Human potassium channel genes

Methods for isolating K+Hnov genes are provided. The K+Hnov nucleic acid compositions find use in identifying homologous or related proteins and the DNA sequences encoding such proteins; in producing compositions that modulate the expression or function of the protein; and in studying associated physiological pathways. In addition, modulation of the gene activity in vivo is used for prophylactic and therapeutic purposes, such as identification of cell type based on expression, and the like.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
BACKGROUND

Ion channels are multi-subunit, membrane bound proteins critical for maintenance of cellular homeostasis in nearly all cell types. Channels are involved in a myriad of processes including modulation of action potentials, regulation of cardiac myocyte excitability, heart rate, vascular tone, neuronal signaling, activation and proliferation of T-cells, and insulin secretion from pancreatic islet cells. In humans, ion channels comprise extended gene families with hundreds, or perhaps thousands, of both closely related and highly divergent family members. The majority of known channels regulate the passage of sodium (Na+), chloride (Cl), calcium (Ca++) and potassium (K+) ions across the cellular membrane.

Given their importance in maintaining normal cellular physiology, it is not surprising that ion channels have been shown to play a role in heritable human disease. Indeed, ion channel defects are involved in predisposition to epilepsy, cardiac arrhythmia (long QT syndrome), hypertension (Bartter's syndrome), cystic fibrosis, (defects in the CFTR chloride channel), several skeletal muscle disorders (hyperkalemic periodic paralysis, paramyotonia congenita, episodic ataxia) and congenital neural deafness (Jervel-Lange-Nielson syndrome), amongst others.

The potassium channel gene family is believed to be the largest and most diverse ion channel family. K+ channels have critical roles in multiple cell types andpathways, and are the focus of significant investigation. Four human conditions, episodic ataxia with myokymia, long QT syndrome, epilepsy and Bartter's syndrome have been shown to be caused by defective K+ ion channels. As the K+ channel family is very diverse, and given that these proteins are critical components of virtually all cells, it is likely that abnormal K+ channels will be involved in the etiology of additional renal, cardiovascular and central nervous system disorders of interest to the medical and pharmaceutical community.

The K+ channel superfamily can be broadly classified into groups, based upon the number of transmembrane domain (TMD) segments in the mature protein. The minK (IsK) gene contains a single TMD, and although not a channel by itself, minK associates with different K+ channel subunits, such as KvLQT1 and HERG to modify the activity of these channels. The inward rectifying K+ channels (GIRK, IRK, CIR, ROMK) contain 2 TMD domains and a highly conserved pore domain. Twik-1 is a member of the newly emerging 4TMD K+ channel subset. Twik-like channels (leak channels) are involved in maintaining the steady-state K+ potentials across membranes and therefore the resting potential of the cell near the equilibrium potential for potassium (Duprat et al. (1997) EMBO J 16(17):5464-5471). These proteins are particularly intriguing targets for therapeutic regulation. The 6TMD, or Shaker-like channels, presently comprise the largest subset of known K+ channels. The slopoke (slo) related channels, or Ca++ regulated channels apparently have either 10 TMD, or 6 TMD with 4 additional hydrophobic domains.

Four transmembrane domain, tandem pore domain K+ channels (4T/2P channels) represent a new family of potassium selective ion channels involved in the control of background membrane conductances. In mammals, five channels fitting the 4T/2P architecture have been described: TWIK, TREK, TASK-1, TASK-2 and TRAAK. The 4T/2P channels all have distinct characteristics, but are all thought to be involved in maintaining the steady-state K+ potentials across membranes and therefore the resting potential of the cell near the equilibrium potential for potassium (Duprat et al. (1997) EMBO J 16(17):5464-5471). These proteins are particularly intriguing targets for therapeutic regulation. Within this group, TWIK-1, TREK-1 and TASK-1 and TASK-2 are widely distributed in many different tissues, while TRAAK is present exclusively in brain, spinal cord and retina. The 4T/2P channels have different physiologic properties; TREK-1 channels, are outwardly rectifying (Fink et al. (1996) EMBO J 15(24):6854-62), while TWIK-1 channels, are inwardly rectifying (Lesage et al. (1996) EMBO J 15(5):1004-11. TASK channels are regulated by changes in PH while TRAAK channels are stimulated by arachidonic acid (Reyes et al. (1998) JBC 273(47):30863-30869).

The degree of sequence homology between different K+ channel genes is substantial. At the amino acid level, there is about 40% similarity between different human genes, with distinct regions having higher homology. specifically the pore domain. It has been estimated that the K+ channel gene family contains approximately 102-103 individual genes. Despite the large number of potential genes, an analysis of public sequence databases and the scientific literature demonstrates that only a small number, approximately 20-30, have been identified. This analysis suggests that many of these important genes remain to be identified.

Potassium channels are involved in multiple different processes and are important regulators of homeostasis in nearly all cell types. Their relevance to basic cellular physiology and role in many human diseases suggests that pharmacological agents could be designed to specific channel subtypes and these compounds then applied to a large market (Bulman, D.E. (1997) Hum Mol Genet 6:1679-1685; Ackerman, M.J. and Clapham D.E. (1997) NEJM 336:1575-1586, Curran, M.E. (1998) Current Opinion in Biotechnology 9:565-572). The variety of therapeutic agents that modulate K+ channel activity reflects the diversity of physiological roles and importance of K+ channels in cellular function. A difficulty encountered in therapeutic use of therapeutic agents that modify K+ channel activity is that the presently available compounds tend to be non-specific and elicit both positive and negative responses, thereby reducing clinical efficacy. To facilitate development of specific compounds it is desirable to have further characterize novel K+ channels for use in in vitro and in vivo assays.

Relevant Literature A large body of literature exists in the general area of potassium channels. A review of the literature may be found in the series of books, “The Ion Channel Factsbook”, volumes 1-4, by Edward C. Conley and William J. Brammar, Academic Press. An overview is provided of: extracellular ligand-gated ion channels (ISBN: 0121844501), intracellular ligand-gated channels (ISBN: 012184451X), inward rectifier and intercellular channels (ISBN: 0121844528), and voltage gated channels (ISBN: 0121844536). Hille, B. (1992) “Ionic Channels of Excitable Membranes”, 2nd Ed. Sunderland MA:Sinauer Associates, also reviews potassium channels.

Jan and Jan (1997) Annu. Rev. Neurosci. 20:91-123 review cloned potassium channels from eukaryotes and prokaryotes. Ackerman and Clapham (1997) N. Engl. J. Med. 336:1575-1586 discuss the basic science of ion channels in connection with clinical disease. Bulman (1997) Hum. Mol. Genet. 6:1679-1685 describe some phenotypic variation in ion channel disorders.

Stephan et al. (1994) i Neurology 44:1915-1920 describe a pedigree segregating a myotonia with muscular hypertrophy and hyperirritability as an autosomal dominant trait (rippling muscle disease, Ricker et al. (1989) Arch. Neurol. 46405-408). Electromyography demonstrated that mechanical stimulation provoked electrically silent contractions. The responsible gene was localized to the distal end of the long arm of chromosome 1, in a 12-cM region near D1S235.

Type II pseudohypoaldosteronism is the designation used for a syndrome of chronic mineralocorticoid-resistant hyperkalemia with hypertension. The primary abnormality in type II PHA is thought to be a specific defect of the renal secretory mechanism for potassium, which limits the kaliuretic response to, but not the sodium and chloride reabsorptive effect of, mineralocorticoid. By analysis of linkage in families with autosomal dominant transmission, Mansfield et al. (1997) Nature Genet. 16:202-205 demonstrated locus heterogeneity of the trait, with linkage of the PHA2 gene to 1q31-q42 and 17p11-q21.

Sequences of four transmembrane, two pore potassium channels have been previously described. Reyes et al. (1998) J Biol Chem 273(47):30863-30869 discloses a pH sensitive channel. As with the related TASK-1 and TRAAK channels, the outward rectification is lost at high external K+ concentration. The TRAAK channel is described by Fink et al. (1998) EMBO J 17(12):3297-308. A cardiac two-pore channel is described in Kim et al. (1998) Circ Res 82(4):513-8. An open rectifier potassium channel with two pore domains in tandem and having a postsynaptic density protein binding sequence at the C terminal was cloned by Leonoudakis et al. (1998) J Neurosci 18(3):868-77.

The electrophysiological properties of Task channels are of interest, (Duprat et al. (1997) EMBO J 16:5464-71). TASK currents are K+-selective, instantaneous and non-inactivating. They show an outward rectification when external [K+] is low, which is not observed for high [K+]out, suggesting a lack of intrinsic voltage sensitivity. The absence of activation and inactivation kinetics as well as voltage independence are characteristic of conductances referred to as leak or background conductances. TASK is very sensitive to variations of extracellular pH in a narrow physiological range, a property probably essential for its physiological function, and suggests that small pH variations may serve a communication role in the nervous system.

SUMMARY OF THE INVENTION

Isolated nucleotide compositions and sequences are provided for K+Hnov genes. The K+Hnov nucleic acid compositions find use in identifying homologous or related genes; in producing compositions that modulate the expression or function of its encoded proteins; for gene therapy; mapping functional regions of the proteins; and in studying associated physiological pathways. In addition, modulation of the gene activity in vivo is used for prophylactic and therapeutic purposes, such as treatment of potassium channel defects, identification of cell type based on expression, and the like.

DESCRIPTION OF THE SPECIFIC EMBODIMENTS

Nucleic acid compositions encoding K+Hnov polypeptides are provided. They are used in identifying homologous or related genes; in producing compositions that modulate the expression or function of the encoded proteins; for gene therapy; mapping functional regions of the proteins; and in studying associated physiological pathways. The K+Hnov gene products are members of the potassium channel gene family, and have high degrees of homology to known potassium channels. The encoded polypeptides may be alpha subunits, which form the functional channel, or accessory subunits that act to modulate the channel activity.

Characterization of K+HNov

The sequence data predict that the provided K+Hnov genes encode potassium channels. Table 1 summarizes the DNA sequences, corresponding SEQ ID NOs, chromosomal locations, and polymorphisms. The provided sequences may encode a predicted K+channel, e.g. voltage gated, inward rectifier, etc.; or a modulatory subunit.

Electrophysiologic characterization of ion channels is an important part of understanding channel function. Full length ion channel cDNAs may be combined with proper vectors to form expression constructs of each individual channel. Functional analyses of expressed channels can be performed in heterologous systems, or by expression in mammalian cell lines. For expression analyses in heterologous systems such as Xenopus oocytes, synthetic mRNA is made through in vitro transcription of each channel construct. mRNA is then injected, singly or in combination with interacting channel subunit mRNAs, into prepared oocytes and the cells allowed to express the channel for several days. Oocytes expressing the channel of interest are then analyzed by whole cell voltage clamp and patch clamp techniques.

To determine the properties of each channel when expressed in mammalian cells expression vectors specific to this type of analyses may be constructed and the resultant construct used to transform the target cells (for example human embryonic kidney (HEK) cells). Both stable and transiently expressing lines may be studied using whole cell voltage clamp and patch clamp techniques. Data obtained from EP studies includes, but is not limited to: current profiles elicited by depolarization and hyperpolarization, current-voltage (I-V) relationships, voltage dependence of activation, biophysical kinetics of channel activation, deactivation, and inactivation, reversal potential, ion selectivity, gating properties and sensitivity to channel antagonists and agonists.

Heterologous or mammalian cell lines expressing the novel channels can be used to characterize small molecules and drugs which interact with the channel. The same experiments can be used to assay for novel compounds which interact with the expressed channels.

In many cases the functional ion channel formed by K+Hnov polypeptides will be heteromultimers. Heteromultimers are known to form between different voltage gated, outward rectifying potassium channel αsubunits, generally comprising four subunits, and frequently associated with auxiliary, βsubunits. Typically such αsubunits share a six-transmembrane domain structure (S1-S6), with one highly positively charged domain (S4) and a pore region situated between S5 and S6. Examples of such subunits are K+Hnov4, K+Hnov9, and K+Hnov12. Channels are also formed by mutimerization of subunits of the two transmembrane and one pore architecture. It is predicted that two subunits of K+Hnov49 or K+Hnov59 will be required to form a functional channel.

Heteromultimers of greatest interest are those that form between subunits expressed in the same tissues, and are a combination of subunits from the same species. In addition, the formation of multimers between the subject polypeptides and subunits that form functional channels are of particular interest. The resulting channel may have decreased or increased conductance relative to a homomultimer, and may be altered in response to beta subunits or other modulatory molecules.

Known voltage gated K+ channel αsubunits include Kv1.1-1.8 (Gutman et al. (1993) Sem. Neurosci. 5:101-106); Kv2.1-2.2; Kv3.1-3.4; Kv4.1-4.3; Kv5.1; Kv6.1; Kv7.1; Kv8.1; Kv9.1-9.2. The subunits capable of forming ion inducing channels include all of those in the Kv1 through Kv4; and Kv7 families. The Kv5.1, Kv6.1, Kv8.1 and Kv9.1-9.2 subunits may be electrically silent, but functional in modifying the properties in heteromultimers.

TABLE 1 Chromosome Name cDNA SEQ Protein SEQ Polymorphisms Position Channel Type K+Hnov1 SEQ ID NO: 1 SEQ ID NO: 2 Alternative poly(A) tail: 1236, 2q37 ATP-sensitive inward rectifying 2395 K+Hnov4 SEQ ID NO: 3 SEQ ID NO: 4 A312C unknown Voltage gated K+ channel T335C A377G T344C A401G CA410-411GG (Ala/Thr) K+Hnov6 SEQ ID NO: 5 SEQ ID NO: 6 2p23 Delayed rectifying K+ channel K+Hnov9 SEQ ID NO: 7 SEQ ID NO: 8 Alternative poly(A) tail: 2304 8q23 Voltage gated K+ channel K+Hnov12 SEQ ID NO: 9 SEQ ID NO: 10 C321T (Pro/Leu) Xp21 Voltage gated K+ channel A375G (Glu/Gly) C407T (Leu/Phe) K+Hnov15 SEQ ID NO: 11 SEQ ID NO: 12 Alternative poly(A) tail: 1427 13q14 modulatory subunit A689G (Gly/Arg) K+Hnov27 SEQ ID NO: 13 SEQ ID NO: 14 T365A (Ile/Asn) 18q12 modulatory subunit K+Hnov2 SEQ ID NO: 15 SEQ ID NO: 16 N/A N/A 4 transmembrane domain, 2 pore domain K+ channel K+Hnov 11 SEQ ID NO: 17 SEQ ID NO: 18 N/A N/A Human ortholog of murine gene, 6 transmembrane dominas, voltage gated, delayed rectifier K+ channel K+Hnov 14 SEQ ID NO: 19 SEQ ID NO: 20 C3168T 12q14 6 transmembrane domain, voltage gated K+ channel K+Hnov28 SEQ ID NO: 21-24 SEQ ID NO: 25 4 alternative 5′ splices 3q29 Modulatory subunit K+Hnov42 SEQ ID NO: 26 SEQ ID NO: 27 G1162A; T1460A; T2496A 8q11 Homology to K+ channel protein of C. elegans K+Hnov44 SEQ ID NO: 28-29 SEQ ID NO: 30 N/A 22p13 beta-subunit. K+Hnov49 SEQ ID NO: 80 SEQ ID NO: 81 (ATCT)n repeats in the 3′ 1q41 4T/2P channel; linked to the UTR sequence, starting at disease loci for rippling muscle position 2186 disease 1 (RMD1), and type II pseudohypoaldosteronism K+Hnov59 SEQ ID NO: 82 SEQ ID NO: 83 N/A chr19 4T/2P channel

K+Hnov Nucleic Acid Compositions

As used herein, the term “K+Hnov” is generically used to refer to any one of the provided genetic sequences listed in Table 1. Where a specific K+Hnov sequence is intended, the numerical designation, e.g. K49 or K59, will be added. Nucleic acids encoding K+Hnov potassium channels may be cDNA or genomic DNA or a fragment thereof. The term “K+Hnov gene” shall be intended to mean the open reading frame encoding any of the provided K+Hnov polypeptides, introns, as well as adjacent 5′ and 3′ non-coding nucleotide sequences involved in the regulation of expression, up to about 20 kb beyond the coding region, but possibly further in either direction. The gene may be introduced into an appropriate vector for extrachromosomal maintenance or for integration into a host genome.

The. term “cDNA” as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons and 3′ and 5′ non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns, when present, removed by nuclear RNA splicing, to create a continuous open reading frame encoding a K+Hnov protein.

A genomic sequence of interest comprises the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It may further include the 3′ and 5′ untranslated regions found in the mature mRNA. It may further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc., including about 1 kb, but possibly more, of flanking genomic DNA at either the 5′ or 3′ end of the transcribed region. The genomic DNA may be isolated as a fragment of 100 kbp or smaller; and substantially free of flanking chromosomal sequence. The genomic DNA flanking the coding region, either 3′ or 5′ , or internal regulatory sequences as sometimes found in introns, contains sequences required for proper tissue and stage specific expression.

The sequence of the 5′ flanking region may be utilized for promoter elements, including enhancer binding sites, that provide for developmental regulation in tissues where K+Hnov genes are expressed. The tissue specific expression is useful for determining the pattern of expression, and for providing promoters that mimic the native pattern of expression. Naturally occurring polymorphisms in the promoter regions are useful for determining natural variations in expression, particularly those that may be associated with disease.

Alternatively, mutations may be introduced into the promoter regions to determine the effect of altering expression in experimentally defined systems. Methods for the identification of specific DNA motifs involved in the binding of transcriptional factors are known in the art, e.g. sequence similarity to known binding motifs, gel retardation studies, etc. For examples, see Blackwell et al. (1995) Mol Med 1: 194-205; Mortlock et al. (1996) Genome Res. 6: 327-33; and Joulin and Richard-Foy (1995) Eur J Biochem 232: 620-626.

The regulatory sequences may be used to identify cis acting sequences required for transcriptional or translational regulation of K+Hnov expression, especially in different tissues or stages of development, and to identify cis acting sequences and trans acting factors that regulate or mediate K+Hnov expression. Such transcription or translational control regions may be operably linked to a K+Hnov gene in order to promote expression of wild type or altered K+Hnov or other proteins of interest in cultured cells, or in embryonic, fetal or adult tissues, and for gene therapy.

The nucleic acid compositions of the subject invention may encode all or a part of the subject polypeptides. Double or single stranded fragments may be obtained of the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc. For the most part, DNA fragments will be of at least 15 nt, usually at least 18 nt or 25 nt, and may be at least about 50 nt. Such small DNA fragments are useful as primers for PCR, hybridization screening probes, etc. Larger DNA fragments, i.e. greater than 100 nt are useful for production of the encoded polypeptide. For use in amplification reactions, such as PCR, a pair of primers will be used. The exact composition of the primer sequences is not critical to the invention, but for most applications the primers will hybridize to the subject sequence under stringent conditions, as known in the art. It is preferable to choose a pair of primers that will generate an amplification product of at least about 50 nt, preferably at least about 100 nt. Algorithms for the selection of primer sequences are generally known, and are available in commercial software packages. Amplification primers hybridize to complementary strands of DNA, and will prime towards each other.

The K+Hnov genes are isolated and obtained in substantial purity, generally as other than an intact chromosome. Usually, the DNA will be obtained substantially free of other nucleic acid sequences that do not include a K+Hnov sequence or fragment thereof, generally being at least about 50%, usually at least about 90% pure and are typically “recombinant”, i.e. flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome.

The DNA may also be used to identify expression of the gene in a biological specimen. The manner in which one probes cells for the presence of particular nucleotide sequences, as genomic DNA or RNA, is well established in the literature and does not require elaboration here. DNA or mRNA is isolated from a cell sample. The mRNA may be amplified by RT-PCR, using reverse transcriptase to form a complementary DNA strand, followed by polymerase chain reaction amplification using primers specific for the subject DNA sequences. Altematively, the mRNA sample is separated by gel electrophoresis, transferred to a suitable support, e.g. nitrocellulose, nylon, etc., and then probed with a fragment of the subject DNA as a probe. Other techniques, such as oligonucleotide ligation assays, in situ hybridizations, and hybridization to DNA probes arrayed on a solid chip may also find use. Detection of mRNA hybridizing to the subject sequence is indicative of K+Hnov gene expression in the sample.

The sequence of a K+Hnov gene, including flanking promoter regions and coding regions, may be mutated in various ways known in the art to generate targeted changes in promoter strength, sequence of the encoded protein, etc. The DNA sequence or protein product of such a mutation will usually be substantially similar to the sequences provided herein, ie. will differ by at least one nucleotide or amino acid, respectively, and may differ by at least two but not more than about ten nucleotides or amino acids. The sequence changes may be substitutions, insertions or deletions. Deletions may further include larger changes, such as deletions of a domain or exon. Other modifications of interest include epitope tagging, e.g. with the FLAG system, HA, etc. For studies of subcellular localization, fusion proteins with green fluorescent proteins (GFP) may be used.

Techniques for in vitro mutagenesis of cloned genes are known. Examples of protocols for site specific mutagenesis may be found in Gustin et al., Biotechniques 14:22 (1993); Barany, Gene 37:111-23 (1985); Colicelli et al., Mol Gen Genet 199:537-9 (1985); and Prentki et al., Gene 29:303-13 (1984). Methods for site specific mutagenesis can be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp. 15.3-15.108; Weiner et al., Gene 126:35-41 (1993); Sayers et al., Biotechniques 13:592-6 (1992); Jones and Winistorfer, Biotechniques 12:528-30 (1992); Barton et al., Nucleic Acids Res 18:7349-55 (1990); Marotti and Tomich, Gene Anal Tech 6:67-70 (1989); and Zhu, Anal Biochem 177:120-4 (1989). Such mutated genes may be used to study structure-function relationships of K+Hnov, or to alter properties of the protein that affect its function or regulation.

Homologs and orthologs of K+Hnov genes are identified by any of a number of methods. A fragment of the provided CDNA may be used as a hybridization probe against a cDNA library from the target organism of interest, where low stringency conditions are used. The probe may be a large fragment, or one or more short degenerate primers. Nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50° C. and 6×SSC (0.9 M sodium chloride/0.09 M sodium citrate) and remain bound when subjected to washing at 55° C. in 1×SSC (0.15 M sodium chloride/0.015 M sodium citrate). Sequence identity may be determined by hybridization under stringent conditions, for example, at 50° C. or higher and 0.1×SSC (15 mM sodium chloride/01.5 mM sodium citrate). Nucleic acids having a region of substantial identity to the provided K+Hnov sequences, e.g. allelic variants, genetically altered versions of the gene, etc., bind to the provided K+Hnov sequences under stringent hybridization conditions. By using probes, particularly labeled probes of DNA sequences, one can isolate homologous or related genes. The source of homologous genes may be any species, e.g. primate species, particularly human; rodents, such as rats and mice, canines, felines, bovines, ovines, equines, yeast, nematodes, etc.

Between mammalian species, e.g. human and mouse, homologs have substantial sequence similarity, i.e. at least 75% sequence identity between nucleotide sequences, in some cases 80 or 90% sequence identity, and may be as high as 95% sequence identity between closely related species. Sequence similarity is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc. A reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared. Algorithms for sequence analysis are known in the art, such as BLAST, described in Altschul et al. (1990), J. Mol. Biol. 215:403-10. In general, variants of the invention have a sequence identity greater than at least about 65%, preferably at least about 75%, more preferably at least about 85%, and may be greater than at least about 90% or more as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular). Exemplary search parameters for use with the MPSRCH program in order to identify sequences of a desired sequence identity are as follows: gap open penalty: 12; and gap extension penalty: 1.

K+Hnov Polypeptides

The subject nucleic acid sequences may be employed for producing all or portions of K+Hnov polypeptides. For expression, an expression cassette may be employed. The expression vector will provide a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region. and a transcriptional and translational termination region. These control regions may be native to a K+Hnov gene, or may be derived from exogenous sources The peptide may be expressed in prokaryotes or eukaryotes in accordance with conventional ways, depending upon the purpose for expression. For large scale production of the protein, a unicellular organism, such as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells of a higher organism such as vertebrates, particularly mammals, e.g. COS 7 cells, may be used as the expression host cells. In some situations, it is desirable to express the K+Hnov gene in eukaryotic cells, where the K+Hnov protein will benefit from native folding and post-translational modifications. Small peptides can also be synthesized in the laboratory. Peptides that are subsets of the complete K+Hnov sequence may be used to identify and investigate parts of the protein important for function, or to raise antibodies directed against these regions.

Fragments of interest include the transmembrane and pore domains, the signal sequences, regions of interaction between subunits, etc. Such domains will usually include at least about 20 amino acids of the provided sequence, more usually at least about 50 amino acids, and may include 100 amino acids or more, up to the complete domain. Binding contacts may be comprised of non-contiguous sequences, which are brought into proximity by the tertiary structure of the protein. The sequence of such fragments may be modified through manipulation of the coding sequence, as described above. Truncations may be performed at the carboxy or amino terminus of the fragment, e.g. to determine the minimum sequence required for biological activity.

With the availability of the protein or fragments thereof in large amounts, by employing an expression host, the protein may be isolated and purified in accordance with conventional ways. A lysate may be prepared of the expression host and the lysate purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification technique. The purified protein will generally be at least about 80% pure, preferably at least about 90% pure, and may be up to and including 100% pure. Pure is intended to mean free of other proteins, as well as cellular debris.

The expressed K+Hnov polypeptides are useful for the production of antibodies, where short fragments provide for antibodies specific for the particular polypeptide, and larger fragments or the entire protein allow for the production of antibodies over the surface of the polypeptide. Antibodies may be raised to the wild-type or variant forms of K+Hnov. Antibodies may be raised to isolated peptides corresponding to specific domains, e.g. the pore domain and the transmembrane domain, or to the native protein.

Antibodies are prepared in accordance with conventional ways, where the expressed polypeptide or protein is used as an immunogen, by itself or conjugated to known immunogenic carriers, e.g. KLH, pre-S HBsAg, other viral or eukaryotic proteins, or the like. Various adjuvants may be employed, with a series of injections, as appropriate. For monoclonal antibodies, after one or more booster injections, the spleen is isolated, the lymphocytes immortalized by cell fusion, and then screened for high affinity antibody binding. The immortalized cells, i.e. hybridomas, producing the desired antibodies may then be expanded. For further description, see Monoclonal Antibodies: A Laboratory Manual, Harlow and Lane eds., Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y., 1988. If desired, the mRNA encoding the heavy and light chains may be isolated and mutagenized by cloning in E. coli, and the heavy and light chains mixed to further enhance the affinity of the antibody. Altematives to in vivo immunization as a method of raising antibodies include binding to phage “display” libraries, usually in conjunction with in vitro affinity maturation.

K+Hnov Genotyping

The subject nucleic acid and/or polypeptide compositions may be used to genotyping and other analysis for the presence of polymorphisms in the sequence, or variation in the expression of the subject genes. Genotyping may be performed to determine whether a particular polymorphisms is associated with a disease state or genetic predisposition to a disease state, particularly diseases associated with defects in excitatory properties of cells, e.g. cardiac, muscle, renal and neural cells. Disease of interest include rippling muscle disease, and type II psuedohypoaldosteronism.

Clinical disorders associated with K+ channel defects include long-QT syndrome; a congenital disorder affecting 1 in 10,000-15,000. Affected individuals have a prolonged QT interval in the electrocardiogram due to a delayed repolarization of the ventricle. Genetic linkage analyses identified two loci for long QT syndrome, LQT1, in 11p15.5 and LQT2, in 7q35-36. Positional cloning techniques identified the novel K+ channel KvLQT1 on chromosome 11 while candidate gene analysis identified causative mutations in the HERG K+ channel for LQT2.

The weaver mouse exhibits several abnormal neurological symptoms, including severe ataxia, loss of granule cell neurons in the cerebellum and dopaminergic cells in the substantia nigra, as well as seizures and male infertility. A G-protein-coupled K+ channel having a mutation in the conserved pore domain has been determined to cause the disease. The pancreatic-islet β-cell ATP-sensitive K+ channel (KATP) is composed of two subunits, the sulfonylurea receptor (SUR) and the inward rectifier K+ channel Kir6.2. Mutations in both SUR and Kir6.2 have been identified in patients with persistent hyperinsulinemic hypoglycemia of infancy, which is caused by unregulated secretion of insulin.

Genotyping may also be performed for pharmacogenetic analysis to assess the association between an individual's genotype and that individual's ability to react to a therapeutic agent. Differences in target sensitivity can lead to toxicity or therapeutic failure. Relationships between polymorphisms in channel expression or specificity can be used to optimize therapeutic dose administration.

Genetic polymorphisms are identified in the K+Hnov gene (examples are listed in table 1), e.g. the repeat variation in the 3′ UTR of K49. Nucleic acids comprising the polymorphic sequences are used to screen patients for altered reactivity and adverse side effects in response to drugs that act on K+ channels.

K+Hnov genotyping is performed by DNA or RNA sequence and/or hybridization analysis of any convenient sample from a patient, e.g. biopsy material, blood sample, scrapings from cheek, etc. A nucleic acid sample from an individual is analyzed for the presence of polymorphisms in K+Hnov, particularly those that affect the activity, responsiveness or expression of K+Hnov. Specific sequences of interest include any polymorphism that leads to changes in basal expression in one or more tissues, to changes in the modulation of K+Hnov expression, or alterations in K+Hnov specificity and/or activity.

The effect of a polymorphism in K+Hnov gene sequence on the response to a particular agent may be determined by in vitro or in vivo assays. Such assays may include monitoring during clinical trials, testing on genetically defined cell lines, etc. The response of an individual to the agent can then be predicted by determining the K+Hnov genotype with respect to the polymorphism. Where there is a differential distribution of a polymorphism by racial background, guidelines for drug administration can be generally tailored to a particular ethnic group.

Biochemical studies may be performed to determine whether a sequence polymorphism in a K+Hnov coding region or control regions is associated with disease, for example the association of K+Hnov 9 with idiopathic generalized epilepsy. Disease associated polymorphisms may include deletion or truncation of the gene, mutations that alter expression level, that affect the electrical activity of the channel, etc.

A number of methods are available for analyzing nucleic acids for the presence of a specific sequence. Where large amounts of DNA are available, genomic DNA is used directly. Alternatively, the region of interest is cloned into a suitable vector and grown in sufficient quantity for analysis. The nucleic acid may be amplified by conventional techniques, such as the polymerase chain reaction (PCR), to provide sufficient amounts for analysis. The use of the polymerase chain reaction is described in Saiki et al. (1985) Science 239:487, and a review of current techniques may be found in Sambrook et al. Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp.14.2-14.33. Amplification may be used to determine whether a polymorphism is present, by using a primer that is specific for the polymorphism. Alternatively, various methods are known in the art that utilize oligonucleotide ligation as a means of detecting polymorphisms, for examples see Riley et al. (1990) N.A.R. 18:2887-2890; and Delahunty et al. (1996) Am. J. Hum. Genet.58:1239-1246.

A detectable label may be included in an amplification reaction. Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2′,4′,7′,4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive labels, e.g. 32P, 35S, 3H; etc. The label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label. The label may be conjugated to one or both of the primers. Alternatively, the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.

The sample nucleic acid, e.g. amplified or cloned fragment, is analyzed by one of a number of methods known in the art. The nucleic acid may be sequenced by dideoxy or other methods. Hybridization with the variant sequence may also be used to determine its presence, by Southern blots, dot blots, etc. The hybridization pattern of a control and variant sequence to an array of oligonucleotide probes immobilised on a solid support, as described in U.S. Pat. No. 5,445,934, or in WO95/35505, may also be used as a means of detecting the presence of variant sequences. Single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), mismatch cleavage detection, and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility. Alternatively, where a polymorphism creates or destroys a recognition site for a restriction endonuclease (restriction fragment length polymorphism, RFLP), the sample is digested with that endonuclease, and the products size fractionated to determine whether the fragment was digested. Fractionation is performed by gel or capillary electrophoresis, particularly acrylamide or agarose gels

In one embodiment of the invention, an array of oligonucleotides are provided, where discrete positions on the array are complementary to one or more of the provided sequences, e.g. oligonucleotides of at least 12 nt, frequently 20 nt, or larger, and including the sequence flanking a polymorphic position in a K+Hnov sequence; coding sequences for different K+Hnov channels, panels of ion channels comprising one or more of the provided K+ channels; etc. Such an array may comprise a series of oligonucleotides, each of which can specifically hybridize to a different polymorphism. For examples of arrays, see Hacia et al. (1996) Nature Genetics 14:441-447; Lockhart et al. (1996) Nature Biotechnol. 14:1675-1680; and De Risi etal. (1996) Nature Genetics 14:457-460.

Screening for polymorphisms in K+Hnov may be based on the functional or antigenic characteristics of the protein. Protein truncation assays are useful in detecting deletions that may affect the biological activity of the protein. Various immunoassays designed to detect polymorphisms in K+Hnov proteins may be used in screening. Where many diverse genetic mutations lead to a particular disease phenotype, functional protein assays have proven to be effective screening tools. The activity of the encoded K+Hnov protein as a potassium channel may be determined by comparison with the wild-type protein.

Antibodies specific for a K+Hnov may be used in staining or in immunoassays. Samples, as used herein, include biological fluids such as semen, blood, cerebrospinal fluid, tears, saliva, lymph, dialysis fluid and the like; organ or tissue culture derived fluids; and fluids extracted from physiological tissues. Also included in the term are derivatives and fractions of such fluids. The cells may be dissociated, in the case of solid tissues, or tissue sections may be analyzed. Alternatively a lysate of the cells may be prepared.

Diagnosis may be performed by a number of methods to determine the absence or presence or altered amounts of normal or abnormal K+Hnov polypeptides in patient cells. For example, detection may utilize staining of cells or histological sections, performed in accordance with conventional methods. The antibodies of interest are added to the cell sample, and incubated for a period of time sufficient to allow binding to the epitope, usually at least about 10 minutes. The antibody may be labeled with radioisotopes, enzymes, fluorescers, chemiluminescers, or other labels for direct detection. Alternatively, a second stage antibody or reagent is used to amplify the signal. Such reagents are well known in the art. For example, the primary antibody may be conjugated to biotin, with horseradish peroxidase-conjugated avidin added as a second stage reagent. Alternatively, the secondary antibody conjugated to a flourescent compound, e.g. flourescein, rhodamine, Texas red, etc. Final detection uses a substrate that undergoes a color change in the presence of the peroxidase. The absence or presence of antibody binding may be determined by various methods, including flow cytometry of dissociated cells, microscopy, radiography, scintillation counting, etc.

Modulation of Gene Expression

The K+Hnov genes, gene fragments, or the encoded protein or protein fragments are useful in gene therapy to treat disorders associated with K+Hnov defects. Expression vectors may be used to introduce the K+Hnov gene into a cell. Such vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences. Transcription cassettes may be prepared comprising a transcription initiation region, the target gene or fragment thereof, and a transcriptional termination region. The transcription cassettes may be introduced into a variety of vectors, e.g. plasmid; retrovirus, e.g. lentivirus; adenovirus; and the like, where the vectors are able to transiently or stably be maintained in the cells, usually for a period of at least about one day, more usually for a period of at least about several days to several weeks.

The gene or K+Hnov protein may be introduced into tissues or host cells by any number of routes, including viral infection, microinjection, or fusion of vesicles. Jet injection may also be used for intramuscular administration, as described by Furth et al. (1992) Anal Biochem 205:365-368. The DNA may be coated onto gold microparticles, and delivered intradermally by a particle bombardment device, or “gene gun” as described in the literature (see, for example, Tang et al. (1992) Nature 356:152-154), where gold microprojectiles are coated with the K+Hnov or DNA, then bombarded into skin cells.

Antisense molecules can be used to down-regulate expression of K+Hnov in cells. The anti-sense reagent may be antisense oligonucleotides (ODN), particularly synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such anti-sense molecules as RNA. The antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products. Antisense molecules inhibit gene expression through various mechanisms, e.g. by reducing the amount of mRNA available for translation, through activation of RNAse H, or steric hindrance. One or a combination of antisense molecules may be administered, where a combination may comprise multiple different sequences.

Antisense molecules may be produced by expression of all or a part of the target gene sequence in an appropriate vector, where the transcriptional initiation is oriented such that an antisense strand is produced as an RNA molecule. Alternatively, the antisense molecule is a synthetic oligonucleotide. Antisense oligonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides in length, and not more than about 500, usually not more than about 50, more usually not more than about 35 nucleotides in length, where the length is governed by efficiency of inhibition, specificity, including absence of cross-reactivity, and the like. It has been found that short oligonucleotides, of from 7 to 8 bases in length, can be strong and selective inhibitors of gene expression (see Wagner et al. (1996) Nature Biotechnology 14:840-844).

A specific region or regions of the endogenous sense strand mRNA sequence is chosen to be complemented by the antisense sequence. Selection of a specific sequence for the oligonucleotide may use an empirical method, where several candidate sequences are assayed for inhibition of expression of the target gene in an in vitro or animal model. A combination of sequences may also be used, where several regions of the mRNA sequence are selected for antisense complementation.

Antisense oligonucleotides may be chemically synthesized by methods known in the art (see Wagner et al. (1993) supra. and Milligan et al., supra.) Preferred oligonucleotides are chemically modified from the native phosphodiester structure, in order to increase their intracellular stability and binding affinity. A number of such modifications have been described in the literature, which alter the chemistry of the backbone, sugars or heterocyclic bases.

Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates. Achiral phosphate derivatives include 3′-O′-5′-S-phosphorothioate, 3′-S-5′-O-phosphorothioate, 3′-CH2-5′-O-phosphonate and 3′-NH-5′-O-phosphoroamidate. Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage. Sugar modifications are also used to enhance stability and affinity. The α-anomer of deoxyribose may be used, where the base is inverted with respect to the natural β-anomer. The 2′-OH of the ribose sugar may be altered to form 2′-O-methyl or 2′-O-allyl sugars, which provides resistance to degradation without comprising affinity. Modification of the heterocyclic bases must maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2′-deoxycytidine and 5-bromo-2′-deoxycytidine for deoxycytidine. 5- propynyl-2′-deoxyuridine and 5-propynyl-2′-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.

As an alternative to anti-sense inhibitors, catalytic nucleic acid compounds, e.g. ribozymes, anti-sense conjugates, etc. may be used to inhibit gene expression. Ribozymes may be synthesized in vitro and administered to the patient, or may be encoded on an expression vector, from which the ribozyme is synthesized in the targeted cell (for example, see International patent application WO 9523225. and Beigelman et al. (1995) Nucl. Acids Res 23:4434-42). Examples of oligonucleotides with catalytic activity are described in WO 9506764. Conjugates of anti-sense ODN with a metal complex, e.g. terpyridylCu(II), capable of mediating mRNA hydrolysis are described in Bashkin et al. (1995) Appl Biochem Biotechnol 54:43-56.

Genetically Altered Cell or Animal Models for K+Hnov Function

The subject nucleic acids can be used to generate transgenic animals or site specific gene modifications in cell lines. Transgenic animals may be made through homologous recombination, where the normal K+Hnov locus is altered. Alternatively, a nucleic acid construct is randomly integrated into the genome. Vectors for stable integration include plasmids, retroviruses and other animal viruses, YACs, and the like.

The modified cells or animals are useful in the study of K+Hnov function and regulation. For example, a series of small deletions and/or substitutions may be made in the K+Hnov gene to determine the role of different transmembrane domains in forming multimeric structures, ion channels, etc. Of interest are the use of K+Hnov to construct transgenic animal models for epilepsy and other neurological defects, where expression of K+Hnov is specifically reduced or absent; Specific constructs of interest include anti-sense K+Hnov, which will block K+Hnov expression, expression of dominant negative K+Hnov mutations, etc. One may also provide for expression of the K+Hnov gene or variants thereof in cells or tissues where it is not normally expressed or at abnormal times of development.

DNA constructs for homologous recombination will comprise at least a portion of the K+Hnov gene with the desired genetic modification, and will include regions of homology to the target locus. DNA constructs for random integration need not include regions of homology to mediate recombination. Conveniently, markers for positive and negative selection are included. Methods for generating cells having targeted gene modifications through homologous recombination are known in the art. For various techniques for transfecting mammalian cells, see Keown et al. (1990) Methods in Enzymology 185:527-537.

For embryonic stem (ES) cells, an ES cell line may be employed, or embryonic cells may be obtained freshly from a host, e.g. mouse, rat, guinea pig, etc. Such cells are grown on an appropriate fibroblast-feeder layer or grown in the presence of leukemia inhibiting factor (LIF). When ES or embryonic cells have been transformed, they may be used to produce transgenic animals. After transformation, the cells are plated onto a feeder layer in an appropriate medium. Cells containing the construct may be detected by employing a selective medium. After sufficient time for colonies to grow, they are picked and analyzed for the occurrence of homologous recombination or integration of the construct. Those colonies that are positive may then be used for embryo manipulation and blastocyst injection. Blastocysts are obtained from 4 to 6 week old superovulated females. The ES cells are trypsinized, and the modified cells are injected into the blastocoel of the blastocyst. After injection, the blastocysts are returned to each uterine horn of pseudopregnant females. Females are then allowed to go to term and the resulting offspring screened for the construct. By providing for a different phenotype of the blastocyst and the genetically modified cells, chimeric progeny can be readily detected.

The chimeric animals are screened for the presence of the modified gene and males and females having the modification are mated to produce homozygous progeny. If the gene alterations cause lethality at some point in development, tissues or organs can be maintained as allogeneic or congenic grafts or transplants, or in in vitro culture. The transgenic animals may be any non-human mammal, such as laboratory animals, domestic animals, etc. The transgenic animals may be used in functional studies, drug screening, etc., e.g. to determine the effect of a candidate drug on Ras or related gene activation, oncogenesis, etc.

Testing of K+Hnov Function and Responses

Potassium channels such as K+Hnov polypeptides are involved in multiple biologically important processes. Pharmacological agents designed to affect only specific channel subtypes are of particular interest. Presently available compounds tend to be non-specific and elicit both positive and negative responses, thereby reducing clinical efficacy.

The subject polypeptides may be used in in vitro and in vivo models to test the specificity of novel compounds, and of analogs and derivatives of compounds known to act on potassium channels. Numerous pharmacological agents have profound affects on K+ channel activity. As examples, Sotalol (BETAPACE) is a class III antiarrhythmic drug that prolongs cardiac action potentials by inhibiting delayed rectifier K+ channels. Sulfonylurea drugs, such as Glipizide (GLUCOTROL) and Tolazamide (TOLAMIDE) function as antidiabetic drugs by blocking ATP-sensitive K+ channels present in pancreatic islet cells, thereby regulating insulin secretion. Diazoxide (HYPERSTAT IV) is an antihypertensive drug that activates ATP-sensitive K+ channels, resulting in the relaxation of vascular smooth muscle. There are several other examples of drugs that have antidiabetic, antihypertensive, or antiarrhythmic activities. A number of drugs that activate K+ channels that have been proposed as coronary vasodilators for the treatment of both vasospastic and chronic stable angina.

The availability of multiple K+ channel subunits allows in vitro reconstruction of functional channels, which may comprise different alpha and beta subunits. The individual components may be modified by sequence deletion, substitution, etc. to determine the functional role of specific domains.

Drug screening may be performed using an in vitro model, a genetically altered cell or animal, or purified K+Hnov protein, either as monomers, homomultimers or hetermultimers. One can identify ligands or substrates that bind to, modulate or mimic the action of K+Hnov. Drug screening identifies agents that provide a replacement for K+Hnov function in abnormal cells. Of particular interest are screening assays for agents that have a low toxicity for human cells. A wide variety of assays may be used for this purpose, including monitoring cellular excitation and conductance, labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, and the like. The purified protein may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions.

The term “agent” as used herein describes any molecule, e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of K+Hnov polypeptide. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.

Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons. Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.

Where the screening assay is a binding assay, one or more of the molecules may be joined to a label, where the label can directly or indirectly provide a detectable signal. Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like. Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc. For the specific binding members, the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.

A variety of other reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.

The compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host in a variety of ways, orally, topically, parenterally e.g. subcutaneously, intraperitoneally, by viral infection, intravascularly, etc. Depending upon the manner of introduction, the compounds may be formulated in a variety of ways. The concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt. %. The pharmaceutical compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like. Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds. Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.

It is to be understood that this invention is not limited to the particular methodology, protocols, cell lines, animal species or genera, and reagents described, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

As used herein the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” includes a plurality of such cells and reference to “the cell” includes reference to one or more cells and equivalents thereof known to those skilled in the art, and so forth. All technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs unless clearly indicated otherwise.

It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a complex” includes a plurality of such complexes and reference to “the formulation” includes reference to one or more formulations and equivalents thereof known to those skilled in the art, and so forth.

All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing, for example, the methods and methodologies that are described in the publications which might be used in connection with the presently described invention. The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention.

Experimental

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the subject invention, and are not intended to limit the scope of what is regarded as the invention. Efforts have been made to ensure accuracy with respect to the numbers used (e.g. amounts, temperature, concentrations, etc.) but some experimental errors and deviations should be allowed for. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight, temperature is in degrees centigrade; and pressure is at or near atmospheric.

Methods Two different types of sequence searches were performed. The first centered on the most highly conserved region of the K+ channel family, the pore domain. The pore is composed of 15-17 amino acids and can be divided into subfamilies based on the number of transmembrane segments present in the channel. Eleven variant peptide sequences corresponding to the pore domain were used in TBLASTN searches against the EST division of Genbank. Significant matches were identified, and classified into 2 categories: identical to known human K+ channels and related to known K+ channels. The pore sequences are shown in Table 2.

TABLE 2 SEQ ID NO Genbank # 49 L02751 TGGTGGGCTGTGGTGACCATGACAACTGTGGGCTATGGGGACATG 50 M60451 TGGTGGGCAGTGGTCACCATGACCACTGTGGGCTACGGGGACATG 51 L02752 TGGTGGGCAGTCGTCTCCATGACAACTGTAGGCTATGGAGACATG 52 M55515 TGGTGGGCAGTGGTAACCATGACAACAGTGGGTTACGGCGATATG 53 Z11585 TGGTGGGCTGTGGTCACCATGACGACCCTGGGCTATGGAGACATG 54 U40990 TGGTGGGGGGTGGTCACAGTCACCACCATCGGCTATGGGGACAAG 55 I26643 TGGTGGGCAGTGGTCACCATGACCACGGTTGGCTATGGGGACATG 56 M96747 TGGTGGGCCGTGGTCACCATGACGACCCTGGGCTATGGAGACATG 57 M64676 TGGTGGGCTGTGGTCACCATGACGACACTGGGCTACGGAGACATG 58 M55514 TGGTGGGCTGTGGTGACCATGACAACTGTGGGCTATGGGGACATG 59 X83582 TTCCTGTTCTCCATTGAGACCGAAACAACCATTGGGTATGGCTTCCG 60 S78684 TTTTTATTCTCAATAGAGACAGAAACCACCATTGGTTATGGCTACCG 61 U22413 TTCCTCTTCTCCATTGAGACCCAGACAACCATAGGCTATGGTTTCAG 62 U24056 TTCCTGTTCTCGGTGGAGACGCAGACGACCATCGGCTATGGGTTCCG 63 U52155 TTCCTCTTCTCCCTTGAATCCCAAACCACCATTGGCTATGGCTTCCG 64 D87291 TTTCTCTTTTCCCTGGAATCCCAGACAACCATTGGCTATGGAGTCCG 65 D50582 TTCCTTTTCTCCATTGAGGTCCAAGTGACTATTGGCTTTGGGGGGCG 66 D50315 TTTCTCTTCTCCATTGAAGTTCAAGTTACCATTGGGTTTGGAGGGAG 67 U04270 GCGCTCTACTTCACCTTCAGCAGCCTCACCAGTGTGGGCTTCGGCAAC

The unique pore peptides sequences are shown in Table 3

TABLE 3 SEQ ID NO Amino acid sequence 68 WWAVVSMTTVGYGDM 69 WWAVVTMTTLGYGDM 70 WWGVVTVTTIGYGDK 71 WWAVVTMTTVGYGDM 72 FLFSIEVQVTIGFGG 73 FLFSLESQTTIGYGV 74 FLFSIETETTIGYGY 75 FLFSIETQTTIGYGF 76 FLFSVETQTTIGYGF 77 FLFSLESQTTIGYGF 78 FLFSIETETTIGYGF 79 ALYFTFSSLTSVGFGN

The second set of experiments was based on a complex, reiterative process. Annotated protein and DNA sequences were obtained from GenBank for all known K+ channels from all species. The TBLASTN and BLASTN programs were used to identify homologous ESTs, which were then analyzed using the BLASTX and BLASTN algorithms to identify ESTs which were related to K+ channels yet not identical to any known human K+ channel gene.

Novel human K+ channels were defined as those that had clear homology to known K+ channels from any species and were not present as identities or near identities to any human-derived sequences in any division of Genbank.

Isolation of full length cDNA sequence. EST clones were picked from the IMAGE consortium cDNA library and end-sequenced with vector primers. Gap closure was achieved either by primer walking or transposon sequencing. GeneTrapper (Life Technologies) was used to isolate larger cDNA clones according to the provided protocol. RACE was used to extend the sequences as necessary using standard protocols

Sequences were assembled in Sequencher (Gene Codes). The presence of open reading frames was assessed as well as potential start codons. Potential polymorphisms were detected as sequence variants between multiple independent clones. Sequence homologies were detected using the BLAST algorithms.

The completed gene sequences and predicted amino acid sequences are provided as SEQ ID NO:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21-24, 26 and 28-29. Polymorphisms, chromosome locations and family assignments are shown in Table 1.

ESTs that had top human hits with >95% identity over 100 amino acids were discarded. This was based upon the inventors'experience that these sequences were usually identical to the starting probe sequences, with the differences due to sequence error. The remaining BLASTN and BLASTX outputs for each EST were examined manually, i.e., ESTs were removed from the analysis if the inventors determined that the variation from the known related probe sequence was a result of poor database sequence. Poor database sequence was usually identified as a number of ‘N’nucleotides in the database sequence for a BLASTN search and as a base deletion or insertion in the database sequence, resulting in a peptide frameshift, for a BLASTX output. ESTs for which the highest scoring match was to non-related sequences were also discarded at this stage. The EST sequences that correspond to each clone are shown in Table 4.

TABLE 4 Genbank IMAGE Plate Accession# K+Hnov clone ID Trace Coordinates Read 5′/3′ N39619 K+Hnov2 277113 yy51h05.s1 611p10 3′ N46767 K+Hnov2 277113 yy51h05.r1 611p10 5′ R19352 K+Hnov11 33144 yg24f12.r1 155o24 5′ R44628 K+Hnov11 33144 yg24f12.s1 155o24 3′ R35526 K+Hnov14 37299 yg64e08.r1 165o15 5′ R73353 K+Hnov14 157854 yl10e04.r1 251g07 5′ AA397616 K+Hnov14 728558 zt79c08.r1 1787j15 5′ AA286692 K+Hnov28 700757 zs48h03.r1 1715d6 5′ AA150494 K+Hnov42 491748 zl08e07.s1 1170o13 3′ AA156697 K+Hnov42 491748 zl08e07.r1 1170o13 5′ AA191752 K+Hnov42 626699 zp82d06.r1 1522f12 5′ AA216446 K+Hnov42 626699 zp82d06.s1 1522f12 3′ AA430591 K+Hnov42 773611 zw51f10.r1 1904o20 5′ AA236930 K+Hnov44 683888 zs01a05.s1 1671e9 3′ AA236968 K+Hnov44 683888 zs01a05.r1 1671e9 5′

Example 2 Chromosomal Localization

Two primers were designed in the 3′-untranslated regions of each gene sequence to amplify a product across the Stanford G3 radiation hybrid map, or the Whitehead GB4 panel. The PCR data were submitted for automatic two-point analysis. Mapping data were correlated with cytoband information and comparisons with the OMIM human gene map data base were made. The following primers were made:

K + Hnov1 on GB4 (SEQ ID NO:31) F: 5′ TATCCACATCAATGGACAAAGC 3′ (SEQ ID NO:32) R: 5′ TGCATAACTGGCTGGGTGTA 3′ Results: 1.71 cR from D2S331, Cytogenetic location of 2q37 K + Hnov2 on G3 F: 5′ GTCAGGTGACCGAGTTCA 3′ R: 5′ GCTCCATCTCCAGATTCTTC 3′ Results: 0.0 cR from SHGC-1320, Cytogenetic location of 11q12 K + Hnov6 on GB4 (SEQ ID NO:33) F: 5′ TGACATCACTGGATGAACTTGA 3′ (SEQ ID NO:34) R: 5′ TGCCTGCAAAGTTTGAACAT 3′ Results: 5.23 cR from WI-5509, Cytogenetic location of 2p23 K + Hnov9 on GB4 (SEQ ID NO:35) F: 5′ TGACATCACTGGATGAACTTGA 3′ (SEQ ID NO:36) R: 5′ TGCCTGCAAAGTTTGAACAT 3′ Results 1 21 cR from AFM200VC7, Cytogenetic location of 8q23 K + Hnov11 on GB4 (SEQ ID NO 37) F: 5′ ACCTGGTGGTATGGAAGCAT 3′ (SEQ ID NO 38) R: 5′ TTTCTCCTGGCCTCTACCC 3′ Results: 2.43 cR from WI-6756, Cytogenetic location of 8q23 K + Hnov12 on G3 (SEQ ID NO:39) F: 5′ TCCCTCTTGGGTGACCTTC 3′ (SEQ ID NO:40) R: 5′ ATCTTTGTCAGCCACCAGCT 3′ Results: 7.45 cR from SHGC-32925, Cytogenetic location of Xp21 K + Hnov14 on GB4 (SEQ ID NO:41) F: 5′ AGGTGTGCTGCCATCTGCTGTTCG3′ (SEQ ID NO:42) R: 5′ AGCCTATCCTCTCTGAGAGTCAGG Results: 7.69 cR from WI-7107, Cytogenetic location of 12q14 K + Hnov28 on GB4 (SEQ ID NO:43) F: 5′ AAGCAGAGTACTCATGATGCC 3′ (SEQ ID NO:44) R: 5′ TCTGGTAGACAGTACAGTGG 3′ Results: 35.38 cR from WI-9695, Cytogenetic location of 3q29 K + Hnov42 on G3 (SEQ ID NO:45) F: 5′ CATTTGGCTGGTCCAAGATG 3′ (SEQ ID NO:46) R: 5′ AGTCATTGGTAGGGAGGTAC 3′ Results: 7.45 cR from SHGC-32925, Cytogenetic location of Xp21 K + Hnov44 on G3 (SEQ ID NO:47) F: 5′ CATGCTTCTACAGTCCAGCC 3′ (SEQ ID NO:48) R: 5′ GGTCCTCAGTTGCAGAAATC 3′ Results: 7.45 cR from SHGC-32925, Cytogenetic location of Xp21

Map positions for K+Hnov15 and K+Hnov27 were obtained for public databases. K+Hnov2 and K+Hnov4 have not been mapped.

Example 3 Expression Analysis

RT-PCR was utilized to characterize the expression pattern of the novel ion channels. This approach used RNA from 30 different tissues to generate first strand cDNA. Total RNA was purchased (Clontech, Invitrogen) and used to synthesize first strand cDNA using M-MLV reverse transcriptase and the supplied buffer (Gibco-BRL). The 20 μl reaction contained 5 μg total RNA, 100 ng of random primers, 10 mM DTT. 0.5 mM each dNTP, and an RNAse inhibitor (Gibco-BRL). Identical reactions were set up without reverse transcriptase to control for DNA contamination in the RNA samples. The synthesis reaction proceeded for 1 hour at 37° C. followed by 10 minutes at 95° C. These cDNAs, along with control cDNA synthesis reactions without reverse transcriptase, were diluted 1:5 and 2 μl of each sample were arrayed into 96-well trays, dried, and resuspended in PCR buffer prior to PCR amplification. The cDNAs were tested with primers with defined expression patterns to verify the presence of amplifiable cDNA from each tissue. Gene-specific primers were used to amplify the cDNAs in 20 μl PCR reactions with standard conditions, 2.5 mM MgCl2, Taq Gold, and an appropriate annealing temperature.

This approach provides for relatively high-throughput analysis of gene expression in a large set of tissues in a cost-efficient manner and provides qualitative analysis of gene expression only. Modifications can be employed, such as the use of internal control primers, limited cycling parameters, and dilution series to convert this to a quantitative experiment.

TABLE 3 Anchor name Adipose Adrenal Gland Bladder Brain Cerebellum Cervix Colon Esophagus Fetal Brain K+Hnov1 + + + + + + + + K+Hnov2 + + + + + + + K+Hnov4 + + + + K+Hnov6 + + + + + + + K+Hnov9 + + + K+Hnov11 + + + + K+Hnov12 + + + + K+Hnov14 + + + + + + + K+Hnov15 + + + + + + K+Hnov27 + + + + + + + + + K+Hnov28 + + + + + + + K+Hnov42 K+Hnov44 + + + + + + + + + Mammary Anchor name Fetal Liver Heart HeLa Cell Kidney Liver Lung Gland Pancreas Placenta Prostate K+Hnov1 + + + + + + + + + + K+Hnov2 + + + + + + + + + K+Hnov4 + + K+Hnov6 + + + + + + + + K+Hnov9 + + K+Hnov11 + + + + + + + + + + K+Hnov12 + K+Hnov14 + + + + + + + + + K+Hnov15 + + + + + + + + + + K+Hnov27 + + + + + + + + + + K+Hnov28 + + + + + + + + + + K+Hnov42 K+Hnov44 + + + + + + + + + + Salivary Skeletal Small Anchor name Rectum Gland Muscle Skin Intestine Spleen Stomach Testis Thymus Trachea Uterus K+Hnov1 + + + + + + + + + K+Hnov2 + + + + + + + K+Hnov4 + + + K+Hnov6 + + + + + + + + + + + K+Hnov9 + + + + + K+Hnov11 + + + + + K+Hnov12 + + K+Hnov14 + + + + + + + + + K+Hnov15 + + + + + + + + + K+Hnov27 + + + + + + + + + + + K+Hnov28 + + + + + + + + + K+Hnov42 K+Hnov44 + + + + + + + + + +
A “+” indicates expression in the tissue,

a “−” indicates no expression, and

blank square indicates no data for that sample.

K + Hnov49 on Whitehead GB4 RH mapping panel: Primer 1 (SEQ ID NO:5): 5′-CATAGCCATAGGTGAGGACT-3′ Primer 2: (SEQ ID N:6) 5′-GAGAGGAAAACAGTCTGGGC-3′ Results: Cytogenetic location 1q41, 4.6cR from framework marker D1S217 K + Hnov59 on Whitehead GB4 RH mapping panel Primer 1 (SEQ ID NO:7): 5′-GGACATCGAACTAAGACCTG-3′ Primer 2 (SEQ ID NO:8): 5′-TCCCATGCCATTCAGATCTG-3′ Results: Cytogenetic location 19q13.2, 8.34cr from framework marker D19S425

Expression Anaylsis of K+Hnov49

A probe was created from a fragment corresponding to nucleotides 50 to 1284 of SEQ ID NO:83 (K+Hnov49) and purified DNA fragment was labeled with [32P]dCTP (Amersham) by the random primer method. Adult human Multiple Tissue Northern (MTM™) Blots (Clontech) were hybridized with the [32P]-labeled fragment in ExpressHyb™ 964 solution (Clontech) for four hours, washed to a final stringency of 0.1×SSC, 0.1% SDS at 65° C. and subjected to autoradiography for 24 hours.

Analysis revealed that K+Hnov49 is expressed as an approximately 4.2 kb mRNA. Expression levels of K+Hnov49 are high in brain and liver and low in kidney tissues. No mRNA was detectable on these Northern blots for heart, skeletal muscle, colon, thymus, spleen, small intestine, placenta, lung or peripheral blood leukocytes indicating either a very low level of expression or that it is not expressed in these tissues. Expression analysis was also carried out by RT-PCR across an extended series of tissues. The results of these analyses are shown in Table 4. Primer pairs used for amplification of K+Hnov49 and 59 are the same as those used for RH mapping as indicated above.

TABLE 4 Adrenal Fetal Fetal Adipose Gland Bladder Brain Cerebellum Cervix Colon Esophagus Brain Liver Heart #49 + + + + + + + + + #59 + + + + HeLa Mammary Salivary Skeletal Cell Kidney Liver Lung Gland Pancreas Placenta Prostate Rectum Galnd Muscle #49 + + + + + + + #59 + + + + + + + Small Skin Intestine Spleen Stomach Testis Thymus Trachea Uterus #49 + + + + #59 + + + + + + +

Claims

1-14. (canceled)

15. An isolated nucleic acid encoding a polypeptide comprising a subunit of a potassium channel, the nucleic acid comprising a nucleotide sequence of SEQ ID NO:9.

16. The isolated nucleic acid of claim 15, wherein the nucleic acid encodes a polypeptide comprising an alpha subunit of a homomeric potassium channel.

17. An expression vector encoding the nucleic acid of claim 15.

18. A host cell transfected with the expression vector of claim 17.

19. An isolated nucleic acid encoding a polypeptide comprising a subunit of a potassium channel, the nucleic acid hybridizing under stringent conditions, wherein the hybridization reaction is incubated at 50° C. or above in a solution comprising 0.1× SSC and washed at 55° C. in a solution comprising 1× SSC, to the complement of a nucleotide sequence of SEQ ID NO:9.

20. An isolated nucleic acid encoding a polypeptide comprising a subunit of a potassium channel, the polypeptide comprising an amino acid sequence of SEQ ID NO:10.

Patent History
Publication number: 20050112663
Type: Application
Filed: Oct 29, 2004
Publication Date: May 26, 2005
Applicant: Icagen, Inc. (Durham, NC)
Inventors: Andrew Miller (San Mateo, CA), Ping Hu (Bethesda, MD), Mark Curran (Raleigh, NC), Marc Rutter (San Diego, CA), Jian-Yang Wang (San Diego, CA)
Application Number: 10/976,647
Classifications
Current U.S. Class: 435/6.000; 435/69.100; 435/199.000; 435/320.100; 435/325.000; 536/23.200