105231.1|KIR3DL1[7363311]
[14410] 9122: AH009212
[14411] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, complete
[14412] cds
[14413] gi|7363310|gb|AH009212.1|SEG_KIR3DL[7363310]
[14414] 9123: AF104856
[14415] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon 9
[14416] and complete cds
[14417] gi|7363308|gb|AF104856.1|HSKCIRV9[7363308]
[14418] 9124: AF104855
[14419] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon 8
[14420] gi|7363307|gb|AF104855.1|HSKCIRV8[7363307]
[14421] 9125: AF104854
[14422] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon 7
[14423] gi|7363306|gb|AF104854.1|HSKCIRV7[7363306]
[14424] 9126: AF104853
[14425] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon 6
[14426] gi|7363305|gb|AF104853.1|HSKCIRV6[7363305]
[14427] 9127: AF104852
[14428] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon 5
[14429] gi|7363304|gb|AF104852.1|HSKCIRV5[7363304]
[14430] 9128: AF104851
[14431] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon 4
[14432] gi|7363303|gb|AF104851.1|HSKCIRV4[7363303]
[14433] 9129: AF104850
[14434] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon 3
[14435] gi|7363302|gb|AF104850.1|HSKCIRV3[7363302]
[14436] 9130: AF104849
[14437] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon 2
[14438] gi|7363301|gb|AF104849.1|HSKCIRV2[7363301]
[14439] 9131: AF104848
[14440] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon
[14441] 1
[14442] gi|7363300|gb|AF104848.1|HSKCIRV1[7363300]
[14443] 9132: AH009211
[14444] Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, complete cds
[14445] gi|7363299|gb|AH009211.1|SEG_HSKCIRV[7363299]
[14446] 9136: AF130742
[14447] AF130742 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence
[14448] gi|7330628|gb|AF130742.1|AF130742[7330628]
[14449] 9137: AF130741
[14450] AF130741 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence
[14451] gi|7330627|gb|AF130741.1|AF130741[7330627]
[14452] 9138: AF130740
[14453] AF130740 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence
[14454] gi|7330626|gb|AF130740.1|AF130740[7330626]
[14455] 9139: AF130739
[14456] AF130739 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence
[14457] gi|7330625|gb|AF130739.1|AF130739[7330625]
[14458] 9140: AF130738
[14459] AF130738 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence
[14460] gi|7330624|gb|AF130738.1|AF130738[7330624]
[14461] 9141: AF130737
[14462] AF130737 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence
[14463] gi|7330623|gb|AF130737.1|AF130737[7330623]
[14464] 9142: AF130743
[14465] AF130743 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence
[14466] 9143: AB032593
[14467] Homo sapiens mRNA for PXR2b, complete cds
[14468] gi|7328930|dbj|AB3032593.1|AB032593[7328930]
[14469] 9144: AB032592
[14470] Homo sapiens mRNA for PXR2a, complete cds
[14471] gi|7328928|dbj|AB032592.1|AB032592[7328928]
[14472] 9145: AF110640
[14473] Homo sapiens orphan seven-transmembrane receptor (VSHK1) mRNA, complete cds
[14474] gi|7328551|gb|AF110640.1|AF110640[7328551]
[14475] 9147: AF181286
[14476] Homo sapiens mutant dystrophin mRNA, partial cds
[14477] gi|7321332|gb|AF181286.1|AF181286[7321332]
[14478] 9148: AF181285
[14479] Homo sapiens X-linked interleukin-1 receptor accessory protein-like 2 (IL1RAPL2)
[14480] mRNA, partial cds
[14481] gi|7321330|gb|AF181285.1|AF181285[7321330]
[14482] 9149: AF181284
[14483] Homo sapiens X-linked interleukin-1 receptor accessory protein-like 1 (IL1RAPL1)
[14484] mRNA, complete cds
[14485] gi|7321328|gb|AF181284.1|AF181284[7321328]
[14486] 9150: G64286
[14487] 34 Human Homo sapiens STS cDNA, sequence tagged site
[14488] gi|7274484|gb|G64286.1G64286[7274484]
[14489] 9151: AF145712
[14490] Homo sapiens soluble neuropilin-1 mRNA, complete cds
[14491] gi|7271464|gb|AF145712.1|AF145712[7271464]
[14492] 9180: AB031325
[14493] Homo sapiens gene for calcium-sensing receptor, exons, promoter region
[14494] gi|7023984|dbj|AB031325.1|AB031325[7023984]
[14495] 9183: AF112461
[14496] Homo sapiens G protein-coupled receptor 57 (GPR57) gene, complete cds
[14497] gi|6739495|gb|AF112461.1|AF112461[6739495]
[14498] 9184: AF112460
[14499] Homo sapiens G protein-coupled receptor 58 (GPR58) gene, complete cds
[14500] gi|6739493|gb|AF112460.1|AF112460[6739493]
[14501] 9185: AF184174
[14502] Homo sapiens somatostatin receptor 2 (SSTR2) gene, complete cds, alternatively
[14503] spliced
[14504] gi|7229402|gb|AF184174.1|AF184174[7229402]
[14505] 9227: AF175207
[14506] Homo sapiens lectin-like receptor F1, splice variant 1 KLRF1-s1 (KLRF1) mRNA, complete cds
[14507] gi|7188568|gb|AF175207.1|AF175207[7188568]
[14508] 9228: AF175206
[14509] Homo sapiens lectin-like receptor F1 (KLRF1) mRNA, complete cds
[14510] gi|7188566|gb|AF175206.1|AF175206[7188566]
[14511] 9229: AJ271348
[14512] Homo sapiens partial DRD3 gene for dopamine D3 receptor, exon 1
[14513] gi|7159738|emb|AJ271348.2|HSA271348[7159738]
[14514] 9236: AF180814
[14515] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 10 and complete cds
[14516] gi|7157949|gb|AF180814.1|HSPEX7NB9[7157949]
[14517] 9237: AF180813
[14518] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 9
[14519] gi|7157948|gb|AF180813.1|HSPEX7NB8[7157948]
[14520] 9238: AF180812
[14521] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 8
[14522] gi|7157947|gb|AF180812.1|HSPEX7NB7[7157947]
[14523] 9239: AF180811
[14524] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 7
[14525] gi|7157946|gb|AF180811.1|HSPEX7NB6[7157946]
[14526] 9240: AF180810
[14527] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 6
[14528] gi|7157945|gb|AF180810.1|HSPEX7NB5[7157945]
[14529] 9241: AF180809
[14530] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exons 4 and 5
[14531] gi|7157944|gb|AF180809.1|HSPEX7NB4[7157944]
[14532] 9242: AF180808
[14533] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 3
[14534] gi|7157943|gb|AF180808.1|HSPEX7NB3[7157943]
[14535] 9243: AF180807
[14536] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 2
[14537] gi|7157942|gb|AF180807.1|HSPEX7NB2[7157942]
[14538] 9244: AF180806
[14539] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, 5′ region and exon 1
[14540] gi|715794|gb|AF180806.1|HSPEX7NB1[7157941]
[14541] 9245: AH009157
[14542] Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, complete cds
[14543] gi|7157940|gb|AH009157.1|SEG_HSPEX7NB[7157940]
[14544] 9246: AF087930
[14545] Homo sapiens olfactory receptor 17-228 (OR3A2) gene, complete cds
[14546] gi|714464|gb|AF087930.1|AF087930[7144641]
[14547] 9248: AF087928
[14548] Homo sapiens olfactory receptor 17-209 (OR1G1) gene, complete cds
[14549] gi|7144638|gb|AF087928.1|AF087928[7144638]
[14550] 9250: AF087926
[14551] Homo sapiens olfactory receptor 17-201 (OR3A3) gene, complete cds
[14552] gi|7144635|gb|AF087926.1|AF087926[7144635]
[14553] 9251: AF087925
[14554] Homo sapiens olfactory receptor 17-93 (OR1E2) gene, complete cds
[14555] gi|7144633|gb|AF087925.1|AF087925[7144633]
[14556] 9252: AF087924
[14557] Homo sapiens olfactory receptor 17-40 (OR3A1) gene, complete cds
[14558] gi|7144631|gb|AF087924.1|AF087924[7144631]
[14559] 9253: AF087923
[14560] Homo sapiens olfactory receptor 17-31 (OR1D5) gene, complete cds
[14561] gi|7144629|gb|AF087923.1|AF087923[7144629]
[14562] 9254: AF087922
[14563] Homo sapiens olfactory receptor 17-30 (OR1D4) gene, complete cds
[14564] gi|7144627|gb|AF087922.1|AF087922[7144627]
[14565] 9258: AF087918
[14566] Homo sapiens olfactory receptor 17-7 (OR1A1) gene, complete cds
[14567] gi|7144622|gb|AF087918.1|AF087918[7144622]
[14568] 9259: AF087917
[14569] Homo sapiens olfactory receptor 17-4 (OR1D2) gene, complete cds
[14570] gi|7144620|gb|AF087917.1|AF087917[7144620]
[14571] 9260: AF087916
[14572] Homo sapiens olfactory receptor 17-2 (OR1E1) gene, complete cds
[14573] gi|7144618|gb|AF087916.1|AF087916[7144618]
[14574] 9262: AC010582
[14575] Homo sapiens chromosome 14 clone CTD-2547F10, complete sequence
[14576] gi|6721135|gb|AC010582.6|AC010582[6721135]
[14577] 9263: AC010072
[14578] Homo sapiens chromosome 14q31 clone CTD-217314 containing TSHR gene, partial cds; and unknown gene, complete sequence
[14579] gi|6453843|gb|AC010072.5|AC010072[6453843]
[14580] 9264: AF155225
[14581] Homo sapiens olfactory receptor 17-6 (OR1A2) gene, complete cds
[14582] gi|5081803|gb|AF155225.1|AF155225[5081803]
[14583] 9265: AC007262
[14584] Homo sapiens chromosome 14 clone containing gene for thyroid stimulating hormone
[14585] receptor, partial CDS, complete sequence
[14586] gi|4883585|gb|AC007262.4|AC007262[4883585]
[14587] 9266: AC002085
[14588] Homo sapiens Chromosome 17 p13 Cosmid Clone cos26, complete sequence
[14589] gi|4835805|gb|AC002085.2|AC002085[4835805]
[14590] 9267: AC006531
[14591] Homo sapiens chromosome 16 clone 113K5, complete sequence
[14592] gi|4235137|gb|AC006531.1|AC006531[4235137]
[14593] 9268: AC004164
[14594] Homo sapiens chromosome 19, cosmid R26450, complete sequence
[14595] gi|2905827|gb|AC004164.1|AC004164[2905827]
[14596] 9269: AF200949
[14597] Homo sapiens C-type lectin-like receptor-1 mRNA, complete cds
[14598] gi|7110215|gb|AF200949.1|AF200949[7110215]
[14599] 9277: AF124841
[14600] Homo sapiens C-type lectin-like receptor-2 mRNA, complete cds
[14601] gi|7109730|gb|AF124841.1|AF124841[7109730]
[14602] 9278: AF210818
[14603] Homo sapiens SWAP-70 mRNA, complete cds
[14604] gi|6691098|gb|AF210818.1|AF210818[6691098]
[14605] 9281: AF134838
[14606] Homo sapiens endocytic receptor Endo180 (ENDO180) mRNA, complete cds
[14607] gi|4835877|gb|AF134838.1|AF134838[4835877]
[14608] 9282: U89326
[14609] Homo sapiens bone morphogenetic protein receptor type I ALK-6 mRNA, complete cds
[14610] gi|3377788|gb|U89326.1|HSU89326[3377788]
[14611] 9283: AJ003080
[14612] Homo sapiens mRNA for serotonin receptor (short isoform)
[14613] gi|3115225|emb|AJ003080.1|HSAJ3080[3115225]
[14614] 9284: AJ003079
[14615] Homo sapiens mRNA for 5-hydroxytryptamine3 receptor
[14616] gi|3115223|emb|AJ003079.1|HSAJ3079[3115223]
[14617] 9285: AJ003078
[14618] Homo sapiens mRNA for 5-HT3 serotonin receptor (long isoform)
[14619] gi|3115221|emb|AJ003078.1|HSAJ3078[3115221]
[14620] 9286: AC024126
[14621] Homo sapiens chromosome 11 clone cosmid f-o-8180 map 11q13, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces
[14622] gi|7025812|gb|AC024126.1|AC024126[7025812]
[14623] 9287: AC024124
[14624] Homo sapiens chromosome 11 clone cosmid b-o-7185 map 11q13, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces
[14625] gi|7025810|gb|AC024124.1|AC024124[7025810]
[14626] 9288: AC024123
[14627] Homo sapiens chromosome 11 clone bac67-m-5 map 11q13, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces
[14628] gi|7025809|gb|AC024123.1|AC024123[7025809]
[14629] 9289: AF226728
[14630] Homo sapiens somatostatin receptor-interacting protein splice variant b (SSTRIP)
[14631] mRNA, complete cds
[14632] gi|7025450|gb|AF226728.1|AF226728[7025450]
[14633] 9290: AL157442
[14634] Homo sapiens mRNA; cDNA DKFZp586P1424 (from clone DKFZp586P1424); partial cds
[14635] gi|7018558|emb|AL157442.1|HSM802508[7018558]
[14636] 9291: AF217796
[14637] Homo sapiens SCG10 like-protein, helicase-like protein NHL, M68, and ADP-ribosylation factor related protein 1 (ARFRP1) genes, complete cds
[14638] gi|7012928|gb|AF217796.1|AF217796[7012928]
[14639] 9293: AL137719
[14640] Homo sapiens mRNA; cDNA DKFZp434K1831 (from clone DKFZp434K1831); partial cds
[14641] gi|6808155|emb|AL137719.1|HSM802224[6808155]
[14642] 9294: AL137432
[14643] Homo sapiens mRNA; cDNA DKFZp761E1824 (from clone DKFZp761E1824); partial cds
[14644] gi|6807990|emb|AL137432.1|HSM802135[6807990]
[14645] 9295: AL137375
[14646] Homo sapiens mRNA; cDNA DKFZp43411926 (from clone DKFZp43411926); partial cds
[14647] gi|6807903|emb|AL137375.1|HSM802063[6807903]
[14648] 9296: AL137288
[14649] Homo sapiens mRNA; cDNA DKFZp434F1516 (from clone DKFZp434F1S16); partial cds
[14650] gi|6807745|emb|AL137288.1|HSM801953[6807745]
[14651] 9297: AL137651
[14652] Homo sapiens mRNA; cDNA DKFZp43400213 (from clone DKFZp43400213); partial cds
[14653] gi|6807717|emb|AL137651.1|HSM801924[6807717]
[14654] 9298: AL133666
[14655] Homo sapiens mRNA; cDNA DKFZp434C1418 (from clone DKFZp434C1418); partial cds
[14656] gi|6599298|emb|AL133666.1|HSM801500[6599298]
[14657] 9299: AL133097
[14658] Homo sapiens mRNA; cDNA DKFZp434N1928 (from clone DKFZp434N1928)
[14659] gi|6453551|emb|AL133097.1|HSM801374[6453551]
[14660] 9300: AL133058
[14661] Homo sapiens mRNA; cDNA DKFZp434K0615 (from clone DKFZp434K0615); partial cds
[14662] gi|6453479|emb|AL133058.1|HSM801329[6453479]
[14663] 9301: AL133030
[14664] Homo sapiens mRNA; cDNA DKFZp434H177 (from clone DKFZp434H177); partial cds
[14665] gi|6453431|emb|AL133030.1|HSM801297[6453431]
[14666] 9304: AL117432
[14667] Homo sapiens mRNA; cDNA DKFZp434E066 (from clone DKFZp434E066); partial cds
[14668] gi|5911868|emb|AL117432.1|HSM800941[5911868]
[14669] 9305: AL096753
[14670] Homo sapiens mRNA; cDNA DKFZp434C192 (from clone DKFZp434C192); partial cds
[14671] gi|5419889|emb|AL096753.1|HSM800719[5419889]
[14672] 9306: AL080164
[14673] Homo sapiens mRNA; cDNA DKFZp564C1940 (from clone DKFZp564C1940); partial cds
[14674] gi|5262628|emb|AL080164.1|HSM800683[5262628]
[14675] 9307: AL050071
[14676] Homo sapiens mRNA; cDNA DKFZp566B0846 (from clone DKFZp566B0846); partial cds
[14677] gi|4884302|emb|AL050071.1|HSM800396[4884302]
[14678] 9308: AL049924
[14679] Homo sapiens mRNA; cDNA DKFZp564G1182 (from clone DKFZp564G1182); partial cds
[14680] gi|4884170|emb|AL049924.1|HSM800265[4884170]
[14681] 9309: X68559
[14682] Homo sapiens partial FGFR-4 gene for acidic fibroblast growth factor
[14683] gi|556841|emb|X68559.1|HSFGRF[556841]
[14684] 9310: AF228312
[14685] Homo sapiens T-cell receptor zeta chain precursor, mRNA, partial cds
[14686] gi|6984206|gb|AF228312.1|AF228312[6984206]
[14687] 9311: AF199028
[14688] Homo sapiens B7-like protein (GL50) mRNA, complete cds
[14689] gi|6983943|gb|AF199028.1|AF199028[6983943]
[14690] 9315: AF225903
[14691] Homo sapiens D1 dopamine receptor interacting protein calcyon mRNA, complete cds
[14692] gi|6980075|gb|AF225903.1|AF225903[6980075]
[14693] 9316: AF222340
[14694] Homo sapiens type 1 tumor necrosis factor receptor shedding aminopeptidase regulator mRNA, complete cds
[14695] gi|6979942|gb|AF222340.1|AF222340[6979942]
[14696] 9317: AF201349
[14697] Homo sapiens glutamate receptor C gene, partial cds
[14698] gi|6690029|gb|AF201349.1|AF201349[6690029]
[14699] 9318: AF201343
[14700] Homo sapiens glutamate receptor B flop isoform and glutamate receptor B flip isoform genes, partial cds
[14701] gi|6690023|gb|AF201343.1|AF201343[6690023]
[14702] 9319: AJ271729
[14703] Homo sapiens mRNA for glucose-regulated protein (HSPA5 gene)
[14704] gi|6900103|emb|AJ271729.1|HSA271729[6900103]
[14705] 9320: AF217794
[14706] Homo sapiens M68E mRNA, alternatively spliced, complete cds
[14707] gi|6969262|gb|AF217794.1|AF217794[6969262]
[14708] 9321: AF217793
[14709] Homo sapiens M68C mRNA, alternatively spliced, complete cds
[14710] gi|6969260|gb|AF217793.1|AF217793[6969260]
[14711] 9322: AF152238
[14712] Homo sapiens V1b vasopressin receptor (VPR3) gene, complete cds
[14713] gi|6969252|gb|AF152238.1|AF152238[6969252]
[14714] 9325: X89271
[14715] H. sapiens mRNA for HG11 orphan receptor
[14716] gi|6911643|emb|X89271.1|HSHG11ORP[6911643]
[14717] 9328: AJ240085
[14718] Homo sapiens mRNA for T-cell receptor interacting molecule protein, splice variant (TRIM gene)
[14719] gi|6911580|emb|AJ240085.1|HSA240085[6911580]
[14720] 9330: AJ271684
[14721] Homo sapiens mRNA for myeloid DAP12-associating lectin (MDL-1 gene)
[14722] gi|6900101|emb|AJ271684.1|HSA271684[6900101]
[14723] 9331: AJ243213
[14724] Homo sapiens partial 5-HT4 receptor gene, exons 2 to 5
[14725] gi|6900061|emb|AJ243213.1|HSA243213[6900061]
[14726] 9332: AC003075
[14727] Human PAC clone RP4-658N5 from 7p21, complete sequence
[14728] gi|2588637|gb|AC003075.1|AC003075[2588637]
[14729] 9333: AC003078
[14730] Human BAC clone GS1-117010 from 7q21-q22, complete sequence
[14731] gi|258863|gb|AC003078.1|AC003078[2588631]
[14732] 9334: AC002381
[14733] Human BAC clone CTB-20D2 from 7q22, complete sequence
[14734] gi|2275186|gb|AC002381.1|AC002381[2275186]
[14735] 9335: AC005155
[14736] Homo sapiens PAC clone RP5-877J2 from 7 p14-p15, complete sequence
[14737] gi|3242760|gb|AC005155.1|AC005155[3242760]
[14738] 9338: D50678
[14739] Human mRNA for apolipoprotein E receptor 2, complete cds
[14740] gi|1321643|dbj|D50678.1|D50678[1321643]
[14741] 9339: D31770
[14742] Human osteosarcoma mRNA for activin typeII A receptor, complete cds
[14743] gi|1321631|dbj|D31770.1|HUMACTRIIA[1321631]
[14744] 9340: D50516
[14745] Human mRNA for type II receptor for bone morphogenetic protein-4, complete cds
[14746] gi|807712|dbj|D50516.1|HUMBMP4A[807712]
[14747] 9341: D31661
[14748] Human mRNA for tyrosine kinase, complete cds
[14749] gi|495677|dbj|D31661.1|HUMERKA[495677]
[14750] 9342: D17516
[14751] Homo sapiens mRNA for PACAP receptor, complete cds
[14752] gi|457562|dbj|D17516.1|HUMPACAPR[457562]
[14753] 9343: D16105
[14754] Human mRNA for leukocyte tyrosine kinase, complete cds
[14755] gi|440854|dbj|D516105.1|HUMLTKLP2[440854]
[14756] 9344: D16494
[14757] Human mRNA for very low density lipoprotein receptor, complete cds
[14758] gi|391735|dbj|D516494.1|HUMVLDLRB[391735]
[14759] 9345: D16493
[14760] Human mRNA for very low density lipoprotein receptor, complete cds
[14761] gi|391733|dbj|D516493.1|HUMVLDLRA[391733]
[14762] 9346: G63891
[14763] GRM7 Human Homo sapiens STS genomic 3′, sequence tagged site
[14764] gi|6842052|gb|G63891.1|G63891[6842052]
[14765] 9347: G63890
[14766] GRM4 Human Homo sapiens STS genomic 5′, sequence tagged site
[14767] gi|6842051|gb|G63890.1|G63890[6842051]
[14768] 9471: AF148806
[14769] Homo sapiens dopamine receptor D2 (DRD2) gene, 5′-flanking region and exon 1
[14770] gi|6759904|gb|AF148806.1|AF148806[6759904]
[14771] 9473: AF189251
[14772] Homo sapiens cytomegalovirus partial fusion receptor mRNA, partial cds
[14773] gi|6760349|gb|AF189251.1|AF189251[6760349]
[14774] 9474: AF202063
[14775] Homo sapiens fibroblast growth factor receptor 4, soluble-form splice variant (FGFR4) mRNA, complete cds
[14776] gi|6739817|gb|AF202063.1|AF202063[6739817]
[14777] 9475: AF201951
[14778] Homo sapiens high affinity immunoglobulin epsilon receptor beta subunit mRNA, complete cds
[14779] gi|6563299|gb|AF201951.1|AF201951[6563299]
[14780] 9476: AB037108
[14781] Homo sapiens mRNA for seven transmembrane domain orphan receptor, complete cds
[14782] gi|6729335|dbj|AB037108.1|AB037108[6729335]
[14783] 9478: AF209721
[14784] Homo sapiens IgG Fc receptor locus, partial sequence
[14785] gi|6715394|gb|AF209721.1|AF209721[6715394]
[14786] 9480: AJ238323
[14787] Homo sapiens mRNA for NK inhibitory receptor (IRC2)
[14788] gi|6707798|emb|AJ238323.1|HSA238323[6707798]
[14789] 9481: AB036432
[14790] Homo sapiens RAGE mRNA for advanced glycation endproducts receptor, complete cds
[14791] gi|6691625|dbj|AB036432.1|AB036432[6691625]
[14792] 9482: AF192548
[14793] Homo sapiens tumor necrosis factor receptor-like protein ZTNFR9 (ZTNFR9) mRNA,
[14794] complete cds
[14795] gi|6319129|gb|AF192548.1|AF192548[6319129]
[14796] 9483: AF184971
[14797] Homo sapiens class II cytokine receptor ZCYTOR7 (ZCYTOR7) mRNA, complete cds
[14798] gi|6013324|gb|AF184971.1|AF184971[6013324]
[14799] 9484: AJ012288
[14800] Homo sapiens mRNA for GABA-BR1
[14801] gi|4186035|emb|AJ012288.1|HSA012288[4186035]
[14802] 9485: AB035073
[14803] Homo sapiens mRNA for platelet glycoprotein VI, complete cds
[14804] gi|6691622|dbj|AB035073.1|AB035073[6691622]
[14805] 9486: AF217403
[14806] Homo sapiens low density lipoprotein receptor (LDLR) gene, partial cds
[14807] gi|6691160|gb|AF217403.1|AF217403[6691160]
[14808] 9487: AF200465
[14809] Homo sapiens coxsackievirus and adenovirus receptor (CXADR) gene, complete cds;
[14810] and ANA gene, partial cds
[14811] gi|6690789|gb|AF200465.1|AF200465[6690789]
[14812] 9509: AJ243342
[14813] Homo sapiens mRNA for nicotinic acetylcholine receptor alpha 9 subunit (NACHRA9 gene)
[14814] gi|6688135|emb|AJ243342.1|HSA243342[6688135]
[14815] 9510: AJ223183
[14816] Homo sapiens mRNA for DORA protein
[14817] gi|3925598|emb|AJ223183.1|HSAJ3183[3925598]
[14818] 9512: AF006265
[14819] Homo sapiens cancer associated surface antigen (RCAS1) mRNA, complete cds
[14820] gi|2213933|gb|AF006265.1|AF006265[2213933]
[14821] 9513: AF159570
[14822] Homo sapiens regulator of G-protein signalling 5 (RGS5) mRNA, complete cds
[14823] gi|5230675|gb|AF159570.1|AF159570[5230675]
[14824] 9515: D29952
[14825] Human DNA for alpha1A/D adrenergic receptor, complete cds
[14826] gi|914933|dbj|D29952.1|HUMA1ADAR[914933]
[14827] 9516: NM—004441
[14828] Homo sapiens EphB1 (EPHB1) mRNA
[14829] gi|4758283|ref|NM—004441.1|[4758283]
[14830] 9532: AF133299
[14831] Homo sapiens lectin-like NK cell receptor LLT1 (LLT1) mRNA, complete cds
[14832] gi|6651064|gb|AF133299.1|AF133299[6651064]
[14833] 9533: AF110265
[14834] Homo sapiens epidermal growth factor receptor substrate EPS15R mRNA, complete cds
[14835] gi|6650598|gb|AF110265.1|AF110265[6650598]
[14836] 9535: AF061779
[14837] Homo sapiens cosmid 25, complete sequence
[14838] gi|6650204|gb|AF061779.1|AF061779[6650204]
[14839] 9537: AF118224
[14840] Homo sapiens matriptase mRNA, complete cds
[14841] gi|6647301|gb|AF118224.2|AF118224[6647301]
[14842] 9538: AF125809
[14843] Homo sapiens neurotrophic receptor tyrosine kinase-ETS related protein fusion protein (NTRK3-ETV6 fusion) mRNA, partial cds
[14844] gi|6635288|gb|AF125809.1|AF125809[6635288]
[14845] 9539: AF125808
[14846] Homo sapiens ETS related protein-neurotrophic receptor tyrosine kinase fusion protein (ETV6-NTRK3 fusion) mRNA, partial cds
[14847] gi|6635286|gb|AF125808.1|AF125808[6635286]
[14848] 9540: AJ000542
[14849] Homo sapiens partial p58 gene for NK receptor
[14850] gi|6624934|emb|AJ000542.2|HSP58NKRC[6624934]
[14851] 9541: AF190826
[14852] Homo sapiens P2X2A receptor (P2X2) gene, complete cds
[14853] gi|6606329|gb|AF190826.1|AF190826[6606329]
[14854] 9542: AF190825
[14855] Homo sapiens P2X2D receptor (P2X2) mRNA, complete cds
[14856] gi|6606327|gb|AF190825.1|AF190825[6606327]
[14857] 9543: AF190824
[14858] Homo sapiens P2X2C receptor (P2X2) mRNA, complete cds
[14859] gi|6606325|gb|AF190824.1|AF190824[6606325]
[14860] 9544: AF190823
[14861] Homo sapiens P2X2B receptor (P2X2) mRNA, complete cds
[14862] gi|6606323|gb|AF190823.1|AF190823[6606323]
[14863] 9545: AF190822
[14864] Homo sapiens P2X2A receptor (P2X2) mRNA, complete cds
[14865] gi|660632|gb|AF190822.1|AF190822[6606321]
[14866] 9546: AH008809
[14867] Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, complete cds
[14868] gi|6606289|gb|AH008809.1|SEG_AF159616S[6606289]
[14869] 9547: AF159621
[14870] Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 6 and complete
[14871] cds
[14872] gi|6606288|gb|AF159621.1|AF159616S6[6606288]
[14873] 9548: AF159620
[14874] Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 5
[14875] gi|6606287|gb|AF159620.1|AF159616S5[6606287]
[14876] 9549: AF159619
[14877] Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 4
[14878] gi|6606286|gb|AF159619.1|AF159616S4[6606286]
[14879] 9550: AF159618
[14880] Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 3
[14881] gi|6606285|gb|AF159618.1|AF159616S3[6606285]
[14882] 9551: AF159617
[14883] Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 2
[14884] gi|6606284|gb|AF159617.1|AF159616S2[6606284]
[14885] 9552: AF159616
[14886] Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 1
[14887] gi|6606283|gb|AF159616.1|AF159616S1[6606283]
[14888] 9553: AH008808
[14889] Homo sapiens PPAR gamma coactivator (PPAR gamma coactivator) gene, complete cds
[14890] gi|6606153|gb|AH008808.1|SEG_F108193S[6606153]
[14891] 9554: AF108205
[14892] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 13 and complete cds
[14893] gi|6606152|gb|AF108205.1|F108193S13[6606152]
[14894] 9555: AF108204
[14895] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 12
[14896] gi|6606151|gb|AF108204.1|F108193S12[6606151]
[14897] 9556: AF108203
[14898] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 11
[14899] gi|6606150|gb|AF108203.1|F108193S11[6606150]
[14900] 9557: AF108202
[14901] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 10
[14902] gi|6606149|gb|AF108202.1|F108193S10[6606149]
[14903] 9558: AF108201
[14904] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 9
[14905] gi|6606148|gb|AF108201.1|F108193S09[6606148]
[14906] 9559: AF108200
[14907] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 8
[14908] gi|6606147|gb|AF108200.1|F108193S08[6606147]
[14909] 9560: AF108199
[14910] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 7
[14911] gi|6606146|gb|AF108199.1|F108193S07[6606146]
[14912] 9561: AF108198
[14913] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 6
[14914] gi|6606145|gb|AF108198.1|F108193S06[6606145]
[14915] 9562: AF108197
[14916] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 5
[14917] gi|6606144|gb|AF108197.1|F108193S05[6606144]
[14918] 9563: AF108196
[14919] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 4
[14920] gi|6606143|gb|AF108196.1F108193S04[6606143]
[14921] 9564: AF108195
[14922] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 3
[14923] gi|6606142|gb|AF108195.1|F108193S03[6606142]
[14924] 9565: AF108194
[14925] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 2
[14926] gi|6606141|gb|AF108194.1|F108193S02[6606141]
[14927] 9566: AF108193
[14928] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 1
[14929] gi|6606140|gb|AF108193.1|F108193S01[6606140]
[14930] 9567: AC005009
[14931] Homo sapiens BAC clone GS1-67A24 from 7q21.q21.2, complete sequence
[14932] gi|4156150|gb|AC005009.1|AC005009[4156150]
[14933] 9568: AF047487
[14934] Homo sapiens Nck-2 (NCK2) mRNA, complete cds
[14935] gi|3930216|gb|AF047487.1|AF047487[3930216]
[14936] 9569: AC004822
[14937] Homo sapiens PAC clone RP1-170D19 from Xq23, complete sequence
[14938] gi|3845420|gb|AC004822.1|AC004822[3845420]
[14939] 9570: AC002543
[14940] Homo sapiens BAC clone CTA-300C3 from 7q31.2, complete sequence
[14941] gi|3645947|gb|AC002543.1|AC002543[3645947]
[14942] 9571: AC002081
[14943] Homo sapiens BAC clone CTA-331C24 from 7q21, complete sequence
[14944] gi|2078453|gb|AC002081.1|AC002081[2078453]
[14945] 9572: AF106698
[14946] Homo sapiens PPAR gamma coactivator-1 (PPARGC1) mRNA, complete cds
[14947] gi|6594644|gb|AF106698.1|AF106698[6594644]
[14948] 9574: AH002552
[14949] Homo sapiens CHRNG gene, complete sequence; and acetylcholine receptor gamma-subunit (ACHR) gene, partial cds
[14950] gi|6579185|gb|AH002552.2|SEG_HUMACHRG[6579185]
[14951] 9575: L29197
[14952] Homo sapiens acetylcholine receptor gamma-subunit (ACHR) gene, exons 10 and 11
[14953] gi|457433|gb|L29197.1|HUMACHRG7[457433]
[14954] 9576: M11811
[14955] Homo sapiens acetylcholine receptor gamma-subunit (ACHR) gene, exon 12 and partial cds
[14956] gi|177984|gb|M11811.1|HUMACHRG8[177984]
[14957] 9580: AF119666
[14958] Homo sapiens insulin receptor tyrosine kinase substrate mRNA, complete cds
[14959] gi|6563257|gb|AF119666.1|AF119666[6563257]
[14960] 9581: AF109683
[14961] Homo sapiens leukocyte-associated Ig-like receptor 1b mRNA, complete cds
[14962] gi|6563041|gb|AF109683.1|AF109683[6563041]
[14963] 9582: AH008758
[14964] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, complete cds
[14965] gi|6561205|gb|AH008758.1|SEG_HSILGFR[6561205]
[14966] 9583: AF109291
[14967] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 48 and complete cds
[14968] gi|6561204|gb|AF109291.1|HSILGFR48[6561204]
[14969] 9584: AF109290
[14970] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 47
[14971] gi|6561203|gb|AF109290.1|HSILGFR47[6561203]
[14972] 9585: AF109289
[14973] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 46
[14974] gi|6561202|gb|AF109289.1|HSILGFR46[6561202]
[14975] 9586: AF109288
[14976] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 45
[14977] gi|656120|gb|AF109288.1|HSILGFR45[6561201]
[14978] 9587: AF109287
[14979] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 44
[14980] gi|6561200|gb|AF109287.1|HSILGFR44[6561200]
[14981] 9588: AF109286
[14982] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 43
[14983] gi|6561199|gb|AF109286.1|HSILGFR43[6561199]
[14984] 9589: AF109285
[14985] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 42
[14986] gi|6561198|gb|AF109285.1|HSILGFR42[6561198]
[14987] 9590: AF109284
[14988] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 41
[14989] gi|6561197|gb|AF109284.1|HSILGFR41[6561197]
[14990] 9591: AF109283
[14991] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 40
[14992] gi|6561196|gb|AF109283.1|HSILGFR40[6561196]
[14993] 9592: AF109282
[14994] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 39
[14995] gi|6561195|gb|AF109282.1|HSILGFR39[6561195]
[14996] 9593: AF109281
[14997] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 38
[14998] gi|6561194|gb|AF109281.1|HSILGFR38[6561194]
[14999] 9594: AF109280
[15000] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 37
[15001] gi|6561193|gb|AF109280.1|HSILGFR37[6561193]
[15002] 9595: AF109279
[15003] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 36
[15004] gi|6561192|gb|AF109279.1|HSILGFR36[6561192]
[15005] 9596: AF109278
[15006] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 35
[15007] gi|6561191|gb|AF109278.1|HSILGFR35[6561191]
[15008] 9597: AF109277
[15009] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 34
[15010] gi|6561190|gb|AF109277.1|HSILGFR34[6561190]
[15011] 9598: AF109276
[15012] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 33
[15013] gi|6561189|gb|AF109276.1|HSILGFR33[6561189]
[15014] 9599: AF109275
[15015] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 32
[15016] gi|6561188|gb|AF109275.1|HSILGFR32[6561188]
[15017] 9600: AF109274
[15018] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 31
[15019] gi|6561187|gb|AF109274.1|HSILGFR31[6561187]
[15020] 9601: AF109273
[15021] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 30
[15022] gi|6561186|gb|AF109273.1|HSILGFR30[6561186]
[15023] 9602: AF109272
[15024] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 29
[15025] gi|6561185|gb|AF109272.1|HSILGFR29[6561185]
[15026] 9603: AF109271
[15027] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 28
[15028] gi|6561184|gb|AF109271.1|HSILGFR28[6561184]
[15029] 9604: AF109270
[15030] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 27
[15031] gi|6561183|gb|AF109270.1|HSILGFR27[6561183]
[15032] 9605: AF109269
[15033] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 26
[15034] gi|6561182|gb|AF109269.1|HSILGFR26[6561182]
[15035] 9606: AF109268
[15036] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 25
[15037] gi|6561181|gb|AF109268.1|HSILGFR25[6561181]
[15038] 9607: AF109267
[15039] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 24
[15040] gi|6561180gb|AF109267.1|HSILGFR24[6561180]
[15041] 9608: AF109266
[15042] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 23
[15043] gi|6561179|gb|AF109266.1|HSILGFR23[6561179]
[15044] 9609: AF109265
[15045] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 22
[15046] gi|6561178|gb|AF109265.1|HSILGFR22[6561178]
[15047] 9610: AF109264
[15048] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 21
[15049] gi|6561177|gb|AF109264.1|HSILGFR21[6561177]
[15050] 9611: AF109263
[15051] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 20
[15052] gi|6561176|gb|AF109263.1|HSILGFR20[6561176]
[15053] 9612: AF109262
[15054] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 19
[15055] gi|6561175|gb|AF109262.1|HSILGFR19[6561175]
[15056] 9613: AF109261
[15057] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 18
[15058] gi|6561174|gb|AF109261.1|HSILGFR18[6561174]
[15059] 9614: AF109260
[15060] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 17
[15061] gi|6561173|gb|AF109260.1|HSILGFR17[6561173]
[15062] 9615: AF109259
[15063] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 16
[15064] gi|6561172|gb|AF109259.1|HSILGFR16[6561172]
[15065] 9616: AF109258
[15066] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 15
[15067] gi|6561171|gb|AF109258.1|HSILGFR15[6561171]
[15068] 9617: AF109257
[15069] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 14
[15070] gi|6561170gb|AF109257.1|HSILGFR14[6561170]
[15071] 9618: AF109256
[15072] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 13
[15073] gi|6561169|gb|AF109256.1|HSILGFR13[6561169]
[15074] 9619: AF109255
[15075] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 12
[15076] gi|6561168|gb|AF109255.1|HSILGFR1 2[6561168]
[15077] 9620: AF109254
[15078] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 11
[15079] gi|6561167|gb|AF109254.1|HSILGFR11[6561167]
[15080] 9621: AF109253
[15081] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 10
[15082] gi|6561166|gb|AF109253.1|HSILGFR10[6561166]
[15083] 9622: AF109252
[15084] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 9
[15085] gi|6561165|gb|AF109252.1|HSILGFR09[6561165]
[15086] 9623: AF109251
[15087] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 8
[15088] gi|6561164|gb|AF109251.1|HSILGFR08[6561164]
[15089] 9624: AF109250
[15090] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 7
[15091] gi|6561163|gb|AF109250.1|HSILGFR07[6561163]
[15092] 9625: AF109249
[15093] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 6
[15094] gi|6561162|gb|AF109249.1|HSILGFR06[6561162]
[15095] 9626: AF109248
[15096] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 5
[15097] gi|6561161|gb|AF109248.1HSILGFR05[6561161]
[15098] 9627: AF109247
[15099] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 4
[15100] gi|6561160gb|AF109247.1|HSILGFR04[6561160]
[15101] 9628: AF109246
[15102] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 3
[15103] gi|6561159|gb|AF109246.1|HSILGFR03[6561159]
[15104] 9629: AF109245
[15105] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 2
[15106] gi|6561158|gb|AF109245.1|HSILGFR02[6561158]
[15107] 9630: AF109244
[15108] Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 1
[15109] gi|6561157|gb|AF109244.1|HSILGFR01[6561157]
[15110] 9631: AF178684
[15111] Homo sapiens class I cytokine receptor (zcytor5) mRNA, complete cds
[15112] gi|5853247|gb|AF178684.1|AF178684[5853247]
[15113] 9632: AQ917583
[15114] hxa18 Bac Human I Homo sapiens genomic, genomic survey sequence
[15115] gi|6552294|gb|AQ917583.1|AQ917583[6552294]
[15116] 9633: AQ917582
[15117] hxa17 Bac Human I Homo sapiens genomic, genomic survey sequence
[15118] gi|6552293|gb|AQ917582.1|AQ917582[6552293]
[15119] 9634: AQ917581
[15120] hxa16 Bac Human I Homo sapiens genomic, genomic survey sequence
[15121] gi|6552292|gb|AQ917581.1|AQ917581[6552292]
[15122] 9635: AQ917580
[15123] hxa15 Bac Human I Homo sapiens genomic, genomic survey sequence
[15124] gi|6552291|gb|AQ917580.1|AQ917580[6552291]
[15125] 9636: AQ917579
[15126] hxa14 Bac Human I Homo sapiens genomic, genomic survey sequence
[15127] gi|6552290|gb|AQ917579.1|AQ917579[6552290]
[15128] 9637: AQ917578
[15129] hxa13 Bac Human I Homo sapiens genomic, genomic survey sequence
[15130] gi|6552289|gb|AQ917578.1|AQ917578[6552289]
[15131] 9638: AQ917577
[15132] hxa12 Bac Human I Homo sapiens genomic, genomic survey sequence
[15133] gi|6552288|gb|AQ917577.1|AQ917577[6552288]
[15134] 9639: AQ917576
[15135] Hxa11 Bac Human I Homo sapiens genomic, genomic survey sequence
[15136] gi|6552287|gb|AQ917576.1|AQ917576[6552287]
[15137] 9640: AQ917575
[15138] hxa10 Bac Human I Homo sapiens genomic, genomic survey sequence
[15139] gi|6552286|gb|AQ917575.1|AQ917575[6552286]
[15140] 9641: AQ917574
[15141] hxa9 Bac Human I Homo sapiens genomic, genomic survey sequence
[15142] gi|6552285|gb|AQ917574.1|AQ917574[6552285]
[15143] 9642: AQ917573
[15144] hxa8 Bac Human I Homo sapiens genomic, genomic survey sequence
[15145] gi|6552284|gb|AQ917573.1|AQ917573[6552284]
[15146] 9643: AQ917572
[15147] hxa7 Bac Human I Homo sapiens genomic, genomic survey sequence
[15148] gi|6552283|gb|AQ917572.1|AQ917572[6552283]
[15149] 9644: AQ917571
[15150] hxa6 Bac Human I Homo sapiens genomic, genomic survey sequence
[15151] gi|6552282|gb|AQ917571.1|AQ917571[6552282]
[15152] 9645: AQ917570
[15153] hxa5 Bac Human I Homo sapiens genomic, genomic survey sequence
[15154] gi|6552281|gb|AQ917570.1|AQ917570[6552281]
[15155] 9646: AQ917569
[15156] hxa4 Bac Human I Homo sapiens genomic, genomic survey sequence
[15157] gi|6552280|gb|AQ917569.1|AQ917569[6552280]
[15158] 9647: AQ917568
[15159] hxa3 Bac Human I Homo sapiens genomic, genomic survey sequence
[15160] gi|6552279|gb|AQ917568.1|AQ917568[6552279]
[15161] 9648: AQ917567
[15162] hxa2 Bac Human I Homo sapiens genomic, genomic survey sequence
[15163] gi|6552278|gb|AQ917567.1|AQ917567[6552278]
[15164] 9649: AQ917566
[15165] hxa1 Bac Human I Homo sapiens genomic, genomic survey sequence
[15166] gi|6552277|gb|AQ917566.1|AQ917566[6552277]
[15167] 9650: AH008470
[15168] Homo sapiens somatostatin receptor subtype 2 gene, partial cds
[15169] gi|6531649|gb|AH008470.1|SEG_AF182397S[6531649]
[15170] 9652: AF182397
[15171] Homo sapiens somatostatin receptor subtype 2 gene, promoter region and patial
[15172] cds
[15173] gi|6531647|gb|AF182397.1|AF182397S1[6531647]
[15174] 9654: AF068757
[15175] Homo sapiens somatostatin receptor subtype 3 (SSTR3) gene, 5′ flanking region and partial cds
[15176] gi|6523784|gb|AF068757.1|AF068757[6523784]
[15177] 9656: AF166329
[15178] Homo sapiens intermediate prolactin receptor isoform mRNA, complete cds
[15179] gi|5734139|gb|AF166329.1|AF166329[5734139]
[15180] 9658: AJ251595
[15181] Homo sapiens mRNA for transmembrane glycoprotein (CD44 gene)
[15182] gi|6491738|emb|AJ251595.1|HSA251595[6491738]
[15183] 9659: AF100772
[15184] Homo sapiens tenascin-M1 (TNM1) mRNA, complete cds
[15185] gi|6165844|gb|AF100772.1|AF100772[6165844]
[15186] 9660: AF100634
[15187] Homo sapiens Duffy antigen/Receptor for chemokines (DARC) gene, DARC-Fya allele,
[15188] partial cds
[15189] gi|6048958|gb|AF100634.1|AF100634[6048958]
[15190] 9661: AH008438
[15191] Homo sapiens outer membrane receptor Tom20 (TOM20) gene, complete cds
[15192] gi|6469611|gb|AH008438.1|SEG_HS20TOM[6469611]
[15193] 9662: AF019638
[15194] Homo sapiens nedasin s-form mRNA, complete cds
[15195] gi|6469319|gb|AF019638.1|AF019638[6469319]
[15196] 9663: AB3010445
[15197] Homo sapiens mRNA for CC chemokine ILC, complete cds
[15198] gi|6469037|dbj|AB010445.1|AB010445[6469037]
[15199] 9664: AF119330
[15200] Synthetic construct from Homo sapiens dopamine receptor D4-7 mRNA, partial cds
[15201] gi|4325159|gb|AF119330.1|AF119330[4325159]
[15202] 9665: AF119329
[15203] Synthetic construct from Homo sapiens dopamine receptor D4-4 mRNA, partial cds
[15204] gi|4325157|gb|AF119329.1|AF119329[4325157]
[15205] 9666: AF119328
[15206] Synthetic construct from Homo sapiens dopamine receptor D4-2 mRNA, partial cds
[15207] gi|4325155|gb|AF119328.1|AF119328[4325155]
[15208] 9667: AL021940
[15209] Homo sapiens DNA sequence from PAC 117P20 on chromosome 1q24. Contains the LNHR
[15210] (SELL) gene coding for Lymph Node Homing Receptor (L-Selectin precursor, LAM-1
[15211] Leukocyte Adhesion Molecule, Leukocyte surface antigen Leu-8, TQ1, GP90-MEL, LECAM1 Leukocyte-Endothelial Cell Adhesion Molecule 1, CD62L). Contains the SELE
[15212] gene coding for E-Selectin precursor (CD62E, ELAM-1 Endothelial Leukocyte Adhesion Molecule 1, LECAM-2 Leukocyte-Endothelial Cell Adhesion Molecule 2).
[15213] Contains an unknown gene with homology to predicted yeast. plant and worm proteins. Contains ESTs and STSs, complete sequence
[15214] gi|3115962|emb|AL021940.1|HS117P20[3115962]
[15215] 9668: AF152113
[15216] Homo sapiens perforin gene, IL-2 responsive enhancer sequence
[15217] gi|6467393|gb|AF152113.1|AF152113[6467393]
[15218] 9669: AB022178
[15219] Homo sapiens mRNA for calcitonin receptor, complete cds, isolate from bone marrow osteoclast
[15220] gi|6456431|dbj|AB022178.1|AB022178[6456431]
[15221] 9670: AB022177
[15222] Homo sapiens mRNA for calcitonin receptor, complete cds, isolate from breast carcinoma
[15223] gi|6456429|dbj|AB022177.1|AB022177[6456429]
[15224] 9671: AJ251004
[15225] Homo sapiens ITGB4 gene for integrin beta 4, exons 1-2 and joined CDS
[15226] gi|6453379|emb|AJ251004.1|HSA251004[6453379]
[15227] 9672: AJ133822
[15228] Homo sapiens mRNA for receptor for Advanced Glycation End Product, secreted isoform (RAGEsec gene)
[15229] gi|4877290|emb|AJ133822.1|HSA133822[4877290]
[15230] 9673: Y18994
[15231] Homo sapiens GABRR3 gene, partial
[15232] gi|6434194|emb|Y18994.1|HSP18994[6434194]
[15233] 9676: AF177766
[15234] Homo sapiens human toll-like receptor 4 (TLR4) gene, TLR4B allele, partial cds
[15235] gi|6403466|gb|AF177766.1|AF177766[6403466]
[15236] 9677: AH008297
[15237] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, complete
[15238] cds
[15239] gi|6090614|gb|AH008297.1|SEG_HSDRA2S[6090614]
[15240] 9678: AF083854
[15241] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 40
[15242] and complete cds
[15243] gi|6090613|gb|AF083854.1|HSDRA2S38[6090613]
[15244] 9679: AF083853
[15245] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 39
[15246] gi|6090612|gb|AF083853.1|HSDRA2S37[6090612]
[15247] 9680: AF083852
[15248] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 38
[15249] gi|6090611|gb|AF083852.1|HSDRA2S36[6090611]
[15250] 9681: AF083851
[15251] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 37
[15252] gi|6090610gb|AF083851.1|HSDRA2S35[6090610]
[15253] 9682: AF083850
[15254] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 36
[15255] gi|6090609|gb|AF083850.1|HSDRA2S34[6090609]
[15256] 9683: AF083849
[15257] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exons 34
[15258] and 35
[15259] gi|6090608|gb|AF083849.1|HSDRA2S33[6090608]
[15260] 9684: AF083848
[15261] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 33
[15262] gi|6090607|gb|AF083848.1|HSDRA2S32[6090607]
[15263] 9685: AF083847
[15264] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 32
[15265] gi|6090606|gb|AF083847.1|HSDRA2S31[6090606]
[15266] 9686: AF083846
[15267] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 31
[15268] gi|6090605|gb|AF083846.1|HSDRA2S30[6090605]
[15269] 9687: AF083845
[15270] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 30
[15271] gi|6090604|gb|AF083845.1|HSDRA2S29[6090604]
[15272] 9688: AF083844
[15273] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 29
[15274] gi|6090603|gb|AF083844.1|HSDRA2S28[6090603]
[15275] 9689: AF083843
[15276] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 28
[15277] gi|6090602|gb|AF083843.1|HSDRA2S27[6090602]
[15278] 9690: AF083842
[15279] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 27
[15280] gi|6090601|gb|AF083842.1|HSDRA2S26[6090601]
[15281] 9691: AF083841
[15282] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 26
[15283] gi|6090600|gb|AF083841.1|HSDRA2S25[6090600]
[15284] 9692: AF083840
[15285] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 25
[15286] gi|6090599|gb|AF083840.1|HSDRA2S24[6090599]
[15287] 9693: AF083839
[15288] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 24
[15289] gi|6090598|gb|AF083839.1|HSDRA2S23[6090598]
[15290] 9694: AF083838
[15291] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 23
[15292] gi|6090597|gb|AF083838.1|HSDRA2S22[6090597]
[15293] 9695: AF083837
[15294] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 22
[15295] gi|6090596|gb|AF083837.1|HSDRA2S21[6090596]
[15296] 9696: AF083836
[15297] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 21
[15298] gi|6090595|gb|AF083836.1|HSDRA2S20[6090595]
[15299] 9697: AF083835
[15300] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 20
[15301] gi|6090594|gb|AF083835.1|HSDRA2S19[6090594]
[15302] 9698: AF083834
[15303] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 19
[15304] gi|6090593|gb|AF083834.1|HSDRA2S18[6090593]
[15305] 9699: AF083833
[15306] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exons 17
[15307] and 18
[15308] gi|6090592|gb|AF083833.1|HSDRA2S17[6090592]
[15309] 9700: AF083832
[15310] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 16
[15311] gi|6090591|gb|AF083832.1|HSDRA2S16[6090591]
[15312] 9701: AF083831
[15313] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 15
[15314] gi|6090590|gb|AF083831.1|HSDRA2S15[6090590]
[15315] 9702: AF083830
[15316] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 14
[15317] gi|6090589|gb|AF083830.1|HSDRA2S14[6090589]
[15318] 9703: AF083829
[15319] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 13
[15320] gi|6090588|gb|AF083829.1|HSDRA2S13[6090588]
[15321] 9704: AF083828
[15322] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 12
[15323] gi|6090587|gb|AF083828.1|HSDRA2S12[6090587]
[15324] 9705: AF083827
[15325] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 11
[15326] gi|6090586|gb|AF083827.1|HSDRA2S11[6090586]
[15327] 9706: AF083826
[15328] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 10
[15329] gi|6090585|gb|AF083826.1|HSDRA2S10[6090585]
[15330] 9707: AF083825
[15331] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 9
[15332] gi|6090584|gb|AF083825.1|HSDRA2S09[6090584]
[15333] 9708: AF083824
[15334] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 8
[15335] gi|6090583|gb|AF083824.1|HSDRA2S08[6090583]
[15336] 9709: AF083823
[15337] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 7
[15338] gi|6090582|gb|AF083823.1|HSDRA2S07[6090582]
[15339] 9710: AF083822
[15340] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 6
[15341] gi|6090581|gb|AF083822.1|HSDRA2S06[6090581]
[15342] 9711: AF083821
[15343] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 5
[15344] gi|6090580|gb|AF083821.1|HSDRA2S05[6090580]
[15345] 9712: AF083820
[15346] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 4
[15347] gi|6090579|gb|AF083820.1|HSDRA2S04[6090579]
[15348] 9713: AF083819
[15349] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 3
[15350] gi|60905781|gb|AF083819.1|HSDRA2S03[6090578]
[15351] 9714: AF083818
[15352] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 2
[15353] gi|6090577|gb|AF083818.1|HSDRA2S02[6090577]
[15354] 9715: AF083817
[15355] Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 1
[15356] gi|6090576|gb|AF083817.1|HSDRA2S01[6090576]
[15357] 9716: U68492
[15358] Homo sapiens 5-hydroxytryptamine 7 receptor isoform B gene, alternatively spliced, partial cds
[15359] gi|1857150|gb|U68492.1|HS5HTSEV01[1857150]
[15360] 9717: AB032417
[15361] Homo sapiens FZD4 mRNA for WNT receptor Frizzled-4, complete cds
[15362] gi|6277265|dbj|AB032417.1|AB032417[6277265]
[15363] 9718: AF191093
[15364] Homo sapiens P2X4 purinoceptor gene, complete cds
[15365] gi|6274470|gb|AF191093.1|AF191093[6274470]
[15366] 9719: AJ130713
[15367] Homo sapiens mRNA for QA79 membrane protein, splice product airm-1
[15368] gi|5541875|emb|AJ130713.1|HSA130713[5541875]
[15369] 9720: AJ130712
[15370] Homo sapiens mRNA for QA79 membrane protein, splice product airm-3
[15371] gi|5541873|emb|AJ130712.1|HSA130712[5541873]
[15372] 9721: AJ130711
[15373] Homo sapiens mRNA for QA79 membrane protein, splice product airm-2
[15374] gi|5541871|emb|AJ130711.1|HSA130711[5541871]
[15375] 9722: AJ130710
[15376] Homo sapiens mRNA for QA79 membrane protein, allelic variant airm-1b
[15377] gi|5541869|emb|AJ130710.1|HSA130710[5541869]
[15378] 9723: AJ007395
[15379] Homo sapiens mRNA for QA79 membrane protein
[15380] gi|5295849|emb|AJ007395.1|HSA7395[5295849]
[15381] 9724: X95097
[15382] Homo sapiens mRNA for VIP receptor 2
[15383] gi|4837717|emb|X95097.2|HSVIP2R[4837717]
[15384] 9725: Y18423
[15385] Homo sapiens VIP2R gene, exons 1-2 (and joined CDS)
[15386] gi|4753150|emb|Y18423.1|HA18423[4753150]
[15387] 9726: Y18431
[15388] Homo sapiens VIP2R gene, exon 13
[15389] gi|4741409|emb|Y18431.1|HA18431[4741409]
[15390] 9727: Y18430
[15391] Homo sapiens VIP2R gene, exons 9-12
[15392] gi|4741408|emb|Y18430.1|HA18430[4741408]
[15393] 9728: Y18429
[15394] Homo sapiens VIP2R gene, exon 8
[15395] gi|4741407|emb|Y18429.1|HA18429[4741407]
[15396] 9729: Y18428
[15397] Homo sapiens VIP2R gene, exon 7
[15398] gi|4741406|emb|Y18428.1|HA18428[4741406]
[15399] 9730: Y18427
[15400] Homo sapiens VIP2R gene, exon 6
[15401] gi|4741405|emb|Y18427.1|HA18427[4741405]
[15402] 9731: Y18426
[15403] Homo sapiens VIPR2 gene exon 5
[15404] gi|4741404|emb|Y18426.1|HA18426[4741404]
[15405] 9732: Y18425
[15406] Homo sapiens VIPR2 gene exon 4
[15407] gi|4741403|emb|Y18425.1|HA18425[4741403]
[15408] 9733: Y18424
[15409] Homo sapiens VIPR2 gene exon 3
[15410] gi|4741402|emb|Y18424.1|HA18424[4741402]
[15411] 9734: X57250
[15412] H. sapiens C5aR mRNA for C5 anaphylatoxin receptor
[15413] gi|29569|emb|X57250.1|HSC5AR[29569]
[15414] 9735: AF200348
[15415] Homo sapiens melanoma-associated antigen MG50 mRNA, partial cds
[15416] gi|6273398|gb|AF200348.1|AF200348[6273398]
[15417] 9736: AH008357
[15418] Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 1
[15419] gi|6224699|gb|AH008357.1|SEG_HSCXADR[6224699]
[15420] 9737: AF169366
[15421] Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 7 and complete cds
[15422] gi|6224698|gb|AF169366.1|HSCXADR7[6224698]
[15423] 9738: AF169365
[15424] Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 6
[15425] gi|6224697|gb|AF169365.1|HSCXADR6[6224697]
[15426] 9739: AF169364
[15427] Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 5
[15428] gi|6224696|gb|AF169364.1|HSCXADR5[6224696]
[15429] 9740: AF169363
[15430] Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 4
[15431] gi|6224695|gb|AF169363.1|HSCXADR4[6224695]
[15432] 9741: AF169362
[15433] Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 3
[15434] gi|6224694|gb|AF169362.1|HSCXADR3[6224694]
[15435] 9742: AF169361
[15436] Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 2
[15437] gi|6224693|gb|AF169361.1|HSCXADR2[6224693]
[15438] 9743: AF169360
[15439] Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 1
[15440] gi|6224692|gb|AF169360.1|HSCXADR1[6224692]
[15441] 9744: AF181862
[15442] Homo sapiens G protein-coupled receptor mRNA, complete cds
[15443] gi|6175912|gb|AF181862.1|AF181862[6175912]
[15444] 9745: AF178632
[15445] Homo sapiens FEM-1-like death receptor binding protein mRNA, complete cds
[15446] gi|6175868|gb|AF178632.1|AF178632[6175868]
[15447] 9755: X80763
[15448] Homo sapiens gene for 5-hydroxytrptamine 2C receptor, exons 1 to 4
[15449] gi|602872|emb|X80763.1|HS5HT2C[602872]
[15450] 9756: X68149
[15451] Homo sapiens BLR1 gene for Burkitt's lymphoma receptor 1
[15452] gi|29459|emb|X68149.1|HSBLR1A[29459]
[15453] 9757: AF187320
[15454] Homo sapiens transferrin receptor (TFRC) gene, complete cds
[15455] gi|6164847|gb|AF187320.1|AF187320[6164847]
[15456] 9758: AF154673
[15457] Homo sapiens olfactory receptor HPFH1OR (HPFH1OR) gene, complete cds
[15458] gi|5764388|gb|AF154673.1|AF154673[5764388]
[15459] 9760: AF169255
[15460] Homo sapiens 5-hydroxytryptamine 3 receptor B subunit (5-HTR3B) mRNA, complete
[15461] cds
[15462] gi|6103620|gb|AF169255.1|AF169255[6103620]
[15463] 9762: AJ133107
[15464] Homo sapiens CD163 gene, exon 17
[15465] gi|5102659|emb|AJ133107.1|HSA133107[5102659]
[15466] 9763: Y18403
[15467] Homo sapiens CD163 gene, exon 16
[15468] gi|5102656|emb|Y18403.1|HSA118403[5102656]
[15469] 9764: Y18402
[15470] Homo sapiens CD163 gene, exon 15
[15471] gi|5102655|emb|Y18402.1|HSA118402[5102655]
[15472] 9765: Y18401
[15473] Homo sapiens CD163 gene, exon 14
[15474] gi|5102654|emb|Y18401.1|HSA118401[5102654]
[15475] 9766: Y18400
[15476] Homo sapiens CD163 gene, exon 13
[15477] gi|5102653|emb|Y18400.1|HSA118400[5102653]
[15478] 9767: Y18399
[15479] Homo sapiens CD163 gene, exon 12
[15480] gi|5102652|emb|Y18399.1|HSA118399[5102652]
[15481] 9768: Y18398
[15482] Homo sapiens CD163 gene, exon 11
[15483] gi|5102651|emb|Y18398.1|HSA118398[5102651]
[15484] 9769: Y18397
[15485] Homo sapiens CD163 gene, exon 10
[15486] gi|5102650|emb|Y18397.1|HSA118397[5102650]
[15487] 9770: Y18396
[15488] Homo sapiens CD163 gene, exon 9
[15489] gi|5102649|emb|Y18396.1|HSA118396[5102649]
[15490] 9771: Y18395
[15491] Homo sapiens CD163 gene, exon 8
[15492] gi|5102648|emb|Y18395.1|HSA118395[5102648]
[15493] 9772: Y18394
[15494] Homo sapiens CD163 gene, exon 7
[15495] gi|5102647|emb|Y18394.1|HSA118394[5102647]
[15496] 9773: Y18393
[15497] Homo sapiens CD163 gene, exon 6
[15498] gi|5102646|emb|Y18393.1|HSA118393[5102646]
[15499] 9774: Y18392
[15500] Homo sapiens CD163 gene, exon 5
[15501] gi|5102645|emb|Y18392.1|HSA118392[5102645]
[15502] 9775: Y18391
[15503] Homo sapiens CD163 gene, exon 4
[15504] gi|5102644|emb|Y18391.1|HSA118391[5102644]
[15505] 9776: Y18390
[15506] Homo sapiens CD163 gene, exon 3
[15507] gi|5102643|emb|Y18390.1|HSA118390[5102643]
[15508] 9777: Y18389
[15509] Homo sapiens CD163 gene, exon 2
[15510] gi|5102642|emb|Y18389.1|HSA118389[5102642]
[15511] 9791: AF095725
[15512] Homo sapiens PAC LLNLP704E02527Q3 olfactory receptor 17-1 (OR17-1), olfactory receptor 17-2 (OR17-2), olfactory receptor 17-201 (OR17-201), and olfactory receptor 17-93 (OR17-93) genes, complete cds
[15513] gi|6090622|gb|AF095725.1|AF095725[6090622]
[15514] 9792: AH007997
[15515] Homo sapiens prostaglandin E2 receptor EP2 subtype (PTGER2) gene, complete cds
[15516] gi|5524234|gb|AH007997.1|SEG_HSPTGER2G[5524234]
[15517] 9793: AF134202
[15518] Homo sapiens prostaglandin E2 receptor EP2 subtype (PTGER2) gene, alternatively
[15519] spliced exons and complete cds
[15520] gi|5524233|gb|AF134202.1|HSPTGER2G2[5524233]
[15521] 9794: AF134201
[15522] Homo sapiens prostaglandin E2 receptor EP2 subtype (PTGER2) gene, exon 1
[15523] gi|5524232|gb|AF134201.1|HSPTGER2G1[5524232]
[15524] 9797: AF139768
[15525] Homo sapiens type II transmembrane protein MDL-1 (MDL1) mRNA, complete cds
[15526] gi|6049175|gb|AF139768.1|AF139768[6049175]
[15527] 9799: X75318
[15528] H. sapiens ITIH1 gene (exon 22) and ITIH3 gene (exon 1 and joining features)
[15529] gi|575256|emb|X75318.1|HSITIH[575256]
[15530] 9800: AJ245822
[15531] Homo sapiens mRNA for type I transmembrane receptor (psk-3 gene)
[15532] gi|6018463|emb|AJ245822.1|HSA245822[6018463]
[15533] 9801: AJ245820
[15534] Homo sapiens mRNA for type I transmembrane receptor (psk-1 gene)
[15535] gi|6018459|emb|AJ245820.1|HSA245820[6018459]
[15536] 9802: L46722
[15537] Homo sapiens BTG1 binding factor 1 (CAF1) mRNA, complete cds
[15538] gi|6016011|gb|L46722.1|L46722[6016011]
[15539] 9803: X87831
[15540] Homo sapiens mRNA for partial OCT/plexin-A2 protein
[15541] gi|6010214|emb|X87831.2|HSOCTPROT[6010214]
[15542] 9804: AJ000994
[15543] Homo sapiens DNA for p58 NK receptor gene
[15544] gi|2764562|emb|AJ000994.1|HSP58NK[2764562]
[15545] 9805: X84761
[15546] H. sapiens LHCGR gene, exon 9
[15547] gi|1225992|emb|X84761.1|HSLHCGRX9[1225992]
[15548] 9806: X84760
[15549] H. sapiens LHCGR gene, exon 8
[15550] gi|1225991|emb|X84760.1|HSLHCGRX8[1225991]
[15551] 9807: X84759
[15552] H. sapiens LHCGR gene, exon 7
[15553] gi|1225990|emb|X84759.1|HSLHCGRX7[1225990]
[15554] 9808: X84758
[15555] H. sapiens LHCGR gene, exon 6
[15556] gi|1225989|emb|X84758.1|HSLHCGRX6[1225989]
[15557] 9809: X84757
[15558] H. sapiens LHCGR gene, exon 5
[15559] gi|1225988|emb|X84757.1|HSLHCGRX5[1225988]
[15560] 9810: X84756
[15561] H. sapiens LHCGR gene, exon 4
[15562] gi|1225987|emb|X84756.1|HSLHCGRX4[1225987]
[15563] 9811: X84754
[15564] H. sapiens LHCGR gene, exon 2
[15565] gi|1225985|emb|X84754.1|HSLHCGRX2[1225985]
[15566] 9812: X84753
[15567] H. sapiens LHCGR gene, exon 1
[15568] gi|1225983|emb|X84753.1|HSLHCGRX1[1225983]
[15569] 9813: X84763
[15570] H. sapiens LHCGR gene, exon 11
[15571] gi|1225982|emb|X84763.1|HSLHCGR111[1225982]
[15572] 9814: X84762
[15573] H. sapiens LHCGR gene, exon 10
[15574] gi|1225981|emb|X84762.1|HSLHCGR10[1225981]
[15575] 9815: AF140631
[15576] Homo sapiens G-protein coupled receptor 14 (GPR14) gene, complete cds
[15577] gi|5902615|gb|AF140631.1|AF140631[5902615]
[15578] 9816: AF140630
[15579] Homo sapiens urotensin-II mRNA, complete cds
[15580] gi|5902613|gb|AF140630.1|AF140630[5902613]
[15581] 9817: AF040752
[15582] Homo sapiens G protein-coupled receptor kinase 6, splice variant C (GRK6) mRNA,
[15583] complete cds
[15584] gi|3005017|gb|AF040752.1|AF040752[3005017]
[15585] 9818: AF040751
[15586] Homo sapiens G protein-coupled receptor kinase 6, splice variant B (GRK6) mRNA,
[15587] complete cds
[15588] gi|3005015|gb|AF040751.1|AF040751[3005015]
[15589] 9819: AF040753
[15590] Homo sapiens G protein-coupled receptor kinase 6 (GRK6) gene, partial cds
[15591] gi|3004990|gb|AF040753.1|AF040753[3004990]
[15592] 9820: X87832
[15593] Homo sapiens mRNA for partial NOV/plexin-A1 protein
[15594] gi|6010216|emb|X87832.2|HSNOVPROT[6010216]
[15595] 9821: X87904
[15596] Homo sapiens mRNA for semaphorin receptor (plexin-B1/SEP gene)
[15597] gi|6010210|emb|X87904.2|HSRNASEP[6010210]
[15598] 9822: AJ011415
[15599] Homo sapiens mRNA for plexin-B1 plasma membrane receptor, splice variant R (plexin-B1/SEP gene)
[15600] gi|5918166|emb|AJ011415.1|HSA011415[5918166]
[15601] 9823: AJ011414
[15602] Homo sapiens mRNA for plexin-B1 plasma membrane receptor, truncated splice variant (plexin-B1/SEP gene)
[15603] gi|5918164|emb|AJ011414.1|HSA011414[5918164]
[15604] 9824: X07019
[15605] Homo sapiens partial TRDC gene for T-cell receptor delta chain, exon 1
[15606] gi|29766|emb|X07019.1|HSCD1G[29766]
[15607] 9825: X54559
[15608] Homo sapiens mRNA for met proto-oncogene
[15609] gi|34557|emb|X54559.1|HSMETPRO[34557]
[15610] 9826: AF186380
[15611] Homo sapiens calcium-mobilizing lysophosphatidic acid receptor LP-A3/Edg-7 mRNA,
[15612] complete cds
[15613] gi|6003655|gb|AF186380.1|AF186380[6003655]
[15614] 9827: AF147204
[15615] Homo sapiens chemokine receptor CXCR4-Lo (CXCR4) mRNA, alternatively spliced, complete cds
[15616] gi|6002763|gb|AF147204.1|AF147204[6002763]
[15617] 9828: AF029213
[15618] Homo sapiens IL-1 receptor accessory protein mRNA, complete cds
[15619] gi|2599126|gb|AF029213.1|AF029213[2599126]
[15620] 9829: Z24462
[15621] H. sapiens MTCP-1 gene
[15622] gi|406858|emb|Z24462.1|HSMTCP1B[406858]
[15623] 9830: Z24455
[15624] H. sapiens MTCP-1 gene
[15625] gi|406857|emb|Z24455.1|HSMTCP1A[406857]
[15626] 9832: AF124598
[15627] Homo sapiens coxsackie and adenovirus receptor protein (HCAR2) mRNA, partial cds
[15628] gi|4884701|gb|AF124598.1|AF124598[4884701]
[15629] 9833: AF124145
[15630] Homo sapiens autocrine motility factor receptor (AMFR) mRNA, complete cds
[15631] gi|5931954|gb|AF124145.1|AF124145[5931954]
[15632] 9835: AF118637
[15633] Homo sapiens feline leukemia virus subgroup C receptor FLVCR(C10) mRNA, complete cds
[15634] gi|5565871|gb|AF118637.1|AF118637[5565871]
[15635] 9836: AF127138
[15636] Homo sapiens lysophosphatidic acid G protein-coupled receptor (EDG7) mRNA, complete cds
[15637] gi|5922724|gb|AF127138.1|AF127138[5922724]
[15638] 9837: AF104939
[15639] Homo sapiens lectomedin-1 gamma (LEC1) mRNA, complete cds
[15640] gi|5880493|gb|AF104939.1|AF104939[5880493]
[15641] 9838: AF104266
[15642] Homo sapiens lectomedin-1 alpha (LEC1) mRNA, complete cds
[15643] gi|5880489|gb|AF104266.1|AF104266[5880489]
[15644] 9839: X51646
[15645] Homo sapiens DRD2 gene for dopamine receptor D2
[15646] gi|30868|emb|X51646.1|HSDOPD2GE[30868]
[15647] 9840: X51645
[15648] Homo sapiens mRNA for dopamine receptor D2 (DRD2 gene)
[15649] gi|30867|emb|X51645.1|HSDOPD2[30867]
[15650] 9841: AB010447
[15651] Homo sapiens mRNA for CC chemokine eotaxin3, complete cds
[15652] gi|5921130|dbj|AB010447.1|AB010447[5921130]
[15653] 9844: AF137378
[15654] Homo sapiens integrin alpha 11 subunit precursor (ITGA11) mRNA, complete cds
[15655] gi|5915661|gb|AF137378.2|AF137378[5915661]
[15656] 9845: AJ243212
[15657] Homo sapiens mRNA for DMBT1 protein 8 kb transcript variant 2 (DMBT1/8 kb.2)
[15658] gi|5912463|emb|AJ243212.1|HSA243212[5912463]
[15659] 9846: AJ243874
[15660] Homo sapiens mRNA for oligophrenin-4 (OPHN4 gene)
[15661] gi|5911829|emb|AJ243874.1|HSA243874[5911829]
[15662] 9847: AF091352
[15663] Homo sapiens vascular permeability factor 148 mRNA, complete cds
[15664] gi|5901560|gb|AF091352.1|AF091352[5901560]
[15665] 9848: AF159456
[15666] Homo sapiens gp-340 variant protein (DMBT1) mRNA, complete cds
[15667] gi|5733597|gb|AF159456.1|AF159456[5733597]
[15668] 9948: AB023486
[15669] Homo sapiens gene for histamine H2 receptor, promoter region and complete cds
[15670] gi|5881575|dbj|AB023486.1|AB023486[5881575]
[15671] 9949: AF104938
[15672] Homo sapiens lectomedin-1 beta (LEC1) mRNA, complete cds
[15673] gi|588049|gb|AF104938.1|AF104938[5880491]
[15674] 9950: U81379
[15675] Homo sapiens interleukin-13 receptor mRNA, complete cds
[15676] gi|5870850|gb|U81379.3|HSU81379[5870850]
[15677] 9951: AH008056
[15678] Homo sapiens galanin receptor (GALR3) gene, complete cds
[15679] gi|5870844|gb|AH008056.2|SEG_HSGALR3S[5870844]
[15680] 9952: AF129514
[15681] Homo sapiens galanin receptor (GALR3) gene, exon 2 and complete cds
[15682] gi|5870843|gb|AF129514.2|HSGALR3S2[5870843]
[15683] 9953: AF129513
[15684] Homo sapiens galanin receptor (GALR3) gene, exon 1
[15685] gi|5870842|gb|AF129513.2|HSGALR3S1[5870842]
[15686] 9954: AF101472
[15687] Homo sapiens G protein-coupled receptor 75 (GPR75) gene, complete cds
[15688] gi|4558866|gb|AF101472.1|AF101472[4558866]
[15689] 9955: AF072693
[15690] Homo sapiens G protein-coupled receptor 75 (GPR75) mRNA, complete cds
[15691] gi|4406084|gb|AF072693.1|AF072693[4406084]
[15692] 9957: AJ246000
[15693] Homo sapiens mRNA for leucocyte adhesion receptor, L-selectin
[15694] gi|5852071|emb|AJ246000.1|HSA246000[5852071]
[15695] 9959: AJ224864
[15696] Homo sapiens mRNA for IRC1 protein
[15697] gi|5834585|emb|AJ224864.1|HSA224864[5834585]
[15698] 9960: AJ132948
[15699] Homo sapiens mRNA for rfg7 protein, partial
[15700] gi|5834581|emb|AJ132948.1|HSA132948[5834581]
[15701] 9961: AB027464
[15702] Homo sapiens FZD10 mRNA for Frizzled-10, complete cds
[15703] gi|5834487|dbj|AB027464.1|AB027464[5834487]
[15704] 9963: AJ133532
[15705] Homo sapiens mRNA for dendritic cell immunoreceptor
[15706] gi|5823973|emb|AJ133532.1|HSA133532[5823973]
[15707] 9964: AJ223153
[15708] Homo sapiens mRNA for activating NK-A1 receptor
[15709] gi|5823969|emb|AJ223153.1|HSAJ3153[5823969]
[15710] 9965: AB025257
[15711] Homo sapiens FCER1B gene for high affinity IgE receptor beta chain, promoter region, partial sequence
[15712] gi|5821396|dbj|AB025257.1|AB025257[5821396]
[15713] 9970: Y16434
[15714] Homo sapiens mRNA for T-cell receptor beta, clone PPN82
[15715] gi|2879843|emb|Y16434.1|HSTCRB82[2879843]
[15716] 9971: Y16433
[15717] Homo sapiens mRNA for T-cell receptor alpha, clone PPN82
[15718] gi|2879842|emb|Y16433.1|HSTCRA82[2879842]
[15719] 9972: AF144648
[15720] Homo sapiens GABA-A receptor theta (theta) mRNA, complete cds
[15721] gi|5764186|gb|AF144648.1|AF144648[5764186]
[15722] 9973: AF151104
[15723] Homo sapiens T-cell receptor gamma gene sequence
[15724] gi|5758137|gb|AF151104.1|AF151104[5758137]
[15725] 9974: AF039686
[15726] Homo sapiens G-protein coupled receptor GPR34 (GPR34) mRNA, complete cds
[15727] gi|5757633|gb|AF039686.1|AF039686[5757633]
[15728] 9975: AF000548
[15729] Homo sapiens P1 clone DMPC-HFF#1-1075-D9, repeat region
[15730] gi|223207|gb|AF000548.1|HSAF000548[2232071]
[15731] 9976: X83701
[15732] Homo sapiens IGF2R gene (subclone pE3UP)
[15733] gi|929648|emb|X83701.1|HSIGF2RX3[929648]
[15734] 9977: X83700
[15735] Home sapiens IGF2R gene (subclone pEX2)
[15736] gi|929646|emb|X83700.1|HSIGF2RX2[929646]
[15737] 9978: X83702
[15738] Homo sapiens IGF2R gene (subclone pEX3)
[15739] gi|929644|emb|X83702.1|HSIGF2R1 3[929644]
[15740] 9979: G16210
[15741] 967A10R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 967A10, sequence tagged site
[15742] gi|1592382|gb|G16210.1|G16210[1592382]
[15743] 9980: AH008077
[15744] Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, complete cds
[15745] gi|5737745|gb|AH008077.1|SEG_HSEDAR[5737745]
[15746] 9981: AF130996
[15747] Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 12 and complete
[15748] cds
[15749] gi|5737744|gb|AF130996.1|HSEDAR8[5737744]
[15750] 9982: AF130995
[15751] Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 11
[15752] gi|5737743|gb|AF130995.1|HSEDAR7[5737743]
[15753] 9983: AF130994
[15754] Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 10
[15755] gi|5737742|gb|AF130994.1|HSEDAR6[5737742]
[15756] 9984: AF130993
[15757] Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exons 7, 8, and 9
[15758] gi|573774|gb|AF130993.1|HSEDAR5[5737741]
[15759] 9985: AF130992
[15760] Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 6
[15761] gi|5737740|gb|AF130992.1|HSEDAR4[5737740]
[15762] 9986: AF130991
[15763] Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 5
[15764] gi|5737739|gb|AF130991.1|HSEDAR3[5737739]
[15765] 9987: AF130990
[15766] Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exons 2, 3, and 4
[15767] gi|5737738|gb|AF130990.1|HSEDAR2[5737738]
[15768] 9988: AF130989
[15769] Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 1
[15770] gi|5737737|gb|AF130989.1|HSEDAR1[5737737]
[15771] 9989: AF130988
[15772] Homo sapiens ectodysplasin-A receptor protein (EDAR) mRNA, complete cds
[15773] gi|5737735|gb|AF130988.1|AF130988[5737735]
[15774] 9990: AF033111
[15775] Homo sapiens Siva-2 mRNA, complete cds
[15776] gi|5737690|gb|AF033111.1|AF033111[5737690]
[15777] 9992: AJ238044
[15778] Homo sapiens mRNA for bradykinin B1 receptor (BLBKR gene)
[15779] gi|5139485|emb|AJ238044.1|HSA238044[5139485]
[15780] 9993: X95425
[15781] H. sapiens mRNA for EHK-1 receptor tyrosine kinase
[15782] gi|1177465|emb|X95425.1|HSEHK1[1177465]
[15783] 9995: AF135562
[15784] Homo sapiens p58 killer cell inhibitory receptor KIR-K78 (KIR-K78) mRNA, partial
[15785] cds
[15786] gi|5730925|gb|AF135562.1|AF135562[5730925]
[15787] 9996: AF135561
[15788] Homo sapiens p58 killer cell inhibitory receptor KIR-K65 (KIR-K65) mRNA, partial
[15789] cds
[15790] gi|5730923|gb|AF135561.1(AF135561[5730923]
[15791] 9997: AF135560
[15792] Homo sapiens p58 killer cell inhibitory receptor KIR-K64 (KIR-K64) mRNA, partial
[15793] cds
[15794] gi|5730921|gb|AF135560.1|AF135560[5730921]
[15795] 9998: AF135559
[15796] Homo sapiens p58 killer cell inhibitory receptor KIR-K61 (KIR-K61) mRNA, partial
[15797] cds
[15798] gi|5730919|gb|AF135559.1|AF135559[5730919]
[15799] 9999: AF135558
[15800] Homo sapiens p58 killer cell inhibitory receptor KIR-K39 (KIR-K39) mRNA, partial
[15801] cds
[15802] gi|5730917|gb|AF135558.1|AF135558[5730917]
[15803] 10000: AF135557
[15804] Homo sapiens p58 killer cell inhibitory receptor KIR-K36 (KIR-K36) mRNA, partial
[15805] cds
[15806] gi|5730915|gb|AF135557.1|AF135557[5730915]
[15807] 10001: AF135556
[15808] Homo sapiens p58 killer cell inhibitory receptor KIR-K15 (KIR-K15) mRNA, partial
[15809] cds
[15810] gi|5730913|gb|AF135556.1|AF135556[5730913]
[15811] 10002: AF135555
[15812] Homo sapiens p58 killer cell inhibitory receptor KIR-K9 (KIR-K9) mRNA, partial
[15813] cds
[15814] gi|5730911|gb|AF135555.1|AF135555[5730911]
[15815] 10003: AF135554
[15816] Homo sapiens p58 killer cell inhibitory receptor KIR-K3 (KIR-K3) mRNA, partial
[15817] cds
[15818] gi|5730909|gb|AF135554.1|AF135554[5730909]
[15819] 10004: AF135567
[15820] Homo sapiens p58 killer cell inhibitory receptor KIR-K7c mRNA, alternatively spliced, partial cds
[15821] gi|5730907|gb|AF135567.1|AF135567[5730907]
[15822] 10005: AF135566
[15823] Homo sapiens p58 killer cell inhibitory receptor KIR-K7b mRNA, alternatively spliced, partial cds
[15824] gi|5730905|gb|AF135566.1|AF135566[5730905]
[15825] 10006: AF135565
[15826] Homo sapiens p58 killer cell inhibitory receptor KIR-K7a mRNA, alternatively spliced, partial cds
[15827] gi|5730903|gb|AF135565.1|AF135565[5730903]
[15828] 10007: AF135564
[15829] Homo sapiens p50 killer cell activating receptor KAR-K1d mRNA, alternatively spliced, partial cds
[15830] gi|5730901|gb|AF135564.1|AF135564[5730901]
[15831] 10008: AF135563
[15832] Homo sapiens p50 killer cell activating receptor KAR-K1a mRNA, alternatively spliced, partial cds
[15833] gi|5730899|gb|AF135563.1|AF135563[5730899]
[15834] 10009: AF172932
[15835] Homo sapiens MIS type II receptor (MISRII) mRNA, complete cds
[15836] gi|5726642|gb|AF172932.1|AF172932[5726642]
[15837] 10010: AF162790
[15838] Homo sapiens Fc gamma receptor III-A gene, partial cds
[15839] gi|5726469|gb|AF162790.1|AF162790[5726469]
[15840] 10012: AF161921
[15841] Homo sapiens clone G7 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15842] gi|5712813|gb|AF161921.1|[5712813]
[15843] 10013: AF161920
[15844] Homo sapiens clone G6 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15845] gi|5712812|gb|AF161920.1|[5712812]
[15846] 10014: AF161919
[15847] Homo sapiens clone F4 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15848] gi|5712811|gb|AF161919.1|[5712811]
[15849] 10015: AF161918
[15850] Homo sapiens clone F3 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15851] gi|5712810|gb|AF161918.1|[5712810]
[15852] 10016: AF161917
[15853] Homo sapiens clone F1.1 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15854] gi|5712809|gb|AF161917.1|[5712809]
[15855] 10017: AF161916
[15856] Homo sapiens clone H-JM-2 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15857] gi|5712808|gb|AF161916.1|[5712808]
[15858] 10018: AF161915
[15859] Homo sapiens clone JM-1 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15860] gi|5712807|gb|AF161915.1|[5712807]
[15861] 10019: AF161914
[15862] Homo sapiens clone 9/8.2 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15863] gi|5712806|gb|AF161914.1|[5712806]
[15864] 10020: AF161913
[15865] Homo sapiens clone 6-53 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15866] gi|5712805|gb|AF161913.1|[5712805]
[15867] 10021: AF161912
[15868] Homo sapiens clone 5-53 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15869] gi|5712804|gb|AF161912.1|[5712804]
[15870] 10022: AF161911
[15871] Homo sapiens clone 4-55 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15872] gi|5712803|gb|AF161911.1|[5712803]
[15873] 10023: AF161910
[15874] Homo sapiens clone 4-53 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15875] gi|5712802|gb|AF161910.1|[5712802]
[15876] 10024: AF161909
[15877] Homo sapiens clone 3-55 C-C chemokine receptor 5 (CCR5) mRNA, partial cds
[15878] gi|5712801|gb|AF161909.1|[5712801]
[15879] 10025: E17202
[15880] Human cDNA for JEG18 complete cds
[15881] gi|5711885|dbj|E17202.1|E17202[5711885]
[15882] 10026: E17201
[15883] Human mRNA for JEG18 complete cds
[15884] gi|5711884|dbj|E17201.1|E17201[5711884]
[15885] 10027: E16188
[15886] cDNA encoding G protein-coupled receptor
[15887] gi|5710871|dbj|E16188.1|E16188[5710871]
[15888] 10028: E16187
[15889] Partial sequence of cDNA encoding G protein-coupled receptor
[15890] gi|5710870|dbj|E16187.1|E16187[5710870]
[15891] 10029: E16186
[15892] Partial sequence of cDNA encoding G protein-coupled receptor
[15893] gi|5710869|dbj|E16186.1|E16186[5710869]
[15894] 10030: E16000
[15895] EST sequence containing human G protein-coupling receptor gene
[15896] gi|5710683|dbj|E6000.1|E16000[5710683]
[15897] 10031: E15999
[15898] EST sequence containing human G protein-coupling receptor gene
[15899] gi|5710682|dbj|E15999.1|E15999[5710682]
[15900] 10032: E15998
[15901] cDNA encoding G protein-coupling receptor protein
[15902] gi|5710681|dbj|E15998.1|E15998[5710681]
[15903] 10033: E15997
[15904] cDNA encoding human G protein-coupling receptor protein
[15905] gi|5710680|dbj|E15997.1|E15997[5710680]
[15906] 10034: E15919
[15907] cDNA encoding prostaglandin EP3-6 receptor
[15908] gi|5710602|dbj|E15919.1|E15919[5710602]
[15909] 10035: E15918
[15910] cDNA encoding prostaglandin EP3-5 receptor
[15911] gi|5710601|dbj|E15918.1|E15918[5710601]
[15912] 10037: E15242
[15913] Human mRNA for endothelin B receptor, complete cds
[15914] gi|5709925|dbj|E15242.1|E15242[5709925]
[15915] 10038: E14946
[15916] Human mRNA for adrenaline beta 3 receptor
[15917] gi|5709629|dbj|E14946.1|E14946[5709629]
[15918] 10039: E14587
[15919] Human mRNA isoform fragment for Vitamin D receptor
[15920] gi|5709270|dbj|E14587.1|E14587[5709270]
[15921] 10040: E14586
[15922] Human mRNA isoform fragment for Vitamin D receptor
[15923] gi|5709269|dbj|E14586.1|E14586[5709269]
[15924] 10041: E14585
[15925] Human mRNA isoform for Vitamin D receptor
[15926] gi|5709268|dbj|E14585.1|E14585[5709268]
[15927] 10042: E14219
[15928] Partial sequence of human cDNA encoding a G protein-coupled receptor, 63A2full
[15929] gi|5708902|dbj|E14219.1|E14219[5708902]
[15930] 10043: E14218
[15931] Partial sequence of human cDNA encoding a G protein-coupled receptor, 63A2full
[15932] gi|5708901|dbj|E14218.1|E14218[5708901]
[15933] 10044: E14217
[15934] Human mRNA for a G protein-coupled receptor, 63A2full, complete cds
[15935] gi|5708900|dbj|E14217.1|E14217[5708900]
[15936] 10046: X83699
[15937] Homo sapiens IGF2R gene (subclone pEX1-P)
[15938] gi|1006660|emb|X83699.1|HSIGF2RX1[1006660]
[15939] 10048: AF007790
[15940] Homo sapiens ICERE-1 mRNA, complete cds
[15941] gi|5670325|gb|AF007790.2|AF007790[5670325]
[15942] 10054: AF036718
[15943] Homo sapiens FGFR signalling adaptor SNT-2 mRNA, complete cds
[15944] gi|2708629|gb|AF036718.1|AF036718[2708629]
[15945] 10056: AF099033
[15946] Homo sapiens gamma-aminobutyric acid type B receptor 2 (GABABR2) mRNA, complete
[15947] cds
[15948] gi|5639666|gb|AF099033.1|AF099033[5639666]
[15949] 10057: AF009221
[15950] Homo sapiens leucocyte immunoglobulin-like receptor-1 mRNA, complete cds
[15951] gi|2267169|gb|AF009221.1|AF009221[2267169]
[15952] 10058: AF009220
[15953] Homo sapiens leucocyte immunoglobulin-like receptor-1 mRNA, complete cds
[15954] gi|2267167|gb|AF009220.1|AF009220[2267167]
[15955] 10059: AF067864
[15956] Homo sapiens transferrin receptor 2 alpha (TFR2) mRNA, complete cds
[15957] gi|5596369|gb|AF067864.1|AF067864[5596369]
[15958] 10061: AF040257
[15959] Homo sapiens TNF receptor homolog mRNA, partial cds
[15960] gi|3170220|gb|AF040257.1|AF040257[3170220]
[15961] 10062: AF026245
[15962] Homo sapiens yotiao mRNA, complete cds
[15963] gi|2623067|gb|AF026245.1|AF026245[2623067]
[15964] 10064: AF163302
[15965] Homo sapiens somatostatin receptor interacting protein splice variant a (SSTRIP)
[15966] mRNA, complete cds
[15967] gi|5533304|gb|AF163302.1|AF163302[5533304]
[15968] 10065: AF153500
[15969] Homo sapiens mu opioid receptor (MOR1) gene, partial cds
[15970] gi|5524612|gb|AF153500.1|AF153500[5524612]
[15971] 10066: AH007996
[15972] Homo sapiens NK receptor Ly-49L gene, complete cds
[15973] gi|5524171|gb|AH007996.1|SEG_HSLY49L[5524171]
[15974] 10067: AF126038
[15975] Homo sapiens NK receptor Ly-49L gene, pseudoexon 7
[15976] gi|5524170|gb|AF126038.1|HSLY49L3[5524170]
[15977] 10068: AF126037
[15978] Homo sapiens NK receptor Ly-49L gene, exon 5, pseudoexon 6, and complete cds
[15979] gi|5524169|gb|AF126037.1|HSLY49L2[5524169]
[15980] 10069: AF126036
[15981] Homo sapiens NK receptor Ly-49L gene, exons 1 through 4
[15982] gi|5524168|gb|AF126036.1|HSLY49L1[5524168]
[15983] 10070: AF081675
[15984] Homo sapiens ITIM-containing receptor MAFA-L mRNA, complete cds
[15985] gi|3421400|gb|AF081675.1|AF081675[3421400]
[15986] 10071: AF145782
[15987] Homo sapiens 2B4 type I transmembrane protein mRNA, complete cds
[15988] gi|5059179|gb|AF145782.1|AF145782[5059179]
[15989] 10072: AH007960
[15990] Homo sapiens receptor tyrosine kinase (EPHAL) gene, complete cds
[15991] gi|5453121|gb|AH007960.1|SEG_HSEPHAI[5453121]
[15992] 10073: AF101171
[15993] Homo sapiens receptor tyrosine kinase (EPHAL) gene, exon 18 and complete cds
[15994] gi|5453120|gb|AF101171.1|HSEPHA17[5453120]
[15995] 10074: AF101170
[15996] Homo sapiens receptor tyrosine kinase (EPHAL) gene, exon 17
[15997] gi|5453119|gb|AF101170.1|HSEPHA16[5453119]
[15998] 10075: AF101169
[15999] Homo sapiens receptor tyrosine kinase (EPHAL) gene, exons 12 through 16
[16000] gi|5453118|gb|AF101169.1|HSEPHA15[5453118]
[16001] 10076: AF101168
[16002] Homo sapiens receptor tyrosine kinase (EPHAL) gene, exons 4 through 11
[16003] gi|5453117|gb|AF101168.1|HSEPHA14[5453117]
[16004] 10077: AF101167
[16005] Homo sapiens receptor tyrosine kinase (EPHAL) gene, exon 3
[16006] gi|5453116|gb|AF101167.1|HSEPHA13[5453116]
[16007] 10078: AF101166
[16008] Homo sapiens receptor tyrosine kinase (EPHAL) gene, exon 2
[16009] gi|5453115|gb|AF101166.1|HSEPHA12[5453115]
[16010] 10079: AF101165
[16011] Homo sapiens receptor tyrosine kinase (EPHAL) gene, exon 1
[16012] gi|5453114|gb|AF101165.1|HSEPHA11[5453114]
[16013] 10080: AF107761
[16014] Homo sapiens NK cell receptor (2B4) mRNA, complete cds
[16015] gi|5442467|gb|AF107761.2|AF107761[5442467]
[16016] 10081: AF109127
[16017] Homo sapiens stromal cell-derived receptor-1 alpha mRNA, complete cds
[16018] gi|5442037|gb|AF109127.1|AF109127[5442037]
[16019] 10082: AF109126
[16020] Homo sapiens stromal cell-derived receptor-1 beta mRNA, complete cds
[16021] gi|5442035|gb|AF109126.1|AF109126[5442035]
[16022] 10084: Y17131
[16023] Homo sapiens FGFR2 gene, exon 7 and exon 8 (partial)
[16024] gi|3077606|emb|Y17131.1|HSY17131[3077606]
[16025] 10085: X57829
[16026] H. sapiens serotonin 5-HT1a receptor gene
[16027] gi|36428|emb|X57829.1|HSSERR51[36428]
[16028] 10086: AF100762
[16029] Homo sapiens thyroid receptor interactor trip15 mRNA, complete cds
[16030] gi|5410309|gb|AF100762.1|TRIP15[5410309]
[16031] 10087: AF109388
[16032] Homo sapiens P2X2B receptor mRNA, complete cds
[16033] gi|5381338|gb|AF109388.1|AF109388[5381338]
[16034] 10088: AF109387
[16035] Homo sapiens P2X2A receptor mRNA, complete cds
[16036] gi|5381336|gb|AF109387.1|AF109387[5381336]
[16037] 10089: AF118108
[16038] Homo sapiens lymphatic endothelium-specific hyaluronan receptor LYVE-1 mRNA, complete cds
[16039] gi|5359672|gb|AF118108.1|AF118108[5359672]
[16040] 10090: AF119711
[16041] Homo sapiens cysLT1 LTD4 receptor (CYSLT1) mRNA, complete cds
[16042] gi|5353886|gb|AF119711.1|AF119711[5353886]
[16043] 10091: X72861
[16044] H. sapiens gene for beta-3-adrenergic receptor
[16045] gi|298094|emb|X72861.1|HSB3A[298094]
[16046] 10092: AF103906
[16047] Homo sapiens vanilloid receptor-like protein (VRL) mRNA, complete cds
[16048] gi|5305597|gb|AF103906.1|AF103906[5305597]
[16049] 10093: AF072873
[16050] Homo sapiens frizzled 6 mRNA, complete cds
[16051] gi|5305408|gb|AF072873.1|AF072873[5305408]
[16052] 10095: AF153437
[16053] Homo sapiens haplotype val92met/A942G melanocortin 1 receptor (MC1R) gene, complete cds
[16054] gi|5257473|gb|AF153437.1|AF153437[5257473]
[16055] 10096: AF153436
[16056] Homo sapiens haplotype A942G melanocortin 1 receptor (MC1R) gene, complete cds
[16057] gi|5257472|gb|AF153436.1|AF153436[5257472]
[16058] 10097: AF153435
[16059] Homo sapiens haplotype arg67gln/arg163gln melanocortin 1 receptor (MC1R) gene,
[16060] complete cds
[16061] gi|525747|gb|AF153435.1|AF153435[5257471]
[16062] 10098: AF153434
[16063] Homo sapiens haplotype arg163gln melanocortin 1 receptor (MC1R) gene, complete
[16064] cds
[16065] gi|5257470|gb|AF153434.1|AF153434[5257470]
[16066] 10099: AF153433
[16067] Homo sapiens haplotype arg151cys melanocortin 1 receptor (MC1R) gene, complete
[16068] cds
[16069] gi|5257469|gb|AF153433.1|AF153433[5257469]
[16070] 10100: AF153432
[16071] Homo sapiens haplotype asp84glu melanocortin 1 receptor (MC1R) gene, complete cds
[16072] gi|5257468|gb|AF153432.1|AF153432[5257468]
[16073] 10101: AF153431
[16074] Homo sapiens melanocortin 1 receptor (MC1R) gene, complete cds
[16075] gi|5257467|gb|AF153431.1|AF153431[5257467]
[16076] 10103: AH007879
[16077] Homo sapiens macrophage receptor (MARCO) gene, complete cds
[16078] gi|5231091|gb|AH007879.1|SEG_HSMARCO[5231091]
[16079] 10104: AF128186
[16080] Homo sapiens macrophage receptor (MARCO) gene, exon 17 and complete cds
[16081] gi|5231090gb|AF128186.1|HSMARCO15[5231090]
[16082] 10105: AF128185
[16083] Homo sapiens macrophage receptor (MARCO) gene, exon 16
[16084] gi|5231089|gb|AF128185.1|HSMARCO14[5231089]
[16085] 10106: AP128184
[16086] Homo sapiens macrophage receptor (MARCO) gene, exon 15
[16087] gi|5231088|gb|AF128184.1|HSMARCO13[5231088]
[16088] 10107: AF128183
[16089] Homo sapiens macrophage receptor (MARCO) gene, exon 14
[16090] gi|5231087|gb|AF128183.1|HSMARCO12[5231087]
[16091] 10108: AF128182
[16092] Homo sapiens macrophage receptor (MARCO) gene, exon 13
[16093] gi|5231086|gb|AF128182.1|HSMARCO11[5231086]
[16094] 10109: AF128181
[16095] Homo sapiens macrophage receptor (MARCO) gene, exons 11 and 12
[16096] gi|5231085|gb|AF128181.1|HSMARCO10[5231085]
[16097] 10110: AF128180
[16098] Homo sapiens macrophage receptor (MARCO) gene, exons 9 and 10
[16099] gi|5231084|gb|AF128180.1|HSMARCO09[5231084]
[16100] 10111: AF128179
[16101] Homo sapiens macrophage receptor (MARCO) gene, exon 8
[16102] gi|5231083|gb|AF128179.1|HSMARCO08[5231083]
[16103] 10112: AF128178
[16104] Homo sapiens macrophage receptor (MARCO) gene, exon 7
[16105] gi|5231082|gb|AF128178.1|HSMARCO07[5231082]
[16106] 10113: AF128177
[16107] Homo sapiens macrophage receptor (MARCO) gene, exon 6
[16108] gi|5231081|gb|AF128177.1|HSMARCO06[5231081]
[16109] 10114: AF128176
[16110] Homo sapiens macrophage receptor (MARCO) gene, exon 5
[16111] gi|5231080|gb|AF128176.1|HSMARCO05[5231080]
[16112] 10115: AF128175
[16113] Homo sapiens macrophage receptor (MARCO) gene, exon 4
[16114] gi|5231079|gb|AF128175.1|HSMARCO04[5231079]
[16115] 10116: AF128174
[16116] Homo sapiens macrophage receptor (MARCO) gene, exon 3
[16117] gi|5231078|gb|AF128174.1|HSMARCO03[5231078]
[16118] 10117: AF128173
[16119] Homo sapiens macrophage receptor (MARCO) gene, exon 2
[16120] gi|5231077|gb|AF128173.1|HSMARCO02[5231077]
[16121] 10118: AF128172
[16122] Homo sapiens macrophage receptor (MARCO) gene, exon 1
[16123] gi|5231076|gb|AF128172.1|HSMARCO01[5231076]
[16124] 10140: D50855
[16125] Human mRNA for Ca-sensing receptor, complete cds
[16126] gi|904209|dbj|D50855.1|HUMCASR[904209]
[16127] 10141: D49783
[16128] Human gene for histamine H2 receptor, complete cds
[16129] gi|728495|dbj|D49783.1|HUMHH2R[728495]
[16130] 10142: D16826
[16131] Human gene for fourth somatostatin receptor subtype
[16132] gi|693907|dbj|D16826.1|HUMSSTR4[693907]
[16133] 10143: D29984
[16134] Human mRNA for monocyte chemoattractant protein 1 receptor (MCP-1 receptor), complete cds
[16135] gi|531246|dbj|D529984.1|HUMMCP1R[531246]
[16136] 10144: D14436
[16137] Human gene for histamine H1-receptor, complete cds
[16138] gi|506335|dbj|D514436.1|HUMHH1RE[506335]
[16139] 10145: D16827
[16140] Human gene for fifth somatostatin receptor subtype
[16141] gi|487683|dbj|D516827.1|HUMSSTR5[487683]
[16142] 10146: D14717
[16143] Human mRNA for large erk kinase
[16144] gi|285916|dbj|D514717.1|HUMERK[285916]
[16145] 10147: AF073515
[16146] Homo sapiens cytokine type 1 receptor CRLP-1 precursor, mRNA, complete cds
[16147] gi|5106394|gb|AF073515.1|AF073515[5106394]
[16148] 10148: AH007696
[16149] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, partial cds; fibroblast growth factor receptor 2 Ksam IV secreted isoform (FGFR2) gene, complete cds; fibroblast growth factor receptor (FGFR2) gene, alternative splice
[16150] products, partial cds; and fibroblast growth factor receptor 2 (FGFR2) gene, partial cds
[16151] gi|4808621|gb|AH007696.1|SEG_HSFGFR2A[4808621]
[16152] 10149: AF097354
[16153] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 20, alternative splice products and partial cds
[16154] gi|4808620|gb|AF097354.1|HSFGFR2A19[4808620]
[16155] 10150: AF097353
[16156] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 19, alternative splice products and partial cds
[16157] gi|4808619|gb|AF097353.1|HSFGFR2A18[4808619]
[16158] 10151: AF097352
[16159] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 18
[16160] gi|4808618|gb|AF097352.1|HSFGFR2A17[4808618]
[16161] 10152: AF097351
[16162] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 17
[16163] gi|4808617|gb|AF097351.1|HSFGFR2A16[4808617]
[16164] 10153: AF097350
[16165] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 16
[16166] gi|4808616|gb|AF097350.1|HSFGFR2A15[4808616]
[16167] 10154: AF097349
[16168] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 15
[16169] gi|4808615|gb|AF097349.1|HSFGFR2A14[4808615]
[16170] 10155: AF097348
[16171] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 14
[16172] gi|4808614|gb|AF097348.1|HSFGFR2A13[4808614]
[16173] 10156: AF097347
[16174] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 13
[16175] gi|4808613|gb|AF097347.1|HSFGFR2A12[4808613]
[16176] 10157: AF097346
[16177] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 12
[16178] gi|4808612|gb|AF097346.1|HSFGFR2A11[4808612]
[16179] 10158: AF097345
[16180] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exons 11 and 11′
[16181] gi|4808611|gb|AF097345.1|HSFGFR2A10[4808611]
[16182] 10159: AF097344
[16183] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 10
[16184] gi|4808610|gb|AF097344.1|HSFGFR2A09[4808610]
[16185] 10160: AF097343
[16186] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 9
[16187] gi|4808609|gb|AF097343.1|HSFGFR2A08[4808609]
[16188] 10161: AF097342
[16189] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 8
[16190] gi|4808608|gb|AF097342.1|HSFGFR2A07[4808608]
[16191] 10162: AF097341
[16192] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exons 6 and 7, alternative splice products and partial cds
[16193] gi|4808607|gb|AF097341.1|HSFGFR2A06[4808607]
[16194] 10163: AF097340
[16195] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 5, alternative splice products and partial cds
[16196] gi|4808606|gb|AF097340.1|HSFGFR2A05[4808606]
[16197] 10164: AF097339
[16198] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 4
[16199] gi|4808605|gb|AF097339.1|HSFGFR2A04[4808605]
[16200] 10165: AF097338
[16201] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 3
[16202] gi|4808604|gb|AF097338.1|HSFGFR2A03[4808604]
[16203] 10166: AF097337
[16204] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 2
[16205] gi|4808603|gb|AF097337.1|HSFGFR2A02[4808603]
[16206] 10167: AF097336
[16207] Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 1
[16208] gi|4808602|gb|AF097336.1|HSFGFR2A01[4808602]
[16209] 10168: U58146
[16210] Homo sapiens alternatively spliced interleukin-6 receptor beta chain mRNA, partial cds
[16211] gi|2253597|gb|U58146.1|HSU58146[2253597]
[16212] 10169: AF134395
[16213] Homo sapiens CARD-like apoptotic protein (CLAP) mRNA, complete cds
[16214] gi|5070371|gb|AF134395.1|AF134395[5070371]
[16215] 10170: AF015044
[16216] Homo sapiens EH-binding protein mRNA, partial cds
[16217] gi|4102712|gb|AF015044.1|AF015044[4102712]
[16218] 10171: AF015043
[16219] Homo sapiens EH-binding protein mRNA, partial cds
[16220] gi|4102710|gb|AF015043.1|AF015043[4102710]
[16221] 10172: AF145207
[16222] Homo sapiens CCR9 chemokine receptor (CCR9) mRNA, partial cds
[16223] gi|5052417|gb|AF145207.1|AF145207[5052417]
[16224] 10173: AB018549
[16225] Homo sapiens MD-2 mRNA, complete cds
[16226] gi|5051739|dbj|AB018549.1|AB018549[5051739]
[16227] 10174: AH007443
[16228] Homo sapiens chromosome 19 clone cosmid R31931 map 19q13.4
[16229] gi|4322573|gb|AH007443.1|SEG_HSCD89S[4322573]
[16230] 10175: AF091544
[16231] Homo sapiens myeloid FcalphaRI (CD89) gene, 3′ sequence
[16232] gi|4322572|gb|AF091544.1|HSCD89S2[4322572]
[16233] 10177: AF152962
[16234] Homo sapiens somatostatin receptor type 5 (SSTR5) gene, promoter region and partial cds
[16235] gi|5031446|gb|AF152962.1|AF152962[5031446]
[16236] 10178: AF140538
[16237] Homo sapiens histamine H3 receptor mRNA, complete cds
[16238] gi|5031290|gb|AF140538.1|AF140538[5031290]
[16239] 10179: AJ238896
[16240] Homo sapiens partial RAGE gene, exons 9 to 11
[16241] gi|4867820|emb|AJ238896.1|HSA238896[4867820]
[16242] 10180: AF039904
[16243] Homo sapiens cosmid D56B10, chromosome 21 5′ of IFNAR1
[16244] gi|2853622|gb|AF039904.1|AF039904[2853622]
[16245] 10181: AF039905
[16246] Homo sapiens cosmid Q95D4, chromosome 21 5′ of IFNAR2
[16247] gi|2766549|gb|AF039905.1|AF039905[2766549]
[16248] 10182: AF039907
[16249] Homo sapiens cosmid Q50G2, chromosome 21 3′ of IFNAR1
[16250] gi|2754858|gb|AF039907.1|AF039907[2754858]
[16251] 10183: AB020807
[16252] Homo sapiens mRNA for TLR6, complete cds
[16253] gi|5006247|dbj|AB020807.1|AB020807[5006247]
[16254] 10184: AF144308
[16255] Homo sapiens putative G protein-coupled receptor (DL1R) mRNA, complete cds
[16256] gi|4959876|gb|AF144308.1|AF144308[4959876]
[16257] 10185: AF107262
[16258] Homo sapiens central cannabinoid receptor (CB1K5) mRNA, complete cds
[16259] gi|4959366|gb|AF107262.1|AF107262[4959366]
[16260] 10263: AH007742
[16261] Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3)
[16262] gene, complete cds
[16263] gi|4927249|gb|AH007742.1|SEG_HSCHRNB[4927249]
[16264] 10264: AF140765
[16265] Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3)
[16266] gene, exon 6 and complete cds
[16267] gi|4927248|gb|AF140765.1|HSCHRNB6[4927248]
[16268] 10265: AF140764
[16269] Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3)
[16270] gene, exon 5
[16271] gi|4927247|gb|AF140764.1|HSCHRNB5[4927247]
[16272] 10266: AF140763
[16273] Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3)
[16274] gene, exon 4
[16275] gi|4927246|gb|AF140763.1|HSCHRNB4[4927246]
[16276] 10267: AF140762
[16277] Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3)
[16278] gene, exon 3
[16279] gi|4927245|gb|AF140762.1|HSCHRNB3[4927245]
[16280] 10268: AF140761
[16281] Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3)
[16282] gene, exon 2
[16283] gi|49272441gb|AF140761.1|HSCHRNB2[4927244]
[16284] 10269: AF140760
[16285] Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3)
[16286] gene, exon 1
[16287] gi|4927243|gb|AF140760.1|HSCHRNB1[4927243]
[16288] 10270: U19261
[16289] Homo sapiens Epstein-Barr virus-induced protein mRNA, complete cds
[16290] gi|675461|gb|U19261.1|HSU19261[675461]
[16291] 10272: AF105261
[16292] Homo sapiens natural killer cell receptor 2B4 mRNA, complete cds
[16293] gi|4894519|gb|AF105261.1|AF105261[4894519]
[16294] 10273: AH007727
[16295] Homo sapiens prolactin receptor gene, complete cds
[16296] gi|4886767|gb|AH007727.1|SEG_HSPLR[4886767]
[16297] 10274: AF091870
[16298] Homo sapiens prolactin receptor gene, alternatively spliced, exon 10 and complete cds
[16299] gi|4886766|gb|AF091870.1|HSPLR12[4886766]
[16300] 10275: AF091869
[16301] Homo sapiens prolactin receptor gene, exon 9
[16302] gi|4886765|gb|AF091869.1|HSPLR11[4886765]
[16303] 10276: AF091868
[16304] Homo sapiens prolactin receptor gene, exon 8
[16305] gi|4886764|gb|AF091868.1|HSPLR10[4886764]
[16306] 10277: AF091867
[16307] Homo sapiens prolactin receptor gene, exon 7
[16308] gi|4886763|gb|AF091867.1|HSPLR09[4886763]
[16309] 10278: AF091866
[16310] Homo sapiens prolactin receptor gene, exon 6
[16311] gi|4886762|gb|AF091866.1|HSPLR08[4886762]
[16312] 10279: AF091865
[16313] Homo sapiens prolactin receptor gene, exon 5
[16314] gi|4886761|gb|AF091865.1|HSPLR07[4886761]
[16315] 10280: AF091864
[16316] Homo sapiens prolactin receptor gene, exon 4
[16317] gi|4886760|gb|AF091864.1|HSPLR06[4886760]
[16318] 10281: AF091863
[16319] Homo sapiens prolactin receptor gene, exon 3
[16320] gi|4886759|gb|AF091863.1|HSPLR05[4886759]
[16321] 10282: AF091862
[16322] Homo sapiens prolactin receptor gene, exon 2
[16323] gi|4886758|gb|AF091862.1|HSPLR04[4886758]
[16324] 10283: AF091859
[16325] Homo sapiens prolactin receptor gene, promoter region and alternative exons 1
[16326] gi|4886757|gb|AF091859.1|HSPLR01[4886757]
[16327] 10284: AJ132337
[16328] Homo sapiens mRNA for chemokine receptor CCR9
[16329] gi|4886431|emb|AJ132337.1|HSA132337[4886431]
[16330] 10285: AF120152
[16331] Mus musculus cytokine receptor-like molecule 9 (Creme9) mRNA, complete cds
[16332] gi|4884628|gb|AF120152.1|AF120152[4884628]
[16333] 10286: AF120151
[16334] Homo sapiens cytokine receptor-like molecule 9 (CREME9) mRNA, complete cds
[16335] gi|4884626|gb|AF120151.1|AF120151[4884626]
[16336] 10287: D13814
[16337] Homo sapiens mRNA for angiotensin II type 1b receptor, complete cds
[16338] gi|471120|dbj|D13814.1|HUMAGRT1B[471120]
[16339] 10288: AJ236922
[16340] Homo sapiens mRNA for metabotropic glutamate receptor 8c
[16341] gi|4456479|emb|AJ236922.1|HSA236922[4456479]
[16342] 10289: AJ236921
[16343] Homo sapiens mRNA for metabotropic glutamate receptor 8b
[16344] gi|4456477|emb|AJ236921.1HSA236921[4456477]
[16345] 10478: AF106858
[16346] Homo sapiens G-protein-coupled receptor (GPR56) mRNA, complete cds
[16347] gi|4836764|gb|AF106858.1|AF106858[4836764]
[16348] 10479: AF095784
[16349] Homo sapiens GABA-B receptor R2 (GABBR2) mRNA, complete cds
[16350] gi|4836217|gb|AF095784.1|AF095784[4836217]
[16351] 10500: AJ006520
[16352] Homo sapiens mRNA for m1 muscarinic acetylcholine receptor protein, partial
[16353] gi|3292964|emb|AJ006520.1|HSA6520[3292964]
[16354] 10693: AF110907
[16355] Homo sapiens TNF-receptor associated factor-3 (TRAF-3) gene, exons 1a and 1b, complete sequence
[16356] gi|4761208|gb|AF110907.1|AF110907[4761208]
[16357] 10694: AJ002425
[16358] Homo sapiens mRNA for p65 protein
[16359] gi|4753767|emb|AJ002425.2|HSAJ2425[4753767]
[16360] 10697: Y15220
[16361] Homo sapiens mRNA for chemokine IP-9
[16362] gi|4225953|emb|Y15220.1|HSCHIP9RN[4225953]
[16363] 10698: AJ005282
[16364] Homo sapiens mRNA for NPR-B1
[16365] gi|3059110|emb|AJ005282.1|HSAJ5282[3059110]
[16366] 10699: AJ012188
[16367] Homo sapiens mRNA for GABAB receptor, subunit 2
[16368] gi|3776097|emb|AJ012188.1|HSA012188[3776097]
[16369] 10700: AJ012187
[16370] Homo sapiens mRNA for GABAB receptor, subunit 1c,
[16371] gi|3776095|emb|AJ012187.1|HSA012187[3776095]
[16372] 10701: AJ012186
[16373] Homo sapiens mRNA for GABAB receptor, subunit 1b
[16374] gi|3776093|emb|AJ012186.1|HSA012186[3776093]
[16375] 10702: AJ012185
[16376] Homo sapiens mRNA for GABAB-receptor, subunit 1a
[16377] gi|3776072|emb|AJ012185.1|HSA012185[3776072]
[16378] 10704: AF129112
[16379] Homo sapiens vanilloid receptor-like protein 1 (VRL-1) mRNA, complete cds
[16380] gi|4589140|gb|AF129112.1|AF129112[4589140]
[16381] 10705: AF068265
[16382] Homo sapiens monocyte chemoattractant protein 1 receptor (CCR2) gene promoter and mRNA, partial sequence
[16383] gi|4587865|gb|AF068265.1|AF068265[4587865]
[16384] 10706: AB020625
[16385] Homo sapiens mRNA for butyrophilin like receptor, complete cds
[16386] gi|4587208|dbj|AB020625.1|AB020625[4587208]
[16387] 10709: AH007576
[16388] Homo sapiens killer cell inhibitory receptor G9P gene, complete cds
[16389] gi|4581764|gb|AH007576.1|SEG_HSKIRG9P[4581764]
[16390] 10710: AF110035
[16391] Homo sapiens killer cell inhibitory receptor G9P gene, complete cds
[16392] gi|4581763|gb|AF110035.1|HSKIRG9P4[4581763]
[16393] 10711: AF110034
[16394] Homo sapiens killer cell inhibitory receptor G9P gene, partial sequence
[16395] gi|4581762|gb|AF110034.1|HSKIRG9P3[4581762]
[16396] 10712: AF110033
[16397] Homo sapiens killer cell inhibitory receptor G9P gene, partial sequence
[16398] gi|4581761|gb|AF110033.1HSKIRG9P2[4581761]
[16399] 10713: AF110032
[16400] Homo sapiens killer cell inhibitory receptor G9P gene, partial sequence
[16401] gi|4581760|gb|AF110032.1|HSKIRG9 P1[4581760]
[16402] 10714: AF114165
[16403] Homo sapiens endothelin receptor B delta 3 mRNA, complete cds
[16404] gi|4580923|gb|AF114165.1|AF114165[4580923]
[16405] 10717: AF105999
[16406] Homo sapiens acetylcholine receptor epsilon subunit (CHRNE) gene, complete cds
[16407] gi|4580858|gb|AF105999.1|AF105999[4580858]
[16408] 10718: AH007573
[16409] Homo sapiens killer inhibitory receptor 1 (KIR1) gene, complete cds; and kill inhibitory receptor 2 (KIR2) gene, partial cds
[16410] gi|4580703|gb|AH007573.1|SEG_HS2KIR[4580703]
[16411] 10720: AF134316
[16412] Homo sapiens killer inhibitory receptor 4-1-2 (KIR412) gene, exon 5 and partial
[16413] cds
[16414] gi|4580701|gb|AF134316.1|SEG_HS2KIR7[4580701]
[16415] 10721: AF134315
[16416] Homo sapiens killer inhibitory receptor 4-1-2 (KIR412) gene, exon 4
[16417] gi|4580700|gb|AF134315.1|SEG_HS2KIR6[4580700]
[16418] 10723: AF134313
[16419] Homo sapiens killer inhibitory receptor 4-1-2 (KIR412) gene, exon 2 and pseudoexon 3
[16420] gi|4580698|gb|AF134313.1|SEG_HS2KIR4[4580698]
[16421] 10724: AF134312
[16422] Homo sapiens killer inhibitory receptor 4-1-1 (KIR411) gene, exons 7, 8 and 9
[16423] and partial cds; killer inhibitory receptor 4-1-2 (KIR412) gene, exon 1
[16424] gi|4580697|gb|AF134312.1|SEG_HS2KIR3[4580697]
[16425] 10725: AF134311
[16426] Homo sapiens killer inhibitory receptor 4-1-1 (KIR411) gene, exon 6
[16427] gi|4580696|gb|AF134311.1|SEG_HS2KIR2[4580696]
[16428] 10727: AH007572
[16429] Homo sapiens killer inhibitory receptor (KIR) gene, partial cds
[16430] gi|4580693|gb|AH007572.1|SEG_HSKIRP[4580693]
[16431] 10728: AF133900
[16432] Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, exons 7, 8, and 9
[16433] and partial cds
[16434] gi|4580692|gb|AF133900.1|HSKIRP5[4580692]
[16435] 10729: AF133899
[16436] Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, exon 6
[16437] gi|4580691|gb|AF133899.1|HSKIRP4[4580691]
[16438] 10730: AF133898
[16439] Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, exon 5
[16440] gi|4580690|gb|AF133898.1|HSKIRP3[4580690]
[16441] 10731: AF133897
[16442] Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, exon 4
[16443] gi|4580689|gb|AF133897.1|HSKIRP2[4580689]
[16444] 10732: AF133896
[16445] Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, pseudoexon 3
[16446] gi|4580688|gb|AF133896.1|HSKIRP1[4580688]
[16447] 10733: AF133901
[16448] Homo sapiens killer inhibitory receptor 2-2-1 (KIR221) and killer inhibitory receptor 2-2-2 (KIR222) genes, partial cds
[16449] gi|4580682|gb|AF133901.1|AF133901[4580682]
[16450] 10736: AF069755
[16451] Homo sapiens orphan G protein-coupled receptor HG20 (HG20) mRNA, complete cds
[16452] gi|4091932|gb|AF069755.1|AF069755[4091932]
[16453] 10738: AC007229
[16454] Homo sapiens chromosome 19, cosmid R34187, complete sequence
[16455] gi|4567173|gb|AC007229.1|AC007229[4567173]
[16456] 10740: AF125303
[16457] Homo sapiens glucocorticoid-induced TNFR-related protein ligand (TNFSF18) mRNA,
[16458] complete cds
[16459] gi|4558500|gb|AF125303.1|AF125303[4558500]
[16460] 10742: AF058762
[16461] Homo sapiens galanin receptor subtype 2 (GALNR2) gene, complete cds
[16462] gi|3170598|gb|AF058762.1|AF058762[3170598]
[16463] 10743: AF096786
[16464] Homo sapiens chromosome 2 G protein-coupled receptor (GPR55) gene, complete cds
[16465] gi|4545136|gb|AF096786.1|AF096786[4545136]
[16466] 10745: AF096784
[16467] Homo sapiens chromosome 1 G protein-coupled receptor (GPR52) gene, complete cds
[16468] gi|4545133|gb|AF096784.1|AF096784[4545133]
[16469] 10746: AF119815
[16470] Homo sapiens G-protein coupled receptor (NPGPR) mRNA, complete cds
[16471] gi|4530468|gb|AF119815.1|AF119815[4530468]
[16472] 10749: AF098664
[16473] Homo sapiens olfactory receptor-like protein (OR2C1) gene, complete cds
[16474] gi|3982606|gb|AF098664.1|AF098664[3982606]
[16475] 10752: AF090131
[16476] Homo sapiens clone b312C2EN9 LDL receptor-related protein 6 gene, partial cds,
[16477] and CpG island sequence
[16478] gi|4494988|gb|AF090131.1|AF090131[4494988]
[16479] 10778: X95583
[16480] H. sapiens mRNA for monocyte chemotactic protein-1 (MCP-1) receptor
[16481] gi|4468944|emb|X95583.1|HSMCP1REC[4468944]
[16482] 10791: AJ131757
[16483] Homo sapiens olr1 gene
[16484] gi|4468343|emb|AJ131757.1|HSA131757[4468343]
[16485] 10792: X58674
[16486] H. sapiens RNA for receptor for C5a anaphylatoxin
[16487] gi|29568|emb|X58674.1|HSC5ANAPL[29568]
[16488] 10793: U51134
[16489] Homo sapiens calcitonin gene-related peptide receptor component protein mRNA, complete cds
[16490] gi|4097252|gb|U51134.1|HSU51134[4097252]
[16491] 10794: Y13464
[16492] Homo sapiens mRNA for cholecystokinin B receptor
[16493] gi|3287189|emb|Y13464.1|HSY13464[3287189]
[16494] 10795: Z66558
[16495] H. sapiens FAS/Apo1 gene (Del B1 mutation; partial)
[16496] gi|150414|embo Z66558.1|HSFASAPOC[1150414]
[16497] 10796: Z66557
[16498] H. sapiens of FAS/Apo1 gene (partial)
[16499] gi|150413|emb|Z66557.1|HSFASAPOB[1150413]
[16500] 10797: Z66556
[16501] H. sapiens FASExo8Del mRNA
[16502] gi|11150412emb|Z66556.1|HSFASAPOA[1150412]
[16503] 10825: AF118266
[16504] Homo sapiens orphan G protein-coupled receptor GPR45 (GPR45) gene, complete cds
[16505] gi|4455062|gb|AF118266.1|AF118266[4455062]
[16506] 10826: AF118265
[16507] Homo sapiens orphan G protein-coupled receptor GPR44 (GPR44) gene, complete cds
[16508] gi|4455060|gb|AF118265.1|AF118265[4455060]
[16509] 10827: Y18046
[16510] Homo sapiens mRNA for FOP (FGFR1 oncogene partner)
[16511] gi|4454262|emb|Y18046.1|HSAY18046[4454262]
[16512] 10828: AJ006276
[16513] Homo sapiens mRNA for transient receptor potential protein TRP6
[16514] gi|4454260|emb|AJ006276.1|HSAJ6276[4454260]
[16515] 10829: M13918
[16516] Homo sapiens fibronectin receptor alpha-subunit precursor (ITGA5) mRNA, partial
[16517] cds
[16518] gi|4464190|gb|M13918.2|HUMFNRAS[4464190]
[16519] 10831: D13515
[16520] Homo sapiens mRNA for key subunit of N-methyl-D-aspartate receptor, complete cds
[16521] gi|219919|dbj|D13515.1|HUMMARR[219919]
[16522] 10832: D10583
[16523] Homo sapiens mRNA for IgE receptor beta subunit, complete cds
[16524] gi|219881|dbj|D10583.1|HUMIGERB[219881]
[16525] 10834: AH007490
[16526] Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, partial cds
[16527] gi|4416260|gb|AH007490.1|SEG_HSGLVR1G[4416260]
[16528] 10835: AF102063
[16529] Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, exon 11 and complete cds
[16530] gi|4416259|gb|AF102063.1|HSGLVR1G5[4416259]
[16531] 10836: AF102062
[16532] Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, exons 7 through 10
[16533] gi|4416258|gb|AF102062.1|HSGLVR1G4[4416258]
[16534] 10837: AF102061
[16535] Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, exon 6
[16536] gi|4416257|gb|AF102061.1|HSGLVR1G3[4416257]
[16537] 10838: AF102060
[16538] Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, exon 5
[16539] gi|4416256|gb|AF102060.1|HSGLVR1G2[4416256]
[16540] 10839: AF102059
[16541] Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, exons 1 through 4
[16542] gi|4416255|gb|AF102059.1|HSGLVR1G1[4416255]
[16543] 10840: AF098798
[16544] Homo sapiens unknown mRNA
[16545] gi|4416073|gb|AF098798.1|AF098798[4416073]
[16546] 10841: AF118670
[16547] Homo sapiens orphan G protein-coupled receptor (GPR34) gene, complete cds
[16548] gi|4325085|gb|AF118670.1|AF118670[4325085]
[16549] 10842: AF053072
[16550] Homo sapiens GABA subunit A receptor alpha 6 precursor, gene, partial cds
[16551] gi|4405812|gb|AF053072.1|AF053072[4405812]
[16552] 10843: AF052539
[16553] Homo sapiens chemokine receptor 5 (CCR5) gene, CCR5—CYS allele, complete cds
[16554] gi|4337455|gb|AF052539.1|AF052539[4337455]
[16555] 10844: AF117713
[16556] Homo sapiens AITR ligand (TL6) mRNA, complete cds
[16557] gi|4378801|gb|AF117713.1|AF117713[4378801]
[16558] 10845: AF117297
[16559] Homo sapiens TNF receptor superfamily activation-inducible protein mRNA, complete cds
[16560] gi|4378799|gb|AF117297.1|AF117297[4378799]
[16561] 10974: Z29585
[16562] H. sapiens gene for high affinity IgE receptor alpha chain
[16563] gi|452350|emb|Z29585.1|HSHAIGER[452350]
[16564] 10975: AF050154
[16565] Homo sapiens clone F19374 APO E-C2 gene cluster, complete sequence
[16566] gi|4105701|gb|AF050154.1|AF050154[4105701]
[16567] 10981: X97881
[16568] H. sapiens mRNA for G protein coupled receptor kinase, GRK4D
[16569] gi|1770427|emb|X97881.1|HSGRK4D[1770427]
[16570] 10982: X97880
[16571] H. sapiens mRNA for G protein coupled receptor kinase, GRK4C
[16572] gi|1770425|emb|X97880.1|HSGRK4C[1770425]
[16573] 10983: X97879
[16574] H. sapiens mRNA for G protein coupled receptor kinase, GRK4B
[16575] gi|1770423|emb|X97879.1|HSGRK4B[1770423]
[16576] 10984: AJ007787
[16577] Homo sapiens CHRNA3 gene, exon 6, partial
[16578] gi|4164387|emb|AJ007787.1|HSA7787[4164387]
[16579] 10985: AJ007786
[16580] Homo sapiens CHRNA3 gene, exon 5
[16581] gi|4164386|emb|AJ007786.1|HSA7786[4164386]
[16582] 10986: AJ007785
[16583] Homo sapiens CHRNA3 gene, exon 4
[16584] gi|4164383|emb|AJ007785.1|HSA7785[4164383]
[16585] 10987: AJ007784
[16586] Homo sapiens CHRNA3 gene, exons 2 to 3
[16587] gi|4164382|emb|AJ007784.1|HSA7784[4164382]
[16588] 10988: AJ007783
[16589] Homo sapiens CHRNA3 gene, exon 1 and joined CDS
[16590] gi|4164380|emb|AJ007783.1|HSA7783[4164380]
[16591] 10989: AJ001939
[16592] Homo sapiens CHRNB2 gene, exon 6
[16593] gi|3766463|emb|AJ001939.1|HSAJ1939[3766463]
[16594] 10990: AJ001938
[16595] Homo sapiens CHRNB2 gene, exon 5
[16596] gi|3766454|emb|AJ001938.1|HSAJ1938[3766454]
[16597] 10991: AJ001937
[16598] Homo sapiens CHRNB2 gene, exon 4
[16599] gi|3766453|emb|AJ001937.1|HSAJ1937[3766453]
[16600] 10992: AJ001936
[16601] Homo sapiens CHRNB2 gene, exon 2 and exon 3
[16602] gi|3766452|emb|AJ001936.1|HSAJ1936[3766452]
[16603] 10993: AJ001935
[16604] Homo sapiens CHRNB2 gene, exon 1 (and joined CDS)
[16605] gi|3766450|emb|AJ001935.1|HSAJ1935[3766450]
[16606] 10998: AJ003147
[16607] Homo sapiens complete genomic sequence between D16S3070 and D16S3275, containing
[16608] Familial Mediterranean Fever gene disease
[16609] gi|2808656|emb|AJ003147.1|HSAJ03147[2808656]
[16610] 11000: AJ225029
[16611] Homo sapiens mRNA for GABA-B R1b receptor
[16612] gi|3892873|emb|AJ225029.1|HSA225029[3892873]
[16613] 11004: AJ003147
[16614] Homo sapiens complete genomic sequence between D16S3070 and D16S3275, containing
[16615] Familial Mediterranean Fever gene disease
[16616] gi|2808656|emb|AJ003147.1|HSAJ03147[2808656]
[16617] 11006: AJ225029
[16618] Homo sapiens mRNA for GABA-B R1b receptor
[16619] gi|3892873|emb|AJ225029.1|HSA225029[3892873]
[16620] 11007: AJ225028
[16621] Homo sapiens mRNA for GABA-B R1a receptor
[16622] gi|3892593|emb|AJ225028.1|HSA225028[3892593]
[16623] 11092: AJ132194
[16624] Homo sapiens olfr89 gene
[16625] gi|4160227|emb|AJ132194.1|HSA132194[4160227]
[16626] 11093: AJ012753
[16627] Homo sapiens RAGE gene (partial), exon 2
[16628] gi|4034482|emb|AJ012753.1|HSA012753[4034482]
[16629] 11094: AJ012332
[16630] Homo sapiens IL-1R gene cluster PAC contig, centromeric STS, sequence tagged site
[16631] gi|4128031|emb|AJ012332.1|HSA012332[4128031]
[16632] 11095: AJ012331
[16633] Homo sapiens IL-1R gene cluster PAC contig, telomeric STS, sequence tagged site
[16634] gi|4128030|emb|AJ012331.1|HSA012331[4128030]
[16635] 11097: AJ011701
[16636] Homo sapiens TRHR gene promoter and exons 1-2, partial
[16637] gi|4128016|emb|AJ011701.1|HSA011701[4128016]
[16638] 11098: AJ010191
[16639] Homo sapiens gababr1 receptor gene, exon 18
[16640] gi|3980509|emb|AJ010191.1|HSA010191[3980509]
[16641] 11099: AJ010190
[16642] Homo sapiens gababr1 receptor gene, exon 17
[16643] gi|3980507|emb|AJ010190.1|HSA010190[3980507]
[16644] 11100: AJ010189
[16645] Homo sapiens gababr1 receptor gene, exon 16
[16646] gi|3980504|emb|AJ010189.1|HSA010189[3980504]
[16647] 11101: AJ010188
[16648] Homo sapiens gababr1 receptor gene, exon 15
[16649] gi|3980502|emb|AJ010188.1|HSA010188[3980502]
[16650] 11102: AJ010187
[16651] Homo sapiens gababr1 receptor gene, exon 14
[16652] gi|3980500|emb|AJ010187.1|HSA010187[3980500]
[16653] 11103: AJ010186
[16654] Homo sapiens gababr1 receptor gene, exon 13
[16655] gi|3980498|emb|AJ010186.1|HSA010186[3980498]
[16656] 11104: AJ010185
[16657] Homo sapiens gababr1 receptor gene, exon 12
[16658] gi|3980496|emb|AJ010185.1|HSA010185[3980496]
[16659] 11105: AJ010184
[16660] Homo sapiens gababr1 receptor gene, exon 11
[16661] gi|3980494|emb|AJ010184.1|HSA010184[3980494]
[16662] 11106: AJ010183
[16663] Homo sapiens gababr1 receptor gene, exon 10
[16664] gi|3980492|emb|AJ010183.1|HSA010183[3980492]
[16665] 11107: AJ010182
[16666] Homo sapiens gababr1 receptor gene, exon 9
[16667] gi|3980490|emb|AJ010182.1|HSA010182[3980490]
[16668] 11108: AJ010181
[16669] Homo sapiens gababr1 receptor gene, exon 8
[16670] gi|3980488|emb|AJ010181.1|HSA010181[3980488]
[16671] 11109: AJ010180
[16672] Homo sapiens gababr1 receptor gene, exon 7
[16673] gi|3980486|emb|AJ010180.1|HSA010180[3980486]
[16674] 11110: AJ010179
[16675] Homo sapiens gababr1 receptor gene, exon 6
[16676] gi|3980484|emb|AJ010179.1|HSA010179[3980484]
[16677] 11111: AJ010178
[16678] Homo sapiens gababr1 receptor gene, exon 5
[16679] gi|3980482|emb|AJ010178.1|HSA010178[3980482]
[16680] 11112: AJ010177
[16681] Homo sapiens gababr1 receptor gene, exon 4
[16682] gi|3980481|emb|AJ010177.1|HSA010177[3980481]
[16683] 11113: AJ010176
[16684] Homo sapiens gababr1 receptor gene, exon 3
[16685] gi|3980480|emb|AJ010176.1|HSA010176[3980480]
[16686] 11114: AJ010175
[16687] Homo sapiens gababr1 receptor gene, exon 2
[16688] gi|3980479|emb|AJ010175.1|HSA010175[3980479]
[16689] 11115: AJ010174
[16690] Homo sapiens gababr1 receptor gene, exon 1
[16691] gi|3980477|emb|AJ010174.1|HSA010174[3980477]
[16692] 11116: AJ010173
[16693] Homo sapiens gababr1 receptor gene, exon 1a4
[16694] gi|3980475|emb|AJ010173.1|HSA010173[3980475]
[16695] 11117: AJ010172
[16696] Homo sapiens gababr1 receptor gene, exon 1a3
[16697] gi|3980472|emb|AJ010172.1|HSA010172[3980472]
[16698] 11118: AJ010171
[16699] Homo sapiens gababr1 receptor gene, exon 1a2
[16700] gi|3980469|emb|AJ010171.1|HSA10171[3980469]
[16701] 11119: AJ010170
[16702] Homo sapiens gababr1 receptor gene, exon 1a1
[16703] gi|3980465|emb|AJ010170.1|HSA10170[3980465]
[16704] 11121: AF061022
[16705] Homo sapiens CTH gene, complete cds
[16706] gi|4335930|gb|AF061022.1|AF061022[4335930]
[16707] 11122: AF052041
[16708] Homo sapiens olfactory receptor gene cluster, complete sequence
[16709] gi|4335873|gb|AF052041.1|AF052041[4335873]
[16710] 11124: AC006953
[16711] Homo sapiens chromosome 19, cosmid R28316, complete sequence
[16712] gi|4335701|gb|AC006953.1|AC006953[4335701]
[16713] 11125: AF105367
[16714] Homo sapiens glucagon-like peptide-2 receptor precursor (GLP2R) mRNA, complete
[16715] cds
[16716] gi|4324490|gb|AF105367.1|AF105367[4324490]
[16717] 11434: AH007439
[16718] Homo sapiens chromosome X
[16719] gi|4322454|gb|AH007439.1|SEG_HSIL2RGIN[4322454]
[16720] 11435: AF085452
[16721] Homo sapiens interleukin-2 receptor gamma chain (IL2RG) gene, intron 5, partial
[16722] sequence
[16723] gi|4322453|gb|AF085452.1|HSIL2RGIN2[4322453]
[16724] 11436: AF085451
[16725] Homo sapiens interleukin-2 receptor gamma chain (IL2RG) gene, intron 4, partial
[16726] sequence
[16727] gi|4322452|gb|AF085451.1|HSIL2RGIN1[4322452]
[16728] 11437: AF065213
[16729] Homo sapiens advanced glycosylation end product-specific receptor (RAGE) gene,
[16730] intron 3, partial sequence
[16731] gi|4321945|gb|AF065213.1|AF065213[4321945]
[16732] 11438: AF065212
[16733] Homo sapiens patient M1 advanced glycosylation end product-specific receptor (RAGE) gene, exon 3 and partial cds
[16734] gi|4321943|gb|AF065212.1|AF065212[4321943]
[16735] 11439: AF065211
[16736] Homo sapiens patient M21 advanced glycosylation end product-specific receptor (RAGE) gene, exon 3 and partial cds
[16737] gi|4321941|gb|AF065211.1|AF065211[4321941]
[16738] 11440: AF065210
[16739] Homo sapiens patient M20 advanced glycosylation end product-specific receptor (RAGE) gene, exon 3 and partial cds
[16740] gi|4321939|gb|AF0652101.1|AF065210[4321939]
[16741] 11441: AF051305
[16742] Homo sapiens beta chemokine receptor (CCR1) gene, promoter region and exon 1
[16743] gi|4321648|gb|AF051305.1|AF051305[4321648]
[16744] 11442: U87223
[16745] Homo sapiens contactin associated protein (Caspr) mRNA, complete cds
[16746] gi|1857707|gb|U87223.1|HSU87223[1857707]
[16747] 11443: AF022386
[16748] Homo sapiens p53-regulated DNA damage-inducible cell death receptor (killer) mRNA, complete cds
[16749] gi|2460427|gb|AF022386.1|AF022386[2460427]
[16750] 11444: AF011368
[16751] Homo sapiens CEV14 mRNA, partial cds
[16752] gi|2618824|gb|AF011368.1|AF011368[2618824]
[16753] 11445: AF016267
[16754] Homo sapiens TRAIL receptor 3 mRNA, complete cds
[16755] gi|2529564|gb|AF016267.1|AF016267[2529564]
[16756] 11446: AF020502
[16757] Homo sapiens cytotoxic TRAIL receptor-3 (TRAIL-R3) mRNA, complete cds
[16758] gi|2443819|gb|AF020502.1|AF020502[2443819]
[16759] 11447: AF020501
[16760] Homo sapiens cytotoxic TRAIL receptor-2 (DR5) mRNA, complete cds
[16761] gi|2443817|gb|AF020501.1|AF020501[2443817]
[16762] 11454: AF075460
[16763] Homo sapiens type 1-like ryanodine receptor mRNA, partial cds
[16764] gi|3328200|gb|AF075460.1|AF075460[3328200]
[16765] 11455: AF054830
[16766] Homo sapiens interleukin-1 type I receptor mRNA, partial sequence
[16767] gi|3003026|gb|AF054830.1|AF054830[3003026]
[16768] 11456: AF099082
[16769] Homo sapiens xenotropic and polytropic murine retrovirus receptor (XPR1) mRNA,
[16770] complete cds
[16771] gi|4176765|gb|AF099082.1|AF099082[4176765]
[16772] 11501: AF089744
[16773] Homo sapiens xenotropic and polytropic murine leukemia virus receptor (X3) mRNA,
[16774] complete cds
[16775] gi|4154282|gb|AF089744.1|AF089744[4154282]
[16776] 11502: AF001095
[16777] Homo sapiens receptor for advanced glycation end products (RAGE) gene, promoter
[16778] region and exon 1
[16779] gi|3093415|gb|AF001095.1|AF001095[3093415]
[16780] 11503: AF101784
[16781] Homo sapiens b-TRCP variant E3RS-IkappaB mRNA, partial cds
[16782] gi|4165135|gb|AF101784.1|AF101784[4165135]
[16783] 11504: AF080586
[16784] Homo sapiens galanin receptor type 2 (GALR2) mRNA, complete cds
[16785] gi|4165080|gb|AF080586.1|AF080586[4165080]
[16786] 11505: U71374
[16787] Homo sapiens HsPex13p mRNA, complete cds
[16788] gi|3738269|gb|U71374.1|HSU71374[3738269]
[16789] 11506: AF111116
[16790] Homo sapiens silencer of death domains (SODD) mRNA, complete cds
[16791] gi|4160013|gb|AF111116.1|AF111116[4160013]
[16792] 11507: AF110314
[16793] Homo sapiens herpesvirus immunoglobulin-like receptor HIgR mRNA, complete cds
[16794] gi|4154345|gb|AF110314.1|AF110314[4154345]
[16795] 11518: AF069543
[16796] Homo sapiens IL-3/IL-5/GM-CSFR receptor beta chain promoter and exon 1 sequence
[16797] gi|4071316|gb|AF069543.1|AF069543[4071316]
[16798] 11519: U81262
[16799] Homo sapiens LERK5 (LERK5) mRNA, complete cds
[16800] gi|1809333|gb|U81262.1|HSU81262[1809333]
[16801] 11520: AF097358
[16802] Homo sapiens mast cell function-associated antigen homolog (MAFA) mRNA, complete
[16803] cds
[16804] gi|4139191|gb|AF097358.1|AF097358[4139191]
[16805] 11521: AF029761
[16806] Homo sapiens decoy receptor 2 mRNA, complete cds
[16807] gi|4106963|gb|AF029761.1|AF029761[4106963]
[16808] 11522: AF074483
[16809] Homo sapiens GABA-B receptor 2 mRNA, complete cds
[16810] gi|4107511|gb|AF074483.1|AF074483[4107511]
[16811] 11523: AC006293
[16812] Homo sapiens chromosome 19, cosmid F15658, complete sequence
[16813] gi|4106979|gb|AC006293.1|AC006293[4106979]
[16814] 11524: AF104419
[16815] Homo sapiens decoy receptor 3 (DcR3) mRNA, complete cds
[16816] gi|4106877|gb|AF104419.1|AF104419[4106877]
[16817] 11525: AF046059
[16818] Homo sapiens cytokine receptor related protein 4 (CYTOR4) mRNA, complete cds
[16819] gi|4105471|gb|AF046059.1|AF046059[4105471]
[16820] 11526: AF041262
[16821] Homo sapiens immunoglobulin-like transcript 8 mRNA, complete cds
[16822] gi|4104892|gb|AF041262.1|AF041262[4104892]
[16823] 11527: AF041261
[16824] Homo sapiens immunoglobulin-like transcript 7 mRNA, complete cds
[16825] gi|4104890|gb|AF041261.1|AF041261[4104890]
[16826] 11528: AH007196
[16827] Homo sapiens transforming growth factor-beta type I receptor gene, exon 6
[16828] gi|4104446|gb|AH007196.1|SEG_HSTGFRBI[4104446]
[16829] 11529: AF035670
[16830] Homo sapiens transforming growth factor-beta type I receptor gene, exon 9, and
[16831] complete cds
[16832] gi|4104445|gb|AF035670.1|HSTGFRBI9[4104445]
[16833] 11530: AF035669
[16834] Homo sapiens transforming growth factor-beta type I receptor gene, exon 8
[16835] gi|4104444|gb|AF035669.1|HSTGFRBI8[4104444]
[16836] 11531: AF035668
[16837] Homo sapiens transforming growth factor-beta type I receptor gene, exon 7
[16838] gi|4104443|gb|AF035668.1|HSTGFRBI7[4104443]
[16839] 11532: AF035667
[16840] Homo sapiens transforming growth factor-beta type I receptor gene, exon 6
[16841] gi|4104442|gb|AF035667.1|HSTGFRBI6[4104442]
[16842] 11533: AF035666
[16843] Homo sapiens transforming growth factor-beta type I receptor gene, exon 5
[16844] gi|4104441|gb|AF035666.1|HSTGFRBI5[4104441]
[16845] 11534: AF035665
[16846] Homo sapiens transforming growth factor-beta type I receptor gene, exon 4
[16847] gi|4104440|gb|AF035665.1|HSTGFRBI4[4104440]
[16848] 11535: AF035664
[16849] Homo sapiens transforming growth factor-beta type I receptor gene, exon 3
[16850] gi|4104439|gb|AF035664.1|HSTGFRBI3[4104439]
[16851] 11536: AF035663
[16852] Homo sapiens transforming growth factor-beta type I receptor gene, exon 2
[16853] gi|4104438|gb|AF035663.1|HSTGFRBI2[4104438]
[16854] 11537: AF035662
[16855] Homo sapiens transforming growth factor-beta type I receptor gene, exon 1
[16856] gi|4104437|gb|AF035662.1|HSTGFRBI1[4104437]
[16857] 11538: AF037332
[16858] Homo sapiens Eph-like receptor tyrosine kinase hEphB1b (EphB1) mRNA, complete cds
[16859] gi|4104412|gb|AF037332.1|AF037332[4104412]
[16860] 11539: AF037331
[16861] Homo sapiens Eph-like receptor tyrosine kinase hEphB1 (EphB1) mRNA, complete cds
[16862] gi|4104410|gb|AF037331.1|AF037331[4104410]
[16863] 11543: AH007119
[16864] Homo sapiens killer cell inhibitory receptor KIRC1 gene, complete cds
[16865] gi|3776473|gb|AH007119.1|SEG_HSKIRCI[3776473]
[16866] 11544: AF072410
[16867] Homo sapiens killer cell inhibitory receptor KIRC1 gene, exons 6, 7 and 8 and complete cds
[16868] gi|3776472|gb|AF072410.1|HSKIRCI4[3776472]
[16869] 11545: AF072409
[16870] Homo sapiens killer cell inhibitory receptor KIRCI gene, exon 5
[16871] gi|3776471|gb|AF072409.1|HSKIRCI3[3776471]
[16872] 11546: AF072408
[16873] Homo sapiens killer cell inhibitor receptor KIRCI gene, exons 2, 3, and 4
[16874] gi|3776470|gb|AF072408.1|HSKIRCI2[3776470]
[16875] 11547: AF072407
[16876] Homo sapiens killer cell inhibitory receptor KIRCI gene, exon 1
[16877] gi|3776469|gb|AF072407.1|HSKIRCI1[3776469]
[16878] 11548: AH007118
[16879] Homo sapiens immunoglobulin-like transcript 10 protein gene, complete cds
[16880] gi|3776467|gb|AH007118.1|SEG_HSILTX[3776467]
[16881] 11549: AF072101
[16882] Homo sapiens immunoglobulin-like transcript 10 protein gene, exons 7 and 8
[16883] and
[16884] complete cds
[16885] gi|3776466|gb|AF072101.1|HSILTX2[3776466]
[16886] 11550: AF072100
[16887] Homo sapiens immunoglobulin-like transcript 10 protein gene, exons 1 through
[16888] gi|3776465|gb|AF072100.1|HSILTX1[3776465]
[16889] 11551: AF072099
[16890] Homo sapiens immunoglobulin-like transcript 3 protein variant 1 gene, complete
[16891] cds
[16892] gi|3776463|gb|AF072099.1|AF072099[3776463]
[16893] 11553: AF106941
[16894] Homo sapiens beta-arrestin 2 mRNA, complete cds
[16895] gi|4092782|gb|AF106941.1|AF106941[4092782]
[16896] 11554: AF104304
[16897] Homo sapiens Smad anchor for receptor activation (SARA) mRNA, complete cds
[16898] gi|4092766|gb|AF104304.1|AF104304[4092766]
[16899] 11555: AF034780
[16900] Homo sapiens lysosphingolipid receptor Edg5 mRNA, complete cds
[16901] gi|4090955|gb|AF034780.1|AF034780[4090955]
[16902] 11556: AF109401
[16903] Homo sapiens neurotrophic factor artemin precursor (ARTN) mRNA, complete cds
[16904] gi|4071352|gb|AF109401.1|AF109401[4071352]
[16905] 11557: AF099148
[16906] Homo sapiens GABA-B1a receptor mRNA, complete cds
[16907] gi|4063891|gb|AF099148.1|AF099148[4063891]
[16908] 11558: AF095448
[16909] Homo sapiens putative G protein-coupled receptor (RAIG1) mRNA, complete cds
[16910] gi|4063889|gb|AF095448.1|AF095448[4063889]
[16911] 11559: L34689
[16912] Homo sapiens somatostatin receptor isoform 2 (SSTR2) gene, partial cds
[16913] gi|598233|gb|L34689.1|HUMSOREC2X[598233]
[16914] 11560: AF100161
[16915] Homo sapiens folate receptor type gamma′ gene, partial cds
[16916] gi|4063392|gb|AF100161.1|AF100161[4063392]
[16917] 11561: AF082076
[16918] Homo sapiens luteinizing hormone receptor (LHR) gene, partial cds
[16919] gi|4063365|gb|AF082076.1|AF082076[4063365]
[16920] 11562: AC006132
[16921] Homo sapiens chromosome 19, cosmid R28204, complete sequence
[16922] gi|3970930|gb|AC006132.1|AC006132[3970930]
[16923] 11563: AH007081
[16924] Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, complete cds
[16925] gi|4050003|gb|AH007081.1|SEG_HSOLR[4050003]
[16926] 11564: AF079167
[16927] Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, exons 4, 5, and 6, and complete cds
[16928] gi|4050002|gb|AF079167.1|HSOLR4[4050002]
[16929] 11565: AF079166
[16930] Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, exon 3
[16931] gi|4050001|gb|AF079166.1|HSOLR3[4050001]
[16932] 11566: AF079165
[16933] Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, exon 2
[16934] gi|4050000|gb|AF079165.1|HSOLR2[4050000]
[16935] 11567: AF079164
[16936] Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, exon 1
[16937] gi|4049999|gb|AF079164.1|HSOLR1[4049999]
[16938] 11568: AF099083
[16939] Homo sapiens growth hormone secretagogue receptor gene, 5′ flanking region and
[16940] partial cds
[16941] gi|4039145|gb|AF099083.1|AF099083[4039145]
[16942] 11569: AF058390
[16943] Homo sapiens neurotrophin 3 receptor truncated isoform (NTRK3) mRNA, partial cds
[16944] gi|4027932|gb|AF058390.1|AF058390[4027932]
[16945] 11570: AF058389
[16946] Homo sapiens neurotrophin 3 receptor (NTRK3) mRNA, partial cds
[16947] gi|4027930|gb|AF058389.1|AF058389[4027930]
[16948] 11877: AF029839
[16949] Homo sapiens alpha 7 neuronal nicotinic receptor mRNA sequence
[16950] gi|3757794|gb|AF029839.1|AF029839[3757794]
[16951] 11878: AF029838
[16952] Homo sapiens alpha 7 neuronal nicotinic receptor mRNA sequence
[16953] gi|3757793|gb|AF029838.1|AF029838[3757793]
[16954] 11880: AH007062
[16955] Homo sapiens galanin receptor (GALNR), complete cds
[16956] gi|3064074|gb|AH007062.1|SEG_HSGALNRS[3064074]
[16957] 11881: U90660
[16958] Homo sapiens galanin receptor (GALNR) gene, exon 3 and complete cds
[16959] gi|3064073|gb|U90660.1|HSGALNRS3[3064073]
[16960] 11882: U90659
[16961] Homo sapiens galanin receptor (GALNR) gene, exon 2
[16962] gi|3064072|gb|U90659.1|HSGALNRS2[3064072]
[16963] 11883: U90658
[16964] Homo sapiens galanin receptor (GALNR) gene, exon 1
[16965] gi|3064071|gb|U90658.1|HSGALNRS1[3064071]
[16966] 11884: AF041474
[16967] Homo sapiens BAF53a (BAF53a) mRNA, complete cds
[16968] gi|4001802|gb|AF041474.1|AF041474[4001802]
[16969] 11886: AF097942
[16970] Homo sapiens monocyte antigen CD14 precursor (CD14) mRNA, complete cds
[16971] gi|3983126|gb|AF097942.1|AF097942[3983126]
[16972] 11887: AH007044
[16973] Homo sapiens growth factor receptor (GRB10) gene, alternative splice products,
[16974] complete cds
[16975] gi|3982774|gb|AH007044.1|SEG_HSGRB[3982774]
[16976] 11904: AF084941
[16977] Homo sapiens pre-T cell receptor alpha chain 1 precursor, gene, complete cds
[16978] gi|3978459|gb|AF084941.1|AF084941[3978459]
[16979] 11905: AH007043
[16980] Homo sapiens interleukin-7 receptor precursor (IL7R), complete cds
[16981] gi|3978161|gb|AH007043.1|SEG_HSIL7R[3978161]
[16982] 11906: AF043129
[16983] Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exons 7 and 8 and complete cds
[16984] gi|3978160|gb|AF043129.1|HSIL7R7[3978160]
[16985] 11907: AF043128
[16986] Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 6
[16987] gi|3978159|gb|AF043128.1|HSIL7R6[3978159]
[16988] 11908: AF043127
[16989] Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 5
[16990] gi|3978158|gb|AF043127.1|HSIL7R5[3978158]
[16991] 11909: AF043126
[16992] Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 4
[16993] gi|3978157|gb|AF043126.1|HSIL7R4[3978157]
[16994] 11910: AF043125
[16995] Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 3
[16996] gi|3978156|gb|AF043125.1|HSIL7R3[3978156]
[16997] 11911: AF043124
[16998] Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 2
[16999] gi|3978155|gb|AF043124.1|HSIL7R2[3978155]
[17000] 11912: AF043123
[17001] Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 1
[17002] gi|3978154|gb|AF043123.1|HSIL7R1[3978154]
[17003] 11913: AH007033
[17004] Homo sapiens prostanoid FP receptor (PTGFR), partial cds
[17005] gi|3941539|gb|AH007033.1|SEG_HSPTF2AGR[3941539]
[17006] 11914: AF068679
[17007] Homo sapiens prostanoid FF receptor gene, exon and partial cds
[17008] gi|3941538|gb|AF068679.1|HSPTF2AGR4[3941538]
[17009] 11915: AF068678
[17010] Homo sapiens prostanoid FP receptor (PTGFR) gene, exon
[17011] gi|3941537|gb|AF068678.1|HSPTF2AGR3[3941537]
[17012] 11916: AF068677
[17013] Homo sapiens prostanoid FP receptor (PTGFR) gene, exon and partial 5′UTR
[17014] gi|3941536|gb|AF068677.1|HSPTF2AGR2[3941536]
[17015] 11917: AF068676
[17016] Homo sapiens prostanoid FP receptor (PTGFR) gene, exon
[17017] gi|3941535|gb|AF068676.1|HSPTF2AGR1[3941535]
[17018] 11918: AF035776
[17019] Homo sapiens oxidized low-density lipoprotein receptor mRNA, complete cds
[17020] gi|3941299|gb|AF035776.1|AF035776[3941299]
[17021] 11920: AF091501
[17022] Homo sapiens receptor protein patched 2 (PTCH2) mRNA, complete cds
[17023] gi|3929234|gb|AF091501.1|AF091501[3929234]
[17024] 11953: X98174
[17025] H. sapiens mRNA for MACH-alpha-3 protein
[17026] gi|3928273|emb|X98174.1|HSMACHA3[3928273]
[17027] 11955: X68990
[17028] Homo sapiens CR2 mRNA for complement receptor
[17029] gi|3928195|emb|X68990.1|HSCR2AA[3928195]
[17030] 11956: X63128
[17031] H. sapiens mRNA for activin receptor
[17032] gi|3928172|emb|X63128.1|HSACTREC[3928172]
[17033] 11958: AF074397
[17034] Homo sapiens anti-mullerian hormone type II receptor (AMHR2) gene, promoter region and partial cds
[17035] gi|3916231|gb|AF074397.1|AF074397[3916231]
[17036] 11959: U72648
[17037] Homo sapiens alpha2-C4-adrenergic receptor gene, complete cds
[17038] gi|3914602|gb|U72648.1|HSU72648[3914602]
[17039] 11960: Y10148
[17040] H. sapiens mRNA for NTR2 receptor
[17041] gi|3901027|emb|Y10148.1|HSNTR2REC[3901027]
[17042] 11961: Y12476
[17043] Homo sapiens putative GPR37 gene (exon 1 and joined CDS)
[17044] gi|2570029|emb|Y12476.1|HSY12476[2570029]
[17045] 11962: AJ000479
[17046] Homo sapiens mRNA for putative G-protein coupled receptor, EDG6
[17047] gi|3805931|emb|AJ000479.1|HSEDG4[3805931]
[17048] 11963: Y12477
[17049] Homo sapiens putative GPR37 gene, exon 2
[17050] gi|2570031|emb|Y12477.1|HSY12477[2570031]
[17051] 11964: X04329
[17052] Homo sapiens mRNA fragment for receptor-like furin
[17053] gi|31479|emb|X04329.1|HSFUR1[31479]
[17054] 11965: AH007002
[17055] Homo sapiens chromosome 1 map 1q12-q13
[17056] gi|3892221|gb|AH007002.1|SEG_HSM1MUSR[3892221]
[17057] 11966: AF091493
[17058] Homo sapiens M1 muscarinic receptor gene, exons 2 and 3
[17059] gi|3892220|gb|AF091493.1|HSM1MUSR2[3892220]
[17060] 11967: AF091492
[17061] Homo sapiens M1 muscarinic receptor gene, promoter region and exon 1
[17062] gi|3892219|gb|AF091492.1|HSM1MUSR1[3892219]
[17063] 12129: AF077820
[17064] Homo sapiens LDL receptor member LR3 mRNA, complete cds
[17065] gi|3831747|gb|AF077820.1|AF077820[3831747]
[17066] 12130: AF055992
[17067] Homo sapiens Duffy antigen/chemokine receptor (FY) gene, FY*X allele,
[17068] complete cds
[17069] gi|3659623|gb|AF055992.1|AF055992[3659623]
[17070] 12131: U58675
[17071] Homo sapiens Chromosome 17 p13 Cosmid Clone cos39, complete sequence
[17072] gi|3849817|gb|U58675.1|U58675[3849817]
[17073] 12132: AF077346
[17074] Homo sapiens interleukin-18 receptor accessory protein-like mRNA, complete cds
[17075] gi|3851059|gb|AF077346.1|AF077346[3851059]
[17076] 12136: Z17227
[17077] Homo sapiens mRNA for transmebrane receptor protein
[17078] gi|393378|emb|Z17227.1|HSTRECP[393378]
[17079] 12137: AF082742
[17080] Homo sapiens CC chemokine receptor 5 (CCR5) gene, promoter region and partial sequence
[17081] gi|3561057|gb|AF082742.1|AF082742[3561057]
[17082] 12139: Z34897
[17083] H. sapiens mRNA for H1 histamine receptor
[17084] gi|510295|emb|Z34897.1|HSHISTR1[510295]
[17085] 12140: X76786
[17086] H. sapiens histamine H1 receptor gene
[17087] gi|442517|emb|X76786.1|HSHISH1[442517]
[17088] 12141: AC005933
[17089] Homo sapiens chromosome 19, cosmid F15472, complete sequence
[17090] gi|3845348|gb|AC005933.1|AC005933[3845348]
[17091] 12142: AF094755
[17092] Homo sapiens glycine receptor beta subunit precursor (GLRB), variant B mRNA, complete cds
[17093] gi|3834636|gb|AF094755.1|AF094755[3834636]
[17094] 12143: AF094754
[17095] Homo sapiens glycine receptor beta subunit precursor (GLRB), variant A mRNA, complete cds
[17096] gi|3834634|gb|AF094754.1|AF094754[3834634]
[17097] 12144: AF091512
[17098] Homo sapiens familial Mediterranean fever locus genomic sequence
[17099] gi|3834584|gb|AF091512.1|AF091512[3834584]
[17100] 12145: AF065876
[17101] Homo sapiens olfactory receptor (OR2D2) gene, partial cds
[17102] gi|3831618|gb|AF065876.1|AF065876[3831618]
[17103] 12147: AF065874
[17104] Homo sapiens olfactory receptor (OR10A1) gene, partial cds
[17105] gi|3831615|gb|AF065874.1|AF065874[3831615]
[17106] 12151: AF065870
[17107] Homo sapiens olfactory receptor (OR6A1) gene, complete cds
[17108] gi|38316100gb|AF065870.1|AF065870[3831610]
[17109] 12158: AF065863
[17110] Homo sapiens olfactory receptor (OR5F1) gene, partial cds
[17111] gi|3831602|gb|AF065863.1|AF065863[3831602]
[17112] 12160: AF065861
[17113] Homo sapiens olfactory receptor (OR5D4) gene, partial cds
[17114] gi|3831599|gb|AF065861.1|AF06S861[3831599]
[17115] 12161: AF065860
[17116] Homo sapiens olfactory receptor (OR5D3) gene, partial cds
[17117] gi|3831597|gb|AF065860.1|AF065860[3831597]
[17118] 12170: AH006968
[17119] Homo sapiens
[17120] gi|2828129|gb|AH006968.1|SEG_HSCRFR[2828129]
[17121] 12171: AF039523
[17122] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 14 and complete cds
[17123] gi|2828128|gb|AF039523.1|HSCRFR14[2828128]
[17124] 12172: AF039522
[17125] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 13
[17126] gi|2828127|gb|AF039522.1|HSCRFR13[2828127]
[17127] 12173: AF039521
[17128] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 12
[17129] gi|2828126|gb|AF039521.1|HSCRFR12[2828126]
[17130] 12174: AF039520
[17131] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 11
[17132] gi|2828125|gb|AF039520.1|HSCRFR11[2828125]
[17133] 12175: AF039519
[17134] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 10
[17135] gi|2828124|gb|AF039519.1|HSCRFR10[2828124]
[17136] 12176: AF039518
[17137] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 9
[17138] gi|2828123|gb|AF039518.1|HSCRFR09[2828123]
[17139] 12177: AF039517
[17140] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 8
[17141] gi|2828122|gb|AF039517.1|HSCRFR08[2828122]
[17142] 12178: AF039516
[17143] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 7
[17144] gi|2828121|gb|AF039516.1|HSCRFR07[2828121]
[17145] 12179: AF039515
[17146] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 6
[17147] gi|28281201gb|AF039515.1|HSCRFR06[2828120]
[17148] 12180: AF039514
[17149] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 5
[17150] gi|2828119|gb|AF039514.1|HSCRFR05[2828119]
[17151] 12181: AF039513
[17152] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 4
[17153] gi|2828118|gb|AF039513.1|HSCRFR04[2828118]
[17154] 12182: AF039512
[17155] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 3
[17156] gi|2828117|gb|AF039512.1|HSCRFR03[2828117]
[17157] 12183: AF039511
[17158] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 2
[17159] gi|2828116|gb|AF039511.1|HSCRFR02[2828116]
[17160] 12184: AF039510
[17161] Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 1
[17162] gi|2828115|gb|AF039510.1|HSCRFR01[2828115]
[17163] 12185: AF030186
[17164] Homo sapiens glypican-4 (GPC4) mRNA, complete cds
[17165] gi|3831546|gb|AF030186.1|AF030186[3831546]
[17166] 12206: AJ006353
[17167] Homo sapiens mRNA for ephrin-A4 protein, soluble form
[17168] gi|3821236|emb|AJ006353.1|HSA6353[3821236]
[17169] 12212: AF055634
[17170] Homo sapiens transmembrane receptor UNC5C (UNC5C) mRNA, complete cds
[17171] gi|3789764|gb|AF055634.1|AF055634[3789764]
[17172] 12227: AH006936
[17173] Homo sapiens activin receptor type IIB (ACVR2B), complete cds
[17174] gi|3769442|gb|AH006936.1|SEG_HSACVR2B[3769442]
[17175] 12228: AF060202
[17176] Homo sapiens activin receptor type IIB (ACVR2B) gene, exon 11 and complete cds
[17177] gi|3769441|gb|AF060202.1|HSACVR2B4[3769441]
[17178] 12229: AF060201
[17179] Homo sapiens activin receptor type IIB (ACVR2B) gene, exons 8, 9, and 10
[17180] gi|3769440|gb|AF060201.1|HSACVR2B3[3769440]
[17181] 12230: AF060200
[17182] Homo sapiens activin receptor type IIB (ACVR2B) gene, exons 2 through 7
[17183] gi|3769439|gb|AF060200.1|HSACVR2B2[3769439]
[17184] 12231: AF060199
[17185] Homo sapiens activin receptor type IIB (ACVR2B) gene, exon 1
[17186] gi|3769438|gb|AF060199.1|HSACVR2B[3769438]
[17187] 12232: AF037646
[17188] Homo sapiens alpha-7 neuronal nicotinic acetylcholine receptor precursor RNA, partial sequence
[17189] gi|3757808|gb|AF037646.1|AF037646[3757808]
[17190] 12233: AF036903
[17191] Homo sapiens alpha-7 neuronal nicotinic acetylcholine receptor mRNA, alternatively spliced, partial sequence
[17192] gi|3757807|gb|AF036903.1|AF036903[3757807]
[17193] 12234: AH006931
[17194] Homo sapiens lipoprotein receptor-related protein (LRP1) gene, complete cds
[17195] gi|3493575|gb|AH006931.1|SEG_HSLRPSS[3493575]
[17196] 12235: AF058427
[17197] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 80 through 89 and complete cds
[17198] gi|3493574|gb|AF058427.1|HSLRPSS61[3493574]
[17199] 12236: AF058426
[17200] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 78 and 79
[17201] gi|3493573|gb|AF058426.1|HSLRPSS59[3493573]
[17202] 12237: AF058425
[17203] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 77
[17204] gi|3493572|gb|AF058425.1|HSLRPSS57[3493572]
[17205] 12238: AF058424
[17206] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 76
[17207] gi|3493571|gb|AF058424.1|HSLRPSS55[3493571]
[17208] 12239: AF058423
[17209] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 71 through 75
[17210] gi|3493570|gb|AF058423.1|HSLRPSS53[3493570]
[17211] 12240: AF058422
[17212] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 61 through 70
[17213] gi|3493569|gb|AF058422.1|HSLRPSS51[3493569]
[17214] 12241: AF058421
[17215] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 59 and 60
[17216] gi|3493568|gb|AF058421.1|HSLRPSS49[3493568]
[17217] 12242: AF058420
[17218] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 56, 57, and
[17219] gi|3493567|gb|AF058420.1|HSLRPSS47[3493567]
[17220] 12243: AF058419
[17221] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 45 through 55
[17222] gi|3493566|gb|AF058419.1|HSLRPSS45[3493566]
[17223] 12244: AF058418
[17224] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 43 and 44
[17225] gi|3493565|gb|AF058418.1|HSLRPSS43[3493565]
[17226] 12245: AF058417
[17227] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 42
[17228] gi|3493564|gb|AF058417.1|HSLRPSS41[3493564]
[17229] 12246: AF058416
[17230] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 39, 40, and
[17231] gi|3493563|gb|AF058416.1|HSLRPSS39[3493563]
[17232] 12247: AF058415
[17233] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 36, 37, and
[17234] gi|3493562|gb|AF058415.1|HSLRPSS37[3493562]
[17235] 12248: AF058414
[17236] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 27 through 34
[17237] gi|3493561|gb|AF058414.1|HSLRPSS35[3493561]
[17238] 12249: AF058413
[17239] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 25 and 26
[17240] gi|3493560|gb|AF058413.1|HSLRPSS33[3493560]
[17241] 12250: AF058412
[17242] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 23 and 24
[17243] gi|3493559|gb|AF058412.1|HSLRPSS31[3493559]
[17244] 12251: AF058411
[17245] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 21 and 22
[17246] gi|3493558|gb|AF058411.1|HSLRPSS29[3493558]
[17247] 12252: AF058410
[17248] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 20
[17249] gi|3493557|gb|AF058410.1|HSLRPSS27[3493557]
[17250] 12253: AF058409
[17251] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 18 and 19
[17252] gi|3493556|gb|AF058409.1|HSLRPSS25[3493556]
[17253] 12254: AF058408
[17254] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 16 and 17
[17255] gi|3493555|gb|AF058408.1|HSLRPSS23[3493555]
[17256] 12255: AF058407
[17257] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 14 and 15
[17258] gi|3493554|gb|AF058407.1|HSLRPSS21[3493554]
[17259] 12256: AF058406
[17260] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 13
[17261] gi|3493553|gb|AF058406.1|HSLRPSS19[3493553]
[17262] 12257: AF058405
[17263] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 12
[17264] gi|3493552|gb|AF058405.1|HSLRPSS17[3493552]
[17265] 12258: AF058404
[17266] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 11
[17267] gi|3493551|gb|AF058404.1|HSLRPSS15[3493551]
[17268] 12259: AF058403
[17269] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 9 and 10
[17270] gi|3493550|gb|AF058403.1|HSLRPSS13[3493550]
[17271] 12260: AF058402
[17272] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 7 and 8
[17273] gi|493549|gb|AF058402.1|HSLRPSS11[3493549r
[17274] 12261: AF058401
[17275] Homo sapiens lipoprotein receptor-related protein (LRP1), exons 5 and 6
[17276] gi|3493548|gb|AF058401.1|HSLRPSS09[3493548]
[17277] 12262: AF058400
[17278] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 4
[17279] gi|3493547|gb|AF058400.1|HSLRPSS07[3493547]
[17280] 12263: AF058399
[17281] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 3
[17282] gi|3493546|gb|AF058399.1|HSLRPSS05[3493546]
[17283] 12264: AF058398
[17284] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 2
[17285] gi|3493545|gb|AF058398.1|HSLRPSS03[3493545]
[17286] 12265: AF058397
[17287] Homo sapiens lipoprotein receptor-related protein (LRP1), exon 1
[17288] gi|3493544|gb|AF058397.1|HSLRPSS01[3493544]
[17289] 12267: Y11044
[17290] Homo sapiens mRNA for GABA-BR1a (hGB1a) receptor
[17291] gi|2826760|emb|Y11044.1|HSGTHLA1[2826760]
[17292] 12277: AF073019
[17293] Homo sapiens clone 21 T cell signal transduction molecule SAP mRNA, complete cds
[17294] gi|3695070|gb|AF073019.1|AF073019[3695070]
[17295] 12278: AF072930
[17296] Homo sapiens clone 14 T cell signal transduction molecule SAP mRNA, complete cds
[17297] gi|3695068|gb|AF072930.1|AF072930[3695068]
[17298] 12279: Y12670
[17299] Homo sapiens mRNA for leptin receptor gene-related protein
[17300] gi|2266637|emb|Y12670.1|HSOBRGRP[2266637]
[17301] 12280: AF091890
[17302] Homo sapiens G-protein coupled receptor RE2 mRNA, complete cds
[17303] gi|3659902|gb|AF091890.1|AF091890[3659902]
[17304] 12281: Y09586
[17305] Homo sapiens mRNA for serotonin 4 receptor (h5-HT4(a)), splice variant
[17306] gi|2584764|emb|Y09586.1|HS5HT4SAR[2584764]
[17307] 12282: X77777
[17308] H. sapiens intestinal VIP receptor related protein mRNA
[17309] gi|456352|emb|X77777.1|HSVIPRRP[456352]
[17310] 12283: AJ001383
[17311] Homo sapiens activating NK-receptor (NK-p46) mRNA
[17312] gi|3647278|emb|AJ001383.1|HSJ001383[3647278]
[17313] 12284: AJ224901
[17314] Homo sapiens mRNA for ZNF198 protein
[17315] gi|3647276|emb|AJ224901.1|HSAJ4901[3647276]
[17316] 12285: AJ006123
[17317] Homo sapiens mRNA for NK receptor (NKp46), isoform d
[17318] gi|3647272|emb|AJ006123.1|HSA6123[3647272]
[17319] 12286: AJ006122
[17320] Homo sapiens mRNA for NK receptor (NKp46) isoform c
[17321] gi|3647270|emb|AJ006122.1|HSA6122[3647270]
[17322] 12287: AJ006121
[17323] Homo sapiens mRNA for NK receptor (NKp46), isoform b
[17324] gi|3647268|emb|AJ006121.1|HSA6121[3647268]
[17325] 12289: X99906
[17326] Homo sapiens mRNA for alpha endosulfine
[17327] gi|2764973|emb|X99906.1|HSALPEND[2764973]
[17328] 12292: U52064
[17329] Kaposi's sarcoma-associated herpes-like virus ORF73 homolog gene, complete cds
[17330] gi|1633571|gb|U52064.1|KSU52064[1633571]
[17331] 12293: U29343
[17332] Homo sapiens hyaluronan receptor (RHAMM) mRNA, complete cds
[17333] gi|2959555|gb|U29343.1|HSU29343[2959555]
[17334] 12294: AF035771
[17335] Homo sapiens Na+/H+ exchanger regulatory factor 2 (NHERF-2) mRNA, complete cds
[17336] gi|2665825|gb|AF035771.1|AF035771[2665825]
[17337] 12296: AF023849
[17338] Homo sapiens TNF receptor-related receptor for TRAIL mRNA, complete cds
[17339] gi|2653844|gb|AF023849.1|AF023849[2653844]
[17340] 12297: AH006710
[17341] Homo sapiens interferon-gamma receptor alpha chain (interferon-gamma receptor alpha chain gene), complete cds
[17342] gi|2078444|gb|AH006710.1|SEG_HSINFGRA[2078444]
[17343] 12298: U19247
[17344] Homo sapiens interferon-gamma receptor alpha chain gene, exon 7 and complete cds
[17345] gi|632541|gb|U19247.1|HSINFGRA7[632541]
[17346] 12299: U19246
[17347] Homo sapiens interferon-gamma receptor alpha chain gene, exon 6
[17348] gi|632540|gb|U19246.1|HSINFGRA6[632540]
[17349] 12300: U19245
[17350] Homo sapiens interferon-gamma receptor alpha chain gene, exon 5
[17351] gi|632539|gb|U19245.1|HSINFGRA5[632539]
[17352] 12301: U19244
[17353] Homo sapiens interferon-gamma receptor alpha chain gene, exon 4
[17354] gi|632538|gb|U19244.1|HSINFGRA4[632538]
[17355] 12302: U19243
[17356] Homo sapiens interferon-gamma receptor alpha chain gene, exon 3
[17357] gi|632537|gb|U19243.1|HSINFGRA3[632537]
[17358] 12303: U19242
[17359] Homo sapiens interferon-gamma receptor alpha chain gene, exon 2
[17360] gi|632536|gb|U19242.1|HSINFGRA2[632536]
[17361] 12304: U19241
[17362] Homo sapiens interferon-gamma receptor alpha chain gene, exon 1
[17363] gi|632535|gb|U19241.1|HSINFGRA1[632535]
[17364] 12305: AF027957
[17365] Homo sapiens G protein-coupled receptor (GPR35) gene, complete cds
[17366] gi|2739108|gb|AF027957.1|AF027957[2739108]
[17367] 12306: AF027956
[17368] Homo sapiens G protein-coupled receptor (GPR30) gene, complete cds
[17369] gi|2739106|gb|AF027956.1|AF027956[2739106]
[17370] 12307: AF016709
[17371] Homo sapiens ATP receptor subunit (P2X5) mRNA, complete cds
[17372] gi|2731560|gb|AF016709.1|AF016709[2731560]
[17373] 12308: AF035824
[17374] Homo sapiens vesicle soluble NSF attachment protein receptor (VTI1) mRNA, complete cds
[17375] gi|2687399|gb|AF035824.1|AF035824[2687399]
[17376] 12309: U96845
[17377] Homo sapiens natual killer cell group 2-F (NKG2-F) mRNA, complete cds
[17378] gi|2673988|gb|U96845.1|HSU96845[2673988]
[17379] 12310: AF022139
[17380] Homo sapiens lysosphingolipid receptor (EDG3) mRNA, partial cds
[17381] gi|2668611|gb|AF022139.1|AF022139[2668611]
[17382] 12311: AF022137
[17383] Homo sapiens G protein-coupled receptor (EDG1) mRNA, partial cds
[17384] gi|2668607|gb|AF022137.1|AF022137[2668607]
[17385] 12312: AF031556
[17386] Homo sapiens clone 17.30 immunoglobulin-like transcript 5 mRNA, complete cds
[17387] gi|2665646|gb|AF031556.1|AF031556[2665646]
[17388] 12313: AF031555
[17389] Homo sapiens clone 17.23 immunoglobulin-like transcript 5 mRNA, complete cds
[17390] gi|2665644|gb|AF031555.1|AF031555[2665644]
[17391] 12314: AF031554
[17392] Homo sapiens clone 17.18 immunoglobulin-like transcript 5 mRNA, complete cds
[17393] gi|2665642|gb|AF031554.1|AF031554[2665642]
[17394] 12315: AF031553
[17395] Homo sapiens clone DC.1 immunoglobulin-like transcript 5 mRNA, complete cds
[17396] gi|2665640|gb|AF031553.1|AF031553[2665640]
[17397] 12316: AF009644
[17398] Homo sapiens clone 41 immunoglobulin-like transcript 5 protein mRNA, complete cds
[17399] gi|2662447|gb|AF009644.1|AF009644[2662447]
[17400] 12317: AF009643
[17401] Homo sapiens clone 6 immunoglobulin-like transcript 5 protein mRNA, complete cds
[17402] gi|2662445|gb|AF009643.1|AF009643[2662445]
[17403] 12318: AF009642
[17404] Homo sapiens clone 40 immunoglobulin-like transcript 5 protein mRNA, complete cds
[17405] gi|2662443|gb|AF009642.1|AF009642[2662443]
[17406] 12319: AF009641
[17407] Homo sapiens clone 36 immunoglobulin-like transcript 5 protein mRNA, complete cds
[17408] gi|2662441|gb|AF009641.1|AF009641[2662441]
[17409] 12320: AF009640
[17410] Homo sapiens clone 33 immunoglobulin-like transcript 5 protein mRNA, complete cds
[17411] gi|2662439|gb|AF009640.1|AF009640[2662439]
[17412] 12321: AF009639
[17413] Homo sapiens clone 31 immunoglobulin-like transcript 5 protein mRNA, complete cds
[17414] gi|2662437|gb|AF009639.1|AF009639[2662437]
[17415] 12322: AF009638
[17416] Homo sapiens clone 22 immunoglobulin-like transcript 5 protein mRNA, complete cds
[17417] gi|2662435|gb|AF009638.1|AF009638[2662435]
[17418] 12323: AF009637
[17419] Homo sapiens clone 19 immunoglobulin-like transcript 5 protein mRNA, complete cds
[17420] gi|2662433|gb|AF009637.1|AF009637[2662433]
[17421] 12324: AF009636
[17422] Homo sapiens clone 17.8 immunoglobulin-like transcript 5 protein mRNA, complete
[17423] cds
[17424] gi|2662431|gb|AF009636.1|AF009636[2662431]
[17425] 12325: AF009635
[17426] Homo sapiens clone 17.7 immunoglobulin-like transcript 5 protein mRNA, complete
[17427] cds
[17428] gi|2662429|gb|AF009635.1|AF009635[2662429]
[17429] 12326: AF009634
[17430] Homo sapiens clone 17.6 immunoglobulin-like transcript 5 protein mRNA, complete
[17431] cds
[17432] gi|2662427|gb|AF009634.1|AF009634[2662427]
[17433] 12327: AF009633
[17434] Homo sapiens clone 17.11 immunoglobulin-like transcript 5 protein mRNA, complete
[17435] cds
[17436] gi|2662425|gb|AF009633.1|AF009633[2662425]
[17437] 12328: AF009632
[17438] Homo sapiens clone 17.10 immunoglobulin-like transcript 5 protein mRNA, complete
[17439] cds
[17440] gi|2662423|gb|AF009632.1|AF009632[2662423]
[17441] 12329: AF014924
[17442] Homo sapiens immunoglobulin-like transcript 6a (ILT6a) mRNA, complete cds
[17443] gi|2661224|gb|AF014924.1|AF014924[2661224]
[17444] 12330: AF014923
[17445] Homo sapiens immunoglobulin-like transcript 6 (ILT6) mRNA, complete cds
[17446] gi|2661222|gb|AF014923.1|AF014923[2661222]
[17447] 12331: AF011566
[17448] Homo sapiens clone 17 immunoglobulin-like transcript 4 mRNA, complete cds
[17449] gi|2660709|gb|AF011566.1|AF011566[2660709]
[17450] 12332: AF011565
[17451] Homo sapiens clone 26 immunoglobulin-like transcript 4 mRNA, complete cds
[17452] gi|2660707|gb|AF011565.1|AF011565[2660707]
[17453] 12333: AF009007
[17454] Homo sapiens immunoglobulin-like transcript 2c mRNA, complete cds
[17455] gi|2660705|gb|AF009007.1|AF009007[2660705]
[17456] 12334: AF009006
[17457] Homo sapiens immunoglobulin-like transcript 2b mRNA, complete cds
[17458] gi|2660703|gb|AF009006.1|AF009006[2660703]
[17459] 12335: AF009005
[17460] Homo sapiens immunoglobulin-like transcript 2a mRNA, complete cds
[17461] gi|2660701|gb|AF009005.1|AF009005[2660701]
[17462] 12336: AH006705
[17463] Homo sapiens mu opioid receptor (OPRM1) and mu opioid receptor (OPRM1)s, partial
[17464] cds
[17465] gi|2655104|gb|AH006705.1|SEG_HSOPRMI[2655104]
[17466] 12338: AF024516
[17467] Homo sapiens mu opioid receptor (OPRM1) gene, partial cds, exons 2 and 3, complete IVS2
[17468] gi|2655102|gb|AF024516.1|HSOPRMI2[2655102]
[17469] 12339: AF024515
[17470] Homo sapiens mu opioid receptor (OPRM1) gene, partial cds, exon 1
[17471] gi|2655101|gb|AF024515.1|HSOPRMI1[2655101]
[17472] 12410: AF030625
[17473] Homo sapiens SCCL vasopressin subtype 1a receptor mRNA, complete cds
[17474] gi|2623229|gb|AF030625.1|AF030625[2623229]
[17475] 12411: AF002986
[17476] Homo sapiens platelet activating receptor homolog (H963) mRNA, complete cds
[17477] gi|2580587|gb|AF002986.1|AF002986[2580587]
[17478] 12412: AF023614
[17479] Homo sapiens transmembrane activator and CAML interactor (TACI) mRNA, complete
[17480] cds
[17481] gi|2554947|gb|AF023614.1|AF023614[2554947]
[17482] 12413: AF022860
[17483] Homo sapiens neuropilin-2(a17) mRNA, complete cds
[17484] gi|2547131|gb|AF022860.1|AF022860[2547131]
[17485] 12414: AF022859
[17486] Homo sapiens neuropilin-2(a0) mRNA, complete cds
[17487] gi|2547129|gb|AF022859.1|AF022859[2547129]
[17488] 12415: AF016849
[17489] Homo sapiens apoptosis inducing receptor TRAIL-R2 (TRAILR2) mRNA, complete cds
[17490] gi|2465585|gb|AF016849.1|AF016849[2465585]
[17491] 12416: AF013171
[17492] Homo sapiens TNF-related ligand TRANCE mRNA, partial cds
[17493] gi|2411499|gb|AF013171.1|AF013171[2411499]
[17494] 12417: AF018956
[17495] Homo sapiens neuropilin mRNA, complete cds
[17496] gi|2407640|gb|AF018956.1|AF018956[2407640]
[17497] 12419: AF015257
[17498] Homo sapiens flow-induced endothelial G protein-coupled receptor (FEG-1) mRNA,
[17499] complete cds
[17500] gi|2353152|gb|AF015257.1|AF015257[2353152]
[17501] 12420: U75285
[17502] Homo sapiens apoptosis inhibitor survivin gene, complete cds
[17503] gi|2315862|gb|U75285.1|HSU75285[2315862]
[17504] 12421: AF012270
[17505] Homo sapiens visual pigment-like receptor peropsin (Rrh) mRNA, complete cds
[17506] gi|2387009|gb|AF012270.1|AF012270[2307009]
[17507] 12422: AH006692
[17508] Homo sapiens chromosome 19 clone PAC clone 72N6 map 19q13.42
[17509] gi|2290633|gb|AH006692.1|SEG_HSNKAT2A[2290633]
[17510] 12423: U97180
[17511] Homo sapiens NKAT-2a like protein (KIR) gene, exons 8 and 9 and complete cds
[17512] gi|2290632|gb|U97180.1|HSNKAT2A8[2290632]
[17513] 12424: U97179
[17514] Homo sapiens NKAT-2a like protein (KIR) gene, exon 7
[17515] gi|2290631|gb|U97179.1|HSNKAT2A7[2290631]
[17516] 12425: U97178
[17517] Homo sapiens NKAT-2a like protein (KIR) gene, exon 6
[17518] gi|2290630|gb|U97178.1|HSNKAT2A6[2290630]
[17519] 12426: U97177
[17520] KIR Homo sapiens NKAT-2a like protein (KIR) gene, exon 5
[17521] gi|2290629|gb|U97177.1|HSNKAT2A5[2290629]
[17522] 12427: U97176
[17523] Homo sapiens NKAT-2a like protein (KIR) gene, exon 4
[17524] gi|2290628|gb|U97176.1|HSNKAT2A4[2290628]
[17525] 12429: U97174
[17526] KIR Homo sapiens NKAT-2a like protein (KIR) gene, exon 2
[17527] gi|2290626|gb|U97174.1|HSNKAT2A2[2290626]
[17528] 12430: U97173
[17529] Homo sapiens NKAT-2a like protein (KIR) gene, exon 1
[17530] gi|2290625|gb|U97173.1|HSNKAT2A1[2290625]
[17531] 12431: U97075
[17532] Homo sapiens FLICE-like inhibitory protein short form mRNA, complete cds
[17533] gi|2253680|gb|U97075.1|U97075[2253680]
[17534] 12432: U97074
[17535] Homo sapiens FLICE-like inhibitory protein long form mRNA, complete cds
[17536] gi|2253678|gb|U97074.1|U97074[2253678]
[17537] 12688: L76380
[17538] Homo sapiens (clone HSNME29) CGRP type 1 receptor mRNA, complete cds
[17539] gi|1321593|gb|L76380.1|HUMCGRPB[1321593]
[17540] 12689: L49241
[17541] Homo sapiens fibroblast growth factor 2 (FGFR2) Ser354Cys mutant gene, exon IIIc
[17542] gi|1129116|gb|L49241.1|HUMFGF354C[1129116]
[17543] 12690: L49240
[17544] Homo sapiens fibroblast growth factor 2 (FGFR2) Ala344Gly mutant gene, exon IIIc
[17545] gi|1129114|gb|L49240.1|HUMFGF344G[1129114]
[17546] 12691: L49239
[17547] Homo sapiens fibroblast growth factor 2 (FGFR2) Cys342Tyr mutant gene, exon IIIc
[17548] gi|1129112|gb|L49239.1|HUMFGF342Y[1129112]
[17549] 12692: L49238
[17550] Homo sapiens fibroblast growth factor 2 (FGFR2) Cys342Ser mutant gene, exon IIIc
[17551] gi|1129110|gb|L49238.1|HUMFGF342S[1129110]
[17552] 12693: L49242
[17553] Homo sapiens fibroblast growth factor 2 (FGFR2) Gly338Arg mutant gene, exon IIIc
[17554] gi|1129108|gb|L49242.1|HUMFGF338R[1129108]
[17555] 12694: L49237
[17556] Homo sapiens fibroblast growth factor 2 (FGFR2) Gln289Pro mutant gene, exon IIIu
[17557] gi|1129106|gb|L49237.1|HUMFGF289P[1129106]
[17558] 12842: L38734
[17559] Homo sapiens hepatoma transmembrane kinase ligand (HTK ligand) mRNA, complete cds
[17560] gi|769675|gb|L38734.1|HUMHTK[769675]
[17561] 12843: L40764
[17562] Homo sapiens vasoactive intestinal polypeptide receptor 2 (VIPR2) mRNA, complete
[17563] cds
[17564] gi|712836|gb|L40764.1|HUMVIPR2A[712836]
[17565] 12844: AF068181
[17566] Homo sapiens B cell linker protein BLNK-s mRNA, alternatively spliced, complete
[17567] cds
[17568] gi|3406750|gb|AF068181.1|AF068181[3406750]
[17569] 12845: AF068180
[17570] Homo sapiens B cell linker protein BLNK mRNA, alternatively spliced, complete cds
[17571] gi|3406748|gb|AF068180.1|AF068180[3406748]
[17572] 12846: AF064801
[17573] Homo sapiens multiple membrane spanning receptor TRC8 (TRC8) mRNA, complete cds
[17574] gi|3395786|gb|AF064801.1|AF064801[3395786]
[17575] 12847: AH006513
[17576] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene
[17577] gi|3342791|gb|AH006513.1|SEG_HSGLRA3S[3342791]
[17578] 12848: AF017724
[17579] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 10n, and complete cds
[17580] gi|3342790|gb|AF017724.1|HSGLRA3S10[3342790]
[17581] 12849: AF017723
[17582] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 9n
[17583] gi|3342789|gb|AF017723.1|HSGLRA3S09[3342789]
[17584] 12850: AF017722
[17585] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 8
[17586] gi|3342788|gb|AF017722.1|HSGLRA3S08[3342788]
[17587] 12851: AF017721
[17588] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 7
[17589] gi|3342787|gb|AF017721.1|HSGLRA3S07[3342787]
[17590] 12852: AF017720
[17591] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 6
[17592] gi|3342786|gb|AF017720.1|HSGLRA3S06[3342786]
[17593] 12853: AF017719
[17594] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 5
[17595] gi|3342785|gb|AF017719.1|HSGLRA3S05[3342785]
[17596] 12854: AF017718
[17597] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 4
[17598] gi|3342784|gb|AF017718.1|HSGLRA3S04[3342784]
[17599] 12855: AF017717
[17600] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 3
[17601] gi|3342783|gb|AF017717.1|HSGLRA3S03[3342783]
[17602] 12856: AF017716
[17603] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 2
[17604] gi|3342782|gb|AF017716.1|HSGLRA3S02[3342782]
[17605] 12857: AF017715
[17606] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 1
[17607] gi|3342781|gb|AF017715.1|HSGLRA3S01[3342781]
[17608] 12858: AF018157
[17609] Homo sapiens glycine receptor alpha 3 subunit (GLRA3) mRNA, alternatively spliced, partial cds
[17610] gi|3342237|gb|AF018157.1|AF018157[3342237]
[17611] 12861: AF045764
[17612] Homo sapiens orphan G protein-coupled receptor (GPR32) gene, complete cds
[17613] gi|3282838|gb|AF045764.1|AF045764[3282838]
[17614] 12864: AF053004
[17615] Homo sapiens class I cytokine receptor (WSX1) mRNA, complete cds
[17616] gi|31532400gb|AF053004.1|AF053004[3153240]
[17617] 12865: AF055872
[17618] Homo sapiens Apo3/DR3 ligand (APO3L) mRNA, complete cds
[17619] gi|3108230|gb|AF055872.1|AF055872[3108230]
[17620] 12866: AF057140
[17621] Homo sapiens cargo selection protein TIP47 (TIP47) mRNA, complete cds
[17622] gi|3095185|gb|AF057140.1|AF057140[3095185]
[17623] 12870: AF028785
[17624] Homo sapiens phosphatidylinositol 3-kinase p55 gamma regulatory subunit mRNA, complete cds
[17625] gi|3046405|gb|AF028785.1|AF028785[3046405]
[17626] 12872: AF027826
[17627] Homo sapiens putative seven pass transmembrane protein (TM7SF1) mRNA, complete
[17628] cds
[17629] gi|2992627|gb|AF027826.1|AF027826[2992627]
[17630] 12883: AF040630
[17631] Homo sapiens galanin receptor GalR2 mRNA, complete cds
[17632] gi|2921759|gb|AF040630.1|AF040630[2921759]
[17633] 12904: U86281
[17634] Homo sapiens olfactory receptor (OR7-141) gene, partial cds
[17635] gi|2921715|gb|U86281.1|U86281[2921715]
[17636] 12905: U86280
[17637] Homo sapiens olfactory receptor (OR7-140) gene, partial cds
[17638] gi|2921713|gb|U86280.1|U86280[2921713]
[17639] 12906: U86279
[17640] Homo sapiens olfactory receptor (OR7-139) gene, partial cds
[17641] gi|2921711|gb|U86279.1|U86279[2921711]
[17642] 12907: U86278
[17643] Homo sapiens olfactory receptor (OR7-138) gene, partial cds
[17644] gi|2921709|gb|U86278.1|U86278[2921709]
[17645] 12911: U86274
[17646] Homo sapiens olfactory receptor (OR5-85) gene, partial cds
[17647] gi|2921704|gb|U86274.1|U86274[2921704]
[17648] 12915: U86270
[17649] Homo sapiens olfactory receptor (OR5-40) gene, partial cds
[17650] gi|2921699|gb|U86270.1|U86270[2921699]
[17651] 12921: U86264
[17652] Homo sapiens olfactory receptor (OR3-145) gene, partial cds
[17653] gi|2921692|gb|U86264.1|U86264[2921692]
[17654] 12927: AH006491
[17655] Homo sapiens GPI-linked anchor protein (GFRA1), complete cds
[17656] gi|2921544|gb|AH006491.1|SEG_HSGFRA1G[2921544]
[17657] 12928: AF038420
[17658] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 11 and complete cds
[17659] gi|2921543|gb|AF038420.1|HSGFRA1G11[2921543]
[17660] 12929: AF038419
[17661] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 10
[17662] gi|2921542|gb|AF038419.1|HSGFRA1G1002921542]
[17663] 12930: AF038418
[17664] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 9
[17665] gi|2921541|gb|AF038418.1|HSGFRA1G 9[2921541]
[17666] 12931: AF038417
[17667] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 8
[17668] gi|2921540|gb|AF038417.1|HSGFRA1G 8[2921540]
[17669] 12932: AF038416
[17670] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 7
[17671] gi|2921539|gb|AF038416.1|HSGFRA1G 7[2921539]
[17672] 12933: AF038415
[17673] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 6
[17674] gi|2921538|gb|AF038415.1|HSGFRA1G 6[2921538]
[17675] 12934: AF038414
[17676] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 5
[17677] gi|2921537|gb|AF038414.1|HSGFRA1G 5[2921537]
[17678] 12935: AF038413
[17679] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 4
[17680] gi|2921536|gb|AF038413.1|HSGFRA1G 4[2921536]
[17681] 12936: AF038412
[17682] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 3
[17683] gi|2921535|gb|AF038412.1|HSGFRA1G 3[2921535]
[17684] 12937: AF038411
[17685] Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 2
[17686] gi|2921534|gb|AF038411.1|HSGFRA1G 2[2921534]
[17687] 12938: AF036906
[17688] Homo sapiens linker for activation of T cells (LAT) mRNA, alternatively spliced
[17689] form, complete cds
[17690] gi|2828025|gb|AF036906.1|AF036906[2828025]
[17691] 12939: AF036905
[17692] Homo sapiens linker for activation of T cells (LAT) mRNA, complete cds
[17693] gi|2828023|gb|AF036905.1|AF036905[2828023]
[17694] 12940: AF043724
[17695] Homo sapiens hepatitis A virus cellular receptor 1 (hHAVcr-1) mRNA, complete cds
[17696] gi|2827453|gb|AF043724.1|AF043724[2827453]
[17697] 12954: U86239
[17698] Homo sapiens olfactory receptor (OR16-90) gene, partial cds
[17699] gi|2921659|gb|U86239.1|U86239[2921659]
[17700] 12955: U86238
[17701] Homo sapiens olfactory receptor (OR16-89) gene, partial cds
[17702] gi|2921657|gb|U86238.1|U86238[2921657]
[17703] 12956: U86237
[17704] Homo sapiens olfactory receptor (OR16-88) gene, partial cds
[17705] gi|2921655|gb|U86237.1U86237[2921655]
[17706] 12957: U86236
[17707] Homo sapiens olfactory receptor (OR16-37) gene, partial cds
[17708] gi|2921653|gb|U86236.1|U86236[2921653]
[17709] 12958: U86235
[17710] Homo sapiens olfactory receptor (OR16-36) gene, partial cds
[17711] gi|2921651|gb|U86235.1|U86235[2921651]
[17712] 12959: U86234
[17713] Homo sapiens olfactory receptor (OR16-35) gene, partial cds
[17714] gi|2921649|gb|U86234.1|U86234[2921649]
[17715] 12971: U86222
[17716] Homo sapiens olfactory receptor (OR13-66) gene, partial cds
[17717] gi|2921636|gb|U86222.1|U86222[2921636]
[17718] 12977: U86216
[17719] Homo sapiens olfactory receptor (OR1-26) gene, partial cds
[17720] gi|2921629|gb|U86216.1U86216[2921629]
[17721] 12978: U86215
[17722] Homo sapiens olfactory receptor (OR1-25) gene, partial cds
[17723] gi|2921627|gb|U86215.1|U86215[2921627]
[17724] 12979: AF016261
[17725] Homo sapiens interleukin-1 receptor accessory protein (IL1RAP) gene, partial cds
[17726] gi|2911297|gb|AF016261.1|AF016261[2911297]
[17727] 12980: AF041245
[17728] Homo sapiens orexin receptor-2 mRNA, complete cds
[17729] gi|2897127|gb|AF041245.1|AF041245[2897127]
[17730] 12981: AF041243
[17731] Homo sapiens orexin receptor-1 mRNA, complete cds
[17732] gi|2897123|gb|AF041243.1|AF041243[2897123]
[17733] 12982: U97123
[17734] Homo sapiens chemokine receptor mRNA, complete cds
[17735] gi|2897070|gb|U97123.1|HSU97123[2897070]
[17736] 12983: AF009014
[17737] Homo sapiens glutamate receptor delta-2 subunit (GLURD2) mRNA, complete cds
[17738] gi|2853314|gb|AF009014.1|AF009014[2853314]
[17739] 12984: AF036581
[17740] Homo sapiens tumor necrosis factor superfamily member LIGHT mRNA, complete cds
[17741] gi|2815623|gb|AF036581.1|AF036581[2815623]
[17742] 12985: AF040991
[17743] Homo sapiens roundabout 2 (robo2) mRNA, partial cds
[17744] gi|2804785|gb|AF040991.1|AF040991[2804785]
[17745] 12986: AF040990
[17746] Homo sapiens roundabout 1 (robo1) mRNA, complete cds
[17747] gi|2804783|gb|AF040990.1|AF040990[2804783]
[17748] 12987: AF026070
[17749] Homo sapiens death receptor 3 beta (DR3) mRNA, complete cds
[17750] gi|2570830|gb|AF026070.1|AF026070[2570830]
[17751] 12988: AF021818
[17752] Homo sapiens putative neurotransmitter receptor mRNA, complete cds
[17753] gi|2465431|gb|AF021818.1|AF021818[2465431]
[17754] 12990: L48211
[17755] Homo Sapiens angiotensin II receptor gene, complete cds
[17756] gi|1160612|gb|L48211.1|HUMAIR[1160612]
[17757] 12992: L47169
[17758] Homo sapiens neuropeptide Y receptor gene, exon, promoter C
[17759] gi|976208|gb|L47169.1|HUMNPYAC[976208]
[17760] 12993: L47168
[17761] Homo sapiens neuropeptide Y receptor gene, exon, promoter B
[17762] gi|976207|gb|L47168.1|HUMNPYAB[976207]
[17763] 12994: L47167
[17764] Homo sapiens neuropeptide Y receptor gene, exon, promoter A
[17765] gi|976206|gb|L47167.1|HUMNPYAA[976206]
[17766] 12995: L37086
[17767] Homo sapiens FK-506 binding protein (fkbp12.6) gene, complete cds
[17768] gi|965467|gb|L37086.1|HUMFK506B[965467]
[17769] 12996: L36566
[17770] Human helodermin-preferring VIP receptor (VIP2/PACAP receptor) mRNA, complete cds
[17771] gi|550477|gb|L36566.1|HUMHVP[550477]
[17772] 12997: L25647
[17773] Homo sapiens fibroblast growth factor receptor gene (located in the central MHC)
[17774] signal peptide and consecutive exon
[17775] gi|457233|gb|L25647.1|HUMFGFRZ[457233]
[17776] 12998: M85247
[17777] H. sapiens dopamine D1A receptor gene, complete exon 1, and exon 2, 5′ end
[17778] gi|181652|gb|M85247.1|HUMDOPAM[181652]
[17779] 12999: L21195
[17780] Human serotonin 5-HT7 receptor mRNA, complete cds
[17781] gi|413865|gb|L21195.1|HLJMSHTR[413865]
[17782] 13000: L22647
[17783] Human prostaglandin receptor ep1 subtype mRNA, complete cds
[17784] gi|410208|gb|L22647.1|HUMG[410208]
[17785] 13001: L10822
[17786] Human gastrin receptor gene, complete cds
[17787] gi|406075|gb|L10822.1|HUMGARE[406075]
[17788] 13002: L19546
[17789] Human (IL2RG) gene, complete cds with repeats
[17790] gi|349631|gb|L19546.1|HUMIL2RGA[349631]
[17791] 13003: M95667
[17792] Homo sapiens c-erb B2/neu protein (ERBB2) gene, partial cds
[17793] gi|182168|gb|M95667.1|HUMERBB2[182168]
[17794] 13004: AF087138
[17795] Homo sapiens sulfonylurea receptor 1 (SUR1) mRNA, complete cds
[17796] gi|3643189|gb|AF087138.1|AF087138[3643189]
[17797] 13005: AF042782
[17798] Homo sapiens galanin receptor type. 2 (GALR2) gene, complete cds
[17799] gi|3642913|gb|AF042782.1|AF042782[3642913]
[17800] 13007: AF064548
[17801] Homo sapiens low-density lipoprotein receptor-related protein 5 (LRP5) mRNA,
[17802] complete cds
[17803] gi|3641526|gb|AF064548.1|AF064548[3641526]
[17804] 13008: AF073799
[17805] Homo sapiens galanin receptor GALR3 mRNA, complete cds
[17806] gi|3608409|gb|AF073799.1|AF073799[3608409]
[17807] 13009: D10202
[17808] Homo sapiens mRNA for platelet-activating factor receptor, complete cds
[17809] gi|219975|dbj|D10202.1|HUMPAFRE[219975]
[17810] 13010: AB017498
[17811] Homo sapiens LRP5 mRNA for Lipoprotein Receptor Related Protein 5, complete cds
[17812] gi|3582144|dbj|AB017498.1|AB017498[3582144]
[17813] 13011: AJ011041
[17814] Homo sapiens CHRM2 gene, satellite
[17815] gi|3581973|emb|AJ011041.1|HSA011041[3581973]
[17816] 13012: AH006427
[17817] Homo sapiens chromosome 12 map 12q13-14
[17818] gi|3561040|gb|AH006427.1|SEG_HOMOVDR[3561040]
[17819] 13013: AF080456
[17820] Homo sapiens vitamin D receptor gene, exon if
[17821] gi|3561039|gb|AF080456.1|HOMOVDR3[3561039]
[17822] 13014: AF080455
[17823] Homo sapiens vitamin D receptor gene, exon le
[17824] gi|3561038|gb|AF080455.1|HOMOVDR2[3561038]
[17825] 13015: AF080454
[17826] Homo sapiens vitamin D receptor gene, exon id
[17827] gi|3561037|gb|AF080454.1|HOMOVDR1[3561037]
[17828] 13025: AJ001689
[17829] Homo sapiens NKG2D gene, exon 10
[17830] gi|2980867|emb|AJ001689.1|HSAJ1689[2980867]
[17831] 13026: AJ001688
[17832] Homo sapiens NKG2D gene, exons 6-9
[17833] gi|2980866|emb|AJ001688.1|HSAJ1688[2980866]
[17834] 13027: AJ001687
[17835] Homo sapiens NKG2D gene, exons 2-5 and joined mRNA and CDS
[17836] gi|2980864|emb|AJ001687.1|HSAJ1687[2980864]
[17837] 13028: AJ001686
[17838] Homo sapiens NKG2F gene
[17839] gi|2980862|emb|AJ001686.1|HSAJ1686[2980862]
[17840] 13029: AJ001685
[17841] Homo sapiens NKG2E gene
[17842] gi|2980860|emb|AJ001685.1|HSAJ1685[2980860]
[17843] 13030: AJ001684
[17844] Homo sapiens NKG2C gene
[17845] gi|2980858|emb|AJ001684.1|HSAJ1684[2980858]
[17846] 13031: AJ001683
[17847] Homo sapiens NKG2F mRNA
[17848] gi|2980856|emb|AJ001683.1|HSAJ1683[2980856]
[17849] 13032: Y12546
[17850] H. sapiens mRNA for P2Y-like G-protein coupled receptor
[17851] gi|2687818|emb|Y12546.1|HSP2YLG[2687818]
[17852] 13033: AF015525
[17853] Homo sapiens putative chemokine receptor (CRAM-B) mRNA, complete cds
[17854] gi|3550069|gb|AF015525.1|AF015525[3550069]
[17855] 13034: AF015524
[17856] Homo sapiens putative chemokine receptor (CRAM-A) mRNA, complete cds
[17857] gi|3550066|gb|AF015524.1|AF015524[3550066]
[17858] 13035: AF068868
[17859] Homo sapiens TNFR-related death receptor-6 (DR6) mRNA, complete cds
[17860] gi|3549262|gb|AF068868.1|AF068868[3549262]
[17861] 13036: AF052572
[17862] Homo sapiens chemokine receptor CXCR4 gene, promoter region and complete cds
[17863] gi|3549254|gb|AF052572.1|AF052572[3549254]
[17864] 13037: AC005625
[17865] Homo sapiens chromosome 19, cosmid R27328, complete sequence
[17866] gi|3549153|gb|AC005625.1|AC005625[3549153]
[17867] 13038: AF051152
[17868] Homo sapiens Toll/interleukin-1 receptor-like protein 4 (TIL4) mRNA, complete cds
[17869] gi|3132527|gb|AF051152.1|AF051152[3132527]
[17870] 13039: AF051151
[17871] Homo sapiens Toll/interleukin-1 receptor-like protein 3 (TIL3) mRNA, complete cds
[17872] gi|3132525|gb|AF051151.1|AF051151[3132525]
[17873] 13040: AC005601
[17874] Homo sapiens chromosome 5, BAC clone 343g16 (LBNL H180), complete sequence
[17875] gi|3522917|gb|AC005601.1|AC005601[3522917]
[17876] 13042: U88540
[17877] Homo sapiens Toll-like receptor 1 (TLR1) mRNA, complete cds
[17878] gi|2459617|gb|U88540.1|HSU88540[2459617]
[17879] 13066: Z94155
[17880] H. sapiens mRNA for P2Y-like G-protein coupled receptor (partial)
[17881] gi|2695875|emb|Z94155.1|HSZ94155[2695875]
[17882] 13067: Z94154
[17883] H. sapiens mRNA for P2Y-like G-protein coupled receptor
[17884] gi|2695873|emb|Z94154.1|HSZ94154[2695873]
[17885] 13068: AF074264
[17886] Homo sapiens LDL receptor-related protein 6 (LRP6) mRNA, complete cds
[17887] gi|3462526|gb|AF074264.1|AF074264[3462526]
[17888] 13069: AF021233
[17889] Homo sapiens TRAIL-R4-B (TRAIL-R4) mRNA, complete cds
[17890] gi|3452184|gb|AF021233.1|AF021233[3452184]
[17891] 13070: AF021232
[17892] Homo sapiens TRAIL-R4-A (TRAIL-R4) mRNA, complete cds
[17893] gi|3452182|gb|AF021232.1|AF021232[3452182]
[17894] 13072: X98765
[17895] H. sapiens gene encoding secretory component of polymeric immunoglobulin receptor
[17896] gi|2546984|emb|X98765.1|HSSC[2546984]
[17897] 13103: U50062
[17898] Homo sapiens RIP protein kinase mRNA, complete cds
[17899] gi|3426026|gb|U50062.1|HSU50062[3426026]
[17900] 13104: AF078925
[17901] Homo sapiens P2X1 receptor gene, partial cds
[17902] gi|3421366|gb|AF078925.1|AF078925[3421366]
[17903] 13106: AF061785
[17904] Homo sapiens gamma-aminobutyric acid receptor A5 subunit (GABRA5) gene, three alternative first exons and exons 2-3, partial cds
[17905] gi|3420025|gb|AF061785.1|AF061785[3420025]
[17906] 13110: AB009462
[17907] Homo sapiens hLRp105 mRNA for LDL receptor related protein 105, complete cds
[17908] gi|3413957|dbj|AB009462.1|AB009462[3413957]
[17909] 13111: AF075590
[17910] Homo sapiens MCF-7 peripheral-type benzodiazepine receptor (PBR) mRNA, partial
[17911] cds
[17912] gi|3411164|gb|AF075590.1|AF075590[3411164]
[17913] 13112: AF075589
[17914] Homo sapiens MDA-MB-231 peripheral-type benzodiazepine receptor (PBR) mRNA, partial cds
[17915] gi|3411162|gb|AF075589.1|AF075589[3411162]
[17916] 13113: L39064
[17917] Homo sapiens interleukin 9 receptor precursor (IL9R) gene, complete cds
[17918] gi|632992|gb|L39064.1|HUMIL9RA[632992]
[17919] 13114: AJ224878
[17920] Homo sapiens mRNA for T-cell receptor interacting molecule (TRIM) protein
[17921] gi|3402215|emb|AJ224878.1|HSAJ4878[3402215]
[17922] 13115: AF080214
[17923] Homo sapiens protease-activated receptor 4 mRNA, complete cds
[17924] gi|3396080|gb|AF080214.1|AF080214[3396080]
[17925] 13116: AF075005
[17926] Homo sapiens full length insert cDNA YH98E06
[17927] gi|3377544|gb|AF075005.1|HUMYH98E06[3377544]
[17928] 13133: AF062006
[17929] Homo sapiens orphan G protein-coupled receptor HG38 mRNA, complete cds
[17930] gi|3366801|gb|AF062006.1|AF062006[3366801]
[17931] 13134: Y12815
[17932] H. sapiens mRNA for chemokine receptor D6
[17933] gi|2204204|emb|Y12815.1|HSY12815[2204204]
[17934] 13135: AC005338
[17935] Homo sapiens chromosome 19, cosmid R31646, complete sequence
[17936] gi|3355457|gb|AC005338.1|AC005338[3355457]
[17937] 13137: AF078530
[17938] Homo sapiens receptor interacting protein 2 (RIP2) mRNA, complete cds
[17939] gi|3342909|gb|AF078530.1|AF078530[3342909]
[17940] 13138: AF077526
[17941] Homo sapiens parathyroid hormone-related protein receptor gene, partial cds
[17942] gi|3342553|gb|AF077526.1|AF077526[3342553]
[17943] 13139: AH006311
[17944] Homo sapiens chromosome 11 gastrin\cholecystokinin brain receptor (CCKBR), partial cds
[17945] gi|3342089|gb|AH006311.1|SEG_HSCCKBR[3342089]
[17946] 13140: AF074029
[17947] Homo sapiens gastrincholecystokinin brain receptor (CCKBR) gene, exons 4 and and partial cds
[17948] gi|3342088|gb|AF074029.1|HSCCKBR2[3342088]
[17949] 13141: AF074035
[17950] Homo sapiens gastrincholecystokinin brain receptor (CCKBR) gene, exons 2 and 3
[17951] gi|3342087|gb|AF074035.1|HSCCKBR1[3342087]
[17952] 13142: U44132
[17953] Homo sapiens lung cancer suppressor region LCR11.1 satellite DNA
[17954] gi|1174163|gb|U44132.1|HSU44132[1174163]
[17955] 13143: Y14930
[17956] Homo sapiens TCRAV28 gene, allele A4, partial
[17957] gi|2664276|emb|Y14930.1|HSY14930[2664276]
[17958] 13144: Y14931
[17959] Homo sapiens TCRAV28 gene, allele A5, partial
[17960] gi|2661832|emb|Y14931.1|HSY14931[2661832]
[17961] 13145: Y14929
[17962] Homo sapiens TCRAV28 gene, allele A3, partial
[17963] gi|2661828|emb|Y14929.1|HSY14929[2661828]
[17964] 13146: AF074087
[17965] Homo sapiens killer cell inhibitory receptor short form (KIR2D52) mRNA, alternatively spliced, partial cds
[17966] gi|3328178|gb|AF074087.1|AF074087[3328178]
[17967] 13147: Y12507
[17968] H. sapiens mRNA for serotonin receptor 5-HT4D, splice variant
[17969] gi|3326990|emb|Y12507.1|HSY12507[3326990]
[17970] 13148: Y12506
[17971] H. sapiens mRNA for serotonin receptor 5-HT4C, splice variant
[17972] gi|3326988|emb|Y12506.1|HSY12506[3326988]
[17973] 13151: D85242
[17974] Homo sapiens mRNA for NOR-1 3′-variant, partial cds
[17975] gi|3168581|dbj|D85242.1D85242[3168581]
[17976] 13152: D85241
[17977] Homo sapiens mRNA for NOR-1beta, partial cds
[17978] gi|3168579|dbj|D85241.1|D85241[3168579]
[17979] 13153: AF034633
[17980] Homo sapiens orphan G protein-coupled receptor (GPR39) mRNA, complete cds
[17981] gi|2654160|gb|AF034633.1|AF034633[2654160]
[17982] 13154: AF034632
[17983] Homo sapiens orphan G protein-coupled receptor (GPR38) gene, complete cds
[17984] gi|2654158|gb|AF034632.1|AF034632[2654158]
[17985] 13155: AF054633
[17986] Homo sapiens thrombin receptor gene, exon 1 and partial cds
[17987] gi|3309036|gb|AF054633.1|AF054633[3309036]
[17988] 13156: AF073792
[17989] Homo sapiens CGRP-receptor component protein mRNA, complete cds
[17990] gi|3300101|gb|AF073792.1|AF073792[3300101]
[17991] 13157: AF007575
[17992] Homo sapiens ES/130-related protein mRNA, partial cds
[17993] 13158: AF055917
[17994] Homo sapiens protease-activated receptor 4 mRNA, complete cds
[17995] gi|329332|gb|AF055917.1|AF055917[3293321]
[17996] 13160: AC005255
[17997] Homo sapiens chromosome 19, CIT-HSP-146e8, complete sequence
[17998] gi|3289998|gb|AC005255.1|AC005255[3289998]
[17999] 13165: AB012724
[18000] Homo sapiens gene for endothelin-A receptor, cis_element region
[18001] gi|3273319|dbj|AB012724.1|AB012724[3273319]
[18002] 13166: AB015745
[18003] Homo sapiens mRNA for human prolactin-releasing peptide receptor, complete cds
[18004] gi|3273224|dbj|AB015745.1|AB015745[3273224]
[18005] 13167: AF020498
[18006] Homo sapiens P2X1 purinoceptor (P2X) mRNA, complete cds
[18007] gi|3258622|gb|AF020498.1|AF020498[3258622]
[18008] 13170: AF051767
[18009] Homo sapiens GDNF family receptor alpha 3 (GFRA3) mRNA, complete cds
[18010] gi|2961631|gb|AF051767.1|AF051767[2961631]
[18011] 13171: AH006188
[18012] Homo sapiens GABA-A receptor pi subunit (GABRP), partial cds
[18013] gi|3252851|gb|AH006188.1|SEG_HSGABRP[3252851]
[18014] 13172: AF009702
[18015] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 10 and complete cds
[18016] gi|3252850|gb|AF009702.1|HSGABRP10[3252850]
[18017] 13173: AF009701
[18018] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 9
[18019] gi|3252849|gb|AF009701.1|HSGABRP09[3252849]
[18020] 13174: AF009700
[18021] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 8
[18022] gi|3252848|gb|AF009700.1|HSGABRP08[3252848]
[18023] 13175: AF009699
[18024] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 7
[18025] gi|3252847|gb|AF009699.1|HSGABRP07[3252847]
[18026] 13176: AF009698
[18027] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 6
[18028] gi|3252846|gb|AF009698.1|HSGABRP06[3252846]
[18029] 13177: AF009697
[18030] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 5
[18031] gi|3252845|gb|AF009697.1|HSGABRP05[3252845]
[18032] 13178: AF009696
[18033] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 4
[18034] gi|3252844|gb|AF009696.1|HSGABRP04[3252844]
[18035] 13179: AF009695
[18036] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 3
[18037] gi|3252843|gb|AF009695.1|HSGABRP03[3252843]
[18038] 13180: AF009694
[18039] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 2
[18040] gi|3252842|gb|AF009694.1|HSGABRP02[3252842]
[18041] 13181: AF009693
[18042] Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 1
[18043] gi|3252841|gb|AF009693.1|HSGABRP01[3252841]
[18044] 13182: E13909
[18045] cDNA encoding human MCP-1 receptor protein
[18046] gi|3252676|dbj|E13909.1|E13909[3252676]
[18047] 13183: E13892
[18048] cDNA encoding human novel G protein-coupling receptor protein
[18049] gi|3252659|dbj|E13892.1|E13892[3252659]
[18050] 13184: E13385
[18051] cDNA encoding human MIP-1 alpha/RANTES receptor
[18052] gi|13252190|dbj|E13385.1|E13385[3252190]
[18053] 13185: E13006
[18054] cDNA encoding human G-protein coupling receptor protein
[18055] gi|3251830|dbj|E13006.1|E13006[3251830]
[18056] 13186: E13005
[18057] cDNA encoding human G-protein-coupling receptor protein
[18058] gi|3251829|dbj|E13005.1|E13005[3251829]
[18059] 13187: E12979
[18060] cDNA encoding human interleukin-6 receptor
[18061] gi|3251803|dbj|E12979.1|E12979[3251803]
[18062] 13188: E12916
[18063] Human cDNA encoding a denatured low-density lipoprotein receptor
[18064] gi|3251747|dbj|E12916.1|E12916[3251747]
[18065] 13189: E12845
[18066] cDNA encoding melatonin receptor
[18067] gi|3251677|dbj|E12845.1|E12845[3251677]
[18068] 13190: E12752
[18069] A novel human Corticotropin Releasing Factor 2 (CRF2) receptor mRNA, complete cds
[18070] gi|3251584|dbj|E12752.1|E12752[3251584]
[18071] 13191: E12750
[18072] A novel human Corticotropin Releasing Factor 2 (CRF2) receptor mRNA, complete cds
[18073] gi|3251582|dbj|E12750.1|E12750[3251582]
[18074] 13192: E12703
[18075] cDNA encoding asialoglycoprotein receptor L-H2, AGPR L-H2
[18076] gi|3251535|dbj|E12703.1|E12703[3251535]
[18077] 13193: E12702
[18078] cDNA encoding asialoglycoprotein receptor H1, AGPR H1
[18079] gi|3251534|dbj|E12702.1|E12702[3251534]
[18080] 13197: E12658
[18081] cDNA encoding galanin receptor
[18082] gi|3251490|dbj|E12658.1|E12658[3251490]
[18083] 13198: E12487
[18084] Human cDNA encoding a G protein-coupled receptor
[18085] gi|3251320|dbj|E12487.1|E12487[3251320]
[18086] 13199: E12484
[18087] Human cDNA encoding a G protein-coupled receptor
[18088] gi|3251317|dbj|E12484.1|E12484[3251317]
[18089] 13200: E12354
[18090] cDNA encoding receptor of luteinizing hormone-releasing hormone, LH-RH receptor
[18091] gi|3251188|dbj|E12354.1|E12354[3251188]
[18092] 13201: E12281
[18093] cDNA encoding human growth hormone-releasing hormone receptor
[18094] gi|3251115|dbj|E12281.1|E12281[3251115]
[18095] 13202: E12186
[18096] A novel ligand for receptor type tyrosine kinase
[18097] gi|3251020|dbj|E12186.1|E12186[3251020]
[18098] 13203: E12185
[18099] cDNA encoding a receptor type tyrosine kinase
[18100] gi|3251019|dbj|E12185.1|E12185[3251019]
[18101] 13204: AF009962
[18102] Homo sapiens CC-chemokine receptor (CCR-5) gene, delta-32 allele, complete cds
[18103] gi|3243092|gb|AF009962.1|AF009962[3243092]
[18104] 13205: AF050525
[18105] Homo sapiens proteinase activated receptor-3 (PAR-3) gene, 5′ regulatory sequence
[18106] gi|3241996|gb|AF050525.1|AF050525[3241996]
[18107] 13206: U33328
[18108] Homo sapiens killer cell Ig-like receptor variant (KIR3DL1) mRNA, complete cds
[18109] gi|995756|gb|U33328.1|HSU33328[995756]
[18110] 13207: U31416
[18111] Homo sapiens killer cell Ig-like receptor (KIR3DL1) mRNA, complete cds
[18112] gi|973405|gb|U31416.1|HSU31416[973405]
[18113] 13208: U50748
[18114] Homo sapiens leptin receptor short form (db) mRNA, complete cds
[18115] gi|3236285|gb|U50748.1|HSU50748[3236285]
[18116] 13215: Y14838
[18117] Homo sapiens ChemR23 gene
[18118] gi|3219597|emb|Y14838.1|HSCHEMR23[3219597]
[18119] 13216: Y12505
[18120] H. sapiens mRNA for serotonin receptor 5-HT4B, splice variant
[18121] gi|2661756|emb|Y12505.1|HSY12505[2661756]
[18122] 13217: Y08756
[18123] H. sapiens mRNA for serotonin receptor 5-HT4
[18124] gi|2661732|emb|Y08756.1|HS5HT4AR[2661732]
[18125] 13218: X85785
[18126] H. sapiens DARC gene
[18127] gi|929624|emb|X85785.1|HSDARC[929624]
[18128] 13219: AH006173
[18129] Homo sapiens Type II integral membrane protein (NKG2-F), complete cds
[18130] gi|2674028|gb|AH006173.1|SEG_HSNKG2F0[2674028]
[18131] 13220: AF001298
[18132] Homo sapiens type II integral membrane protein (NKG2-D) gene, exons 9-13
[18133] gi|2674027|gb|AF001298.1|HSNKG2F02[2674027]
[18134] 13221: AF001297
[18135] Homo sapiens type II integral membrane protein (NKG2-D) gene, exons 5-8
[18136] gi|2674026|gb|AF001297.1|HSNKG2F01[2674026]
[18137] 13222: AF048704
[18138] Homo sapiens lamin B receptor homolog TM7SF2 gene, complete cds
[18139] gi|3211743|gb|AF048704.1|AF048704[3211743]
[18140] 13223: AF023676
[18141] Homo sapiens lamin B receptor homolog TM7SF2 (TM7SF2) mRNA, complete cds
[18142] gi|3211721|gb|AF023676.1|AF023676[3211721]
[18143] 13224: AJ001016
[18144] Homo sapiens mRNA encoding RAMP3
[18145] gi|3171913|emb|AJ001016.1|HSRAMP3[3171913]
[18146] 13236: Y13584
[18147] Homo sapiens mRNA for serotin receptor 4, short splice variant
[18148] gi|3183985|emb|Y13584.1|HSY13584[3183985]
[18149] 13237: AF030339
[18150] Homo sapiens receptor for viral semaphorin protein (VESPR) mRNA, complete cds
[18151] gi|3176761|gb|AF030339.1|AF030339[3176761]
[18152] 13239: AC004782
[18153] Homo sapiens chromosome 5, BAC clone 205e20 (LBNL H170), complete sequence
[18154] gi|3172145|gb|AC004782.1|AC004782[3172145]
[18155] 13240: AF009662
[18156] Homo sapiens T cell receptor beta locus, TCRBV13S1 to TCRBV6S9 region
[18157] gi|2275573|gb|AF009662.1|HSTCRBB27[2275573]
[18158] 13241: AJ001015
[18159] Homo sapiens mRNA encoding RAMP2
[18160] gi|3171911|emb|AJ001015.1|HSRAMP2[3171911]
[18161] 13242: AJ001014
[18162] Homo sapiens mRNA encoding RAMP1
[18163] gi|3171909|emb|AJ001014.1|HSRAMP1[3171909]
[18164] 13243: AF011333
[18165] Homo sapiens DEC-205 mRNA, complete cds
[18166] gi|3165456|gb|AF011333.1|AF011333[3165456]
[18167] 13244: AJ001902
[18168] Homo sapiens mRNA for TRIP6 (thyroid receptor interacting protein)
[18169] gi|2558591|emb|AJ001902.1|HSTRIP6[2558591]
[18170] 13245: AF002216
[18171] AF002216 AP20 melanoma mRNA Homo sapiens cDNA, mRNA sequence
[18172] gi|2895065|gb|AF002216.1|AF002216[2895065]
[18173] 13246: AF002215
[18174] AF002215 AP20 melanoma mRNA Homo sapiens cDNA, mRNA sequence
[18175] gi|2895064|gb|AF002215.1|AF002215[2895064]
[18176] 13247: AF002214
[18177] AF002214 AP20 melanoma mRNA Homo sapiens cDNA, mRNA sequence
[18178] gi|2895063|gb|AF002214.1|AF002214[2895063]
[18179] 13248: AC002411
[18180] Arabidopsis thaliana chromosome 1 BAC F20D22 sequence, complete sequence
[18181] gi|2570223|gb|AC002411.1|F20D22[2570223]
[18182] 13249: AF058927
[18183] Homo sapiens clone hvRNA92 vRNA sequence
[18184] gi|3138979|gb|AF058927.1|AF058927[3138979]
[18185] 13250: AF058926
[18186] Homo sapiens clone hvRNA82 vRNA sequence
[18187] gi|3138978|gb|AF058926.1|AF058926[3138978]
[18188] 13252: AC004699
[18189] Homo sapiens chromosome 19, cosmid R31973, complete sequence
[18190] gi|3138892|gb|AC004699.1|AC004699[3138892]
[18191] 13253: Y13472
[18192] Homo sapiens mRNA for FIM protein
[18193] gi|3135791|emb|Y13472.1|HSRIMP[3135791]
[18194] 13254: AF015452
[18195] Homo sapiens Usurpin-gamma mRNA, complete cds
[18196] gi|3133284|gb|AF015452.1|AF015452[3133284]
[18197] 13255: AF015451
[18198] Homo sapiens Usurpin-beta mRNA, complete cds
[18199] gi|3133282|gb|AF015451.1|AF015451[3133282]
[18200] 13256: AF015450
[18201] Homo sapiens Usurpin-alpha mRNA, complete cds
[18202] gi|3133280|gb|AF015450.1|AF015450[3133280]
[18203] 13257: AF063658
[18204] Homo sapiens vascular endothelial growth factor receptor 2 (KDR) mRNA, complete
[18205] cds
[18206] gi|3132832|gb|AF063658.1|AF063658[3132832]
[18207] 13258: AJ224869
[18208] Homo sapiens CXCR4 gene encoding receptor CXCR4
[18209] gi|3059119|emb|AJ224869.1|HSA224869[3059119]
[18210] 13259: AH006106
[18211] Homo sapiens apoptosis signaling receptor FAS (FAS) and apoptosis signaling receptor FAS (FAS)s, partial cds
[18212] gi|3128402|gb|AH006106.1|SEG_HSASRFAS[3128402]
[18213] 13260: AF061979
[18214] Homo sapiens apoptosis signaling receptor FAS (FAS) gene, exon 7 and partial cds
[18215] gi|3128401|gb|AF061979.1|HSASRFAS2[3128401]
[18216] 13261: AF061978
[18217] Homo sapiens apoptosis signaling receptor FAS (FAS) gene, exons 6 and 7 and partial cds
[18218] gi|3128400|gb|AF061978.1|HSASRFAS1[3128400]
[18219] 13262: AH006105
[18220] Homo sapiens sulfonylurea receptor type (SUR2) gene, alternative splice products, complete cds
[18221] gi|3127174|gb|AH006105.1|SEG_HSSUR2G[3127174]
[18222] 13263: AF061324
[18223] Homo sapiens sulfonylurea receptor 2B (SUR2) gene, alternatively spliced product, exon 38b and complete cds
[18224] gi|3127173|gb|AF061324.1|HSSUR2G71[3127173]
[18225] 13264: AF061323
[18226] Homo sapiens sulfonylurea receptor 2A (SUR2) gene, alternatively spliced product, exon 38a and complete cds
[18227] gi|3127172|gb|AF061323.1|HSSUR2G69[3127172]
[18228] 13265: AF061322
[18229] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 37
[18230] gi|3127171|gb|AF061322.1|HSSUR2G67[3127171]
[18231] 13266: AF061321
[18232] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 36
[18233] gi|3127170|gb|AF061321.1HSSUR2G65[3127170]
[18234] 13267: AF061320
[18235] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 35
[18236] gi|3127169|gb|AF061320.1|HSSUR2G63[3127169]
[18237] 13268: AF061319
[18238] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 34
[18239] gi|3127168|gb|AF061319.1|HSSUR2G61[3127168]
[18240] 13269: AF061318
[18241] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 33
[18242] gi|3127167|gb|AF061318.1|HSSUR2G59[3127167]
[18243] 13270: AF061317
[18244] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 32
[18245] gi|3127166|gb|AF061317.1|HSSUR2G57[3127166]
[18246] 13271: AF061316
[18247] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 31
[18248] gi|3127165|gb|AF061316.1|HSSUR2G55[3127165]
[18249] 13272: AF061315
[18250] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 30
[18251] gi|3127164|gb|AF061315.1|HSSUR2G53[3127164]
[18252] 13273: AF061314
[18253] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 29
[18254] gi|3127163|gb|AF061314.1|HSSUR2G51[3127163]
[18255] 13274: AF061313
[18256] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 28
[18257] gi|3127162|gb|AF061313.1|HSSUR2G49[3127162]
[18258] 13275: AF061312
[18259] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 27
[18260] gi|3127161|gb|AF061312.1|HSSUR2G47[3127161]
[18261] 13276: AF061311
[18262] Homo sapiens sulfonylurea receptor (SUR2) gene, exons 25 and 26
[18263] gi|3127160|gb|AF061311.1|HSSUR2G45[3127160]
[18264] 13277: AF061310
[18265] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 24
[18266] gi|3127159|gb|AF061310.1|HSSUR2G43[3127159]
[18267] 13278: AF061309
[18268] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 23
[18269] gi|3127158|gb|AF061309.1|HSSUR2G41[3127158]
[18270] 13279: AF061308
[18271] Homo sapiens sulfonylurea receptor (SUR2) gene, exons 21 and 22
[18272] gi|3127157|gb|AF061308.1|HSSUR2G39[3127157]
[18273] 13280: AF061307
[18274] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 20
[18275] gi|3127156|gb|AF061307.1|HSSUR2G37[3127156]
[18276] 13281: AF061306
[18277] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 19
[18278] gi|3127155|gb|AF061306.1|HSSUR2G35[3127155]
[18279] 13282: AF061305
[18280] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 18
[18281] gi|3127154|gb|AF061305.1|HSSUR2G33[3127154]
[18282] 13283: AF061304
[18283] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 17
[18284] gi|3127153|gb|AF061304.1|HSSUR2G31[3127153]
[18285] 13284: AF061303
[18286] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 16
[18287] gi|3127152|gb|AF061303.1|HSSUR2G29[3127152]
[18288] 13285: AF061302
[18289] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 15
[18290] gi|3127151|gb|AF061302.1|HSSUR2G27[3127151]
[18291] 13286: AF061301
[18292] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 14
[18293] gi|3127150|gb|AF061301.1|HSSUR2G25[3127150]
[18294] 13287: AF061300
[18295] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 13
[18296] gi|3127149|gb|AF061300.1|HSSUR2G23[3127149]
[18297] 13288: AF061299
[18298] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 12
[18299] gi|3127148|gb|AF061299.1|HSSUR2G21[3127148]
[18300] 13289: AF061298
[18301] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 11
[18302] gi|3127147|gb|AF061298.1|HSSUR2G19[3127147]
[18303] 13290: AF061297
[18304] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 10
[18305] gi|3127146|gb|AF061297.1|HSSUR2G17[3127146]
[18306] 13291: AF061296
[18307] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 9
[18308] gi|3127145|gb|AF061296.1|HSSUR2G15[3127145]
[18309] 13292: AF061295
[18310] Homo sapiens sulfonylurea receptor (SUR2) gene, exons 7 and 8
[18311] gi|3127144|gb|AF061295.1|HSSUR2G13[3127144]
[18312] 13293: AF061294
[18313] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 6
[18314] gi|3127143|gb|AF061294.1|HSSUR2G11[3127143]
[18315] 13294: AF061293
[18316] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 5
[18317] gi|3127142|gb|AF061293.1|HSSUR2G09[3127142]
[18318] 13295: AF061292
[18319] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 4
[18320] gi|3127141|gb|AF061292.1|HSSUR2G07[3127141]
[18321] 13296: AF061291
[18322] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 3
[18323] gi|3127140|gb|AF061291.1|HSSUR2G05[3127140]
[18324] 13297: AF061290
[18325] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 2
[18326] gi|3127139|gb|AF061290.1|HSSUR2G03[3127139]
[18327] 13298: AF061289
[18328] Homo sapiens sulfonylurea receptor (SUR2) gene, exon 1
[18329] gi|3127138|gb|AF061289.1|HSSUR2G01[3127138]
[18330] 13299: U77783
[18331] Homo sapiens N-methyl-D-aspartate receptor 2D subunit precursor (NMDAR2D) mRNA,
[18332] complete cds
[18333] gi|2444025|gb|U77783.1|HSU77783[2444025]
[18334] 13300: AJ001515
[18335] Homo sapiens mRNA for ryanodine receptor 3, complete CDS
[18336] gi|3123583|emb|AJ001515.1|HSRYR3[3123583]
[18337] 13302: AJ002512
[18338] Homo sapiens mRNA for ryanodine receptor 3, partial
[18339] gi|2582750|emb|AJ002512.1|HSAJ2512[2582750]
[18340] 13303: AJ002511
[18341] Homo sapiens mRNA for ryanodine receptor 2, partial
[18342] gi|2582748|emb|AJ002511.1HSAJ2511[2582748]
[18343] 13315: Z81148
[18344] H. sapiens mRNA for gonadotropin-releasing hormone receptor, splice variant
[18345] gi|1628389|emb|Z81148.1|HSGTRHSV[1628389]
[18346] 13316: U71092
[18347] Homo sapiens somatostatin receptor-like protein (GPR24) gene, complete cds
[18348] gi|1737178|gb|U71092.1|HSU71092[1737178]
[18349] 13317: AH006056
[18350] Homo sapiens chromosome 10 clone BAC 73106 map 10q25-q26
[18351] gi|3068782|gb|AH006056.1|SEG_HSGFRA1H[3068782]
[18352] 13318: AF058999
[18353] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18354] gene, exon 11 and complete cds
[18355] gi|3068781|gb|AF058999.1|HSGFRA1H10[3068781]
[18356] 13319: AF058998
[18357] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18358] gene, exon 10
[18359] gi|3068780|gb|AF058998.1|HSGFRA1H09[3068780]
[18360] 13320: AF058997
[18361] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18362] gene, exon 9
[18363] gi|3068779|gb|AF058997.1|HSGFRA1H08[3068779]
[18364] 13321: AF058996
[18365] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18366] gene, exon 8
[18367] gi|3068778|gb|AF058996.1|HSGFRA1H07[3068778]
[18368] 13322: AF058995
[18369] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18370] gene, exon 7
[18371] gi|3068777|gb|AF058995.1|HSGFRA1H06[3068777]
[18372] 13323: AF058994
[18373] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18374] gene, exon 6
[18375] gi|3068776|gb|AF058994.1|HSGFRA1H05[3068776]
[18376] 13324: AF058993
[18377] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18378] gene, exon 5
[18379] gi|3068775|gb|AF058993.1|HSGFRA1H04[3068775]
[18380] 13325: AF058992
[18381] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18382] gene, exon 4
[18383] gi|3068774|gb|AF058992.1|HSGFRA1H03[3068774]
[18384] 13326: AF058991
[18385] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18386] gene, exon 3
[18387] gi|3068773|gb|AF058991.1|HSGFRA1H02[3068773]
[18388] 13327: AF058990
[18389] Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1)
[18390] gene, exon 2
[18391] gi|3068772|gb|AF058990.1|HSGFRA1H01[3068772]
[18392] 13328: AF044197
[18393] Homo sapiens B lymphocyte chemoattractant BLC mRNA, complete cds
[18394] gi|2911375|gb|AF044197.1|AF044197[2911375]
[18395] 13329: Y16280
[18396] Homo sapiens mRNA for G protein-coupled receptor ETBR-LP-2
[18397] gi|3059117|emb|Y16280.1|HSETBRLP2[3059117]
[18398] 13330: U16260
[18399] Neisseria gonorrheae lactoferrin receptor precursor (lbpA) gene, complete cds
[18400] gi|915277|gb|U16260.1|NGU16260[915277]
[18401] 13331: AF057177
[18402] Homo sapiens T-cell receptor gamma V1 gene region
[18403] gi|3047019|gb|AF057177.1|AF057177[3047019]
[18404] 13333: AF057168
[18405] Homo sapiens type II interleukin-1 receptor antagonist (IL-1ra3) gene, partial
[18406] cds
[18407] gi|3046605|gb|AF057168.1|AF057168[3046605]
[18408] 13334: L06155
[18409] Homo sapiens melanocortin receptor gene, complete cds
[18410] gi|188673|gb|L06155.1|HUMMR[188673]
[18411] 13335: L27490
[18412] Homo sapiens prostanoid EP3-I receptor mRNA, complete cds
[18413] gi|440313|gb|L27490.1|HUMPEIRB[440313]
[18414] 13336: L27489
[18415] Homo sapiens prostanoid EP3-III receptor mRNA, complete cds
[18416] gi|44031|gb|L27489.1|HUMPEIRA[440311]
[18417] 13337: L27488
[18418] Homo sapiens prostanoid EP3-II receptor mRNA, complete cds
[18419] gi|440309|gb|L27488.1|HUMPEIR[440309]
[18420] 13338: AF009664
[18421] Homo sapiens T cell receptor beta locus, 3′ trypsinogen repeats
[18422] gi|2275594|gb|AF009664.1|HSTCRB1H[2275594]
[18423] 13339: AF009660
[18424] Homo sapiens T cell receptor beta locus, TCRBV7S3A2 to TCRBV12S2 region
[18425] gi|2275560|gb|AF009660.1|HSTCRBK17[2275560]
[18426] 13340: AB006537
[18427] Homo sapiens mRNA for interleukin 1 receptor accessory protein, complete cds
[18428] gi|3041772|dbj|AB006537.1|AB006537[3041772]
[18429] 13341: AF016098
[18430] Homo sapiens vascular endothelial cell growth factor 165 receptor 2 (VEGF165R2)
[18431] mRNA, complete cds
[18432] gi|2978561|gb|AF016098.1|AF016098[2978561]
[18433] 13342: AF016050
[18434] Homo sapiens vascular endothelial cell growth factor 165 receptor/neuropilin (VEGF165) mRNA, complete cds
[18435] gi|2978559|gb|AF016050.1|AF016050[2978559]
[18436] 13343: U90941
[18437] Homo sapiens cell-type natural killer cells Fc gamma receptor RIIc4 (Fc-gammaRIIC) mRNA, complete cds
[18438] gi|214963|gb|U90941.1|HSU90941[2149631]
[18439] 13344: U90940
[18440] Homo sapiens cell-type natural killer cells Fc gamma receptor IIc3 (Fc-gammaRIIC) mRNA, complete cds
[18441] gi|2149629|gb|U90940.1|HSU90940[2149629]
[18442] 13345: U90939
[18443] Homo sapiens cell-type natural killer cells Fc gamma receptor IIc2 (Fc-gammaRIIC) mRNA, complete cds
[18444] gi|2149627|gb|U90939.1|HSU90939[2149627]
[18445] 13346: U90938
[18446] Homo sapiens cell-type natural killer cells Fc gamma receptor IIc1 (Fc-gammaRIIC) mRNA, complete cds
[18447] gi|2149625|gb|U90938.1|HSU90938[2149625]
[18448] 13348: Y14739
[18449] Homo sapiens CXCR4 gene
[18450] gi|3021393|emb|Y14739.1|HSCXCR4[3021393]
[18451] 13349: Y07683
[18452] H. sapiens mRNA for P2X3 purinoceptor
[18453] gi|2370146|emb|Y07683.1|HSP2X3PC[2370146]
[18454] 13350: AF027390
[18455] Homo sapiens 7q telomere, complete sequence
[18456] gi|3004858|gb|AF027390.1|AF027390[3004858]
[18457] 13351: U04357
[18458] Homo sapiens arginine vasopressin receptor type 11, V2 antidiuretic hormone receptor (AVPR2) gene, complete cds
[18459] gi|3004498|gb|U04357.1|HSU04357[3004498]
[18460] 13352: AH006005
[18461] Homo sapiens TGF-beta type I receptor (TGFBR1), complete cds
[18462] gi|3003037|gb|AH006005.1|SEG_HSTGFBR1G[3003037]
[18463] 13353: AF054598
[18464] Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 9 and complete cds
[18465] gi|3003036|gb|AF054598.1|HSTGFBR1G9[3003036]
[18466] 13354: AF054597
[18467] Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 8
[18468] gi|3003035|gb|AF054597.1|HSTGFBR1G8[3003035]
[18469] 13355: AF054596
[18470] Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 7
[18471] gi|3003034|gb|AF054596.1|HSTGFBR1G7[3003034]
[18472] 13356: AF054595
[18473] Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 6
[18474] gi|3003033|gb|AF054595.1|HSTGFBR1G6[3003033]
[18475] 13357: AF054594
[18476] Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 5
[18477] gi|3003032|gb|AF054594.1|HSTGFBR1G5[3003032]
[18478] 13358: AF054593
[18479] Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 4
[18480] gi|3003031|gb|AF054593.1|HSTGFBR1G4[3003031]
[18481] 13359: AF054592
[18482] Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 3
[18483] gi|3003030|gb|AF054592.1|HSTGFBR1G3[3003030]
[18484] 13360: AF054591
[18485] Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 2
[18486] gi|3003029|gb|AF054591.1|HSTGFBR1G2[3003029]
[18487] 13361: AF054590
[18488] Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 1
[18489] gi|3003028|gb|AF054590.1|HSTGFBR1G1[3003028]
[18490] 13362: L12406
[18491] Homo sapiens chemoattractant receptor (fMLP) gene sequence
[18492] gi|348164|gb|L12406.1|HUMCR[348164]
[18493] 13363: AC004510
[18494] Homo sapiens chromosome 19, cosmid R30385, complete sequence
[18495] gi|12996651|gb|AC004510.1|AC004510[29969551]
[18496] 13364: U84721
[18497] Homo sapiens interferon gamma receptor 1 gene, microsatellite sequence
[18498] gi|2982188|gb|U84721.1|HSU84721[2982188]
[18499] 13365: AF013261
[18500] Homo sapiens alpha 1A adrenergic receptor isoform 4 mRNA, complete cds
[18501] gi|2978555|gb|AF013261.1|AF013261[2978555]
[18502] 13369: AF014794
[18503] Homo sapiens TNF related TRAIL receptor (TRAIL-R3) mRNA, complete cds
[18504] gi|2957263|gb|AF014794.1|AF014794[2957263]
[18505] 13372: AC003658
[18506] Homo sapiens Xp22 BAC GS-607H18 (Genome Systems Human BAC library) complete sequence
[18507] gi|2935592|gb|AC003658.1|AC003658[2935592]
[18508] 13375: AH005897
[18509] Homo sapiens type I sigma receptor, complete cds
[18510] gi|2914739|gb|AH005897.1|SEG_HSTIRG[2914739]
[18511] 13376: AF001977
[18512] Homo sapiens type I sigma receptor gene, exon 4 and complete cds
[18513] gi|2914738|gb|AF001977.1|HSTIRG3[2914738]
[18514] 13377: AF001976
[18515] Homo sapiens type I sigma receptor gene, exons 1, 2 and 3
[18516] gi|2914737|gb|AF001976.1|HSTIRG2[2914737]
[18517] 13486: U78192
[18518] Homo sapiens Edg-2 receptor mRNA, complete cds
[18519] gi|1688304|gb|U78192.1|HSU78192[1688304]
[18520] 13488: AF044492
[18521] Homo sapiens olfactory receptor-like protein (OLFR42A) gene, allele 9092.1, partial cds
[18522] gi|2828698|gb|AF044492.1|AF044492[2828698]
[18523] 13489: AF044491
[18524] Homo sapiens olfactory receptor-like protein (OLFR42A) gene, allele 9004.14, partial cds
[18525] gi|2828696|gb|AF044491.1|AF044491[2828696]
[18526] 13490: AF042078
[18527] Homo sapiens olfactory receptor-like protein (OLFR42A) gene, OLFR42A-9026.2 allele, partial cds
[18528] gi|282868|gb|AF042078.1|AF042078[2828681]
[18529] 13491: AB010710
[18530] Homo sapiens mRNA for lectin-like oxidized LDL receptor, complete cds
[18531] gi|2828355|dbj|AB010710.1|AB010710[2828355]
[18532] 13492: AF041462
[18533] Homo sapiens I-FLICE isoform 5 mRNA, complete cds
[18534] gi|2827297|gb|AF041462.1|AF041462[2827297]
[18535] 13493: AF041461
[18536] Homo sapiens I-FLICE isoform 4 mRNA, complete cds
[18537] gi|2827295|gb|AF041461.1|AF041461[2827295]
[18538] 13494: AF041460
[18539] Homo sapiens I-FLICE isoform 3 mRNA, complete cds
[18540] gi|2827293|gb|AF041460.1|AF041460[2827293]
[18541] 13495: AF041459
[18542] Homo sapiens I-FLICE isoform 2 mRNA, complete cds
[18543] gi|2827291|gb|AF041459.1|AF041459[2827291]
[18544] 13496: AF041458
[18545] Homo sapiens I-FLICE mRNA, complete cds
[18546] gi|2827289|gb|AF041458.1|AF041458[2827289]
[18547] 13497: Z73157
[18548] H. sapiens mRNA for C3a anaphylatoxin receptor
[18549] gi|2826756|emb|Z73157.1|HSC3AAREC[2826756]
[18550] 13498: U58917
[18551] Homo sapiens IL-17 receptor mRNA, complete cds
[18552] gi|2826475|gb|U58917.1|HSU58917[2826475]
[18553] 13524: Y16282
[18554] Homo sapiens mRNA for nicotinic acetylcholine receptor alpha6 subunit precursor
[18555] gi|2815224|emb|Y16282.1|HSY16282[2815224]
[18556] 13525: Y16281
[18557] Homo sapiens mRNA for nicotinic acetylcholine receptor alpha2 subunit precursor
[18558] gi|2815222|emb|Y16281.1|HSY16281[2815222]
[18559] 13526: X98858
[18560] H. sapiens mRNA for HLA-C specific activatory NK receptor
[18561] gi|1419593|emb|X98858.1|HSNKREC[1419593]
[18562] 13527: M76676
[18563] Homo sapiens leukocyte platelet-activating factor receptor mRNA, complete cds
[18564] gi|2810988|gb|M76676.1|HUMNPIIY20[2810988]
[18565] 13528: Y08420
[18566] H. sapiens mRNA for nicotinic acetylcholine receptor alpha7 subunit precursor
[18567] gi|2808623|emb|Y08420.1|HSNACHRA7[2808623]
[18568] 13529: Y08419
[18569] H. sapiens mRNA for nicotinic acetylcholine receptor alpha5 subunit precursor
[18570] gi|1702913|emb|Y08419.1|HSNACHRA5[1702913]
[18571] 13530: Y08421
[18572] H. sapiens mRNA for nicotinic acetylcholine receptor alpha4 subunit precursor
[18573] gi|1702911|emb|Y08421.1|HSNACHRA4[1702911]
[18574] 13531: Y08417
[18575] H. sapiens mRNA for nicotinic acetylcholine receptor beta3 subunit precursor
[18576] gi|1702909|emb|Y08417.1|HSNACHR3B[1702909]
[18577] 13532: Y08416
[18578] H. sapiens mRNA for nicotinic acetylcholine receptor beta4 subunit precursor
[18579] gi|1702919|emb|Y08416.1|HSNACHRB4[1702919]
[18580] 13533: Y08415
[18581] H. sapiens mRNA for nicotinic acetylcholine receptor beta2 subunit precursor
[18582] gi|1702917|emb|Y08415.1|HSNACHRB2[1702917]
[18583] 13534: Y08418
[18584] H. sapiens mRNA for nicotinic acetylcholine receptor alpha3 subunit precursor
[18585] gi|1702907|emb|Y08418.1|HSNACHR3A[1702907]
[18586] 13536: AF042077
[18587] Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9079.6 allele, partial cds
[18588] gi|2801710|gb|AF042077.1|AF042077[2801710]
[18589] 13537: AF042076
[18590] Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9108.1 allele, partial cds
[18591] gi|2801708|gb|AF042076.1|AF042076[2801708]
[18592] 13538: AF042075
[18593] Homo sapiens olfactory receptor-like protein (OLFR 428) gene, OLFR 42B-9110 allele, partial cds
[18594] gi|2801706|gb|AF042075.1|AF042075[2801706]
[18595] 13539: AF042074
[18596] Homo sapiens olfactory receptor-like protein (OLFR 42A) gene, OLFR 42A-9079.3 allele, partial cds
[18597] gi|2801704|gb|AF042074.1|AF042074[2801704]
[18598] 13540: AF042073
[18599] Homo sapiens olfactory receptor-like protein (OLFR 42A) gene, OLFR 42A-9049 allele, partial cds
[18600] gi|2801702|gb|AF042073.1|AF042073[2801702]
[18601] 13600: Y10530
[18602] H. sapiens gene encoding putative olfactory receptor (clone htpcr2)
[18603] gi|2792017|emb|Y10530.1|HSHTPCR2[2792017]
[18604] 13601: Y10529
[18605] H. sapiens mRNA for putative olfactory receptor (clone ht2)
[18606] gi|2792015|emb|Y10529.1|HSHT2[2792015]
[18607] 13614: Z26876
[18608] H. sapiens gene for ribosomal protein L38
[18609] gi|407422|emb|Z26876.1|HSRPL38[407422]
[18610] 13615: Z50150
[18611] H. sapiens mRNA for tyrosine kinase activator protein 1 (TKA-1)
[18612] gi|1246762|emb|Z50150.1|HSTKA1MR[1246762]
[18613] 13616: Y13055
[18614] Homo sapiens mRNA for NKG2-CII activating NK receptor
[18615] gi|2765292|emb|Y13055.1|HSNKG2CII[2765292]
[18616] 13617: Y13054
[18617] Homo sapiens mRNA for NK receptor, clone GR #29
[18618] gi|2765290|emb|Y13054.1|HSNKREC29[2765290]
[18619] 13618: Y10437
[18620] H. sapiens mRNA for serotonin receptor 4
[18621] gi|2765076|emb|Y10437.1|HSSERR4[2765076]
[18622] 13619: AJ002105
[18623] Homo sapiens mRNA for NK receptor, clone library TG14#13
[18624] gi|2764706|emb|AJ002105.1|HSAJ2105[2764706]
[18625] 13620: AJ002104
[18626] Homo sapiens mRNA for NK receptor, clone library TG14#6
[18627] gi|2764704|emb|AJ002104.1|HSAJ2104[2764704]
[18628] 13621: AJ002103
[18629] Homo sapiens mRNA for NK receptor, clone library TG14#35
[18630] gi|2764702|emb|AJ002103.1|HSAJ2103[2764702]
[18631] 13622: AJ002102
[18632] Homo sapiens mRNA for NK receptor, clone library TG14#8
[18633] gi|2764700|emb|AJ002102.1|HSAJ2102[2764700]
[18634] 13623: AJ000001
[18635] Homo sapiens mRNA for CD94-B NK receptor
[18636] gi|2764393|emb|AJ000001.1|HSCD94B[2764393]
[18637] 13624: Y10141
[18638] H. sapiens DAT1 gene, partial, VNTR
[18639] gi|1752665|emb|Y10141.1|HSDAT1[1752665]
[18640] 13625: Z97213
[18641] Homo sapiens mRNA for T-cell receptor
[18642] gi|2239129|emb|Z97213.1|HSTCRBV2S[2239129]
[18643] 13627: AF026263
[18644] Homo sapiens muscarinic receptor (CHRM5) mRNA, complete cds
[18645] gi|2605721|gb|AF026263.1|AF026263[2605721]
[18646] 13628: AF026261
[18647] Homo sapiens histamine H1 receptor mRNA, complete cds
[18648] gi|2605717|gb|AF026261.1|AF026261[2605717]
[18649] 13629: AF026260
[18650] Homo sapiens vitamin D receptor (VDR) mRNA, complete cds
[18651] gi|2605715|gb|AF026260.1|AF026260[2605715]
[18652] 13630: AH005786
[18653] Homo sapiens CC chemokine receptor 5 (CCR5) gene, complete cds
[18654] gi|2739498|gb|AH005786.1|SEG_HSCCR5AB[2739498]
[18655] 13631: AF031237
[18656] Homo sapiens CC chemokine receptor 5 (CCR5) gene, complete cds
[18657] gi|2739497|gb|AF031237.1|HSCCR5AB3[2739497]
[18658] 13633: AH005782
[18659] Homo sapiens chromosome X map Xq28
[18660] gi|2735348|gb|AH005782.1|SEG_HSGABRE[2735348]
[18661] 13634: AF037334
[18662] Homo sapiens Eph-like receptor tyrosine kinase hEphB1d (EphB1) mRNA, complete cds
[18663] gi|2739209|gb|AF037334.1|AF037334[2739209]
[18664] 13635: AF037333
[18665] Homo sapiens Eph-like receptor tyrosine kinase hEphB1c (EphB1) mRNA, complete cds
[18666] gi|2739207|gb|AF037333.1|AF037333[2739207]
[18667] 13636: AF011406
[18668] Homo sapiens corticotropin releasing hormone receptor type 2 beta isoform (CRH2R) mRNA, complete cds
[18669] gi|2738557|gb|AF011406.1|AF011406[2738557]
[18670] 13637: U59632
[18671] Homo sapiens H5 mRNA, partial cds; and platelet glycoprotein Ib beta chain mRNA,
[18672] complete cds
[18673] gi|1809264|gb|U59632.1|HSU59632[1809264]
[18674] 13638: D86864
[18675] Homo sapiens mRNA for acetyl LDL receptor, complete cds
[18676] gi|2723468|dbj|D586864.1|D86864[2723468]
[18677] 13639: AF027208
[18678] Homo sapiens AC133 antigen mRNA, complete cds
[18679] gi|2688948|gb|AF027208.1|AF027208[2688948]
[18680] 13640: AB001025
[18681] Homo sapiens mRNA for brain ryanodine receptor, complete cds
[18682] gi|2696014|dbj|AB001025.1|AB001025[2696014]
[18683] 13641: D00017
[18684] Homo sapiens mRNA for lipocortin II, complete cds
[18685] gi|219909|dbj|D00017.1|HUMLIC[219909]
[18686] 13642: Y08236
[18687] H. sapiens LRP gene, polymorphisms in intron 24
[18688] gi|2125808|emb|Y08236.1|HSLRPIN24[2125808]
[18689] 13644: AF025998
[18690] Homo sapiens atrial natriuretic peptide clearance receptor (ANPRC) mRNA, complete cds
[18691] gi|2570851|gb|AF025998.1|AF025998[2570851]
[18692] 13645: AD000671
[18693] Homo sapiens DNA from chromosome 19-cosmid f24109 containing HRX2, genomic sequence
[18694] gi|1905893|gb|AD000671.1|AD000671[1905893]
[18695] 13646: Z49119
[18696] H. sapiens mRNA for serotonin 6 receptor (5-HT6; partial)
[18697] gi|984128|emb|Z49119.1|HS5HT6[984128]
[18698] 13647: Z48150
[18699] H. sapiens 5-HT4 mRNA for serotonin 4 receptor (5-HT4)
[18700] gi|984126|emb|Z48150.1|HS5HT4[984126]
[18701] 13648: Y15743
[18702] Homo sapiens RET proto-oncogene, exon 13 containing two mutations
[18703] gi|2665353|emb|Y15743.1|HSRET13[2665353]
[18704] 13649: AF000575
[18705] Homo sapiens clone 16 immunoglobulin-like transcript 5 mRNA, complete cds
[18706] gi|2264428|gb|AF000575.1|AF000575[2264428]
[18707] 13650: AF000574
[18708] Homo sapiens clone 1 immunoglobulin-like transcript 4 mRNA, complete cds
[18709] gi|2264426|gb|AF000574.1|AF000574[2264426]
[18710] 13651: Z26652
[18711] H. sapiens FLT3 mRNA for FLT3 receptor tyrosine kinase
[18712] gi|406322|emb|Z26652.1|HSFLT3RTK[406322]
[18713] 13653: X82208
[18714] H. sapiens mRNA for beta-centractin (ATCC# HHCPJ76)
[18715] gi|563887|emb|X82208.1|HSBCENTR[563887]
[18716] 13654: AF035261
[18717] Homo sapiens thyroid stimulating hormone receptor (TSHR) mRNA, partial cds
[18718] gi|2654195|gb|AF035261.1|HSTSHR[2654195]
[18719] 13655: AF032388
[18720] Homo sapiens vasopressin receptor type 2 mRNA, alternatively spliced, complete
[18721] cds
[18722] gi|2654030|gb|AF032388.1|AF032388[2654030]
[18723] 13656: AF025534
[18724] Homo sapiens leucocyte immunoglobulin-like receptor-8 (LIR-8) mRNA, complete cds
[18725] gi|2653874|gb|AF025534.1|AF025534[2653874]
[18726] 13657: AF025533
[18727] Homo sapiens leucocyte immunoglobulin-like receptor-3 (LIR-3) mRNA, complete cds
[18728] gi|2653872|gb|AF025533.1|AF025533[2653872]
[18729] 13658: AF025532
[18730] Homo sapiens leucocyte immunoglobulin-like receptor-5 (LIR-5) mRNA, complete cds
[18731] gi|2653870|gb|AF025532.1|AF025532[2653870]
[18732] 13659: AF025531
[18733] Homo sapiens leucocyte immunoglobulin-like receptor-7 (LIR-7) mRNA, complete cds
[18734] gi|2653868|gb|AF025531.1|AF025531[2653868]
[18735] 13660: AF025530
[18736] Homo sapiens leucocyte immunoglobulin-like receptor-6a (LIR-6) mRNA, complete cds
[18737] gi|2653866|gb|AF025530.1|AF025530[2653866]
[18738] 13661: AF025529
[18739] Homo sapiens leucocyte immunoglobulin-like receptor-6b (LIR-6) mRNA, complete cds
[18740] gi|2653864|gb|AF025529.1|AF025529[2653864]
[18741] 13662: AF025528
[18742] Homo sapiens leucocyte immunoglobulin-like receptor-2 (LIR-2) mRNA, complete cds
[18743] gi|2653862|gb|AF025528.1|AF025528[2653862]
[18744] 13663: AF025527
[18745] Homo sapiens leucocyte immunoglobulin-like receptor-4 (LIR-4) mRNA, complete cds
[18746] gi|2653860|gb|AF025527.1|AF025527[2653860]
[18747] 13664: Y13583
[18748] Homo sapiens mRNA for G-protein coupled receptor
[18749] gi|2652933|emb|Y13583.1|HSGPCP[2652933]
[18750] 13665: Y13367
[18751] H. sapiens mRNA for phosphoinositide 3-kinase
[18752] gi|2143259|emb|Y13367.1|HSPHOSI3K[2143259]
[18753] 13666: X82207
[18754] H. sapiens mRNA for beta-centractin (PC3)
[18755] gi|563885|emb|X82207.1|HSBCENT[563885]
[18756] 13667: AF033854
[18757] Homo sapiens lymphocyte inhibitor of TRAIL (LIT) mRNA, complete cds
[18758] gi|2645841|gb|AF033854.1|AF033854[2645841]
[18759] 13668: X81882
[18760] H. sapiens mRNA for for vasopressin activated calcium mobilizing receptor-like protein
[18761] gi|1628414|emb|X81882.1|HSVACM1[1628414]
[18762] 13669: AF024690
[18763] Homo sapiens putative G protein-coupled receptor (GPR43) gene, complete cds
[18764] gi|2612951|gb|AF024690.1|AF024690[2612951]
[18765] 13670: AF024689
[18766] Homo sapiens putative G protein-coupled receptor (GPR42) gene, complete cds
[18767] gi|2612949|gb|AF024689.1|AF024689[2612949]
[18768] 13671: AF024688
[18769] Homo sapiens putative G protein-coupled receptor (GPR41) gene, complete cds
[18770] gi|2612947|gb|AF024688.1|AF024688[2612947]
[18771] 13672: AF024687
[18772] Homo sapiens putative G protein-coupled receptor (GPR40) gene, complete cds
[18773] gi|2612945|gb|AF024687.1|AF024687[2612945]
[18774] 13673: D87513
[18775] Homo sapiens mRNA for Grb7 protein, partial cds
[18776] gi|1526534|dbj|D587513.1|D87513[1526534]
[18777] 13674: D49919
[18778] Homo sapiens mRNA for C-C chemokine receptor type 2, complete cds
[18779] gi|2626807|dbj|D549919.1|D49919[2626807]
[18780] 13675: AF030512
[18781] Homo sapiens small cell vasopressin subtype 1b receptor mRNA, complete cds
[18782] gi|2613124|gb|AF030512.1|AF030512[2613124]
[18783] 13676: Y12852
[18784] Homo sapiens P2X7 gene, exon 2 and 3
[18785] gi|2612788|emb|Y12852.1|HSP2X7E23[2612788]
[18786] 13677: Y12851
[18787] Homo sapiens P2X7 gene, exon 1 and joined CDS
[18788] gi|2597926|emb|Y12851.1|HSP2X7EX1[2597926]
[18789] 13678: Y12854
[18790] Homo sapiens P2X7 gene, exon 9-11
[18791] gi|2612787|emb|Y12854.1|HSP2X7911[2612787]
[18792] 13679: Y12853
[18793] Homo sapiens P2X7 gene, exon 4-8
[18794] gi|2612786|emb|Y12853.1|HSP2X748[2612786]
[18795] 13680: Y12855
[18796] Homo sapiens P2X7 gene, exon 12 and 13
[18797] gi|2612785|emb|Y12855.1|HSP2X7123[2612785]
[18798] 13681: AB005520
[18799] Homo sapiens ppar gamma2 gene for peroxisome proliferator activated-receptor gamma, partial cds and 5′ flanking
[18800] gi|2605488|dbj|AB005520.1|AB005520[2605488]
[18801] 13682: Y09765
[18802] Homo sapiens mRNA for putative GABA receptor epsilon subunit
[18803] gi|2285960|emb|Y09765.1|HSY09765[2285960]
[18804] 13683: Y09764
[18805] Homo sapiens GABRE gene, exon 2-8
[18806] gi|2285959|emb|Y09764.1|HSY09764[2285959]
[18807] 13684: Y09763
[18808] Homo sapiens GABRE gene, exon 1 (and joined CDS)
[18809] gi|2285957|emb|Y09763.1|HSY09763[2285957]
[18810] 13685: AF026535
[18811] Homo sapiens chemokine receptor (CCR3) mRNA, complete cds
[18812] gi|2582565|gb|AF026535.1|AF026535[2582565]
[18813] 13686: AF026071
[18814] Homo sapiens soluble death receptor 3 beta (DR3) mRNA, complete cds
[18815] gi|2570832|gb|AF026071.1|AF026071[2570832]
[18816] 13687: AF022956
[18817] Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds
[18818] gi|2570532|gb|AF022956.1|AF022956[2570532]
[18819] 13688: AF022955
[18820] Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds
[18821] gi|2570530|gb|AF022955.1|AF022955[2570530]
[18822] 13689: AF022954
[18823] Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds
[18824] gi|2570528|gb|AF022954.1|AF022954[2570528]
[18825] 13690: AF022953
[18826] Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds
[18827] gi|2570526|gb|AF022953.1|AF022953[2570526]
[18828] 13691: AF014958
[18829] Homo sapiens chemokine receptor X (CKRX) mRNA, complete cds
[18830] gi|2305263|gb|AF014958.1|AF014958[2305263]
[18831] 13692: AB000712
[18832] Homo sapiens hCPE-R mRNA for CPE-receptor, complete cds
[18833] gi|2570124|dbj|AB000712.1|AB000712[2570124]
[18834] 13693: X94609
[18835] H. sapiens mRNA for activatory NK receptor/KKA3 p50.3
[18836] gi|1495414|emb|X94609.1HSANKRMR[1495414]
[18837] 13694: AF025375
[18838] Homo sapiens chemokine receptor-4 (CXCR4) mRNA, complete cds
[18839] gi|2565335|gb|AF025375.1|AF025375[2565335]
[18840] 13695: AF000380
[18841] Homo sapiens folate binding protein mRNA, complete cds
[18842] gi|2565193|gb|AF000380.1|HSAF000380[2565193]
[18843] 13696: U35875
[18844] Homo sapiens B2 bradykinin receptor mRNA, 5′ sequence
[18845] gi|1353391|gb|U35875.1|HSU35875[1353391]
[18846] 13697: AF010193
[18847] Homo sapiens MAD-related gene SMAD7 (SMAD7) mRNA, complete cds
[18848] gi|2252821|gb|AF010193.1|AF010193[2252821]
[18849] 13698: X94634
[18850] H. sapiens CD97 gene exon 7
[18851] gi|1165087|emb|X94634.1|HSX94634[1165087]
[18852] 13699: X94633
[18853] H. sapiens CD97 gene exon 4
[18854] gi|1165086|emb|X94633.1|HSX94633[1165086]
[18855] 13700: X94632
[18856] H. sapiens CD97 gene exon 3
[18857] gi|1165085|emb|X94632.1|HSX94632[1165085]
[18858] 13702: AF007892
[18859] Homo sapiens P2Y6 receptor, long splice variant mRNA, complete cds
[18860] gi|2258421|gb|AF007892.1|[2258421]
[18861] 13703: AF007891
[18862] Homo sapiens P2Y6 receptor, short splice variant mRNA, complete cds
[18863] gi|2258419|gb|AF007891.1|[2258419]
[18864] 13704: AF022383
[18865] Homo sapiens complexin I mRNA, complete cds
[18866] gi|2465458|gb|AF022383.1|AF022383[2465458]
[18867] 13709: X89860
[18868] H. sapiens mRNA for T-cell receptor alpha chain
[18869] gi|927420|emb|X89860.1|HSNP7TCR2[927420]
[18870] 13710: Y08456
[18871] H. sapiens ChemR1 gene
[18872] gi|2465081|emb|Y08456.1|HSCHEMR1[2465081]
[18873] 13711: U95025
[18874] Homo sapiens metabotropic glutamate receptor 8 (GRM8) mRNA, complete cds
[18875] gi|2435409|gb|U95025.1|HSU95025[2435409]
[18876] 13712: AF021799
[18877] Homo sapiens interleukin 17 receptor-like mRNA sequence
[18878] gi|2460201|gb|AF021799.1|AF021799[2460201]
[18879] 13714: U73443
[18880] Homo sapiens 5HT3 serotonin receptor gene, partial cds
[18881] gi|2459549|gb|U73443.1|MMU73443[2459549]
[18882] 13715: AB000520
[18883] Homo sapiens mRNA for APS, complete cds
[18884] gi|2447035|dbj|AB000520.1|AB000520[2447035]
[18885] 13716: X98172
[18886] H. sapiens mRNA for MACH-alpha-1 protein
[18887] gi|1403318|emb|X98172.1|HSMACHA1[1403318]
[18888] 13728: AH005567
[18889] Homo sapiens chromosome 4 map 4q13
[18890] gi|2290767|gb|AH005567.1|SEG_HSGNRHR[2290767]
[18891] 13729: AF001952
[18892] Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 3 and complete cds
[18893] gi|2290766|gb|AF001952.1|HSGNRHR3[2290766]
[18894] 13730: AF001951
[18895] Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 2
[18896] gi|2290765|gb|AF001951.1|HSGNRHR2[2290765]
[18897] 13731: AF001950
[18898] Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 1
[18899] gi|2290764|gb|AF001950.1|HSGNRHR1[2290764]
[18900] 13733: AF020201
[18901] Homo sapiens Jagged 2 mRNA, complete cds
[18902] gi|2432001|gb|AF020201.1|AF020201([2432001]
[18903] 13734: Y14442
[18904] Homo sapiens mRNA for olfactory receptor protein, partial
[18905] gi|2370144|emb|Y14442.1|HSOLFMF[2370144]
[18906] 13736: AF017061
[18907] Homo sapiens vasopressin-activated calcium mobilizing putative receptor protein
[18908] (VACM-1) mRNA, complete cds
[18909] gi|2394273|gb|AF017061.1|AF017061[2394273]
[18910] 13737: AF017262
[18911] Homo sapiens putative G protein-coupled receptor mRNA, complete cds
[18912] gi|2388705|gb|AF017262.1|AF017262[2388705]
[18913] 13738: AF016917
[18914] Homo sapiens GABA-A receptor delta subunit (GABRD) mRNA, complete cds
[18915] gi|2388692|gb|AF016917.1|AF016917[2388692]
[18916] 13739: Y13248
[18917] Homo sapiens mRNA for orphan chemokine receptor TYMSTR
[18918] gi|2370179|emb|Y13248.1|HSY13248[2370179]
[18919] 13740: D83492
[18920] Homo sapiens mRNA for Eph-family protein, complete cds
[18921] gi|2281007|dbj|D83492.1|D83492[2281007]
[18922] 13741: AB002058
[18923] Homo sapiens mRNA for HUMAN P2XM, complete cds
[18924] gi|2350846|dbj|AB002058.1|AB002058[2350846]
[18925] 13742: AF015251
[18926] Homo sapiens breast cancer-related unknown protein mRNA, partial cds
[18927] gi|2345090|gb|AF015251.1|AF015251[2345090]
[18928] 13743: AF004231
[18929] Homo sapiens monocyte/macrophage Ig-related receptor MIR-10 (MIR cl-10) mRNA, complete cds
[18930] gi|2343110|gb|AF004231.1|AF004231[2343110]
[18931] 13744: AF004230
[18932] Homo sapiens monocyte/macrophage Ig-related receptor MIR-7 (MIR cl-7) mRNA, complete cds
[18933] gi|2343108|gb|AF004230.1|AF004230[2343108]
[18934] 13745: X90563
[18935] H. sapiens mRNA for peroxisome proliferactor activated receptor gamma
[18936] gi|1480099|emb|X90563.1|HSPPARGAM[1480099]
[18937] 13746: AF012629
[18938] Homo sapiens antagonist decoy receptor for TRAIL/Apo-2L (TRID) mRNA, complete cds
[18939] gi|2338430|gb|AF012629.1|AF012629[2338430]
[18940] 13747: AF012628
[18941] Homo sapiens death domain containing receptor for TRAIL/Apo-2L (DR5) mRNA, complete cds
[18942] gi|2338428|gb|AF012628.1|AF012628[2338428]
[18943] 13748: AF012536
[18944] Homo sapiens decoy receptor 1 (DcR1) mRNA, complete cds
[18945] gi|2338421|gb|AF012536.1|AF012536[2338421]
[18946] 13749: AF012535
[18947] Homo sapiens death receptor 5 (DR5) mRNA, complete cds
[18948] gi|2338419|gb|AF012535.1|AF012535[2338419]
[18949] 13750: AF012903
[18950] Homo sapiens P2X4 ATP-gated cation channel protein mRNA, partial cds
[18951] gi|2331043|gb|AF012903.1|AF012903[2331043]
[18952] 13751: X69316
[18953] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 21
[18954] gi|34105|emb|X69316.1|HSKITPO16[34105]
[18955] 13752: X69315
[18956] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exons 18, 19, 20
[18957] gi|34104|emb|X69315.1|HSKITPO15[34104]
[18958] 13753: X69314
[18959] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 17
[18960] gi|34103|emb|X69314.1|HSKITPO14[34103]
[18961] 13754: X69313
[18962] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 16
[18963] gi|34102|emb|X69313.1|HSKITPO13[34102]
[18964] 13755: X69312
[18965] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 15
[18966] gi|34101|emb|X69312.1|HSKITPO12[34101]
[18967] 13756: X69311
[18968] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 14
[18969] gi|34100|emb|X69311.1|HSKITPO11[34100]
[18970] 13757: X69310
[18971] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exons 10, 11, 12, 13
[18972] gi|34099|emb|X69310.1|HSKITPO10[34099]
[18973] 13758: X69309
[18974] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 9
[18975] gi|34098|emb|X69309.1|HSKITPO09[34098]
[18976] 13759: X69308
[18977] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 8
[18978] gi|34097|emb|X69308.1|HSKITPO08[34097]
[18979] 13760: X69307
[18980] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 7
[18981] gi|34096|emb|X69307.1|HSKITPO07[34096]
[18982] 13761: X69306
[18983] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 6
[18984] gi|34095|emboX69306.1|HSKITPO06[34095]
[18985] 13762: X69305
[18986] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 5
[18987] gi|34094|emb|X69305.1|HSKITPO05[34094]
[18988] 13763: AF005419
[18989] Homo sapiens P2Y5-like receptor gene, complete cds
[18990] gi|2240034|gb|AF005419.1|AF005419[2240034]
[18991] 13764: L42324
[18992] Homo sapiens (clone GPCR W) G protein-linked receptor gene (GPCR) gene, 5′ end
[18993] of cds
[18994] gi|066730|gb|L42324.1|HUMFRCG[1066730]
[18995] 13766: AF015910
[18996] Homo sapiens unknown protein mRNA, partial cds
[18997] gi|2286201|gb|AF015910.1|AF015910[2286201]
[18998] 13767: X99250
[18999] H. sapiens mRNA for endothelin-B receptor splice variant
[19000] gi|2285955|emb|X99250.1|HSX99250[2285955]
[19001] 13768: AF007545
[19002] Homo sapiens SIV/HIV receptor Bonzo (Bonzo) mRNA, complete cds
[19003] gi|225342|gb|AF007545.1|AF007545[2253421]
[19004] 13769: Z79783
[19005] H. sapiens G protein-coupled receptor CKR-L2
[19006] gi|2281709|emb|Z79783.1|HSCKRL2[2281709]
[19007] 13778: Z49994
[19008] H. sapiens partial gene for proteinase-activated receptor 2 (1289 BP)
[19009] gi|1008086|emb|Z49994.1|HSPAR2B[1008086]
[19010] 13779: AF007555
[19011] Homo sapiens IAR/receptor-like protein-tyrosine phosphatase precursor mRNA, complete cds
[19012] gi|2262074|gb|AF007555.1|AF007555[2262074]
[19013] 13780: AF008556
[19014] Homo sapiens interleukin-2 receptor mRNA, alternatively spliced, partial cds
[19015] gi|2266932|gb|AF008556.1|AF008556[2266932]
[19016] 13891: Y10152
[19017] H. sapiens mRNA for CRF2 receptor, beta isoform, aberrantly spliced, (94 bp deletion)
[19018] gi|1785640|emb|Y10152.1|HSCRF294[1785640]
[19019] 13892: Y10153
[19020] H. sapiens mRNA for CRF2 receptor, beta isoform, aberrantly spliced, (227 bp insertion)
[19021] gi|1785639|emb|Y10153.1|HSCRF2227[1785639]
[19022] 13893: Y10151
[19023] H. sapiens mRNA for CRF2 receptor, beta isoform, partial
[19024] gi|1785637|emb|Y10151.1|HSCRF2[1785637]
[19025] 13894: M17325
[19026] Homo sapiens T-cell receptor gamma-chain constant region (TCRGC1) mRNA, partial
[19027] cds
[19028] gi|2072752|gb|M17325.1|HUMTCGCJ[2072752]
[19029] 13895: M17324
[19030] Homo sapiens T-cell receptor gamma-chain constant region (TCRGC2) mRNA, partial
[19031] cds
[19032] gi|207275|gb|M17324.1|HUMTCGCI[2072751]
[19033] 13896: M17323
[19034] Homo sapiens T-cell receptor gamma-chain constant region (TCRGC2) mRNA, partial
[19035] cds
[19036] gi|2072750|gb|M17323.1|HUMTCGCH[2072750]
[19037] 13897: AF004327
[19038] Homo sapiens angiopoietin-2 mRNA, complete cds
[19039] gi|2257932|gb|AF004327.1|AF004327[2257932]
[19040] 13898: AF004021
[19041] Homo sapiens prostaglandin F2 alpha receptor mRNA, complete cds
[19042] gi|2257849|gb|AF004021.1|AF004021[2257849]
[19043] 13899: AF006464
[19044] Homo sapiens muscle specific tyrosine kinase receptor (MUSK) mRNA, complete cds
[19045] gi|225331|gb|AF006464.1|AF006464[2253311]
[19046] 13900: AF005637
[19047] Homo sapiens endothelin A receptor gene, 5′ flanking region and exon 1
[19048] gi|2253289|gb|AF005637.1|AF005637[2253289]
[19049] 13902: Z24461
[19050] H. sapiens MTCP-1 gene
[19051] gi|406866|emb|Z24461.1|HSMTCP1I[406866]
[19052] 13903: Z24463
[19053] H. sapiens MTCP-1 gene
[19054] gi|406865|emb|Z24463.1|HSMTCP1H[406865]
[19055] 13904: Z24457
[19056] H. sapiens of TCRA gene MTCP-1 gene
[19057] gi|406860|emb|Z24457.1|HSMTCP1D[406860]
[19058] 13905: Z24456
[19059] H. sapiens of MTCP-1 gene MTCP-1 gene
[19060] gi|406859|emb|Z24456.1|HSMTCP1C[406859]
[19061] 13906: U45984
[19062] Homo sapiens CCR6 chemokine receptor (CMKBR6) gene, complete cds
[19063] gi|2246432|gb|U45984.1|HSU45984[2246432]
[19064] 13908: AF005900
[19065] Homo sapiens alpha2B-adrenergic receptor (alpha2C2AR) gene, complete cds
[19066] gi|2245627|gb|AF005900.1|AF005900[2245627]
[19067] 13909: AF005210
[19068] Homo sapiens CC chemokine receptor CCR8 (CMKBR8) mRNA, partial cds
[19069] gi|2245579|gb|AF005210.1|AF005210[2245579]
[19070] 13524: Y16282
[19071] Homo sapiens mRNA for nicotinic acetylcholine receptor alpha6 subunit precursor
[19072] gi|2815224|emb|Y16282.1|HSY16282[2815224]
[19073] 13525: Y16281
[19074] Homo sapiens mRNA for nicotinic acetylcholine receptor alpha2 subunit precursor
[19075] gi|2815222|emb|Y16281.1|HSY16281[2815222]
[19076] 13526: X98858
[19077] H. sapiens mRNA for HLA-C specific activatory NK receptor
[19078] gi|1419593|emb|X98858.1|HSNKREC[1419593]
[19079] 13527: M76676
[19080] Homo sapiens leukocyte platelet-activating factor receptor mRNA, complete cds
[19081] gi|2810988|gb|M76676.1|HUMNPIIY20[2810988]
[19082] 13528: Y08420
[19083] H. sapiens mRNA for nicotinic acetylcholine receptor alpha7 subunit precursor
[19084] gi|2808623|emb|Y08420.1|HSNACHRA7[2808623]
[19085] 13529: Y08419
[19086] H. sapiens mRNA for nicotinic acetylcholine receptor alpha5 subunit precursor
[19087] gi|1702913|emb|Y08419.1|HSNACHRA5[1702913]
[19088] 13530: Y08421
[19089] H. sapiens mRNA for nicotinic acetylcholine receptor alpha4 subunit precursor
[19090] gi|1702911|emb|Y08421.1|HSNACHRA4[1702911]
[19091] 13531: Y08417
[19092] H. sapiens mRNA for nicotinic acetylcholine receptor beta3 subunit precursor
[19093] gi|1702909|emb|Y08417.1|HSNACHR3B[1702909]
[19094] 13532: Y08416
[19095] H. sapiens mRNA for nicotinic acetylcholine receptor beta4 subunit precursor
[19096] gi|1702919|emb|Y08416.1|HSNACHRB4[1702919]
[19097] 13533: Y08415
[19098] H. sapiens mRNA for nicotinic acetylcholine receptor beta2 subunit precursor
[19099] gi|1702917|emb|Y08415.1|HSNACHRB2[1702917]
[19100] 13534: Y08418
[19101] H. sapiens mRNA for nicotinic acetylcholine receptor alpha3 subunit precursor
[19102] gi|1702907|emb|Y08418.1|HSNACHR3A[1702907]
[19103] 13535: AF001985
[19104] Homo sapiens CD38 gene, 5′ upstream sequence
[19105] gi|2804672|gb|AF001985.1|AF001985[2804672]
[19106] 13536: AF042077
[19107] Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9079.6 allele, partial cds
[19108] gi|2801710|gb|AF042077.1|AF042077[2801710]
[19109] 13537: AF042076
[19110] Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9108.1 allele, partial cds
[19111] gi|2801708|gb|AF042076.1|AF042076[2801708]
[19112] 13538: AF042075
[19113] Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9110 allele, partial cds
[19114] gi|2801706|gb|AF042075.1|AF042075[2801706]
[19115] 13539: AF042074
[19116] Homo sapiens olfactory receptor-like protein (OLFR 42A) gene, OLFR 42A-9079.3 allele, partial cds
[19117] gi|2801704|gb|AF042074.1|AF042074[2801704]
[19118] 13540: AF042073
[19119] Homo sapiens olfactory receptor-like protein (OLFR 42A) gene, OLFR 42A-9049 allele, partial cds
[19120] gi|2801702|gb|AF042073.1|AF042073[2801702]
[19121] 13600: Y10530
[19122] H. sapiens gene encoding putative olfactory receptor (clone htpcr2)
[19123] gi|2792017|emb|Y10530.1|HSHTPCR2[2792017]
[19124] 13601: Y10529
[19125] H. sapiens mRNA for putative olfactory receptor (clone ht2)
[19126] gi|2792015|emb|Y10529.1|HSHT2[2792015]
[19127] 13614: Z26876
[19128] H. sapiens gene for ribosomal protein L38
[19129] gi|407422|emb|Z26876.1|HSRPL38[407422]
[19130] 13615: Z50150
[19131] H. sapiens mRNA for tyrosine kinase activator protein 1 (TKA-1)
[19132] gi|1246762|emb|Z50150.1|HSTKA1MR[1246762]
[19133] 13616: Y13055
[19134] Homo sapiens mRNA for NKG2-CII activating NK receptor
[19135] gi|2765292|emb|Y13055.1|HSNKG2CII[2765292]
[19136] 13617: Y13054
[19137] Homo sapiens mRNA for NK receptor, clone GR #29
[19138] gi|2765290|emb|Y13054.1|HSNKREC29[2765290]
[19139] 13618: Y10437
[19140] H. sapiens mRNA for serotonin receptor 4
[19141] gi|2765076|emb|Y10437.1|HSSERR4[2765076]
[19142] 13619: AJ002105
[19143] Homo sapiens mRNA for NK receptor, clone library TG14#13
[19144] gi|2764706|emb|AJ002105.1|HSAJ2105[2764706]
[19145] 13620: AJ002104
[19146] Homo sapiens mRNA for NK receptor, clone library TG14#6
[19147] gi|2764704|emb|AJ002104.1|HSAJ2104[2764704]
[19148] 13621: AJ002103
[19149] Homo sapiens mRNA for NK receptor, clone library TG14#35
[19150] gi|2764702|emb|AJ002103.1|HSAJ2103[2764702]
[19151] 13622: AJ002102
[19152] Homo sapiens mRNA for NK receptor, clone library TG14#8
[19153] gi|2764700|emb|AJ002102.1|HSAJ2102[2764700]
[19154] 13623: AJ000001
[19155] Homo sapiens mRNA for CD94-B NK receptor
[19156] gi|2764393|emb|AJ000001.1|HSCD94B[2764393]
[19157] 13624: Y10141
[19158] H. sapiens DAT1 gene, partial, VNTR
[19159] gi|1752665|emb|Y10141.1|HSDAT1[1752665]
[19160] 13625: Z97213
[19161] Homo sapiens mRNA for T-cell receptor
[19162] gi|2239129|emb|Z97213.1|HSTCRBV2S[2239129]
[19163] 13627: AF026263
[19164] Homo sapiens muscarinic receptor (CHRM5) mRNA, complete cds
[19165] gi|2605721|gb|AF026263.1|AF026263[2605721]
[19166] 13628: AF026261
[19167] Homo sapiens histamine H1 receptor mRNA, complete cds
[19168] gi|2605717|gb|AF026261.1|AF026261[2605717]
[19169] 13629: AF026260
[19170] Homo sapiens vitamin D receptor (VDR) mRNA, complete cds
[19171] gi|2605715|gb|AF026260.1|AF026260[2605715]
[19172] 13630: AH005786
[19173] Homo sapiens CC chemokine receptor 5 (CCR5) gene, complete cds
[19174] gi|2739498|gb|AH005786.1|SEG_HSCCR5AB[2739498]
[19175] 13631: AF031237
[19176] Homo sapiens CC chemokine receptor 5 (CCR5) gene, complete cds
[19177] gi|2739497|gb|AF031237.1|HSCCR5AB3[2739497]
[19178] 13633: AH005782
[19179] Homo sapiens chromosome X map Xq28
[19180] gi|2735348|gb|AH005782.1|SEG_HSGABRE[2735348]
[19181] 13634: AF037334
[19182] Homo sapiens Eph-like receptor tyrosine kinase hEphB1d (EphB1) mRNA, complete cds
[19183] gi|2739209|gb|AF037334.1|AF037334[2739209]
[19184] 13635: AF037333
[19185] Homo sapiens Eph-like receptor tyrosine kinase hEphB1c (EphB1) mRNA, complete cds
[19186] gi|2739207|gb|AF037333.1|AF037333[2739207]
[19187] 13636: AF011406
[19188] Homo sapiens corticotropin releasing hormone receptor type 2 beta isoform (CRH2R) mRNA, complete cds
[19189] gi|2738557|gb|AF011406.1|AF011406[2738557]
[19190] 13637: U59632
[19191] Homo sapiens H5 mRNA, partial cds; and platelet glycoprotein Ib beta chain mRNA,
[19192] complete cds
[19193] gi|1809264|gb|U59632.1|HSU59632[1809264]
[19194] 13638: D86864
[19195] Homo sapiens mRNA for acetyl LDL receptor, complete cds
[19196] gi|2723468|dbj|D86864.1|D86864[2723468]
[19197] 13639: AF027208
[19198] Homo sapiens AC133 antigen mRNA, complete cds
[19199] gi|2688948|gb|AF027208.1|AF027208[2688948]
[19200] 13640: AB001025
[19201] Homo sapiens mRNA for brain ryanodine receptor, complete cds
[19202] gi|2696014|dbj|AB001025.1|AB001025[2696014]
[19203] 13641: D00017
[19204] Homo sapiens mRNA for lipocortin II, complete cds
[19205] gi|219909|dbj|D00017.1|HUMLIC[219909]
[19206] 13644: AF025998
[19207] Homo sapiens atrial natriuretic peptide clearance receptor (ANPRC) mRNA, complete cds
[19208] gi|257085|gb|AF025998.1|AF025998[2570851]
[19209] 13645: AD000671
[19210] Homo sapiens DNA from chromosome 19-cosmid f24109 containing HRX2, genomic sequence
[19211] gi|1905893|gb|AD000671.1|AD000671[1905893]
[19212] 13646: Z49119
[19213] H. sapiens mRNA for serotonin 6 receptor (5-HT6; partial)
[19214] gi|984128|emb|Z49119.1|HS5HT6[984128]
[19215] 13647: Z48150
[19216] H. sapiens 5-HT4 mRNA for serotonin 4 receptor (5-HT4)
[19217] gi|984126|emb|Z48150.1|HS5HT4[984126]
[19218] 13648: Y15743
[19219] Homo sapiens RET proto-oncogene, exon 13 containing two mutations
[19220] gi|2665353|emb|Y15743.1|HSRET13[2665353]
[19221] 13649: AF000575
[19222] Homo sapiens clone 16 immunoglobulin-like transcript 5 mRNA, complete cds
[19223] gi|2264428|gb|AF000575.1|AF000575[2264428]
[19224] 13650: AF000574
[19225] Homo sapiens clone 1 immunoglobulin-like transcript 4 mRNA, complete cds
[19226] gi|2264426|gb|AF000574.1|AF000574[2264426]
[19227] 13651: Z26652
[19228] H. sapiens FLT3 mRNA for FLT3 receptor tyrosine kinase
[19229] gi|406322|emb|Z26652.1|HSFLT3RTK[406322]
[19230] 13653: X82208
[19231] H. sapiens mRNA for beta-centractin (ATCC# HHCPJ76)
[19232] gi|563887|emb|X82208.1|HSBCENTR[563887]
[19233] 13654: AF035261
[19234] Homo sapiens thyroid stimulating hormone receptor (TSHR) mRNA, partial cds
[19235] gi|2654195|gb|AF035261.1|HSTSHR[2654195]
[19236] 13655: AF032388
[19237] Homo sapiens vasopressin receptor type 2 mRNA, alternatively spliced, complete
[19238] cds
[19239] gi|2654030|gb|AF032388.1|AF032388[2654030]
[19240] 13656: AF025534
[19241] Homo sapiens leucocyte immunoglobulin-like receptor-8 (LIR-8) mRNA, complete cds
[19242] gi|2653874|gb|AF025534.1|AF025534[2653874]
[19243] 13657: AF025533
[19244] Homo sapiens leucocyte immunoglobulin-like receptor-3 (LIR-3) mRNA, complete cds
[19245] gi|2653872|gb|AF025533.1|AF025533[2653872]
[19246] 13658: AF025532
[19247] Homo sapiens leucocyte immunoglobulin-like receptor-5 (LIR-5) mRNA, complete cds
[19248] gi|2653870|gb|AF025532.1|AF025532[2653870]
[19249] 13659: AF025531
[19250] Homo sapiens leucocyte immunoglobulin-like receptor-7 (LIR-7) mRNA, complete cds
[19251] gi|2653868|gb|AF025531.1|AF025531[2653868]
[19252] 13660: AF025530
[19253] Homo sapiens leucocyte immunoglobulin-like receptor-6a (LIR-6) mRNA, complete cds
[19254] gi|2653866|gb|AF025530.1|AF025530[2653866]
[19255] 13661: AF025529
[19256] Homo sapiens leucocyte immunoglobulin-like receptor-6b (LIR-6) mRNA, complete cds
[19257] gi|2653864|gb|AF025529.1|AF025529[2653864]
[19258] 13662: AF025528
[19259] Homo sapiens leucocyte immunoglobulin-like receptor-2 (LIR-2) mRNA, complete cds
[19260] gi|2653862|gb|AF025528.1|AF025528[2653862]
[19261] 13663: AF025527
[19262] Homo sapiens leucocyte immunoglobulin-like receptor-4 (LIR-4) mRNA, complete cds
[19263] gi|2653860|gb|AF025527.1|AF025527[2653860]
[19264] 13664: Y13583
[19265] Homo sapiens mRNA for G-protein coupled receptor
[19266] gi|255233|emb|Y13583.1|HSGPCP[2652933]
[19267] 13665: Y13367
[19268] H. sapiens mRNA for phosphoinositide 3-kinase
[19269] gi|2143259|emb|Y13367.1|HSPHOSI3K[2143259]
[19270] 13666: X82207
[19271] H. sapiens mRNA for beta-centractin (PC3)
[19272] gi|563885|emb|X82207.1|HSBCENT[563885]
[19273] 13667: AF033854
[19274] Homo sapiens lymphocyte inhibitor of TRAIL (LIT) mRNA, complete cds
[19275] gi|2645841|gb|AF033854.1|AF033854[2645841]
[19276] 13668: X81882
[19277] H. sapiens mRNA for for vasopressin activated calcium mobilizing receptor-like protein
[19278] gi|1628414|emb|X81882.1|HSVACM1[1628414]
[19279] 13669: AF024690
[19280] Homo sapiens putative G protein-coupled receptor (GPR43) gene, complete cds
[19281] gi|2612951|gb|AF024690.1|AF024690[2612951]
[19282] 13670: AF024689
[19283] Homo sapiens putative G protein-coupled receptor (GPR42) gene, complete cds
[19284] gi|2612949|gb|AF024689.1|AF024689[2612949]
[19285] 13671: AF024688
[19286] Homo sapiens putative G protein-coupled receptor (GPR41) gene, complete cds
[19287] gi|2612947|gb|AF024688.1|AF024688[2612947]
[19288] 13672: AF024687
[19289] Homo sapiens putative G protein-coupled receptor (GPR40) gene, complete cds
[19290] gi|2612945|gb|AF024687.1|AF024687[2612945]
[19291] 13673: D87513
[19292] Homo sapiens mRNA for Grb7 protein, partial cds
[19293] gi|1526534|dbj|D87513.1|D87513[1526534]
[19294] 13674: D49919
[19295] Homo sapiens mRNA for C-C chemokine receptor type 2, complete cds
[19296] gi|2626807|dbj|D49919.1|D49919[2626807]
[19297] 13675: AF030512
[19298] Homo sapiens small cell vasopressin subtype 1b receptor mRNA, complete cds
[19299] gi|2613124|gb|AF030512.1|AF030512[2613124]
[19300] 13676: Y12852
[19301] Homo sapiens P2X7 gene, exon 2 and 3
[19302] gi|2612788|emb|Y12852.1|HSP2X7E23[2612788]
[19303] 13677: Y12851
[19304] Homo sapiens P2X7 gene, exon 1 and joined CDS
[19305] gi|2597926|emb|Y12851.1|HSP2X7EX1[2597926]
[19306] 13678: Y12854
[19307] Homo sapiens P2X7 gene, exon 9-11
[19308] gi|2612787|emb|Y12854.1|HSP2X7911[2612787]
[19309] 13679: Y12853
[19310] Homo sapiens P2X7 gene, exon 4-8
[19311] gi|2612786|emb|Y12853.1|HSP2X748[2612786]
[19312] 13680: Y12855
[19313] Homo sapiens P2X7 gene, exon 12 and 13
[19314] gi|2612785|emb|Y112855.1|HSP2X7123[2612785]
[19315] 13681: AB005520
[19316] Homo sapiens ppar gamma2 gene for peroxisome proliferator activated-receptor gamma, partial cds and 5′ flanking
[19317] gi|2605488|dbj|AB005520.1|AB005520[2605488]
[19318] 13682: Y09765
[19319] Homo sapiens mRNA for putative GABA receptor epsilon subunit
[19320] gi|2285960|emb|Y09765.1|HSY09765[2285960]
[19321] 13683: Y09764
[19322] Homo sapiens GABRE gene, exon 2-8
[19323] gi|2285959|emb|Y09764.1|HSY09764[2285959]
[19324] 13684: Y09763
[19325] Homo sapiens GABRE gene, exon 1 (and joined CDS)
[19326] gi|2285957|emb|Y09763.1|HSY09763[2285957]
[19327] 13685: AF026535
[19328] Homo sapiens chemokine receptor (CCR3) mRNA, complete cds
[19329] gi|2582565|gb|AF026535.1|AF026535[2582565]
[19330] 13686: AF026071
[19331] Homo sapiens soluble death receptor 3 beta (DR3) mRNA, complete cds
[19332] gi|2570832|gb|AF026071.1|AF026071[2570832]
[19333] 13687: AF022956
[19334] Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds
[19335] gi|2570532|gb|AF022956.1|AF022956[2570532]
[19336] 13688: AF022955
[19337] Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds
[19338] gi|2570530|gb|AF022955.1|AF022955[2570530]
[19339] 13689: AF022954
[19340] Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds
[19341] gi|2570528|gb|AF022954.1|AF022954[2570528]
[19342] 13690: AF022953
[19343] Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds
[19344] gi|2570526|gb|AF022953.1|AF022953[2570526]
[19345] 13691: AF014958
[19346] Homo sapiens chemokine receptor X (CKRX) mRNA, complete cds
[19347] gi|2305263|gb|AF014958.1|AF014958[2305263]
[19348] 13692: AB000712
[19349] Homo sapiens hCPE-R mRNA for CPE-receptor, complete cds
[19350] gi|2570124|dbj|AB000712.1|AB000712[2570124]
[19351] 13693: X94609
[19352] H. sapiens mRNA for activatory NK receptor/KKA3 p50.3
[19353] gi|1495414|emb|X94609.1|HSANKRMR[1495414]
[19354] 13694: AF025375
[19355] Homo sapiens chemokine receptor-4 (CXCR4) mRNA, complete cds
[19356] gi|2565335|gb|AF025375.1|AF025375[2565335]
[19357] 13695: AF000380
[19358] Homo sapiens folate binding protein mRNA, complete cds
[19359] gi|2565193|gb|AF000380.1|HSAF000380[2565193]
[19360] 13696: U35875
[19361] Homo sapiens B2 bradykinin receptor mRNA, 5′ sequence
[19362] gi|135339|gb|U35875.1|HSU35875[1353391]
[19363] 13697: AF010193
[19364] Homo sapiens MAD-related gene SMAD7 (SMAD7) mRNA, complete cds
[19365] gi|225282|gb|AF010193.1|AF010193[2252821]
[19366] 13698: X94634
[19367] H. sapiens CD97 gene exon 7
[19368] gi|1165087|emb|X94634.1|HSX94634[1165087]
[19369] 13699: X94633
[19370] H. sapiens CD97 gene exon 4
[19371] gi|1165086|emb|X94633.1|HSX94633[1165086]
[19372] 13700: X94632
[19373] H. sapiens CD97 gene exon 3
[19374] gi|1165085|emb|X94632.1|HSX94632[1165085]
[19375] 13702: AF007892
[19376] Homo sapiens P2Y6 receptor, long splice variant mRNA, complete cds
[19377] gi|225842|gb|AF007892.1|[2258421]
[19378] 13703: AF007891
[19379] Homo sapiens P2Y6 receptor, short splice variant mRNA, complete cds
[19380] gi|2258419|gb|AF007891.1|[2258419]
[19381] 13704: AF022383
[19382] Homo sapiens complexin I mRNA, complete cds
[19383] gi|2465458|gb|AF022383.1|AF022383[2465458]
[19384] 13709: X89860
[19385] H. sapiens mRNA for T-cell receptor alpha chain
[19386] gi|927420|emb|X89860.1|HSNP7TCR2[927420]
[19387] 13710: Y08456
[19388] H. sapiens ChemR1 gene
[19389] gi|2465081|emb|Y08456.1|HSCHEMR1[2465081]
[19390] 13711: U95025
[19391] Homo sapiens metabotropic glutamate receptor 8 (GRM8) mRNA, complete cds
[19392] gi|2435409|gb|U95025.1|HsU95025[2435409]
[19393] 13712: AF021799
[19394] Homo sapiens interleukin 17 receptor-like mRNA sequence
[19395] gi|2460201|gb|AF021799.1|AF021799[2460201]
[19396] 13714: U73443
[19397] Homo sapiens 5HT3 serotonin receptor gene, partial cds
[19398] gi|2459549|gb|U73443.1|MMU73443[2459549]
[19399] 13715: AB000520
[19400] Homo sapiens mRNA for APS, complete cds
[19401] gi|2447035|dbj|AB3000520.1|AB3000520[2447035]
[19402] 13716: X98172
[19403] H. sapiens mRNA for MACH-alpha-1 protein
[19404] gi|1403318|emb|X98172.1|HSMACHA1[1403318]
[19405] 13727: X92883
[19406] H. sapiens mRNA for T cell receptor alpha (clone XPHC46IV)
[19407] gi|1061141|emb|X92883.1|HSPHC46A1[1061141]
[19408] 13728: AH005567
[19409] Homo sapiens chromosome 4 map 4q13
[19410] gi|2290767|gb|AH005567.1|SEG_HSGNRHR[2290767]
[19411] 13729: AF001952
[19412] Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 3 and complete cds
[19413] gi|2290766|gb|AF001952.1|HSGNRHR3[2290766]
[19414] 13730: AF001951
[19415] Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 2
[19416] gi|2290765|gb|AF001951.1|HSGNRHR2[2290765]
[19417] 13731: AF001950
[19418] Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 1
[19419] gi|2290764|gb|AF001951.1|HSGNRHR1[2290764]
[19420] 13732: AF017263
[19421] Homo sapiens putative G protein-coupled receptor gene, partial intron sequence
[19422] gi|2435439|gb|AF017263.1|AF017263[2435439]
[19423] 13733: AF020201
[19424] Homo sapiens Jagged 2 mRNA, complete cds
[19425] gi|2432001|gb|AF020201.1|AF020201[2432001]
[19426] 13734: Y14442
[19427] Homo sapiens mRNA for olfactory receptor protein, partial
[19428] gi|2370144|emb|Y14442.1|HSOLFMF[2370144]
[19429] 13735: AF017264
[19430] Homo sapiens putative G protein-coupled receptor gene, intronic sequence
[19431] gi|2407224|gb|AF017264.1|AF017264[2407224]
[19432] 13736: AF017061
[19433] Homo sapiens vasopressin-activated calcium mobilizing putative receptor protein
[19434] (VACM-1) mRNA, complete cds
[19435] gi|2394273|gb|AF01706.1|AF017061[2394273]
[19436] 13737: AF017262
[19437] Homo sapiens putative G protein-coupled receptor mRNA, complete cds
[19438] gi|2388705|gb|AF017262.1|AF017262[2388705]
[19439] 13738: AF016917
[19440] Homo sapiens GABA-A receptor delta subunit (GABRD) mRNA, complete cds
[19441] gi|2388692|gb|AF016917.1|AF016917[2388692]
[19442] 13739: Y13248
[19443] Homo sapiens mRNA for orphan chemokine receptor TYMSTR
[19444] gi|2370179|emb|Y13248.1|HSY13248[2370179]
[19445] 13740: D83492
[19446] Homo sapiens mRNA for Eph-family protein, complete cds
[19447] gi|2281007|dbj|D83492.1|D83492[2281007]
[19448] 13741: AB002058
[19449] Homo sapiens mRNA for HUMAN P2XM, complete cds
[19450] gi|2350846|dbj|AB002058.1|AB002058[2350846]
[19451] 13742: AF015251
[19452] Homo sapiens breast cancer-related unknown protein mRNA, partial cds
[19453] gi|2345090|gb|AF015251.1|AF015251[2345090]
[19454] 13743: AF004231
[19455] Homo sapiens monocyte/macrophage Ig-related receptor MIR-10 (MIR cl-10) mRNA, complete cds
[19456] gi|2343110|gb|AF004231.1|AF004231[2343110]
[19457] 13744: AF004230
[19458] Homo sapiens monocyte/macrophage Ig-related receptor MIR-7 (MIR cl-7) mRNA, complete cds
[19459] gi|2343108|gb|AF004230.1|AF004230[2343108]
[19460] 13745: X90563
[19461] H. sapiens mRNA for peroxisome proliferactor activated receptor gamma
[19462] gi|1480099|emb|X90563.1|HSPPARGAM[1480099]
[19463] 13746: AF012629
[19464] Homo sapiens antagonist decoy receptor for TRAIL/Apo-2L (TRID) mRNA, complete cds
[19465] gi|2338430|gb|AF012629.1|AF012629[2338430]
[19466] 13747: AF012628
[19467] Homo sapiens death domain containing receptor for TRAIL/Apo-2L (DR5) mRNA, complete cds
[19468] gi|2338428|gb|AF012628.1|AF012628[2338428]
[19469] 13748: AF012536
[19470] Homo sapiens decoy receptor 1 (DcR1) mRNA, complete cds
[19471] gi|2338421|gb|AF012536.1|AF012536[2338421]
[19472] 13749: AF012535
[19473] Homo sapiens death receptor 5 (DR5) mRNA, complete cds
[19474] gi|2338419|gb|AF012535.1|AF012535[2338419]
[19475] 13750: AF012903
[19476] Homo sapiens P2X4 ATP-gated cation channel protein mRNA, partial cds
[19477] gi|2331043|gb|AF012903.1|AF012903[2331043]
[19478] 13751: X69316
[19479] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 21
[19480] gi|34105|emb|X69316.1|HSKITPO16[34105]
[19481] 13752: X69315
[19482] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exons 18, 19, 20
[19483] gi|34104|emb|X69315.1|HSKITPO15[34104]
[19484] 13753: X69314
[19485] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 17
[19486] gi|34103|emb|X69314.1|HSKITPO14[34103]
[19487] 13754: X69313
[19488] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 16
[19489] gi|34102|emb|X69313.1|HSKITPO13[34102]
[19490] 13755: X69312
[19491] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 15
[19492] gi|34101|emb|X69312.1|HSKITPO12[34101]
[19493] 13756: X69311
[19494] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 14
[19495] gi|34100|emb|X69311.1|HSKITPO11[34100]
[19496] 13757: X69310
[19497] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exons 10, 11, 12, 13
[19498] gi|34099|emb|X69310.1|HSKITPO10[34099]
[19499] 13758: X69309
[19500] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 9
[19501] gi|34098|emb|X69309.1|HSKITPO09[34098]
[19502] 13759: X69308
[19503] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 9
[19504] gi|34097|emb|X69308.1|HSKITPO08[34097]
[19505] 13760: X69307
[19506] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 8
[19507] gi|34096|emb|X69307.1|HSKITPO07[34096]
[19508] 13761: X69306
[19509] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 7
[19510] gi|34095|emb|X69306.1|HSKITPO06[34095]
[19511] 13762: X69305
[19512] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 5
[19513] gi|34094|emb|X69305.1|HSKITPO05[34094]
[19514] 13763: AF005419
[19515] Homo sapiens P2Y5-like receptor gene, complete cds
[19516] gi|2240034|gb|AF005419.1|AF005419[2240034]
[19517] 13764: L42324
[19518] Homo sapiens (clone GPCR W) G protein-linked receptor gene (GPCR) gene, 5′ end
[19519] of cds
[19520] gi|1066730|gb|L42324.1|HUMFRCG[1066730]
[19521] 13766: AF015910
[19522] Homo sapiens unknown protein mRNA, partial cds
[19523] gi|2286201|gb|AF015910.1|AF015910[2286201]
[19524] 13767: X99250
[19525] H. sapiens mRNA for endothelin-B receptor splice variant
[19526] gi|2285955|emb|X99250.1|HSX99250[2285955]
[19527] 13768: AF007545
[19528] Homo sapiens SIV/HIV receptor Bonzo (Bonzo) mRNA, complete cds
[19529] gi|225342|gb|AF007545.1|AF007545[2253421]
[19530] 13769: Z79783
[19531] H. sapiens G protein-coupled receptor CKR-L2
[19532] gi|2281709|emb|Z79783.1|HSCKRL2[2281709]
[19533] 13778: Z49994
[19534] H. sapiens partial gene for proteinase-activated receptor 2 (1289 BP)
[19535] gi|1008086|emb|Z49994.1|HSPAR2B[1008086]
[19536] 13779: AF007555
[19537] Homo sapiens IAR/receptor-like protein-tyrosine phosphatase precursor mRNA, complete cds
[19538] gi|2262074|gb|AF007555.1|AF007555[2262074]
[19539] 13780: AF008556
[19540] Homo sapiens interleukin-2 receptor mRNA, alternatively spliced, partial cds
[19541] gi|2266932|gb|AF008556.1|AF008556[2266932]
[19542] 13891: Y10152
[19543] H. sapiens mRNA for CRF2 receptor, beta isoform, aberrantly spliced, (94 bp deletion)
[19544] gi|1785640|emb|Y10152.1|HSCRF294[1785640]
[19545] 13892: Y10153
[19546] H. sapiens mRNA for CRF2 receptor, beta isoform, aberrantly spliced, (227 bp insertion)
[19547] gi|1785639|emb|Y10153.1|HSCRF2227[1785639]
[19548] 13893: Y10151
[19549] H. sapiens mRNA for CRF2 receptor, beta isoform, partial
[19550] gi|1785637|emb|Y10151.1|HSCRF2[1785637]
[19551] 13894: M17325
[19552] Homo sapiens T-cell receptor gamma-chain constant region (TCRGC1) mRNA, partial
[19553] cds
[19554] gi|2072752|gb|M17325.1|HUMTCGCJ[2072752]
[19555] 13895: M17324
[19556] Homo sapiens T-cell receptor gamma-chain constant region (TCRGC2) mRNA, partial
[19557] cds
[19558] gi|2072751|gb|M17324.1|HUMTCGCI[2072751]
[19559] 13896: M17323
[19560] Homo sapiens T-cell receptor gamma-chain constant region (TCRGC2) mRNA, partial
[19561] cds
[19562] gi|2072750|gb|M17323.1|HUMTCGCH[2072750]
[19563] 13897: AF004327
[19564] Homo sapiens angiopoietin-2 mRNA, complete cds
[19565] gi|2257932|gb|AF004327.1|AF004327[2257932]
[19566] 13898: AF004021
[19567] Homo sapiens prostaglandin F2 alpha receptor mRNA, complete cds
[19568] gi|2257849|gb|AF004021.1|AF004021[2257849]
[19569] 13899: AF006464
[19570] Homo sapiens muscle specific tyrosine kinase receptor (MUSK) mRNA, complete cds
[19571] gi|2253311|gb|AF006464.1|AF006464[2253311]
[19572] 13900: AF005637
[19573] Homo sapiens endothelin A receptor gene, 5′ flanking region and exon 1
[19574] gi|2253289|gb|AF005637.1|AF005637[2253289]
[19575] 13902: Z24461
[19576] H. sapiens MTCP-1 gene
[19577] gi|406866|emb|Z24461.1|HSMTCP1I[406866]
[19578] 13903: Z24463
[19579] H. sapiens MTCP-1 gene
[19580] gi|406865|emb|Z24463.1|HSMTCP1H[406865]
[19581] 13904: Z24457
[19582] H. sapiens of TCRA gene MTCP-1 gene
[19583] gi|406860|emb|Z24457.1|HSMTCP1D[406860]
[19584] 13905: Z24456
[19585] H. sapiens of MTCP-1 gene MTCP-1 gene
[19586] gi|406859|emb|Z24456.1|HSMTCP1C[406859]
[19587] 13906: U45984
[19588] Homo sapiens CCR6 chemokine receptor (CMKBR6) gene, complete cds
[19589] gi|2246432|gb|U45984.1|HSU45984[2246432]
[19590] 13908: AF005900
[19591] Homo sapiens alpha2B-adrenergic receptor (alpha2C2AR) gene, complete cds
[19592] gi|2245627|gb|AF005900.1|AF005900[2245627]
[19593] 13909: AF005210
[19594] Homo sapiens CC chemokine receptor CCR8 (CMKBR8) mRNA, partial cds
[19595] gi|2245579|gb|AF005210.1|AF005210[2245579]
[19596] 14010: Y13758
[19597] Homo sapiens mRNA for transient receptor potential related channel 3 protein
[19598] gi|2225936|emb|Y13758.1|HSY13758[2225936]
[19599] 14012: AF000546
[19600] Homo sapiens purinergic receptor P2Y5 mRNA, complete cds
[19601] gi|2232068|gb|AF000546.1|HSAF000546[2232068]
[19602] 14013: U45983
[19603] Homo sapiens CCR8 chemokine receptor (CMKBR8) gene, complete cds
[19604] gi|2231165|gb|U45983.1|HSU45983[2231165]
[19605] 14015: X63819
[19606] H. sapiens mRNA for Lipoxin A4 receptor
[19607] gi|31460|emb|X63819.1|HSLIPA4R[31460]
[19608] 14016: X15274
[19609] H. sapiens TRGV9 gene, allele V9*A2
[19610] gi|1848091|emb|X15274.1|HSTRGV9F[1848091]
[19611] 14020: X80282
[19612] H. sapiens gene for oxytocin receptor
[19613] gi|609014|emb|X80282.1|HSOXYTOC[609014]
[19614] 14021: X81086
[19615] H. sapiens PCaR1 gene
[19616] gi|599819|emb|X81086.1|HSPCAR1[599819]
[19617] 14023: X65857
[19618] H. sapiens HGMP07E gene for olfactory receptor
[19619] gi|425220|emb|X65857.1|HSHGM07EG[425220]
[19620] 14024: X65858
[19621] H. sapiens gene for high affinity IL-8 receptor
[19622] gi|312046|emb|X65858.1|HSHAIL8G[312046]
[19623] 14026: Z69640
[19624] H. sapiens fgfr2 gene (exon 5)
[19625] gi|200062|emb|Z69640.1|HSFGFR2UB[1200062]
[19626] 14027: Z69641
[19627] H. sapiens fgfr2 gene
[19628] gi|1120006|emb|Z69641.1|HSFGFR2UA[1200061]
[19629] 14029: Z70243
[19630] H. sapiens enhancer region for interleukin-2 receptor alpha chain
[19631] gi|1769435|emb|Z70243.1|HSENHREG1[1769435]
[19632] 14030: Z38109
[19633] H. sapiens DNA for CD69, exon 1
[19634] gi|793837|emb|Z38109.1|HSCD69X1[793837]
[19635] 14031: AC002306
[19636] Homo sapiens DNA from chromosome 19-cosmid R33799, genomic sequence, complete sequence
[19637] gi|2213634|gb|AC002306.1|AC002306[2213634]
[19638] 14032: AF002256
[19639] Homo sapiens killer cell inhibitory receptor homolog cl-9 mRNA, complete cds
[19640] gi|2197058|gb|AF002256.1|AF002256[2197058]
[19641] 14033: AF002255
[19642] Homo sapiens killer cell inhibitory receptor cl-17 mRNA, complete cds
[19643] gi|2197056|gb|AF002255.1|AF002255[2197056]
[19644] 14034: D89079
[19645] Homo sapiens mRNA for leukotriene b4 receptor, complete cds
[19646] gi|2196450|dbj|D589079.1|D89079[2196450]
[19647] 14035: D89078
[19648] Homo sapiens mRNA for leukotriene b4 receptor, complete cds
[19649] gi|2196448|dbj|D89078.1|D89078[2196448]
[19650] 14036: AB004662
[19651] Homo sapiens mRNA for adenosine A1-receptor, complete cds
[19652] gi|2196442|dbj|AB004662.1|AB004662[2196442]
[19653] 14037: Y07909
[19654] H. sapiens mRNA for Progression Associated Protein
[19655] gi|1542882|emb|Y07909.1|HSPAPR[1542882]
[19656] 14038: L17411
[19657] Human complement receptor type 1 (alleles S and F) gene, exon 40
[19658] gi|1199855|gb|L17411.1|HUMCR1SF34[1199855]
[19659] 14039: L17425
[19660] Human complement receptor type 1 (allele S) gene, exon 11
[19661] gi|451301|gb|L17425.1|HUMCR1SF10[451301]
[19662] 14040: L17418
[19663] Human complement receptor type 1 (alleles S and F) gene, exon 47 and complete cds's
[19664] gi|306678|gb|L17418.1|HUMCR1SF41[306678]
[19665] 14041: L17417
[19666] Human complement receptor type 1 (alleles S and F) gene, exon 46
[19667] gi|306677|gb|L17417.1|HUMCR1SF40[306677]
[19668] 14042: L17416
[19669] Human complement receptor type 1 (alleles S and F) gene, exon 45
[19670] gi|306676|gb|L17416.1|HUMCR1SF39[306676]
[19671] 14043: L17415
[19672] Human complement receptor type 1 (alleles S and F) gene, exon 44
[19673] gi|306675|gb|L17415.1|HUMCR1SF38[306675]
[19674] 14044: L17414
[19675] Human complement receptor type 1 (alleles S and F) gene, exon 43
[19676] gi|306674|gb|L17414.1|HUMCR1SF37[306674]
[19677] 14045: L17413
[19678] Human complement receptor type 1 (alleles S and F) gene, exon 42
[19679] gi|306673|gb|L17413.1|HUMCR1SF36[306673]
[19680] 14046: L17412
[19681] Human complement receptor type 1 (alleles S and F) gene, exon 41
[19682] gi|306672|gb|L17412.1|HUMCR1SF35[306672]
[19683] 14047: L17410
[19684] Human complement receptor type 1 (alleles S and F) gene, exons 38 and 39
[19685] gi|306670|gb|L17410.1|HUMCR1SF33[306670]
[19686] 14048: L17408
[19687] Human complement receptor type 1 (alleles S and F) gene, exon 37
[19688] gi|306669|gb|L17408.1|HUMCR1SF32[306669]
[19689] 14049: L17407
[19690] Human complement receptor type 1 (alleles S and F) gene, exon 36
[19691] gi|306668|gb|L17407.1|HUMCR1SF31[306668]
[19692] 14050: L17406
[19693] Human complement receptor type 1 (alleles S and F) gene, exon 35
[19694] gi|306667|gb|L17406.1|HUMCR1SF30[306667]
[19695] 14051: L17405
[19696] Human complement receptor type 1 (alleles S and F) gene, exon 34
[19697] gi|306666|gb|L17405.1|HUMCR1SF29[306666]
[19698] 14052: L17404
[19699] Human complement receptor type 1 (alleles S and F) gene, exon 33
[19700] gi|306665|gb|L17404.1|HUMCR1SF28[306665]
[19701] 14053: L17403
[19702] Human complement receptor type 1 (alleles S and F) gene, exon 32
[19703] gi|306664|gb|L17403.1|HUMCR1SF27[306664]
[19704] 14054: L17402
[19705] Human complement receptor type 1 (alleles S and F) gene, exons 30 and 31
[19706] gi|306663|gb|L17402.1|HUMCR1SF26[306663]
[19707] 14055: L17401
[19708] Human complement receptor type 1 (alleles S and F) gene, exon 29
[19709] gi|306662|gb|L17401.1|HUMCR1SF25[306662]
[19710] 14056: L17400
[19711] Human complement receptor type 1 (alleles S and F) gene, exon 28
[19712] gi|306661|gb|L17400.1|HUMCR1SF24[306661]
[19713] 14057: L17398
[19714] Human complement receptor type 1 (alleles S and F) gene, exons 26 and 27
[19715] gi|306660|gb|L17398.1|HUMCR1SF23[306660]
[19716] 14058: L17397
[19717] Human complement receptor type 1 (alleles S and F) gene, exon 25
[19718] gi|306659|gb|L17397.1|HUMCR1SF22[306659]
[19719] 14059: L17396
[19720] Human complement receptor type 1 (alleles S and F) gene, exon 24
[19721] gi|306658|gb|L17396.1|HUMCR1SF21[306658]
[19722] 14060: L17395
[19723] Human complement receptor type 1 (alleles S and F) gene, exons 22 and 23
[19724] gi|306657|gb|L17395.1|HUMCR1SF20[306657]
[19725] 14061: L17394
[19726] Human complement receptor type 1 (alleles S and F) gene, exon 21
[19727] gi|306656|gb|L17394.1|HUMCR1SF19[306656]
[19728] 14062: L17393
[19729] Human complement receptor type 1 (alleles S and F) gene, exon 20
[19730] gi|306655|gb|L17393.1|HUMCR1SF18[306655]
[19731] 14063: L17392
[19732] Human complement receptor type 1 (alleles S and F) gene, exon 19
[19733] gi|306654|gb|L17392.1|HUMCR1SF17[306654]
[19734] 14064: L17391
[19735] Human complement receptor type 1 (alleles S and F) gene, exon 18
[19736] gi|306653|gb|L17391.1|HUMCR1SF16[306653]
[19737] 14065: L17430
[19738] Human complement receptor type 1 (allele S) gene, exon 17
[19739] gi|306652|gb|L17430.1|HUMCR1SF15[306652]
[19740] 14066: L17429
[19741] Human complement receptor type 1 (allele S) gene, exon 16
[19742] gi|306651|gb|L17429.1|HUMCR1SF14[306651]
[19743] 14067: L17428
[19744] Human complement receptor type 1 (allele S) gene, exons 14 and 15
[19745] gi|306650|gb|L17428.1|HUMCR1SF13[306650]
[19746] 14068: L17427
[19747] Human complement receptor type 1 (allele S) gene, exon 13
[19748] gi|306649|gb|L17427.1|HUMCR1SF12[306649]
[19749] 14069: L17426
[19750] Human complement receptor type 1 (allele S) gene, exon 12
[19751] gi|306648|gb|L17426.1|HUMCR1SF11[306648]
[19752] 14070: L17424
[19753] Human complement receptor type 1 (allele S) gene, exon 10
[19754] gi|306646|gb|L17424.1|HUMCR1SF09[306646]
[19755] 14071: L17423
[19756] Human complement receptor type 1 (alleles S and F) gene, exon 9
[19757] gi|306645|gb|L17423.1|HUMCR1SF08[306645]
[19758] 14072: L17422
[19759] Human complement receptor type 1 (alleles S and F) gene, exon 8
[19760] gi|306644|gb|L17422.1|HUMCR1SF07[306644]
[19761] 14073: L17421
[19762] Human complement receptor type 1 (alleles S and F) gene, exons 6 and 7
[19763] gi|306643|gb|L17421.1|HUMCR1SF06[306643]
[19764] 14074: L17420
[19765] Human complement receptor type 1 (alleles S and F) gene, exon 5
[19766] gi|306642|gb|L17420.1|HUMCR1SF05[306642]
[19767] 14075: L17419
[19768] Human complement receptor type 1 (alleles S and F) gene, exon 4
[19769] gi|306641|gb|L17419.1|HUMCR1SF04[306641]
[19770] 14076: L17409
[19771] Human complement receptor type 1 (alleles S and F) gene, exon 3
[19772] gi|306640|gb|L17409.1|HUMCR1SF03[306640]
[19773] 14077: L17399
[19774] Human complement receptor type 1 (alleles S and F) gene, exon 2
[19775] gi|306639|gb|L17399.1|HUMCR1SF02[306639]
[19776] 14078: L17390
[19777] Human complement receptor type 1 (alleles S and F) gene, enhancer and exon 1
[19778] gi|306638|gb|L17390.1|HUMCR1SF01[306638]
[19779] 14081: M14764
[19780] Human nerve growth factor receptor mRNA, complete cds
[19781] gi|189204|gb|M14764.1|HUMNGFR[189204]
[19782] 14082: M11025
[19783] Human asialoglycoprotein receptor H2 mRNA, complete cds
[19784] gi|179080|gb|M11025.1|HUMASGPR2[179080]
[19785] 14083: L31772
[19786] Human alpha-1a/d adrenergic receptor mRNA, complete cds
[19787] gi|666894|gb|L31772.1|HUMA1DA[666894]
[19788] 14084: L31774
[19789] Human alpha-1c-adrenergic receptor mRNA, complete cds
[19790] gi|666892|gb|L31774.1|HUMA1ARA[666892]
[19791] 14085: L31773
[19792] Human alpha-1B-adrenergic receptor mRNA, complete cds
[19793] gi|666890|gb|L31773.1|HUMA1AR[666890]
[19794] 14093: L07868
[19795] Homo sapiens receptor tyrosine kinase (ERBB4) gene, complete cds
[19796] gi|337359|gb|L07868.1|HUMRETYKIN[337359]
[19797] 14094: L19593
[19798] Homo sapiens interleukin 8 receptor beta (IL8RB) mRNA, complete cds
[19799] gi|559053|gb|L19593.1|HUMIL8RB[559053]
[19800] 14095: L19591
[19801] Homo sapiens interleukin 8 receptor alpha (IL8RA) mRNA, complete cds
[19802] gi|559049|gb|L19591.1|HUMIL8RAA[559049]
[19803] 14096: M69229
[19804] Human insulin-like growth factor I receptor gene, promoter region and 5′ end
[19805] gi|184837|gb|M69229.1|HUMIGFR1PR[184837]
[19806] 14097: L03840
[19807] Human fibroblast growth factor receptor 4 (FGFR4) mRNA, complete cds
[19808] gi|182570|gb|L03840.1|HUMFGFR4X[182570]
[19809] 14098: L13268
[19810] Homo sapiens N-methyl-d-aspartate receptor (NR1-3) mRNA, 3′ end
[19811] gi|292286|gb|L13268.1|HUMMARB[292286]
[19812] 14099: L13266
[19813] Homo sapiens N-methyl-d-aspartate receptor (NR1-1) mRNA, complete cds
[19814] gi|292282|gb|L13266.1|HUMMAR[292282]
[19815] 14100: Y13426
[19816] Homo sapiens TCRDV2 gene, partial
[19817] gi|2181879|emb|Y13426.1|HSTCRDV2[2181879]
[19818] 14101: Y08768
[19819] H. sapiens mRNA for IL-13 receptor
[19820] gi|1877211|emb|Y08768.1|HSIL13[1877211]
[19821] 14102: Y08110
[19822] H. sapiens mRNA for mosaic protein LR11
[19823] gi|1552323|emb|Y08110.1|HSLR11[1552323]
[19824] 14103: E08844
[19825] Histamine H1 receptor gene
[19826] gi|2176948|dbj|E08844.1|E08844[2176948]
[19827] 14104: E08843
[19828] cDNA encoding Histamine H1 receptor
[19829] gi|2176947|dbj|E08843.1|E08843[2176947]
[19830] 14106: E07873
[19831] cDNA encoding cholecystokinin B/gastrin receptor
[19832] gi|2176006|dbj|E07873.1|E07873[2176006]
[19833] 14107: E07650
[19834] cDNA encoding endothelin receptor, ETB-receptor
[19835] gi|2175785|dbj|E07650.1|E07650[2175785]
[19836] 14108: E07649
[19837] cDNA encoding endothelin receptor, ETA-receptor
[19838] gi|2175784|dbj|E07649.1|E07649[2175784]
[19839] 14109: E07358
[19840] cDNA encoding adrenaline alpha2CII receptor
[19841] gi|2175498|dbj|E07358.1|E07358[2175498]
[19842] 14110: E07278
[19843] cDNA encoding human cholecystokinin (CCK) receptor
[19844] gi|2175419|dbj|E07278.1|E07278[2175419]
[19845] 14111: E06799
[19846] DNA encoding human Interleukin-5 receptor
[19847] gi|2174981|dbj|E06799.1|E06799[2174981]
[19848] 14112: E06798
[19849] DNA encoding human Interleukin-5 receptor
[19850] gi|2174980|dbj|E06798.1|E06798[2174980]
[19851] 14113: E06797
[19852] DNA encoding human Interleukin-5 receptor
[19853] gi|2174979|dbj|E06797.1|E06797[2174979]
[19854] 14114: E06796
[19855] DNA encoding human Interleukin-5 receptor
[19856] gi|2174978|dbj|E06796.1|E06796[2174978]
[19857] 14115: E05678
[19858] cDNA encoding human LH-hCG (luteinizing hormone-human choriogonadotropic hormone) receptor
[19859] gi|2173865|dbj|E05678.1|E05678[2173865]
[19860] 14116: E05211
[19861] DNA encoding human scavenger receptor II
[19862] gi|2173401|dbj|E05211.1|E05211[2173401]
[19863] 14117: E05210
[19864] DNA encoding human scavenger receptor I
[19865] gi|2173400|dbj|E05210.1|E05210[2173400]
[19866] 14118: E05109
[19867] cDNA encoding human oxytocin receptor
[19868] gi|2173303|dbj|E05109.1|E05109[2173303]
[19869] 14189: E04823
[19870] cDNA encoding interleukin 6 receptor
[19871] gi|2173019|dbj|E04823.1|E04823[2173019]
[19872] 14190: E03879
[19873] cDNA encoding platelet activating factor receptor
[19874] gi|2172093|dbj|E03879.1|E03879[2172093]
[19875] 14191: E03829
[19876] cDNA encoding human thromboxane receptor
[19877] gi|2172043|dbj|E03829.1|E03829[2172043]
[19878] 14192: E03378
[19879] DNA encoding N-terminal fragment of human growth hormone receptor
[19880] gi|2171595|dbj|E03378.1|E03378[2171595]
[19881] 14193: E03377
[19882] DNA encoding C-terminal fragment of human growth hormone receptor
[19883] gi|2171594|dbj|E03377.1|E03377[2171594]
[19884] 14194: E03335
[19885] Human b-FGF receptor gene
[19886] gi|2171552|dbj|E03335.1|E03335[2171552]
[19887] 14195: E03268
[19888] cDNA sequence coding for human scavenger receptor, type II
[19889] gi|2171485|dbj|E03268.1|E03268[2171485]
[19890] 14196: E03267
[19891] cDNA sequence coding for human scavenger receptor, type I
[19892] gi|2171484|dbj|E03267.1|E03267[2171484]
[19893] 14197: E02673
[19894] cDNA encoding human B cell stimulating factor 2 receptor protein
[19895] gi|2170901|dbj|E02673.1|E02673[2170901]
[19896] 14198: E02541
[19897] cDNA encoding human Interleukin-2 receptor L chain
[19898] gi|2170771|dbj|E02541.1|E02541[2170771]
[19899] 14199: E02151
[19900] Terminal sequence of constant region of T cell receptor beta chain (c beta-1)
[19901] gi|2170389|dbj|E02151.1|E02151[2170389]
[19902] 14200: E01646
[19903] cDNA encoding Fc epsilon receptor
[19904] gi|2169899|dbj|E01646.1|E01646[2169899]
[19905] 14201: E01052
[19906] DNA encoding human mature TNF
[19907] gi|2169311|dbj|E01052.1|E01052[2169311]
[19908] 14202: E00999
[19909] cDNA encoding human insulin receptor
[19910] gi|2169258|dbj|E00999.1|E00999[2169258]
[19911] 14203: E00990
[19912] cDNA encoding alpha chain of T-cell receptor
[19913] gi|2169251|dbj|E00990.1|E00990[2169251]
[19914] 14204: E00727
[19915] cDNA encoding human IL-2 receptor
[19916] gi|2169004|dbj|E00727.1|E00727[2169004]
[19917] 14205: E00723
[19918] cDNA encoding human interleukin-2 receptor
[19919] gi|2169000|dbj|E00723.1|E00723[2169000]
[19920] 14206: E00685
[19921] cDNA encoding human T-cell antigen receptor protein
[19922] gi|2168964|dbj|E00685.1|E00685[2168964]
[19923] 14207: D31833
[19924] Human mRNA for vasopressin V1b receptor, complete cds
[19925] gi|563981|dbj|D31833.1|HUMVV1BR[563981]
[19926] 14208: D16845
[19927] Human mRNA for thyrotropin-releasing hormone receptor, complete cds
[19928] gi|577631|dbj|D16845.1|HUMTRHR1[577631]
[19929] 14209: D28131
[19930] Human mRNA for TGF-beta receptor type IIB, partial sequence
[19931] gi|456708|dbj|D28131.1|HUMTGFBRII[456708]
[19932] 14211: D17517
[19933] Human sky mRNA for Sky, complete cds
[19934] gi|624880|dbj|D17517.1|HUMSKY[624880]
[19935] 14214: D30780
[19936] Human mRNA for phospholipase A2 receptor, partial cds
[19937] gi|565645|dbj|D30780.1|HUMPLA21R[565645]
[19938] 14215: D38299
[19939] Homo sapiens mRNA for prostaglandin E receotor EP3 subtype 2 isoform, complete
[19940] cds
[19941] gi|1389574|dbj|D38299.1|HUMPEREFC[1389574]
[19942] 14216: D38298
[19943] Homo sapiens mRNA for prostaglandin E receotor EP3 subtype 1b isoform, complete
[19944] cds
[19945] gi|1389573|dbj|D38298.1|HUMPEREEB[1389573]
[19946] 14217: D38301
[19947] Homo sapiens mRNA for prostaglandin E receptor EP3 subtype 3 isoform, complete
[19948] cds
[19949] gi|1389572|dbj|D38301.1|HUMPERECE[1389572]
[19950] 14218: D38300
[19951] Homo sapiens mRNA for prostaglandin E receotor EP3 subtype 4 isoform, complete
[19952] cds
[19953] gi|1389571|dbj|D38300.1|HUMPEREBD[1389571]
[19954] 14219: D38297
[19955] Homo sapiens mRNA for prostaglandin E receotor EP3 subtype 1a isoform, complete
[19956] cds
[19957] gi|1389570|dbj|D38297.1|HUMPEREA[1389570]
[19958] 14220: D28538
[19959] Human mRNA for metabotropic glutamate receptor subtype 5a, complete cds
[19960] gi|1140805|dbj|D28538.1|HUMMGRS5A[1408051]
[19961] 14221: D14872
[19962] Human DNA for fibroblast growth factor receptor 2 (K-sam-II) exon C3, partial sequence
[19963] gi|511927|dbj|D14872.1|HUMKSAMC3[511927]
[19964] 14222: D50582
[19965] Human gene for inward rectifier K channel, complete cds
[19966] gi|1088444|dbj|D50582.1|HUMIRKCB[1088444]
[19967] 14223: D26070
[19968] Human mRNA for type 1 inositol 1,4,5-trisphosphate receptor, complete cds
[19969] gi|559322|dbj|D26070.1|HUMINSP3R1[559322]
[19970] 14232: D26156
[19971] Human mRNA for transcriptional activator hSNF2b, complete cds
[19972] gi|505087|dbj|D26156.1|HUMHSNF2B[505087]
[19973] 14233: D26155
[19974] Human mRNA for transcriptional activator hSNF2a, complete cds
[19975] gi|505086|dbj|D26155.1|HUMHSNF2A[505086]
[19976] 14234: D26351
[19977] Human mRNA for type 3 inositol 1,4,5-trisphosphate receptor, complete cds
[19978] gi|450470|dbj|D26351.1|HUMHT3I[450470]
[19979] 14235: D26350
[19980] Human mRNA for type 2 inositol 1,4,5-trisphosphate receptor, complete cds
[19981] gi|450468|dbj|D26350.1|HUMHT2I[450468]
[19982] 14236: D25418
[19983] Human mRNA for prostacyclin receptor, complete cds
[19984] gi|467509|dbj|D25418.1|HUMHPR[467509]
[19985] 14237: D10924
[19986] Human mRNA for HM89
[19987] gi|219868|dbj|D10924.1|HUMHM89[219868]
[19988] 14238: D10923
[19989] Human mRNA for HM74
[19990] gi|219866|dbj|D10923.1|HUMHM74[219866]
[19991] 14239: D10922
[19992] Human mRNA for FMLP-related receptor (HM63)
[19993] gi|219864|dbj|D10922.1|HUMHM63[219864]
[19994] 14240: D10925
[19995] Human mRNA for HM145
[19996] gi|219862|dbj|D10925.1|HUMHM145[219862]
[19997] 14241: D28481
[19998] Human mRNA for histamine H1 receptor, complete cds
[19999] gi|457654|dbj|D28481.1|HUMHH1R[457654]
[20000] 14242: D10995
[20001] Human gene for serotonin 1B receptor, complete cds
[20002] gi|219678|dbj|D10995.1|HUMHGCR[219678]
[20003] 14243: D38449
[20004] Human mRNA for G protein-coupled receptor, complete cds
[20005] gi|556519|dbj|D30449.1|HUMGPCRAA[556519]
[20006] 14243: D38449
[20007] 14245: D37827
[20008] Homo sapiens mRNA for large erk/cek5 tyrosine kinase, partial cds
[20009] gi|1060894|dbj|D37827.1|HUMERK1P[1060894]
[20010] 14246: D13305
[20011] Human mRNA for brain cholecystokinin receptor
[20012] gi|436039|dbj|D13305.1|HUMBRACHRE[436039]
[20013] 14247: D32201
[20014] Human mRNA for alpha 1C adrenergic receptor isoform 3, complete cds
[20015] gi|927210|dbj|D32201.1|HUMAICAR3[927210]
[20016] 14248: D16354
[20017] Human mRNA for Ah receptor, complete cds
[20018] gi|464179|dbj|D16354.1|HUMAHRE[464179]
[20019] 14249: D25235
[20020] Human mRNA for alpha1C adrenergic receptor, complete cds
[20021] gi|433200|dbj|D25235.1|HUMACAR[433200]
[20022] 14250: D13538
[20023] Human alpha2CII-adrenergic receptor gene, complete cds
[20024] gi|219405|dbj|D13538.1|HUMA2CIIA[219405]
[20025] 14251: D32202
[20026] Human mRNA for alpha 1C adrenergic receptor isoform 2, complete cds
[20027] gi|927208|dbj|D32202.1|HUMA1CAR2[927208]
[20028] 14253: D86519
[20029] Human mRNA for neuropeptide y/peptide YY Y6 receptor, complete cds
[20030] gi|1731789|dbj|D86519.1|D86519[1731789]
[20031] 14254: D50683
[20032] Homo sapiens mRNA for TGF-betaIIR alpha, complete cds
[20033] gi|1827474|dbj|D50683.1|D50683[1827474]
[20034] 14255: D50682
[20035] Homo sapiens mRNA for TGF-betaIIR beta, partial cds
[20036] gi|1827472|dbj|D50682.1|D50682[1827472]
[20037] 14256: D28472
[20038] Human mRNA for prostaglandin E receptor EP4 subtype, complete cds
[20039] gi|1486234|dbj|D28472.1|D28472[1486234]
[20040] 14257: D29634
[20041] Human lung mRNA for receptor for prostacyclin, complete cds
[20042] gi|577629|dbj|D29634.1|D29634[577629]
[20043] 14258: D28539
[20044] Human mRNA for metabotropic glutamate receptor subtype 5b, complete cds
[20045] gi|1408053|dbj|D28539.1|HUMMGRS5B[1408053]
[20046] 14259: Y09479
[20047] H. sapiens mRNA for G protein-coupled receptor Edg-2
[20048] gi|1679601|emb|Y09479.1|HSEDG2[1679601]
[20049] 14260: U97197
[20050] Homo sapiens asialoglycoprotein receptor (ASGPR) mRNA, complete cds
[20051] gi|2121249|gb|U97197.1|HSU97197[2121249]
[20052] 14261: X81892
[20053] H. sapiens mA for HE6 Tm7 receptor
[20054] gi|2117160|emb|X81892.1|HSHE6[2117160]
[20055] 14262: Y07619
[20056] H. sapiens mRNA for peroxisome proliferator-activated receptor alpha
[20057] gi|1514594|emb|Y07619.1|HSPPARAGE[1514594]
[20058] 14263: D16815
[20059] Homo sapiens mRNA for EAR-1r, complete cds
[20060] gi|2116671|dbj|D16815.1|D16815[2116671]
[20061] 14264: X95876
[20062] H. sapiens mRNA for G-protein coupled receptor
[20063] gi|1552845|emb|X95876.1|HSGPCRIN8[1552845]
[20064] 14265: AF000545
[20065] Homo sapiens putative purinergic receptor P2Y10 gene, complete cds
[20066] gi|2104786|gb|AF000545.1|HSAF000545[2104786]
[20067] 14267: U95626
[20068] Homo sapiens ccr2b (ccr2), ccr2a (ccr2), ccr5 (ccr5) and ccr6 (ccr6) genes, complete cds, and lactoferrin (lactoferrin) gene, partial cds, complete sequence
[20069] gi|2104517|gb|U95626.1|HSU95626[2104517]
[20070] 14268: U77352
[20071] Homo sapiens MAP kinase-activating death domain protein (MADD) mRNA, complete cds
[20072] gi|2102697|gb|U77352.1|HSU77352[2102697]
[20073] 14269: D86098
[20074] Homo sapiens mRNA for prostaglandin EP3 receptor subtype isoform, complete cds
[20075] gi|2102646|dbj|D86098.1|D86098[2102646]
[20076] 14270: D86097
[20077] Homo sapiens mRNA for prostaglandin EP3 receptor subtype isoform, complete cds
[20078] gi|2102644|dbj|D86097.1|D86097[2102644]
[20079] 14271: X98510
[20080] H. sapiens mRNA for G protein-coupled receptor
[20081] gi|1894788|emb|X98510.1|HSX98510[1894788]
[20082] 14272: D89675
[20083] Homo sapiens mRNA for bone morphogenetic protein type IB receptor, complete cds
[20084] gi|2055308|dbj|D89675.1|D89675[2055308]
[20085] 14273: D43772
[20086] Human squamous cell carcinoma of esophagus mRNA for GRB-7 SH2 domain protein, complete cds
[20087] gi|601890|dbj|D43772.1|HUMGRB7[601890]
[20088] 14274: X89677
[20089] H. sapiens RA for TPCR92 protein
[20090] gi|902337|emb|X89677.1|HSTPCR92P[902337]
[20091] 14275: X89676
[20092] H. sapiens mRNA for TPCR86 protein
[20093] gi|902335|emb|X89676.1|HSTPCR86P[902335]
[20094] 14276: X89675
[20095] H. sapiens mRNA for TPCR85 protein
[20096] gi|902333|emb|X89675.1|HSTPCR85P[902333]
[20097] 14277: X89674
[20098] H. sapiens mRNA for TPCR27 protein
[20099] gi|902331|emb|X89674.1|HSTPCR27P[902331]
[20100] 14278: X89673
[20101] H. sapiens mRNA for TPCR26 protein
[20102] gi|902329|emb|X89673.1|HSTPCR26P[902329]
[20103] 14279: X89672
[20104] H. sapiens mRNA for TPCR25 protein
[20105] gi|902327|emb|X89672.1|HSTPCR25P[902327]
[20106] 14280: X89671
[20107] H. sapiens mRNA for TPCR24 protein
[20108] gi|902325|emb|X89671.1|HSTPCR24P[902325]
[20109] 14281: X89670
[20110] H. sapiens mRNA for TPCR16 protein
[20111] gi|902323|emb|X89670.1|HSTPCR16P[902323]
[20112] 14282: X89669
[20113] H. sapiens mRNA for TPCR120 protein
[20114] gi|902321|emb|X89669.1|HSTPCR120[902321]
[20115] 14283: X89668
[20116] H. sapiens mRNA for TPCR110 protein
[20117] gi|902319|emb|X89668.1|HSTPCR110[902319]
[20118] 14284: X89667
[20119] H. sapiens mRNA for TPCR106 protein
[20120] gi|902317|emb|X89667.1|HSTPCR106[902317]
[20121] 14285: X89666
[20122] H. sapiens mRNA for TPCR100 protein
[20123] gi|902315|emb|X89666.1|HSTPCR100[902315]
[20124] 14291: X73617
[20125] H. sapiens mRNA for T-cell receptor delta
[20126] gi|402624|emb|X73617.1|HSTCRDE[402624]
[20127] 14292: Z79612
[20128] H. sapiens DNA for muscle nicotinic acetylcholine receptor gene promotor, clone
[20129] DBLambda20
[20130] gi|1922318|emb|Z79612.1|HSMNAR3[1922318]
[20131] 14293: Z79611
[20132] H. sapiens DNA for muscle nicotinic acetylcholine receptor gene promotor, clone
[20133] DBLambda23
[20134] gi|1922317|emb|Z79611.1|HSMNAR2[1922317]
[20135] 14294: Z79610
[20136] H. sapiens DNA for muscle nicotinic acetylcholine receptor gene promotor, clone
[20137] ICRFc105F02104
[20138] gi|1922316|emb|Z79610.1|HSMNAR1[1922316]
[20139] 14295: Y09852
[20140] H. sapiens FGFR3 gene, partial
[20141] gi|1922307|emb|Y09852.1|HSFGFR312[1922307]
[20142] 14309: Z46223
[20143] H. sapiens DNA for immunoglobulin G Fc receptor IIIB
[20144] gi|559446|emb|Z46223.1|HSIGGRE3B[559446]
[20145] 14310: Z46222
[20146] H. sapiens DNA for immunoglobulin G Fc receptor 111A
[20147] gi|559445|emb|Z46222.1|HSIGGRE3A[559445]
[20148] 14311: Y09561
[20149] H. sapiens mRNA for P2X7 receptor
[20150] gi|1854511|emb|Y09561.1|HSP2X7[1854511]
[20151] 14312: Y09328
[20152] H. sapiens mRNA for IL13 receptor alpha-1 chain
[20153] gi|1885307|emb|Y09328.1|HSIL13RA1[1885307]
[20154] 14313: Y07593
[20155] H. sapiens mRNA for 46 kDa coxsackievirus and adenovirus receptor (CAR) protein
[20156] gi|1881446|emb|Y07593.1|HS46 KDA[1881446]
[20157] 14314: X07205
[20158] H. sapiens TRGV9 gene, allele V9*A1
[20159] gi|1848089|emb|X07205.1|HSTRGV9[1848089]
[20160] 14315: X15272
[20161] H. sapiens TRGV4F gene
[20162] gi|1841921|emb|X15272.1|HSTRGV4F[1841921]
[20163] 14316: Y11227
[20164] H. sapiens TRGV11 gene
[20165] gi|1848086|emb|Y11227.1|HSTRGV11G[1848086]
[20166] 14317: X74798
[20167] H. sapiens TRGV10 gene, allele V10*A2
[20168] gi|1848083|emb|X74798.1|HSTRGV[1848083]
[20169] 14321: X80878
[20170] H. sapiens R kappa B mRNA
[20171] gi|695578|emb|X80878.1|HSTRGV[695578]
[20172] 14324: X70070
[20173] H. sapiens mRNA for neurotensin receptor
[20174] gi|35020|emb|X70070.1|HSNEURA[35020]
[20175] 14325: X94552
[20176] H. sapiens mRNA for metabotropic glutamate receptor type 7
[20177] gi|1370110|emb|X94552.1|HSMGLU7[1370110]
[20178] 14326: X89105
[20179] H. sapiens krag-like mRNA
[20180] gi|939922|emb|X89105.1|HSKRAGGEN[939922]
[20181] 14327: X92562
[20182] H. sapiens mRNA for myeloid IgA Fc receptor, CD89 (539 bp)
[20183] gi|1296655|emb|X92562.1|HSIGAFCR5[1296655]
[20184] 14328: X92561
[20185] H. sapiens mRNA for myeloid IgA Fc receptor, CD89 (585 bp)
[20186] gi|1296654|emb|X92561.1|HSIGAFCR4[1296654]
[20187] 14329: X92560
[20188] H. sapiens mRNA for myeloid IgA Fc receptor, CD89 (807 bp)
[20189] gi|1296653|emb|X92560.1|HSIGAFCR3[1296653]
[20190] 14330: X92559
[20191] H. sapiens mRNA for myeloid IgA Fc receptor, CD89 (771 bp)
[20192] gi|1296652|emb|X92559.1|HSIGAFCR2[1296652]
[20193] 14331: X92558
[20194] H. sapiens mRNA for myeloid IgA Fc receptor, CD89 (837 bp)
[20195] gi|1296651|emb|X92558.1|HSIGAFCR1[1296651]
[20196] 14332: Z50197
[20197] H. sapiens FGFR2, Bek gene (partial; mutation C)
[20198] gi|929635|emb|Z50197.1|HSFGFR2XC[929635]
[20199] 14333: Z50196
[20200] H. sapiens FGFR2, Bek gene (partial; mutation B)
[20201] gi|929634|emb|Z50196.1|HSFGFR2XB[929634]
[20202] 14334: Z50201
[20203] H. sapiens FGFR2 gene (partial; mutation A)
[20204] gi|929633|emb|Z50201.1|HSFGFR2XA[929633]
[20205] 14335: X72304
[20206] H. sapiens mRNA for corticotrophin releasing factor receptor
[20207] gi|436118|emb|X72304.1|HSCRFA[436118]
[20208] 14336: X86169
[20209] H. sapiens B2-bradykinin receptor gene, exon 2, C allele
[20210] gi|1220165|emb|X86169.1|HSB2BRX2C[1220165]
[20211] 14342: X03131
[20212] H. sapiens interleukin 2 receptor gene 5′ flanking region and exon 1 (and joined
[20213] CDS)
[20214] gi|33818|emb|X03131.1|HSIL2RG1[33818]
[20215] 14343: X57740
[20216] H. sapiens rearranged T-cell receptor gamma chain gene, V3RS-J1 (hybrid joint)
[20217] gi|505478|emb|X57740.1|HSTCRHJD[505478]
[20218] 14344: X01719
[20219] H. sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 7 and
[20220] 8)
[20221] gi|28278|emb|X01719.1|HSACHG5[28278]
[20222] 14345: X01715
[20223] H. sapiens gene fragment for the acetylcholine receptor gamma subunit precursor
[20224] (exons 1 and 2)
[20225] gi|28268|emb|X01715.1|HSACHG1[28268]
[20226] 14535: Z30429
[20227] H. sapiens gene for early lymphocyte activation antigen CD69, exon 4
[20228] gi|534947|emb|Z30429.1|HSLACD694[534947]
[20229] 14536: X89744
[20230] H. sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 4
[20231] gi|1279462|emb|X89744.1|HSCHRNA44[1279462]
[20232] 14537: X87765
[20233] H. sapiens CD89 gene, exon TM/C
[20234] gi|963045|emb|X87765.1|HSCD89EX5[963045]
[20235] 14538: X87766
[20236] H. sapiens CD89 gene, exon EC2
[20237] gi|963044|emb|X87766.1|HSCD89EX4[963044]
[20238] 14539: X87769
[20239] H. sapiens CD89 gene, exon EC1
[20240] gi|963043|emb|X87769.1|HSCD89EX3[963043]
[20241] 14540: X87768
[20242] H. sapiens CD89 gene, exon S2
[20243] gi|963042|emb|X87768.1|HSCD89EX2[963042]
[20244] 14541: X87767
[20245] H. sapiens CD89 gene, exon S1
[20246] gi|963041|emb|X87767.1|HSCD89EX1[963041]
[20247] 14542: AH004970
[20248] Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene
[20249] gi|995299|gb|AH004970.1|SEG_HUMIFNAMO[995299]
[20250] 14543: L42243
[20251] Homo sapiens (clone 51H8) alternatively spliced interferon receptor (IFNAR2) gene, exon 9 and complete cds's
[20252] gi|995298|gb|L42243.1|HUMIFNAM08[995298]
[20253] 14544: L41944
[20254] Homo sapiens interferon receptor ifnar2-1 (splice variant IFNAR2-1) mRNA, complete cds
[20255] gi|995296|gb|L41944.1|HUMIFNAL[995296]
[20256] 14545: L41943
[20257] Homo sapiens interferon receptor ifnar2-3 (splice variant IFNAR2-3) mRNA, complete cds
[20258] gi|995294|gb|L41943.1|HUMIFNAK[995294]
[20259] 14546: L41942
[20260] Homo sapiens interferon receptor ifnar2-2 (splice variant IFNAR2-2) mRNA, complete cds
[20261] gi|995292|gb|L41942.1|HUMIFNAJ[995292]
[20262] 14547: L42242
[20263] Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 8
[20264] gi|994722|gb|L42242.1|HUMIFNAM07[994722]
[20265] 14548: L42241
[20266] Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 7
[20267] gi|994721|gb|L42241.1|HUMIFNAM06[994721]
[20268] 14549: L42323
[20269] Homo sapiens (clone 20D3) interferon receptor (IFNAR2) gene, exon 6
[20270] gi|994720|gb|L42323.1|HUMIFNAM05[994720]
[20271] 14550: L42240
[20272] Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 5
[20273] gi|994719|gb|L42240.1|HUMIFNAM04[994719]
[20274] 14551: L42239
[20275] Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exons 3-4
[20276] gi|994718|gb|L42239.1|HUMIFNAM03[994718]
[20277] 14552: L42238
[20278] Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 2
[20279] gi|994717|gb|L42238.1|HUMIFNAM02[994717]
[20280] 14553: L42237
[20281] Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 1
[20282] gi|994716|gb|L42237.1|HUMIFNAM01[994716]
[20283] 14557: X94647
[20284] H. sapiens CD97 gene exon 20
[20285] gi|1165083|emb|X94647.1|HSX94647[1165083]
[20286] 14558: X94630
[20287] H. sapiens CD97 gene exon 1 (and joined CDS)
[20288] gi|1165073|emb|X94630.1|HSX94630[1165073]
[20289] 14560: X91747
[20290] H. sapiens gene for FSH receptor (exon 10)
[20291] gi|1009412|emb|X91747.1|HSFSHRX10[1009412]
[20292] 14561: X74979
[20293] H. sapiens TRK E mRNA
[20294] gi|400462|emb|X74979.1|HSTRKE[400462]
[20295] 14562: Y10100
[20296] H. sapiens ACTH receptor promoter & exon 1
[20297] gi|1743254|emb|Y10100.11HSACTHPRO[1743254]
[20298] 14563: Y09028
[20299] H. sapiens NTRK1 gene, exon 1 (and joined mRNA)
[20300] gi|1785644|emb|Y09028.1|HSNTRK11[1785644]
[20301] 14564: Y07684
[20302] H. sapiens mRNA for P2X4 purinoceptor
[20303] gi|1781008|emb|Y07684.1|HSP2X4PC[1781008]
[20304] 14565: X95712
[20305] H. sapiens mRNA for receptor protein tyrosine phosphatase
[20306] gi|1666422|emb|X95712.1|HSRPTYRPH[1666422]
[20307] 14568: X97232
[20308] H. sapiens mRNA for NK receptor, clone library D97.10
[20309] gi|1770483|emb|X97232.1|HSNKRD9[1770483]
[20310] 14569: X97233
[20311] H. sapiens mRNA for NK receptor, clone library C97.12#5
[20312] gi|1770481|emb|X97233.1|HSNKRC9[1770481]
[20313] 14570: X97231
[20314] H. sapiens mRNA for NK receptor, clone library 59C/K3
[20315] gi|1770479|emb|X97231.1|HSNKR59[1770479]
[20316] 14571: X97230
[20317] H. sapiens mRNA for NK receptor, clone library 4M1#6
[20318] gi|1770477|emb|X97230.1|HSNKR4M[1770477]
[20319] 14572: X97229
[20320] H. sapiens mRNA for NK receptor, clone library 15.212
[20321] gi|1770475|emb|X97229.1|HSNKR15[1770475]
[20322] 14573: X99481
[20323] H. sapiens mRNA for NK receptor, clone GR #19
[20324] gi|1770473|emb|X99481.1|HSNKGR19[1770473]
[20325] 14574: X99480
[20326] H. sapiens mRNA for NK receptor, clone NK3.3 #27
[20327] gi|1770471|emb|X99480.1|HSNK3327[1770471]
[20328] 14575: X99479
[20329] H. sapiens mRNA for NK receptor, clone 12.11C
[20330] gi|1770469|emb|X99479.1|HSNK1211C[1770469]
[20331] 14576: X98118
[20332] H. sapiens GRK4A gene
[20333] gi|1770421|emb|X98118.1|HSGRK4AGE[1770421]
[20334] 14589: X83864
[20335] H. sapiens EDG-3 gene
[20336] gi|1770395|emb|X83864.1|HSEDG3[1770395]
[20337] 14590: Z48923
[20338] H. sapiens mRNA for BMPR-II
[20339] gi|1009409|emb|Z48923.1|HSBMPRII[1009409]
[20340] 14592: X84939
[20341] H. sapiens mRNA for fibroblast growth factor receptor-3
[20342] gi|695548|emb|X84939.1|HSFGFR3EX[695548]
[20343] 14593: X89604
[20344] H. sapiens mRNA for metallothionein-III
[20345] gi|914850|emb|X89604.1|HSMTIII[914850]
[20346] 14594: Z70276
[20347] H. sapiens mRNA for fibroblast growth factor 12 (partial)
[20348] gi|1749790|emb|Z70276.1|HSFGF12CR[1749790]
[20349] 14595: Z70275
[20350] H. sapiens mRNA for fibroblast growth factor 11 (partial)
[20351] gi|1749788|emb|Z70275.1|HSFGF11CR[1749788]
[20352] 14596: Y09392
[20353] H. sapiens mRNA for WSL-LR, WSL-S1 and WSL-S2 proteins
[20354] gi|1669690|emb|Y09392.1|HSWSL1[1669690]
[20355] 14597: X99031
[20356] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 14
[20357] gi|1480251|emb|X99031.1|HSDRTK14[1480251]
[20358] 14598: X99029
[20359] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 11
[20360] gi|1480247|emb|X99029.1|HSDRTK11[1480247]
[20361] 14599: Y08162
[20362] H. sapiens mRNA for heptahelix receptor
[20363] gi|1707499|emb|Y08162.1|HSHHR[1707499]
[20364] 14600: X98194
[20365] H. sapiens gene encoding serotonin receptor, 5-HT7, exon 3
[20366] gi|1707470|emb|X98194.1|HS5HT73[1707470]
[20367] 14601: X99025
[20368] H. sapiens gene encoding discoidin receptor tyrosine kinase, exons 6 & 7
[20369] gi|1480257|emb|X99025.1|HSDRTK6[1480257]
[20370] 14615: X98147
[20371] H. sapiens gene encoding serotonin receptor, 5-HT7, exon 2
[20372] gi|1707469|emb|X98147.1|HS5HT72[1707469]
[20373] 14616: X98193
[20374] H. sapiens gene encoding serotonin receptor, 5-HT7, exon 1 (and joined CDS)
[20375] gi|1707467|emb|X98193.1|HS5HT71[1707467]
[20376] 14617: X90753
[20377] H. sapiens mRNA for alternatively spliced IgA Fc receptor (CD89)
[20378] gi|951268|emb|X90753.1|HSIGAFCGN[951268]
[20379] 14618: X70812
[20380] H. sapiens gene for beta 3 adrenergic receptor
[20381] gi|312398|emb|X70812.1|HSBARED[312398]
[20382] 14619: Z22971
[20383] H. sapiens mRNA for M130 antigen extracellular variant
[20384] gi|312147|emb|Z22971.1|HSM130AE[312147]
[20385] 14620: Z22970
[20386] H. sapiens mRNA for M130 antigen cytoplasmic variant 2
[20387] gi|312145|emb|Z22970.1|HSM130AC2[312145]
[20388] 14621: Z22969
[20389] H. sapiens mRNA for M130 antigen cytoplasmic variant 1
[20390] gi|312143|emb|Z22969.1|HSM130AC1[312143]
[20391] 14622: Z22968
[20392] H. sapiens mRNA for M130 antigen
[20393] gi|312141|emb|Z22968.1|HSM130A[312141]
[20394] 14623: X69680
[20395] H. sapiens mRNA for bradykinin receptor
[20396] gi|288798|emb|X69680.1|HSBKR[288798]
[20397] 14624: Z79784
[20398] H. sapiens G protein-coupled receptor CKR-L3
[20399] gi|1668737|emb|Z79784.1|HSCKRL3[1668737]
[20400] 14625: Z79782
[20401] H. sapiens G protein-coupled receptor CKR-L1
[20402] gi|1668735|emb|Z79782.1|HSCKRL1[1668735]
[20403] 14626: X94374
[20404] H. sapiens mRNA for HLA class I inhibitory NK receptor (AMC5)
[20405] gi|1495480|emb|X94374.1|HSNKRAMC5[1495480]
[20406] 14627: X94373
[20407] H. sapiens mRNA for HLA class I inhibitory NK receptor (1.1)
[20408] gi|1495478|emb|X94373.1|HSNKR11[1495478]
[20409] 14628: X93596
[20410] H. sapiens mRNA for HLA specific NK receptor
[20411] gi|1495476|emb|X93596.1|HSNKI8[1495476]
[20412] 14629: X93595
[20413] H. sapiens mRNA for NK receptor (clone 17.1C)
[20414] gi|1495474|emb|X93595.1|HSNKI7[1495474]
[20415] 14630: X94262
[20416] H. sapiens mRNA for HLA-Bw4 specific inhibitory NK cell receptor
[20417] gi|1495472|emb|X94262.1|HSNKCRMR[1495472]
[20418] 14631: X89772
[20419] H. sapiens mRNA for interferon alpha/beta receptor (long form)
[20420] gi|1620400|emb|X89772.1|HSRNAIABR[1620400]
[20421] 14632: X69516
[20422] H. sapiens gene for folate receptor
[20423] gi|288876|emb|X69516.1|HSFOLA[288876]
[20424] 14633: X97671
[20425] H. sapiens mRNA for erythropoietin receptor
[20426] gi|1310666|emb|X97671.1|HSERYTHR[1310666]
[20427] 14639: X97874
[20428] H. sapiens EP4 prostaglandin receptor gene, exon III
[20429] gi|1359732|emb|X97874.1|HSEP4EX3[1359732]
[20430] 14640: X97873
[20431] H. sapiens EP4 prostaglandin receptor gene, exons I & II (and joined CDS)
[20432] gi|1359730|emb|X97873.1|HSEP4EX12[1359730]
[20433] 14646: X99404
[20434] H. sapiens mRNA for early response gene, Berg36
[20435] gi|1480242|emb|X99404.1|HSBERG36[1480242]
[20436] 14647: Z49205
[20437] H. sapiens mRNA for purinergic receptor
[20438] gi|798835|emb|Z49205.1|HSATPRMR[798835]
[20439] 14650: X89066
[20440] H. sapiens mRNA for TRPC1 protein
[20441] gi|1370118|emb|X89066.1|HSTRPC1GN[1370118]
[20442] 14671: Y08218
[20443] H. sapiens mRNA for ryanodine receptor 2
[20444] gi|1561613|emb|Y08218.1|HSRYAN2[1561613]
[20445] 14678: X96586
[20446] H. sapiens mRNA for FAN protein
[20447] gi|1556398|emb|X96586.1|HSFAN[1556398]
[20448] 14679: Z48226
[20449] H. sapiens partial gene for receptor-type protein tyrosine phosphatase IA-2
[20450] gi|667014|emb|Z48226.1|HSPTPAIA2[667014]
[20451] 14680: X91665
[20452] H. sapiens B2-bradykinin receptor gene (allele BE-R33)
[20453] gi|121615|emb|X91665.1|HSB2BER33[1216151]
[20454] 14681: L05424
[20455] Human cell surface glycoprotein CD44 (CD44) gene, 3′ end of long tailed isoform
[20456] gi|337956|gb|L05424.1|HUMSCG19[337956]
[20457] 14682: L05423
[20458] Human cell surface glycoprotein CD44 (CD44) gene, exon 18, 3′ end of short tailed isoform
[20459] gi|337955|gb|L05423.1|HUMSCG18[337955]
[20460] 14683: L05422
[20461] Human cell surface glycoprotein CD44 (CD44) gene, exon 17
[20462] gi|337954|gb|L05422.1|HUMSCG17[337954]
[20463] 14684: L05421
[20464] Human cell surface glycoprotein CD44 (CD44) gene, exon 16
[20465] gi|337953|gb|L05421.1|HUMSCG16[337953]
[20466] 14685: L05420
[20467] Human cell surface glycoprotein CD44 (CD44) gene, exon 15
[20468] gi|337952|gb|L05420.1|HUMSCG1S[337952]
[20469] 14686: L05419
[20470] Human cell surface glycoprotein CD44 (CD44) gene, exon 14
[20471] gi|337951|gb|L05419.1|HUMSCG14[337951]
[20472] 14687: L05418
[20473] Human cell surface glycoprotein CD44 (CD44) gene, exon 13
[20474] gi|337950|gb|L05418.1|HUMSCG13[337950]
[20475] 14688: L05417
[20476] Human cell surface glycoprotein CD44 (CD44) gene, exon 12
[20477] gi|337949|gb|L05417.1|HUMSCG12[337949]
[20478] 14689: L05416
[20479] Human cell surface glycoprotein CD44 (CD44) gene, exon 11
[20480] gi|337948|gb|L05416.1|HUMSCG11[337948]
[20481] 14690: L05415
[20482] Human cell surface glycoprotein CD44 (CD44) gene, exon 10
[20483] gi|337947|gb|L05415.1|HUMSCG10[337947]
[20484] 14691: L05414
[20485] Human cell surface glycoprotein CD44 (CD44) gene, exon 9
[20486] gi|337946|gb|L05414.1|HUMSCG09[337946]
[20487] 14692: L05413
[20488] Human cell surface glycoprotein CD44 (CD44) gene, exon 8
[20489] gi|337945|gb|L05413.1|HUMSCG08[337945]
[20490] 14693: L05412
[20491] Human cell surface glycoprotein CD44 (CD44) gene, exon 7
[20492] gi|337944|gb|L05412.1|HUMSCG07[337944]
[20493] 14694: L05411
[20494] Human cell surface glycoprotein CD44 (CD44) gene, exon 6
[20495] gi|337943|gb|L05411.1|HUMSCG06[337943]
[20496] 14695: L05410
[20497] Human cell surface glycoprotein CD44 (CD44) gene, exon 5
[20498] gi|337942|gb|L05410.1|HUMSCG05[337942]
[20499] 14696: L05409
[20500] Human cell surface glycoprotein CD44 (CD44) gene, exon 4
[20501] gi|33794|gb|L05409.1|HUMSCG04[337941]
[20502] 14697: L05408
[20503] Human cell surface glycoprotein CD44 (CD44) gene, exon 3
[20504] gi|337940|gb|L05408.1|HUMSCG03[337940]
[20505] 14698: L05407
[20506] Human cell surface glycoprotein CD44 (CD44) gene, exon 2
[20507] gi|337939|gb|L05407.1|HUMSCG02[337939]
[20508] 14699: M69214
[20509] Human hyaluronate receptor (CD44) gene, exon 1
[20510] gi|180127|gb|M69215.1|HUMSCG01[180127]
[20511] 14700: X91492
[20512] H. sapiens ChemR13 gene
[20513] gi|1262810|emb|X91492.1|HSCCCKR4G[1262810]
[20514] 14701: X91742
[20515] H. sapiens gene for FSH receptor (exon 5)
[20516] gi|1051149|emb|X91742.1|HSFSHRX5[1051149]
[20517] 14702: X91746
[20518] H. sapiens gene for FSH receptor (exon 9)
[20519] gi|1009420|emb|X91746.1|HSFSHRX9[1009420]
[20520] 14703: X91745
[20521] H. sapiens gene for FSH receptor (exon 8)
[20522] gi|1009419|emb|X91745.1|HSFSHRX8[1009419]
[20523] 14704: X91744
[20524] H. sapiens gene for FSH receptor (exon 7)
[20525] gi|1009418|emb|X91744.1|HSFSHRX7[1009418]
[20526] 14705: X91743
[20527] H. sapiens gene for FSH receptor (exon 6)
[20528] gi|1009417|emb|X91743.1|HSFSHRX6[1009417]
[20529] 14706: X91741
[20530] H. sapiens gene for FSH receptor (exon 4)
[20531] gi|1009415|emb|X91741.1|HSFSHRX4[1009415]
[20532] 14707: X91740
[20533] H. sapiens gene for FSH receptor (exon 3)
[20534] gi|1009414|emb|X91740.1|HSFSHRX3[1009414]
[20535] 14708: X91739
[20536] H. sapiens gene for FSH receptor (exon 2)
[20537] gi|1009413|emb|X91739.1|HSFSHRX2[1009413]
[20538] 14709: X91738
[20539] H. sapiens gene for FSH receptor (exon 1)
[20540] gi|1009411|emb|X91738.1|HSFSHRX1[1009411]
[20541] 14710: A34990
[20542] H. sapiens TSH receptor
[20543] gi|1568335|emb|A34990.1|A34990[1568335]
[20544] 14729: A23337
[20545] H. sapiens mRNA for 5-HT2 receptor
[20546] gi|1566776|emb|A23337.1|A23337[1566776]
[20547] 14730: X95095
[20548] H. sapiens mRNA for PDGFRalpha protein
[20549] gi|1403334|emb|X95095.1|HSPDGFRAL[1403334]
[20550] 14731: X91875
[20551] H. sapiens IGF2R gene exon & intron 1
[20552] gi|1017421|emb|X91875.1|HSIGF2R1[1017421]
[20553] 14733: L40636
[20554] Homo sapiens (clone FBK III 16) protein tyrosine kinase (NET PTK) mRNA, complete
[20555] cds
[20556] gi|1100111|gb|L40636.1|HUMEPHT2R[1100111]
[20557] 14734: X55077
[20558] H. sapiens mRNA fragment for alpha-2 macroglobulin receptor
[20559] gi|24762|emb|X55077.1|HSA2MR[24762]
[20560] 14735: X98330
[20561] H. sapiens mRNA for ryanodine receptor 2
[20562] gi|1526977|emb|X98330.1|HSRR2[1526977]
[20563] 14737: X80038
[20564] H. sapiens PRR2 mRNA
[20565] gi|1524087|emb|X80038.1|HSPRR2[1524087]
[20566] 14738: Z15017
[20567] H. sapiens mRNA for glycoprotein 39 (gp39)
[20568] gi|38483|emb|Z15017.1|HSGP39MR[38483]
[20569] 14740: Z36748
[20570] H. sapiens mRNA for serotonin receptor
[20571] gi|558382|emb|Z36748.1|HSSERRC[558382]
[20572] 14741: X97198
[20573] H. sapiens mRNA for receptor phosphate PCP-2
[20574] gi|1502342|emb|X97198.1|HSRECPCP2[1502342]
[20575] 14742: X81870
[20576] H. sapiens DNA for macrophage stimulating protein receptor
[20577] gi|1491705|emb|X81870.1|HSDNAMSPR[1491705]
[20578] 14743: Z11168
[20579] H. sapiens 5HT1A receptor region
[20580] gi|1033027|emb|Z11168.1|HS5HT1A[1033027]
[20581] 14744: M75105
[20582] Human neurokinin-2 receptor (TAC2R) gene, exon 5
[20583] gi|189219|gb|M75105.1|HUMNK25[189219]
[20584] 14745: M75104
[20585] Human neurokinin-2 receptor (NK-2) gene, exon 4
[20586] gi|189218|gb|M75104.1|HUMNK24[189218]
[20587] 14746: M75103
[20588] Human neurokinin-2 receptor (NK-2) gene, exon 3
[20589] gi|189217|gb|M75103.1|HUMNK23[189217]
[20590] 14747: M75102
[20591] Human neurokinin-2 receptor (NK-2) gene, exon 2
[20592] gi|189216|gb|M75102.1|HUMNK22[189216]
[20593] 14748: M75101
[20594] Human neurokinin-2 receptor (TAC2R) gene, exon 1
[20595] gi|189215|gb|M75101.1|HUMNK21[189215]
[20596] 14750: X76981
[20597] H. sapiens mRNA for adenosin receptor A3
[20598] gi|440547|emb|X76981.1|HSRADRA3[440547]
[20599] 14751: X95302
[20600] H. sapiens mRNA for IL13 receptor
[20601] gi|1483349|emb|X95302.1|HSIL13REC[1483349]
[20602] 14752: X51469
[20603] H. sapiens cell receptor gamma-chain J1-C1 DNA fragment (Raji cell line)
[20604] gi|1480294|emb|X51469.1|HSRAJI[1480294]
[20605] 14753: X99027
[20606] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 9
[20607] gi|1480259|emb|X99027.1|HSDRTK9[1480259]
[20608] 14754: X99026
[20609] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 8
[20610] gi|1480258|emb|X99026.1|HSDRTK8[1480258]
[20611] 14755: X99024
[20612] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 5
[20613] gi|1480256|emb|X99024.1|HSDRTK5[1480256]
[20614] 14756: X99023
[20615] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 4
[20616] gi|1480255|emb|X99023.1|HSDRTK4[1480255]
[20617] 14757: X99034
[20618] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 17
[20619] gi|1480254|emb|X99034.1|HSDRTK17[1480254]
[20620] 14758: X99033
[20621] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 16
[20622] gi|1480253|emb|X99033.1|HSDRTK16[1480253]
[20623] 14759: X99032
[20624] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 15
[20625] gi|1480252|emb|X99032.1|HSDRTK15[1480252]
[20626] 14760: X98208
[20627] H. sapiens gene encoding discoidin receptor tyrosine kinase, exons 1, 2, 3 and joined CDS
[20628] gi|1480249|emb|X98208.1|HSDRTK123[1480249]
[20629] 14761: X99030
[20630] H. sapiens gene encoding discoidin receptor tyrosine kinase, exons 12 & 13
[20631] gi|1480248|emb|X99030.1|HSDRTK12[1480248]
[20632] 14762: X99028
[20633] H. sapiens gene encoding discoidin receptor tyrosine kinase, exon 10
[20634] gi|1480246|emb|X99028.1|HSDRTK10[1480246]
[20635] 14763: X51470
[20636] H. sapiens T-cell receptor gamma-chain J1-C1 DNA fragment (D-PLL cell line)
[20637] gi|1480245|emb|X51470.1|HSDPLL[1480245]
[20638] 14764: L76631
[20639] Homo sapiens metabotropic glutamate receptor 1 beta (mGluR1beta) mRNA, complete
[20640] cds
[20641] gi|1477389|gb|L76631.1|HUMMGLUB[1477389]
[20642] 14765: L76627
[20643] Homo sapiens metabotropic glutamate receptor 1 alpha (mGluR1alpha) mRNA, complete cds
[20644] gi|1477387|gb|L76627.1|HUMMGLUB[1477387]
[20645] 14766: L57508
[20646] Homo sapiens Cak receptor kinase mRNA, complete cds
[20647] gi|1160924|gb|L57508.1|HUMCAKA[1160924]
[20648] 14767: L38019
[20649] Homo sapiens (clone HUM-IP3R1) inositol 1,4,5-trisphosphate receptor type 1 mRNA, complete cds
[20650] gi|1464750|gb|L38019.1|HUMITR[1464750]
[20651] 14768: X77748
[20652] H. sapiens mRNA for metabotropic glutamate receptor type 3
[20653] gi|1171563|emb|X77748.1|HSMGLUR3[1171563]
[20654] 14769: M26016
[20655] Human CR2/CD21/C3d/Epstein-Barr virus receptor gene, exon IC
[20656] gi|181935|gb|M26016.1|HUMEBUR13[181935]
[20657] 14770: X63717
[20658] H. sapiens mRNA for APO-1 cell surface antigen
[20659] gi|28741|emb|X63717.1|HSAPO1[28741]
[20660] 14771: L03718
[20661] Human G protein-coupled receptor (kinase-like) gene, complete cds
[20662] gi|183598|gb|L03718.1|HUMGPRKLG[183598]
[20663] 14773: X99269
[20664] H. sapiens NPYY1 gene
[20665] gi|1430810|emb|X99269.1|HSNPYY1[1430810]
[20666] 14774: X95536
[20667] H. sapiens earl gene
[20668] gi|418937|emb|X95536.1|HSREOR[1418937]
[20669] 14775: X63745
[20670] H. sapiens ERD2.2 mRNA for KDEL receptor
[20671] gi|31217|emb|X63745.1|HSERD22[31217]
[20672] 14777: X98133
[20673] H. sapiens gene encoding histamine H2 receptor
[20674] gi|1359758|emb|X98133.1|HSH2R[1359758]
[20675] 14778: X89893
[20676] H. sapiens mRNA for NK receptor (183 ActI)
[20677] gi|1103680|emb|X89893.1|HSNKRECT2[1103680]
[20678] 14779: X89892
[20679] H. sapiens mRNA for NK receptor (Eb6 ActI)
[20680] gi|1103678|emb|X89892.1|HSNKRECT1[1103678]
[20681] 14780: X98178
[20682] H. sapiens mRNA for MACH-beta-4 protein
[20683] gi|1403330|emb|X98178.1|HSMACHB4[1403330]
[20684] 14781: X98177
[20685] H. sapiens mRNA for MACH-beta-3 protein
[20686] gi|1403328|emb|X98177.1|HSMACHB3[1403328]
[20687] 14782: X98175
[20688] H. sapiens mRNA for MACH-beta-2 protein
[20689] gi|1403326|emb|X98175.1|HSMACHB2[1403326]
[20690] 14783: X98176
[20691] H. sapiens mRNA for MACH-beta-1 protein
[20692] gi|1403324|emb|X98176.1|HSMACHB1[1403324]
[20693] 14784: X98173
[20694] H. sapiens mRNA for MACH-alpha-2 protein
[20695] gi|1403320|emb|X98173.1|HSMACHA2[1403320]
[20696] 14785: X67594
[20697] H. sapiens mRNA for MSH receptor
[20698] gi|1405733|emb|X67594.1|HSMSHRECA[1405733]
[20699] 14786: X96597
[20700] H. sapiens gene encoding G protein coupled receptor
[20701] gi|1296631|emb|X96597.1|HSGPCRE[1296631]
[20702] 14789: M88714
[20703] Human bradykinin receptor (BK-2) mRNA, complete cds
[20704] gi|1387999|gb|M88714.1|HUMBK2A[1387999]
[20705] 14790: AH003589
[20706] Homo sapiens sulfonylurea receptor (SUR1) gene
[20707] gi|1374918|gb|AH003589.1|SEG_HUMSUR1G[1374918]
[20708] 14791: L78243
[20709] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 39
[20710] gi|1374917|gb|L78243.1|HUMSUR1G38[1374917]
[20711] 14792: L78242
[20712] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 38
[20713] gi|1374916|gb|L78242.1|HUMSUR1G37[1374916]
[20714] 14793: L78241
[20715] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 37
[20716] gi|1374915|gb|L78241.1|HUMSUR1G36[1374915]
[20717] 14794: L78240
[20718] Homo sapiens sulfonylurea receptor (SUR1) gene, exons 34, 35, and 36
[20719] gi|1374914|gb|L78240.1|HUMSUR1G35[1374914]
[20720] 14795: L78239
[20721] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 33
[20722] gi|1374913|gb|L78239.1|HUMSUR1G34[1374913]
[20723] 14796: L78238
[20724] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 32
[20725] gi|1374912|gb|L78238.1|HUMSUR1G33[1374912]
[20726] 14797: L78237
[20727] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 31
[20728] gi|1374911|gb|L78237.1|HUSUR1G32[1374911]
[20729] 14798: L78236
[20730] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 30
[20731] gi|1374910|gb|L78236.1|HUMSUR1G31[1374910]
[20732] 14799: L78235
[20733] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 29
[20734] gi|1374909|gb|L78235.1|HUMSUR1G30[1374909]
[20735] 14800: L78234
[20736] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 28
[20737] gi|1374908|gb|L78234.1|HUMSUR1G29[1374908]
[20738] 14801: L78233
[20739] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 27
[20740] gi|1374907|gb|L78233.1|HUMSUR1G28[1374907]
[20741] 14802: L78232
[20742] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 26
[20743] gi|1374906|gb|L78232.1|HUMSUR1G27[1374906]
[20744] 14803: L78231
[20745] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 25
[20746] gi|1374905|gb|L78231.1|HUMSUR1G28[1374905]
[20747] 14804: L78230
[20748] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 24
[20749] gi|1374904|gb|L78230.1|HUMSUR1G25[1374904]
[20750] 14805: L78229
[20751] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 23
[20752] gi|1374903|gb|L78229.1|HUMSUR1G24[1374903]
[20753] 14806: L78228
[20754] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 22
[20755] gi|1374902|gb|L78228.1|HUMSUR1G23[1374902]
[20756] 14807: L78227
[20757] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 21
[20758] gi|1374901|gb|L78227.1|HUMSUR1G22[1374901]
[20759] 14808: L78226
[20760] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 20
[20761] gi|1374900|gb|L78226.1|HUMSUR1G21[1374900]
[20762] 14809: L78254
[20763] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 19
[20764] gi|1374899|gb|L78254.1|HUMSUR1G20[1374899]
[20765] 14810: L78225
[20766] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 18
[20767] gi|1374898|gb|L78225.1|HUMSUR1G19[1374898]
[20768] 14811: L78224
[20769] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 17 (alternative)
[20770] gi|1374897|gb|L78224.1|HUMSUR1G18[1374897]
[20771] 14812: L78223
[20772] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 17
[20773] gi|1374896|gb|L78223.1|HUMSUR1G17[1374896]
[20774] 14813: L78222
[20775] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 16
[20776] gi|1374895|gb|L78222.1|HUMSUR1G16[1374895]
[20777] 14814: L78221
[20778] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 15
[20779] gi|1374894|gb|L78221.1|HUMSUR1G15[1374894]
[20780] 14815: L78220
[20781] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 14
[20782] gi|1374893|gb|L78220.1|HUMSUR1G14[1374893]
[20783] 14816: L78219
[20784] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 13
[20785] gi|1374892|gb|L78219.1|HUMSUR1G13[1374892]
[20786] 14817: L78218
[20787] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 12
[20788] gi|1374891|gb|L78218.1|HUMSUR1G12[1374891]
[20789] 14818: L78217
[20790] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 11
[20791] gi|1374890|gb|L78217.1|HUMSUR1G11[1374890]
[20792] 14819: L78216
[20793] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 10
[20794] gi|1374889|gb|L78216.1|HUMSUR1G10[1374889]
[20795] 14820: L78215
[20796] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 9
[20797] gi|1374888|gb|L78215.1|HUMSUR1G09[1374888]
[20798] 14821: L78214
[20799] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 8
[20800] gi|1374887|gb|L78214.1|HUMSUR1G08[1374887]
[20801] 14822: L78213
[20802] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 7
[20803] gi|1374886|gb|L78213.1|HUMSUR1G07[1374886]
[20804] 14823: L78255
[20805] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 6
[20806] gi|1374885|gb|L78255.1|HUMSUR1G06[1374885]
[20807] 14824: L78212
[20808] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 5
[20809] gi|1374884|gb|L78212.1|HUMSUR1G05[1374884]
[20810] 14825: L78211
[20811] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 4
[20812] gi|1374883|gb|L78211.1|HUMSUR1G04[1374883]
[20813] 14826: L78210
[20814] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 3
[20815] gi|1374882|gb|L78210.1|HUMSUR1G03[1374882]
[20816] 14827: L78209
[20817] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 2
[20818] gi|137488|gb|L78209.1|HUMSUR1G02[1374881]
[20819] 14828: L78208
[20820] Homo sapiens sulfonylurea receptor (SUR1) gene, exon 1
[20821] gi|1374880|gb|L78208.1|HUMSUR1G01[1374880]
[20822] 14829: L78207
[20823] Homo sapiens sulfonylurea receptor (SUR1) mRNA, complete cds
[20824] gi|1374674|gb|L78207.1|HUMSUR1RNA[1374674]
[20825] 14830: X80818
[20826] H. sapiens mRNA for metabotropic glutamate receptor type 4
[20827] gi|1160182|emb|X80818.1|HSMGLUR4[1160182]
[20828] 14831: X89068
[20829] H. sapiens mRNA for TRPC3 protein
[20830] gi|1019789|emb|X89068.1|HSTRPC3GN[1019789]
[20831] 14832: X85740
[20832] H. sapiens mRNA for C-C chemokine receptor-4
[20833] gi|1370103|emb|X85740.1|HSCCCR3[1370103]
[20834] 14833: X72924
[20835] H. sapiens STS in the vicinity of the ADRA2C gene, sequence tagged site
[20836] gi|458814|emb|X72924.1|HSADRASTS[458814]
[20837] 14834: A27282
[20838] H. sapiens TGR-CL3C
[20839] gi|1247129|emb|A27282.1|A27282[1247129]
[20840] 14835: A27278
[20841] H. sapiens TGR-CL5
[20842] gi|1247127|emb|A27278.1|A27278[1247127]
[20843] 14836: A27276
[20844] H. sapiens TGR-CL1
[20845] gi|1247125|emb|A27276.1|A27276[1247125]
[20846] 14837: A27270
[20847] H. sapiens TGR-CL10C
[20848] gi|1247123|emb|A27270.1|A27270[1247123]
[20849] 14838: A10542
[20850] H. sapiens low affinity Fc-epsilon-receptor
[20851] gi|489152|emb|A10542.1|A10542[489152]
[20852] 14839: X84700
[20853] H. sapiens mRNA for leucocyte antigen CD97
[20854] gi|840770|emb|X84700.1|HSCD97[840770]
[20855] 14841: X56794
[20856] H. sapiens CD44R mRNA
[20857] gi|29798|emb|X56794.1|HSCD441[29798]
[20858] 14842: Z22924
[20859] H. sapiens of CD36 gene, partial CDS
[20860] gi|397604|emb|Z22924.1|HSCD36AA[397604]
[20861] 14843: X81121
[20862] H. sapiens mRNA for central cannabinoid receptor, short isoform
[20863] gi|736238|emb|X81121.1|HSCB1A[736238]
[20864] 14844: X74328
[20865] H. sapiens mRNA for CB2 (peripheral) cannabinoid receptor
[20866] gi|407806|emb|X74328.1|HSCB2CANR[407806]
[20867] 14852: X81120
[20868] H. sapiens mRNA for central cannabinoid receptor
[20869] gi|736236|emb|X81120.1|HSCANN6[736236]
[20870] 14853: X82466
[20871] H. sapiens mRNA for calcitonin receptor
[20872] gi|565026|emb|X82466.1|HSCALRECR[565026]
[20873] 14854: X69920
[20874] H. sapiens mRNA for calcitonin receptor
[20875] gi|474931|emb|X69920.1|HSCALRE[474931]
[20876] 14855: Z22672
[20877] H. sapiens cacnl1a3 gene encoding skeletal muscle dhp-receptor alpha 1 subunit
[20878] gi|297467|emb|Z22672.1|HSCACN1A[297467]
[20879] 14856: Z35761
[20880] H. sapiens TEL/ABL fusion protien
[20881] gi|601903|emb|Z35761.1|HSBREAKP3[601903]
[20882] 14862: X62515
[20883] H. sapiens mRNA for basement membrane heparan sulfate proteoglycan
[20884] gi|29469|emb|X62515.1|HSBMHSP[29469]
[20885] 14887: X70811
[20886] H. sapiens mRNA for beta 3 adrenergic receptor
[20887] gi|312396|emb|X70811.1|HSBARE[312396]
[20888] 14888: X69117
[20889] H. sapiens mRNA for beta-adrenergic kinase 2
[20890] gi|312394|emb|X69117.1|HSBADRK2[312394]
[20891] 14889: X61157
[20892] H. sapiens mRNA for beta-adrenergic receptor kinase
[20893] gi|288307|emb|X61157.1|HSBARK[288307]
[20894] 14891: X77584
[20895] H. sapiens mRNA for ATL-derived factor/thiredoxin
[20896] gi|453963|emb|X77584.1|HSATLRED[453963]
[20897] 14894: X70297
[20898] H. sapiens mRNA for neuronal nicotinic acetylcholine receptor alpha-7 subunit
[20899] gi|496606|emb|X70297.1|HSARA7A[496606]
[20900] 14901: Z11162
[20901] H. sapiens gene for angiotensin II
[20902] gi|28709|emb|Z11162.1|HSANTENII[28709]
[20903] 14902: X91162
[20904] H. sapiens anti-mullerian hormone type II receptor exon 9
[20905] gi|1107682|emb|X91162.1|HSAMREXO9[1107682]
[20906] 14903: X91164
[20907] H. sapiens anti-mullerian hormone type II receptor exon 11
[20908] gi|1107681|emb|X91164.1|HSAMREX11[1107681]
[20909] 14904: X91163
[20910] H. sapiens anti-mullerian hormone type II receptor exon 10
[20911] gi|1107680|emb|X91163.1|HSAMREX10[1107680]
[20912] 14905: X91161
[20913] H. sapiens anti-mullerian hormone type II receptor exon 8
[20914] gi|1107679|emb|X91161.1|HSAMREX08[1107679]
[20915] 14906: X91160
[20916] H. sapiens anti-mullerian hormone type II receptor exon 7
[20917] gi|1107678|emb|X91160.1|HSAMREX07[1107678]
[20918] 14907: X91159
[20919] H. sapiens anti-mullerian hormone type II receptor exon 6
[20920] gi|1107677|emb|X91159.1|HSAMREX06[1107677]
[20921] 14908: X91158
[20922] H. sapiens anti-mullerian hormone type II receptor exon 5
[20923] gi|1107676|emb|X91158.1|HSAMREX05[1107676]
[20924] 14909: X91157
[20925] H. sapiens anti-mullerian hormone type II receptor exon 4
[20926] gi|1107675|emb|X91157.1|HSAMREX04[1107675]
[20927] 14910: X91165
[20928] H. sapiens anti-mullerian hormone type II receptor exon 3
[20929] gi|1107674|emb|X91165.1|HSAMREX03[1107674]
[20930] 14911: X91166
[20931] H. sapiens anti-mullerian hormone type II receptor exon 2
[20932] gi|1107673|emb|X91166.1|HSAMREX02[1107673]
[20933] 14912: X65699
[20934] H. sapiens mRNA for angiotensin II receptor
[20935] gi|510983|emb|X65699.1|HSANGII[510983]
[20936] 14913: X91156
[20937] H. sapiens anti-mullerian hormone type II receptor exon 1
[20938] gi|1107671|emb|X91156.1|HSAMREX01[1107671]
[20939] 14914: Z22533
[20940] H. sapiens ALK-1 mRNA
[20941] gi|402196|emb|Z22533.1|HSALK1A[402196]
[20942] 14915: Z22536
[20943] Homo sapiens ALK-4 mRNA, complete CDS
[20944] gi|402188|emb|Z22536.1|HSALK4A[402188]
[20945] 14916: Z22535
[20946] H. sapiens ALK-3 mRNA
[20947] gi|402186|emb|Z22535.1|HSALK3A[402186]
[20948] 14917: Z22534
[20949] H. sapiens ALK-2 mRNA
[20950] gi|402184|emb|Z22534.1|HSALK2A[402184]
[20951] 14918: X59684
[20952] H. sapiens DNA for alpha2-1.8 adrenergic receptor gene
[20953] gi|28635|emb|X59684.1|HSALPH218[28635]
[20954] 14919: Z11687
[20955] H. sapiens mRNA for antidiuretic hormone receptor
[20956] gi|28417|emb|Z11687.1|HSADHRMR[28417]
[20957] 14920: X77533
[20958] H. sapiens mRNA for activin type II receptor
[20959] gi|825619|emb|X77533.1|HSACTIIRE[825619]
[20960] 14921: X62381
[20961] H. sapiens mRNA for activin receptor
[20962] gi|28347|emb|X62381.1|HSACTR[28347]
[20963] 14922: X65633
[20964] H. sapiens ACTH-R gene for adrenocorticotropic hormone receptor
[20965] gi|28343|emb|X65633.1|HSACTHR[28343]
[20966] 14923: X55019
[20967] H. sapiens mRNA for acetylcholine receptor delta subunit
[20968] gi|297401|emb|X55019.1|HSACHRG[297401]
[20969] 14924: X02508
[20970] H. sapiens gene fragment for acetylcholine receptor (AChR) alpha subunit exons 8,
[20971] 9 and 3′ flanking region
[20972] gi|28306|emb|X02508.1|HSACHR8[28306]
[20973] 14925: X02507
[20974] H. sapiens gene fragment for acetylcholine receptor (AChR) alpha subunit exon 7
[20975] gi|28304|emb|X02507.1|HSACHR7[28304]
[20976] 14926: X02506
[20977] H. sapiens gene fragment for acetylcholine receptor (AChR) alpha-subunit exon 6
[20978] gi|28302|emb|X02506.1|HSACHR6[28302]
[20979] 14927: X83956
[20980] H. sapiens ACCA gene
[20981] gi|1061125|emb|X83956.1|HSACCAGEN[1061125]
[20982] 14928: X66403
[20983] H. sapiens mRNA for acetylcholine receptor (epsilon subunit)
[20984] gi|560152|emb|X66403.1|HSACETR[560152]
[20985] 14929: X02505
[20986] H. sapiens gene fragment for acetylcholine receptor (AChR) alpha subunit exon 5
[20987] gi|28300|emb|X02505.1|HSACHR5[28300]
[20988] 14930: X02504
[20989] H. sapiens gene fragment for acetylcholine receptor (AChR) alpha-subunit exon 4
[20990] gi|28298|emb|X02504.1|HSACHR4[28298]
[20991] 14931: X02503
[20992] H. sapiens gene fragment for acetylcholine receptor (AChR) alpha-subunit exons 2 and 3
[20993] gi|28293|emb|X02503.1|HSACHR2[28293]
[20994] 14932: X02502
[20995] H. sapiens gene fragment for acetylcholine receptor (AChR) alpha-subunit exon
[20996] gi|28291|emb|X02502.1|HSACHR[28291]
[20997] 14933: X04759
[20998] H. sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 12)
[20999] gi|28288|emb|X04759.1|HSACHG8[28288]
[21000] 14934: X01721
[21001] H. sapiens gene fragment for the acetylcholine receptor gamma subunit (exons and 11)
[21002] gi|28286|emb|X01721.1|HSACHG7[28286]
[21003] 14935: X01720
[21004] H. sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 9)
[21005] gi|28283|emb|X01720.1|HSACHG6[28283]
[21006] 14936: X01718
[21007] H. sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 6)
[21008] gi|28276|emb|X01718.1|HSACHG4[28276]
[21009] 14937: X01717
[21010] H. sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 5)
[21011] gi|28274|emb|X01717.1|HSACHG3[28274]
[21012] 14938: X01716
[21013] H. sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 3 and
[21014] 4)
[21015] gi|28271|emb|X01716.1|HSACHG2[28271]
[21016] 14939: X77018
[21017] H. sapiens mRNA for anti-acetylcholine receptor monoclonal autoantibody V lambda
[21018] region
[21019] gi|441251|emb|X77018.1|HSAARMA2[441251]
[21020] 14941: X68487
[21021] H. sapiens mRNA for A2b adenosine receptor
[21022] gi|400453|emb|X68487.1|HSA2BREC[400453]
[21023] 14942: X68486
[21024] H. sapiens mRNA for A2a adenosine receptor
[21025] gi|400451|emb|X68486.1|HSA2AREC[400451]
[21026] 14943: X68485
[21027] H. sapiens mRNA for A1 adenosine receptor
[21028] gi|400449|emb|X68485.1|HSA1ADREC[400449]
[21029] 14948: X87197
[21030] H. sapiens mRNA for 6.3 gene
[21031] gi|854083|emb|X87197.1|HS63MRNAG[854083]
[21032] 14949: X81412
[21033] H. sapiens DNA for 5-HT5A exon2
[21034] gi|541777|emb|X81412.1|HS5HT5A2[541777]
[21035] 14950: X81411
[21036] H. sapiens DNA for 5-HT5A exon1
[21037] gi|541776|emb|X81411.1|HS5HT5A1[541776]
[21038] 14952: X77307
[21039] H. sapiens mRNA for 5-HT2B serotonin receptor
[21040] gi|475197|emb|X77307.1|HS5HT2BSR[475197]
[21041] 14968: X75299
[21042] H. sapiens HIVR mRNA for vasoactive intestinal peptide (VIP) receptor
[21043] gi|407461|emb|X75299.1|HSVIPRE[407461]
[21044] 14969: X94216
[21045] H. sapiens mRNA for VEGF-C protein
[21046] gi|1177488|emb|X94216.1|HSVEGFC[1177488]
[21047] 14971: X67482
[21048] H. sapiens mRNA for 1,25-dihydroxyvitamin D-3 receptor
[21049] gi|37653|emb|X67482.1|HSVD3R[37653]
[21050] 14976: Z46797
[21051] H. sapiens gene for urokinase receptor (partial)
[21052] gi|732804|emb|Z46797.1|HSUPAR5[732804]
[21053] 14977: X74039
[21054] H. sapiens mRNA for urokinase plasminogen activator receptor
[21055] gi|456192|emb|X74039.1|HSUPAR[456192]
[21056] 14984: X51675
[21057] H. sapiens urokinase plasminogen activator surface receptor (UPAR) mRNA
[21058] gi|37604|emb|X51675.1|HSUPARAA[37604]
[21059] 14985: X76498
[21060] H. sapiens gene for uterine bombesin receptor
[21061] gi|468753|emb|X76498.1|HSUBR[468753]
[21062] 14986: X66029
[21063] H. sapiens mRNA for tyrosine kinase receptor
[21064] gi|37596|emb|X66029.1|HSUFOR[37596]
[21065] 14987: X66030
[21066] Homo sapiens partial ufo gene encoding tyrosine kinase receptor
[21067] gi|37594|emb|X66030.1|HSUFOD[37594]
[21068] 14998: X72089
[21069] H. sapiens mRNA for TRH receptor
[21070] gi|440155|emb|X72089.1|HSTRHREC[440155]
[21071] 15005: X72018
[21072] H. sapiens hTGR 1 mRNA
[21073] gi|1200088|emb|X72018.1|HSTGR1[1200088]
[21074] 15006: X69178
[21075] H. sapiens mRNA for thyrotropin receptor, partial
[21076] gi|288212|emb|X69178.1|HSTHREC[288212]
[21077] 15007: X69177
[21078] H. sapiens mRNA for thyrotropin receptor, partial
[21079] gi|288211|emb|X69177.1|HSTHRE[288211]
[21080] 15246: X65181
[21081] H. sapiens gene for substance P receptor (exon 5)
[21082] gi|36640|emb|X65181.1|HSSUBP5G[36640]
[21083] 15247: X65180
[21084] H. sapiens gene for substance P receptor (exon 4)
[21085] gi|36639|emb|X65180.1|HSSUBP4G[36639]
[21086] 15248: X65179
[21087] H. sapiens gene for substance P receptor (exon 3)
[21088] gi|36638|emb|X65179.1|HSSUBP3G[36638]
[21089] 15249: X65177
[21090] H. sapiens gene for substance P receptor (exon 1)
[21091] gi|36636|emb|X65177.1|HSSUBP1G[36636]
[21092] 15253: X62156
[21093] H. sapiens mRNA for soluble interleukin-5 receptor
[21094] gi|36465|emb|X62156.1|HSSILRS[36465]
[21095] 15254: X57830
[21096] H. sapiens serotonin 5-HT2 receptor mRNA
[21097] gi|36430|emb|X57830.1|HSSERR52[36430]
[21098] 15255: Z11166
[21099] H. sapiens S31 gene for serotonin receptor
[21100] gi|36264|emb|Z11166.1|HSS31G[36264]
[21101] 15256: X91869
[21102] H. sapiens mRNA for ryanodine receptor
[21103] gi|1022320|emb|X91869.1|HSRYR2[1022320]
[21104] 15257: X74269
[21105] H. sapiens RYR3 mRNA for ryanodine receptor type 3 (partial)
[21106] gi|405718|emb|X74269.1|HSRYR3MR[405718]
[21107] 15258: X74270
[21108] H. sapiens RYR3 gene for ryanodine receptor type 3 (partial)
[21109] gi|405716|emb|X74270.1|HSRYR3G[405716]
[21110] 15261: Z27409
[21111] H. sapiens mRNA for receptor tyrosine kinase eph (partial)
[21112] gi|482916|emb|Z27409.1|HSRTKEPH[482916]
[21113] 15262: X74764
[21114] H. sapiens mRNA for receptor protein tyrosine kinase
[21115] gi|433337|emb|X74764.1|HSRPTK[433337]
[21116] 15265: X59155
[21117] H. sapiens retroviral receptor mRNA
[21118] gi|36160|emb|X59155.1|HSRRMRNA[36160]
[21119] 15267: X70040
[21120] H. sapiens RON mRNA for tyrosine kinase
[21121] gi|36109|emb|X70040.1|HSRON[36109]
[21122] 15268: X75071
[21123] H. sapiens mRNA for human thyrotropin-releasing hormone receptor
[21124] gi|404157|emb|X75071.1|HSRNAHTRH[404157]
[21125] 15269: X86446
[21126] H. sapiens mRNA for 55.11 binding protein
[21127] gi|1008088|emb|X86446.1|HSRNA5511[1008088]
[21128] 15270: Z29093
[21129] H. sapiens EDDR1 gene for receptor tyrosine kinase
[21130] gi|732799|emb|Z29093.1|HSRETYK1[732799]
[21131] 15274: X64123
[21132] H. sapiens PVR gene for poliovirus receptor (exon 8)
[21133] gi|35819|emb|X64123.1|HSPVR8G[35819]
[21134] 15275: X64122
[21135] H. sapiens PVR gene for poliovirus receptor (exon 7)
[21136] gi|35818|emb|X64122.1|HSPVR7G[35818]
[21137] 15276: X64121
[21138] H. sapiens PVR gene for poliovirus receptor (exon 6)
[21139] gi|35817|emb|X64121.1|HSPVR6G[35817]
[21140] 15277: X64120
[21141] H. sapiens PVR gene for poliovirus receptor (exon 5)
[21142] gi|35816|emb|X64120.1|HSPVR5G[35816]
[21143] 15278: X64119
[21144] H. sapiens PVR gene for poliovirus receptor (exon 4)
[21145] gi|35815|emb|X64119.1|HSPVR4G[35815]
[21146] 15279: X64118
[21147] H. sapiens PVR gene for poliovirus receptor (exon 3)
[21148] gi|35814|emb|X64118.1|HSPVR3G[35814]
[21149] 15280: X64117
[21150] H. sapiens PVR gene for poliovirus receptor (exon 2)
[21151] gi|35813|emb|X64117.1|HSPVR2G[35813]
[21152] 15281: X64116
[21153] H. sapiens PVR gene for poliovirus receptor (exon 1)
[21154] gi|35809|emb|X64116.1|HSPVR1G[35809]
[21155] 15283: X75208
[21156] H. sapiens HEK2 mRNA for protein tyrosine kinase receptor
[21157] gi|406867|emb|X75208.1|HSPTKR[406867]
[21158] 15284: X65178
[21159] H. sapiens gene for substance P receptor (exon 2)
[21160] gi|35653|emb|X65178.1|HSPREC2G[35653]
[21161] 15285: X94226
[21162] H. sapiens poliovirus receptor gene
[21163] gi|1185121|emb|X94226.1|HSPOLR[1185121]
[21164] 15288: X73079
[21165] Homo sapiens encoding Polymeric immunoglobulin receptor
[21166] gi|456345|emb|X73079.1|HSPIR[456345]
[21167] 15291: X68596
[21168] H. sapiens mRNA for parathyroid hormone receptor
[21169] gi|396812|emb|X68596.1|HSPHR[396812]
[21170] 15302: X76079
[21171] H. sapiens mRNA for platelet derived growth factor alpha receptor
[21172] gi|433494|emb|X76079.1|HSPDGF[433494]
[21173] 15311: Z49993
[21174] H. sapiens partial gene for proteinase-activated receptor 2 (292 BP)
[21175] gi|1008084|emb|Z49993.1|HSPAR2A[1008084]
[21176] 15321: X80022
[21177] H. sapiens p75 TNF receptor, exon 2
[21178] gi|666045|emb|X80022.1|HSP75NFR2[666045]
[21179] 15322: X80021
[21180] H. sapiens p75 TNF receptor, exon 1
[21181] gi|666044|emb|X80021.1|HSP75NFR1[666044]
[21182] 15323: X69810
[21183] H. sapiens gene for p55 tumor necrosis factor receptor, exon 1
[21184] gi|288493|emb|X69810.1|HSP55TNF[288493]
[21185] 15324: X83688
[21186] H. sapiens mRNA for ATP receptor
[21187] gi|1166437|emb|X83688.1|HSP2XRCPR[1166437]
[21188] 15325: X77130
[21189] H. sapiens mRNA for ORL1 receptor
[21190] gi|471316|emb|X77130.1|HSORL1[471316]
[21191] 15327: X71635
[21192] H. sapiens mRNA for neuropeptide Y-like receptor
[21193] gi|297099|emb|X71635.1|HSNPYRLA[297099]
[21194] 15328: X71445
[21195] H. sapiens partial NTRK1 gene, involved in oncogenic rearrangements
[21196] gi|296536|emb|X71445.1|HSNTRK1[296536]
[21197] 15329: X66945
[21198] H. sapiens N-sam mRNA for fibroblast growth factor receptor
[21199] gi|35109|emb|X66945.1|HSNSAMTK[35109]
[21200] 15330: X75918
[21201] H. sapiens mRNA for NOT
[21202] gi|415822|emb|X75918.1|HSNOT[415822]
[21203] 15331: Z32774
[21204] H. sapiens gene for N-methyl-D-aspartate receptor R1 exons 6-21
[21205] gi|807894|emb|Z32774.1|HSNMDAR1C[807894]
[21206] 15332: Z32773
[21207] H. sapiens gene for N-methyl-D-aspartate receptor R1 exons 3, 4, 5
[21208] gi|807893|emb|Z32773.1|HSNMDAR1B[807893]
[21209] 15333: Z32772
[21210] H. sapiens gene for N-methyl-D-aspartate receptor R1, exon1, exon2
[21211] gi|807892|emb|Z32772.1|HSNMDAR1A[807892]
[21212] 15334: X68275
[21213] H. sapiens mRNA for nicotinic receptor beta 4 subunit
[21214] gi|35054|emb|X68275.1|HSNICRB[35054]
[21215] 15335: X65176
[21216] H. sapiens gene for neuromedin K receptor (exon 5)
[21217] gi|35027|emb|X65176.1|HSNEURK5[35027]
[21218] 15336: X65175
[21219] H. sapiens gene for neuromedin K receptor (exon 4)
[21220] gi|35026|emb|X65175.1|HSNEURK4[35026]
[21221] 15337: X65174
[21222] H. sapiens gene for neuromedin K receptor (exon 3)
[21223] gi|35025|emb|X65174.1|HSNEURK3[35025]
[21224] 15338: X65173
[21225] H. sapiens gene for neuromedin K receptor (exon 2)
[21226] gi|35024|emb|X65173.1|HSNEURK2[35024]
[21227] 15339: X65172
[21228] H. sapiens gene for neuromedin K receptor (exon 1)
[21229] gi|35022|emb|X65172.1|HSNEURK1[35022]
[21230] 15340: X87629
[21231] H. sapiens mRNA for nicotinic acetylcholine receptor alpha4 subunit
[21232] gi|854158|emb|X87629.1|HSNACRA4G[854158]
[21233] 15341: X70108
[21234] H. sapiens gene for nicotinic acetylcholine receptor alpha subunit, partial
[21235] gi|312470|emb|X70108.1|HSNACHRA[312470]
[21236] 15342: X67513
[21237] H. sapiens mRNA for neuronal nAChR beta-3 subunit
[21238] gi|34987|emb|X67513.1|HSNACHRB3[34987]
[21239] 15343: X53559
[21240] H. sapiens Hachr alpha-3 mRNA for mature neuronal nicotinic acetylcholine receptor alpha-3 subunit
[21241] gi|34985|emb|X53559.1|HSNACHRA3[34985]
[21242] 15344: X63131
[21243] H. sapiens My1 (PML) mRNA
[21244] gi|34813|emb|X63131.1|HSMY1[34813]
[21245] 15345: X65634
[21246] H. sapiens MSH-R gene for melanocyte stimulating hormone receptor
[21247] gi|34790|emb|X65634.1HSMSHR[34790]
[21248] 15346: X64878
[21249] H. sapiens mRNA for oxytocin receptor
[21250] gi|34764|emb|X64878.1|HSMRNAOXY[34764]
[21251] 15347: X84709
[21252] H. sapiens mRNA for mediator of receptor-induced toxicity
[21253] gi|791037|emb|X84709.1|HSMRINTX[791037]
[21254] 15348: X55635
[21255] H. sapiens mRNA for macrophage mannose receptor
[21256] gi|34702|emb|X55635.1|HSMMR[34702]
[21257] 15349: Z25470
[21258] H. sapiens melanocortin 5 receptor gene, complete CDS
[21259] gi|939924|emb|Z25470.1|HSMELRECA[939924]
[21260] 15350: X68829
[21261] H. sapiens mRNA for MDR15 protein
[21262] gi|840783|emb|X68829.1|HSMDCR[840783]
[21263] 15351: X61615
[21264] H. sapiens mRNA for leukemia inhibitory factor (LIF) receptor
[21265] gi|34365|emb|X61615.1|HSLIFR[34365]
[21266] 15374: X86128
[21267] H. sapiens mRNA for ood T lymphocyte
[21268] gi|1197254|emb|X86128.1|HSLAB2725[1197254]
[21269] 15375: Z30428
[21270] H. sapiens gene for early lymphocyte activation antigen CD69, exon 5
[21271] gi|536775|emb|Z30428.1|HSLACD695[536775]
[21272] 15376: Z30430
[21273] H. sapiens gene for early lymphocyte activation antigen CD69, exon 2
[21274] gi|535122|emb|Z30430.1|HSLACD692[535122]
[21275] 15398: X69304
[21276] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 4
[21277] gi|34093|emb|X69304.1HSKITPO04[34093]
[21278] 15399: X69303
[21279] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 3
[21280] gi|34092|emb|X69303.1|HSKITPO03[34092]
[21281] 15400: X69302
[21282] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 2
[21283] gi|34091|emb|X69302.1|HSKITPO02[34091]
[21284] 15401: X69301
[21285] H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon 1
[21286] gi|34089|emb|X69301.1|HSKITPO01[34089]
[21287] 15405: X03138
[21288] H. sapiens interleukin 2 receptor gene exon 8 and 3′ untranslated region
[21289] gi|33830|emb|X03138.1|HSIL2RG8[33830]
[21290] 15406: X03137
[21291] H. sapiens interleukin 2 receptor gene exon 7
[21292] gi|33829|emb|X03137.1|HSIL2RG7[33829]
[21293] 15407: X03136
[21294] H. sapiens interleukin 2 receptor gene exon 6
[21295] gi|33827|emb|X03136.1|HSIL2RG6[33827]
[21296] 15408: X03135
[21297] H. sapiens interleukin 2 receptor gene exon 5
[21298] gi|33825|emb|X03135.1|HSIL2RG5[33825]
[21299] 15409: X03134
[21300] H. sapiens interleukin 2 receptor gene exon 4
[21301] gi|33823|emb|X03134.1|HSIL2RG4[33823]
[21302] 15410: X03133
[21303] H. sapiens interleukin 2 receptor gene exon 3
[21304] gi|33822|emb|X03133.1|HSIL2RG3[33822]
[21305] 15411: X03132
[21306] H. sapiens interleukin 2 receptor gene exon 2
[21307] gi|33820|emb|X03132.1|HSIL2RG2[33820]
[21308] 15412: X84348
[21309] H. sapiens mRNA for intracellular IL-1 receptor antagonist type II
[21310] gi|1008970|emb|X84348.1|HSIL1RAII[1008970]
[21311] 15413: Z46595
[21312] H. sapiens mRNA for interleukin 11 receptor isoform (incomplete)
[21313] gi|995655|emb|Z46595.1|HSIL11RR[995655]
[21314] 15414: Z38102
[21315] H. sapiens mRNA for interleukin-11 receptor
[21316] gi|995653|emb|Z38102.1|HSIL11RM[995653]
[21317] 15415: Z46596
[21318] H. sapiens gene for interleukin 11 receptor
[21319] gi|995652|emb|Z46596.1|HSIL11RGN[995652]
[21320] 15416: X59770
[21321] H. sapiens IL-1R2 mRNA for type II interleukin-1 receptor, (cell line CB23)
[21322] gi|33796|emb|X59770.1|HSIL1R211[33796]
[21323] 15421: X77722
[21324] H. sapiens mRNA for interferon alpha/beta receptor
[21325] gi|488363|emb|X77722.1|HSIFNABR[488363]
[21326] 15423: X53296
[21327] H. sapiens mRNA for IRAP
[21328] gi|32578|emb|X53296.1|HSI1RAP[32578]
[21329] 15424: X52015
[21330] H. sapiens mRNA for interleukin-1 receptor antagonist
[21331] gi|32576|emb|X52015.1|HSI1RA[32576]
[21332] 15425: X64993
[21333] H. sapiens mRNA HTPCRX19 for olfactory receptor
[21334] gi|32523|emb|X64993.1|HSHTPRX19[32523]
[21335] 15426: X64992
[21336] H. sapiens mRNA HTPCRX18 for olfactory receptor
[21337] gi|32522|emb|X64992.1|HSHTPRX18[32522]
[21338] 15427: X64991
[21339] H. sapiens mRNA HTPCRX17 for olfactory receptor
[21340] gi|32521|emb|X64991.1|HSHTPRX17[32521]
[21341] 15428: X64990
[21342] H. sapiens mRNA HTPCRX16 for olfactory receptor
[21343] gi|32520|emb|X64990.1|HSHTPRX16[32520]
[21344] 15429: X64989
[21345] H. sapiens mRNA HTPCRX15 for olfactory receptor
[21346] gi|32519|emb|X64989.1|HSHTPRX15[32519]
[21347] 15430: X64988
[21348] H. sapiens mRNA HTPCRX14 for olfactory receptor
[21349] gi|32518|emb|X64988.1|HSHTPRX14[32518]
[21350] 15431: X64987
[21351] H. sapiens mRNA HTPCRX13 for olfactory receptor
[21352] gi|32517|emb|X64987.1|HSHTPRX13[32517]
[21353] 15432: X64986
[21354] H. sapiens mRNA HTPCRX12 for olfactory receptor
[21355] gi|32516|emb|X64986.1|HSHTPRX12[32516]
[21356] 15433: X64985
[21357] H. sapiens mRNA HTPCRX11 for olfactory receptor
[21358] gi|32515|emb|X64985.1|HSHTPRX11[32515]
[21359] 15434: X64984
[21360] H. sapiens mRNA HTPCRX10 for olfactory receptor
[21361] gi|32514|emb|X64984.1|HSHTPRX10[32514]
[21362] 15435: X64983
[21363] H. sapiens mRNA HTPCRX09 for olfactory receptor
[21364] gi|32513|emb|X64983.1|HSHTPRX09[32513]
[21365] 15436: X64982
[21366] H. sapiens mRNA HTPCRX06 for olfactory receptor
[21367] gi|32512|emb|X64982.1|HSHTPRX06[32512]
[21368] 15437: X64981
[21369] H. sapiens mRNA HTPCRX03 for olfactory receptor
[21370] gi|32511|emb|X64981.1|HSHTPRX03[32511]
[21371] 15438: X64980
[21372] H. sapiens mRNA HTPCRX02 for olfactory receptor
[21373] gi|32510|emb|X64Y80.1|HSHTPRX02[32510]
[21374] 15439: X64979
[21375] H. sapiens mRNA HTPCRX01 for olfactory receptor
[21376] gi|32509|emb|X64979.1|HSHTPRX01[32509]
[21377] 15440: X64974
[21378] H. sapiens mRNA HTPCRH02 for olfactory receptor
[21379] gi|32508|emb|X64974.1|HSHTPRH02[32508]
[21380] 15441: X64978
[21381] H. sapiens mRNA HTPCRH07 for olfactory receptor
[21382] gi|32507|emb|X64978.1|HSHTPRH07[32507]
[21383] 15442: X64977
[21384] H. sapiens mRNA HTPCRH06 for olfactory receptor
[21385] gi|32506|emb|X64977.1|HSHTPRH06[32506]
[21386] 15443: X64976
[21387] H. sapiens mRNA HTPCRH04 for olfactory receptor
[21388] gi|32505|emb|X64976.1|HSHTPRH04[32505]
[21389] 15444: X64975
[21390] H. sapiens mRNA HTPCRH03 for olfactory receptor
[21391] gi|32504|emb|X64975.1|HSHTPRH03[32504]
[21392] 15445: X58288
[21393] H. sapiens hR-PTPu gene for protein tyrosine phosphatase
[21394] gi|32455|emb|X58288.1|HSHRPTPU[32455]
[21395] 15449: X64995
[21396] H. sapiens HGMP07J gene for olfactory receptor
[21397] gi|32092|emb|X64995.1|HSHGMP07J[32092]
[21398] 15450: X64994
[21399] H. sapiens HGMP07I gene for olfactory receptor
[21400] gi|32085|emb|X64994.1|HSHGM071[32085]
[21401] 15451: X17653
[21402] H. sapiens hFcRII-C isoform mRNA for IgG Fc receptor hFcRII
[21403] gi|32076|emb|X17653.1|HSHFCRIIC[32076]
[21404] 15452: X17652
[21405] H. sapiens hFcRII-B isoform mRNA for IgG Fc receptor hFcRII
[21406] gi|32073|emb|X17652.1|HSHFCRIIB[32073]
[21407] 15453: X53364
[21408] H. sapiens HePTP mRNA for tyrosine phosphatase
[21409] gi|32066|emb|X53364.1|HSHEPTP[32066]
[21410] 15454: X64830
[21411] H. sapiens mRNA for GLU-R2 glutamate receptor subunit, ‘flop’ exon
[21412] gi|31911|emb|X64830.1|HSGRSFLOP[31911]
[21413] 15455: X64829
[21414] H. sapiens mRNA for GLU-R2 glutamate receptor subunit, ‘flip’ exon
[21415] gi|31910|emb|X64829.1|HSGRSFLIP[31910]
[21416] 15456: X75897
[21417] H. sapiens mRNA for G-protein coupled kinase 4
[21418] gi|483764|emb|X75897.1|HSGRK4[483764]
[21419] 15460: X52009
[21420] H. sapiens alpha-1 strychnine binding subunit of inhibitory glycine receptor mRNA
[21421] gi|3185|emb|X52009.1|HSGLYRA2[31850]
[21422] 15461: X52008
[21423] H. sapiens alpha-2 strychnine binding subunit of inhibitory glycine receptor mRNA
[21424] gi|31848|emb|X52008.1|HSGLYRA1[31848]
[21425] 15462: X82068
[21426] H. sapiens mRNA for glutamate receptor subunit GluRC
[21427] gi|558587|emb|X82068.1|HSGLURC[558587]
[21428] 15463: X58633
[21429] H. sapiens mRNA for glutamate receptor GLUR1
[21430] gi|414892|emb|X58633.1|HSGLUR1[414892]
[21431] 15464: X81832
[21432] H. sapiens mRNA for glucose-dependant insulinotropic polypeptide receptor gene
[21433] gi|11030050 emb|X81832.1|HSGDIPR[1030050]
[21434] 15465: X61656
[21435] H. sapiens mRNA for growth factor receptor tyrosine kinase
[21436] gi|31717|emb|X61656.1|HSGFRTK[31717]
[21437] 15466: X55037
[21438] H. sapiens GATA-3 mRNA
[21439] gi|31661|emb|X55037.1|HSGATA3[31661]
[21440] 15467: X63670
[21441] H. sapiens DNA sequence for polymorphism at the GABA receptor B3
[21442] gi|31638|emb|X63670.1|HSGABRB3[31638]
[21443] 15472: Z34260
[21444] H. sapiens DNA for follicle stimulating hormone (FSH) receptor
[21445] gi|1052701|emb|Z34260.1|HSFSHX1[1052701]
[21446] 15473: X68044
[21447] H. sapiens mRNA for follicle-stimulating hormone receptor
[21448] gi|31473|emb|X68044.1|HSFSTHR[31473]
[21449] 15474: Z46619
[21450] H. sapiens mRNA for immunoglobulin kappa chain (fsa10)
[21451] gi|575235|emb|Z46619.1|HSFSA10KA[575235]
[21452] 15475: Z46615
[21453] H. sapiens DNA for immunoglobulin kappa chain (fsa10glk)
[21454] gi|575234|emb|Z46615.1|HSFSA10GL[575234]
[21455] 15476: Z32633
[21456] H. sapiens FRGAMMA′ mRNA for folate receptor (817 bp)
[21457] gi|474060|emb|Z32633.1|HSFRGAM2[474060]
[21458] 15477: Z32564
[21459] H. sapiens FRGAMMA mRNA (819 bp) for folate receptor
[21460] gi|473235|emb|Z32564.1|HSFRGAM1[473235]
[21461] 15478: X69878
[21462] H. sapiens Flt4 mRNA for transmembrane tyrosine kinase
[21463] gi|297049|emb|X69878.1|HSFLT4X[297049]
[21464] 15479: X68203
[21465] H. sapiens mRNA for FLT4, class III receptor tyrosine kinase
[21466] gi|31433|emb|X68203.1|HSFLT4[31433]
[21467] 15480: X62573
[21468] H. sapiens RNA for Fc receptor, TC9
[21469] gi|31339|emb|X62573.1|HSFCTC6[31339]
[21470] 15481: X66187
[21471] H. sapiens FceRI mRNA, partial CDS
[21472] gi|396463|emb|X66187.1|HSFCERIGB[396463]
[21473] 15482: X62572
[21474] H. sapiens RNA for Fc receptor, PC23
[21475] gi|31328|emb|X62572.1|HSFCPC23[31328]
[21476] 15483: Z46618
[21477] H. sapiens mRNA for immunoglobulin lambda chain (f29)
[21478] gi|575230|emb|Z46618.1|HSF29LAM[575230]
[21479] 15484: Z46634
[21480] H. sapiens mRNA for immunoglobulin kappa chain (f29)
[21481] gi|575228|emb|Z46634.1|HSF29KAP[575228]
[21482] 15485: X61950
[21483] H. sapiens mRNA for endothelin-1 receptor
[21484] gi|288312|emb|X61950.1|HSET1R[288312]
[21485] 15486: X83863
[21486] H. sapiens mRNA for prostaglandin E receptor (EP3f)
[21487] gi|633219|emb|X83863.1|HSEP3F[633219]
[21488] 15487: X83862
[21489] H. sapiens mRNA for prostaglandin E receptor (EP3e)
[21490] gi|633217|emb|X83862.1|HSEP3E[633217]
[21491] 15488: X83861
[21492] H. sapiens mRNA for prostaglandin E receptor (EP3d)
[21493] gi|633215|emb|X83861.1|HSEP3D[633215]
[21494] 15489: X83860
[21495] H. sapiens mRNA for prostaglandin E receptor (EP3c)
[21496] gi|633213|emb|X83860.1|HSEP3C[633213]
[21497] 15490: X83859
[21498] H. sapiens mRNA for prostaglandin E receptor (EP3b)
[21499] gi|633211|emb|X83859.1|HSEP3B[633211]
[21500] 15491: X83858
[21501] H. sapiens mRNA for prostaglandin E receptor (EP3a2)
[21502] gi|633209|emb|X83858.1|HSEP3A2[633209]
[21503] 15492: X83857
[21504] H. sapiens mRNA for prostaglandin E receptor (EP3a1)
[21505] gi|633207|emb|X83857.1HSEP3A1[633207]
[21506] 15493: X83868
[21507] H. sapiens mRNA for EP2 prostaglandin receptor
[21508] gi|633205|emb|X83868.1|HSEP2PR[633205]
[21509] 15494: X81479
[21510] H. sapiens mRNA for EMR1 hormone receptor
[21511] gi|784993|emb|X81479.1|HSEMR1[784993]
[21512] 15518: Z28613
[21513] H. sapiens (dhpa215) cacnl2a gene for dihydropyridine receptor alpha-2 subunit
[21514] gi|472953|emb|Z28613.1|HSDPRA25[472953]
[21515] 15519: Z28609
[21516] H. sapiens (dhpa22hd) cacnl2a gene for dihydropyridine receptor alpha 2-subunit
[21517] gi|472952|emb|Z28609.1|HSDPRA24[472952]
[21518] 15520: Z28605
[21519] H. sapiens (dhpa23) cacnl2a gene for dihydropyridine receptor alpha2 subunit
[21520] gi|472951|emb|Z28605.1|HSDPRA23[472951]
[21521] 15521: Z28602
[21522] H. sapiens (dhpa21hb) cacnl2a gene for dihydropyridine receptor alpha 2-subunit
[21523] gi|472950|emb|Z28602.1|HSDPRA22[472950]
[21524] 15522: Z28599
[21525] H. sapiens (a225eh) cacnl2a gene for dihydropyridine receptor alpha2 subunit
[21526] gi|472949|emb|Z28599.1|HSDPRA21[472949]
[21527] 15526: X55758
[21528] H. sapiens dopamine D1 receptor gene
[21529] gi|288931|emb|X55758.1|HSDOPD1[288931]
[21530] 15529: Z23025
[21531] H. sapiens cacnl1a3 gene encoding skeletal muscle DHP-receptor alpha 1 subunit (exon)
[21532] gi|312285|emb|Z23025.1|HSDHPRA1S[312285]
[21533] 15530: X84076
[21534] H. sapiens mRNA for DGCR2
[21535] gi|80902|emb|X84076.1|HSDGCR2[809021]
[21536] 15532: X63523
[21537] H. sapiens mRNA DAUD16 3′-region
[21538] gi|30449|emb|X63523.1|HSDAUDI63[30449]
[21539] 15533: X66171
[21540] H. sapiens CMRF35 mRNA, complete CDS
[21541] gi|396169|emb|X66171.1|HSCMRF35A[396169]
[21542] 15534: Z23141
[21543] H. sapiens CHRNA7 mRNA, 3′ end
[21544] gi|457736|emb|Z23141.1|HSCHRNA7A[457736]
[21545] 15550: X56777
[21546] H. sapiens mRNA for ZP3 gene
[21547] gi|297790|emb|X56777.1|HSZP3G[297790]
[21548] 15551: X77155
[21549] H. sapiens genomic DNA (YAC end 63 with high affinity Fc-receptor for IgG)
[21550] gi|450533|emb|X77155.1|HSYACFC[450533]
[21551] 15582: M31165
[21552] Human tumor necrosis factor-inducible (TSG-6) mRNA fragment, adhesion receptor
[21553] CD44 putative CDS
[21554] gi|339994|gb|M31165.1|HUMTSG6A[339994]
[21555] 15594: A31613
[21556] H. sapiens beta-adrenergic receptor gene
[21557] gi|1247565|emb|A31613.1|A31613[1247565]
[21558] 15595: A29216
[21559] H. sapiens DNA for bFGF receptor from patent WO9111459
[21560] gi|1247528|emb|A29216.1|A29216[1247528]
[21561] 15596: A29103
[21562] H. sapiens mRNA for TNF-binding polypeptide from patent EP0393438
[21563] gi|1247517|emb|A29103.1|A29103[1247517]
[21564] 15597: A28489
[21565] H. sapiens mRNA for IL-2R-beta-chain from patent EP0395853
[21566] gi|1247509|emb|A28489.1|A28489[1247509]
[21567] 15598: A28003
[21568] H. sapiens HEK gene
[21569] gi|1247486|emb|A28003.1|A28003[1247486]
[21570] 15599: A27284
[21571] H. sapiens TGR-CLH
[21572] gi|1247482|emb|A27284.1|A27284[1247482]
[21573] 15600: A27280
[21574] H. sapiens TGR-CL3
[21575] gi|1247480|emb|A27280.1|A27280[1247480]
[21576] 15601: A27274
[21577] H. sapiens TGR-CL11/TGR-C15
[21578] gi|1247478|emb|A27274.1|A27274[1247478]
[21579] 15602: A27272
[21580] H. sapiens TGR-CL11
[21581] gi|1247476|emb|A27272.1|A27272[1247476]
[21582] 15603: A27268
[21583] H. sapiens TGR-CL10
[21584] gi|1247474|emb|A27268.1|A27268[1247474]
[21585] 15604: A27266
[21586] H. sapiens TGR-CL7
[21587] gi|1247472|emb|A27266.1|A27266[1247472]
[21588] 15605: A27264
[21589] H. sapiens TGR-CL6
[21590] gi|1247470|emb|A27264.1|A27264[1247470]
[21591] 15606: A27262
[21592] H. sapiens TGR-CL5bis
[21593] gi|1247468|emb|A27262.1|A27262[1247468]
[21594] 15607: A27260
[21595] H. sapiens TGR-CL4
[21596] gi|1247466|emb|A27260.1|A27260[1247466]
[21597] 15608: A27258
[21598] H. sapiens TGR-CL1bis
[21599] gi|1247464|emb|A27258.1|A27258[1247464]
[21600] 15609: A19671
[21601] H. sapiens DNA for D3 receptor fragment
[21602] gi|579581|emb|A19671.1|A19671[579581]
[21603] 15610: A19670
[21604] H. sapiens DNA for D3 receptor fragment
[21605] gi|579580|emb|A19670.1|A19670[579580]
[21606] 15611: A19667
[21607] H. sapiens gene for dopaminergic receptor D-3
[21608] gi|579578|emb|A19667.1|A19667[579578]
[21609] 15612: A09781
[21610] H. sapiens (clone 18-4-3) mRNA interferon-gamma receptor segment
[21611] gi|412192|emb|A09781.1|A09781[412192]
[21612] 15613: A09779
[21613] H. sapiens (clone 15-21-1) mRNA for interferon-gamma receptor segment binding interferon-gamma
[21614] gi|412190|emb|A09779.1|A09779[412190]
[21615] 15614: A07799
[21616] H. sapiens IL-2R-beta mRNA for interleukin-2 beta-chain
[21617] gi|1247399|emb|A07799.1|A07799[1247399]
[21618] 15615: A07801
[21619] H. sapiens IL-2R-beta mRNA for interleukin-2 beta-chain
[21620] gi|490067|emb|A07801.1|A07801[490067]
[21621] 15616: A07795
[21622] H. sapiens IL-2R-beta mRNA for interleukin-2 receptor beta-chain
[21623] gi|412175|emb|A07795.1|A07795[412175]
[21624] 15617: L11573
[21625] Human surfactant protein B mRNA, complete cds
[21626] gi|1220354|gb|L11573.1|HUMPSPBQ[1220354]
[21627] 15618: L40625
[21628] Homo sapiens sulfonylurea receptor (SUR) mRNA, 3′ end of cds
[21629] gi|784881|gb|L40625.1|HUMSUR[784881]
[21630] 15620: L34579
[21631] Homo sapiens (clone HCl) angiotensin II type-2 receptor (AGTR2) gene, complete
[21632] cds
[21633] gi|510700|gb|L34579.1|HUMAIRS[510700]
[21634] 15621: X97058
[21635] H. sapiens mRNA for P2Y6 receptor
[21636] gi|1296659|emb|X97058.1|HSP2Y6[1296659]
[21637] 15622: X96588
[21638] H. sapiens mRNA for H-RYK receptor tyrosine kinase
[21639] gi|1296649|emb|X96588.1|HSHRYKG[1296649]
[21640] 15623: X80391
[21641] H. sapiens OR17-40 gene
[21642] gi|516319|emb|X80391.1|HSOR1740[516319]
[21643] 15624: L41690
[21644] Homo sapiens TNF receptor-1 associated protein (TRADD) mRNA, 3′ end of cds
[21645] gi|808914|gb|L41690.1|HUMTRADD[808914]
[21646] 15630: X89746
[21647] H. sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 6
[21648] gi|1279464|emb|X89746.1|HSCHRNA46[1279464]
[21649] 15631: X89745
[21650] H. sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 5
[21651] gi|1279463|emb|X89745.1|HSCHRNA45[1279463]
[21652] 15632: X89743
[21653] H. sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 3
[21654] gi|1279461|emb|X89743.1|HSCHRNA43[1279461]
[21655] 15633: X89742
[21656] H. sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 2
[21657] gi|1279460|emb|X89742.1|HSCHRNA42[1279460]
[21658] 15634: X89741
[21659] H. sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 1
[21660] gi|1279458|emb|X89741.1|HSCHRNA41[1279458]
[21661] 15644: M21574
[21662] Human platelet-derived growth factor receptor alpha (PDGFRA) mRNA, complete cds
[21663] gi|189733|gb|M21574.1|HUMPDGFRAA[189733]
[21664] 15645: X94635
[21665] H. sapiens CD97 gene exon 8
[21666] gi|4379070|emb|X94635.1|HSX94635[4379070]
[21667] 15646: X94638
[21668] H. sapiens CD97 gene exon 11
[21669] gi|165091|emb|X94638.1|HSX94638[1165091]
[21670] 15647: X94637
[21671] H. sapiens CD97 gene exon 10
[21672] gi|1165090|emb|X94637.1|HSX94637[1165090]
[21673] 15648: X94636
[21674] H. sapiens CD97 gene exon 9
[21675] gi|1165089|emb|X94636.1|HSX94636[1165089]
[21676] 15649: X94631
[21677] H. sapiens CD97 gene exon 2
[21678] gi|1165084|emb|X94631.1|HSX94631[1165084]
[21679] 15650: X94646
[21680] H. sapiens CD97 gene exon 19
[21681] gi|1165082|emb|X94646.1|HSX94646[1165082]
[21682] 15651: X94645
[21683] H. sapiens CD97 gene exon 18
[21684] gi|1165081|emb|X94645.1|HSX94645[1165081]
[21685] 15652: X94644
[21686] H. sapiens CD97 gene exon 17
[21687] gi|1165080|emb|X94644.1|HSX94644[1165080]
[21688] 15653: X94643
[21689] H. sapiens CD97 gene exon 16
[21690] gi|1165079|emb|X94643.1|HSX94643[1165079]
[21691] 15654: X94642
[21692] H. sapiens CD97 gene exon 15
[21693] gi|1165078|emb|X94642.1|HSX94642[1165078]
[21694] 15655: X94641
[21695] H. sapiens CD97 gene exon 14
[21696] gi|1165077|emb|X94641.1|HSX94641[1165077]
[21697] 15656: X94640
[21698] H. sapiens CD97 gene exon 13
[21699] gi|1165076|emb|X94640.1|HSX94640[1165076]
[21700] 15657: X94639
[21701] H. sapiens CD97 gene exon 12
[21702] gi|1165075|emb|X94639.1|HSX94639[1165075]
[21703] 15658: L40949
[21704] Homo sapiens (clone AT7-5eu) opioid-receptor-like protein mRNA, 5′ end
[21705] gi|725265|gb|L40949.1|HUMOPRLP[725265]
[21706] 15659: X57282
[21707] H. sapiens mRNA for soluble erythropoietin receptor
[21708] gi|36426|emb|X57282.1|HSSER[36426]
[21709] 15660: Z66526
[21710] H. sapiens pancreatic polypeptide receptor PP1 gene
[21711] gi|1107699|emb|Z66526.1|HSPP1GN[1107699]
[21712] 15661: X89013
[21713] H. sapiens gene for anti-mullerian hormone type II receptor
[21714] gi|1212943|emb|X89013.1|HSDNAAMHI[1212943]
[21715] 15662: X86163
[21716] H. sapiens mRNA for B2-bradykinin receptor, 3′
[21717] gi|1220163|emb|X86163.1|HSB2BRRNA[1220163]
[21718] 15663: X86165
[21719] H. sapiens mRNA for B2-bradykinin receptor, R14 allele
[21720] gi|1220160|emb|X86165.1|HSB2BRR14[1220160]
[21721] 15664: X86164
[21722] H. sapiens mRNA for B2-bradykinin receptor, C14 allele
[21723] gi|1220155|emb|X86164.1|HSB2BRC14[1220155]
[21724] 15665: L08187
[21725] Human cytokine receptor (EBI3) mRNA, complete cds
[21726] gi|632973|gb|L08187.1|HUMEBI3X[632973]
[21727] 15666: L41147
[21728] Homo sapiens 5-HT6 serotonin receptor mRNA, complete cds
[21729] gi|1162923|gb|L41147.1|HUM5HSR[1162923]
[21730] 15698: X84755
[21731] H. sapiens LHCGR gene, exon 3
[21732] gi|1225986|emb|X84755.1|HSLHCGRX3[1225986]
[21733] 15699: L25829
[21734] Human platelet-derived growth factor alpha-receptor (PDGFRA) mRNA, exons 13-gi|1220351|gb|L25829.1|HUMPDGFRAX[1220351]
[21735] 15700: L07746
[21736] Human cholecystokinin B receptor (CCK-B) mRNA, complete cds
[21737] gi|1220298|gb|L07746.1|HUMCCKBR[1220298]
[21738] 15701: X86172
[21739] H. sapiens B2-bradykinin receptor gene, exon 3, allele R48
[21740] gi|220162|emb|X86172.1|HSB2BRR48[1220162]
[21741] 15702: X86180
[21742] H. sapiens B2-bradykinin receptor gene, promoter region and exon 1
[21743] gi|1220159|emb|X86180.1|HSB2BRPX1[1220159]
[21744] 15703: X86173
[21745] H. sapiens B2-bradykinin receptor gene, promotor region and exon 1
[21746] gi|220158|emb|X86173.1|HSB2BREX11[1220158]
[21747] 15704: X86162
[21748] H. sapiens B2-bradykinin receptor gene, 3′
[21749] gi|1220157|emb|X86162.1|HSB2BRDNA[1220157]
[21750] 15705: X86171
[21751] H. sapiens B2-bradykinin receptor gene, exon 3, BE3-R43 allele
[21752] gi|1220154|emb|X86171.1|HSB2BRBE3[1220154]
[21753] 15706: X86170
[21754] H. sapiens B2-bradykinin receptor gene, exon 2, T allele
[21755] gi|1220153|emb|X86170.1|HSB2BRAXT[1220153]
[21756] 15707: X86168
[21757] H. sapiens B2-bradykinin receptor gene, exon 1, 3T allele
[21758] gi|1220152|emb|X86168.1|HSB2BR3T[1220152]
[21759] 15708: X86167
[21760] H. sapiens B2-bradykinin receptor gene, exon 1, 3G allele
[21761] gi|1220151|emb|X86167.1|HSB2BR3G[1220151]
[21762] 15709: X86166
[21763] H. sapiens B2-bradykinin receptor gene, exon 1, 2G allele
[21764] gi|1220150|emb|X86166.1|HSB2BR2G[1220150]
[21765] 15710: Z69891
[21766] H. sapiens mRNA (clone ICRFp507G10101)
[21767] gi|1213610|emb|Z69891.1|HSBRN3B2[1213610]
[21768] 15711: L18983
[21769] Homo sapiens tyrosine phosphatase (IA-2/PTP) mRNA, complete cds
[21770] gi|662362|gb|L18983.1|HUMTYROPHO[662362]
[21771] 15712: L76224
[21772] Homo sapiens NMDA receptor mRNA, complete cds
[21773] gi|1196448|gb|L76224.1|HUMNMRE[1196448]
[21774] 15715: M73481
[21775] Human gastrin releasing peptide receptor (GRPR) mRNA, complete cds
[21776] gi|183649|gb|M73481.1|HUMGRPR[183649]
[21777] 15717: M30625
[21778] Human dopamine D2 receptor, mRNA, complete cds
[21779] gi|181431|gb|M30625.1|HUMD2A[181431]
[21780] 15718: J02960
[21781] Human beta-2-adrenergic receptor gene, complete cds
[21782] gi|178203|gb|J02960.1|HUMADRBRA[178203]
[21783] 15719: M15169
[21784] Human beta-2-adrenergic receptor mRNA, complete cds
[21785] 15720: L18973
[21786] Human acetylcholine receptor mRNA, partial cds
[21787] gi|441143|gb|L18973.1|HUMACETYL[441143]
[21788] 15723: M73969
[21789] Human interleukin-8 receptor type B (IL8RB) mRNA, complete cds
[21790] gi|186516|gb|M73969.1|HUMINTLEU8[186516]
[21791] 15752: L35233
[21792] Homo sapiens autocrine motility factor receptor (AMFR) mRNA, complete cds
[21793] gi|521220|gb|L35233.1|HUMNGP78A[521220]
[21794] 15754: U35399
[21795] Human G protein-coupled receptor mRNA, complete cds
[21796] gi|1015420|gb|U35399.1|HSU35399[1015420]
[21797] 15755: L35318
[21798] Human rearranged metabotropic glutamate receptor type II (GLUR2) mRNA, complete
[21799] cds
[21800] gi|999415|gb|L35318.1|HUMGLUR2A[999415]
[21801] 15756: M11730
[21802] Human tyrosine kinase-type receptor (HER2) mRNA, complete cds
[21803] gi|183986|gb|M11730.1|HUMHER2A[183986]
[21804] 15759: U33017
[21805] Human signaling lymphocytic activation molecule (SLAM) mRNA, complete cds
[21806] gi|984968|gb|U33017.1|HSU33017[984968]
[21807] 15761: L47220
[21808] Homo sapiens inositol triphosphate receptor type 1 gene fragment
[21809] gi|976275|gb|L47220.1|HUMITRT1F[976275]
[21810] 15762: M37722
[21811] Human shorter form basic fibroblast growth factor (bFGF) receptor mRNA, complete
[21812] cds
[21813] gi|179413|gb|M37722.1|HUMBFGFS[179413]
[21814] 15765: L09753
[21815] Homo sapiens CD30 ligand mRNA, complete cds
[21816] gi|349277|gb|L09753.1|HUMCD30[349277]
[21817] 15767: L36645
[21818] Homo sapiens receptor protein-tyrosine kinase (HEK8) mRNA, complete cds
[21819] gi|551613|gb|L36645.1|HUMRPTKC[551613]
[21820] 15768: L36644
[21821] Homo sapiens receptor protein-tyrosine kinase (HEK7) mRNA, 3′ end
[21822] gi|551611|gb|L36644.1|HUMRPTKB[551611]
[21823] 15769: L36643
[21824] Homo sapiens receptor protein-tyrosine kinase (HEK5) mRNA, 3′ end
[21825] gi|551609|gb|L36643.1|HUMRPTKA[551609]
[21826] 15770: L36642
[21827] Homo sapiens receptor protein-tyrosine kinase (HEK11) mRNA, complete cds
[21828] gi|551607|gb|L36642.1|HUMRPTK[551607]
[21829] 15771: L31581
[21830] Human G protein-coupled receptor (EBI 1) mRNA, complete cds
[21831] gi|468319|gb|L31581.1|HUMEBI1CDN[468319]
[21832] 15772: L29301
[21833] Homo sapiens opioid receptor mRNA, complete cds
[21834] gi|459831|gb|L29301.1|HUMOPIOIDA[459831]
[21835] 15773: L32831
[21836] Homo sapiens G protein-coupled receptor (GPR3) gene, complete cds
[21837] gi|602311|gb|L32831.1|HUMGPCRD[602311]
[21838] 15774: L32830
[21839] Homo sapiens G protein-coupled receptor (GPR3) gene, exon
[21840] gi|602310|gb|L32830.1|HUMGPCRC[602310]
[21841] 15775: M88461
[21842] Human neuropeptide Y peptide YY receptor mRNA, complete cds
[21843] gi|189155|gb|M88461.1|HUMNEYPEPY[189155]
[21844] 15779: M73747
[21845] Homo sapiens thyroid stimulating hormone receptor (TSHR) mRNA, complete cds
[21846] gi|903759|gb|M73747.1|HUMTSHR[903759]
[21847] 15780: M73746
[21848] Homo sapiens lutropin/choriogonadotropin receptor (LHCGR) mRNA, complete cds
[21849] gi|903745|gb|M73746.1|HUMLHCGR[903745]
[21850] 15781: M90103
[21851] Human (clones 18, 23, 27, 24) c-myeloproliferative leukemia virus type K (c-mpl-K) mRNA, complete cds
[21852] gi|184262|gb|M90103.1|HSHMPLK[184262]
[21853] 15782: M90102
[21854] Human (clones 15, 39, 41) c-myeloproliferative leukemia virus type P (c-mpl-P)
[21855] mRNA, complete cds
[21856] gi|184260|gb|M90102.1|HSHMPLP[184260]
[21857] 15796: M98512
[21858] Human NFG genomic fragment
[21859] gi|292359|gb|M98512.1|HUMNF1FRAG[292359]
[21860] 15797: M98511
[21861] Human NFE genomic fragment
[21862] gi|292358|gb|M98511.1|HUMNF1FRAE[292358]
[21863] 15798: M98510
[21864] Human NFC genomic fragment
[21865] gi|292357|gb|M98510.1|HUMNF1FRAC[292357]
[21866] 15799: M98508
[21867] Human NFA genomic fragment
[21868] gi|292355|gb|M98508.1|HUMNF1FRAA[292355]
[21869] 15801: L32662
[21870] Human prostaglandin E2 receptor EP3 subtype isoform IV mRNA, complete cds
[21871] gi|484163|gb|L32662.1|HUMEP3IV[484163]
[21872] 15802: L32661
[21873] Human prostaglandin E2 receptor EP3 subtype isoform III mRNA, 3′ end
[21874] gi|48416|gb|L32661.1|HUMEP3III[484161]
[21875] 15803: L32660
[21876] Human prostaglandin E2 receptor EP3 subtype isoform II mRNA, partial cds
[21877] gi|484159|gb|L32660.1|HUMEP3II[484159]
[21878] 15822: L07594
[21879] Human transforming growth factor-beta type III receptor (TGF-beta) mRNA, complete cds
[21880] gi|818001|gb|L07594.1|HUMTGFB3C[818001]
[21881] 15823: M83181
[21882] Human serotonin receptor gene, complete cds
[21883] gi|8080000gb|M83181.1|HUMHTRB[808000]
[21884] 15824: M33602
[21885] Human T-cell leukemia t(10:14) (q24:q11) chromosomal translocation
[21886] gi|339907|gb|M33602.1|HUMTRANSX[339907]
[21887] 15828: L37112
[21888] Homo sapiens vasopressin V3 receptor mRNA, complete cds
[21889] gi|791151|gb|L37112.1|HUMVVR[791151]
[21890] 15829: L35901
[21891] Human nicotinic acetylcholine receptor alpha 4 subunit (nAChR) mRNA, complete cds
[21892] gi|755647|gb|L35901.1|HUMNACHR4A[755647]
[21893] 15830: U13666
[21894] Human G protein-coupled receptor (GPR1) gene, complete cds
[21895] gi|577412|gb|U13666.1|HSU13666[577412]
[21896] 15831: L35903
[21897] Human dopamine D3 receptor gene, exon 6
[21898] gi|532478|gb|L35903.1|UMDOPD30S2[532478]
[21899] 15832: L35902
[21900] Human dopamine D3 receptor gene, exon 5
[21901] gi|532477|gb|L35902.1|UMDOPD30S1[532477]
[21902] 15833: L37362
[21903] Homo sapiens (clone d2-115) kappa opioid receptor (OPRK1) mRNA, complete cds
[21904] gi|722617|gb|L37362.1|HUMOPRK1B[722617]
[21905] 15834: L35545
[21906] Homo sapiens endothelial cell protein C/APC receptor (EPCR) mRNA, complete cds
[21907] gi|565267|gb|L35545.1|HUMECPC[565267]
[21908] 15835: L36130
[21909] Homo sapiens kappa opiate receptor mRNA, partial cds
[21910] gi|598184|gb|L36130.1|HUMKOR[598184]
[21911] 15836: L36150
[21912] Homo sapiens G protein-coupled receptor (GPR6) gene, complete cds
[21913] gi|598156|gb|L361500.1HUMGPR6A[598156]
[21914] 15837: L36148
[21915] Homo sapiens G protein-coupled receptor (GPR4) gene, complete cds
[21916] gi|598152|gb|L36148.1|HUMGPR4A[598152]
[21917] 15839: L36149
[21918] Homo sapiens G protein-coupled receptor (GPR5) gene, complete cds
[21919] gi|598154|gb|L36149.1|HUMGPR5A[598154]
[21920] 15840: M64749
[21921] Human homologue of the canine orphan receptor (RDC1) mRNA, 5′ end
[21922] gi|292418|gb|M64749.1|HUMRDC1A[292418]
[21923] 15841: L35848
[21924] Homo sapiens IgE receptor beta chain (HTm4) mRNA, complete cds
[21925] gi|561638|gb|L35848.1|HUMIERB[561638]
[21926] 16011: L22431
[21927] Human very low density lipoprotein receptor, complete cds
[21928] gi|437386|gb|L22431.1|HUMVLDLRX[437386]
[21929] 16012: M90366
[21930] Human zona pellucida glycoprotein 2 (ZP2) mRNA, complete cds
[21931] gi|292939|gb|M90366.1|HUMZP2GP[292939]
[21932] 16015: M76125
[21933] Human tyrosine kinase receptor (axl) mRNA, complete cds
[21934] gi|292869|gb|M76125.1|HUMTYRKINR[292869]
[21935] 16016: L04489
[21936] Homo sapiens (clone NCD18) tumor necrosis factor receptor related protein mRNA,
[21937] complete exon and repeat region
[21938] gi|340022|gb|L04489.1|HUMTUMNEC[340022]
[21939] 16017: M31163
[21940] Human tumor necrosis factor-inducible (TSG-12) mRNA fragment
[21941] gi|339990|gb|M31163.1|HUMTSG12A[339990]
[21942] 16019: M75866
[21943] Human tumor necrosis factor receptor 1 (TNFR1) gene, complete cds
[21944] gi|339748|gb|M75866.1|HUMTNFR103[339748]
[21945] 16020: M75865
[21946] Human tumor necrosis factor receptor 1 (TNFR1) gene, exons 2-5
[21947] gi|339747|gb|M75865.1|HUMTNFR102[339747]
[21948] 16021: M75864
[21949] Human tumor necrosis factor receptor 1 (TNFR1) gene, exon 1
[21950] gi|339746|gb|M75864.1|HUMTNFR101[339746]
[21951] 16026: M85079
[21952] Human TGF-beta type II receptor mRNA, complete cds
[21953] gi|339569|gb|M85079.1|HUMTGFBIIR[339569]
[21954] 16027: L06139
[21955] Homo sapiens receptor protein-tyrosine kinase (TEK) mRNA, complete cds
[21956] gi|292823|gb|L06139.1|HUMTEKRPTK[292823]
[21957] 16204: L29349
[21958] Homo sapiens granulocyte-macrophage colony-stimulating factor receptor alpha-subunit 3 (GM-CSF-RA3) mRNA, complete cds
[21959] gi|460284|gb|L29349.1|HUMGMCSA[460284]
[21960] 16205: L29348
[21961] Homo sapiens granulocyte-macrophage colony-stimulating factor receptor alpha-subunit soluble isoform 2 (GM-CSF-RAS2) mRNA, complete cds
[21962] gi|460282|gb|L29348.1|HUMGMCS[460282]
[21963] 16270: M74290
[21964] Human substance P receptor protein mRNA
[21965] gi|338612|gb|M74290.1|HUMSUBPRA[338612]
[21966] 16271: M96738
[21967] Human somatostatin receptor subtype 3 (SSTR3) gene, complete cds
[21968] gi|338498|gb|M96738.1|HUMSSTR3X[338498]
[21969] 16272: L13033
[21970] Homo sapiens somatostatin receptor isoform 2 gene, alternatively spliced exon
[21971] gi|292515|gb|L13033.1|HUMSSTR23X[292515]
[21972] 16273: L07833
[21973] Homo sapiens somatostatin receptor (SSTR4) gene, complete cds
[21974] gi|307429|gb|L07833.1|HUMSOMATA[307429]
[21975] 16274: L10126
[21976] Human serine/threonine kinase receptor-2-3 (SKR2-3) mRNA, complete cds
[21977] gi|558102|gb|L10126.1|HUMSKR23A[558102]
[21978] 16275: L10125
[21979] Human serine/threonine kinase receptor-2-2 (SKR2-2) mRNA, complete cds
[21980] gi|558101|gb|L10125.1|HUMSKR22A[558101]
[21981] 16276: J04132
[21982] Human T cell receptor zeta-chain mRNA, complete cds
[21983] gi|623041|gb|J04132.1|HUMTCRZCN[623041]
[21984] 16277: M93221
[21985] Human macrophage mannose receptor (MRC1) gene, exon 30
[21986] gi|187332|gb|M93221.1|HUMMANR30[187332]
[21987] 16278: M93220
[21988] Human macrophage mannose receptor (MRC1) gene, exon 29
[21989] gi|187331|gb|M93220.1|HUMMANR29[187331]
[21990] 16279: M93219
[21991] Human macrophage mannose receptor (MRC1) gene, exon 28
[21992] gi|187330|gb|M93219.1|HUMMANR28[187330]
[21993] 16280: M93218
[21994] Human macrophage mannose receptor (MRC1) gene, exon 27
[21995] gi|187329|gb|M93218.1|HUMMANR27[187329]
[21996] 16281: M93217
[21997] Human macrophage mannose receptor (MRC1) gene, exon 26
[21998] gi|187328|gb|M93217.1|HUMMANR26[187328]
[21999] 16282: M93216
[22000] Human macrophage mannose receptor (MRC1) gene, exon 25
[22001] gi|187327|gb|M93216.1|HUMMANR25[187327]
[22002] 16283: M93215
[22003] Human macrophage mannose receptor (MRC1) gene, exon 24
[22004] gi|187326|gb|M93215.1|HUMMANR24[187326]
[22005] 16284: M93214
[22006] Human macrophage mannose receptor (MRC1) gene, exon 23
[22007] gi|187325|gb|M93214.1|HUMMANR23[187325]
[22008] 16285: M93213
[22009] Human macrophage mannose receptor (MRC1) gene, exon 22
[22010] gi|187324|gb|M93213.1|HUMMANR22[187324]
[22011] 16286: M93212
[22012] Human macrophage mannose receptor (MRC1) gene, exon 21
[22013] gi|187323|gb|M93212.1|HUMMANR21[187323]
[22014] 16287: M93211
[22015] Human macrophage mannose receptor (MRC1) gene, exon 20
[22016] gi|187322|gb|M93211.1|HUMMANR20[187322]
[22017] 16288: M93210
[22018] Human macrophage mannose receptor (MRC1) gene, exon 19
[22019] gi|187321|gb|M93210.1|HUMMANR19[187321]
[22020] 16289: M93209
[22021] Human macrophage mannose receptor (MRC1) gene, exon 18
[22022] gi|187320|gb|M93209.1|HUMMANR18[187320]
[22023] 16290: M93208
[22024] Human macrophage mannose receptor (MRC1) gene, exon 17
[22025] gi|187319|gb|M93208.1|HUMMANR17[187319]
[22026] 16291: M93207
[22027] Human macrophage mannose receptor (MRC1) gene, exon 16
[22028] gi|187318|gb|M93207.1|HUMMANR16[187318]
[22029] 16292: M93206
[22030] Human macrophage mannose receptor (MRC1) gene, exon 15
[22031] gi|187317|gb|M93206.1|HUMMANR15[187317]
[22032] 16293: M93205
[22033] Human macrophage mannose receptor (MRC1) gene, exon 14
[22034] gi|187316|gb|M93205.1|HUMMANR14[187316]
[22035] 16294: M93204
[22036] Human macrophage mannose receptor (MRC1) gene, exon 13
[22037] gi|187315|gb|M93204.1|HUMMANR13[187315]
[22038] 16295: M93203
[22039] Human macrophage mannose receptor (MRC1) gene, exon 12
[22040] gi|187314|gb|M93203.1|HUMMANR12[187314]
[22041] 16296: M93202
[22042] Human macrophage mannose receptor (MRC1) gene, exon 11
[22043] gi|187313|gb|M93202.1|HUMMANR11[187313]
[22044] 16297: M93201
[22045] Human macrophage mannose receptor (MRC1) gene, exon 10
[22046] gi|187312|gb|M93201.1|HUMMANR10[187312]
[22047] 16298: M93200
[22048] Human macrophage mannose receptor (MRC1) gene, exon 9
[22049] gi|187311|gb|M93200.1|HUMMANR09[187311]
[22050] 16299: M93199
[22051] Human macrophage mannose receptor (MRC1) gene, exon 8
[22052] gi|187310|gb|M93199.1|HUMMANR08[187310]
[22053] 16300: M93198
[22054] Human macrophage mannose receptor (MRC1) gene, exon 7
[22055] gi|187309|gb|M93198.1|HUMMANR07[187309]
[22056] 16301: M93197
[22057] Human macrophage mannose receptor (MRC1) gene, exon 6
[22058] gi|187308|gb|M93197.1|HUMMANR06[187308]
[22059] 16302: M93196
[22060] Human macrophage mannose receptor (MRC1) gene, exon 5
[22061] gi|187307|gb|M93196.1|HUMMANR05[187307]
[22062] 16303: M93195
[22063] Human macrophage mannose receptor (MRC1) gene, exon 4
[22064] gi|187306|gb|M93195.1|HUMMANR04[187306]
[22065] 16304: M93194
[22066] Human macrophage mannose receptor (MRC1) gene, exon 3
[22067] gi|187305|gb|M93194.1HUMMANR03[187305]
[22068] 16305: M93193
[22069] Human macrophage mannose receptor (MRC1) gene, exon 2
[22070] gi|187304|gb|M93193.1HUMMANR02[187304]
[22071] 16306: M93192
[22072] Human macrophage mannose receptor (MRC1) gene, exon 1
[22073] gi|87303|gb|M93192.1|HUMMANR01[187303]
[22074] 16307: L05198
[22075] Homo sapiens insulin receptor substrate 1 (IRS1) gene, repeat polymorphism
[22076] gi|307396|gb|L05198.1|HUMIRS1RPT[307396]
[22077] 16308: M15365
[22078] Human low density lipoprotein receptor mutant gene recombination site
[22079] gi|187107|gb|M15365.1|HUMLDLRM[187107]
[22080] 16309: M80637
[22081] Human keratinocyte growth factor receptor gene, exon K
[22082] gi|186758|gb|M80637.1|HUMKKGFRA[186758]
[22083] 16310: M81778
[22084] Human serotonin 5-HT1C receptor mRNA, complete cds
[22085] gi|338027|gb|M81778.1|HUMSER5R[338027]
[22086] 16311: M81590
[22087] Homo sapiens serotonin 1D receptor (5-HT1D-) mRNA, complete cds
[22088] gi|338025|gb|M81590.1|HUMSER1DRB[338025]
[22089] 16312: M81589
[22090] Homo sapiens serotonin 1D receptor (5-HT1D) mRNA, complete cds
[22091] gi|338023|gb|M81589.1|HUMSER1DRA[338023]
[22092] 16313: M91455
[22093] Human ryanodine receptor (RYR1) gene, exons 17 and 18
[22094] gi|337723|gb|M91455.1|HUMRYR1[337723]
[22095] 16316: M97639
[22096] Human transmembrane receptor (ror2) mRNA, complete cds
[22097] gi|337466|gb|M97639.1|HUMROR2A[337466]
[22098] 16317: M97675
[22099] Human transmembrane receptor (ror1) mRNA, complete cds
[22100] gi|337464|gb|M97675.1|HUMROR1A[337464]
[22101] 16318: M74721
[22102] Human B-cell antigen receptor (MB-1) mRNA, complete cds
[22103] gi|337419|gb|M74721.1|HUMRIGMAMB[337419]
[22104] 16319: M89796
[22105] Human high affinity IgE receptor beta chain gene, complete cds
[22106] gi|337417|gb|M89796.1|HUMRIGBCHA[337417]
[22107] 16329: L09247
[22108] Human receptor-type protein tyrosine phosphatase gamma (PTPRG) mRNA, complete cds
[22109] gi|292410|gb|L09247.1|HUMPTPRG[292410]
[22110] 16330: M93426
[22111] Human protein tyrosine phosphatase zeta-polypeptide (PTPRZ) mRNA, complete cds
[22112] gi|190743|gb|M93426.1|HUMPTPRZ[190743]
[22113] 16331: M88177
[22114] Human platelet activating factor receptor (PTAFR) gene, complete cds
[22115] gi|190697|gb|M88177.1|HUMPTAFR[190697]
[22116] 16332: L16862
[22117] Homo sapiens G protein-coupled receptor kinase (GRK6) mRNA, complete cds
[22118] gi|388766|gb|L16862.1|HUMPROCRKI[388766]
[22119] 16333: M86528
[22120] Human neurotrophin-4 (NT-4) gene, complete cds
[22121] gi|190264|gb|M86528.1|HUMPPNT4P[190264]
[22122] 16334: L07334
[22123] Human platelet-activating factor receptor mRNA, complete cds
[22124] gi|1190014gb|L07334.1|HUMPLACTFR[190014]
[22125] 16335: L26976
[22126] Human prostalandin receptor (PGE-2) mRNA, complete cds
[22127] gi|473428|gb|L26976.1|HUMPGE2REP[473428]
[22128] 16336: M88107
[22129] Human formyl peptide receptor (FPR2) mRNA, complete cds
[22130] gi|189862|gb|M88107.1|HUMPFPR2A[189862]
[22131] 16337: M76674
[22132] Human platelet activating factor receptor (PAFR) mRNA, complete cds
[22133] gi|456293|gb|M76674.1|HUMPAFRX[456293]
[22134] 16338: M80436
[22135] Human platelet activating factor receptor mRNA, complete cds
[22136] gi|189537|gb|M80436.1|HUMPAFR[189537]
[22137] 16339: L26079
[22138] Homo sapiens (clone hSR4-1) kappa opioid receptor (OPRK1) gene, complete exon
[22139] gi|416143|gb|L26079.1|HUMOPRK1A[416143]
[22140] 16340: L07615
[22141] Human neuropeptide Y receptor Y1 (NPYY1) mRNA, exon 2-3 and complete cds
[22142] gi|189284|gb|L07615.1|HUMNPYY1A2[189284]
[22143] 16341: L07614
[22144] Human neuropeptide Y receptor Y1 (NPYY1) mA, exon 1
[22145] gi|189283|gb|L07614.1|PYY1A1[189283]
[22146] 16342: M37981
[22147] Human alpha-3 neuronal nicotinic acetylcholine receptor subunit mRNA, complete
[22148] cds
[22149] gi|189252|gb|M37981.1|HUMNNAR[189252]
[22150] 16343: M73482
[22151] Human neuromedin B receptor (NMB-R) mRNA, complete cds
[22152] gi|18924|gb|M73482.1|HUMNMBR[189241]
[22153] 16344: M76675
[22154] Human neurokinin 1 receptor (NKIR) mRNA, complete cds
[22155] gi|189231|gb|M76675.1|HUMNKIRX[189231]
[22156] 16345: M81797
[22157] Human NK-1 receptor mRNA, complete cds
[22158] gi|189213|gb|M81797.1|HUMNK1A[189213]
[22159] 16346: M32315
[22160] Human tumor necrosis factor receptor mRNA, complete cds
[22161] Human tumor necrosis factor receptor mRNA, complete cds
[22162] gi|189185|gb|M32315.1|HUMNFR[189185]
[22163] 16347: M84755
[22164] Human neuropeptide y receptor mRNA, complete cds
[22165] gi|189153|gb|M84755.1|HUMNEUYREC[189153]
[22166] 16348: M83246
[22167] Human monocyte activation antigen (Mo3) mRNA, complete cds
[22168] gi|188623|gb|M83246.1|HUMMO3A[188623]
[22169] 16350: L27080
[22170] Human melanocortin 5 receptor (MC5R) gene, complete cds
[22171] gi|435599|gb|L27080.1|HUMMC5R[435599]
[22172] 16351: M28219
[22173] Homo sapiens low density lipoprotein receptor (FH 10 mutant causing familial hypercholesterolemia) mRNA, 3′ end
[22174] gi|619785|gb|M28219.1|HUMLDLRFMT[619785]
[22175] 16352: M12626
[22176] Human low density lipoprotein receptor gene, FH381 (deletion mutant) allele
[22177] gi|187103|gb|M12626.1|HUMLDLRFH[187103]
[22178] 16353: M93189
[22179] Human acetylated low density lipoprotein (ACLDL) receptor (LDLR) gene, promoter
[22180] and exon 1
[22181] gi|187100|gb|M93189.1|HUMLDLRAC[187100]
[22182] 16354: M87772
[22183] Human secreted fibroblast growth factor receptor (K-sam-IV) mRNA, complete cds
[22184] gi|186783|gb|M87772.1|HUMKSAMIV[186783]
[22185] 16355: M87771
[22186] Human secreted fibroblast growth factor receptor (K-sam-III) mRNA, complete cds
[22187] 16356: M87770
[22188] Human fibroblast growth factor receptor (K-sam) mRNA, complete cds
[22189] gi|186779|gb|M87770.1|HUMKSAMI[186779]
[22190] 16357: L04947
[22191] Homo sapiens (clones BT3.081.8, BT3.129.5 and BT4.169) receptor tyrosine kinase
[22192] (KDR) mRNA, 31 end cds
[22193] gi|186674|gb|L04947.1|HUMKDRZ[186674]
[22194] 16358: M32972
[22195] Human insulin receptor (INSR) gene, exon 22, clones lambda-hINSR-(1-13)
[22196] gi|186462|gb|M32972.1|HUMINSR22[186462]
[22197] 16359: M32842
[22198] Human insulin receptor (INSR) gene, exon 21, clones lambda-hINSR-(1-13)
[22199] gi|8646|gb|M32842.1|HUMINSR21[186461]
[22200] 16360: M32841
[22201] Human insulin receptor (INSR) gene, exon 20, clones lambda-hINSR-(1-13)
[22202] gi|186460|gb|M32841.1|HUMINSR20[186460]
[22203] 16361: M32840
[22204] Human insulin receptor (INSR) gene, exon 19, clones lambda-hINSR-(1-13)
[22205] gi|186459|gb|M32840.1|HUMINSR19[186459]
[22206] 16362: M32839
[22207] Human insulin receptor (INSR) gene, exon 18, clones lambda-hINSR-(1-13)
[22208] gi|186458|gb|M32839.1|HUMINSR18[186458]
[22209] 16363: M32838
[22210] Human insulin receptor (hINSR) gene, exon 17, clones lambda-hINSR-(1-13)
[22211] gi|186457|gb|M32838.1|HUMINSR17[186457]
[22212] 16364: M32837
[22213] Human insulin receptor (INSR) gene, exon 16, clones lambda-hINSR-(1-13)
[22214] gi|186456|gb|M32837.1|HUMINSR16[186456]
[22215] 16365: M32836
[22216] Human insulin receptor (INSR) gene, exon 15, clones lambda-hINSR-(1-13)
[22217] gi|186455|gb|M32836.1|HUMINSR15[186455]
[22218] 16366: M32835
[22219] Human insulin receptor (INSR) gene, exon 14, clones lambda-hINSR-(1-13)
[22220] gi|186454|gb|M32835.1|HUMINSR14[186454]
[22221] 16367: M32834
[22222] Human insulin receptor (INSR) gene, exon 13, clones lambda-hINSR-(1-13)
[22223] gi|186453|gb|M32834.1|HUMINSR13[186453]
[22224] 16368: M32833
[22225] Human insulin receptor (INSR) gene, exon 12, clones lambda-hINSR-(1-13)
[22226] gi|186452|gb|M32833.1|HUMINSR12[186452]
[22227] 16369: M32832
[22228] Human insulin receptor (INSR) gene, exon 11, clones lambda-hINSR-(1-13)
[22229] gi|186451|gb|M32832.1|HUMINSR11[186451]
[22230] 16370: M32831
[22231] Human insulin receptor (INSR) gene, exon 10, clones lambda-hINSR-(1-13)
[22232] gi|186450|gb|M32831.1|HUMINSR10[186450]
[22233] 16371: M32830
[22234] Human insulin receptor (hINSR) gene, exon 9, clones lambda-hINSR-(1-13)
[22235] gi|186449|gb|M32830.1|HUMINSR09[186449]
[22236] 16372: M32829
[22237] Human insulin receptor (INSR) gene, exon 8, clones lambda-hINSR-(1-13)
[22238] gi|186448|gb|M32829.1|HUMINSR08[186448]
[22239] 16373: M32828
[22240] Human insulin receptor (INSR) gene, exon 7, clones lambda-hINSR-(1-13)
[22241] gi|186447|gb|M32828.1|HUMINSR07[186447]
[22242] 16374: M32827
[22243] Human insulin receptor (INSR) gene, exon 6, clones lambda-hINSR-(1-13)
[22244] gi|186446|gb|M32827.1|HUMINSR06[186446]
[22245] 16375: M32826
[22246] Human insulin receptor (INSR) gene, exon 5, clones lambda-hINSR-(1-13)
[22247] gi|186445|gb|M32826.1|HUMINSR05[186445]
[22248] 16376: M32825
[22249] Human insulin receptor (INSR) gene, exon 4, clones lambda-hINSR-(1-13)
[22250] gi|186444|gb|M32825.1|HUMINSR04[186444]
[22251] 16377: M32824
[22252] Human insulin receptor (INSR) gene, exon 3, clones lambda-hINSR-(1-13)
[22253] gi|186443|gb|M32824.1|HUMINSR03[186443]
[22254] 16378: M32823
[22255] Human insulin receptor (INSR) gene, exon 2, clones lambda-hINSR-(1-13)
[22256] gi|186442|gb|M32823.1|HUMINSR02[186442]
[22257] 16379: M23100
[22258] Human insulin receptor (INSR) gene, exon 1, clones lambda-hINSR-(1-13)
[22259] gi|186441|gb|M23100.1|HUMINSR01[186441]
[22260] 16380: J05043
[22261] Human insulin receptor (1R) gene, exon 1
[22262] gi|186556|gb|J05043.1|HUMIRSRE[186556]
[22263] 16381: M24555
[22264] Human insulin receptor (INSR) mRNA, partial cds
[22265] gi|186480|gb|M24555.1|HUMINSRZ[186480]
[22266] 16382: L07782
[22267] Human insulin receptor gene, last exon
[22268] gi|186475|gb|L07782.1|HUMINSRE[186475]
[22269] 16383: J03466
[22270] Human insulin receptor gene, exon 1, clone p-lambda EA2
[22271] gi|186469|gb|J03466.1|HUMINSRB[186469]
[22272] 16384: L19592
[22273] Homo sapiens interleukin 8 receptor alpha (IL8RA) gene, complete cds
[22274] gi|559051|gb|L19592.1|HUMIL8RAB[559051]
[22275] 16385: M15864
[22276] Human interleukin-2 receptor alpha (IL2R-alpha) gene, exon 1 and promoter region
[22277] gi|186375|gb|M15864.1|HUMILA2R1A[186375]
[22278] 16387: M68932
[22279] Human IL-8 receptor mRNA, complete cds
[22280] gi|186369|gb|M68932.1|HUMIL8RA[186369]
[22281] 16388: L12183
[22282] Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 8 and complete cds
[22283] gi|307056|gb|L12183.1|HUMIL2RG08[307056]
[22284] 16389: L12182
[22285] Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 7
[22286] gi|307055|gb|L12182.1|HUMIL2RG07[3070155]
[22287] 16390: L12181
[22288] Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 6
[22289] gi|307054|gb|L12181.1|HUMIL2RG06[307054]
[22290] 16391: L12180
[22291] Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 5
[22292] gi|307053|gb|L12180.1|HUMIL2RG05[307053]
[22293] 16392: L12179
[22294] Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 4
[22295] gi|307052|gb|L12179.1|HUMIL2RG04[307052]
[22296] 16393: L12177
[22297] Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 3
[22298] gi|307051|gb|L12177.1|HUMIL2RG03[307051]
[22299] 16394: L12176
[22300] Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 2
[22301] gi|307050|gb|L12176.1|HUMIL2RG02[307050]
[22302] 16395: L12178
[22303] Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 1 and promoter region
[22304] gi|307049|gb|L12178.1|HUMIL2RG01[307049]
[22305] 16396: M96652
[22306] Human interleukin 5 receptor alpha-subunit (IL5R) mRNA, complete cds
[22307] gi|186344|gb|M96652.1|HUMILSRB[186344]
[22308] 16397: M96651
[22309] Human interleukin 5 receptor alpha-subunit (IL5R) mRNA, complete cds
[22310] gi|186342|gb|M96651.1|HUMIL5RA[186342]
[22311] 16398: M74782
[22312] Human interleukin 3 receptor (hIL-3Ra) mRNA, complete cds
[22313] gi|186330|gb|M74782.1|HUMIL3B[186330]
[22314] 16405: M84967
[22315] Human acrosin-trypsin inhibitor (HUSI-II) gene
[22316] gi|553347|gb|M84967.1|HUMHUSIIIA[553347]
[22317] 16406: M84747
[22318] Human interleukin 9 receptor mRNA, complete cds
[22319] gi|184508|gb|M84747.1|HUMI9R[184508]
[22320] 16407: M75128
[22321] Human serotonin 1Db receptor (HTR1D) gene, complete cds
[22322] gi|184459|gb|M75128.1|HUMHTR1DB[184459]
[22323] 16408: M64799
[22324] Human histamine H2 receptor gene, complete cds
[22325] gi|184087|gb|M64799.1|HUMHISH2R[184087]
[22326] 16409: M83941
[22327] Human receptor tyrosine kinase (HEK) mRNA, complete cds
[22328] gi|183931|gb|M83941.1|HUMHEK[183931]
[22329] 16410: L20814
[22330] Human glutamate receptor 2 (HBGR2) mRNA, complete cds
[22331] gi|493133|gb|L20814.1|HUMHBGR2A[493133]
[22332] 16412: L09237
[22333] growth hormone releasing hormone receptor, human, G-protein coupled receptor, secretin family
[22334] gi|337134|gb|L09237.1|HUMGRFREC1[337134]
[22335] 16413: L15388
[22336] Human G protein-coupled receptor kinase (GRK5) mRNA, complete cds
[22337] gi|306804|gb|L15388.1|HUMGRK5A[306804]
[22338] 16415: L08176
[22339] Human Epstein-Barr virus induced G-protein coupled receptor mRNA, complete cds
[22340] gi|183484|gb|L08176.1|HUMGPCRA[183484]
[22341] 16416: M64752
[22342] Human glutamate receptor subunit (GluH1) mRNA, complete cds
[22343] gi|183280|gb|M64752.1|HUMGLURS[183280]
[22344] 16417: L34075
[22345] Human FKBP-rapamycin associated protein (FRAP) mRNA, complete cds
[22346] gi|508481|gb|L34075.1|HUMFRAPX[508481]
[22347] 16418: L08485
[22348] Human GABA-benzodiazepine receptor alpha-5-subunit (GABRA5) mRNA, complete cds
[22349] gi|182915|gb|L08485.1|HUMGABRA5Y[182915]
[22350] 16419: M93435
[22351] Human gamma-aminobutyric acid receptor A5 subunit (GABRA5) gene
[22352] gi|182914|gb|M93435.1|HUMGABRASX[182914]
[22353] 16421: M76673
[22354] Human RMLP-related receptor I (RMLP R I) mRNA, complete cds
[22355] gi|182668|gb|M76673.1|HUMFMLPY[182668]
[22356] 16422: M76672
[22357] Human FMLP-related receptor II (FMLP R II) mRNA, complete cds
[22358] gi|182666|gb|M76672.1|HUMFMLPX[182666]
[22359] 16423: M64347
[22360] Human novel growth factor receptor mRNA, 3′ cds
[22361] gi|182564|gb|M64347.1|HUMFGFLR[182564]
[22362] 16424: M74921
[22363] Human endothelin receptor mRNA, complete cds
[22364] gi|182275|gb|M74921.1|HUMETSR[182275]
[22365] 16427: M96995
[22366] Homo sapiens epidermal growth factor receptor-binding protein GRB2 (EGFRBP-GRB2) mRNA sequence
[22367] gi|181975|gb|M96995.1|HUMEGFGRBA[181975]
[22368] 16428: L06622
[22369] Homo sapiens endothelin receptor type A (EDNRA) mRNA, complete cds
[22370] gi|181956|gb|L06622.1|HUMEDNRA[181956]
[22371] 16434: M26317
[22372] Homo sapiens (clone lambda-6.11) complement receptor 2 (CR2) allele, mRNA fragment
[22373] gi|541647|gb|M26317.1|HUMCR2ALLE[541647]
[22374] 16435: M25785
[22375] Homo sapiens transmembrane glycoprotein (c-fms) gene, exon 1, and platelet-derived growth factor receptor (PDGF) gene, 3′UTR
[22376] gi|349453|gb|M25785.1|HUMCFMS01[349453]
[22377] 16436: M91555
[22378] Human Fc gamma receptor type I (CD64) gene, exon 6
[22379] gi|180160|gb|M91555.1|HUMCD6406[180160]
[22380] 16437: M91554
[22381] Human Fc gamma receptor type I (CD64) gene, exon 5
[22382] gi|180159|gb|M91554.1|HUMCD6405[180159]
[22383] 16438: M91553
[22384] Human Fc gamma receptor type I (CD64) gene, exon 4
[22385] gi|180158|gb|M91553.1|HUMCD6404[180158]
[22386] 16439: M91552
[22387] Human Fc gamma receptor type I (CD64) gene, exon 3
[22388] gi|180157|gb|M91552.1|HUMCD6403[180157]
[22389] 16440: M91551
[22390] Human Fc gamma receptor type I (CD64) gene, exon 2
[22391] gi|180156|gb|M91551.1|HUMCD6402[180156]
[22392] 16441: M91550
[22393] Human Fc gamma receptor type I (CD64) gene, exon 1
[22394] gi|180155|gb|M91550.1|HUMCD6401[180155]
[22395] 16442: M63928
[22396] Homo sapiens T cell activation antigen (CD27) mRNA, complete cds
[22397] gi|180084|gb|M63928.1|HUMCD27A[180084]
[22398] 16443: M95293
[22399] Homo sapiens integrin beta subunit (CD18) gene, exon 1
[22400] gi|180022|gb|M95293.1|HUMCD18EX[180022]
[22401] 16444: M76724
[22402] Human leukocyte adhesion receptor alpha subunit (CD11b) gene, 5′ end
[22403] gi|180018|gb|M76724.1|HUMCD11B[180018]
[22404] 16447: L09230
[22405] Human C-C chemokine receptor type 1 (C-C CKR-1) mRNA, complete cds
[22406] gi|179984|gb|L09230.1|HUMCCCKR1A[179984]
[22407] 16448: M81886
[22408] Human glutamate receptor type 1 (HBGR1) mRNA, complete cds
[22409] gi|17944|gb|M81886.1|HUMBGR1A[179441]
[22410] 16449: M80776
[22411] Human beta-adrenergic receptor kinase 1 mRNA, complete cds
[22412] gi|179334|gb|M80776.1|HUMBARK1A[179334]
[22413] 16450: L25259
[22414] Human CTLA4 counter-receptor (B7-2) mRNA, complete cds
[22415] gi|416368|gb|L25259.1|HUMB72A[416368]
[22416] 16451: M93394
[22417] Human angiotensin 11 type-1 receptor (AT1) mRNA, complete cds
[22418] gi|178680|gb|M93394.1|HUMANTIIR[178680]
[22419] 16452: M83712
[22420] H. sapiens nicotinic receptor alpha 5 subunit mRNA, complete cds
[22421] gi|177925|gb|M83712.1|HUMA5NICRC[177925]
[22422] 16453: M97370
[22423] Human adenosine receptor (A2) gene, complete cds
[22424] gi|177891|gb|M97370.1|HUMA2XXX[177891]
[22425] 16454: M92826
[22426] Human serotonin receptor (5-HTR1E) gene, complete cds
[22427] gi|177777|gb|M92826.1|HUM5HTR1E[177777]
[22428] 16455: M86841
[22429] Human serotonin receptor type 2 (5HT2) mRNA, complete cds
[22430] gi|177775|gb|M86841.1|HUM5HT2A[177775]
[22431] 16456: M91467
[22432] Human serotonin receptor (5HT1E) mRNA, complete cds
[22433] gi|177773|gb|M91467.1|HUM5HT1E[177773]
[22434] 16457: M81830
[22435] Human somatostatin receptor isoform 2 (SSTR2) gene, complete cds
[22436] gi|307435|gb|M81830.1|HUMSRI2A[307435]
[22437] 16458: M81829
[22438] Human somatostatin receptor isoform 1 gene, complete cds
[22439] gi|307433|gb|M81829.1|HUMSRI1A[307433]
[22440] 16463: L20470
[22441] Human very low density lipoprotein receptor mRNA, complete cds
[22442] gi|409425|gb|L20470.1|HUMVLDLR[409425]
[22443] 16464: L20316
[22444] Human glucagon receptor mRNA, complete cds
[22445] gi|405189|gb|L20316.1|HUMGLUCREC[405189]
[22446] 16465: M24853
[22447] Homo sapiens (clone H12) low affinity IgG receptor CD16 (FcGRIII) mRNA, 3′ end
[22448] gi|184849|gb|M24853.1|HUMIGGRLA[184849]
[22449] 16466: M80635
[22450] Human fibroblast growth factor receptor-2 (FGFR2) gene, exon B
[22451] gi|182572|gb|M80635.1|HUMFGFRA[182572]
[22452] 16467: L31848
[22453] Homo sapiens serine/threonine kinase receptor 2 (SKR2) gene, 3 alternative splices, 3′ ends
[22454] gi|576680|gb|L31848.1|HUMSKR2[576680]
[22455] 16472: M29066
[22456] Human dopamine D2 receptor (DRD2) mRNA, complete cds
[22457] gi|181828|gb|M29066.1|HUMDRD2A[181828]
[22458] 16473: M85289
[22459] Human heparan sulfate proteoglycan (HSPG2) mRNA, complete cds
[22460] gi|184426|gb|M85289.1|HUMHSPG2B[184426]
[22461] 16474: L02931
[22462] Human hepatocyte growth factor heavy chain (HGF) gene mRNA, complete cds
[22463] gi|184033|gb|L02931.1|HUMHGFX[184033]
[22464] 16475: L19058
[22465] Human glutamate receptor (GLUR5) mRNA, complete cds
[22466] gi|455447|gb|L19058.1|HUMGLUR5X[455447]
[22467] 16476: L20859
[22468] Human leukemia virus receptor 1 (GLVR1) mRNA, complete cds
[22469] gi|306769|gb|L20859.1|HUMGLVR1X[306769]
[22470] 16477: M82919
[22471] Human gamma amino butyric acid (GABAA) receptor beta-3 subunit mRNA, complete cds
[22472] gi|182924|gb|M82919.1|HUMGABRB3A[182924]
[22473] 16478: M86868
[22474] Human gamma amino butyric acid (GABA rho2) gene mRNA, complete cds
[22475] gi|182912|gb|M86868.1|HUMGABARHO[182912]
[22476] 16479: L14061
[22477] Human N-formyl receptor-like 2 protein (FPRL2) gene, complete cds
[22478] gi|292034|gb|L14061.1|HUMFRPL2[292034]
[22479] 16480: M95489
[22480] H. sapiens follicle stimulating hormone receptor mRNA, complete cds
[22481] gi|182772|gb|M95489.1|HUMFSHREC[182772]
[22482] 16481: M84562
[22483] Human formyl peptide receptor-like receptor (FPRL1) mRNA, complete cds
[22484] gi|182741|gb|M84562.1|HUMFPRL1A[182741]
[22485] 16482: M97193
[22486] Homo sapiens fibroblast growth factor receptor 2 IIIb (FGFR2) mRNA, complete cds
[22487] gi|182566|gb|M97193.1|HUMFGFR2A[182566]
[22488] 16483: M23562
[22489] Human IgE Fc-epsilon-RIIa gene, exon 2, and Fc-epsilon-RIIb gene, exon 1
[22490] gi|182444|gb|M23562.1|HUMFCEIIA[182444]
[22491] 16484: M76595
[22492] Human erythropoietin receptor mRNA sequence derived from DNA, 5′ end
[22493] gi|182147|gb|M76595.1|HUMEPR[182147]
[22494] 16485: M77244
[22495] H. sapiens erythropoietin receptor (EPOR) gene, 5′ end
[22496] gi|182133|gb|M77244.1|HUMEPOR[182133]
[22497] 16486: M24736
[22498] Human endothelial leukocyte adhesion molecule 1 (ELAM-1) mRNA, complete cds
[22499] gi|537523|gb|M24736.1|HUMELAM1A[537523]
[22500] 16487: L37361
[22501] Homo sapiens (clone hELK-L) ELK receptor tyrosine kinase ligand (EFL-3) mRNA, complete cds
[22502] gi|567005|gb|L37361.1|HUMEFL3[567005]
[22503] 16488: L37360
[22504] Homo sapiens (clone hEHK1-L) EHK1 receptor tyrosine kinase ligand (EFL-2) mRNA,
[22505] complete cds
[22506] gi|567003|gb|L37360.1|HUMEFL2[567003]
[22507] 16489: K03193
[22508] Human aberrant (short) epidermal growth factor receptor mRNA, complete cds
[22509] gi|181984|gb|K03193.1|HUMEGFRS[181984]
[22510] 16490: M11234
[22511] Human epidermal growth factor receptor (EGFR) gene, exon 1
[22512] gi|181981|gb|M11234.1|HUMEGFRG[181981]
[22513] 16491: L06623
[22514] Homo sapiens endothelin receptor type B (EDNRB) mRNA, complete cds
[22515] gi|9181958|gb|L06623.1|HUMEDNRB[181958]
[22516] 16494: M67439
[22517] Human D5 dopamine receptor (DRD5) gene, complete cds
[22518] gi|181830|gb|M67439.1|HUMDRD5A[181830]
[22519] 16495: M77250
[22520] Human dopamine D2 receptor gene, intron 6/exon 7 boundary
[22521] gi|181825|gb|M77250.1|HUMDRD24[181825]
[22522] 16496: M77249
[22523] Human dopamine D2 receptor gene; exon 3
[22524] gi|181824|gb|M77249.1|HUMDRD23[181824]
[22525] 16497: M77247
[22526] Human dopamine D2 receptor gene, exon 2
[22527] gi|181823|gb|M77247.1|HUMDRD22[181823]
[22528] 16498: M77248
[22529] Human dopamine D2 receptor gene, exon 1
[22530] gi|181822|gb|M77248.1|HUMDRD21[181822]
[22531] 16499: M33210
[22532] Human colony stimulating factor 1 receptor (CSF1R) gene, exon 5
[22533] gi|532591|gb|M33210.1|HUMCSF1R03[532591]
[22534] 16500: M33209
[22535] Human colony stimulating factor 1 receptor (CSF1R) gene, exon 4
[22536] gi|532590|gb|M33209.1|HUMCSF1R02[532590]
[22537] 16501: M33208
[22538] Human colony stimulating factor 1 receptor (CSF1R) gene, exon 2
[22539] gi|532589|gb|M33208.1|HUMCSF1R01[532589]
[22540] 16502: M83328
[22541] Human cell surface glycoprotein CD44 mRNA, (variant F) exons 1, 2, 3, and 5
[22542] gi|180135|gb|M83328.1|HUMCD44J[180135]
[22543] 16503: M83327
[22544] Human cell surface glycoprotein CD44 mRNA, (variant E) exons 1, 2, 3, and 4
[22545] gi|180134|gb|M83327.1|HUMCD441[180134]
[22546] 16504: M83326
[22547] Human cell surface glycoprotein CD44 mRNA, (variant D) exon 1, 2, and 3
[22548] gi|180133|gb|M83326.1|HUMCD44H[180133]
[22549] 16505: M83325
[22550] Human cell surface glycoprotein CD44 mRNA, (variant C) exons 1 and 2
[22551] gi|180132|gb|M83325.1|HUMCD44G[180132]
[22552] 16506: M83324
[22553] Human cell surface glycoprotein CD44 mRNA, (variant B) exon 1
[22554] gi|180131|gb|M83324.1|HUMCD44F[180131]
[22555] 16507: M83554
[22556] H. sapiens lymphocyte activation antigen CD30 mRNA, complete cds
[22557] gi|180095|gb|M83554.1|HUMCD30A[180095]
[22558] 16512: M97759
[22559] Human adenosine A2b receptor (ADORA2) mRNA, complete cds
[22560] gi|178149|gb|M97759.1|HUMADORA1[178149]
[22561] 16513: M80333
[22562] Human m5 muscarinic acetylcholine receptor gene, complete cds
[22563] gi|177987|gb|M80333.1|HUMACHRM[177987]
[22564] 16527: L34339
[22565] Human galanin receptor mRNA, complete cds
[22566] gi|559047|gb|L34339.1|HUMGALAREC[559047]
[22567] 16528: L17033
[22568] Human heparin-binding epidermal growth factor gene sequence
[22569] gi|348176|gb|L17033.1|HUMHBEGFF[348176]
[22570] 16529: L17032
[22571] Human heparin-binding epidermal growth factor gene sequence
[22572] gi|348175|gb|L17032.1|HUMHBEGFE[348175]
[22573] 16530: L17031
[22574] Human heparin-binding epidermal growth factor gene, 3′ end
[22575] gi|348173|gb|L17031.1|HUMHBEGFD[348173]
[22576] 16531: L17030
[22577] Human heparin-binding epidermal growth factor gene, partial cds
[22578] gi|348171|gb|L17030.1|HUMHBEGFC[348171]
[22579] 16532: L17029
[22580] Human heparin-binding epidermal growth factor gene, partial cds
[22581] gi|348169|gb|L17029.1|HUMHBEGFB[348169]
[22582] 16533: L17028
[22583] Human heparin-binding epidermal growth factor gene, 5′ end
[22584] gi|348168|gb|L17028.1|HUMHBEGFA[348168]
[22585] 16534: L13288
[22586] Human vasoactive intestial peptide receptor mRNA, complete cds
[22587] gi|292903|gb|L13288.1|HUMVIPR[292903]
[22588] 16545: M31164
[22589] Human tumor necrosis factor-inducible (TSG-37) mRNA fragment
[22590] gi|339993|gb|M31164.1|HUMTSG37A[339993]
[22591] 16547: L04270
[22592] Homo sapiens (clone CD18) tumor necrosis factor receptor 2 related protein mRNA,
[22593] complete cds
[22594] gi|339761|gb|L04270.1|HUMTNFRRP[339761]
[22595] 16548: M58286
[22596] Homo sapiens tumor necrosis factor receptor mRNA, complete cds
[22597] gi|339753|gb|M58286.1|HUMTNFRB[339753]
[22598] 16562: L07062
[22599] Human somatostatin receptor 3 (SSTR3) gene
[22600] gi|348713|gb|L07062.1|HUMSSTR3Y[348713]
[22601] 16563: L07061
[22602] Human somatostatin receptor 4 (SSTR4) gene
[22603] gi|348712|gb|L07061.1|HUMSSTR4Z[348712]
[22604] 16564: M73489
[22605] Human heat-stable enterotoxin receptor mRNA, complete cds
[22606] gi|338501|gb|M73489.1|HUMSTAR[338501]
[22607] 16565: L04962
[22608] Homo sapiens serotonin receptor (HTR1F) gene, complete cds
[22609] gi|338464|gb|L04962.1|HUMSRCPT1F[338464]
[22610] 16566: M84426
[22611] Homo sapiens substance P receptor (short form) mRNA, complete cds
[22612] gi|338435|gb|M84426.1|HUMSPRSHOR[338435]
[22613] 16567: M84425
[22614] Homo sapiens substance P receptor (long form) mRNA, complete cds
[22615] gi|338427|gb|M84425.1|HUMSPRLONG[338427]
[22616] 16568: M97190
[22617] Human Sp2 protein mRNA, complete cds
[22618] gi|338300|gb|M97190.1|HUMSP2A[338300]
[22619] 16569: L05521
[22620] Human somatostatin receptor subtype 2 gene related dinucleotide repeat
[22621] gi|292502|gb|L05521.1|HUMSOMREPB[292502]
[22622] 16570: L05520
[22623] Human somatostatin receptor subtype 1 gene related dinucleotide repeat
[22624] gi|292501|gb|L05520.1|HUMSOMREPA[292501]
[22625] 16570: L14856
[22626] Human somatostatin receptor gene, complete cds
[22627] gi|292499|gb|L14856.1|HUMSOMAT[292499]
[22628] 16572: L02911
[22629] Human novel serine kinase receptor mRNA, complete cds
[22630] gi|338218|gb|L02911.1|HUMSKRN[338218]
[22631] 16573: L05597
[22632] Human serotonin receptor gene, complete cds
[22633] gi|307419|gb|L05597.1|HUMSEROTON[307419]
[22634] 16576: L10918
[22635] Homo sapiens macrophage inflammatory protein-1-alpha/RANTES receptor mRNA, complete cds
[22636] gi|292416|gb|L10918.1|HUMRANTES[292416]
[22637] 16577: L28824
[22638] Homo sapiens protein tyrosine kinase (Syk) mRNA, complete cds
[22639] gi|479012|gb|L28824.1|HUMPTK[479012]
[22640] 16578: L04308
[22641] Human parathyroid hormone receptor mRNA, complete cds
[22642] gi|190721|gb|L04308.1|HUMPTHR[190721]
[22643] 16579: L02932
[22644] Human peroxisome proliferator activated receptor mRNA, complete cds
[22645] gi|307340|gb|L02932.1|HUMPPAR[307340]
[22646] 16580: L07592
[22647] Human peroxisome proliferator activated receptor mRNA, complete cds
[22648] gi|190229|gb|L07592.1|HUMPPARA[190229]
[22649] 16581: L29016
[22650] Homo sapiens prostanoid IP receptor, complete cds
[22651] gi|495042|gb|L29016.1|HUMPIR[495042]
[22652] 16582: L25124
[22653] Homo sapiens prostaglandin E2 receptor mRNA, complete cds
[22654] gi|435049|gb|L25124.1|HUMPGE2R[435049]
[22655] 16583: L28175
[22656] Homo sapiens prostaglandin E2 receptor EP2 subtype mRNA, complete cds
[22657] gi|452495|gb|L28175.1|HUMPERE[452495]
[22658] 16584: M84986
[22659] Human DNA sequence from 5-hydroxytryptamine 1B receptor region
[22660] gi|189401|gb|M84986.1|HUMORFZ[189401]
[22661] 16585: M84605
[22662] Human putative opioid receptor mRNA, complete cds
[22663] gi|189391|gb|M84605.1|HUMOPIODRE[189391]
[22664] 16587: M89473
[22665] Human neurokinin 3 receptor (NK3R) mRNA, complete cds
[22666] gi|189223|gb|M89473.1|HUMNK3R[189223]
[22667] 16588: L12214
[22668] Human N-formyl receptor gene
[22669] gi|189182|gb|L12214.1|HUMNFORECB[189182]
[22670] 16589: L12213
[22671] Human N-formyl receptor gene
[22672] gi|189181|gb|L12213.1|HUMNFORECA[189181]
[22673] 16590: L13267
[22674] Homo sapiens N-methyl-d-aspartate receptor (NR1-2) mRNA, 3′ end
[22675] gi|292284|gb|L13267.1|HUMMARA[292284]
[22676] 16591: M80634
[22677] Human keratinocyte growth factor receptor mRNA, complete cds
[22678] gi|186740|gb|M80634.1|HUMKGFRA[186740]
[22679] 16592: M80638
[22680] Human keratinocyte growth factor receptor and fibroblast growth factor receptor-2 gene, exon
[22681] gi|186737|gb|M80638.1|HUMKFGFRB[186737]
[22682] 16593: M80636
[22683] Human keratinocyte growth factor receptor and fibroblast growth factor receptor-2 gene, exon
[22684] gi|186736|gb|M80636.1|HUMKFGFRA[186736]
[22685] 16594: M59911
[22686] Human integrin alpha-3 chain mRNA, complete cds
[22687] gi|186496|gb|M59911.1|HUMINTA3A[186496]
[22688] 16595: M75914
[22689] Human interleukin 5 receptor alpha mRNA, complete cds
[22690] gi|186387|gb|M75914.1|HUMILSRAA[186387]
[22691] 16596: M73724
[22692] Human insulin-like growth factor-I receptor gene, exon 1
[22693] gi|186383|gb|M73724.1|HUMILGFIR[186383]
[22694] 16597: M94582
[22695] Human interleukin 8 receptor B mRNA, complete cds
[22696] gi|186377|gb|M94582.1|HUMILEU8R[186377]
[22697] 16599: M24559
[22698] Human poly-Ig receptor transmembrane secretory component mRNA, 3′ end
[22699] gi|514365|gb|M24559.1|HUMIGRPOLY[514365]
[22700] 16600: L03418
[22701] Human Fc-gamma receptor I A1 mRNA, complete cds
[22702] gi|184840|gb|L03418.1|HUMIGGFCIA[184840]
[22703] 16601: M73780
[22704] Human integrin beta-8 subunit mRNA, complete cds
[22705] gi|184520|gb|M73780.1|HUMIBBSUA[184520]
[22706] 16602: L09732
[22707] Homo sapiens 5-hydroxytryptamine 1D receptor gene, complete cds
[22708] gi|184467|gb|L09732.1|HUMHTRD1A[184467]
[22709] 16603: M83180
[22710] Human serotonin receptor gene, complete cds
[22711] gi|184463|gb|M83180.1|HUMHTRA[184463]
[22712] 16605: M63889
[22713] Human heparin-binding growth factor receptor (HBGF-R-alpha-a3) mRNA, complete cds
[22714] gi|183882|gb|M63889.1|HUMHBGFC[183882]
[22715] 16606: L22607
[22716] Homo sapiens A3 adenosine receptor mRNA, complete cds
[22717] gi|413863|gb|L22607.1|HUMHAAR[413863]
[22718] 16607: M82819
[22719] Human DNA sequence
[22720] gi|183778|gb|M82819.1|HUMHAIGGR[183778]
[22721] 16608: L13436
[22722] Homo sapiens guanylate cyclase mRNA, complete mature peptide
[22723] gi|292071|gb|L13436.1|HUMGUANCYC[292071]
[22724] 16609: L08177
[22725] Human EBV induced G-protein coupled receptor (EBI2) mRNA, complete cds
[22726] gi|292056|gb|L08177.1|HUMGPCRB[292056]
[22727] 16610: L07949
[22728] Homo sapiens GnRH receptor mRNA, complete cds
[22729] gi|292052|gb|L07949.1|HUMGNRHR[292052]
[22730] 16611: L03380
[22731] Human gonadotropin-releasing hormone receptor mRNA, complete cds
[22732] gi|18342|gb|L03380.1|HUMGNRHREC[183421]
[22733] 16612: M73832
[22734] Human GM-CSF receptor (GM-CSF receptor) mRNA, complete cds
[22735] gi|306773|gb|M73832.1|HUMGMCSFRA[306773]
[22736] 16613: M64445
[22737] Human GM-CSF receptor mRNA, complete cds
[22738] gi|183361|gb|M64445.1|HUMGMCSF[183361]
[22739] 16614: L24751
[22740] Homo sapiens glucagon receptor gene, partial cds
[22741] gi|404723|gb|L24751.1|HUMGLCGNR[404723]
[22742] 16615: L01406
[22743] Human growth hormone-releasing hormone receptor mRNA, complete cds
[22744] gi|183172|gb|L01406.1|HUMGHRHREC[183172]
[22745] 16616: L08109
[22746] Human low-affinity Fc-gamma receptor IIC gene, exons 4-7
[22747] gi|183090|gb|L08109.1|HUMGFCIIC[183090]
[22748] 16617: L08108
[22749] Human low-affinity Fc-receptor IIB gene, exons 4-7
[22750] gi|183089|gb|L08108.1|HUMGFCIIB[183089]
[22751] 16618: L08107
[22752] Human low-affinity Fc-gamma receptor IIA gene, exons 4-7
[22753] gi|183088|gb|L08107.1|HUMGFCIIA[183088]
[22754] 16619: M69106
[22755] Human Gata3 enhancer-binding protein mRNA, complete cds
[22756] gi|182999|gb|M69106.1|HUMGATA3BP[182999]
[22757] 16620: M59216
[22758] Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exon 9
[22759] gi|182921|gb|M59216.1|HUMGABRB15[182921]
[22760] 16621: M59215
[22761] Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exons 6, 7 and
[22762] 8
[22763] gi|182920|gb|M59215.1|HUMGABRB14[182920]
[22764] 16622: M59214
[22765] Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exon 5
[22766] gi|182919|gb|M59214.1|HUMGABRB13[182919]
[22767] 16623: M59213
[22768] Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exon 4
[22769] gi|182918|gb|M5923.13|HUMGABRB12[182918]
[22770] 16624: M59212
[22771] Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exons 1, 2 and
[22772] 3
[22773] gi|182917|gb|M59212.1|HUMGABRB11[182917]
[22774] 16625: M11067
[22775] Human c-fms proto-oncogene, exon 2, partial cds
[22776] gi|182674|gb|M11067.1|HUMFMSB[182674]
[22777] 16626: M91647
[22778] Human high-affinity Fc IgG receptor gamma polypeptide (FcgammaRI) gene
[22779] gi|182486|gb|M91647.1|HUMFCIGGHC[182486]
[22780] 16627: M91646
[22781] Human high-affinity Fc IgG receptor gamma polypeptide (FcgammaRI) gene
[22782] gi|182485(gb|M91646.1|HUMFCIGGHB[182485]
[22783] 16628: M91645
[22784] Human high-affinity Fc IgG receptor gamma polypeptide (FcgammaRI) gene
[22785] gi|182484|gb|M91645.1|HUMFCIGGHA[182484]
[22786] 16629: L03420
[22787] Human Fc-gamma receptor I B2 mRNA, complete cds
[22788] gi|182461|gb|L03420.1|HUMFCGR1BB[182461]
[22789] 16630: L03419
[22790] Human Fc-gamma receptor I B1 mRNA, complete cds
[22791] gi|182460|gb|L03419.1|HUMFCGR1B[182460]
[22792] 16632: L08603
[22793] Human melanocortin 4 receptor gene, complete cds
[22794] gi|291977|gb|L08603.1|HUMEL4REC[182460]
[22795] 16633: M93111
[22796] Human endothelial cell-derived thrombin receptor cDNA, 5′ additional sequence
[22797] gi|181945 gb|M93111.1|HUMECTR[181945]
[22798] 16635: M94915
[22799] Human dinucleotide repeat polymorphism gene
[22800] gi|181836|gb|M94915.1|HUMDRP[181836]
[22801] 16636: L12116
[22802] Homo sapiens dinucleotide polymorphism in the G-protein coupled receptor gene (d20s32e)
[22803] gi|181631|gb|L12116.1|HUMDNP[181631]
[22804] 16637: M25945
[22805] Human DNA sequence, C-beta locus
[22806] gi|181627|gb|M25945.1|HUMDNAZ[181627]
[22807] 16639: L22303
[22808] Human dopamine receptor D2 gene, repeat polymorphism
[22809] gi|441061|gb|L22303.1|HUMD2RP[441061]
[22810] 16640: L23333
[22811] Human corticotropin releasing factor receptor mRNA, complete cds
[22812] gi|408691|gb|L23333.1|HUMCRFRB[408691]
[22813] 16641: L23332
[22814] Human corticotropin releasing factor receptor mRNA, complete cds
[22815] gi|408689|gb|L23332.1|HUMCRFRA[408689]
[22816] 16642: M73238
[22817] Human ciliary neurotrophic factor receptor (CNTFR) mRNA, complete cds
[22818] gi|180710|gb|M73238.1|HUMCNTFR[180710]
[22819] 16643: M63835
[22820] Human IgG Fc receptor I gene, exon 6 and complete cds
[22821] gi|80277|gb|M63835.1|HUMCFCGRI6[180277]
[22822] 16644: M63834
[22823] Human IgG Fc receptor I gene, exon 5
[22824] gi|180276|gb|M63834.1|HUMCFCGRI5[180276]
[22825] 16645: M63833
[22826] Human IgG Fc receptor I gene, exon 4
[22827] gi|180275|gb|M63833.1|HUMCFCGRI4[180275]
[22828] 16646: M63832
[22829] Human IgG Fc receptor I gene, exon 3
[22830] gi|180274|gb|M63832.1|HUMCFCGRI3[180274]
[22831] 16647: M63831
[22832] Human IgG Fc receptor I gene, exon 2
[22833] gi|180273|gb|M63831.1|HUMCFCGRI2[180273]
[22834] 16648: M63830
[22835] Human IgG Fc receptor I gene, exon 1
[22836] gi|180272|gb|M63830.1|HUMCFCGRI1[180272]
[22837] 16649: L13605
[22838] Human cholecystokinin A receptor mRNA, complete cds
[22839] gi|306490|gb|L13605.1|HUMCCKAR[306490]
[22840] 16650: L08112
[22841] Human brain cholecystokinin-B/gastrin receptor mRNA, complete cds
[22842] gi|306488|gb|L08112.1|HUMCCBGR[306488]
[22843] 16651: L04473
[22844] Human cholecystokinin receptor mRNA, complete cds
[22845] gi|179997|gb|L04473.1|HUMCCKR[179997]
[22846] 16652: L00587
[22847] Human calcitonin receptor mRNA, complete cds
[22848] gi|179879|gb|L00587.1|HUMCALREC[179879]
[22849] 16653: L08893
[22850] Human bombesin receptor subtype-3 mRNA, complete cds
[22851] gi|291876|gb|L08893.1|HUMBOMB3S[291876]
[22852] 16654: L27594
[22853] Homo sapiens bradykinin B2 receptor gene sequence
[22854] gi|508475|gb|L27594.1|HUMBB2R[508475]
[22855] 16656: M28639
[22856] Human autoimmune thyroid disease-related antigen mRNA
[22857] gi|291864|gb|M28639.1|HUMATDRAGA[291864]
[22858] 16657: M91464
[22859] Human angiotensinogen II type-1A receptor gene, complete cds
[22860] gi|179121|gb|M91464.1|HUMAT1A[179121]
[22861] 16658: M87290
[22862] Human angiotensin II type 1 receptor mRNA, complete cds
[22863] gi|178682|gb|M87290.1|HUMANTIR[178682]
[22864] 16659: M26228
[22865] Human anti-angiotensinogen mRNA, partial cds
[22866] gi|178641|gb|M26228.1|HUMANGA[178641]
[22867] 16661: M99590
[22868] Homo sapiens (clone pmt2-huma1b) alpha-1B adrenergic receptor gene sequence
[22869] gi|17821|gb|M99590.1|HUMADRENB[178211]
[22870] 16663: M93415
[22871] Human activin type II receptor mRNA, complete cds
[22872] gi|178049|gb|M93415.1|HUMACTIIA[178049]
[22873] 16664: M74954
[22874] Human alpha-5-beta-1 fibronectin receptor
[22875] gi|177940|gb|M74954.1|HUMABFIREC[177940]
[22876] 16665: L25827
[22877] Human a7 nicotinic acetylcholine receptor mRNA
[22878] gi|438616|gb|L25827.1|HUMA7NAR[438616]
[22879] 16666: M76446
[22880] Human alpha-A1-adrenergic receptor mRNA, complete cds
[22881] gi|177806|gb|M76446.1|HUMA1AADR[177806]
[22882] 16667: M89955
[22883] Human 5-HT1D-type serotonin receptor gene, complete cds
[22884] gi|177771|gb|M89955.1|HUM5HT1DA[177771]
[22885] 16668: M89478
[22886] Human 5-HT1B serotonin receptor gene
[22887] gi|177770|gb|M89478.1|HUM5HT1BSR[177770]
[22888] 16669: L36162
[22889] Homo sapiens (clone TH3L) receptor tyrosine kinase tire ITT (DTD) mRNA
[22890] gi|537326|gb|L36162.1|HUM3RTK[537326]
[22891] 16670: L05666
[22892] Homo sapiens NMDA receptor subunit (NR1) mRNA, complete cds
[22893] gi|307302|gb|L05666.1|HUMNMDAREC[307302]
[22894] 16671: L14865
[22895] Human somatostatin receptor (SST) gene, complete cds
[22896] gi|431094|gb|L14865.1|HUMSST28A[431094]
[22897] 16672: L24894
[22898] Human myelin protein zero (PO) gene, exon 1
[22899] gi|454413|gb|L24894.1|HUMAAC01[454413]
[22900] 16673: L24893
[22901] Human myelin protein zero (PO) gene, exons 2, 3, 4, 5, and 6
[22902] gi|454412|gb|L24893.1|HUMAAC02[454412]
[22903] 16674: L25119
[22904] Human Mu opiate receptor (MOR1) mRNA, complete cds
[22905] gi|452072|gb|L25119.1|HUMMOR1X[452072]
[22906] 16676: L24804
[22907] Human (p23) mRNA, complete cds
[22908] gi|438651|gb|L24804.1|HUMPRA[438651]
[22909] 16677: L21954
[22910] Human peripheral benzodiazepine receptor gene, exon 4
[22911] gi|483405|gb|L21954.1|HSPBR4[483405]
[22912] 16678: L21953
[22913] Human peripheral benzodiazepine receptor gene, exon 3
[22914] gi|483404|gb|L21953.1|HSPBR3[483404]
[22915] 16679: L21952
[22916] Human peripheral benzodiazepine receptor gene, exon 2
[22917] gi|483403|gb|L21952.1|HSPBR2[483403]
[22918] 16680: L21951
[22919] Human peripheral benzodiazepine receptor gene, exon 1
[22920] gi|483402|gb|L21951.1|HSPBR1[483402]
[22921] 16681: L21950
[22922] Human peripheral benzodiazepine receptor related mRNA sequence
[22923] gi|483401|gb|L21950.1|HUMBENZA[483401]
[22924] 16682: L20817
[22925] Homo sapiens tyrosine protein kinase (CAK) gene, complete cds
[22926] gi|306474|gb|L20817.1|HUMCAK[306474]
[22927] 16683: L20852
[22928] Human leukemia virus receptor 2 (GLVR2) mRNA, complete cds
[22929] gi|306771|gb|L20852.1|HUMGLVR2X[306771]
[22930] 16684: L24470
[22931] Homo sapiens prostanoid FP receptor mRNA, complete cds
[22932] gi|456563|gb|L24470.1|HUMPF2AR[456563]
[22933] 16685: L22214
[22934] Human adenosine A1 receptor (ADORA1) mRNA exons 1-6, complete cds
[22935] gi|347520|gb|L22214.1|HUMADORA1X[347520]
[22936] 16687: L23503
[22937] Human glucagon-like peptide-1 receptor (GLP-1) mRNA, complete cds
[22938] gi|402480|gb|L23503.1|HUMGLP1R[402480]
[22939] 16689: L10820
[22940] Human N-formyl peptide receptor (FPR1) gene, complete cds and Alu repeats
[22941] gi|182739|gb|L10820.1|HUMFPR1A[182739]
[22942] 16690: M99293
[22943] Homo sapiens seven transmembrane segment receptor mRNA, complete cds
[22944] gi|292516|gb|M99293.1|HUMSTSR[292516]
[22945] 16691: L01639
[22946] Human (clone HSY3RR) neuropeptide Y receptor (NPYR) mRNA, complete cds
[22947] gi|189313|gb|L01639.1|HUMNYRECA[189313]
[22948] 16692: L20463
[22949] Human A3 adenosine receptor mRNA, complete cds
[22950] gi|349448|gb|L20463.1|HUMA3ADENR[349448]
[22951] 16693: L19872
[22952] Human AH-receptor mRNA, complete cds
[22953] gi|41614|gb|L19872.1|HUMAHREC[416141]
[22954] 16694: L17075
[22955] Human TGF-b superfamily receptor type I mRNA, complete cds
[22956] gi|425147|gb|L17075.1|HUMTGFBRS[425147]
[22957] 16695: L14075
[22958] Homo sapiens immunoglobulin receptor alpha chain gene, complete cds
[22959] gi|410211|gb|L14075.1|HUMIGERA[410211]
[22960] 16696: L11695
[22961] Human activin receptor-like kinase (ALK-5) mRNA, complete cds
[22962] gi|431034|gb|L11695.1|HUMALK5A[431034]
[22963] 16697: L22206
[22964] Human vasopressin receptor V2 gene, complete cds
[22965] gi|347522|gb|L22206.1|HUMV2R[347522]
[22966] 16698: M91211
[22967] Human receptor for advanced glycosylation end products (RAGE) mRNA, partial cds
[22968] gi|190845|gb|M91211.1|HUMRAGE[190845]
[22969] 16699: L20469
[22970] Human truncated dopamine D3 receptor mRNA, complete cds
[22971] gi|306688|gb|L20469.1|HUMD3DR[306688]
[22972] 16701: L11315
[22973] Homo sapiens receptor tyrosine kinase mRNA, complete cds
[22974] gi|403386|gb|L11315.1|HUMRTK[403386]
[22975] 16702: L19315
[22976] Human cholecystokinin A receptor mRNA, complete cds
[22977] gi|306595|gb|L19315.1|HUMCHOLREC[306595]
[22978] 16724: L15310
[22979] Homo sapiens glucagon-like peptide-1 receptor gene
[22980] gi|292051|gb|L15310.1|HUMGLP1RGA[292051]
[22981] 16725: M99624
[22982] Human epidermal growth factor receptor-related gene, 5′ end
[22983] gi|178251|gb|M99624.1|HUMAGGCRB[178251]-892-Appendix II
[22984] 1: NM—017882
[22985] Homo sapiens ceroid-lipofuscinosis, neuronal 6, late infantile, variant (CLN6),
[22986] mRNA
[22987] gi|8923531|ref|NM—017882.1|[8923531]
[22988] 2: BI480800
[22989] H2RPE-0436 Human Retinal Pigment Epithelium (2) Homo sapiens cDNA 5′ similar to
[22990] glycoprotein (transmembrane) nmb (GPNMB), mRNA sequence
[22991] gi|18998609|gb|BI480800.1|BI480800[18998609]
[22992] 4: AC096780
[22993] Tcc118, complete sequence
[22994] gi|18958727|gb|AC096780.1|[18958727]
[22995] 5: AC113243
[22996] Tcc1a22, complete sequence
[22997] gi|18958719|gb|AC113243.1|[18958719]
[22998] 6: AF347029
[22999] Homo sapiens transmembrane protein (C60RF33) mRNA, complete cds
[23000] gi|18873730|gb|AF347029.1|[18873730]
[23001] 8: NM—001183
[23002] Homo sapiens ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit
[23003] 1 (ATP6S1), mRNA
[23004] gi|17136147|ref|NM—001183.2|[17136147]
[23005] 13: NM—005765
[23006] Homo sapiens ATPase, H+ transporting, lysosomal (vacuolar proton pump) membrane
[23007] sector associated protein M8-9 (ATP6M8-9), mRNA
[23008] gi|15011917|ref|NM—005765.2|[15011917]
[23009] 14: AB028140
[23010] Homo sapiens mRNA for spinesin, complete cds
[23011] gi|12248916|dbj|AB028140.1|[12248916]
[23012] 15: NM—002846
[23013] Homo sapiens protein tyrosine phosphatase, receptor type, N (PTPRN), mRNA
[23014] gi|18860905|ref|NM—002846.2|[18860905]
[23015] 16: NM—002845
[23016] Homo sapiens protein tyrosine phosphatase, receptor type, M (PTPRM), mRNA
[23017] gi|18860903|ref|NM—002845.2|[18860903]
[23018] 17: NM—002844
[23019] Homo sapiens protein tyrosine phosphatase, receptor type, K (PTPRK), mRNA
[23020] gi|18860901|ref|NM—002844.2|[18860901]
[23021] 18: NM—002843
[23022] Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA
[23023] gi|18860899|ref|NM—002843.2|[18860899]
[23024] 19: NM—002841
[23025] Homo sapiens protein tyrosine phosphatase, receptor type, G (PTPRG), mRNA
[23026] gi|18860897|ref|NM—002841.2|[18860897]
[23027] 20: NM—130440
[23028] Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript
[23029] variant 2, mRNA
[23030] gi|18860895|ref|NM—130440.1|[18860895]
[23031] 21: NM—130393
[23032] Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript
[23033] variant 4, mRNA
[23034] gi|18860893|ref|NM—130393.1|[18860893]
[23035] 22: NM—130392
[23036] Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript
[23037] variant 3, mRNA
[23038] gi|18860891|ref|NM—130392.1|[18860891]
[23039] 23: NM—130391
[23040] Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript
[23041] variant 2, mRNA
[23042] gi|18860889|ref|NM—130391.1|[18860889]
[23043] 24: NM—002840
[23044] Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript
[23045] variant 1, mRNA
[23046] gi|18860871|ref|NM—002840.2|[18860871]
[23047] 25: NM—006504
[23048] Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript
[23049] variant 1, mRNA
[23050] gi|18860860|ref|NM—006504.2|[18860860]
[23051] 26: NM—130435
[23052] Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript
[23053] variant 2, mRNA
[23054] gi|18860858|ref|NM—130435.1|[18860858]
[23055] 27: NM—002842
[23056] Homo sapiens protein tyrosine phosphatase, receptor type, H (PTPRH), mRNA
[23057] gi|4506312|ref|NM—002842.1|[4506312]
[23058] 28: NM—002839
[23059] Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript
[23060] variant 1, mRNA
[23061] gi|4506308|ref|NM—002839.1|[4506308]
[23062] 29: BC024191
[23063] Homo sapiens, Similar to transmembrane protein HTMP10, clone IMAGE:4799785, mRNA
[23064] gi|18848306|gb|BC024191.1[18848306]
[23065] 30: NM—023068
[23066] Homo sapiens sialoadhesin (SN), mRNA
[23067] gi|18765743|ref|NM—023068.2|[18765743]
[23068] 31: NM—032646
[23069] Homo sapiens tweety homolog 2 (Drosophila) (TTYH2), mRNA
[23070] gi|17939343|ref|NM—032646.4|[17939343]
[23071] 32: NM—022006
[23072] Homo sapiens FXYD domain-containing ion transport regulator 7 (FXYD7), mRNA
[23073] gi|11612658|ref|NM—022006.1|[11612658]
[23074] 33: NM—022003
[23075] Homo sapiens FXYD domain-containing ion transport regulator 6 (FXYD6), mRNA
[23076] gi|11612654|ref|NM—022003.1|[11612654]
[23077] 34: NM—002127
[23078] Homo sapiens HLA-G histocompatibility antigen, class I, G (HLA-G), mRNA
[23079] gi|18765718|ref|NM—002127.2|[18765718]
[23080] 35: NM—005516
[23081] Homo sapiens major histocompatibility complex, class I, E (HLA-E), mRNA
[23082] gi|18765717|ref|NM—005516.2|[18765717]
[23083] 36: NM—002121
[23084] Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1),
[23085] mRNA
[23086] gi|18765716|ref|NM—002121.3|[18765716]
[23087] 37: NM—006120
[23088] Homo sapiens major histocompatibility complex, class II, DM alpha (HLA-DMA), mRNA
[23089] gi|18765714|ref|NM—006120.2|[18765714]
[23090] 38: NM—002116
[23091] Homo sapiens major histocompatibility complex, class I, A (HLA-A), mRNA
[23092] gi|18765713|ref|NM—002116.3|[18765713]
[23093] 39: NM—130797
[23094] Homo sapiens dipeptidylpeptidase VI (DPP6), transcript variant 1, mRNA
[23095] gi|18765697|ref|NM—130797.1|[18765697]
[23096] 40: NM—001936
[23097] Homo sapiens dipeptidylpeptidase VI (DPP6), transcript variant 2, mRNA
[23098] gi|18765695|ref|NM—001936.2|[18765695]
[23099] 41: NM—018593
[23100] Homo sapiens solute carrier family 16 (monocarboxylic acid transporters), member
[23101] 10 (SLC16A10), mRNA
[23102] gi|18699729|ref|NM—018593.2|[18699729]
[23103] 42: BM510040
[23104] ig97b09.x1 HR85 islet Homo sapiens cDNA clone IMAGE: 3′ similar to TR:O60478 O60478 PUTATIVE SEVEN PASS TRANSMEMBRANE PROTEIN.;, mRNA sequence
[23105] gi|18681183|gb|BM510040.1|BM510040[18681183]
[23106] 43: BM509858
[23107] ig94h01.y1 HR85 islet Homo sapiens cDNA clone IMAGE: 5′ similar to SW:MTRP_HUMAN
[23108] Q15012 GOLGI 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP; mRNA sequence
[23109] gi|18681001|gb|BM509858.1|BM509858[18681001]
[23110] 44: BM509717
[23111] ig93b05.y1 HR85 islet Homo sapiens cDNA clone IMAGE: 5′ similar to SW:MTRP_HUMAN
[23112] Q15012 GOLGI 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence
[23113] gi|18680860|gb|BM509717.1|BM509717[18680860]
[23114] 45: BM508064
[23115] ij38f06.x1 Human insulinoma Homo sapiens cDNA clone IMAGE:5633410 3′ similar to
[23116] TR:P97544 P97544 ER TRANSMEMBRANE PROTEIN.;, mRNA sequence
[23117] gi|18679207|gb|BM508064.1|BM508064[18679207]
[23118] 46: NM—033543
[23119] Homo sapiens hypothetical protein R29124—1 (R29124—1), mRNA
[23120] gi|16117774|ref|NM—033543.1|[16117774]
[23121] 47: NM—032732
[23122] Homo sapiens hypothetical protein MGC10763 (IL17RL), mRNA
[23123] gi|14249349|ref|NM—032732.1|[14249349]
[23124] 48: NM—018676
[23125] Homo sapiens TMTSP for transmembrane molecule with thrombospondin module (LOC55901), mRNA
[23126] gi|8923893|ref|NM—018676.1|[8923893]
[23127] 49: NM—016372
[23128] Homo sapiens seven transmembrane domain orphan receptor (TPRA40), mRNA
[23129] gi|7705964|ref|NM—016372.1|[7705964]
[23130] 50: L47337
[23131] Homo sapiens transmembrane protein (TMC) mRNA, complete cds
[23132] gi|18654193|gb|L47337.1|HUMTMC[18654193]
[23133] 56: Y13567
[23134] Homo sapiens HLA-B*07022 gene exon 1-5
[23135] gi|4007617|emb|Y13567.1|HSY13567[4007617]
[23136] 57: NM—032027
[23137] Homo sapiens beta-amyloid binding protein precursor (BBP), mRNA
[23138] gi|17738309|ref|NM—032027.2|[17738309]
[23139] 58: NM—030913
[23140] Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C (SEMA6C), mRNA
[23141] gi|16306551|ref|NM—030913.2|[16306551]
[23142] 59: NM—021203
[23143] Homo sapiens APMCF1 protein (APMCF1), mRNA
[23144] gi|14917112|ref|NM—021203.2|[14917112]
[23145] 60: NM—006854
[23146] Homo sapiens KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), mRNA
[23147] gi|8051609|ref|NM—006854.21[8051609]
[23148] 61: NM—014394
[23149] Homo sapiens growth hormone inducible transmembrane protein (GHITM), mRNA
[23150] gi|7657479|ref|NM—014394.1|[7657479]
[23151] 62: NM—014399
[23152] Homo sapiens tetraspan NET-6 protein (NET-6), mRNA
[23153] gi|7657372|ref|NM—014399.1|[7657372]
[23154] 63: NM—014478
[23155] Homo sapiens calcitonin gene-related peptide-receptor component protein (CGRP-RCP), mRNA
[23156] gi|7656976|ref|NM—014478.1|[7656976]
[23157] 64: NM—007324
[23158] Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 1,
[23159] mRNA
[23160] gi|6552338|ref|NM—007324.1|[6552338]
[23161] 65: NM—007323
[23162] Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 2,
[23163] mRNA
[23164] gi|6552336|ref|NM—007323.1|[6552336]
[23165] 66: NM—006876
[23166] Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (B3GNT6), mRNA
[23167] gi|5802983|ref|NM—006876.1|[5802983]
[23168] 67: NM—006675
[23169] Homo sapiens tetraspan transmembrane 4 super family (NET-5), mRNA
[23170] gi|5729940|ref|NM—006675.1|[5729940]
[23171] 68: NM—006405
[23172] Homo sapiens transmembrane 9 superfamily member 1 (TM9SF1), mRNA
[23173] gi|5453741|ref|NM—006405.1|[5453741]
[23174] 69: NM—005761
[23175] Homo sapiens plexin C1 (PLXNC1), mRNA
[23176] gi|5032222|ref|NM—005761.1|[5032222]
[23177] 70: NM—005814
[23178] Homo sapiens glycoprotein A33 (transmembrane) (GPA33), mRNA
[23179] gi|5031560|ref|NM—005814.1|[5031560]
[23180] 71: NM—004799
[23181] Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 3,
[23182] mRNA
[23183] gi|4759059|ref|NM—004799.1|[4759059]
[23184] 72: NM—003764
[23185] Homo sapiens syntaxin 11 (STX11), mRNA
[23186] gi|4507286|ref|NM—003764.1|[4507286]
[23187] 73: NM—003622
[23188] Homo sapiens PTPRF interacting protein, binding protein 1 (liprin beta 1) (PPFIBP1), mRNA
[23189] gi|4505986|ref|NM—003622.1|[4505986]
[23190] 74: NM—003626
[23191] Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF),
[23192] interacting protein (liprin), alpha 1 (PPFIA1), mRNA
[23193] gi|4505982|ref|NM—003626.1|[4505982]
[23194] 75: NM—033266
[23195] Homo sapiens ER to nucleus signalling 2 (ERN2), mRNA
[23196] gi|15149481|ref|NM—033266.1|[15149481]
[23197] 76: NM—030780
[23198] Homo sapiens folate transporter/carrier (LOC81034), mRNA
[23199] gi|13540550|ref|NM—030780.1|[13540550]
[23200] 77: NM—025179
[23201] Homo sapiens plexin A2 (PLXNA2), mRNA
[23202] gi|13378152|ref|NM—025179.1|[13378152]
[23203] 78: NM—022097
[23204] Homo sapiens hepatocellular carcinoma antigen gene 520 (LOC63928), mRNA
[23205] gi|11545810|ref|NM—022097.1|[11545810]
[23206] 79: NM—019111
[23207] Homo sapiens major histocompatibility complex, class II, DR alpha (HLA-DRA), mRNA
[23208] gi|18641378|ref|NM—019111.2|[18641378]
[23209] 80: NM—002120
[23210] Homo sapiens major histocompatibility complex, class II, DO beta (HLA-DOB), mRNA
[23211] gi|18641377|ref|NM—002120.2|[18641377]
[23212] 81: NM—002118
[23213] Homo sapiens major histocompatibility complex, class II, DM beta (HLA-DMB), mRNA
[23214] gi|18641376|ref|NM—002118.3|[18641376]
[23215] 82: NM—002125
[23216] Homo sapiens major histocompatibility complex, class II, DR beta 5 (HLA-DRB5),
[23217] mRNA
[23218] gi|18641374|ref|NM—002125.2|[18641374]
[23219] 83: NM—021983
[23220] Homo sapiens major histocompatibility complex, class II, DR beta 4 (HLA-DRB4),
[23221] mRNA
[23222] gi|18641372|ref|NM—021983.3|[18641372]
[23223] 84: NM—022555
[23224] Homo sapiens major histocompatibility complex, class II, DR beta 3 (HLA-DRB3),
[23225] mRNA
[23226] gi|18641371|ref|NM—022555.3|[18641371]
[23227] 85: NM—080923
[23228] Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript
[23229] variant 4, mRNA
[23230] gi|18641365|ref|NM—080923.1|[18641365]
[23231] 86: NM—080922
[23232] Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript
[23233] variant 3, mRNA
[23234] gi|18641363|ref|NM—080922.1|[18641363]
[23235] 87: NM—080921
[23236] Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript
[23237] variant 2, mRNA
[23238] gi|18641361|ref|NM—080921.1|[18641361]
[23239] 88: NM—130778
[23240] Homo sapiens collagen, type XVII, alpha 1 (COL17A1), transcript variant short,
[23241] mRNA
[23242] gi|18641355|ref|NM—130778.1|[18641355]
[23243] 89: NM—000494
[23244] Homo sapiens collagen, type XVII, alpha 1 (COL17A1), transcript variant long, mRNA
[23245] gi|18641353|ref|NM—000494.2|[18641353]
[23246] 90: NM—002838
[23247] Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript
[23248] variant 1, mRNA
[23249] gi|18641346|ref|NM—002838.2|[18641346]
[23250] 91: NM—030950
[23251] Homo sapiens ret finger protein (RFP), transcript variant beta, mRNA
[23252] gi|18641280|ref|NM—030950.2[18641280]
[23253] 92: NM—130785
[23254] Homo sapiens TPTE and PTEN homologous inositol lipid phosphatase (TPIP), mRNA
[23255] gi|18640755|ref|NM—130785.1|[18640755]
[23256] 93: AB057445
[23257] Homo sapiens hTAT1 mRNA for aromatic amino acid transporter, complete cds
[23258] gi|18640046|dbj|AB057445.1|[18640046]
[23259] 94: NM—006510
[23260] Homo sapiens ret finger protein (RFP), transcript variant alpha, mRNA
[23261] gi|17105396|ref|NM—006510.3|[17105396]
[23262] 95: NM—033554
[23263] Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1),
[23264] mRNA
[23265] gi|15809045|ref|NM—033554.1|[15809045]
[23266] 96: NM—005608
[23267] Homo sapiens protein tyrosine phosphatase, receptor type, C-associated protein
[23268] (PTPRCAP), mRNA
[23269] gi|5032004|ref|NM—005608.1|[5032004]
[23270] 97: BM491907
[23271] pgp2n.pk007.m20 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n)
[23272] Gallus gallus cDNA clone pgp2n.pk007.m20 5′ similar to gb|AAH17476.1|AAH17476 (BC017476) sema domain, immunoglobulin domain (Ig), transmembrane domain TM) and
[23273] short cytoplasmic domain, (semaphorin) 4C [Homo sapiens], mRNA sequence
[23274] gi|18612838|gb|BM491907.1|BM491907[18612838]
[23275] 98: BM491823
[23276] pgp2n.pk007.i6 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n)
[23277] Gallus gallus cDNA clone pgp2n.pk007.i6 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence
[23278] gi|18612754|gb|BM491823.1|BM491823[18612754]
[23279] 99: BM491746
[23280] pgp2n.pk107.f14 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n)
[23281] Gallus gallus cDNA clone pgp2n.pk007.f14 5′ similar to ref|XP—044533.2 (XM—044533) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM)
[23282] and short cytoplasmic domain, (semaphorin) 4B [Homo sapiens], mRNA sequence
[23283] gi|18612677|gb|BM491746.1|BM491746[18612677]
[23284] 100: BM491722
[23285] pgp2n.pk007.d9 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n)
[23286] Gallus gallus cDNA clone pgp2n.pk007.d9 5′ similar to ref|XP—032285.1 (XM—032285) similar to putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1p (Yip1p-interacting factor) [Homo sapiens], mRNA sequence
[23287] gi|18612653|gb|BM491722.1|BM491722[18612653]
[23288] 101: BM491453
[23289] pgp2n.pk006.h11 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n)
[23290] Gallus gallus cDNA clone pgp2n.pk006.h11 5′ similar to ref|XP 058189.1 (XM—058189) similar to Similar to transmembrane 4 superfamily member 1 (H. sapiens) [Homo sapiens] gb|AAH14339.1|AAH14339 (BC014339) Similar to transmembrane 4 superfamily member 1 [Homo sapiens], mRNA sequence
[23291] gi|18612384|gb|BM491453.1|BM491453[18612384]
[23292] 102: BM490974
[23293] pgp2n.pk005.a11 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n)
[23294] Gallus gallus cDNA clone pgp2n.pk005.a11 5′ similar to ref|XP—008022.1 (XM—008022) chromosome 16 open reading frame 5 [Homo sapiens]
[23295] gi|AAG35583.1|AF195661—1 (AF195661) transmembrane protein I1 [Homo sapiens]
[23296] gi|AAH02882.1|AAH02882 (BC002882) chromosome 16 open reading frame 5 [Homo sapiens], mRNA sequence
[23297] gi|18611905|gb|BM490974.1|BM490974[18611905]
[23298] 103: BM490515
[23299] pgp2n.pk003.k2 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n)
[23300] Gallus gallus cDNA clone pgp2n.pk003.k2 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence
[23301] gi|18611446|gb|BM490515.1|BM490515[18611446]
[23302] 104: BM490496
[23303] pgp2n.pk003.j21 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n)
[23304] Gallus gallus cDNA clone pgp2n.pk003.j21 5′ similar to ref|XP—015557.1 (XM—015557) transmembrane gamma-carboxyglutamic acid protein 3 [Homo sapiens],
[23305] mRNA sequence
[23306] gi|18611427|gb|BM490496.1|BM490496[18611427]
[23307] 105: BM490381
[23308] pgp2n.pk003.e10 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n)
[23309] Gallus gallus cDNA clone pgp2n.pk003.e10 5′ similar to ref|NP—057641.1 (NM—016557) orphan seven-transmembrane receptor, chemokine related [Homo sapiens] ref|XP—016022.11 (XM—016022) orphan seven-transmembrane receptor, chemokine related [Homo sapiens] sp|Q9NPB9|CKRB_HUMAN C-C CHEMOKINE RECEPTOR TYPE, mRNA sequence
[23310] gi|18611312|gb|BM490381.1|BM490381[18611312]
[23311] 106: BM489618
[23312] pgm2n.pk011.h5 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk011.h5 5′ similar to ref|NP—114131.1 (NM—031925) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens] gb|AAK16442.1|AF327923—1 (AF327923) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens], mRNA sequence
[23313] gi|18610549|gb|BM489618.1|BM489618[18610549]
[23314] 107: BM489501
[23315] pgm2n.pk011.b24 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk011.b24 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II
[23316] membrane protein [Homo sapiens] dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence
[23317] gi|18610432|gb|BM489501.1|BM489501[18610432]
[23318] 108: BM489487
[23319] pgm2n.pk011.a8 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk011.a8 5′ similar to gb|AAC64943.1 (AF084481) transmembrane protein [Homo sapiens], mRNA
[23320] sequence
[23321] gi|18610418|gb|BM489487.1|BM489487[18610418]
[23322] 109: BM489466
[23323] pgm2n.pk010.p5 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.p5 5′ similar to dbj|AK056595.1|AK056595 Homo sapiens cDNA FLJ32033 fis, clone NTONG2000265, weakly similar to Probable transmembrane protein of fission yeast,
[23324] mRNA sequence
[23325] gi|18610397|gb|BM489466.1|BM489466[18610397]
[23326] 110: BM489443
[23327] pgm2n.pk010.o4 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.o4 5′ similar to ref|XP—008022.1 (XM—008022) chromosome 16 open reading frame 5 [Homo sapiens] gb|AAG35583.1|AF195661—1 (AF195661) transmembrane protein I1 [Homo sapiens] gb|AAH02882.1|AAH02882 (BC002882) chromosome 16 open reading frame 5 [Homo sapiens], mRNA sequence
[23328] gi|18610374|gb|BM489443.1|BM489443[18610374]
[23329] 111: BM489432
[23330] pgm2n.pk010.o15 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.o15 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II
[23331] membrane protein [Homo sapiens] dbj|BAA76498.11 (AB015631) type II membrane protein [Homo sapiens], mRNA sequence
[23332] gi|18610363|gb|BM489432.1|BM489432[18610363]
[23333] 112: BM489389
[23334] pgm2n.pk010.m15 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.m15 5′ similar to ref|XP—028438.1 (XM—028438) CGI-101 protein [Homo sapiens]
[23335] gi|AAF99603.1|AF242523—1 (AF242523) hypothetical transmembrane protein SBB153 [Homo sapiens] gb|AAG43049.1|AF132289—1 (AF132289) F-LAN-1 [Homo sapiens]
[23336] gi|AAH10890.1|AAH10890 (BC010890), mRNA sequence
[23337] gi|18610320|gb|BM489389.1|BM489389[18610320]
[23338] 113: BM489272
[23339] pgm2n.pk010.g4 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.g4 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II
[23340] membrane protein [Homo sapiens] dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence
[23341] gi|18610203|gb|BM489272.1|BM489272[18610203]
[23342] 114: BM489267
[23343] pgm2n.pk010.g2 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.g2 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II
[23344] membrane protein [Homo sapiens] dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens), mRNA sequence
[23345] gi|18610198|gb|BM489267.1|BM489267[18610198]
[23346] 115: BM488196
[23347] pgm2n.pk006.n2 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk006.n2 5′ similar to ref|NP—114434.1 (NM—032045) kringle-containing transmembrane protein;
[23348] kringle-coding gene marking the eye and the nose [Homo sapiens] dbj|BAB40969.11
[23349] (AB059618) kringle-containing transmembrane protein [Homo sapiens), mRNA sequence
[23350] gi|18609127|gb|BM488196.1|BM488196[18609127]
[23351] 116: BM488072
[23352] pgm2n.pk006.h15 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk006.h15 5′ similar to ref|XP—044533.2 (XM—044533) sema domain, immunoglobulin domain (Ig),
[23353] transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B [Homo sapiens], mRNA sequence
[23354] gi|18609003|gb|BM488072.1|BM488072[18609003]
[23355] 117: BM487945
[23356] pgm2n.pk006.h16 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk006.b16 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II
[23357] membrane protein [Homo sapiens] dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence
[23358] gi|18608876|gb|BM487945.1|BM487945[18608876]
[23359] 118: BM487175
[23360] pgm2n.pk003.m18 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk003.m18 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II
[23361] membrane protein [Homo sapiens] dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence
[23362] gi|18608105|gb|BM487175.1|BM487175[18608105]
[23363] 119: BM487035
[23364] pgm2n.pk003.f7 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk003.f7 5′ similar to emb|CAC88191.1 (AL136141) bA138E2.2 (novel protein (lung seven transmembrane receptor 1 (LUSTR1), KIAA1623, FLJ22591, MGC15440)) [Homo sapiens), mRNA sequence
[23365] gi|18607965|gb|BM487035.1|BM487035[18607965]
[23366] 120: BM486914
[23367] pgm2n.pk003.a11 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk003.a11 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II
[23368] membrane protein [Homo sapiens] dbj|BAA76498.11 (AB015631) type II membrane protein [Homo sapiens], mRNA sequence
[23369] gi|18607844|gb|BM486914.1|BM486914[18607844]
[23370] 121: NT—009151
[23371] Homo sapiens chromosome 11 working draft sequence segment
[23372] gi|18604868|ref|NT—009151.8|Hs11—9308[18604868]
[23373] 122: NT—010823
[23374] Homo sapiens chromosome 17 working draft sequence segment
[23375] gi|18604211|ref|NT—010823.8|Hs17—10980[18604211]
[23376] 123: XM—008517
[23377] Homo sapiens similar to transmembrane 4 superfamily member 5 (H. sapiens) (LOC147059), mRNA
[23378] gi|18604159|ref|XM—008517.4|[18604159]
[23379] 124: NT—009482
[23380] Homo sapiens chromosome 12 working draft sequence segment
[23381] gi|18601829|ref|NT—009482.8|Hs129639[18601829]
[23382] 125: NT—009458
[23383] Homo sapiens chromosome 12 working draft sequence segment
[23384] gi|18601539|ref|NT—009458.7|Hs12—9615[18601539]
[23385] 126: NT—005428
[23386] Homo sapiens chromosome 2 working draft sequence segment
[23387] gi|18600405|ref|NT—005428.7|Hs25585[18600405]
[23388] 127: XM—087234
[23389] Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM)
[23390] and short cytoplasmic domain, (semaphorin) 4F (SEMA4F), mRNA
[23391] gi|18600294|ref|XM—087234.1|[18600294]
[23392] 128: NT—030593
[23393] Homo sapiens chromosome 2 working draft sequence segment
[23394] gi|18599598|ref|NT—030593.2|Hs2—30849[18599598]
[23395] 129: XM—092364
[23396] Homo sapiens similar to seven transmembrane receptor (LOC165082), mRNA
[23397] gi|18599578|ref|XM—092364.1|[18599578]
[23398] 130: NT—025667
[23399] Homo sapiens chromosome 3 working draft sequence segment
[23400] gi|18599563|ref|NT—025667.2|Hs325823[18599563]
[23401] 131: NT—010478
[23402] Homo sapiens chromosome 16 working draft sequence segment
[23403] gi|18598685|ref|NT—010478.8|Hs16—10635[18598685]
[23404] 132: NT—010422
[23405] Homo sapiens chromosome 16 working draft sequence segment
[23406] gi|18598469|ref|NT—010422.8|Hs16—10579[18598469]
[23407] 133: NT—030136
[23408] Homo sapiens chromosome 14 working draft sequence segment
[23409] gi|18597657|ref|NT—030136.3|Hs1430391[18597657]
[23410] 134: XM—090902
[23411] Homo sapiens similar to transmembrane 9 superfamily member 1 (H. sapiens) (LOC161426), mRNA
[23412] gi|18597655|ref|XM—090902.1|[18597655]
[23413] 135: XM—085169
[23414] Homo sapiens similar to seven transmembrane receptor BLTR2; leukotriene B4 receptor BLT2 (H. sapiens) (LOC145549), mRNA
[23415] gi|18597626|ref|XM—085169.1|[18597626]
[23416] 136: NT—026437
[23417] Homo sapiens chromosome 14 working draft sequence segment
[23418] gi|18597566|ref|NT—026437.6|Hs14—26604[18597566]
[23419] 137: XM—085149
[23420] Homo sapiens similar to fibronectin leucine rich transmembrane protein 2 (H. sapiens) (LOC145535), mRNA
[23421] gi|18597448|ref|XM—085149.1|[18597448]
[23422] 138: NT—025892
[23423] Homo sapiens chromosome 14 working draft sequence segment
[23424] gi|18597282|ref|NT—025892.7|Hs14—26048[18597282]
[23425] 139: NT—019583
[23426] Homo sapiens chromosome 14 working draft sequence segment
[23427] gi|18596851|ref|NT—019583.8|Hs14—19739[18596851]
[23428] 140: XM—093204
[23429] Homo sapiens similar to G protein-coupled receptor 64; G protein-coupled receptor, epididymis-specific (seven transmembrane family) (LOC170247), mRNA
[23430] gi|18596481|ref|XM—093204.1|[18596481]
[23431] 141: NT—025319
[23432] Homo sapiens chromosome X working draft sequence segment
[23433] gi|18596220|ref|NT—025319.8|HsX—25475[18596220]
[23434] 142: NT—011719
[23435] Homo sapiens chromosome X working draft sequence segment
[23436] gi|18595448|ref|NT—011719.6|HsX—11876[18595448]
[23437] 143: XM—093073
[23438] Homo sapiens similar to TRANSMEMBRANE 9 SUPERFAMILY PROTEIN MEMBER 2 PRECURSOR
[23439] (LOC170048), mRNA
[23440] gi|18595444|ref|XM—093073.1|[18595444]
[23441] 144: XM—060026
[23442] Homo sapiens similar to transmembrane 9 superfamily member 2; 76 kDa membrane protein; transmembrane protein 9 superfamily member 2 (LOC139375), mRNA
[23443] gi|18595426|ref|XM—060026.2|[18595426]
[23444] 145: NT—011687
[23445] Homo sapiens chromosome X working draft sequence segment
[23446] gi|18595291|ref|NT—011687.8|HsX—11844[18595291]
[23447] 146: NT—011657
[23448] Homo sapiens chromosome X working draft sequence segment
[23449] gi|18595178|ref|NT—011657.8|HsX—11814[18595178]
[23450] 147: XM—032382
[23451] Homo sapiens transmembrane 4 superfamily member 2 (TM4SF2), mRNA
[23452] gi|18595108|ref|XM—032382.3|[18595108]
[23453] 148: XM—055073
[23454] Homo sapiens similar to transmembrane phosphatase with tensin homology (H. sapiens) (LOC150132), mRNA
[23455] gi|18593511|ref|XM—055073.3|[18593511]
[23456] 149: XM—009671
[23457] Homo sapiens transmembrane, prostate androgen induced RNA (TMEPAI), mRNA
[23458] gi|18591987|ref|XM—009671.7|[18591987]
[23459] 150: NT—011296
[23460] Homo sapiens chromosome 19 working draft sequence segment
[23461] gi|18591133|ref|NT—011296.8|Hs19—11453[18591133]
[23462] 151: NT—011295
[23463] Homo sapiens chromosome 19 working draft sequence segment
[23464] gi|18591086|ref|NT—011295.5|Hs19—11452[18591086]
[23465] 152: NT—011294
[23466] Homo sapiens chromosome 19 working draft sequence segment
[23467] gi|18591029|ref|NT—011294.7|Hs19—11451[18591029]
[23468] 153: NT—011255
[23469] Homo sapiens chromosome 19 working draft sequence segment
[23470] gi|18590680|ref|NT—011255.8|HS19 11412[18590680]
[23471] 154: NT—011233
[23472] Homo sapiens chromosome 19 working draft sequence segment
[23473] gi|18590500|ref|NT—011233.8|Hs19—11390[18590500]
[23474] 155: XM—032285
[23475] Homo sapiens similar to putative transmembrane protein; homolog of yeast Golgi
[23476] membrane protein Yif1p (Yip1p-interacting factor) (LOC90522), mRNA
[23477] gi|18590452|ref|XM—032285.2|[18590452]
[23478] 156: NT—011151
[23479] Homo sapiens chromosome 19 working draft sequence segment
[23480] gi|18590324|ref|NT—011151.8|Hs19—11308[18590324]
[23481] 157: NT—011109
[23482] Homo sapiens chromosome 19 working draft sequence segment
[23483] gi|18589940|ref|NT—011109.8|Hs19—11266[18589940]
[23484] 158: NT—030157
[23485] Homo sapiens chromosome 17 working draft sequence segment
[23486] gi|18588299|ref|NT—030157.3|Hs1730412[18588299]
[23487] 159: XM—096100
[23488] Homo sapiens transmembrane activator and CAML interactor (TACI), mRNA
[23489] gi|18588295|ref|XM—096100.1|[18588295]
[23490] 160: NT—010672
[23491] Homo sapiens chromosome 17 working draft sequence segment
[23492] gi|18586808|ref|NT—010672.8|Hs17—10829[18586808]
[23493] 161: NT—024776
[23494] Homo sapiens chromosome 16 working draft sequence segment
[23495] gi|8585964|ref|NT—024776.4|Hs16—24932[18585964]
[23496] 162: NT—015360
[23497] Homo sapiens chromosome 16 working draft sequence segment
[23498] gi|18585813|ref|NT—015360.8|Hs16—15516[18585813]
[23499] 163: NT—010552
[23500] Homo sapiens chromosome 16 working draft sequence segment
[23501] gi|18585429|ref|NT—010552.8|Hs16—10709[18585429]
[23502] 164: NT—010356
[23503] Homo sapiens chromosome 15 working draft sequence segment
[23504] gi|18584698|ref|NT—010356.8|Hs15—10513[18584698]
[23505] 165: NT—010351
[23506] Homo sapiens chromosome 15 working draft sequence segment
[23507] gi|18584556|ref|NT—010351.8|Hs15—10508[18584556]
[23508] 166: NT—010224
[23509] Homo sapiens chromosome 15 working draft sequence segment
[23510] gi|18583998|ref|NT—010224.7|Hs15—10381[18583998]
[23511] 167: XM—083914
[23512] Homo sapiens transmembrane 6 superfamily member 1 (TM6SF1), mRNA
[23513] gi|18583986|ref|XM—083914.1|[18583986]
[23514] 168: XM—083903
[23515] Homo sapiens transmembrane 9 superfamily member 1 (TM9SF1), mRNA
[23516] gi|18583350|ref|XM—083903.1|[18583350]
[23517] 169: NT—010036
[23518] Homo sapiens chromosome 14 working draft sequence segment
[23519] gi|18583080|ref|NT—010036.8|Hs14—10193[18583080]
[23520] 170: XM—028295
[23521] Homo sapiens calponin like transmembrane domain protein (calmin), mRNA
[23522] gi|18582992|ref|XM—028295.3|[18582992]
[23523] 171: NT—029430
[23524] Homo sapiens chromosome 13 working draft sequence segment
[23525] gi|18582622|ref|NT—029430.4|Hs13—29589[18582622]
[23526] 172: NT—009967
[23527] Homo sapiens chromosome 13 working draft sequence segment
[23528] gi|18582005|ref|NT—009967.8|Hs13—10124[18582005]
[23529] 173: NT—009952
[23530] Homo sapiens chromosome 13 working draft sequence segment
[23531] gi|18581926|ref|NT—009952.8|Hs13—10109[18581926]
[23532] 174: NT—009917
[23533] Homo sapiens chromosome 13 working draft sequence segment
[23534] gi|18581517(ref|NT—009917.8|Hs13—10074[18581517]
[23535] 175: XM—084974
[23536] Homo sapiens transmembrane phosphatase with tensin homology (TPTE), mRNA
[23537] gi|18581435|ref|XM—084974.1|[18581435]
[23538] 176: NT—009910
[23539] Homo sapiens chromosome 13 working draft sequence segment
[23540] gi|18581383|ref|NT—009910.8|Hs13—10067[18581383]
[23541] 177: NT—009711
[23542] Homo sapiens chromosome 12 working draft sequence segment
[23543] gi|18580591|ref|NT—009711.8|Hs12—9868[18580591]
[23544] 178: NT—009540
[23545] Homo sapiens chromosome 12 working draft sequence segment
[23546] gi|18579972|ref|NT—009540.8|Hs129697[18579972]
[23547] 179: NT—009487
[23548] Homo sapiens chromosome 12 working draft sequence segment
[23549] gi|18579817|ref|NT—009487.8|Hs12—9644[18579817]
[23550] 180: XM—084852
[23551] Homo sapiens similar to transmembrane protein induced by tumor necrosis factor
[23552] alpha (LOC144404), mRNA
[23553] gi|18579801|ref|XM—084852.1|[18579801]
[23554] 181: NT—009471
[23555] Homo sapiens chromosome 12 working draft sequence segment
[23556] gi|18579778|ref|NT—009471.8|Hs12—9628[18579778]
[23557] 182: XM—084845
[23558] Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC144383), mRNA
[23559] gi|18579688|ref|XM—084845.1|[18579688]
[23560] 183: XM—006748
[23561] Homo sapiens seven transmembrane protein TM7SF3 (TM7SF3), mRNA
[23562] gi|18579647|ref|XM—006748.5|[18579647]
[23563] 184: NT—030809
[23564] Homo sapiens chromosome 12 working draft sequence segment
[23565] gi|18579377|ref|NT—030809.2|Hs12—31065[18579377]
[23566] 185: NT—024394
[23567] Homo sapiens chromosome 12 working draft sequence segment
[23568] gi|18579035|ref|NT—024394.7|Hs12—24550[18579035]
[23569] 186: NT—009237
[23570] Homo sapiens chromosome 11 working draft sequence segment
[23571] gi|18578641|ref|NT—009237.8|Hs11—9394[18578641]
[23572] 187: NT—009215
[23573] Homo sapiens chromosome 11 working draft sequence segment
[23574] gi|18578584|ref|NT—009215.8|Hs11—9372[18578584]
[23575] 188: NT—008992
[23576] Homo sapiens chromosome 11 working draft sequence segment
[23577] gi|18578338|ref|NT—008992.7|Hs11—9149[18578338]
[23578] 189: XM—055266
[23579] Homo sapiens putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1p (Yip1p-interacting factor) (54TM), mRNA
[23580] gi|18578177|ref|XM—055266.2|[18578177]
[23581] 190: XM—045525
[23582] Homo sapiens transmembrane 7 superfamily member 2 (TM7SF2), mRNA
[23583] gi|18578063|ref|XM—045525.4|[18578063]
[23584] 191: XM—006111
[23585] Homo sapiens fibronectin leucine rich transmembrane protein 1 (FLRT1), mRNA
[23586] gi|18578050|ref|XM—006111.5|[18578050]
[23587] 192: NT—008804
[23588] Homo sapiens chromosome 10 working draft sequence segment
[23589] gi|18576536|ref|NT—008804.8|Hs10—8961[18576536]
[23590] 193: XM—084484
[23591] Homo sapiens similar to sema domain, immunoglobulin domain (Ig), transmembrane
[23592] domain (TM) and short cytoplasmic domain, (semaphorin) 4G; sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, 4G (LOC143288), mRNA
[23593] gi|18576428|ref|XM—084484.1|[18576428]
[23594] 194: NT—008609
[23595] Homo sapiens chromosome 10 working draft sequence segment
[23596] gi|18575857|ref|NT—008609.8|Hs10—8766[18575857]
[23597] 195: NT—029394
[23598] Homo sapiens chromosome 10 working draft sequence segment
[23599] gi|185745771 ref|NT029394.3|Hs10—29553[18574577]
[23600] 196: NT—024089
[23601] Homo sapiens chromosome 10 working draft sequence segment
[23602] gi|8574182|ref|NT—024089.8|Hs10—24245[18574182]
[23603] 197: NT—024064
[23604] Homo sapiens chromosome 10 working draft sequence segment
[23605] gi|18574077|ref|NT—024064.8|Hs10—24220[18574077]
[23606] 198: XM—084331
[23607] Homo sapiens similar to growth hormone inducible transmembrane protein (H. sapiens) (LOC170427), mRNA
[23608] gi|18574063|ref|XM—084331.1|[18574063]
[23609] 199: XM—043589
[23610] Homo sapiens growth hormone inducible transmembrane protein (GHITM), mRNA
[23611] gi|8574061|ref|XM—043589.3|[18574061]
[23612] 200: NT—008554
[23613] Homo sapiens chromosome 9 working draft sequence segment
[23614] gi|8573734|ref|NT—008554.8|HS9—8711[18573734]
[23615] 201: XM—071188
[23616] Homo sapiens similar to mucin 1, transmembrane (LOC138940), mRNA
[23617] gi|18573702|ref|XM—071188.2|[18573702]
[23618] 202: NT—008476
[23619] Homo sapiens chromosome 9 working draft sequence segment
[23620] gi|18573649|ref|NT—008476.8|HS9—8633[18573649]
[23621] 203: NT—008421
[23622] Homo sapiens chromosome 9 working draft sequence segment
[23623] gi|18573390|ref|NT—008421.8|Hs9—8578[18573390]
[23624] 204: NT—031831
[23625] Homo sapiens chromosome 9 working draft sequence segment
[23626] gi|18572946|ref|NT—031831.1|Hs9—32002[18572946]
[23627] 205: NT—031830
[23628] Homo sapiens chromosome 9 working draft sequence segment
[23629] gi|18572933|ref|NT—031830.1|HS9—32001[18572933]
[23630] 206: NT—029366
[23631] Homo sapiens chromosome 9 working draft sequence segment
[23632] gi|18572447|ref|NT—029366.4|Hs9—29525[18572447]
[23633] 207: NT—027082
[23634] Homo sapiens chromosome 9 working draft sequence segment
[23635] gi|18572282|ref|NT—027082.5|Hs9—27242[18572282]
[23636] 208: NT—024010
[23637] Homo sapiens chromosome 9 working draft sequence segment
[23638] gi|18572162|ref|NT—024010.7|Hs9—24166[18572162]
[23639] 209: XM—108898
[23640] Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM)
[23641] and short cytoplasmic domain, (semaphorin) 4D (SEMA4D), mRNA
[23642] gi|18572160|ref|XM—108898.1|[18572160]
[23643] 210: NT—023967
[23644] Homo sapiens chromosome 9 working draft sequence segment
[23645] gi|18571929|ref|NT—023967.8|Hs924123[18571929]
[23646] 211: XM—095756
[23647] Homo sapiens similar to transmembrane protein 2 (H. sapiens) (LOC169529), mRNA
[23648] gi|18571901|ref|XM—095756.1|[18571901]
[23649] 212: NT—008253
[23650] Homo sapiens chromosome 8 working draft sequence segment
[23651] gi|18571429|ref|NT—008253.8|Hs88410[18571429]
[23652] 213: NT—008079
[23653] Homo sapiens chromosome 8 working draft sequence segment
[23654] gi|18570812|ref|NT—008079.8|Hs8—8236[18570812]
[23655] 214: NT—007997
[23656] Homo sapiens chromosome 8 working draft sequence segment
[23657] gi|8570417|ref|NT—007997.8|Hs88154[18570417]
[23658] 215: XM—095564
[23659] Homo sapiens similar to transmembrane trafficking protein (LOC169193), mRNA
[23660] gi|18570401|ref|XM—095564.1|[18570401]
[23661] 216: NT—007978
[23662] Homo sapiens chromosome 8 working draft sequence segment
[23663] gi|18570256|ref|NT—007978.8|Hs8—8135[18570256]
[23664] 217: NT—030735
[23665] Homo sapiens chromosome 8 working draft sequence segment
[23666] gi|18569963|ref|NT—030735.2|Hs8—30991[18569963]
[23667] 218: NT—007905
[23668] Homo sapiens chromosome 7 working draft sequence segment
[23669] gi|18568542|ref|NT—007905.8Hs7—8062[18568542]
[23670] 219: NT—007902
[23671] Homo sapiens chromosome 7 working draft sequence segment
[23672] gi|18568515|ref|NT—007902.8|Hs78059[18568515]
[23673] 220: AF132746
[23674] Homo sapiens transmembrane protein mRNA, complete cds
[23675] gi|18568116|gb|AF132746.1|[18568116]
[23676] 221: NT—007867
[23677] Homo sapiens chromosome 7 working draft sequence segment
[23678] gi|18568101|ref|NT—007867.8|Hs78024[18568101]
[23679] 222: NT—007751
[23680] Homo sapiens chromosome 7 working draft sequence segment
[23681] gi|18567173|ref|NT—007751.8|Hs7—7908[18567173]
[23682] 223: NT—031815
[23683] Homo sapiens chromosome 7 working draft sequence segment
[23684] gi|18566709|ref|NT—031815.1|Hs731986[18566709]
[23685] 224: NT—031811
[23686] Homo sapiens chromosome 7 working draft sequence segment
[23687] gi|18566667|ref|NT—031811.1Hs731982[18566667]
[23688] 225: XM—095132
[23689] Homo sapiens similar to dM538M10.1 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor like) protein similar to human HS6M1-21) (LOC154958), mRNA
[23690] gi|18566661|ref|XM—095132.1|[18566661]
[23691] 226: NT—031807
[23692] Homo sapiens chromosome 7 working draft sequence segment
[23693] gi|18566613|ref|NT—031807.1|Hs7—31978[18566613]
[23694] 227: NT—030004
[23695] Homo sapiens chromosome 7 working draft sequence segment
[23696] gi|18566403|ref|NT—030004.3|Hs7—30259[18566403]
[23697] 228: NT—027064
[23698] Homo sapiens chromosome 7 working draft sequence segment
[23699] gi|18566143|ref|NT—027064.5|Hs7—27224[18566143]
[23700] 229: NT—017168
[23701] Homo sapiens chromosome 7 working draft sequence segment
[23702] gi|18565551|ref|NT—017168.8|Hs7—17324[18565551]
[23703] 230: NT—007592
[23704] Homo sapiens chromosome 6 working draft sequence segment
[23705] gi|18565438|ref|NT—007592.8|Hs6—7749[18565438]
[23706] 231: XM—094938
[23707] Homo sapiens similar to 573K1.2 (mm17M1-3 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) protein)) (LOC168233), mRNA
[23708] gi|18565395|ref|XM—094938.1|[18565395]
[23709] 232: XM—094903
[23710] Homo sapiens similar to 573K1.15 (mm17M1-6 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) protein)) (LOC168189), mRNA
[23711] gi|18565249|ref|XM—094903.1|[18565249]
[23712] 233: XM—094939
[23713] Homo sapiens similar to dM538M10.7 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor like) protein) (LOC154634), mRNA
[23714] gi|18565093|ref|XM—094939.1|[18565093]
[23715] 234: NT—007402
[23716] Homo sapiens chromosome 6 working draft sequence segment
[23717] gi|18564193|ref|NT—007402.8|Hs6—7559[18564193]
[23718] 235: XM—069322
[23719] Homo sapiens similar to transmembrane protein 2 (LOC135381), mRNA
[23720] gi|18564165|ref|XM—069322.2|[18564165]
[23721] 236: XM—087914
[23722] Homo sapiens similar to dJ402H5.1 (novel 7 transmembrane receptor of the rhodopsin family) (LOC154354), mRNA
[23723] gi|18564052|ref|XM—087914.1|[18564052]
[23724] 237: XM—087917
[23725] Homo sapiens similar to embryonic seven-span transmembrane protein-like protein
[23726] (LOC154344), mRNA
[23727] gi|18564031|ref|XM—087917.1|[18564031]
[23728] 238: XM—094741
[23729] Homo sapiens similar to 573K1.15 (mm17M1-6 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) protein)) (LOC167905), mRNA
[23730] gi|18563541|ref|XM—094741.1|[18563541]
[23731] 239: NT—025741
[23732] Homo sapiens chromosome 6 working draft sequence segment
[23733] gi|18563240|ref|NT—025741.7|Hs6—25897[18563240]
[23734] 240: NT—023451
[23735] Homo sapiens chromosome 6 working draft sequence segment
[23736] gi|18563080|ref|NT—023451.8|Hs623607[18563080]
[23737] 241: XM—069021
[23738] Homo sapiens similar to putative transmembrane protein PTG (L1C134801) mRNA
[23739] gi|18563039|ref|XM—069021.2|[18563039]
[23740] 242: NT—006725
[23741] Homo sapiens chromosome 5 working draft sequence segment
[23742] gi|18561712|ref|NT—006725.8|Hs56882[18561712]
[23743] 243: XM—094515
[23744] Homo sapiens similar to transmembrane receptor Unc5H1 (LOC167476), mRNA
[23745] gi|18561698|ref|XM—094515.1|[18561698]
[23746] 244: NT—006576
[23747] Homo sapiens chromosome 5 working draft sequence segment
[23748] gi|18561313|ref|NT—006576.8|Hs56733[18561313]
[23749] 245: XM—004042
[23750] Homo sapiens sema domain, seven thrombospondin repeats (type 1 and type 1-like),
[23751] transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A (SEMA5A), mRNA
[23752] gi|18561264|ref|XM—004042.7|[18561264]
[23753] 246: XM—087665
[23754] Homo sapiens similar to semaphorin 6A1; sema domain, transmembrane domain (TM),
[23755] and cytoplasmic domain, 6A; semaphorin 6A-1 (LOC153420), mRNA
[23756] gi|18560683|ref|XM—087665.1|[18560683]
[23757] 247: NT—006169
[23758] Homo sapiens chromosome 4 working draft sequence segment
[23759] gi|18558377|ref|NT—006169.8|Hs4—6326[18558377]
[23760] 248: NT—022836
[23761] Homo sapiens chromosome 4 working draft sequence segment
[23762] gi|18557125|ref|NT—022836.7|Hs4—22992[18557125]
[23763] 249: XM—093891
[23764] Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC166482), mRNA
[23765] gi|18557119|ref|XM—093891.1|[18557119]
[23766] 250: AF456925
[23767] Homo sapiens USH3 region, partial sequence
[23768] gi|17901944|gb|AF456925.1|AF411849S2[17901944]
[23769] 251: AF411849
[23770] Homo sapiens USH3 region, partial sequence
[23771] gi|17901943|gb|AF411849.1|AF411849S1]17901943]
[23772] 252: AH011260
[23773] Homo sapiens
[23774] gi|17901942|gb|AH011260.1|SEG_AF411849S[17901942]
[23775] 253: XM—064062
[23776] Homo sapiens similar to putative transmembrane receptor (LOC124274), mRNA
[23777] gi|17488065|ref|XM—064062.1|[17488065]
[23778] 254: XM—063875
[23779] Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC123862), mRNA
[23780] gi|17487213|ref|XM—063875.1|[17487213]
[23781] 255: XM—066655
[23782] Homo sapiens similar to G protein-coupled receptor 64; G protein-coupled receptor, epididymis-specific (seven transmembrane family) (LOC139378), mRNA
[23783] gi|17485715|ref|XM—066655.1|[17485715]
[23784] 256: NT—011519
[23785] Homo sapiens chromosome 22 working draft sequence segment
[23786] gi|17484914|ref|NT—011519.9|Hs22—11676[17484914]
[23787] 257: NT—011362
[23788] Homo sapiens chromosome 20 working draft sequence segment
[23789] gi|17484369|ref|NT—011362.7|Hs20—11519[17484369]
[23790] 258: XM—063355
[23791] Homo sapiens similar to transmembrane 7 superfamily member 1 (upregulated in kidney); transmembrane 7 superfamily member 1 (upregulated in (LOC122791), mRNA
[23792] gi|17476790|ref|XM—063355.1|[17476790]
[23793] 259: XM—062544
[23794] Homo sapiens similar to transmembrane protein 4; putative secreted protein ZSIG9 (LOC121255), mRNA
[23795] gi|17474559|ref|XM—062544.1|[17474559]
[23796] 260: XM—062443
[23797] Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC121062), mRNA
[23798] gi|17474137|ref|XM—062443.1|[17474137]
[23799] 261: XM—070446
[23800] Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC137474), mRNA
[23801] gi|17466780|ref|XM—070446.1|[17466780]
[23802] 262: XM—070130
[23803] Homo sapiens similar to transmembrane protein 4; putative secreted protein ZSIG9
[23804] (LOC136903), mRNA
[23805] gi|17465836|ref|XM—070130.1|[17465836]
[23806] 263: XM—069635
[23807] Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC135982), mRNA
[23808] gi|17465065|ref|XM—069635.1|[17465065]
[23809] 264: XM—069633
[23810] Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U); interferon-inducible (LOC135976), mRNA
[23811] gi|17465055|ref|XM—069633.1|[17465055]
[23812] 265: XM—069470
[23813] Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC135637), mRNA
[23814] gi|17464370|ref|XM—069470.1|[17464370]
[23815] 266: XM—069460
[23816] Homo sapiens similar to dM538M10.7 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor like) protein) (LOC135626), mRNA
[23817] gi|17464346|ref|XM—069460.1|[17464346]
[23818] 267: XM—064220
[23819] Homo sapiens similar to putative transmembrane receptor (LOC124601), mRNA
[23820] gi|17457972|ref|XM—064220.1|[17457972]
[23821] 268: XM—063652
[23822] Homo sapiens similar to leucine zipper-EF-hand containing transmembrane protein
[23823] 1; leucine zipper-EF-hand containing transmembrane protein 1 (LOC123430), mRNA
[23824] gi|17456715|ref|XM—063652.1|[17456715]
[23825] 269: XM—062703
[23826] Homo sapiens similar to tetraspan transmembrane 4 super family (LOC121590), mRNA
[23827] gi|17456679|ref|XM—062703.1|[17456679]
[23828] 270: XM—051362
[23829] Homo sapiens transmembrane 6 superfamily member 2 (TM6SF2), mRNA
[23830] gi|17456138|ref|XM—051362.2|[17456138]
[23831] 271: NT—011288
[23832] Homo sapiens chromosome 19 working draft sequence segment
[23833] gi|17455923|ref|NT—011288.7|HS19—11445[17455923]
[23834] 272: XM—031933
[23835] Homo sapiens transmembrane protein vezatin (VEZATIN), mRNA
[23836] gi|17454769|ref|XM—031933.3|[17454769]
[23837] 273: XM—068785
[23838] Homo sapiens similar to transmembrane receptor Unc5H1 (LOC13430i), mRNA
[23839] gi|17446928|ref|XM—068785.1|[17446928]
[23840] 274: NT—030685
[23841] Homo sapiens chromosome 5 working draft sequence segment
[23842] gi|17443457|ref|NT—030685.1Hs5—30941[17443457]
[23843] 275: NT—011387
[23844] Homo sapiens chromosome 20 working draft sequence segment
[23845] gi|16195112|ref|NT—011387.6|Hs20—11544[16195112]
[23846] 276: NT—011512
[23847] Homo sapiens chromosome 21 working draft sequence segment
[23848] gi|16170824|ref|NT—011512.4|Hs21—11669[16170824]
[23849] 277: XM—049793
[23850] Homo sapiens transmembrane protease, serine 2 (TMPRSS2), mRNA
[23851] gi|16170797|ref|XM—049793.2|[16170797]
[23852] 278: NT—011520
[23853] Homo sapiens chromosome 22 working draft sequence segment
[23854] gi|16168698|ref|NT—011520.8|Hs22—11677[16168698]
[23855] 279: NT—030188
[23856] Homo sapiens chromosome 21 working draft sequence segment
[23857] gi|16166749|ref|NT—030188.1|Hs21—30443[16166749]
[23858] 280: NT—029490
[23859] Homo sapiens chromosome 21 working draft sequence segment
[23860] gi|16166567|ref|NT—029490.2|Hs21—29649[16166567]
[23861] 281: NT—011515
[23862] Homo sapiens chromosome 21 working draft sequence segment
[23863] gi|16166537|ref|NT—011515.6|Hs21—11672[16166537]
[23864] 282: XM—009794
[23865] Homo sapiens transmembrane protein 1 (TMEM1), mRNA
[23866] gi|16166381|ref|XM—009794.4|[16166381]
[23867] 283: NT—009407
[23868] Homo sapiens chromosome 11 working draft sequence segment
[23869] gi|16164445|ref|NT—009407.5|Hs11—9564[16164445]
[23870] 284: NT—027220
[23871] Homo sapiens chromosome X working draft sequence segment
[23872] gi|16163830|ref|NT—027220.2|HsX—27380[16163830]
[23873] 285: XM—055222
[23874] Homo sapiens region containing sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G; mitochondrial ribosomal protein L32 (LOC143289), mRNA
[23875] gi|16156787|ref|XM—055222.1|[16156787]
[23876] 286: XM—008123
[23877] Homo sapiens tryptase gamma 1 (TPSG1), mRNA
[23878] gi|15317318|ref|XM—008123.5|[15317318]
[23879] 287: NT—009738
[23880] Homo sapiens chromosome 12 working draft sequence segment
[23881] gi|15307319|ref|NT—009738.5|HS12—9895[15307319]
[23882] 288: XM—006991
[23883] Homo sapiens tetraspan transmembrane 4 super family (NET-5), mRNA
[23884] gi|15307297|ref|XM—006991.5|[15307297]
[23885] 289: NT—009513
[23886] Homo sapiens chromosome 12 working draft sequence segment
[23887] gi|15303938|ref|NT—009513.5|Hs12—9670[15303938]
[23888] 290: NT—029317
[23889] Homo sapiens chromosome 6 working draft sequence segment
[23890] gi|15300889|ref|NT—029317.1|Hs6—29476[15300889]
[23891] 291: XM—040419
[23892] Homo sapiens transmembrane trafficking protein (TMP21), mRNA
[23893] gi|14784589|ref|XM—040419.1|[14784589]
[23894] 292: XM—030300
[23895] Homo sapiens similar to transmembrane receptor Unc5H1 (LOC90249), mRNA
[23896] gi|14781377|ref|XM—030300.1|[14781377]
[23897] 293: XM—036570
[23898] Homo sapiens type I transmembrane protein Fn14 (FN14), mRNA
[23899] gi|14777984|ref|XM—036570.1|[14777984]
[23900] 294: XM—027469
[23901] Homo sapiens transmembrane protein 8 (five membrane-spanning domains) (TMEM8),
[23902] mRNA
[23903] gi|14777199|ref|XM—027469.1|[14777199]
[23904] 295: XM—009839
[23905] Homo sapiens claudin 5 (transmembrane protein deleted in velocardiofacial syndrome) (CLDN5), mRNA
[23906] gi|14777026|ref|XM—009839.4|[14777026]
[23907] 296: NT—025911
[23908] Homo sapiens chromosome 17 working draft sequence segment
[23909] gi|14776336|ref|NT—025911.3|Hs17—26067[14776336]
[23910] 297: XM—041427
[23911] Homo sapiens transmembrane protease, serine 5 (spinesin) (TMPRSS5), mRNA
[23912] gi|14770562|ref|XM—041427.1|[14770562]
[23913] 298: XM—006940
[23914] Homo sapiens cytoskeleton-associated protein 4 (CKAP4), mRNA
[23915] gi|14766392|ref|XM—006940.4|[14766392]
[23916] 299: NT—011598
[23917] Homo sapiens chromosome X working draft sequence segment
[23918] gi|14759313|ref|NT—011598.4|HsX—11755[14759313]
[23919] 300: XM—033157
[23920] Homo sapiens transmembrane 4 superfamily member 6 (TM4SF6), mRNA
[23921] gi|14757314|ref|XM—033157.1|[14757314]
[23922] 301: XM—044358
[23923] Homo sapiens similar to cleft lip and palate associated transmembrane protein (LOC92330), mRNA
[23924] gi|14755905|ref|XM—044358.1|[14755905]
[23925] 302: XM—004980
[23926] Homo sapiens cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7) (CFTR), mRNA
[23927] gi|14753226|ref|XM—004980.4|[14753226]
[23928] 303: XM—002838
[23929] Homo sapiens similar to orphan seven-transmembrane receptor, chemokine related
[23930] (H. sapiens) (LOC154103), mRNA
[23931] gi|14750021|ref|XM—002838.6|[14750021]
[23932] 304: XM—005949
[23933] Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM)
[23934] and short cytoplasmic domain, (semaphorin) 4G (SEMA4G), mRNA
[23935] gi|14747317|ref|XM—005949.4|[14747317]
[23936] 305: XM—035329
[23937] Homo sapiens similar to transmembrane trafficking protein (LOC90981), mRNA
[23938] gi|14744677|ref|XM—035329.1|[14744677]
[23939] 306: XM—038156
[23940] Homo sapiens transmembrane protein 2 (TMEM2), mRNA
[23941] gi|14743733|ref|XM—038156.1|[14743733]
[23942] 307: XM—005346
[23943] Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 1 (TMEFF1), mRNA
[23944] gi|14738782|ref|XM—005346.4|[14738782]
[23945] 308: XM—045505
[23946] Homo sapiens transmembrane 4 superfamily member (tetraspan NET-7) (NET-7), mRNA
[23947] gi|14738519|ref|XM—045505.1|[14738519]
[23948] 311: NT—026472
[23949] Homo sapiens chromosome 17 working draft sequence segment
[23950] gi|13654226|ref|NT—026472.1|Hs17—26639[13654226]
[23951] 312: XM—012718
[23952] Homo sapiens secreted and transmembrane 1 (SECTM1), mRNA
[23953] gi|13654161|ref|XM—012718.2|[13654161]
[23954] 313: XM—016506
[23955] Homo sapiens fibronectin leucine rich transmembrane protein 2 (FLRT2), mRNA
[23956] gi|13648109|ref|XM—016506.1|[13648109]
[23957] 314: XM—005187
[23958] Homo sapiens ankyrin-like with transmembrane domains 1 (ANKTM1), mRNA
[23959] gi|13645787|ref|XM—005187.3|[13645787]
[23960] 315: NT—025803
[23961] Homo sapiens chromosome 8 working draft sequence segment
[23962] gi|13642635|ref|NT—025803.2|Hs8—25959[13642635]
[23963] 316: XM—017003
[23964] Homo sapiens interferon induced transmembrane protein 3 (1-8U) (IFITM3), mRNA
[23965] gi|13642630|ref|XM—017003.1|[13642630]
[23966] 317: NT—022761
[23967] Homo sapiens chromosome 4 working draft sequence segment
[23968] gi|18556805|ref|NT—022761.8|Hs4—22917[18556805]
[23969] 318: XM—093853
[23970] Homo sapiens similar to transmembrane tryptase (LOC166415), mRNA
[23971] gi|18556799|ref|XM—093853.1|[18556799]
[23972] 319: NT—005997
[23973] Homo sapiens chromosome 3 working draft sequence segment
[23974] gi|18556520|ref|NT—005997.8|Hs3—6154[18556520]
[23975] 320: XM—087464
[23976] Homo sapiens similar to transmembrane protein 7 (LOC152408), mRNA
[23977] gi|18556483|ref|XM—087464.1|[18556483]
[23978] 321: NT—005986
[23979] Homo sapiens chromosome 3 working draft sequence segment
[23980] gi|18556440|ref|NT—005986.8|Hs3—6143[18556440]
[23981] 322: NT—005678
[23982] Homo sapiens chromosome 3 working draft sequence segment
[23983] gi|18555423|ref|NT—005678.7|Hs3—5835[18555423]
[23984] 323: XM—093638
[23985] Homo sapiens similar to orphan seven transmembrane receptor (LOC166071), mRNA
[23986] gi|18555421|ref|XM—093638.1|[18555421]
[23987] 324: XM—093637
[23988] Homo sapiens similar to orphan seven transmembrane receptor (LOC166070), mRNA
[23989] gi|18555419|ref|XM—093637.1|[18555419]
[23990] 325: NT—005654
[23991] Homo sapiens chromosome 3 working draft sequence segment
[23992] gi|18555355|ref|NT—005654.8|Hs3—5811[18555355]
[23993] 326: NT—005616
[23994] Homo sapiens chromosome 3 working draft sequence segment
[23995] gi|18555281|ref|NT—005616.8|Hs3—5773[18555281]
[23996] 327: NT—005543
[23997] Homo sapiens chromosome 3 working draft sequence segment
[23998] gi|18555061|ref|NT—005543.7|Hs35700[18555061]
[23999] 328: XM—098155
[24000] Homo sapiens similar to seven transmembrane domain orphan receptor (H. sapiens)
[24001] (LOC152010), mRNA
[24002] gi|18555022|ref|XM—098155.1|[18555022]
[24003] 329: NT—022531
[24004] Homo sapiens chromosome 3 working draft sequence segment
[24005] gi|18554079|ref|NT—022531.4|Hs3—22687[18554079]
[24006] 330: XM—096181
[24007] Homo sapiens transmembrane 4 superfamily member 4 (TM4SF4), mRNA
[24008] gi|18554072|ref|XM—096181.1|[18554072]
[24009] 331: NT—022412
[24010] Homo sapiens chromosome 3 working draft sequence segment
[24011] gi|18553606|ref NT—022412.6|Hs322568[18553606]
[24012] 332: NT —022393
[24013] Homo sapiens chromosome 3 working draft sequence segment
[24014] gi|18553572|ref|NT—022393.7|Hs322549[18553572]
[24015] 333: NT—005423
[24016] Homo sapiens chromosome 2 working draft sequence segment
[24017] gi|18553407|ref|NT—005423.8|Hs2—5580[18553407]
[24018] 334: NT—005387
[24019] Homo sapiens chromosome 2 working draft sequence segment
[24020] gi|18553071|ref|NT—005387.8|Hs2—5544[18553071]
[24021] 335: NT—005289
[24022] Homo sapiens chromosome 2 working draft sequence segment
[24023] gi|18552655|ref|NT—005289.8|Hs25446[18552655]
[24024] 336: NT—005214
[24025] Homo sapiens chromosome 2 working draft sequence segment
[24026] gi|18552351|ref|NT—005214.8|Hs25371[18552351]
[24027] 337: NT—005138
[24028] Homo sapiens chromosome 2 working draft sequence segment
[24029] gi|18552129|ref|NT—005138.8|Hs25295[18552129]
[24030] 338: NT —022180
[24031] Homo sapiens chromosome 2 working draft sequence segment
[24032] gi|18550124|ref|NT—022180.8|Hs222336[18550124]
[24033] 339: NT—004858
[24034] Homo sapiens chromosome 1 working draft sequence segment
[24035] gi|18549451|ref|NT—004858.8|Hs1—5015[18549451]
[24036] 340: XM—053256
[24037] Homo sapiens mucin 1, transmembrane (MUC1), mRNA
[24038] gi|18549380|ref|XM—053256.4|[18549380]
[24039] 341: NT—004836
[24040] Homo sapiens chromosome 1 working draft sequence segment
[24041] gi|18549182|ref|NT—004836.8|Hs1—4993[18549182]
[24042] 342: NT—004811
[24043] Homo sapiens chromosome 1 working draft sequence segment
[24044] gi|18549145|ref|NT—004811.8|Hs14968[18549145]
[24045] 343: XM—041879
[24046] Homo sapiens similar to AF1Q protein; transmembrane protein (LOC149430), mRNA
[24047] gi|18549121|ref|XM—041879.2|[18549121]
[24048] 344: NT—004668
[24049] Homo sapiens chromosome 1 working draft sequence segment
[24050] gi|18548894|ref|NT—004668.8|Hs14825[18548894]
[24051] 345: NT—004441
[24052] Homo sapiens chromosome 1 working draft sequence segment
[24053] gi|18547758|ref|NT—004441.8|Hs1—4598[18547758]
[24054] 346: NT—004434
[24055] Homo sapiens chromosome 1 working draft sequence segment
[24056] gi|18547724|ref|NT—004434.8|Hs14591[18547724]
[24057] 347: NT—004391
[24058] Homo sapiens chromosome 1 working draft sequence segment
[24059] gi|18547557|ref|NT—004391.8|Hs14548[18547557]
[24060] 348: NT—021907
[24061] Homo sapiens chromosome 1 working draft sequence segment
[24062] gi|18544452|ref|NT—021907.8|Hs1—22063[18544452]
[24063] 349: XM—053163
[24064] Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C (SEMA6C), mRNA
[24065] gi|18544383|ref|XM—053163.4|[18544383]
[24066] 350: NM—016155
[24067] Homo sapiens matrix metalloproteinase 17 (membrane-inserted) (MMP17), mRNA
[24068] gi|18543372|ref|NM—016155.2|[18543372]
[24069] 351: XM—060507
[24070] Homo sapiens similar to putative integral membrane transporter; lysosomal associated transmembrane protein 4 beta (LOC127480), mRNA
[24071] gi|17443784|ref|XM—060507.1|[17443784]
[24072] 352: XM—060501
[24073] Homo sapiens similar to bM332P19.3 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor like) protein (mm17M1-14)) (LOC127469), mRNA
[24074] gi|17443690|ref|XM—060501.1|[17443690]
[24075] 353: XM—060442
[24076] Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U); interferon-inducible (LOC127360), mRNA
[24077] gi|17441370|ref|XM—060442.1|[17441370]
[24078] 354: XM—065294
[24079] Homo sapiens similar to Transmembrane protease, serine 3 (Serine protease TADG-12) (Tumor associated differentially-expressed gene-12 protein) (LOC129566), mRNA
[24080] gi|17439790|ref|XM—065294.1|[17439790]
[24081] 355: XM—032249
[24082] Homo sapiens sema domain, seven thrombospondin repeats (type 1 and type 1-like),
[24083] transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B (SEMA5B), mRNA
[24084] gi|17438489|ref|XM—032249.3|[17438489]
[24085] 356: XM—058189
[24086] Homo sapiens similar to TRANSMEMBRANE 4 SUPERFAMILY, MEMBER 1 (TUMOR-ASSOCIATED
[24087] ANTIGEN L6) (MEMBRANE COMPONENT, SURFACE MARKER 1) (M3S1) (LOC116441), mRNA
[24088] gi|17437690|ref|XM—058189.2|[17437690]
[24089] 357: NT—011903
[24090] Homo sapiens chromosome Y working draft sequence segment
[24091] gi|17433681|ref|NT—011903.8|HsY—12060[17433681]
[24092] 358: XM—034757
[24093] Homo sapiens similar to transmembrane phosphatase with tensin homology (H. sapiens) (LOC159185), mRNA
[24094] gi|16164045|ref|XM—034757.2|[16164045]
[24095] 359: XM—003025
[24096] Homo sapiens mucin 13, epithelial transmembrane (MUC13), mRNA
[24097] gi|16159511|ref|XM—003025.5|[16159511]
[24098] 360: NT—015169
[24099] Homo sapiens chromosome 4 working draft sequence segment
[24100] gi|16156888|ref|NT—015169.5|Hs4—15325[16156888]
[24101] 361: NM—002837
[24102] Homo sapiens protein tyrosine phosphatase, receptor type, B (PTPRB), mRNA
[24103] gi|18491009|ref|NM—002837.2|[18491009]
[24104] 362: BC022439
[24105] Homo sapiens, interferon induced transmembrane protein 3 (1-8U), clone MGC:24755
[24106] IMAGE:4282809, mRNA, complete cds
[24107] gi|18490258|gb|BC022439.1|[18490258]
[24108] 363: NM—005031
[24109] Homo sapiens FXYD domain containing ion transport regulator 1 (phospholemman) (FXYD1), transcript variant a, mRNA
[24110] gi|11612671|ref|NM—005031.2|[11612671]
[24111] 364: NM—021902
[24112] Homo sapiens FXYD domain containing ion transport regulator 1 (phospholemman) (FXYD1), transcript variant b, mRNA
[24113] gi|11612669|ref|NM—021902.1|[11612669]
[24114] 365: NM—014164
[24115] Homo sapiens FXYD domain-containing ion transport regulator 5 (FXYD5), mRNA
[24116] gi|11612664|ref|NM—014164.2|[11612664]
[24117] 366: NM—020399
[24118] Homo sapiens PDZ/coiled-coil domain binding partner for the rho-family GTPase TC10 (PIST), mRNA
[24119] gi|9966876|ref|NM—020399.1|[9966876]
[24120] 367: BM439879
[24121] pgr1n.pk001.i17 Normalized Chicken Reproductive Tract cDNA Library (pgr1n) Gallus gallus cDNA clone pgr1n.pk001.i17 5′ similar to gi|7657373 ref|NP—055214.11 tetraspan NET-6 protein; transmembrane 4 superfamily protein [Homo sapiens] gi|13628481 ref|XP—004793.31 tetraspan NET-6 protein [Homo sapiens] gi|14747013 ref|XP—049585.11 tetraspan NET-6 protein [Homo sapiens]
[24122] gi|14, mRNA sequence
[24123] gi|18470654|gb|BM439879.1|BM439879[18470654]
[24124] 368: BM439852
[24125] pgr1n.pk001.h13 Normalized Chicken Reproductive Tract cDNA Library (pgr1n) Gallus gallus cDNA clone pgr1n.pk001.h13 5′ similar to gi|7657176 ref|NP—055070.1|transmembrane protein 4; putative type II membrane protein [Homo sapiens] dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence
[24126] gi|18470627|gb|BM439852.1|BM439852[18470627]
[24127] 369: BM439375
[24128] pgr1c.pk001.a9 Primary Chicken Reproductive Tract cDNA Library (pgr1c) Gallus gallus cDNA clone pgr1c.pk001.a9 5′ similar to gi|13994300 ref|NP—114131.1] transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens] gi|AAK16442.1|AF327923—1 (AF327923) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens], mRNA sequence
[24129] gi|18470150|gb|BM439375.1|BM439375[18470150]
[24130] 370: NM—080841
[24131] Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript
[24132] variant 3, mRNA
[24133] gi|18450370|ref|NM—080841.1|[18450370]
[24134] 371: NM—080840
[24135] Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript
[24136] variant 2, mRNA
[24137] gi|18450368|ref|NM—080840.1|[18450368]
[24138] 372: NM—002836
[24139] Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript
[24140] variant 1, mRNA
[24141] gi|18450367|ref|NM—002836.2|[18450367]
[24142] 373: NM—018490
[24143] Homo sapiens G protein-coupled receptor 48 (GPR48), mRNA
[24144] gi|8923700|ref|NM—018490.1|[8923700]
[24145] 374: NM—006065
[24146] Homo sapiens signal-regulatory protein beta 1 (SIRPB1), mRNA
[24147] gi|5174678|ref|NM—006065.1|[5174678]
[24148] 375: NM—004648
[24149] Homo sapiens protein tyrosine phosphatase, non-receptor type substrate 1 (PTPNS1), mRNA
[24150] gi|4758977|ref|NM—004648.1|[4758977]
[24151] 376: NM—003667
[24152] Homo sapiens G protein-coupled receptor 49 (GPR49), mRNA
[24153] gi|4504378|ref|NM—003667.1|[4504378]
[24154] 377: BM427439
[24155] pgf2n.pk006.m15 Normalized Chicken Abdominal Fat Library (pgf2n) Gallus gallus
[24156] cDNA clone pgf2n.pk006.m15 5′ similar to gi|13994300 ref|NP—114131.11 transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens] gi|AAK16442.1|AF327923—1 (AF327923) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens], mRNA sequence
[24157] gi|18432616|gb|BM427439.1|BM427439[18432616]
[24158] 378: BM427410
[24159] pgf2n.pk006.k5 Normalized Chicken Abdominal Fat Library (pgf2n) Gallus gallus cDNA clone pgf2n.pk006.k5 5′ similar to gi|13994300 ref|NP—114131.1|transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens] gi|AAK16442.1|AF327923—1 (AF327923) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens], mRNA sequence
[24160] gi|18432562|gb|BM427410.1|BM427410[18432562]
[24161] 379: BM427358
[24162] pgf2n.pk006.i13 Normalized Chicken Abdominal Fat Library (pgf2n) Gallus gallus
[24163] cDNA clone pgf2n.pk006.i13 5′ similar to gi|7705965 ref|NP—057456.11 seven transmembrane domain orphan receptor [Homo sapiens] dbj|BAA89782.1|(AB037108)
[24164] seven transmembrane domain orphan receptor [Homo sapiens], mRNA sequence
[24165] gi|18432475|gb|BM427358.1|BM427358[18432475]
[24166] 380: NM—002122
[24167] Homo sapiens major histocompatibility complex, class II, DQ alpha 1 (HLA-DQA1),
[24168] mRNA
[24169] gi|18426974|ref|NM—002122.2|[18426974]
[24170] 381: NM—080815
[24171] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 19, mRNA
[24172] gi|18426960|ref|NM—080815.1|[18426960]
[24173] 382: NM—080814
[24174] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 18, mRNA
[24175] gi|18426958|ref|NM—080814.1|[18426958]
[24176] 383: NM—080813
[24177] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 17, mRNA
[24178] gi|18426956|ref|NM—080813.1|[18426956]
[24179] 384: NM—080812
[24180] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 16, mRNA
[24181] gi|18426954|ref|NM—080812.1|[18426954]
[24182] 385: NM—080811
[24183] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 15, mRNA
[24184] gi|18426952|ref|NM—080811.1|[18426952]
[24185] 386: NM—080810
[24186] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 14, mRNA
[24187] gi|18426950|ref|NM—080810.1|[18426950]
[24188] 387: NM—080809
[24189] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 13, mRNA
[24190] gi|18426948|ref|NM—080809.1|[18426948]
[24191] 388: NM—080808
[24192] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 12, mRNA
[24193] gi|18426946|ref|NM—080808.1|[18426946]
[24194] 389: NM—080807
[24195] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 11, mRNA
[24196] gi|18426944|ref|NM—080807.1|[18426944]
[24197] 390: NM—080806
[24198] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 10, mRNA
[24199] gi|18426942|ref|NM—080806.1|[18426942]
[24200] 391: NM—080805
[24201] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 9, mRNA
[24202] gi|18426940|ref|NM—080805.1|[18426940]
[24203] 392: NM—080804
[24204] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 8, mRNA
[24205] gi|18426938|ref|NM—080804.1|[18426938]
[24206] 393: NM—080803
[24207] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 7, mRNA
[24208] gi|18426936|ref|NM—080803.1|[18426936]
[24209] 394: NM—080802
[24210] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 6, mRNA
[24211] gi|18426934|ref|NM—080802.1|[18426934]
[24212] 395: NM—080801
[24213] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 5, mRNA
[24214] gi|18426932|ref|NM—080801.1|[18426932]
[24215] 396: NM—080800
[24216] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 4, mRNA
[24217] gi|18426930|ref|NM—080800.1|[18426930]
[24218] 397: NM—080799
[24219] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 3, mRNA
[24220] gi|18426928|ref|NM—080799.1|[18426928]
[24221] 398: NM—080798
[24222] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 2, mRNA
[24223] gi|18426926|ref|NM—080798.1|[18426926]
[24224] 399: NM—005203
[24225] Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 1, mRNA
[24226] gi|18426924|ref|NM—005203.2|[18426924]
[24227] 400: NM—080792
[24228] Homo sapiens brain-immunoglobulin-like molecule with tyrosine-based activation
[24229] motifs (BIT), mRNA
[24230] gi|18426910|ref|NM—080792.1|[8426910]
[24231] 401: NM—080816
[24232] Homo sapiens signal-regulatory protein beta 2 (SIRPB2), transcript variant 2, mRNA
[24233] gi|18426908|ref|NM—080816.1|[18426908]
[24234] 402: NM—018556
[24235] Homo sapiens signal-regulatory protein beta 2 (SIRPB2), transcript variant 1, mRNA
[24236] gi|18426907|ref|NM—018556.2|[18426907]
[24237] 406: AF367761
[24238] Homo sapiens transmembrane protein HTMP10 (HTMP10) mRNA, complete cds
[24239] gi|16356924|gb|AF367761.2|[16356924]
[24240] 409: NM—002124
[24241] Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-DRB1),
[24242] mRNA
[24243] gi|4504410|ref|NM—002124.1|[4504410]
[24244] 411: NM—016235
[24245] Homo sapiens G protein-coupled receptor, family C, group 1, member B (GPRC5B),
[24246] mRNA
[24247] gi|7706450|ref|NM—016235.1|[7706450]
[24248] 412: NM—003105
[24249] Homo sapiens sortilin-related receptor, L(DLR class) A repeats-containing (SORL1), mRNA
[24250] gi|18379347|ref|NM—003105.3|[18379347]
[24251] 413: NM—004843
[24252] Homo sapiens class I cytokine receptor (WSX1), mRNA
[24253] gi|18379338|ref|NM—004843.2|[18379338]
[24254] 414: AF450008
[24255] Homo sapiens CFTR-associated ligand (CAL) mRNA, complete cds
[24256] gi|17865153|gb|AF450008.1|AF450008[17865153]
[24257] 415: NM—033056
[24258] Homo sapiens protocadherin 15 (PCDH15), mRNA
[24259] gi|16933554|ref|NM—033056.2|[16933554]
[24260] 416: NM—022349
[24261] Homo sapiens membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), mRNA
[24262] gi|11641258|ref|NM—022349.1|[11641258]
[24263] 417: NM—005438
[24264] Homo sapiens FOS-like antigen 1 (FOSL1), mRNA
[24265] gi|4885242|ref|NM—005438.1|[4885242]
[24266] 418: BC021208
[24267] Homo sapiens, leucine zipper-EF-hand containing transmembrane protein 1, clone
[24268] MGC:12631 IMAGE:4126510, mRNA, complete cds
[24269] gi|18204588|gb|BC021208.1|BC021208[18204588]
[24270] 419: BC021557
[24271] Homo sapiens, transmembrane protein 8 (five membrane-spanning domains), clone MGC:31822 IMAGE:4899167, mRNA, complete cds
[24272] gi|18204291|gb|BC021557.1|BC021557[18204291]
[24273] 420: BC020870
[24274] Homo sapiens, fibronectin leucine rich transmembrane protein 3, clone MGC:24073
[24275] IMAGE: A 6065852, mRNA, complete cds
[24276] gi|18088787|gb|BC020870.1|BC020870[18088787]
[24277] 421: BC020960
[24278] Homo sapiens, sema domain, immunoglobulin domain (Ig), transmembrane domain (TM)
[24279] and short cytoplasmic domain, (semaphorin) 4G, clone MGC:8849 IMAGE:3851526, mRNA, complete cds
[24280] gi|18088075|gb|BC020960.1|BC020960[18088075]
[24281] 422: AF444779
[24282] Homo sapiens myocyte inner nuclear membrane protein (MYNE1) mRNA, complete cds
[24283] gi|17227153|gb|AF444779.1|AF444779[17227153]
[24284] 423: AF329637
[24285] Homo sapiens mitofusin 1 mRNA, nuclear gene for mitochondrial protein, complete
[24286] cds
[24287] gi|12744895|gb|AF329637.1|AF329637[12744895]
[24288] 424: NM—019074
[24289] Homo sapiens delta-like 4 (Drosophila) (DLL4), mRNA
[24290] gi|9506544|ref|NM—019074.1|[9506544]
[24291] 425: NM—017789
[24292] Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM)
[24293] and short cytoplasmic domain, (semaphorin) 4C (SEMA4C), mRNA
[24294] gi|8923345|ref|NM—017789.1|[8923345]
[24295] 426: NM—003836
[24296] Homo sapiens delta-like 1 homolog (Drosophila) (DLK1), mRNA
[24297] gi|4503338|ref|NM—003836.1|[4503338]
[24298] 427: NM—024021
[24299] Homo sapiens membrane-spanning 4-domains, subfamily A, member 4 (MS4A4A), mRNA
[24300] gi|13430865|ref|NM—024021.1|[13430865]
[24301] 432: NM—021950
[24302] Homo sapiens membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of
[24303] IgE, high affinity I, receptor for; beta polypeptide) (MS4A1), mRNA
[24304] gi|11386186|ref|NM—021950.1|[11386186]
[24305] 433: AY046529
[24306] Homo sapiens melanocortin 1 receptor mutant V122M (MC1R) gene, complete cds
[24307] gi|18138241|gb|AY046529.1|[18138241]
[24308] 434: AY046528
[24309] Homo sapiens melanocortin 1 receptor mutant 140T (MC1R) gene, complete cds
[24310] gi|18138239|gb|AY046528.1|[18138239]
[24311] 436: AY028261
[24312] Homo sapiens delta transmembrane LIGHT mRNA, complete cds, alternatively spliced
[24313] gi|14278834|gb|AY028261.1|[14278834]
[24314] 437: AF296875
[24315] Gallus gallus fas ligand receptor soluble form mRNA, partial cds
[24316] gi|993164|gb|AF296875.1|AF296875[9931641]
[24317] 439: BM315073
[24318] ig43b07.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:MTRP_HUMAN Q15012 GOLGI
[24319] 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence
[24320] gi|18049418|gb|BM315073.1|BM315073[18049418]
[24321] 440: BM314493
[24322] ig51c05.y1 HR85 islet Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence
[24323] gi|18048838|gb|BM314493.1|BM314493[18048838]
[24324] 441: BM313985
[24325] ih05d09.y1 Human insulinoma Homo sapiens cDNA 5′ similar to SW:MTRP_HUMAN
[24326] Q15012 GOLGI 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence
[24327] gi|18048330|gb|BM313985.1|BM313985[18048330]
[24328] 442: AF267740
[24329] Homo sapiens transmembrane protein H4 mRNA, complete cds
[24330] gi|18032260|gb|AF267740.1|AF267740[18032260]
[24331] 443: AF350504
[24332] Homo sapiens four-span transmembrane protein 4 (4SPAN4) mRNA, complete cds
[24333] gi|18028935|gb|AF350504.1|AF350504[18028935]
[24334] 444: AF350503
[24335] Homo sapiens four-span transmembrane protein 3.2 (4SPAN3) mRNA, complete cds
[24336] gi|18028933|gb|AF350503.1|AF350503[18028933]
[24337] 445: AF350502
[24338] Homo sapiens four-span transmembrane protein 3.1 (4SPAN3) mRNA, complete cds
[24339] gi|1802893|gb|AF350502.1|AF350502[18028931]
[24340] 446: AF350501
[24341] Homo sapiens four-span transmembrane protein 2 (4SPAN2) mRNA, complete cds
[24342] gi|18028929|gb|AF350501.1|AF350501[18028929]
[24343] 447: AF350500
[24344] Homo sapiens four-span transmembrane protein 1 (4SPAN1) mRNA, complete cds
[24345] gi|18028927|gb|AF350500.1|AF350500[18028927]
[24346] 448: NM—078470
[24347] Homo sapiens COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA
[24348] gi|17921984|ref|NM—078470.1|[17921984]
[24349] 449: NM—004375
[24350] Homo sapiens COX11 homolog, cytochrome c oxidase assembly protein (yeast) (COX11), nuclear gene encoding mitochondrial protein, mRNA
[24351] gi|17921983|ref|NM—004375.2|[17921983]
[24352] 450: NM—001303
[24353] Homo sapiens COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) (COX10), nuclear gene encoding mitochondrial protein, mRNA
[24354] gi|17921981|ref|NM—001303.2|[17921981]
[24355] 451: NM—031999
[24356] Mus musculus transmembrane 7 superfamily member 1 (Tm7sf1), mRNA
[24357] gi|14269573|ref|NM—031999.1|[14269573]
[24358] 452: NM—020659
[24359] Homo sapiens tweety homolog 1 (Drosophila) (TTYH1), mRNA
[24360] gi|10257436|ref|NM—020659.1|[10257436]
[24361] 453: NM—052945
[24362] Homo sapiens BAFF receptor (BAFFR), mRNA
[24363] gi|17978517|ref|NM—052945.2|[17978517]
[24364] 454: NM—078481
[24365] Homo sapiens CD97 antigen (CD97), transcript variant 1, mRNA
[24366] gi|17978490|ref|NM—078481.1|[17978490]
[24367] 455: NM—001784
[24368] Homo sapiens CD97 antigen (CD97), transcript variant 2, mRNA
[24369] gi|17978488|ref|NM—001784.2|[17978488]
[24370] 456: NM—1004444
[24371] Homo sapiens EphB4 (EPHB4), mRNA
[24372] gi|17975769|ref|NM—004444.2|[17975769]
[24373] 457: NM—004443
[24374] Homo sapiens EphB3 (EPHB3), mRNA
[24375] gi|17975767|ref|NM—004443.2|[17975767]
[24376] 458: NM—004442
[24377] Homo sapiens EphB2 (EPHB2), transcript variant 1, mRNA
[24378] gi|17975766|ref|NM—004442.2|[17975766]
[24379] 459: NM—017449
[24380] Homo sapiens EphB2 (EPHB2), transcript variant 2, mRNA
[24381] gi|17975764|ref|NM—017449.1|[17975764]
[24382] 460: BM273281
[24383] if28f09.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar
[24384] to TR:Q9Z112 Q9Z112 SEVEN TRANSMEMBRANE DOMAIN ORPHAN RECEPTOR.;, mRNA sequence
[24385] gi|17966574|gb|BM273281.1|BM273281[17966574]
[24386] 461: BM271899
[24387] ig36e08.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:MTRP_HUMAN Q15012 GOLGI
[24388] 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence
[24389] gi|17965175|gb|BM271899.1|BM271899[17965175]
[24390] 462: BM271817
[24391] ig35e06.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:MTRP_HUMAN Q15012 GOLGI
[24392] 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence
[24393] gi|1796509|gb|BM271817.1|BM271817[17965091]
[24394] 463: BM271771
[24395] ig38h09.x1 HR85 islet Homo sapiens cDNA 3′ similar to TR:O08721 O08721 TRANSMEMBRANE RECEPTOR UNC5H1.;, mRNA sequence
[24396] gi|17965045|gb|BM271771.1|BM271771[17965045]
[24397] 464: BC019314
[24398] Homo sapiens, transmembrane 4 superfamily member 7, clone MGC:4337 IMAGE:2821236, mRNA, complete cds
[24399] gi|17939509|gb|BC019314.1|BC019314[17939509]
[24400] 465: BM263743
[24401] ig29h12.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:NMB_HUMAN Q14956 PUTATIVE TRANSMEMBRANE PROTEIN NMB PRECURSOR.;, mRNA sequence
[24402] gi|17926783|gb|BM263743.1|BM263743[17926783]
[24403] 466: NM—004376
[24404] Homo sapiens COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA
[24405] gi|17921986|ref|NM—004376.2|[17921986]
[24406] 467: AY062295
[24407] Homo sapiens prolactin receptor (PRLR) mRNA, partial cds; alternatively spliced
[24408] gi|17887307|gb|AY062295.1|[17887307]
[24409] 468: NM—078474
[24410] Homo sapiens BBP-like protein 2 (BLP2), transcript variant 1, mRNA
[24411] gi|17865799|ref|NM—078474.1|[17865799]
[24412] 469: NM—025141
[24413] Homo sapiens BBP-like protein 2 (BLP2), transcript variant 2, mRNA
[24414] gi|17865798|ref|NM—025141.2|[17865798]
[24415] 470: NM—078473
[24416] Homo sapiens BBP-like protein 1 (BLP1), transcript variant 1, mRNA
[24417] gi|17865796|ref|NM—078473.1|[17865796]
[24418] 471: NM—031940
[24419] Homo sapiens BBP-like protein 1 (BLP1), transcript variant 2, mRNA
[24420] gi|17865794|ref|NM—031940.2|[17865794]
[24421] 472: NM—003728
[24422] Homo sapiens unc-5 homolog B (C. elegans) (UNC5C), mRNA
[24423] gi|16933524|ref|NM—003728.2|[16933524]
[24424] 473: NM—054027
[24425] Homo sapiens ankylosis, progressive homolog (mouse) (ANKH), transcript variant
[24426] 2, mRNA
[24427] gi|16905506|ref|NM—054027.1|[16905506]
[24428] 474: NM—019847
[24429] Homo sapiens ankylosis, progressive homolog (mouse) (ANKH), transcript variant
[24430] 1, mRNA
[24431] gi|16905505|ref|NM—019847.3|[16905505]
[24432] 475: NM—018440
[24433] Homo sapiens phosphoprotein associated with glycosphingolipid-enriched microdomains (PAG), mRNA
[24434] gi|16753228|ref|NM—018440.2|[16753228]
[24435] 478: NM—019894
[24436] Homo sapiens transmembrane protease, serine 4 (TMPRSS4), mRNA
[24437] gi|15451939|ref|NM—019894.1|[15451939]
[24438] 479: NM—006577
[24439] Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 (B3GNT1), transcript variant 1, mRNA
[24440] gi|15451893|ref|NM—006577.3|[15451893]
[24441] 480: NM—033252
[24442] Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 (B3GNT1), transcript variant 2, mRNA
[24443] gi|15451863|ref|NM—033252.1|[15451863]
[24444] 481: NM—014302
[24445] Homo sapiens Sec61 gamma (SEC61G), mRNA
[24446] gi|14591933|ref|NM—014302.2|[14591933]
[24447] 482: NM—014459
[24448] Homo sapiens protocadherin 17 (PCDH17), mRNA
[24449] gi|14589926|ref|NM—014459.2|[14589926]
[24450] 483: NM—032961
[24451] Homo sapiens protocadherin 10 (PCDH10), transcript variant 1, mRNA
[24452] gi|14589915|ref|NM—032961.1|[14589915]
[24453] 484: NM—020815
[24454] Homo sapiens protocadherin 10 (PCDH10), transcript variant 2, mRNA
[24455] gi|14589913|ref|NM—020815.1|[14589913]
[24456] 485: NM—032966
[24457] Homo sapiens Burkitt lymphoma receptor 1, GTP binding protein (BLR1), transcript
[24458] variant 2, mRNA
[24459] gi|14589868|ref|NM—032966.1|[14589868]
[24460] 486: NM—001716
[24461] Homo sapiens Burkitt lymphoma receptor 1, GTP binding protein (BLR1), transcript
[24462] variant 1, mRNA
[24463] gi|14589867|ref|NM—001716.2|[14589867]
[24464] 487: NM—031866
[24465] Homo sapiens trizzled homolog 8 (Drosophila) (FZD8), mRNA
[24466] gi|13994189|ref|NM—031866.1|[13994189]
[24467] 488: NM—030770
[24468] Homo sapiens transmembrane protease, serine 5 (spinesin) (TMPRSS5), mRNA
[24469] gi|13540534|ref|NM—030770.1|[13540534]
[24470] 489: NM—001407
[24471] Homo sapiens cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog,
[24472] Drosophila) (CELSR3), mRNA
[24473] gi|13325065|ref|NM—001407.1|[13325065]
[24474] 490: NM—001408
[24475] Homo sapiens cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog,
[24476] Drosophila) (CELSR2), mRNA
[24477] gi|13325063|ref|NM—001408.1|[13325063]
[24478] 491: NM—005971
[24479] Homo sapiens FXYD domain-containing ion transport regulator 3 (FXYD3), transcript variant 1, mRNA
[24480] gi|11612675|ref|NM—005971.2|[11612675]
[24481] 492: NM—021910
[24482] Homo sapiens FXYD domain-containing ion transport regulator 3 (FXYD3), transcript variant 2, mRNA
[24483] gi|11612673|ref|NM—021910.1|[11612673]
[24484] 493: NM—021778
[24485] Homo sapiens a disintegrin and metalloproteinase domain 28 (ADAM28), transcript
[24486] variant 2, mRNA
[24487] gi|11496995|ref|NM—021778.1|[11496995]
[24488] 494: NM—021777
[24489] Homo sapiens a disintegrin and metalloproteinase domain 28 (ADAM28), transcript
[24490] variant 3, mRNA
[24491] gi|11496993|ref|NM—021777.1|[11496993]
[24492] 495: NM—021783
[24493] Homo sapiens ectodysplasin A2 isoform receptor (XEDAR), mRNA
[24494] gi|11140822|ref|NM—021783.1|[11140822]
[24495] 496: NM—020182
[24496] Homo sapiens transmembrane, prostate androgen induced RNA (TMEPAI), mRNA
[24497] gi|9910497|ref|NM—020182.1|[9910497]
[24498] 497: NM—003857
[24499] Homo sapiens galanin receptor 2 (GALR2), mRNA
[24500] gi|8051600|ref|NM—003857.21[8051600]
[24501] 498: NM—015727
[24502] Homo sapiens tachykinin receptor 1 (TACR1), transcript variant short, mRNA
[24503] gi|7669545|ref|NM—015727.1|[7669545]
[24504] 499: NM—001058
[24505] Homo sapiens tachykinin receptor 1 (TACR1), transcript variant long, mRNA
[24506] gi|7669544|ref|NM—001058.2|[7669544]
[24507] 501: NM—014246
[24508] Homo sapiens cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog,
[24509] Drosophila) (CELSR1), mRNA
[24510] gi|7656966|ref|NM—014246.1|[7656966]
[24511] 502: NM—014265
[24512] Homo sapiens a disintegrin and metalloproteinase domain 28 (ADAM28), transcript
[24513] variant 1, mRNA
[24514] gi|7656862|ref|NM—014265.1|[7656862]
[24515] 503: NM—007264
[24516] Homo sapiens adrenomedullin receptor (ADMR), mRNA
[24517] gi|6466448|ref|NM—007264.2|[6466448]
[24518] 504: NM—004733
[24519] Homo sapiens acetyl-Coenzyme A transporter (ACATN), mRNA
[24520] gi|6042194|ref|NM—004733.2|[6042194]
[24521] 505: NM—003801
[24522] Homo sapiens GPAA1P anchor attachment protein 1 homolog (yeast) (GPAA1), mRNA
[24523] gi|6031166|ref|NM—003801.2|[6031166]
[24524] 506: NM—007197
[24525] Homo sapiens frizzled homolog 10 (Drosophila) (FZD10), mRNA
[24526] gi|6005761|ref|NM—007197.1|[6005761]
[24527] 507: NM—001466
[24528] Homo sapiens frizzled homolog 2 (Drosophila) (FZD2), mRNA
[24529] gi|5922012|ref|NM—001466.21[5922012]
[24530] 508: NM—006579
[24531] Homo sapiens emopamil binding protein (sterol isomerase) (EBP), mRNA
[24532] gi|5729809|ref|NM—006579.1|[5729809]
[24533] 509: NM—006017
[24534] Homo sapiens prominin-like 1 (mouse) (PROML1), mRNA
[24535] gi|5174386|ref|NM—006017.1|[5174386]
[24536] 510: NM—005228
[24537] Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) (EGFR), mRNA
[24538] gi|4885198|ref|NM—005228.1|[4885198]
[24539] 511: NM—004617
[24540] Homo sapiens transmembrane 4 superfamily member 4 (TM4SF4), mRNA
[24541] gi|4759239|ref|NM—004617.1|[4759239]
[24542] 512: NM—004787
[24543] Homo sapiens slit homolog 2 (Drosophila) (SLIT2), mRNA
[24544] gi|4759145|ref|NM—004787.1|[4759145]
[24545] 513: NM—004445
[24546] Homo sapiens EphB6 (EPHB6), mRNA
[24547] gi|4758291|ref|NM—004445.1|[4758291]
[24548] 514: NM—004338
[24549] Homo sapiens chromosome 18 open reading frame 1 (C18orf1), mRNA
[24550] gi|4757883|ref|NM—004338.1|[4757883]
[24551] 515: NM—002982
[24552] Homo sapiens small inducible cytokine A2 (monocyte chemotactic protein 1) (SCYA2), mRNA
[24553] gi|4506840|ref|NM—002982.1|[4506840]
[24554] 516: NM—002944
[24555] Homo sapiens v-ros UR2 sarcoma virus oncogene homolog 1 (avian) (ROS1), mRNA
[24556] gi|4506578|ref|NM—002944.1|[4506578]
[24557] 517: NM—000264
[24558] Homo sapiens patched homolog (Drosophila) (PTCH), mRNA
[24559] gi|4506246|ref|NM—000264.1|[4506246]
[24560] 518: NM—003508
[24561] Homo sapiens frizzled homolog 9 (Drosophila) (FZD9), mRNA
[24562] gi|4503834|ref|NM—003508.1|[4503834]
[24563] 519: NM—003507
[24564] Homo sapiens frizzled homolog 7 (Drosophila) (FZD7), mRNA
[24565] gi|4503832|ref|NM—003507.1|[4503832]
[24566] 520: NM—003506
[24567] Homo sapiens frizzled homolog 6 (Drosophila) (FZD6), mRNA
[24568] gi|4503830|ref|NM—003506.1|[4503830]
[24569] 521: NM—003468
[24570] Homo sapiens frizzled homolog 5 (Drosophila) (FZD5), mRNA
[24571] gi|4503828|ref|NM—003468.1|[4503828]
[24572] 522: NM—003505
[24573] Homo sapiens frizzled homolog 1 (Drosophila) (FZD1), mRNA
[24574] gi|4503824|ref|NM—003505.1|[4503824]
[24575] 523: NM—001982
[24576] Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
[24577] (ERBB3), mRNA
[24578] gi|4503596|ref|NM—001982.1|[4503596]
[24579] 524: NM—003859
[24580] Homo sapiens dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit (DPM1), mRNA
[24581] gi|4503362|ref|NM—003859.1|[4503362]
[24582] 525: NM—003915
[24583] Homo sapiens copine I (CPNE1), mRNA
[24584] gi|4503012|ref|NM—003915.1|[4503012]
[24585] 527: NM—052959
[24586] Homo sapiens pannexin 3 (PANX3), mRNA
[24587] gi|16418452|ref|NM—052959.1|[16418452]
[24588] 528: NM—052859
[24589] Homo sapiens putative endoplasmic reticulum multispan transmembrane protein (RFT1), mRNA
[24590] gi|16418360|ref|NM—052859.1|[16418360]
[24591] 531: NM—032108
[24592] Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B (SEMA6B), mRNA
[24593] gi|14165267|ref|NM—032108.1|[14165267]
[24594] 532: NM—031925
[24595] Homo sapiens transmembrane protein induced by tumor necrosis factor alpha (TMPIT), mRNA
[24596] gi|13994299|ref|NM—031925.1|[13994299]
[24597] 533: NM—030960
[24598] Homo sapiens sperm acrosome associated 1 (SPACA1), mRNA
[24599] gi|13569933|ref|NM—030960.1|[13569933]
[24600] 534: NM—030755
[24601] Homo sapiens thioredoxin domain-containing (TXNDC), mRNA
[24602] gi|13559515|ref|NM—030755.1|[13559515]
[24603] 535: NM—024734
[24604] Homo sapiens calponin like transmembrane domain protein (calmin), mRNA
[24605] gi|13376053|ref|NM—024734.1|[13376053]
[24606] 536: NM—023003
[24607] Homo sapiens transmembrane 6 superfamily member 1 (TM6SF1), mRNA
[24608] gi|13194198|ref|NM—023003.1|[13194198]
[24609] 537: NM—021034
[24610] Homo sapiens interferon induced transmembrane protein 3 (1-8U) (IFITM3), mRNA
[24611] gi|11995467|ref|NM—021034.1|[11995467]
[24612] 538: NM—006435
[24613] Homo sapiens interferon induced transmembrane protein 2 (1-8D) (IFITM2), mRNA
[24614] gi|10835237|ref|NM—006435.1|[0835237]
[24615] 539: NM—016326
[24616] Homo sapiens chemokine-like factor 1 (CKLF1), mRNA
[24617] gi|10092611|ref|NM—016326.2|[10092611]
[24618] 540: NM—016951
[24619] Homo sapiens chemokine-like factor 1 (CKLF1), mRNA
[24620] gi|10092593|ref|NM—016951.2|[10092593]
[24621] 541: NM—000888
[24622] Homo sapiens integrin, beta 6 (ITGB6), mRNA
[24623] gi|9966771|ref|NM—000888.3|[9966771]
[24624] 542: NM—020241
[24625] Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B (SEMA6B), mRNA
[24626] gi|9910379|ref|NM—020241.1|[9910379]
[24627] 543: NM—018407
[24628] Homo sapiens putative integral membrane transporter (LC27), mRNA
[24629] gi|8923827|ref|NM—018407.1|[8923827]
[24630] 544: NM—017514
[24631] Homo sapiens SEX gene (HSSEXGENE), mRNA
[24632] gi|8923792|ref|NM—017514.1|[8923792]
[24633] 545: NM—017893
[24634] Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM)
[24635] and short cytoplasmic domain, (semaphorin) 4G (SEMA4G), mRNA
[24636] gi|8923550|ref|NM—017893.1|[8923550]
[24637] 546: NM—017599
[24638] Homo sapiens transmembrane protein vezatin (VEZATIN), mRNA
[24639] gi|8922162|ref|NM—017599.1|[8922162]
[24640] 547: NM—014254
[24641] Homo sapiens transmembrane protein 5 (TMEM5), mRNA
[24642] gi|7657177|ref|NM—014254.1|[7657177]
[24643] 548: NM—012339
[24644] Homo sapiens transmembrane 4 superfamily member (tetraspan NET-7) (NET-7), mRNA
[24645] gi|6912529|ref|NM—012339.1|[6912529]
[24646] 549: NM—012338
[24647] Homo sapiens transmembrane 4 superfamily member (tetraspan NET-2) (NET-2), mRNA
[24648] gi|6912527|ref|NM—012338.1|[6912527]
[24649] 550: NM—002673
[24650] Homo sapiens plexin B1 (PLXNB1), mRNA
[24651] gi|6631105|ref|NM—002673.1|[6631105]
[24652] 551: NM—006825
[24653] Homo sapiens cytoskeleton-associated protein 4 (CKAP4), mRNA
[24654] gi|5803112|ref|NM—006825.1|[5803112]
[24655] 552: NM—004785
[24656] Homo sapiens solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2 (SLC9A3R2), mRNA
[24657] gi|4759141|ref|NM—004785.1|[4759141]
[24658] 553: NM—004263
[24659] Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM)
[24660] and short cytoplasmic domain, (semaphorin) 4F (SEMA4F), mRNA
[24661] gi|4759093|ref|NM—004263.1|[4759093]
[24662] 554: NM—004800
[24663] Homo sapiens transmembrane 9 superfamily member 2 (TM9SF2), mRNA
[24664] gi|4758873|ref|NM—004800.1|[4758873]
[24665] 555: NM—000950
[24666] Homo sapiens proline-rich Gla (G-carboxyglutamic acid) polypeptide 1 (PRRG1), mRNA
[24667] gi|4506134|ref|NM—000950.1|[4506134]
[24668] 556: NM—003625
[24669] Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF),
[24670] interacting protein (liprin), alpha 2 (PPFIA2), mRNA
[24671] gi|4505984|ref|NM—003625.1|[4505984]
[24672] 558: NM—032518
[24673] Homo sapiens collagen-like Alzheimer amyloid plaque component precursor (LOC84570), mRNA
[24674] gi|14210525|ref|NM—032518.1|[14210525]
[24675] 559: NM—023945
[24676] Homo sapiens membrane-spanning 4-domains, subfamily A, member 5 (MS4A5), mRNA
[24677] gi|12965204|ref|NM—023945.1|[12965204]
[24678] 560: NM—016158
[24679] Homo sapiens erythrocyte transmembrane protein (LOC51145), % T
[24680] gi|7705856|ref|NM—016158.1|[7705856]
[24681] 561: AK056649
[24682] Homo sapiens cDNA FLJ32087 fis, clone OCBBF2000467, highly similar to Fibronectin leucine rich transmembrane protein 2
[24683] gi|16552109|dbj|AK056649.1|AK056649[16552109]
[24684] 562: AK056595
[24685] Homo sapiens cDNA FLJ32033 fis, clone NTONG2000265, weakly similar to Probable
[24686] transmembrane protein of fission yeast
[24687] gi|16552042|dbj|AK056595.1|AK056595[16552042]
[24688] 563: AK055648
[24689] Homo sapiens cDNA FLJ31086 fis, clone IMR321000044, highly similar to Human transmembrane receptor precursor (PTK7) mRNA
[24690] gi|16550428|dbj|AK055648.1|AK055648[16550428]
[24691] 564: AK055208
[24692] Homo sapiens cDNA FLJ30646 fis, clone CTONG2004716, weakly similar to Rattus norvegicus mRNA for seven transmembrane receptor
[24693] gi|16549884|dbj|AK055208.1|AK055208[16549884]
[24694] 565: AK054712
[24695] Homo sapiens cDNA FLJ30150 fis, clone BRACE2000300, highly similar to TRANSMEMBRANE PROTEIN PFT27
[24696] gi|16549313|dbj|AK054712.1|AK054712[16549313]
[24697] 566: AK054646
[24698] Homo sapiens cDNA FLJ30084 fis, clone BGGI12001682, highly similar to Homo sapiens transmembrane protein TENB2 (TENB2) mRNA
[24699] gi|16549231|dbj|AK054646.1|AK054646[16549231]
[24700] 567: NM—019035
[24701] Homo sapiens protocadherin 18 (PCDH18), mRNA
[24702] gi|14589928|ref|NM—019035.1|[14589928]
[24703] 568: NM—030943
[24704] Homo sapiens amnionless protein (AMN), mRNA
[24705] gi|13569914|ref|NM—030943.1|[13569914]
[24706] 570: BC018361
[24707] Homo sapiens, sema domain, immunoglobulin domain (Ig), transmembrane domain (TM)
[24708] and short cytoplasmic domain, (semaphorin) 4F, clone MGC:21849 IMAGE:4215248, mRNA, complete cds
[24709] gi|17390842|gb|BC018361.1|BC018361[17390842]
[24710] 571: AF214006
[24711] Homo sapiens TDC1 (TDC1) mRNA, complete cds
[24712] gi|17221828|gb|AF214006.1|AF214006[17221828]
[24713] 572: NM—021201
[24714] Homo sapiens membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), mRNA
[24715] gi|11139298|ref|NM—021201.1|[11139298]
[24716] 573: AF289028
[24717] Homo sapiens transmembrane protein B7-H2 ICOS ligand mRNA, complete cds
[24718] gi|9858866|gb|AF289028.1|AF289028[9858866]
[24719] 574: NM—016941
[24720] Homo sapiens delta-like 3 (Drosophila) (DLL3), mRNA
[24721] gi|8393263|ref|NM—016941.1|[8393263]
[24722] 575: NM—014450
[24723] Homo sapiens SHP2 interacting transmembrane adaptor (SIT), mRNA
[24724] gi|7657576|ref|NM—014450.1|[7657576]
[24725] 576: NM—021259
[24726] Homo sapiens transmembrane protein 8 (five membrane-spanning domains) (TMEM8),
[24727] mRNA
[24728] gi|10864068|ref|NM—021259.1|[10864068]
[24729] 577: NM—002959
[24730] Homo sapiens sortilin 1 (SORT1), mRNA
[24731] gi|17149833|ref|NM—002959.3|[17149833]
[24732] 578: NM—000675
[24733] Homo sapiens adenosine A2a receptor (ADORA2A), mRNA
[24734] gi|17136146|ref|NM—000675.3|[17136146]
[24735] 579: BM128846
[24736] if17e06.x1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 3′ similar
[24737] to SW:PF27_MOUSE P52875 TRANSMEMBRANE PROTEIN PFT27. [1];, mRNA sequence
[24738] gi|17123398|gb|BM128846.1|BM128846[17123398]
[24739] 580: BM127423
[24740] ie95b07.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar
[24741] to TR:O60639 O60639 PUTATIVE TRANSMEMBRANE GTPASE;, mRNA sequence
[24742] gi|17121975|gb|BM127423.1|BM127423[17121975]
[24743] 581: AY016020
[24744] Gallus gallus alpha globin gene cluster, complete sequence
[24745] gi|17104478|gb|AY016020.1|[17104478]
[24746] 582: M86631
[24747] Homo sapiens (clone ST-18-5(9/16)) cystic fibrosis transmembrane conductance regulator (CFTR) gene, 3′ end intron 17B; complete exon 18; complete intron
[24748] gi|180296|gb|M86631.1|HUMCFTR[180296]
[24749] 584: BC017476
[24750] Homo sapiens, sema domain, immunoglobulin domain (Ig), transmembrane domain TM)
[24751] and short cytoplasmic domain, (semaphorin) 4C, clone MGC:15189 IMAGE:3528227, mRNA, complete cds
[24752] gi|17028345|gb|BC017476.1|BC017476[17028345]
[24753] 585: NM—000420
[24754] Homo sapiens Kell blood group (KEL), mRNA
[24755] gi|17025233|ref|NM—000420.2|[17025233]
[24756] 586: BM090614
[24757] ig16b09.y1 Human Fetal Pancreas 1A Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence
[24758] gi|17019580|gb|BM090614.1|BM090614[17019580]
[24759] 587: AF217288
[24760] Homo sapiens protocadherin-S mRNA, complete cds, alternatively spliced
[24761] gi|15054520|gb|AF217288.1|AF217288[15054520]
[24762] 588: AF206516
[24763] Homo sapiens protocadherin-S mRNA, complete cds
[24764] gi|15054518 gb|AF206516.1|AF206516[15054518]
[24765] 589: NM—021153
[24766] Homo sapiens cadherin 19, type 2 (CDH19), mRNA
[24767] gi|16306535|ref|NM—021153.2|[16306535]
[24768] 590: AY048509
[24769] Homo sapiens pannexin 1 (PANX1) gene, partial cds
[24770] gi|15808666|gb|AY048509.1|[15808666]
[24771] 591: NG—000012
[24772] Homo sapiens genomic protocadherin gamma cluster (PCDHG@) on chromosome 5
[24773] gi|14861871|ref|NG—000012.1|[14861871]
[24774] 592: AE006466
[24775] Homo sapiens 16p13.3 sequence section 5 of 8
[24776] gi|14336735|gb|AE006466.1|AE006466[14336735]
[24777] 593: AF376725
[24778] Homo sapiens lung seven transmembrane receptor 1 (LUSTR1) mRNA, complete cds
[24779] gi|14248996|gb|AF376725.1|AF376725[14248996]
[24780] 594: NM—004776
[24781] Homo sapiens UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
[24782] (B4GALT5), mRNA
[24783] gi|13929470|ref|NM—004776.2|[13929470]
[24784] 595: NM—030587
[24785] Homo sapiens UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 2
[24786] (B4GALT2), transcript variant 1, mRNA
[24787] gi|13929464|ref|NM—030587.1|[13929464]
[24788] 596: NM—003780
[24789] Homo sapiens UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 2
[24790] (B4GALT2), transcript variant 2, mRNA
[24791] gi|13929463|ref|NM—003780.2|[13929463]
[24792] 597: NM—002590
[24793] Homo sapiens protocadherin 8 (PCDH8), transcript variant 1, mRNA
[24794] gi|6631101|ref|NM—002590.2|[6631101]
[24795] 598: L42572
[24796] Homo sapiens transmembrane protein (p87/89) mRNA, complete cds
[24797] gi|1160962|gb|L42572.1|HUMP8789R[1160962]
[24798] 599: AF106202
[24799] Homo sapiens endothelial cell protein C receptor precursor (EPCR) gene, promoter
[24800] region and complete cds
[24801] gi|16950557|gb|AF106202.2|AF106202[16950557]
[24802] 600: NM—033207
[24803] Homo sapiens transmembrane protein HTMP10 (HTMP10), mRNA
[24804] gi|16945967|ref|NM—033207.2|[16945967]
[24805] 601: AF153440
[24806] Mus musculus Nma (Nma) mRNA, complete cds
[24807] gi|14328906|gb|AF153440.1|AF153440[14328906]
[24808] 604: NM—005086
[24809] Homo sapiens sarcospan (Kras oncogene-associated gene) (SSPN), mRNA
[24810] gi|16933560|ref|NM—005086.3|[16933560]
[24811] 605: NM—018153
[24812] Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 3, mRNA
[24813] gi|16933552|ref|NM—018153.2|[16933552]
[24814] 606: NM—053034
[24815] Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 2, mRNA
[24816] gi|16933550|ref|NM—053034.1|[16933550]
[24817] 607: NM—032208
[24818] Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 1, mRNA
[24819] gi|14149903|ref|NM—032208.1|[14149903]
[24820] 608: AV225853
[24821] AV225853 RIKEN full-length enriched, 18 days pregnant, placenta and extra embryonic tissue Mus musculus cDNA clone 3830432D01 3′ similar to X69910
[24822] H. sapiens p63 mRNA for transmembrane protein, mRNA sequence
[24823] gi|6177168|dbj|AV225853.1|AV225853[6177168]
[24824] 609: AV222771
[24825] AV222771 RIKEN full-length enriched, 18 days pregnant, placenta and extra embryonic tissue Mus musculus cDNA clone 3830404C12 3′ similar to X69910
[24826] H. sapiens p63 mRNA for transmembrane protein, mRNA sequence
[24827] gi|6171948|dbj|AV222771.1|AV222771[6171948]
[24828] 611: BC017058
[24829] Homo sapiens, Similar to seven transmembrane domain orphan receptor, clone MGC:9442 IMAGE:3904719, mRNA, complete cds
[24830] gi|16877618|gb|BC017058.1|BC017058[16877618]
[24831] 612: BM055437
[24832] ie94h04.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar
[24833] to SW:CFTR_HUMAN P13569 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR;, mRNA sequence
[24834] gi|16813328|gb|BM055437.1|BM055437[16813328]
[24835] 614: AF328788
[24836] Homo sapiens amnionless mRNA, complete cds
[24837] gi|13507258|gb|AF328788.1|AF328788[13507258]
[24838] 615: NM—052836
[24839] Homo sapiens cadherin related 23 (CDH23), transcript variant 2, mRNA
[24840] gi|16507963|ref|NM—052836.1|[16507963]
[24841] 616: NM—022124
[24842] Homo sapiens cadherin related 23 (CDH23), transcript variant 1, mRNA
[24843] gi|16507961|ref|NM—022124.2|[16507961]
[24844] 617: NM—004063
[24845] Homo sapiens cadherin 17, LI cadherin (liver-intestine) (CDH17), mRNA
[24846] gi|16507959|ref|NM—004063.2|[16507959]
[24847] 618: NM—004062
[24848] Homo sapiens cadherin 16, KSP-cadherin (CDH16), mRNA
[24849] gi|16507958|ref|NM—004062.2|[16507958]
[24850] 619: NM—004933
[24851] Homo sapiens cadherin 15, M-cadherin (myotubule) (CDH15), mRNA
[24852] gi|16507957|ref|NM—004933.2|[16507957]
[24853] 620: NM—001257
[24854] Homo sapiens cadherin 13, H-cadherin (heart) (CDH13), mRNA
[24855] gi|16507956|ref|NM—001257.2|[16507956]
[24856] 621: BC009704
[24857] Homo sapiens, transmembrane 4 superfamily member 9, clone MGC:9300 IMAGE:3895933, mRNA, complete cds
[24858] gi|16307230|gb|BC009704.1|BC009704[16307230]
[24859] 622: BC001496
[24860] Homo sapiens, transmembrane trafficking protein, clone MGC:1979
[24861] IMAGE:2959718, mRNA, complete cds
[24862] gi|16306639|gb|BC001496.1|BC001496[16306639]
[24863] 623: BC013577
[24864] Homo sapiens, claudin 11 (oligodendrocyte transmembrane protein), clone MGC:9232
[24865] IMAGE:3895040, mRNA, complete cds
[24866] gi|15488893|gb|BC013577.1|BC013577[15488893]
[24867] 624: NM—053002
[24868] Homo sapiens no opposite paired repeat protein (NOPAR), mRNA
[24869] gi|16506292|ref|NM—053002.1|[16506292]
[24870] 625: NM—052995
[24871] Homo sapiens Usher syndrome 3A (USH3A), mRNA
[24872] gi|16506280|ref|NM—052995.1|[16506280]
[24873] 639: NM—014879
[24874] Homo sapiens G protein-coupled receptor 105 (GPR105), mRNA
[24875] gi|7661847|ref|NM—014879.1|[7661847]
[24876] 640: NM—052891
[24877] Homo sapiens peptidoglycan recognition protein-1-alpha precursor (PGLYRPIalpha),
[24878] mRNA
[24879] gi|16418404|ref|NM—052891.1|[16418404]
[24880] 642: B1964203
[24881] ie66b09.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar
[24882] to TR:Q99989 Q99989 TRANSMEMBRANE CHLORIDE CONDUCTOR PROTEIN;, mRNA sequence
[24883] gi|16338608|gb|BI964203.1|BI964203[16338608]
[24884] 643: B1963913
[24885] ie66e08.x1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 3′ similar
[24886] to SW:PF27_MOUSE P52875 TRANSMEMBRANE PROTEIN PFT27. [1];, mRNA sequence
[24887] gi|16338318|gb|BI963913.1|BI963913[16338318]
[24888] 644: AF293372
[24889] Pan troglodytes sialic acid-binding lectin Siglec-L1 mRNA, complete cds
[24890] gi|15824309|gb|AF293372.1|AF293372[15824309]
[24891] 645: BC009696
[24892] Homo sapiens, interferon induced transmembrane protein 2 (1-8D), clone MGC:9196
[24893] IMAGE:3876542, mRNA, complete cds
[24894] gi|16307214|gb|BC009696.1|BC009696[16307214]
[24895] 646: NM—031891
[24896] Homo sapiens cadherin 20, type 2 (CDH20), mRNA
[24897] gi|16306536|ref|NM—031891.2|[16306536]
[24898] 647: NM—004361
[24899] Homo sapiens cadherin 7, type 2 (CDH7), transcript variant b, mRNA
[24900] gi|16306488|ref|NM—004361.2|[16306488]
[24901] 648: NM—033646
[24902] Homo sapiens cadherin 7, type 2 (CDH7), transcript variant a, mRNA
[24903] gi|16306486|ref|NM—033646.1|[16306486]
[24904] 649: AF319952
[24905] Homo sapiens tweety-like protein 2 mRNA, complete cds
[24906] gi|16303747|gb|AF319952.1|AF319952[16303747]
[24907] 651: NM—005756
[24908] Homo sapiens G protein-coupled receptor 64 (GPR64), mRNA
[24909] gi|5031732|ref|NM—005756.1|[5031732]
[24910] 652: AF416903
[24911] Homo sapiens SH2 domain-containing phosphatase anchor protein 2c mRNA, complete
[24912] cds, alternatively spliced
[24913] gi|16033593|gb|AF416903.1|AF416903[16033593]
[24914] 653: AF416902
[24915] Homo sapiens SH2 domain-containing phosphatase anchor protein 2b mRNA, complete
[24916] cds, alternatively spliced
[24917] gi|16033590|gb|AF416902.1|AF416902[16033590]
[24918] 654: AF416901
[24919] Homo sapiens SH2 domain-containing phosphatase anchor protein 2a mRNA, complete
[24920] cds, alternatively spliced
[24921] gi|16033587|gb|AF416901.1|AF416901[16033587]
[24922] 655: AF264740
[24923] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*015 allele,
[24924] exon 6 and partial cds
[24925] gi|16032983|gb|AF264740.1|AF264738S3[16032983]
[24926] 656: AF264739
[24927] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*015 allele,
[24928] exons 4 and 5
[24929] gi|16032982|gb|AF264739.1|AF264738S2[16032982]
[24930] 657: AF264738
[24931] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*015 allele,
[24932] exons 2 and 3
[24933] gi|16032981|gb|AF264738.1|AF264738S1[16032981]
[24934] 658: AH011143
[24935] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*015 allele,
[24936] partial cds
[24937] gi|16032980|gb|AH011143.1|SEG_AF264738S[16032980]
[24938] 659: NM—033467
[24939] Homo sapiens membrane metallo-endopeptidase-like 2 (MMEL2), mRNA
[24940] gi|15991812|ref|NM—033467.1|[15991812]
[24941] 660: AF378755
[24942] Homo sapiens tumor endothelial marker 5 precursor (TEM5) mRNA, complete cds
[24943] gi|15987490|gb|AF378755.1|AF378755[15987490]
[24944] 661: NM—016227
[24945] Homo sapiens chromosome 1 open reading frame 9 (C1orf9), mRNA
[24946] gi|7705321|ref|NM—016227.1|[7705321]
[24947] 662: NM—014283
[24948] Homo sapiens chromosome 1 open reading frame 9 (C1orf9), mRNA
[24949] gi|7656939|ref|NM—014283.1|[7656939]
[24950] 663: NM—018475
[24951] Homo sapiens TPA regulated locus (TPARL), mRNA
[24952] gi|8923860|ref|NM—018475.1|[8923860]
[24953] 664: D83783
[24954] Human mRNA for KIAA0192 gene, partial cds
[24955] gi|1663693|dbj|D83783.1D83783[1663693]
[24956] 665: D79997
[24957] Human mRNA for KIAA0175 gene, complete cds
[24958] gi|1136409|dbj|D79997.1|D79997[1136409]
[24959] 666: D13626
[24960] Human mRNA for KIAA0001 gene, complete cds
[24961] gi|285994|dbj|D13626.1|HUMRSC338[285994]
[24962] 679: B1793175
[24963] ie48h08.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar
[24964] to SW:NMB_HUMAN Q14956 PUTATIVE TRANSMEMBRANE PROTEIN NMB PRECURSOR.;, mRNA sequence
[24965] gi|15820900|gb|BI793175.1|BI793175[15820900]
[24966] 680: U40271
[24967] Homo sapiens transmembrane receptor precursor (PTK7) mRNA, complete cds
[24968] gi|15808058|gb|U40271.2|HSU40271[15808058]
[24969] 681: BC014554
[24970] Homo sapiens, calponin like transmembrane domain protein, clone IMAGE:3837453,
[24971] mRNA
[24972] gi|15778950|gb|BC014554.1|BC014554[15778950]
[24973] 682: NM—018916
[24974] Homo sapiens protocadherin gamma subfamily A, 3 (PCDHGA3), transcript variant 1,
[24975] mRNA
[24976] gi|14589879|ref|NM—018916.3|[14589879]
[24977] 683: NM—032407
[24978] Homo sapiens protocadherin gamma subfamily C, 5 (PCDHGC5), transcript variant 2,
[24979] mRNA
[24980] gi|14277684|ref|NM—032407.1|[14277684]
[24981] 684: NM—018929
[24982] Homo sapiens protocadherin gamma subfamily C, 5 (PCDHGC5), transcript variant 1,
[24983] mRNA
[24984] gi|14277683|ref|NM—018929.2|[14277683]
[24985] 685: NM—032406
[24986] Homo sapiens protocadherin gamma subfamily C, 4 (PCDHGC4), transcript variant 2,
[24987] mRNA
[24988] gi|14277681|ref|NM—032406.1|[14277681]
[24989] 686: NM—018928
[24990] Homo sapiens protocadherin gamma subfamily C, 4 (PCDHGC4), transcript variant 1,
[24991] mRNA
[24992] gi|14277680|ref|NM—018928.2|[14277680]
[24993] 687: NM—032101
[24994] Homo sapiens protocadherin gamma subfamily B, 7 (PCDHGB7), transcript variant 2,
[24995] mRNA
[24996] gi|14270507|ref|NM—032101.1|[14270507]
[24997] 688: NM—018927
[24998] Homo sapiens protocadherin gamma subfamily B, 7 (PCDHGB7), transcript variant 1,
[24999] gi|14270506|ref|NM—018927.2|[14270506]
[25000] 689: NM—032099
[25001] Homo sapiens protocadherin gamma subfamily B, 5 (PCDHGB5), transcript variant 2,
[25002] mRNA
[25003] gi|14270504|ref|NM—032099.1|[14270504]
[25004] 690: NM—018925
[25005] Homo sapiens protocadherin gamma subfamily B, 5 (PCDHGB5), transcript variant 1,
[25006] mRNA
[25007] gi|14270503|ref|NM—018925.2|[14270503]
[25008] 691: NM—032100
[25009] Homo sapiens protocadherin gamma subfamily B, 6 (PCDHGB6), transcript variant 2,
[25010] mRNA
[25011] gi|14270501|ref|NM—032100.2|[14270501]
[25012] 692: NM—018926
[25013] Homo sapiens protocadherin gamma subfamily B, 6 (PCDHGB6), transcript variant 1,
[25014] mRNA
[25015] gi|14270500|ref|NM—018926.2|[14270500]
[25016] 693: NM—032097
[25017] Homo sapiens protocadherin gamma subfamily B, 3 (PCDHGB3), transcript variant 2,
[25018] mRNA
[25019] gi|14270495|ref|NM—032097.1|[14270495]
[25020] 694: NM—018924
[25021] Homo sapiens protocadherin gamma subfamily B, 3 (PCDHGB3), transcript variant 1,
[25022] mRNA
[25023] gi|14270494|ref|NM—018924.2|[14270494]
[25024] 695: NM—032096
[25025] Homo sapiens protocadherin gamma subfamily B, 2 (PCDHGB2), transcript variant 2,
[25026] mRNA
[25027] gi|14270492|ref|NM—032096.1|[14270492]
[25028] 696: NM—018923
[25029] Homo sapiens protocadherin gamma subfamily B, 2 (PCDHGB2), transcript variant 1,
[25030] mRNA
[25031] gi|14270491|ref|NM—018923.2|[14270491]
[25032] 697: NM—032095
[25033] Homo sapiens protocadherin gamma subfamily B, 1 (PCDHGB1), transcript variant 2,
[25034] mRNA
[25035] gi|14270489|ref|NM—032095.1|[14270489]
[25036] 698: NM—018922
[25037] Homo sapiens protocadherin gamma subfamily B, 1 (PCDHGB1), transcript variant 1,
[25038] mRNA
[25039] gi|14270488|ref|NM—018922.2|[14270488]
[25040] 699: NM—032089
[25041] Homo sapiens protocadherin gamma subfamily A, 9 (PCDHGA9), transcript variant 2,
[25042] mRNA
[25043] gi|14270486|ref|NM—032089.1|[14270486]
[25044] 700: NM—018921
[25045] Homo sapiens protocadherin gamma subfamily A, 9 (PCDHGA9), transcript variant 1,
[25046] mRNA
[25047] gi|14270485|ref|NM—018921.2|[14270485]
[25048] 701: NM—032088
[25049] Homo sapiens protocadherin gamma subfamily A, 8 (PCDHGA8), transcript variant 1,
[25050] mRNA
[25051] gi|14270483|ref|NM—032088.1|[14270483]
[25052] 702: NM—014004
[25053] Homo sapiens protocadherin gamma subfamily A, 8 (PCDHGA8), transcript variant 2,
[25054] mRNA
[25055] gi|14270482|ref|NM—014004.2|[14270482]
[25056] 703: NM—032087
[25057] Homo sapiens protocadherin gamma subfamily A, 7 (PCDHGA7), transcript variant 2,
[25058] mRNA
[25059] gi|14196476|ref|NM—032087.1|[14196476]
[25060] 704: NM—018920
[25061] Homo sapiens protocadherin gamma subfamily A, 7 (PCDHGA7), transcript variant 1,
[25062] mRNA
[25063] gi|14196475|ref|NM—018920.2|[14196475]
[25064] 705: NM—032086
[25065] Homo sapiens protocadherin gamma subfamily A, 6 (PCDHGA6), transcript variant 2,
[25066] mRNA
[25067] gi|14196473|ref|NM—032086.1|[14196473]
[25068] 706: NM—018919
[25069] Homo sapiens protocadherin gamma subfamily A, 6 (PCDHGA6), transcript variant 1,
[25070] mRNA
[25071] gi|14196472|ref|NM—018919.2|[14196472]
[25072] 707: NM—032054
[25073] Homo sapiens protocadherin gamma subfamily A, 5 (PCDHGA5), transcript variant 2,
[25074] mRNA
[25075] gi|14196470|ref|NM—032054.1|[14196470]
[25076] 708: NM—018918
[25077] Homo sapiens protocadherin gamma subfamily A, 5 (PCDHGA5), transcript variant 1,
[25078] mRNA
[25079] gi|14196469|ref|NM—018918.2|[14196469]
[25080] 709: NM—032053
[25081] Homo sapiens protocadherin gamma subfamily A, 4 (PCDHGA4), transcript variant 2,
[25082] mRNA
[25083] gi|14196467|ref|NM—032053.1|[14196467]
[25084] 710: NM—018917
[25085] Homo sapiens protocadherin gamma subfamily A, 4 (PCDHGA4), transcript variant 1,
[25086] mRNA
[25087] gi|14196466|ref|NM—018917.2|[14196466]
[25088] 711: NM—032011
[25089] Homo sapiens protocadherin gamma subfamily A, 3 (PCDHGA3), transcript variant 2,
[25090] mRNA
[25091] gi|14196464|ref|NM—032011.1|[14196464]
[25092] 712: NM—032009
[25093] Homo sapiens protocadherin gamma subfamily A, 2 (PCDHGA2), transcript variant 2,
[25094] mRNA
[25095] gi|14196461|ref|NM—032009.1|[14196461]
[25096] 713: NM—018915
[25097] Homo sapiens protocadherin gamma subfamily A, 2 (PCDHGA2), transcript variant 1,
[25098] mRNA
[25099] gi|14196460|ref|NM—018915.2|[14196460]
[25100] 714: NM—031993
[25101] Homo sapiens protocadherin gamma subfamily A, 1 (PCDHGA1), transcript variant 2,
[25102] mRNA
[25103] gi|14196458|ref|NM—031993.1|[14196458]
[25104] 715: NM—032092
[25105] Homo sapiens protocadherin gamma subfamily A, 11 (PCDHGA11), transcript variant
[25106] 3, mRNA
[25107] gi|14196454|ref|NM—032092.1|[14196454]
[25108] 716: NM—018912
[25109] Homo sapiens protocadherin gamma subfamily A, 1 (PCDHGA1), transcript variant mRNA
[25110] gi|14196453|ref|NM—018912.2|[14196453]
[25111] 717: NM—032091
[25112] Homo sapiens protocadherin gamma subfamily A, 11 (PCDHGA11), transcript variant
[25113] 2, mRNA
[25114] gi|14196450|ref|NM—032091.1|[14196450]
[25115] 718: NM—018914
[25116] Homo sapiens protocadherin gamma subfamily A, 11 (PCDHGA11), transcript variant
[25117] 1, mRNA
[25118] gi|14196449|ref|NM—018914.2|[14196449]
[25119] 719: NM—032090
[25120] Homo sapiens protocadherin gamma subfamily A, 10 (PCDHGA10), transcript variant
[25121] 2, mRNA
[25122] gi|14196447|ref|NM—032090.1|[14196447]
[25123] 720: NM—018913
[25124] Homo sapiens protocadherin gamma subfamily A, 10 (PCDHGA10), transcript variant
[25125] 1, mRNA
[25126] gi|14196446|ref|NM—018913.2|[14196446]
[25127] 721: NM—031411
[25128] Homo sapiens protocadherin alpha 1 (PCDHA1), transcript variant 3, mRNA
[25129] gi|14165401|ref|NM—031411.1|[14165401]
[25130] 722: NM—031849
[25131] Homo sapiens protocadherin alpha 6 (PCDHA6), transcript variant 3, mRNA
[25132] gi|14165393|ref|NM—031849.1|[14165393]
[25133] 723: NM—031860
[25134] Homo sapiens protocadherin alpha 10 (PCDHA10), transcript variant 3, mRNA
[25135] gi|14165382|ref|NM—031860.1|[14165382]
[25136] 724: NM—031442
[25137] Homo sapiens brain cell membrane protein 1 (BCMP1), mRNA
[25138] gi|13899272|ref|NM—031442.1|[13899272]
[25139] 725: NM—007000
[25140] Homo sapiens uroplakin 1A (UPK1A), mRNA
[25141] gi|5902147|ref|NM—007000.1|[5902147]
[25142] 726: NM—003332
[25143] Homo sapiens TYRO protein tyrosine kinase binding protein (TYROBP), mRNA
[25144] gi|4507754|ref|NM—003332.1|[4507754]
[25145] 727: AF264747
[25146] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*00901 allele,
[25147] exon 6 and partial cds
[25148] gi|14279228|gb|AF264747.1|AF264744S3[14279228]
[25149] 728: AF264746
[25150] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*00901 allele,
[25151] exons 4 and 5
[25152] gi|14279227|gb|AF264746.1|AF264744S2[14279227]
[25153] 729: AF264744
[25154] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*00901 allele,
[25155] exons 2 and 3
[25156] gi|14279226|gb|AF264744.1|AF264744S1[14279226]
[25157] 730: AH010821
[25158] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*00901 allele,
[25159] partial cds
[25160] gi|14279225|gb|AH010821.1|SEG_AF264744S[14279225]
[25161] 731: AF264743
[25162] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*048 allele,
[25163] exon 6 and partial cds
[25164] gi|14279223|gb|AF264743.1|AF264741S3[14279223]
[25165] 732: AF264742
[25166] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*048 allele,
[25167] exons 4 and 5
[25168] gi|14279222|gb|AF264742.1|AF264741S2[14279222]
[25169] 733: AF264741
[25170] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*048 allele,
[25171] exons 2 and 3
[25172] gi|14279221|gb|AF264741.1|AF264741S1[14279221]
[25173] 734: AH010820
[25174] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*048 allele,
[25175] partial cds
[25176] gi|14279220|gb|AH010820.1|SEG_AF264741S[14279220]
[25177] 735: AF264737
[25178] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*017 allele,
[25179] exon 6 and partial cds
[25180] gi|14279218|gb|AF264737.1|AF264735S3[14279218]
[25181] 736: AF264736
[25182] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*017 allele,
[25183] exons 4 and 5
[25184] gi|14279217|gb|AF264736.1|AF264735S2[14279217]
[25185] 737: AF264735
[25186] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*017 allele,
[25187] exons 2 and 3
[25188] gi|14279216|gb|AF264735.1|AF264735S1[14279216]
[25189] 738: AH010819
[25190] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*017 allele,
[25191] partial cds
[25192] gi|14279215|gb|AH010819.1|SEG_AF264735S[14279215]
[25193] 739: AF336080
[25194] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*019 allele,
[25195] exon 6 and partial cds
[25196] gi|13469855|gb|AF336080.1|AF336079S2[13469855]
[25197] 740: AF336079
[25198] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*019 allele,
[25199] exons 2 through 5
[25200] gi|13469854|gb|AF336079.1|AF336079S1[13469854]
[25201] 741: AH010587
[25202] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*019 allele,
[25203] partial cds
[25204] gi|13469853|gb|AH010587.1|SEG_AF336079S[13469853]
[25205] 742: AF336086
[25206] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*001 allele,
[25207] exon 6 and partial cds
[25208] gi|13445651|gb|AF336086.1|AF336085S2[13445651]
[25209] 743: AF336085
[25210] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*001 allele,
[25211] exons 2 through 5
[25212] gi|13445650 gb|AF336085.1|AF336085S1[13445650]
[25213] 744: AH010572
[25214] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*001 allele,
[25215] partial cds
[25216] gi|13445649|gb|AH010572.1|SEG_AF336085S[13445649]
[25217] 745: AF336084
[25218] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele,
[25219] exon 6 and partial cds
[25220] gi|13445647|gb|AF336084.1|AF336083S2[13445647]
[25221] 746: AF336083
[25222] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele,
[25223] exons 2 through 5
[25224] gi|13445646|gb|AF336083.1|AF336083S1[13445646]
[25225] 747: AH010571
[25226] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele,
[25227] partial cds
[25228] gi|13445645|gb|AH010571.1|SEG_AF336083S[13445645]
[25229] 748: AF336070
[25230] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*009 allele,
[25231] exon 6 and partial cds
[25232] gi|13430213|gb|AF336070.1|AF336069S2[13430213]
[25233] 749: AF336069
[25234] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*009 allele,
[25235] exons 2 through 5
[25236] gi|3430212|gb|AF336069.1|AF336069S1[13430212]
[25237] 750: AH010569
[25238] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*009 allele,
[25239] partial cds
[25240] gi|13430211|gb|AH010569.1|SEG_AF336069S[13430211]
[25241] 751: AF336068
[25242] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*008 allele,
[25243] exon 6
[25244] gi|13430209|gb|AF336068.1|AF336067S2[13430209]
[25245] 752: AF336067
[25246] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*008 allele,
[25247] exons 2 through 5 and partial cds
[25248] gi|13430208|gb|AF336067.1|AF336067S1[13430208]
[25249] 753: AH010568
[25250] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*008 allele,
[25251] partial cds
[25252] gi|13430207|gb|AH010568.1|SEG_AF336067S[13430207]
[25253] 754: AF336082
[25254] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*012 allele,
[25255] exon 6 and partial cds
[25256] gi|13378046|gb|AF336082.1|AF336081S2[13378046]
[25257] 755: AF336081
[25258] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*012 allele,
[25259] exons 2 through 5
[25260] gi|13378045|gb|AF336081.1|AF336081S1[13378045]
[25261] 756: AH010562
[25262] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*012 allele,
[25263] partial cds
[25264] gi|13378044|gb|AH010562.1|SEG_AF336081S[13378044]
[25265] 757: AF336078
[25266] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*018 allele,
[25267] exon 6 and partial cds
[25268] gi|13378042|gb|AF336078.1|AF336077S2[13378042]
[25269] 758: AF336077
[25270] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*018 allele,
[25271] exons 2 through 5
[25272] gi|13378041|gb|AF336077.1|AF336077S1[13378041]
[25273] 759: AH010561
[25274] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*018 allele,
[25275] partial cds
[25276] gi|13378040|gb|AH010561.1|SEG_AF336077S[13378040]
[25277] 760: AF336076
[25278] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*016 allele,
[25279] exon 6 and partial cds
[25280] gi|13378038|gb|AF336076.1|AF336075S2[13378038]
[25281] 761: AF336075
[25282] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*016 allele,
[25283] exons 2 through 5
[25284] gi|13378037|gb|AF336075.1|AF336075S1[13378037]
[25285] 762: AH010560
[25286] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*016 allele,
[25287] partial cds
[25288] gi|13378036|gb|AH010560.1|SEG_AF336075S[13378036]
[25289] 763: AF336074
[25290] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*011 allele,
[25291] exon 6 and partial cds
[25292] gi|13346205|gb|AF336074.1|AF336073S2[13346205]
[25293] 764: AF336073
[25294] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*011 allele,
[25295] exons 2 through 5
[25296] gi|13346204|gb|AF336073.1|AF336073S1[13346204]
[25297] 765: AH010546
[25298] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*011 allele,
[25299] partial cds
[25300] gi|13346203|gb|AH010546.1|SEG_AF336073S[13346203]
[25301] 766: AF336064
[25302] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele,
[25303] exon 6 and partial cds
[25304] gi|13346201|gb|AF336064.1|AF336063S2[13346201]
[25305] 767: AF336063
[25306] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele,
[25307] exons 2 through 5
[25308] gi|13346200|gb|AF336063.1|AF336063S1[13346200]
[25309] 768: AH010545
[25310] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele,
[25311] partial cds
[25312] gi|13346199|gb|AH010545.1|SEG_AF336063S[13346199]
[25313] 769: AF336072
[25314] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*010 allele,
[25315] exon 6 and partial cds
[25316] gi|13310419|gb|AF336072.1|AF336071S2[13310419]
[25317] 770: AF336071
[25318] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*010 allele,
[25319] exons 2 through 5
[25320] gi|13310418|gb|AF336071.1|AF336071S1[13310418]
[25321] 771: AH010532
[25322] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*010 allele,
[25323] partial cds
[25324] gi|13310417|gb|AH010532.1|SEG_AF336071S[13310417]
[25325] 772: AF336066
[25326] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*006 allele,
[25327] exon 6 and partial cds
[25328] gi|13274608|gb|AF336066.1|AF336065S2[13274608]
[25329] 773: AF336065
[25330] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*006 allele,
[25331] exons 2 through 5
[25332] gi|13274607|gb|AF336065.1|AF336065S1[13274607]
[25333] 774: AH010526
[25334] Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*006 allele,
[25335] partial cds
[25336] gi|13274606|gb|AH010526.1|SEG_AF336065S[13274606]
[25337] 775: NM—022059
[25338] Homo sapiens chemokine (C-X-C motif) ligand 16 (CXCL16), mRNA
[25339] gi|11545764|ref|NM—022059.1|[11545764]
[25340] 776: NM—000024
[25341] Homo sapiens adrenergic, beta-2-, receptor, surface (ADRB2), mRNA
[25342] gi|15718673|ref|NM—000024.3|[15718673]
[25343] 777: AF257472
[25344] Homo sapiens transmembrane protein MT75 mRNA, complete cds
[25345] gi|15718477|gb|AF257472.1|AF257472[15718477]
[25346] 778: AJ301609
[25347] Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene), exons 10, and 13
[25348] gi|15485589|emb|AJ301609.1|HSA301609[15485589]
[25349] 779: AJ301608
[25350] Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene), exons 11, and 14
[25351] gi|15485587|emb|AJ301608.1|HSA301608[15485587]
[25352] 780: B1713761
[25353] ie03f09.y1 HR85 islet Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence
[25354] gi|15689456|gb|BI713761.1|BI713761[15689456]
[25355] 781: B1713497
[25356] ie03f09.x1 HR85 islet Homo sapiens cDNA 3′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence
[25357] gi|15689192|gb|BI713497.1|BI713497[15689192]
[25358] 782: B1712829
[25359] ie09g03.y1 HR85 islet Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence
[25360] gi|15688524|gb|BI712829.1|BI712829[15688524]
[25361] 783: B1712748
[25362] ie08g08.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:TM21_RAT Q63584 TRANSMEMBRANE PROTEIN TMP21 PRECURSOR;, mRNA sequence
[25363] gi|15688524|gb|BI712829.1|BI712829[15688524]
[25364] 784: B1711750
[25365] id97b10.y1 Human insulinoma Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence
[25366] gi|15687445|gb|BI711750.1|BI711750[15687445]
[25367] 785: B1711468
[25368] id97b10.x1 Human insulinoma Homo sapiens cDNA 3′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence
[25369] gi|15687163|gb|BI711468.1|BI711468[15687163]
[25370] 786: B1711211
[25371] id93c12.x1 Human insulinoma Homo sapiens cDNA 3′ similar to TR:P97544 P97544 ER
[25372] TRANSMEMBRANE PROTEIN.;, mRNA sequence
[25373] gi|15686906|gb|BI711211.1|BI711211[15686906]
[25374] 787: B1710795
[25375] id92a02.y1 Human insulinoma Homo sapiens cDNA 5′ similar to SW:NMB_HUMAN Q14956
[25376] PUTATIVE TRANSMEMBRANE PROTEIN NMB PRECURSOR.;, mRNA sequence
[25377] gi|15686490|gb|BI710795.1|BI710795[15686490]
[25378] 788: BC014500
[25379] Homo sapiens, Similar to leucine zipper-EF-hand containing transmembrane protein
[25380] 1, clone MGC:23613 IMAGE:4860194, mRNA, complete cds
[25381] gi|15680274|gb|BC014500.1|BC014500[15680274]
[25382] 789: BC014443
[25383] Homo sapiens, Similar to transmembrane protein vezatin, clone IMAGE:4851150, mRNA
[25384] gi|15680188|gb|BC014443.1|BC014443[15680188]
[25385] 790: BC014339
[25386] Homo sapiens, Similar to transmembrane 4 superfamily member 1, clone MGC:23935
[25387] IMAGE:3828466, mRNA, complete cds
[25388] gi|15680043|gb|BC014339.1|BC014339[15680043]
[25389] 791: NM—032405
[25390] Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant D,
[25391] mRNA
[25392] gi|14602456|ref|NM—032405.1|[14602456]
[25393] 792: NM—032404
[25394] Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant C,
[25395] mRNA
[25396] gi|14602454|ref|NM—032404.1|[14602454]
[25397] 793: NM—032401
[25398] Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant B,
[25399] mRNA
[25400] gi|14602452|ref|NM—032401.1|[14602452]
[25401] 794: NM—024022
[25402] Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant A,
[25403] mRNA
[25404] gi|13173470|ref|NM—024022.1|[13173470]
[25405] 795: AF325418
[25406] Ovis aries cystic fibrosis transmembrane conductance regulator (CFTR) gene, intron 21
[25407] gi|15637182|gb|AF325418.1|F325416S08[15637182]
[25408] 796: AF325419
[25409] Ovis aries cystic fibrosis transmembrane conductance regulator (CFTR) gene, intron 10
[25410] gi|15637180|gb|AF325419.1|F325416S06[15637180]
[25411] 797: AH011064
[25412] Ovis aries
[25413] gi|15637174|gb|AH011064.1|SEG_F325416S[15637174]
[25414] 798: NM—022570
[25415] Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin,
[25416] superfamily member 12 (CLECSF12), mRNA
[25417] gi|13384603|ref|NM—022570.2|[13384603]
[25418] 799: AF360695
[25419] Homo sapiens keratinocyte growth factor receptor 2 (FGFR2) gene, exons 3 through
[25420] 22 and complete cds, alternatively spliced
[25421] gi|15620559|gb|AF360695.3|AF410480S2[15620559]
[25422] 800: AH010989
[25423] Homo sapiens keratinocyte growth factor receptor 2 (FGFR2) gene, complete cds,
[25424] alternatively spliced
[25425] gi|15620558|gb|AH010989.3|SEG_AF410480S[15620558]
[25426] 801: AY035377
[25427] Homo sapiens peptidoglycan recognition protein-1-beta precursor (PGLYRPIbeta) mRNA, complete cds
[25428] gi|15590685|gb|AY035377.1|[15590685]
[25429] 802: AY035376
[25430] Homo sapiens peptidoglycan recognition protein-1-alpha precursor (PGLYRPIalpha)
[25431] mRNA, complete cds
[25432] gi|15590683|gb|AY035376.1|[15590683]
[25433] 803: NM—013317
[25434] Homo sapiens lung type-I cell membrane-associated glycoprotein (T1A-2), transcript variant 1, mRNA
[25435] gi|7019416|ref|NM—013317.1|[7019416]
[25436] 804: AJ318099
[25437] Homo sapiens mRNA for putative endoplasmic reticulum multispan transmembrane protein (RFT1 gene)
[25438] gi|15558857|emb|AJ318099.1|HSA318099[15558857]
[25439] 807: NM—021808
[25440] Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), mRNA
[25441] gi|11141878|ref|NM—021808.1|[11141878]
[25442] 808: AF275150
[25443] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 20 and complete cds
[25444] gi|9652146|gb|AF275150.1|F275131S20[9652146]
[25445] 809: AF275149
[25446] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 19
[25447] gi|9652145|gb|AF275149.1|F275131S19[9652145]
[25448] 810: AF275148
[25449] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 18
[25450] gi|9652144|gb|AF275148.1|F275131S18[9652144]
[25451] 811: AF275147
[25452] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 17
[25453] gi|9652143|gb|AF275147.1|F275131S17[9652143]
[25454] 812: AF275146
[25455] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 16
[25456] gi|9652142|gb|AF275146.1|F275131S16[9652142]
[25457] 813: AF275145
[25458] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 15
[25459] gi|9652141|gb|AF275145.1|F275131S15[9652141]
[25460] 814: AF275144
[25461] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 14
[25462] gi|9652140|gb|AF275144.1|F275131S14[9652140]
[25463] 815: AF275143
[25464] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 13
[25465] gi|9652139|gb|AF275143.1|F275131S13[9652139]
[25466] 816: AF275142
[25467] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 12
[25468] gi|9652138|gb|AF275142.1|F275131S12[9652138]
[25469] 817: AF275141
[25470] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 11
[25471] gi|9652137|gb|AF275141.1|F275131S11[9652137]
[25472] 818: AF275140
[25473] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 10
[25474] gi|9652136|gb|AF275140.1|F275131S10[9652136]
[25475] 819: AF275139
[25476] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 9
[25477] gi|9652135|gb|AF275139.1|F275131S09[9652135]
[25478] 820: AF275138
[25479] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 8
[25480] gi|9652134|gb|AF275138.1|F275131S08[9652134]
[25481] 821: AF275137
[25482] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 7
[25483] gi|9652133|gb|AF275137.1|F275131S07[9652133]
[25484] 822: AF275136
[25485] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 6
[25486] gi|9652132|gb|AF275136.1|F275131S06[9652132]
[25487] 823: AF275135
[25488] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 5
[25489] gi|9652131|gb|AF275135.1|F275131S05[9652131]
[25490] 824: AF275134
[25491] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 4
[25492] gi|9652130|gb|AF275134.1F275131S04[9652130]
[25493] 825: AF275133
[25494] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 3
[25495] gi|9652129|gb|AF275133.1F275131S03[9652129]
[25496] 826: AF275132
[25497] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 2
[25498] gi|9652128|gb|AF275132.1|F275131S02[9652128]
[25499] 827: AF275131
[25500] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 1
[25501] gi|9652127|gb|AF275131.1|F275131S01[9652127]
[25502] 828: AH009676
[25503] Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, complete cds
[25504] gi|9652126|gb|AH009676.1|SEG_F275131S[9652126]
[25505] 829: NM—017417
[25506] Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8) (GALNT8), mRNA
[25507] gi|8393411|ref|NM—017417.1|[8393411]
[25508] 830: NM—033346
[25509] Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2), transcript variant 2, mRNA
[25510] gi|15451917|ref|NM—033346.1|[15451917]
[25511] 831: NM—001204
[25512] Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2), transcript variant 1, mRNA
[25513] gi|15451915|ref|NM—001204.3|[15451915]
[25514] 832: NM—003933
[25515] Homo sapiens BAI1-associated protein 3 (BAIAP3), mRNA
[25516] gi|15451913|ref|NM—003933.3|[15451913]
[25517] 833: NM—014256
[25518] Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 (B3GNT3), mRNA
[25519] gi|15451894|ref|NM—014256.2|[15451894]-834: NM—033274
[25520] Homo sapiens a disintegrin and metalloproteinase domain 19 (meltrin beta) (ADAM19), transcript variant 2, mRNA
[25521] gi|15451843|ref|NM—033274.1|[15451843]
[25522] 835: NM—023038
[25523] Homo sapiens a disintegrin and metalloproteinase domain 19 (meltrin beta) (ADAM19), transcript variant 1, mRNA
[25524] gi|15451841|ref|NM—023038.2|[15451841]
[25525] 836: NM—030765
[25526] Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4 (B3GNT4), mRNA
[25527] gi|13540526|ref|NM—030765.1|[13540526]
[25528] 837: AB048207
[25529] Homo sapiens mRNA for TIGA1, complete cds
[25530] gi|15425668|dbj|AB048207.1|AB048207[15425668]
[25531] 838: NM—006005
[25532] Homo sapiens Wolfram syndrome 1 (wolframin) (WFS1), mRNA
[25533] gi|13376995|ref|NM—006005.2|[13376995]
[25534] 839: NM—015722
[25535] Homo sapiens calcyon; D1 dopamine receptor-interacting protein (CALCYON),
[25536] gi|9257200|ref|NM—015722.2|[9257200]
[25537] 840: AY038990
[25538] Homo sapiens ER-localized type I transmembrane adaptor precursor (CAPER) mRNA,
[25539] complete cds
[25540] gi|15418959|gb|AY038990.1|[15418959]
[25541] 841: BB226825
[25542] BB226825 RIKEN full-length enriched, adult male aorta and vein Mus musculus cDNA
[25543] clone A530098L04 3′ similar to AF169676 Homo sapiens leucine-rich repeat transmembrane protein FLRT2 (FLRT2) mRNA, mRNA sequence
[25544] gi|15410201|dbj|BB226825.2|BB226825[15410201]
[25545] 843: AF059274
[25546] Homo sapiens neuroglycan C mRNA, complete cds
[25547] gi|3820499|gb|AF059274.1|AF059274[3820499]
[25548] 844: BC013152
[25549] Homo sapiens, Similar to transmembrane protein 5, clone MGC:17085 IMAGE:3919181, mRNA, complete cds
[25550] gi|15341928|gb|BC013152.1|BC013152[15341928]
[25551] 845: AH011005
[25552] Homo sapiens
[25553] gi|15341629|gb|AH011005.1|SEG_L11671S[15341629]
[25554] 846: AF406650
[25555] Homo sapiens putative gap junction protein pannexin 3 (PANX3) mRNA, complete cds
[25556] gi|1534153|gb|AF406650.1|AF406650[15341531]
[25557] 847: L11671
[25558] Homo sapiens transmembrane glycoprotein (CD53) gene, exon 1
[25559] gi|291896|gb|L11671.1|L11671S1[291896]
[25560] 848: L11670
[25561] Homo sapiens transmembrane glycoprotein (CD53) gene, exons 2 through 8
[25562] gi|180145|gb|L11670.1|L11671S2[180145]
[25563] 849: B1468287
[25564] id87a04.y1 Human insulinoma Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence
[25565] gi|15284396|gb|BI468287.1|BI468287[15284396]
[25566] 850: B1468286
[25567] id87a04.x1 Human insulinoma Homo sapiens cDNA 3′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence
[25568] gi|15284395|gb|BI468286.1|BI468286[15284395]
Claims
1. A vaccine composition comprising a virus or a cell and further comprising a fusion polypeptide, said fusion polypeptide comprising
- a first amino acid sequence which comprises a cell—surface binding moiety and
- a second amino acid sequence comprising a ligand for a cell surface polypeptide of a leukocyte,
- wherein said vaccine composition comprises said fusion polypeptide bound to said virus or said cell and further comprises some of said polypeptide which is not bound to said virus or said cell.
2. The vaccine composition of claim 1, wherein said ligand of said second amino acid sequence is chosen from the group: a ligand for a cytokine receptor, a ligand for CD40, a ligand for an adhesion molecule, a ligand for a defensin receptor, a ligand for a heat shock protein receptor, a ligand for a T cell costimulatory molecule, a ligand for a counterreceptor for a T cell costimulatory molecule, a ligand for an opsonin receptor.
3. The vaccine composition of claim 2 wherein said ligand comprises at least about five contiguous amino acids of a naturally occurring cytokine, said cytokine being chosen from the group: GM-CSF, an interleukin, a chemokine, an interferon, a TNF-alpha, a flt-3 ligand.
4. The vaccine composition of claim 2 wherein said ligand comprises at least about five contiguous amino acids of a naturally occurring CD154 molecule.
5. The vaccine composition of claim 1, wherein said comprised cell is chosen from the group: a tumor cell, a bacterial cell, a fungal cell, a cell of a parasite, a mammalian cell, an insect cell.
6. The vaccine composition of claim 5, wherein said cell is pathogenic.
7. The vaccine composition of claim 5, wherein said cell is attenuated.
8. The vaccine composition of claim 1, wherein said cell is substantially unable to divide.
9. The vaccine composition of claim 1, wherein said leukocyte is an antigen presenting cell.
10. The vaccine composition of claim 9, wherein said leukocyte is a professional antigen presenting cell.
11. The vaccine composition of claim 9, wherein said leukocyte is a dendritic cell.
Type: Application
Filed: Sep 19, 2003
Publication Date: Jul 1, 2004
Applicant: Genitrix, LLC
Inventors: Andrew H. Segal (Boston, MA), Elihu Young (Sharon, MA)
Application Number: 10666886
International Classification: A61K048/00; A61K039/00; A61K038/19;