Truncation SELEX method
This invention is directed to a method for identifying nucleic acid ligands by the SELEX method wherein the participation of fixed sequences is eliminated or minimized.
Latest Patents:
- LASER-GUIDANCE ROBOT FOR VISUALLY PROJECTING A GUIDE TO A SURGERY PLAN, PROJECTION METHOD, AND LASER-GUIDANCE ROBOT SYSTEM
- COMBINED FACE SCANNING AND INTRAORAL SCANNING
- ELASTIC ORTHODONTIC APPLIANCES, SYSTEMS, AND METHODS FOR USE
- PERIODONTAL LIGAMENT REGENERATIVE MATERIAL
- L-SHAPED DENTAL POST FOR ROOT CANAL TREATMENT
This application is a continuation of U.S. patent application Ser. No. 09/907,111, filed Jul. 17, 2001, now U.S. Pat. No. 6,855.496, which is a continuation of U.S. patent application Ser. No. 09/275,850, filed Mar. 24, 1999, now U.S. Pat. No. 6,261,774, which is a continuation-in-part of U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, now U.S. Pat. No. 5,475,096, which is a continuation-in-part of U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, now abandoned.
FIELD OF THE INVENTIONThe present invention is directed to methods for identifying oligonucleotide sequences which specifically bind to target molecules. More particularly, this invention is directed to methods for identifying oligonucleotide sequences in which the participation of fixed sequences is eliminated or minimized.
BACKGROUND OF THE INVENTIONThe dogma for many years was that nucleic acids had primarily an informational role. Through a method known as Systematic Evolution of Ligands by Exponential enrichment, termed SELEX, it has become clear that nucleic acids have three dimensional structural diversity not unlike proteins. SELEX is a method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules and is described in U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled “Systematic Evolution of Ligands by Exponential Enrichment,” now abandoned, U.S. patent application Serial No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands.” now U.S. Pat. No. 5,475,096 and U.S. patent application Ser. No. 07/93 1,473, filed Aug. 17, 1992, entitled “Methods for Identifying Nucleic Acid Ligands,” now U.S. Pat. No. 5,270,163 (see also WO 91/19813), each of which is specifically incorporated by reference herein. Each of these applications, collectively referred to herein as the SELEX Patent Applications, describes a fundamentally novel method for making a Nucleic Acid Ligand to any desired target molecule. The SELEX process provides a class of products which are referred to as Nucleic Acid Ligands, each ligand having a unique sequence, and which has the property of binding specifically to a desired target compound or molecule. Each SELEX-identified Nucleic Acid Ligand is a specific ligand of a given target compound or molecule. SELEX is based on the unique insight that Nucleic Acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets.
The SELEX method involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of Nucleic Acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound Nucleic Acids from those Nucleic Acids which have bound specifically to target molecules, dissociating the Nucleic Acid-target complexes, amplifying the Nucleic Acids dissociated from the Nucleic Acid-target complexes to yield a ligand-enriched mixture of Nucleic Acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific high affinity Nucleic Acid Ligands to the target molecule.
It has been recognized by the present inventors that the SELEX method demonstrates that Nucleic Acids as chemical compounds can form a wide array of shapes, sizes and configurations, and are capable of a far broader repertoire of binding and other functions than those displayed by Nucleic Acids in biological systems.
The present inventors have recognized that SELEX or SELEX-like processes could be used to identify Nucleic Acids which can facilitate any chosen reaction in a manner similar to that in which Nucleic Acid Ligands can be identified for any given target. In theory within a Candidate Mixture of approximately 1013 to 1018 Nucleic Acids, the present inventors postulate that at least one Nucleic Acid exists with the appropriate shape to facilitate each of a broad variety of physical and chemical interactions.
The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, entitled “Method for Selecting Nucleic Acids on the Basis of Structure.” now abandoned (see U.S. Pat. No. 5,707,796), describes the use of SELEX in conjunction with gel electrophoresis to select Nucleic Acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands,” now abandoned (see U.S. Pat. No. 5,763,177), describes a SELEX based method for selecting Nucleic Acid Ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. patent application Ser. No. 08/134,028, filed Oct. 7, 1993, entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” now U.S. Pat. No. 5,580,737, describes a method for identifying highly specific Nucleic Acid Ligands able to discriminate between closely related molecules, which can be non-peptidic, termed Counter-SELEX. U.S. patent application Ser. No. 08/143,564, filed Oct. 25, 1993, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Solution SELEX,” now U.S. Pat. No. 5,567,588, describes a SELEX-based method which achieves highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule.
The SELEX method encompasses the identification of high-affinity Nucleic Acid Ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified Nucleic Acid Ligands containing modified nucleotides are described in U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” now U.S. Pat. No. 5,660,985, that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. patent application Ser. No. 08/134,028, supra, describes highly specific Nucleic Acid Ligands containing one or more nucleotides modified with 2′-amino (2′-NH2), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of Known and Novel 2′-Modified Nucleosides by Intramolecular Nucleophilic Displacement,” now abandoned, describes oligonucleotides containing various 2′-modified pyrimidines. The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. patent application Ser No. 08/284,063, filed Aug. 2, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX,” now U.S. Pat. No. 5,637,459, and U.S. patent application Ser. No. 08/234,997, filed Apr. 28, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX,” now U.S. Pat. No. 5,683,867, respectively. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules.
The SELEX method further encompasses combining selected nucleic acid ligands with lipophilic compounds or non-immunogenic, high molecular weight compounds in a diagnostic or therapeutic complex as described in U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes.” VEGF Nucleic Acid Ligands that are associated with a Lipophilic Compound, such as diacyl glycerol or dialkyl glycerol, in a diagnostic or therapeutic complex are described in U.S. patent application Ser. No. 08/739,109, filed Oct. 25, 1996, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes,” now U.S. Pat. No. 5,859,228. VEGF Nucleic Acid Ligands that are associated with a Lipophilic Compound, such as a glycerol lipid, or a Non-Immunogenic, High Molecular Weight Compound, such as polyethylene glycol, are further described in U.S. patent application Ser. No. 08/897,351, filed July 21, 1997, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes.” VEGF Nucleic Acid Ligands that are associated with a non-immunogenic, high molecular weight compound or lipophilic compound are also further described in WO 98/18480, published May 7, 1998, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes.” Each of the above described patent applications that describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety.
In the SELEX process, generally the candidate mixture includes regions of fixed sequences (i.e., each of the members of the candidate mixture contains the same sequences in the same location) and regions of randomized sequence. The fixed sequences are usually selected for: a) assisting in the amplification steps; b) mimicking a sequence known to bind to the target; or c) enhancing the concentration of a given structural arrangement of the nucleic acids in the candidate mixture. The fixed region(s) (or part of the fixed region) in the SELEX-identified Nucleic Acid Ligand may participate in binding to the target. Additionally, the fixed region(s) (or part of the fixed region) could form a structure(s) or contribute to a structure that binds to or facilitates binding to the target. Although in some circumstances this is a desirable attribute, in other circumstances the fixed region(s) may limit the possible structural variation and number of different nucleic acid ligands resulting from the SELEX process. The development of a method for generating nucleic acid ligands in which the participation of fixed sequences in binding to the target is minimized or eliminated is desirable.
Toole et al. (WO 92/14843) discloses a method for identifying oligonucleotide sequences which specifically bind biomolecules. In one embodiment, the method includes identifying and amplifying oligonucleotides without attached flanking regions or structural constraints, but which nevertheless are capable of specific binding to desired targets. This method provides the ability to engineer appropriate means for amplifying the desired oligonucleotides. In this method, a pool of oligonucleotides is generated in which the sequences are unknown. These sequences are incubated with the target under conditions wherein some of the oligonucleotides complex with the target. The oligonucleotides that complex with the target are recovered and known sequences are added to at least one end of the oligonucleotide. These known sequences are then used in amplifying the nucleic acid ligands. Once the nucleic acid ligands have been amplified, the known nucleotide sequence is removed. The process may be repeated for the desired number of rounds until an optimal nucleic acid ligand population may be identified.
SUMMARY OF THE INVENTIONThe present invention describes methods for generating nucleic acid ligands in which the participation of fixed sequences in binding to the target is minimized or eliminated.
In one embodiment of the method of this invention, a method for generating nucleic acid ligands without the participation of fixed sequences is described, comprising:
a) preparing a candidate mixture of single-stranded nucleic acids wherein each nucleic acid member of said candidate mixture comprises a fixed region;
b) annealing oligonucleotides to the fixed sequences that are complementary to said fixed sequences;
c) contacting said candidate mixture with said target molecule;
d) partitioning the nucleic acids having, an increased affinity to the target molecule relative to the candidate mixture from the remainder of the candidate mixture; and
e) amplifying the increased affinity nucleic acids, in vitro, to yield a ligand-enriched mixture of nucleic acids whereby nucleic acid ligands of the target molecule are identified.
In another embodiment of the method of this invention, a method for generating nucleic acid ligands without the participation of fixed sequences is described, comprising
a) preparing a candidate mixture of single-stranded nucleic acids wherein each nucleic acid member of said candidate mixture comprises one or more regions of fixed sequences;
b) contacting said candidate mixture with said target molecule;
c) partitioning the nucleic acids having an increased affinity to the target molecule relative to the candidate mixture from the remainder of the candidate mixture;
d) amplifying the increased affinity nucleic acids, in vitro, to yield a ligand-enriched mixture of nucleic acids;
f) replacing said one or more regions of fixed sequences with a different one or more regions of fixed sequences; and
g) repeating steps b)-d), whereby nucleic acid ligands of the target molecule are identified.
In yet another embodiment of the invention, a method for generating nucleic acid ligands without the participation of fixed sequences is described as follows:
a) contacting a candidate mixture with a target molecule;
b) partitioning the nucleic acids having an increased affinity to the target molecule relative to the candidate mixture from the remainder of the candidate mixture;
c) hybridizing the nucleic acids partitioned in step b) with a library of single stranded nucleic acids that are complementary to the single stranded nucleic acids of the candidate mixture, wherein each nucleic acid member of the complementary library has a fixed region;
d) amplifying the nucleic acids that hybridized to a nucleic acid in the complementary library whereby increased affinity nucleic acid ligands of the target molecule having fixed regions are produced; and
e) cleaving said fixed regions of the increased affinity nucleic acids whereby nucleic acid ligands of the target molecule are identified.
BRIEF DESCRIPTION OF THE FIGURES
FIGS. 2A-E show MS2 CP binding sites.
FIGS. 6A-C show the comparison of the truncation SELEX protocols to regular SELEX.
FIGS. 22A-C show binding properties of TGF∃1 pools with and without their fixed sequences. Body labeled 2′F pyrimidine modified transcripts from TGF∃1 40N7 round 12 (R12) (
FIGS. 24A-C show the application of gel shifts to partition the hybridization products during the truncation SELEX by hybridization process. In
FIGS. 29A-C show PCR using short primers. The sequence of the template, primers, and expected reaction products are as shown in
The right branch shows the process to generate the antisense full length strand of the library for the hybridization SELEX process.
FIGS. 35A-D show the ligation of the 5′ fixed sequence.
FIGS. 37A-F show nitrocellulose filter binding curves with an example set of ligands from the VEGF round 1 truncation SELEX by ligation experiment. All RNAs were high specific activity body labeled. Binding was measured with undigested and RNaseH truncated (designated by T after the ligand designation) RNA lacking both the bulk of 5′ and the 3′ fixed sequences. RNA was incubated with various concentrations of VEGF and bound RNA was partitioned by nitrocellulose filtration and quantitated. Ligands tested are as shown.
FIGS. 38A-C show the effect of removal of fixed sequences on the affinities of ligands from the starting 5′ truncated (5′TR) (
Definitions:
“Nucleic Acid Ligand” or “Aptamer” as used herein is a non-naturally occurring Nucleic Acid having a desirable action on a Target. A desirable action includes, but is not limited to, binding of the Target, catalytically changing the Target, reacting with the Target in a way which modifies/alters the Target or the functional activity of the Target, covalently attaching to the Target as in a suicide inhibitor, facilitating the reaction between the Target and another molecule. In the preferred embodiment, the action is specific binding affinity for a Target molecule, such Target molecule being a three dimensional chemical structure other than a polynucleotide that binds to the Nucleic Acid Ligand through a mechanism which predominantly depends on Watson/Crick base pairing or triple helix binding, wherein the Nucleic Acid Ligand is not a Nucleic Acid having the known physiological function of being bound by the Target molecule.
“Candidate Mixture” is a mixture of Nucleic Acids of differing sequence from which to select a desired ligand. The source of a Candidate Mixture can be from naturally occurring Nucleic Acids or fragments thereof, chemically synthesized Nucleic Acids, enzymatically synthesized Nucleic Acids or Nucleic Acids made by a combination of the foregoing techniques. In a preferred embodiment, each Nucleic Acid has fixed sequences surrounding a randomized region to facilitate the amplification process.
“Nucleic Acid” means either DNA, RNA, single-stranded or double-stranded and any chemical modifications thereof. Modifications include, but are not limited to, those that provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and fluxionality to the Nucleic Acid Ligand bases or to the Nucleic Acid Ligand as a whole. Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications such as intemucleoside phosphorothioate linkages, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping.
“SELEX” methodology involves the combination of selection of Nucleic Acid Ligands that interact with a Target in a desirable manner, for example binding to a protein, with amplification of those selected Nucleic Acids. Iterative cycling of the selection/amplification steps allows selection of one or a small number of Nucleic Acids that interact most strongly with the Target from a pool which contains a very large number of Nucleic Acids. Cycling of the selection/amplification procedure is continued until a selected goal is achieved. The SELEX methodology is described in the SELEX Patent Applications. The SELEX methodology is sometimes referred to herein as Conventional SELEX.
“Genomic SELEX” is a variation on the SELEX methodology in which the nucleic acids in the randomized region of the candidate mixture are replaced by genomic sequences (or inserts) derived from an organism. Genomic SELEX is also sometimes referred to herein as Conventional (or Regular) Genomic SELEX when the method is performed without changing the fixed sequences or annealing of oligonucleotides. It will be understood from the context of the specification whether Genomic SELEX is being performed with or without changing the fixed sequences or annealing of oligonucleotides.
“Truncation SELEX” is a variation on the SELEX methodology in which the participation of fixed sequences in the binding to the Target is minimized or eliminated.
“Truncation SELEX by Ligation” is a variation on the Truncation SELEX Method whereby amplifiable molecules are created by introducing fixed regions with a ligation reaction after interaction with the target (i.e., the nucleic acid does not contain fixed sequences when it interacts with the target). An example of Truncation SELEX by Ligation is illustrated in
“Truncation SELEX by Hybridization” is a variation on the Truncation SELEX Method whereby amplifiable molecules are obtained by hybridizing the selected nucleic acid (containing minimal or no fixed sequences) to the original candidate mixture. An example of Truncation SELEX by Hybridization is illustrated in
“Target” means any compound or molecule of interest for which a ligand is desired. A Target can be a protein (such as PDGF, thrombin, and selectin), peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc. without limitation.
The SELEX process provides a class of products which are Nucleic Acid molecules, each having a unique sequence, and each of which has the property of binding specifically to a desired Target compound or molecule. Target molecules are preferably proteins, but can also include among others carbohydrates, peptidoglycans and a variety of small molecules. SELEX methodology can also be used to Target biological structures, such as cell surfaces or viruses, through specific interaction with a molecule that is an integral part of that biological structure.
In its most basic form, the SELEX process may be defined by the following series of steps:
1) A Candidate Mixture of Nucleic Acids of differing sequence is prepared. The Candidate Mixture generally includes regions of fixed sequences (i.e., each of the members of the Candidate Mixture contains the same sequences in the same location) and regions of randomized sequences. The fixed sequence regions are selected either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the Target, or (c) to enhance the concentration of a given structural arrangement of the Nucleic Acids in the Candidate Mixture. The randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent).
2) The Candidate Mixture is contacted with the selected Target under conditions favorable for binding between the Target and members of the Candidate Mixture. Under these circumstances, the interaction between the Target and the Nucleic Acids of the Candidate Mixture can be considered as forming Nucleic Acid-target pairs between the Target and those Nucleic Acids having the strongest affinity for the Target.
3) The Nucleic Acids with the highest affinity for the target are partitioned from those Nucleic Acids with lesser affinity to the target. Because only an extremely small number of sequences (and possibly only one molecule of Nucleic Acid) corresponding to the highest affinity Nucleic Acids exist in the Candidate Mixture, it is generally desirable to set the partitioning criteria so that a significant amount of the Nucleic Acids in the Candidate Mixture (approximately 5-50%) are retained during partitioning.
4) Those Nucleic Acids selected during partitioning as having the relatively higher affinity for the target are then amplified to create a new Candidate Mixture that is enriched in Nucleic Acids having a relatively higher affinity for the target.
5) By repeating the partitioning and amplifying steps above, the newly formed Candidate Mixture contains fewer and fewer unique sequences, and the average degree of affinity of the Nucleic Acids to the target will generally increase. Taken to its extreme, the SELEX process will yield a Candidate Mixture containing one or a small number of unique Nucleic Acids representing those Nucleic Acids from the original Candidate Mixture having the highest affinity to the target molecule.
The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, entitled “Method for Selecting Nucleic Acids on the Basis of Structure,” now abandoned (see U.S. Pat. No. 5,707,796), describes the use of SELEX in conjunction with gel electrophoresis to select Nucleic Acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123.935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands,” now abandoned (see U.S. Pat. No. 5,763,177), describes a SELEX based method for selecting Nucleic Acid Ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. patent application Ser. No.08/134,028, filed Oct. 7, 1993, entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” now U.S. Pat. No. 5,580,737, describes a method for identifying highly specific Nucleic Acid Ligands able to discriminate between closely related molecules, termed Counter-SELEX. U.S. patent application Ser. No. 08/143,564, filed Oct. 25, 1993, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Solution SELEX,” now U.S. Pat. No. 5,567,588, describes a SELEX-based method which achieves highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992, entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev.” now U.S. Pat. No. 5,496,938, describes methods for obtaining improved Nucleic Acid Ligands after SELEX has been performed. U.S. patent application Ser. No. 08/400,440, filed Mar. 8, 1995, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chemi-SELEX,” now U.S. Pat. No. 5,705,337, describes methods for covalently linking a ligand to its target.
The SELEX method encompasses the identification of high-affinity Nucleic Acid Ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified Nucleic Acid Ligands containing modified nucleotides are described in U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides.” now U.S. Pat. No. 5,660,985, that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. patent application Ser. No. 08/134,028, supra, describes highly specific Nucleic Acid Ligands containing one or more nucleotides modified with 2′-amino (2′-NH2), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of Known and Novel 2′ Modified Nucleosides by Intramolecular Nucleophilic Displacement,” describes oligonucleotides containing various 2′-modified pyrimidines.
The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. patent application Ser. No. 08/284,063, filed Aug. 2, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX,” now U.S. Pat. No. 5,637,459, and U.S. patent application Ser. No. 08/234,997, filed Apr. 28, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX,” now U.S. Pat. No. 5,683,867, respectively. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules.
The SELEX method further encompasses combining selected Nucleic Acid Ligands with Lipophilic Compounds or Non-Immunogenic, High Molecular Weight Compounds in a diagnostic or therapeutic Complex as described in U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes.” The SELEX method further encompasses combining selected VEGF Nucleic Acid Ligands with lipophilic compounds, such as diacyl glycerol or dialkyl glycerol, as described in U.S. patent application Ser. No. 08/739,109, filed Oct. 25, 1996, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes,” now U.S. Pat. No. 5,859,229. VEGF Nucleic Acid Ligands that are associated with a High Molecular Weight, Non-Immunogenic Compound, such as Polyethylene glycol, or a Lipophilic Compound, such as Glycerolipid, phospholipid, or glycerol amide lipid, in a diagnostic or therapeutic complex are described in U.S. patent application Ser. No. 08/897,351, filed Jul. 21, 1997, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes.” Each of the above described patent applications that describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety.
SELEX identifies Nucleic Acid Ligands that are able to bind targets with high affinity and with outstanding specificity, which represents a singular achievement that is unprecedented in the field of Nucleic Acids research. These characteristics are, of course, the desired properties one skilled in the art would seek in a therapeutic or diagnostic ligand.
In order to produce Nucleic Acid Ligands desirable for use as a pharmaceutical, it is preferred that the Nucleic Acid Ligand (1) binds to the target in a manner capable of achieving the desired effect on the target; (2) be as small as possible to obtain the desired effect; (3) be as stable as possible; and (4) be a specific ligand to the chosen target. In most situations, it is preferred that the Nucleic Acid Ligand has the highest possible affinity to the target. Additionally, Nucleic Acid Ligands can have facilitating properties.
In commonly assigned U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992, now U.S. Pat. No. 5,496,938 ('938), methods are described for obtaining improved Nucleic Acid Ligands after SELEX has been performed. The '938 patent, entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev,” is specifically incorporated herein by reference.
As discussed above, generally the candidate mixture in the SELEX process includes regions of fixed sequences and randomized sequences. The fixed sequences are usually present for assisting in the amplification steps of the SELEX process and may participate in binding to the target or contribute to structures that bind to the target. In some circumstances, the participation of the fixed sequences in binding to the target may not be desirable. Generation of nucleic acid ligands in which the participation of fixed sequences in binding to the target is minimized or eliminated can be accomplished is several ways:
1) The participation of fixed regions in the binding of the target could be reduced or eliminated by annealing complementary oligonucleotides to the fixed regions prior to contacting the candidate mixture with the target. The double-stranded region is then bound together through Watson/Crick base pairing, and, therefore, is not available for binding to the target.
2) The fixed regions can also be changed at different rounds. As these sequences are changed, their participation of any one fixed region in binding is reduced.
3) Reduce the size of the fixed regions.
4) Eliminate the fixed sequences before interaction with the target.
As described above, in some circumstances it is desirable to have short ligands following the SELEX process. The reduction in the fixed region of the template will accomplish reduction in the overall size of the individual molecules. Reduction of the fixed regions is limited in order to maintain PCR amplification. The shortest primer binding site reported for specific amplification is 7-bases long (Vincent et al. (1994) DNA and Cell Biology 13:75-82). Based on this approach, templates were designed to allow amplification of RNA that has 5′ and 3′fixed regions of 5- and 8-bases long (
Reduction of the random region of the template will also accomplish reduction in the overall size of the individual molecules. Random region of a certain length however might be crucial in the isolation of high affinity and bioactivity ligands as evident by experiments where libraries with random regions of different length were applied to the same target in parallel. In one such experiment where TGF∃1 was the SELEX target, it was determined that the length of the random region affected the recovery of bioactive ligands with only the 40N libraries yielded high affinity bioactive ligands, as described in U.S. patent application Ser. No. 09/046,247, filed Mar. 23, 1998.
To further illustrate the approach for elimination of fixed sequences, the primer binding sites are removed from the molecules of the library, before the interaction with the target. After selection, primer binding sites are re-introduced for amplification and generation of the pool for the next round. Primer-building-site-removal requires nucleolytic digestion either before or after generation of the population of single stranded molecules. In SELEX experiments requiring transcription, removal of at least the 5′ fixed region must occur after transcription because digestion before transcription will remove the promoter site and will eliminate transcription.
For SELEX experiments using DNA based libraries, removal of primer binding sites can be done as described in
For SELEX experiments using RNA based libraries, removal of primer binding sites can be done by site specific digestion by RNaseH as described below, where DNA-2′ OMeRNA oligonucleotides are annealed to RNA molecules and the hybridization products are digested by RNaseH.
Following digestion and selection the fixed sequences need to be added back to the library in order to allow amplification and carry the pool forward to the next round. Generation of amplifiable pools following nuclease digestion and affinity selection can be achieved as described below in two ways (
Overview of Truncation-SELEX-by-Ligation
This is an enzymatic method of Truncation SELEX. The steps of Truncation-SELEX-by-ligation are summarized in
For de novo Truncation-SELEX-by-ligation, the starting synthetic oligonucleotide pools can be designed to include just the random region. In order to avoid potential counterselection pressure due to transcription efficiency, especially if modified nucleotides are used as polymerase substrates, it might be beneficial to include a transcription initiation sequence immediately downstream of the T7 promoter such as 5′GGGAG followed by the random region. The starting pool may include a 3′ primer binding site or it may not. If no 3′ primer binding site is used at the starting pool, then single stranded oligonucleotides can be converted to double stranded templates by including the T7 promoter-initiator complement at the 3′ end of the random region, for example 5′[N]30CTCCCTATAGTGAGTCGTATTA (SEQ ID NO:325), and performing primer extension using a primer such as 5′TAATACGACTCACTATAGGGAG (SEQ ID NO:46). If there is a 3′ primer binding site, then RNasell digestion can be used, as described below, to remove that fixed sequence before binding to the target. Alternatively, a starting pool of DNA templates can be used where appropriate restriction sites were incorporated downstream of the T7 promoter and random region as shown in
For application of truncation SELEX on pools evolved by conventional SELEX experiments, the primer binding sites are removed by digestion and then they are reintroduced following affinity selection by ligation. These steps will be done at each truncation SELEX round. Alternatively, a 5′ truncated library can be generated before affinity selection starts. This is a preferential alternative to avoid the use of a random bridge sequence for the 5′ end ligation since such ligation condition is inefficient. The generation of the 5′ truncated library will allow introduction of the transcription initiation sequence 5′GGGAG adjacent to the 5′ end of the random region of the template. This initiation sequence in addition of relieving potential transcription selection bias, it can also provide a specific sequence for the ligation bridge used in the introduction of the 5′ primer binding site. Therefore, a conventional SELEX pool (
For each truncation-SELEX-by-ligation round, truncated RNA (
Overview of Truncation SELEX by Tailing
This is an alternative enzymatic method of Truncation SELEX. The steps of Truncation-SELEX-by-tailing are summarized in
Overview of Truncation-SELEX-by-Hybrid-Selection
The steps of RNA Truncation-SELEX-by-hybrid-selection are summarized in
Each RNA truncation-SELEX-by-hybrid-selection round, starts with a dsDNA template (
When the hybrid selection method is used, the hybridization rate of complex nucleic acids must be taken into consideration, so enough hybridization time is given at early rounds to allow capture of selected sequences. There is a practical limit on the complexity of pools that can be utilized in the hybrid selection method. This practical limit needs to be determined experimentally in the presence of compounds that enhance hybridization rate such as CTAB (Pontius and Berg (1991) Proc. Natl. Acad. Sci. U.S.A. 88:8237-8241; Nedbal et al. (1997) Biochemistry 36:13552-57).
Size Selection
This approach is a variation of the scheme, which involves removal of fixed sequence and subsequent reintroduction of the same or different fixed sequences either enzymatically, or by hybrid selection. It involves the random fragmentation of an advanced or semiadvanced SELEX pool at either the DNA or RNA level followed by size selection (for example using gel electrophoresis), and finally by introduction of fixed sequences either enzymatically or by hybrid selection.
Digestion at the DNA level (
Digestion at the RNA level can be done with a nuclease and digested RNA can be size selected by gel electrophoresis (or any other method). Size selected RNA can either be used for affinity selection directly or can be used to generate a starting pool for subsequent truncation SELEX rounds. When RNA is used directly following affinity selection, the next pool is generated by either the truncation SELEX-by-Ligation, -Tailing or -Hybrid Selection methods as described above. When RNA is used to generate the starting pool for truncation SELEX, fixed sequences can be introduced enzymatically by either the truncation SELEX-by-Ligation, or -Tailing methods as described above. The new pools are then used as described above.
Screening for Ligands of a Certain Size
There is a desire for obtaining short ligands following application of the SELEX process for economical reasons. Therefore an efficient way to screen for ligands that can be truncated to an appropriate length could be very useful. Screening can be done by procedures that allow boundary determination. Currently boundary determination (Fitzwater and Polisky (1996) Methods Enzymol 267:275-301) is done in two separate experiments where each boundary is first determined separately followed by experiments where both boundaries are tested together in one molecule for binding activity (
Presented here is an alternative way of screening for ligands that can tolerate truncation to a given length. This approach is based on random cleavage of internally labeled RNA ligands and then partition of those fragments that retain binding to the target followed by gel electrophoresis (
Therefore, the size of the minimal fragment necessary for binding can be determined in a large number of ligands at once as follows. Each ligand is randomly cleaved to generate a ladder of molecules. These molecules are radioactively labeled by either using body labeled starting material or end labeling the resulting fragments, following fragmentation. End labeling can be done with either kinase or RNA ligase or terminal transferase with γ-32P-ATP or 32P-pCp or α32P-ddNTP, respectively. The resulting radiolabeled ladder is allowed to bind to the target and the target bound molecules are then partitioned and analyzed on a sequencing gel along with size markers. Following autoradiography, minimum retained fragment for each ligand can be observed and ligands with minimum fragments of desired length can be identified.
In addition to screening, minimum fragment methodology can be used for truncation SELEX where the minimum fragments are excised from the gel and used in the truncation SELEX schemes described above.
EXAMPLE 1 Experimental Procedures for Performing the SELEX Process by Annealing of the Complementary Oligonucleotides to the Fixed Sequence Region or by Changing the Fixed SequencesThis example provides general procedures followed by and incorporated into Example 2.
Materials and Methods
Genomic Library
The library from E. coli B genomic DNA was constructed as described previously (Singer et al. (1997) Nuc. Acids Res. 25:781-786). Briefly, genomic DNA was denatured and annealed to a primer with a fixed 5′ end and 9 randomized nucleotides at the 3′ end. After annealing at 2° C., the primer was extended with Klenow on ice, followed by room temperature, and 50° C. Another primer with a different fixed sequence was added, and the denaturation/annealing/extension was repeated. The molecules were separated by size on a denaturing polyacrylamide gel, and amplified by PCR using the above two primers minus the randomized sequences, plus the T7 promoter.
Genomic SELEX
A non-aggregating MS2 CP variant V75E;A81G with RNA-binding properties identical to wild type was purified as described previously (LeCuyer et al. (1995) Biochemistry 34:10600-6). Any endogenous E. coli RNA was removed in the purification process, as indicated by the binding stoichiometry and the UV absorbance spectra (LeCuyer et al. (1995) Biochemistry 34:10600-6).
SELEX was initiated with 1 nmole of RNA, transcribed from the E. coli genomic DNA library. This amount is theoretically equivalent to more than 107 copies of every possible genomic insert, assuming the inserts start with equal probability at any position within the E. coli genome.
In each round of selection, 1 nmole of gel-purified RNA (a mixture of unlabeled RNA and a trace amount of RNA labeled during transcription with [α-32P]GTP) was denatured in TE at 95° C. for 1 minute, quickly chilled on ice and incubated on ice for 10 more minutes. Binding buffer was added to give a final concentration of 100 mM HEPES-KOH, pH 7.5, 80 mM KCl, 10 mM MgCl2. The mixture was pre-filtered through nitrocellulose (0.45 micron pore, 25 mm diameter filter unit, Micro Filtration Systems (Dublin, Calif.), connected to a 3 ml disposable syringe and pre-wetted with 0.5 ml of the binding buffer) to reduce the fraction of the nitrocellulose-binding RNA. The volume was adjusted with the binding buffer to make up for the loss on the filter. MS2 CP was added to the final concentration of 100 nM of the dimer in a 0.1 ml reaction. Binding proceeded for 45 minutes at room temperature (22-24° C.).
The binding reaction was vacuum manifold-filtered through nitrocellulose (0.45 micron pore, 25 mm diameter, Micron Separations, Westborough, Mass.) and washed with 5 ml of the binding buffer. The fraction of the bound RNA, that is retained on nitrocellulose, was estimated by Cerenkov counting. The protein and RNA concentrations were chosen so that in every round this fraction was as low as possible, usually less than 1-2% of the total (to speed up the selection), but higher than in the control reaction without MS2 CP (to reduce the “background” selection of nitrocellulose binders).
The bound RNA was eluted from the cut filters by denaturation at 95° C. for 2 minutes in a suspension of 0.5 ml of 8 M urea in TBE and 0.5 ml of phenol, and then amplified for the next round of SELEX essentially as in Tuerk ((1997) Methods Mol. Biol. 67:219-230) with the following changes. RNA and primer B (5′-tcccgctcgtcg tctg-′ (SEQ ID NO:3)) were denatured at 95° C. for 1 minute, annealed at 70° C. for 10 minutes, and reverse transcribed at 48° C. for 30 minutes with SuperScript (Gibco BRL) reverse transcriptase (these temperatures were chosen to melt RNA secondary structures). The cDNA was amplified in PCR with Taq DNA polymerase as in Singer et al. ((1997) Nuc. Acids Res. 25:781-786) with primers B and A (5′-gaaattaatacgactcactatagggaggacgatgcgg-3′ (SEQ ID NO:326); T7 promoter underlined). In this PCR, as well as in all others in this study, the relatively low concentrations of MgCl2 (3 mM) and dNTPs (50:M each) served to decrease the error rate. RNA was transcribed, labeled and gel-purified as in Schneider et al. ((1992) J. Mol. Bio. 228:862-9) and Tuerk ((1997) Methods Mol. Biol. 67:219-230). After the completion of SELEX. DNA was cloned and sequenced as in Singer et al. ((1997) Nuc. Acids Res. 25:781-786).
SELEX with Annealing of the Complementary Oligonucleotides
Instead of 1 nmole of RNA, 0.1 nmoles of RNA and 0.4 nmoles of each of the two complementary oligonucleotides were used (Table 1). An extra 10 minute incubation at room temperature was introduced directly after the addition of the binding buffer to allow oligonucleotides to anneal. The annealed oligonucleotides decreased the yield of the full-length reverse transcription product only by 10%. Otherwise, this SELEX was identical to the conventional SELEX.
SELEX with Changing the Fixed Sequences
Step 1. Changing, the 3′ fixed sequence: DNA purification and PCR. Conventional SELEX was carried out for 3 rounds using the old fixed sequence primers A and B described above. Since the old fixed sequences did not contain FokI restriction sites, the sites had to be introduced by PCR (alternatively, the sites can be introduced during the library construction). DNA product from either the reverse transcription reaction, or from PCR after round 3, was purified from primer B. Primer B interferes with the subsequent steps if not completely removed. Reverse transcription product was purified on a Microcon-30 filter (Amicon, Mass.), by centrifugation 3 times with 0.2 ml of TE buffer for 10 minutes at 16,000×g. PCR product, since it contains more primer B, had to be purified, instead of Microcon-30, by native polyacrylamide gel electrophoresis (PAGE) with ethidium bromide staining, followed by crush-and-soak elution for 30 minutes at 37° C.
Purified DNA was amplified by PCR (
The amplified DNA was extracted with chloroform, phenol, and 2 more times with chloroform, then ethanol precipitated and resuspended in water (unpurified PCR product inhibits subsequent FokI digestion).
Step 2. FokI digestion. Purified DNA product of 0.1 ml PCR was incubated with FokI (New England Biolabs) at a ratio of >1.5 units per microgram of DNA (the DNA mass was estimated assuming that <100% of the primers were converted into the full-length PCR product). This ratio had to be optimized with every new DNA preparation. FokI digestion was carried out in 40:1 at 37° C. for 1 hour in the manufacturer's buffer with 0.1% of Tween-20 detergent to decrease the exonuclease activity.
Step 3. Klenow extension. dNTPs (final concentration of 0.5 mM each) and the Klenow fragment of E. coli DNA polymerase 1 (from US Biochemicals, final concentration 370 units/ml) were added directly to the FokI digest. Extension proceeded for 15 minutes at 37° C. The digested and blunt-ended library DNA was then purified from the other digestion fragments by native PAGE as in step 1. PAGE showed that 60% of the input DNA was cut as expected, 40% was degraded nonspecifically, and a negligible fraction was left uncut.
Step 4. Ligation. The purified library DNA was resuspended in water and blunt-end ligated to the new fixed sequence. The new fixed sequence was a duplex of two DNA oligonucleotides: C (5′-ggtgcggcagttcggt-3′ (SEQ ID NO:328)) and its complement, cC (5′-accgaactgccgcacct-3′ (SEQ ID NO:329)). The duplex was formed by incubation of the mixture of 200 pmoles of each oligo in 4:1 of TE at 95° C. for 1 minute, followed by 60° C. for 10 minutes and room temperature for 10 minutes. The duplex was added to the purified DNA, and incubated with 2 units of T4 DNA ligase (Roche Molecular Biochemicals) in the manufacturer's buffer in 20 μl for 1 hour at 30° C. The ligation yield was 50%, estimated by Molecular Dynamics phosphorimager quantification of 32P-labeled DNA separated by PAGE. The overall yield of all steps was 10% relative to the input DNA at the beginning of step 2. The relatively high blunt-end ligation yield was achieved by keeping all DNAs as concentrated as possible (more than a few :M), since the Km of ligase for blunt ends is 50:M (Sugino el al. (1997) J. Biol. Chem. 252:3987-94). The oligonucleotides, lacking a phosphate, cannot be ligated to anything except the digested library DNA. To reduce ligation of the library DNA molecules to each other, an excess of oligonucleotides over the library DNA was used (>2-fold excess, estimated by assuming that <100% of the primers were converted into the full-length PCR product, and that <100% of it was recovered after gel purification). The length of the ligation products was verified by PAGE.
Step 5. PCR. One-third of the ligation product was amplified by PCR with the new 3′ fixed sequence primer C (sequence shown above) and primer A+FokI (which introduces the FokI site into the old 5′ fixed sequence, and relates to primer A as B+FokI relates to B). Higher concentrations of the primers were used in this PCR (10:M each, instead of 1:M, as in all other PCRs in this study). This served to provide an excess of primer C over cC (cC is complementary to C, and was carried over from the ligation in step 4).
Only one of the two major ligation products can be amplified in PCR with primers C and A+FokI, namely, the product in which the duplex of oligonucleotides C and cC has been ligated in one of the 2 possible orientations with respect to the FokI-digested library DNA molecule. A single T was added to the 3′ end of oligonucleotide cC, as shown above, in order to create a single base overhang in the C-cC duplex. Under the experimental conditions, adding a single overhanging T directs ligation more toward the desired orientation: blunt end to blunt end, as opposed to the undesired orientation of overhanging end to blunt end (data not shown).
Step 6. Changing the 5′ fixed sequence. DNA was purified as in the third paragraph of step 1, and then steps 2-5 for 3′ fixed sequence were essentially repeated for the 5′ fixed sequence. For the PCR in step 5, primers for the new fixed sequences were used: C (step 4, above) and D (5′-gaaattaatacgactcactatagggaaagcccacgcc-3′ (SEQ ID NO:330)). The resulting molecules had both fixed sequences replaced with the new ones, with both tails removed entirely. One such molecule is shown in
rffG End-Point Analysis
To find the sequences of the library molecules that share the rffG site, the method described previously (Singer et al., 1997, supra) was used. Briefly, the starting library DNA was amplified by PCR with the library primer B, and the genomic primer from rffG gene (5′-bbbcactgagcatcagecag-3′ (SEQ ID NO:333); b stands for biotin). The products that contained the genomic primer were purified on immobilized streptavidin. Their complementary strands were eluted, and amplified using primer B and a nested genomic rffG primer (5′-bbbatcagccagactgtgtca-3′ (SEQ ID NO:334); the sequence in common is in boldface). The PCR products were purified on immobilized streptavidin again, eluted, and amplified with uracil-primers for subsequent cloning and sequencing.
Binding Analysis
The MS2 replicase fragment (the natural MS2 CP binding site;
The RNAMOT site Nos. 8, 12 and 14 (Table 3) were amplified from E. coli genomic DNA template by PCR. The transcribed RNA molecules had the MS2 CP binding sites positioned approximately in the middle Oust as they were positioned for simplicity when their predicted secondary structures were examined). The molecules also had the same fixed sequences, and were 70 nucleotides long.
Labeled RNA (0.1 nM) was bound to MS2 CP in variable excess concentrations as above, but without pre-filtering, at 24-25° C. Each binding reaction was filtered through nitrocellulose (0.45 micron pore, from Bio-Rad) using a Bio-Dot apparatus (Bio-Rad) and washed with 0.5 ml of the binding buffer.
STOGEN: A Computer Program to Choose New Fixed Sequences
To reduce the possible influence of the fixed sequences on the outcome of the SELEX experiments, a computer program to design new fixed sequences was developed. The program (available by anonymous ftp from /usr/local/ftp/pub/STOGEN at beagle.colorado.edu or by e-mailing to [email protected] or [email protected]) takes as input the old fixed sequences. It generates possible candidates for the new fixed sequences, using 4 heuristic rules with user-adjustable parameters (see below). For computational efficiency, the program does not generate and test all possible sequences of a given length, but rather randomly generates a subset of sequences, tests them, and repeats the process again, until it arrives at sequences that conform to all of the rules (hence the name of the program—STOGEN, short for stochastic generator). The STOGEN rules are:
1. The new fixed sequences should have approximately the same annealing temperatures to the primers as the old fixed sequences, in order to facilitate amplification. Therefore, the new fixed sequences have the same length and the same number of G+C as the old ones (Wu el al. (1991) Prog Nucleic Acid Res. Mol. Biol. 40:185-220).
2. The new fixed sequences should form among themselves as little secondary structure as possible. In addition to potentially influencing SELEX, the structure may hinder either PCR or reverse transcription. The longest allowed continuous stem was usually limited to 3 base pairs.
3. The new fixed sequences should share as little similarity as possible to the old ones. Thus, all the molecules that used the old fixed sequences for binding, will be lost in subsequent rounds of SELEX. Two criteria were used to this end: shared sequence size and position-by-position identity. The maximum allowed size of any sequence in common between the old and the new fixed sequences was usually set to 2 nucleotides. That is, if the old fixed sequence contains AUG, the new one may contain AU or UG, but not AUG. The only exception is the invariant starting GGG, required for optimal transcription yield (Milligan et al. (1987) Nucleic Acids Res. 15:8783-98).
Also, position-by-position identity between the old and the new fixed sequences is limited. Since the parts of the fixed sequences closest to the insert participate in binding more often, identity is weighted by position, assigning greater penalty to positions closest to the insert. The weight function was derived by evaluating the fixed sequence participation data from 11 different SELEX experiments. Seven experiments were randomized sequence SELEXes for protein binders (Brown et al. (1997) J. Biol. Chem. 272:14969-74; Brown and Gold (1995) Biochemistry 34:14765-74; Burke et al. (1996) J. Mol. Biol. 264:650-66; Jellinek et al. (1994) Biochemistry 33:10450-6; Kubik et al. (1994) Nucleic Acids Res. 22:2619-26; Tuerk et al. (1992) Proc. Natl. Acad. Sci. USA 89:6988-92; Tuerk & MacDougal-Waugh (1993) Gene 137(1):33-9), two were genomic SELEX experiments (experiments 1 and 2,
f=0.027+2.0×10−8×(n−20)6, for n≦10, and
f=0.022, for n>10.
Here f is the relative frequency of participation of each position within the fixed sequence, and n is the position (counting from the insert, n=1 is the first fixed nucleotide). The program assigns the identity score for each position to be f, if the new fixed sequence and the old one both have the same nucleotide at this position, and to 0—otherwise. New fixed sequences with a particularly high total identity score (=the sum of the identity scores over all positions) are avoided.
4. The new fixed sequences should have minimal potential to form secondary structure with the genomic insert. In most cases, the sequence of the genomic insert is not known in advance. Hence, the generalized potential to form secondary structure is evaluated in the following way.
For each of the candidates for the new fixed sequences, the free energy of annealing to its complement is calculated (the complement used here includes A:U, G:C and G:U base pairs). For example, the sequence AC thus has one possible perfect complement, GU. The sequence GU has 4 possible perfect complements: AC, AU, GC and GU, since U can base pair with either A or G, and G—with either C or U.
The sum of free energies of all possible complements annealing to the fixed sequence is calculated using the Turner rules (Serra & Turner (1995) Methods Enzymol. 259:242-61). The more negative the sum, the larger the potential to form secondary structure. Sequences with a particularly negative sum of free energies (typically, G,U-rich) are avoided.
EXAMPLE 2Binding Sites from the MS2 CP SELEX Agree with the Known Consensus Structure
A library of genomic DNA was prepared from E. coli B by random primer extension (Singer et al. (1997) Nucleic Acids Research 25:781-786). The library contained approximately 65 nucleotide genomic inserts flanked by fixed sequences, which serve as primer annealing sites for amplification. Insert refers to the genomic sequence located in the library molecule between the two fixed sequences. In each round of SELEX, the transcribed library was allowed to bind MS2 CP, and then the bound RNA was amplified. In SELEX experiment 1, the DNA was cloned and sequenced after 5 rounds, when the optimal binding was observed.
Out of 25 isolates sequenced, 12 had the predicted consensus (Witherell et al. (1991) Prog Nucleic Acid Res. Mol. Biol. 40:185-220) binding site (
Surprisingly, the genomic sequences, obtained from the GenBank, that corresponded to 9 out of the 10 isolates with the consensus binding site, did not contain this site. Thus, they were not predicted to bind MS2 CP. In other words, 9 out of the 10 isolates were experimentally induced artifacts.
One of the frequent artifacts is shown in
In the isolate shown in
Note that the binding of the genomic sequences was not actually measured, but rather inferred from the sequence. The sequence alone should predict the binding fairly well, as confirmed in this paper (see below), and as shown earlier by others (Schneider et al. (1992) J. Mol. Biol. 228:862-9; Stockley) et al. (1995) Nucleic Acids Res. 23:2512-8; Uhlenbeck et al. (1983) J. Biomol. Struct. Dyn. 1:539-52; Witherell et al. (1991) Prog Nucleic Acid Res. Mol. Biol. 40:185-220).
Annealing of the Complementary Oligonucleotides Reduces the Fraction of SELEX Artifacts
It was desirable to reduce the fraction of isolates in which the fixed sequences, or tail, or both, participate in binding. The first method to solve this problem was designed to reduce the participation in binding of only the fixed sequences, but not the tails. The genomic SELEX described in Example 1 above (termed conventional genomic SELEX) was carried out for 3 rounds. In each subsequent round, two DNA oligonucleotides complementary to the two fixed sequences were annealed prior to binding of RNA to MS2 CP (Table 1). SELEX with annealing was carried out for 3 rounds (
Out of 35 sequenced isolates from “annealing” SELEX, 26 had the consensus binding site, and 17 of those 26 were found in the GenBank. Of these 17 isolates, 7 (40%) had a consensus binding site present in the corresponding genomic sequence from the GenBank, and the rest were artifacts as described above. The fraction of artifacts in which fixed sequences, but not tails, participated in binding, decreased only by approximately twofold.
Changing Fixed Sequences Eliminates Most of the SELEX Artifacts
The second, and more efficient, method of reducing the artifacts consists of changing the fixed sequences sometime through the course of SELEX, replacing them with entirely new fixed sequences, and at the same time eliminating the “tails” altogether (
FokI endonuclease was used to cut the 3′ fixed sequence and the tail of the library DNA after round 3 of conventional genomic SELEX. FokI cuts at a specific distance (9-13 nucleotides, regardless of their sequence) away from its recognition site, which was introduced in the fixed sequence near its junction with the genomic insert. After digestion with FokI, the overhang at the cut end of the library DNA was extended with Klenow, and blunt-end ligated to the new 3′ fixed sequence, which was a duplex of synthetic oligonucleotides. The ligation product was amplified by PCR, and the whole procedure was repeated again—this time to change the 5′ fixed sequence. The new fixed sequences were chosen using a specially developed computer program termed STOGEN (see Example 1). The sequences may also be chosen manually, with the careful consideration of all the important factors involved (discussed in Example 1).
After changing the 5′ and 3′ fixed sequences, SELEX was performed in 2 different ways in parallel: (1) with annealing of the DNA oligonucleotides complementary to the new fixed sequences, and (2) without any complementary oligonucleotides, as in conventional genomic SELEX (
SELEX experiments 3 and 4). Both SELEX experiments gave virtually identical results. After 2 and 3 rounds of SELEX with the new fixed sequences, 101 isolates were sequenced. Out of 101 isolates, 76 had the consensus binding site, and 75 out of these 76 were found in the GenBank.
The fixed sequences never made any part of the consensus binding site. Neither did the tails, except for 1 artifact. Practically all tails had been successfully removed by FokI. Internal, rather than tail, mutations caused 2 artifacts. This is comparable to the frequency of any mutations in genomic SELEX (1.7 mutations per 100 nucleotides after 5-6 SELEX rounds, data not shown).
Five isolates closely resembled the consensus binding site, but had mutations in those parts that do not contact the coat protein directly (Valegard et al. (1 994) Nature 3711:623-6; Valegard et al. (1997) J. Mol. Biol. 270:724-38). None of the F6-like, 3 nucleotide loop variants, which binds more weakly than the consensus binding site (Convery et al. (1998) Nat. Struct. Biol. 5:133-9), has been found in the genomic SELEX experiments.
All of the SELEX isolates with the MS2 CP consensus binding site (Table 2) had the higher-affinity RNCA tetraloop instead of the lower-affinity RNUA tetraloop of the natural MS2 CP binding site on MS2 mRNA (Johansson (1998) Proc. Natl. Acad. Sci. USA 95:9244-9; Lowary and Uhlenbeck (1987) Nucleic Acids Res. 15:10483-93). As expected, these SELEX isolates bound better than the natural binding site, as measured by the nitrocellulose filter-binding assay (
The consensus of the isolates in Table 2, with consideration of their frequencies in the selected pool, is shown in
The isolates that bind MS2 CP were located in 8 distinct genomic sites. Locations of the MS2 CP binding sites within the corresponding genes did not follow any obvious pattern, with some sites being on the sense, and some on the antisense strand.
Fifty-six isolates were from the sense strand of mRNA of the rffG gene (
Library Composition Partially Explains SELEX Results
It is worth noting that 93% of all the rffG isolates were virtually copies of each other, with the 15 nucleotide consensus binding site always starting at any of only 4 adjacent positions (or adjacent “registers”) within the 40 nucleotide insert. The site was predicted ideally to shift everywhere within the 40−15+1=26 available registers within the insert. The fact that it did not, was possibly due to a bias in the starting library. The end-point analysis (Singer et al. (1997) Nucleic Acids Research 25:781-786) showed that more than half of the molecules of the starting library have end-points that correspond to the registers of the majority (93%) of all rffG SELEX isolates (
Comparison of the MS2 CP Binding Sites Predicted by the Computer Search with the Sites Found by SELEX
Other sites in the E. coli genome that bind to MS2 CP were much less frequent than rffG, in these (Table 2) and prior rounds of SELEX (data not shown). This raised the question about the efficiency of finding all potentially biologically important binding sites. To check if any other binding sites were missed by the SELEX process, a search was performed for the MS2 CP consensus binding site (
To narrow this list to only the tightest binding sites, the SELEX consensus binding site (
Three binding sites were found both by SELEX and by RNAMOT program, including the major (rffG) SELEX isolate. Most of the minor SELEX isolates were not found by RNAMOT. Some of these did not fit the SELEX consensus used for searching the database. For example, had G:U pairs been allowed in the consensus, these sites would have been found, too. Others, like isolate Nos. 7 and 9 from Table 2, were not in the database.
Most of the RNAMOT sites were not found by the SELEX process. It is possible that some of them were under-represented in the starting library, or that they were poorly amplifiable in the SELEX process, or that they bound MS2 CP weakly because the RNA folds into alternate, non-binding, structures within the context of a larger molecule. It is unlikely that these sites were entirely absent from the library. In a previous experiment, all of the 13 other independently tested genomic fragments were successfully amplified by PCR from the same E. coli genomic library (Singer et al. (1997) Nucleic Acids Research 25:781-786).
To find out why the RNAMOT sites were not isolated in SELEX, 20-40 most stable predicted secondary structures of some RNAMOT sites were compared to those of the actual SELEX isolates. In addition, structures of the rffG binding site present in all possible registers within the insert were examined. There appeared only a weak correlation between structures and the frequency of isolation in SELEX. The absolute free energy of the binding site structure, or of the whole molecule, was not correlated with its isolation in SELEX. However, the major rffG isolate had a fairly long stem that supported the binding site (
Perhaps a longer stem provides extra stability to the correct binding site structure and thus reduces the fraction of molecules folded into other, non-binding, structures. In the randomized sequence SELEX for R17 coat protein binders, Schneider and coworkers also found mostly long (7 base pairs) and stable (mostly G:C or C:G base pairs) stems (Schneider et al. (1992) J. Mol. Biol. 228:862-9). Also, in the regular MS2 CP genomic SELEX experiment (without changing the fixed sequences or annealing of oligonucleotides;
However, when RNAMOT sites were considered as well, longer stems did not correlate with the frequency of isolation in SELEX. For example, site Nos. 8, 12 and 14 (Table 3), which were found by RNAMOT, are also predicted to have long stems, just like the most frequent genomic SELEX isolates (Nos. 1, 2 and 3, Table 2), and yet they were not found in the SELEX process. They fit the randomized sequence SELEX consensus stems (Schneider et al. (1992) J. Mol. Biol. 228:862-9) as well or better than the most frequent genomic SELEX isolates. They also bind MS2 CP rather well. Site Nos. 8 and 14 bind to MS2 CP with affinities between those of SELEX isolate Nos. 1 and 2 (data not shown). Site No. 12 binds MS2 CP with affinity only slightly weaker than SELEX isolate No. 6.
In short, the only parameters that apparently affect isolation of any particular molecule in the SELEX process are the molecule's affinity and its frequency in the starting library. Perhaps the sites predicted by RNAMOT, but not found in SELEX, were less frequent in the library.
Examples 1 and 2 demonstrate methods for generating nucleic acid ligands in which the participation of the fixed region in binding to the target is minimized or eliminated by changing fixed region sequences or by annealing of complementary nucleotides to the fixed regions. These methods were demonstrated using the Genomic SELEX methodology; however, it would be known by one of skill in the art that these methods are not specific to the Genomic SELEX methodology, but can by applied to the more broad SELEX methodology.
EXAMPLE 3This Example provides general procedures followed by and incorporated into Examples 4-12.
Materials
Recombinant human Transforming Growth Factor Beta 1 (hTGFβ1) and human Vascular Endothelial Growth Factor (VEGF) were from R&D Systems (Minneapolis, Minn.). DNA and RNA modifying enzymes were from Roche Molecular Biochemicals (Indianapolis, Ind.), BRL (Gaithersburg, Md.), or NEB (Beverly, Mass.) or PE (Foster City. Calif.). Biotin-21-dUTP was from Clontech (Palo Alto, Calif.), terminal deoxynucleotidyl transferase was from Clontech (Palo Alto, Calif.) or Roche Molecular Biochemicals (Indianapolis, Ind.). T7 RNA polymerase, 2′F-modified CTP and UTP were prepared in house. Taq DNA polymerase was from Perkin Elmer (Foster City, Calif.). DNA oligonucleotides were obtained from Operon Technologies, Inc. (Alameda, Calif.). All other reagents and chemicals were from commercial sources.
Affinity Selection (SELEX)
The SELEX procedure has been described in detail in the SELEX Patent Applications. The DNA templates contained either 40 or 30 random nucleotides, flanked by 5′ and 3′ constant regions for primer annealing sites for PCR and cDNA synthesis (Table 5). Truncation SELEX started with VEGF round 12 VT30 or TGF∃1 round 13 40N7 or 30N7 pools. These pools were described previously (see Ruckman et al. (1998) J. Biol. Chem. 273:20556-67 and U.S. Ser. No. 09/046,247, filed Mar. 23, 1998). Selection conditions for truncation SELEX are summarized in Tables 6A-D. RNA pools were prepared by transcription with about 5 μM DNA template, 5 units/μl T7 RNA polymerase, 40 mM Tris-HCl (pH8), 12 mM MgCl2, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 2-4 mM each 2′OH ATP, 2′OH GTP, 2′F CTP, 2′F UTP, and 0.25 μM α32P-ATP (800 Ci/mmole). When necessary, RNA pools were prefiltered and/or preadsorbed with multiple layers of same nitrocellulose filter type used in the SELEX process in order to reduce the frequency of molecules selected for nitrocellulose binding. To prepare binding reactions, the RNA molecules were incubated with recombinant h TGF∃1 in Dulbecco's Phosphate-Buffered Saline (DPBS) (Life Technologies, Gaithersburg, Md.) containing 1 mM MgCl2 and 0.01% human serum albumin or with recombinant VEGF in TBS (Sambrook et al., Molecular Cloning: A Laboratory, Manual, 2nd Edition, Cold Spring Harbor, N.Y., 1989) containing 1 mM MgCl2, 1 mM CaCl2 and 0.01% human serum albumin. Following incubation at 37° C. (about 30 minutes) the protein-RNA complexes were partitioned from unbound RNA by capture on nitrocellulose. Nitrocellulose filter bound RNA was recovered by phenol/urea extraction. Pools were amplified by RT/PCR or PCR. Reverse transcriptions were done by AMV reverse transcriptase at 48° C. for 60 minutes in 50 mM Tris-HCl pH 8.3, 60 mM NaCl, 6 mM Mg(OAc)2, 10 mM DTT, 50 pmol DNA 3′ primer (3G7) (Table 5), 0.4 mM each of dATP, dCTP, dGTP, and dTTP, and 1 unit/μl AMV RT. PCR amplifications were done with 2 μM each 3G7 and 5G7 primers (
Nitrocellulose Filter Partitioning
To partition the protein-RNA complexes away from uncomplexed RNA, the binding reactions were filtered through nitrocellulose/cellulose acetated mixed matrix, 0.45 μm pore size filter disks, type HA, (Millipore, Co., Bedford, Mass.). For filtration, the filters were placed onto a vacuum manifold and wetted by aspirating 5 ml of binding buffer. The binding reactions were aspirated through the filters, then filters were washed with 5-50 ml of binding buffer (without BSA) and counted in a scintillation counter (Beckmann). When necessary, nitrocellulose filters were preblocked with 2 ml of PBS +0.01% BSA to reduce background binding of RNA.
Nitrocellulose partitioning was also used for determining the equilibrium dissociation constants of RNA ligands to hVEGF or hTGFβ1. High specific activity transcripts for affinity determination were prepared in 20 μl reactions containing 5 μl crude PCR product and 15 μl transcription mix (3.9 μl 5× transcription buffer, 0.1 μl 1 mM ATP, 0.2 μl 100 mM GTP, 0.6 μl 100 mM 2′F-CTP, 0.6 μl 100 mM 2′F-UTP. 2.5 μl α-32P-ATP (800 Ci/mmol, NEN, Boston, Mass.), 0.5 μl T7 RNA polymerase (at 14.7 μM)). Following incubation (1 hour—overnight), transcripts were gel purified from denaturing polyacrylamide TBE gels (for example 10% or 15%, Novex, San Diego, Calif.) and were used at about 25,000-50,000 cpm per 8-12 point binding curve. Binding curves obtained by nitrocellulose filtration indicated that RNA pools and some RNA ligands bind monophasically while others bind biphasically. Biphasic binding can be described as the binding of two affinity species derived from the same ligand sequence that can fold into alternate structures that are kinetically trapped and are not in equilibrium.
To obtain the monophasic equilibrium dissociation constants of RNA ligands to hTGFβ1the binding reaction:
KD
R:P→R+P
-
- R=RNA
- P=Protein
- KD=dissociation constant
is converted into an equation for the fraction of RNA bound at equilibrium:
q=(f/2RT)(PT+RT+KD−((PT+RT+KD))2−4PTRT)1/2) - q=fraction of RNA bound
- PT=total protein concentration
- RT=total RNA concentration
- f=retention efficiency of RNA-protein complexes
The average retention efficiency for RNA-TGF∃1 complexes on nitrocellulose filters is 0.4-0.8. Biphasic binding data were evaluated with the equation:
q=2PT+RT+KD1+KD2−[(PT+X1R1+KD1)2−4PTX1RT]1/2−[(PT+X2RT+KD2)2−4PTX2RT]1/2,
where X1 and X2 are the mole fractions of the affinity species R1 and R2 and KD1 and KD2 are the corresponding dissociation constants.
The KDs were determined by least square fitting of the data points using the software Kaleidagraph (Synergy Software, Reading, Pa.).
RNaseH Digestion
Primer binding sites of RNA transcripts were removed by RNaseH digestion as follows. Gel purified 2′fluoro-pyrimidine modified RNA (about 200 pmoles) was incubated with 0.1 mM each final concentration of 3H7 and 5H7 oligonucleotides (Table 7) in 50 μl volume. The transcript-oligonucleotide mix was heated at 95° C. for 4 minutes, incubated at 50° C. for 10 minutes and at 37° C. for 2 minutes and was supplemented with 5 μl of 10× RNaseH buffer (200 mM Hepes-KOH, pH 9.0, 500 mM KCl, 100 mM MgCl2) and 25 μl of RNaseH (1 U/μl, Roche Molecular Biochemicals, Indianapolis, Ind.). The transcripts were digested at 37° C. for 30-60 minutes and then were ethanol precipitated in 2 M ammonium acetate in the presence of 20 μg of glycogen carrier (Roche Molecular Biochemicals, Indianapolis, Ind.) and resuspended in appropriate volume of H2O. RNaseH digestion of small amounts (0.03-0.5 pmoles) of high specific activity RNA was done in a smaller volume (usually 20 μl) in the presence of 1 unit of RNaseH and 250 nM each 3H7 and 5H7.
Mapping of RNaseH Digestion Sites
To map RNaseH digestion sites, 2′F RNA transcripts of ligands VT30-07 and VT30-44 (Ruckman et al. (1998) J. Biol. Chem. 273:20556-67) were 32P labeled at their 5′ or 3′ ends. For 5′ end labeling, 2.5 pmols of each transcript were phosphatased in 25 μl reactions containing 2.5 units shrimp alkaline phosphatase (Roche Molecular Biochemicals cat#1 758250) in manufacturer's specified buffer, for 60 minutes at 37° C. Following heat inactivation at 70° C. for 20 minutes, the phosphatased RNA was kinased with T4 polynucleotide kinase (Roche Molecular Biochemicals cat# 709557) per manufacturer's instruction and 2 μCi γ32P-ATP (10 Ci/mmole, New England Nuclear, cat#NEG502) at 37° C. for 30 minutes. For 3′ end labeling, 10 pmols of each transcript were incubated with T4 RNA ligase (Roche Molecular Biochemicals cat#1449478) and 10 pmols of Cytidine 3′,5′-bis(phosphate), [5′-32P] (3000 Ci/mmol, New England Nuclear, cat# NEG019A) in 30 μl (total) of reaction buffer containing 10% DMSO. Ligation reactions were incubated at 4° C. overnight. Labeled RNA was recovered by ethanol precipitation in the presence of glycogen as carrier (Roche Molecular Biochemicals, cat# 901393) and gel purified from a denaturing 10% polyacrylamide 8M urea gel. About 105 cpm equivalents of labeled RNA was then digested by RNaseH as described before using such oligonucleotides to digest the 5′ end labeled RNA at its 3′ primer binding site while the 3′ end labeled RNA at its 5′ primer binding site. Following RNaseH digestion, the RNAs were recovered by ethanol precipitation with glycogen as above. To prepare size markers, RNA equivalent to 2.5×105 cpm were subject to alkaline hydrolysis as follows. RNAs were incubated in 50 mM NaCO3 pH 9.75 at 92° C. for 12 minutes and was then neutralized with 2 μl (a tenth volume) 3M Na(CH3COO) pH 5.5. Hydrolyzed RNAs were recovered by ethanol precipitation as above. RNaseH digested and alkaline hydrolyzed RNAs were then analyzed on a 15% acrylamide, 8M urea gel.
Mapping of 5′ RNaseH Digestion Sites by Primer Extension
To map the RNaseH digestion sites by primer extension, 200 pmol 2′F RNA transcripts of ligands VT30-07 and VT30-44 (Ruckman et al. (1998) J. Biol. Chem. 273:20556-67) were RNaseH digested and gel purified as above. Primer 3G7 was 5′ end labeled with T4 polynucleotide kinase (Roche Molecular Biochemicals cat# 709557) per manufacturer's instructions and 4 μCi γ32P-ATP (10 Ci/mmole, New England Nuclear, cat#NEG502) at 37° C. for 30 minutes followed by heat inactivation at 70° C. for 10 minutes. For sequencing reactions, 0.5 pmoles of template (RNaseH digested VT30-01 or VT30-44) were mixed with 5 pmoles of kinased 3G7 primer in 10 μl 1×RT-no-Mg buffer (50 mM Tris-HCl, pH 8.6, 60 mM NaCl, 10 mM DTT), incubated at 70° C. for 5 minutes and chilled on ice. Extension reactions were set in 5 μl volumes, utilizing 2 μl of the annealing mix, and 0.2 mM (final concentration) dideoxy mix (A or C or G or T) in 1× RT buffer (50 mM Tris-HCl pH 8.6. 60 mM NaCl, 10 mM DTT, 6 mM Mg(CH3COO)2) and 5 U AMV RT (Boheringer Mannhein cat# 1495062). Dideoxy mixes were prepared in 5× concentration containing one dideoxy nucleotide at 1 mM and each dNTP at 1.87 mM, in 1× RT buffer (50 mM Tris-HCl, pH 8.6, 60 mM NaCl, 10 mM DTT, 6 mM Mg(CH3COO)2) supplemented to 24 mM Mg(CH3COO)2). Extension reactions were incubated at 37° C. for 15 minutes, supplemented with formamide dye, denatured at 95° C. for five minutes and analyzed on an 8% polyacrylamide, 8 M urea gel.
Short Primer RT/PCR
Primers and templates are as shown in Table 8. RT reactions were set in 50 μl volume 1× reaction buffer (manufacturer supplied), containing 1 μM primer 3GTR, 0.4 mM each dNTP and 25 Us AMV RT (Boheringer Mannhein cat# 1495062). Prior to adding the RT, reaction mixes were denatured at 95° C. for 3 minutes, annealed at 40° C. for 10 minutes and following the addition of RT, they were incubated at 40° C. for 45 minutes. RT reactions were then supplemented to 100 μl PCR reactions containing 1× buffer (manufacturer supplied) 3 mM MgCl2. 0.5 mM each dNTP, 1 μM each 3GTR and 5GTR primers, 10% DMSO and, 5 Us Taq DNA polymerase (Perkin Elmer, cat#1248). PCR reactions were denatured at 93° C. for 3 minutes and then cycled (20-25 cycles) at 93° C. 2 minutes, 40° C. 1 minute. 72° C. 1 minute. PCR products were analyzed on 10% polyacrylamide TBE gels and used for transcription without purification.
RNA Ligation
Primer binding sites at the 3′ end were introduced to RNA using RNA ligations by mixing 16 μl (about 1 pmole) RNA, 3 μl 10× buffer (500 mM HEPES pH 7.8, 200 mM MgCl2, 35 mM DTT, 100 μg/ml BSA), 1 μl 3′ oligo (5′-CAGACGACTCGCCCGA (SEQ ID NO: 174) or 5′-GACGACTCGCCCGA (SEQ ID NO:175)) at 20 μM, 6 μl DMSO, and 1 μl RNA ligase (10 U/μl, Roche Molecular Biochemicals, Indianapolis, Ind.). Reactions were incubated at 4° C. for 12-16 hours and ligated RNA was purified by ethanol precipitation in the presence of 10 μg glycogen. Purified RNA usually was resuspended in water.
DNA Ligation
Primer binding sites at the 5′ end were introduced by ligation at the 3′ end of cDNA synthesized on selected RNA. For reverse transcription, to 18 μl of 3′ end ligated RNA we added 2 μl of 3G7 primer (Table 5) at 100 μM, and the mix was annealed by heating at 95° C. for 5 minutes, then at 55° C. for 10 minutes, followed at 37° C. for 15 minutes and 25° C. for 5 minutes. Following annealing, the reaction was supplemented with 8 μl 5× superscript builder (Roche Molecular Biochemicals, Indianapolis, Ind.), 5 μl H2O, 4 μl DTT at 100 mM, 2 μl dNTPs at 10 mM each, and 1 μl superscript (200 U/μl, Roche Molecular Biochemicals, Indianapolis, Ind.). The reaction was then incubated at 45° C. for 45 minutes, the enzyme was heat inactivated at 95° C. for 5 minutes, and the cDNA was ethanol precipitated in 2M ammonium acetate, resuspended in 14 μl water and carried into a ligation reaction where it was supplemented with 2 μl preannealed bridge/linker (Table 4. Set One or Two) at 10 μM, heated at 42° C. for 10 minutes and 25° C. for 10 minutes, supplemented with 2 μl ligase storage buffer (Roche Molecular Biochemicals, Indianapolis, Ind.), 2 μl 10× ligation buffer (Roche Molecular Biochemicals, Indianapolis, Ind.),and 1 μl of T4 DNA ligase (5 U/μl, Roche Molecular Biochemicals, Indianapolis, Ind.), and incubated at 16° C. overnight. Half of the ligated cDNA was PCR amplified as follows. In PCR tubes we mixed 14 μl H2O, 2.5 μl 10× amplitaq buffer (Perkin Elmer, Foster City, Calif.), 2.5 μl MgCl2 at 25 mM, 2 μl each 5′(5′N7) and 3′ (3G7) primer (Table 4 and Table 5, respectively), and 2 μl of dNTPs at 10 mM each. The mix was then sealed with wax (ampliwax, Perkin Elmer. Foster City, Calif.), and supplemented above the wax layer with 53 μl H2O, 7.5 μl 10× amplitaq buffer, 3.5 μl MgCl2 at 25 mM, 10 μl ligated cDNA, and 1 μl Taq polymerase (Perkin Elmer, Foster City, Calif.). The mix was cycled 25 times at 54° C. (annealing) for 30 seconds, 72° C. (extension) for 1 minute, and 95° C. (denaturation) for 30 seconds. Amplified products were ethanol precipitated and gel purified on a 6% polyacrylamide TBE gel and reamplified for an additional 10 cycles as above. Final amplified DNA was used as template for transcription.
Truncation SELEX by Ligation
SELEX pools were in vitro transcribed and the generated RNA was digested with RNaseH to remove either both (VEGF) or just the 5′ primer binding site (TGFβ1). Digested RNA was reverse 20 transcribed following (if appropriate) ligation of 3′ primer binding site at its 3′ end. Generated cDNA was ligated with preannealed oligonucleotides 5N7 Linker (5′pCTCCCT ATAGTGAGTCGTATTA (SEQ ID NO:36)), and 5N7 bridge (TAATACGACTCACTATAGGGAGNNNNN (SEQ ID NO:37)) as described above (Table 4). These oligos introduce the T7 promoter and a transcription initiation site GGGAG at the 5′ end of the library's sense strand while removing, the bulk of the 5′ primer binding site (5′Trunc-Library). Resulting cDNA is PCR amplified to generate the starting library as described above. For affinity selection, the 5′Trunc-Library is transcribed with about 5 μM DNA template, 5 units/μl T7 RNA polymerase, 40 mM Tris-HCl (pH 8), 12 mM MgCl2, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 2-4 mM each 2′OH ATP, 2′OH GTP, 2′F CTP, 2′F UTP, and 0.25 μM α32P-ATP (800 Ci/mnmole). The 3′ primer binding site is then removed by RNaseH digestion. Resulting truncate RNA is then incubated with recombinant h TGF∃1 in Dulbecco's Phosphate-Buffered Saline (DPBS) (Life Technologies, Gaithersburg, Md.) containing 1 mM MgCl2 and 0.01% human serum albumin or with recombinant VEGF in TBS (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y., 1989) containing 1 mM MgCl2, 1 mM CaCl2 and 0.01% human serum albumin. Following incubation at 37° C. (about 30 minutes) the protein-RNA complexes were partitioned from unbound RNA by capture on nitrocellulose. Nitrocellulose filter bound RNA was recovered by phenol/urea extraction. When necessary, RNA pools were prefiltered and/or preadsorbed with multiple layers of same nitrocellulose filter type used in the SELEX process in order to reduce the frequency of molecules selected for nitrocellulose binding. Affinity selected RNA was ligated to the 3′primer binding site, and was reverse transcribed into cDNA as described above. Resulting cDNA was ligated with preannealed oligonucleotides 5G7 RC Linker (5′pTATAGTGAGTCGTATTA (SEQ ID NO:34)) (Table 4), and 5′N7 (TAATACGACTCACTATAGGGAG (SEQ ID NO:46)) (Table 8) and PCR amplified as described above to generate the next Truncate SELEX pool.
Streptavidin Gel Shift on Denaturing Gels
Streptavidin gel shifts on denaturing gels (Pagratis (1996) Nucleic Acids Research 24:3645-6) was used to either analyze the presence of biotin on oligonucleotides or to purify, ssDNA following PCR. Briefly, biotinylated nucleic acid was mixed with 0.5 mg/mil (final) streptavidin (Pierce, Rockford, Ill.) in buffer (PBS, TFBS, or PCR), incubated at room temperature for 10 min and mixed with equal volume of 2× formamide dye (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y., 1989). Following denaturation at 95° C. for 5 minutes, the mix was resolved on a 10% polyacrylamide 7M denaturing TBE gel (Novex, San Diego, Calif.). To purify end-labeled ssDNA template strand from SELEX pools, 3′ primer was first end labeled by mixing 1 μl of primer at 1 mM, 2 μl of 10× T4 polynucleotide kinase (PNK) buffer (Boheringer Mannhein, Indianapolis, Ind.), 1 μl PNK (Boheringer Mannhein, Indianapolis, Ind.) at 10 u/μl, and 16 μl of γ-32P-ATP (3000 Ci/mmole, NEN, Boston, Mass.), and incubating at 37° C. for 30 minutes. The labeled primer (in 20 μl) was then heat treated at 65° C. for 10 minutes and mixed with 5 μl crude PCR template (SELEX pool), 40 μl 10× PCR buffer (Perkin Elmer, Foster City, Calif.), 48 μl 25 mM MgCl2, 20 μl 10 mM each dNTP, 1 μl 1 mM 5′ primer which contains 3 biotin molecules at its 5′end (incorporated as phosphoramidites, Operon Technologies, Alameda, Calif.), and 4 μl Taq polymerase (Perkin Elmer, Foster City, Calif.), in 400 μl final volume and was PCR amplified for 15 cycles as described before. The volume of the amplified DNA was then reduced to 50 μl using microcon 30 cartridges (Amicon, Beverly, Mass.), mixed with 5 μl of streptavidin (Pierce, Rockford, Ill.) at 5 mg/ml, incubated at room temperature for 10 minutes, mixed with equal volume of 2× formamide dye, and denatured and electrophoresed as described above. Following electrophoresis the radioactive band was purified by crushing-soaking and ethanol precipitation.
RNA 3′ Biotinylation Using RNA Ligase
Acceptor RNA (0.1-10 pmole) was incubated with 20-200-fold excess donor dinucleotide (
RNA 3′ Biotinylation Using Terminal Deoxynucleotidyl Transferase
Selected RNA was biotinylated by terminal deoxynucleotidyl transferase by mixing 3 μl RNA (about 1 pmole), 2 μl 5× (Clontech, Palo Alto, Calif.) buffer, 0.5 μl 25 mM CoCl2, 2 μl 0.5 mM Biotin-21-dUTP (Clontech, Palo Alto, Calif. or Roche Molecular Biochemicals, Indianapolis. Ind.), and 2 μl terminal deoxynucleotidyl transferase (25 U/μl, Clontech, Palo Alto, Calif. or Roche Molecular Biochemicals, Indianapolis, Ind.), in total of 10 μl reaction volume. Reactions were incubated at 37° C. for 3 hours and labeled RNA was used as is or alter ethanol precipitation.
Hybrid Formation
Selected RNA was biotinylated and then was mixed with ssDNA templated strands purified (as described) at 10× excess DNA over RNA, 1000× excess synthetic 40-mer oligonucleotide DNA randomized at each position, 2 μl 10× renature buffer (100 mM Tris, pH 7.5, 10 mM EDTA), 2 μl 500 mM NaCl in a total volume of 18 μl. The mix was heated at 95° C. for 4 minutes, transferred on ice for 10 minutes, supplemented with 2 μl of 10 mM cetyltrimethylammonium bromide (CTAB), and annealed overnight at 72° C. Following overnight hybridization the reaction was stopped by adding 30 μl of 1× renature buffer containing 0.2% SDS, and ethanol precipitated in 2 M ammonium acetate and 10 μg glycogen (Roche Molecular Biochemicals, Indianapolis, Ind.). The pellet was resuspended in 1× renature buffer and hybridized ssDNA strands were capture by streptavidin gel shift on native gels or by streptavidin agarose beads (cat# 20349, Immunopure immobilized streptavidin, Pierce, Rockford, Ill.).
Hybrid Selection by Streptavidin Beads
Following hybridization and ethanol precipitation, the reactions were resuspended in 100 μl 1× renature buffer-50 mM NaCl. Streptavidin-agarose beads (50 μl) were washed in 0.45 μm spin-X filter units (costar, Cambridge, Mass.), 2 times with 250 μl 1× renature buffer-50 mM NaCl and incubated with the 100 μl of hybridization mix for 10 minutes at room temperature. Noncaptured nucleic acid was removed and the beads were washed 3 times with 250 μl 1× renature buffer-50 mM NaCl (or until counts are no longer in the wash) and captured ssDNA was eluted by adding 100 μl H2O incubated at 95° C. for 5 minutes. Collected ssDNA was supplemented with 20 μl 10× Taq buffer, 24 μl 25 mM MgCl2, 10 μl 10 mM each dNTPs,0.5 μl each 1 mM 3G7 and 5G7, 2 μl Taq polymerase in total volume of 200 μl and PCR amplified taking 30 μl samples after 3, 6, 9, 12, and 15 cycles for electrophoretic analysis (8 μl). The PCR aliquot with the best signal to noise ratio was amplified further in 400 μl PCR reactions for additional 15 cycles.
Hybrid Selection by Gel Shift
Following hybridization and ethanol precipitation, the reactions (usually 15 μl total) were supplemented with streptavidin at 2.5 mg/ml (final concentration), incubated at room temperature for 10 minutes supplemented with 6× glycerol dye to final 1× and electrophoresed on a 6%, 0.5× TBE gel, at 150 volts, for 30 minutes at room temperature. Streptavidin shifted bands were visualized following auto-radiography and excised to recover ssDNA following crush-soaking and ethanol precipitation. Eluted ssDNA was then PCR amplified as in the hybrid selection by streptavidin beads.
Truncation SELEX by Hybrid Selection
SELEX pools were in vitro transcribed and the generated RNA was digested with RNaseH to remove both primer binding sites. Resulting truncate RNA was then incubated with recombinant h TGF∃1 in Dulbecco's Phosphate-Buffered Saline (DPBS) (Life Technologies, Gaithersburg, Md.) containing 1 mM MgCl2 and 0.01% human serum albumin or with recombinant VEGF in TBS (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y., 1989) containing 1 mM MgCl2, 1 mM CaCl2 and 0.01% human serum albumin. Following incubation at 37° C. (about 30 minutes) the protein-RNA complexes were partitioned from unbound RNA by capture on nitrocellulose. Nitrocellulose filter bound RNA was recovered by phenol/urea extraction. When necessary. RNA pools were prefiltered and/or preadsorbed with multiple layers of same nitrocellulose filter type used in SELEX in order to reduce the frequency of molecules selected for nitrocellulose binding. Affinity selected RNA was biotinylated with either terminal deoxynucleotidyl transferase or RNA ligase as described above, and was hybridized to purified ssDNA from the same pool as described. Hybridized molecules were then captured by either streptavidin beads (TGFβ1) or streptavidin gel shifts (VEGF) and were PCR amplified to generate the next Truncation SELEX pool.
Cloning and Sequencing
RNA recovered from the final-round filters was reverse transcribed and PCR amplified as in every round. The PCR products were purified by PAG electrophoresis and cloned into the SrfI restriction site of pCR-Script Direct SK(+) plasmid using the pCR-Script Amp SK(+) cloning kit (STRATAGENE CLONING SYSTEMS, La Jolla, Calif.). Clones were sequenced with ABI Prism sequencing kit (Applied Biosystems, Perkin-Elmer, Foster City, Calif.).
TGF∃1 Bioassay
The bioactivity of TGFμ1 nucleic acid ligands was measured with mink lung epithelial cells as described in U.S. patent application Ser. Number 09/046,247, filed Mar. 23, 1998. Briefly, proliferation of these cells is inhibited by TGFβ1. Human TGFβ1 was titrated on the cells and 3H-thymidine incorporation was measured. The point at which 3H-thymidine incorporation by the cells was inhibited by 90-100% was determined (typically 1-4 pM). This inhibitory amount of TGFβ1 along with varying amounts of nucleic acid ligand (typically 0.3 or 1 nM to 1 or 3 μM, in 3 fold increments) was used. Cells were plated at 1×105/ml in 96-well plates in 100 μl MEM, 10 mM HEPES pH 7.5, 0.2% FBS. Following 4 hours of incubation at 37° C., when cells were well attached to the well surface, TGFβ1 was added at 1-4 pM with or without nucleic acid ligands as follows: the ligands were diluted across the 96 well plate in 3-fold dilution steps and then TGFβ1 was added at 1-4 pM to all wells except controls. The cells were incubated for 16-18 hours prior to addition of 3H-thymidine, and continued incubation for 20 additional hours following 3H-thymidine addition at 0.25 μCi per well. After incubation, the cells were lysed with 1% Triton X-100 and harvested onto GF/B filter plates by the Packard 96 well plate harvester, and 3H-thymidine incorporation in cellular DNA was quantitated by scintillation counting in microscint at the Packard Top-Count. Data were plotted as % of max 3H-thymidine incorporation vs RNA concentration and were fitted by the software Kaleidagraph (Synergy Software, Reading, Pa.) to the equation m3*(m0+m1+(m2)−((m0+m1+(m2))*(m0+m1+(m2))-4*(m0)*((m2))){circumflex over ( )}0.5)/(2*(m2)); where m0 is the concentration of competitor RNA; m1 is the IC50, m2 is the concentration of TGF∃1, and m3 is the plateau value of the fraction of max 3H-thymidine incorporation. Ki values were determined from IC50 values according to the equation Ki=IC50/(1+([T]/KdT), where [T] is the molar concentration of TGF∃1 present in the assay and KdT is the concentration of TGFβ1 causing 50% inhibition of MLEC proliferation as determined by TGFβ1 titration experiments.
EXAMPLE 4RNaseH Digestion
For application of RNaseH site specific cleavage of RNA to truncation SELEX where 2′F modified nucleotides are present, it is necessary that RNaseH is able to digest 2′F-deoxyribopyrimidine substituted RNA. In addition, in order to eliminate the bulk of the 3′ primer binding site, it would be desirable for the RNaseH to accept targeting oligonucleotides that include the 2′deoxyribonucleotide gap at its 3′end.
RNaseH is an enzyme that recognizes RNA-DNA hybrids and digests the RNA strand through an endonucleolytic mechanism (Hostomsky et al., Cold Spring Harbor Laboratory Press, New York, pp. viii, 499, 1993). RNaseH is a ubiquitous enzyme found in procaryotes and eukaryotes mechanism (Hostomsky et al., Cold Spring Harbor Laboratory Press, New York, pp. viii, 499, 1993). E. coli encodes at least two RNaseH isotypes on separate genes (Itaya (1990) Proc. Natl. Acad. Sci. U.S.A. 87:8587-91). The E. coli RNaseH1 is most extensively studied. The digestive mechanism of E. coli RNaseH1 is similar to DNases where the 2′OH group does not participate in the nucleophilic attack of the phosphodiester bond and the product ends are 3′OH and 5′P (Crooke et al. (1995) J. Biochemistry 312:599-608). It has been shown that E. coli RNaseH 1 could be used for site directed digestion of RNA using DNA molecules complementary to the site of digestion (Inoue et al. (1987) FEBS Letters 215:327-330). The digestion site could be targeted to a single position using chimeric targeting oligonucleotides containing regions of 2′deoxyribonucleotides flanked by regions of 2′OMe nucleotides (Inoue et al. (1987) FEBS Letters 215:327-330) taking advantage of the inability of the enzyme to digest RNA-2′OMeRNA hybrids (Inoue et al. (1987) FEBS Letters 215:327-330: Lima and Crooke (1997) Biochemistry 36:390-398). The length of the 2′deoxyribonucleotide region influences the function of the E. coli RNaseH1 where the cleavage rate is decreased with diminishing number of contiguous 2′deoxyribonucleotides, where no cleavage occurring with less than four contiguous 2′deoxyribonucleotides (Monia et al. (1993) J. Biol. Chem. 268:14514-22; Crooke et al. (1995) J. Biochemistry 312:599-608). The site of cleavage by E. coli RNaseH1 of RNA bound to chimeric oligonucleotide containing a 2′deoxyribonucleotide region flanked by 2′OMe-ribonucleotide regions, has been demonstrated to occur at the 3′site of the RNA base found opposite to the most 5′ nucleotide of the 2′deoxyribonucleotide region (Inoue et al. (1987) FEBS Letters 215:327-330; Crooke et al. (1995) J. Biochemistry 312:599-608; Lapham and Crothers (1996) RNA 2:289-296). Cleavage by E. coli RNaseH1 can occur when the targeting chimeric oligonucleotide contains at least 4 contiguous 2′deoxyribonucleotides in the middle or at the 5′end (Inoue et al. (1987) FEBS Letters 215:327-330; Lapham and Crothers (1996) RNA 2:289-296), but not at the 3′ end (Inoue et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87:8587-91) of the targeting chimeric oligonucleotide. Recently, different digestion specificities were found depending on the commercial source of RNaseH used, where RNaseH from Pharmacia (cat.#27-0894). Sigma (cat. R-6501) or Takarashuzo digest like the E. coli RNaseH1, while RNaseH from Roche Molecular Biochemicals (cat.#786-349) cleaves at one base upstream of the expected site (Lapham et al. (1997) RNA 3:950-951). The effect of 2′F modifications was determined with E. coli RNaseH1 in examples where the modified bases were at the targeting oligonucleotide. Full 2′F modified targeting oligonucleotides reduced the overall affinity of RNaseH1 for the hybrid complex with RNA (Crooke et al. (1995) J. Biochemistry 312:599-608). Replacing 2′OMe-deoxyribonucleotide positions of the chimeric targeting oligonucleotide (which include a gap of 2′deoxyribonucleotides in the middle) with 2′F-2′deoxy-nucleotides reduced the initial cleavage rate by about 5 fold. The effect of 2′F modification of the RNA substrate, instead of the targeting oligonucleotide, was determined only at a single site, namely at the site of cleavage and found to reduce the reaction rate by 1000-fold (Uchiyama et al. (1994) J. Mol. Biol. 243:782-791).
The ability of E. coli RNaseH obtained from Pharmacia and Roche Molecular Biochemicals to cleave 2′F-deoxyribopyrimidine substituted RNA with chimeric oligonucleotides containing 11 or 12 2′OMe-deoxyribonucleotides and a gap of 4 contiguous 2′deoxyribonucleotides at either their 5′ or 3′ end (
The data presented here clearly show for the first time, that RNase H can digest 2′F-deoxyribopyrimidine substituted RNA at a specific site, directed by an appropriate targeting oligonucleotide. They also show, for the first time, that the Roche Molecular Biochemicals enzyme can use targeting oligonucleotides containing a gap of four contiguous 2′deoxyribonucleotide bases at its 3′ end.
EXAMPLE 5Biotinylation of RNA
The truncation-SELEX-by-hybridization protocol requires the ability to biotinylate RNA following RNaseH digestion and affinity selection. There are several procedures that allow such RNA modification of which two were tested with RNaseH digested RNA, namely photo biotinylation and tailing by Terminal Deoxynucleotidyl Transferase (TdT). In addition, biotinylation scheme was developed using RNA ligase. Extent of biotinylation was determined by measuring streptavidin complexing of body labeled RNA by either gel shift, or capture to streptavidin loaded-beads (Pierce) or -membranes (Promega).
For photobiotinylation and tailing reactions, commercially available kits (Clontech) were used per manufacturer's instructions. From these two methods only the tailing reaction was successful. By using the enzyme and reaction buffer from Roche Molecular Biochemicals (Indianapolis, Ind.) it was observed that biotinylation efficiencies could be improved.
As stated above, we developed a new RNA biotinylation method based on T4 RNA ligase. In analogy to the RNA labeling reaction utilizing 32PCP (Cytidine 3′,5′-bis(phosphate), [5′-32P]), two biotinylation substrates were used as shown in
Specificity of Hybridization
The success of the truncation SELEX by hybridization depends on the ability of the selected biotinylated truncated RNA to specifically hybridized to its complementary sequence. The hybridization specificity of an evolved pool (VEGF Rd2), (Ruckman et al. (1 998) J. Biol. Chem. 273:20556-67) in the presence of different amounts of excess salmon sperm DNA (
Truncation-SELEX-by-Hybrid-Selection
The truncation SELEX by hybrid selection protocol was applied to two pools. The first pool, Round 12 VT30, was derived from the 30N7 random library, and was selected for binding to VEGF for 12 rounds (Ruckman et al. (1998) J. Biol. Chem. 273:20556-67). The second pool, Round 12 40N-TGF∃1, was derived from the 40N7 random library, and was selected to bind TGF∃1 for 12 rounds as described in U.S. patent application Ser. No. 09/046,247, filed Mar. 23, 1998. These pools were selected because removal of fixed regions did not completely eliminate binding to their respective targets.
Affinity selections were done as described in Example 3. The conditions of affinity selections are summarized in Tables 6A and 6B. The RNA used at each round was generated by RNaseH digestion as described in Example 3. We used two different methods to partition the hybrids following hybridization. For the VEGF pool, a gel shift method was used on native gels while for the TGF∃1 pool streptavidin-agarose beads were used as described in Example 3.
As seen in Tables 6A and 6B improving signal to noise ratios and an increase of the amount of RNA binding to the target were observed suggesting the selection process was successful. Pools Rd1-VEGF, Rd1-ct-VEGF and Rd2-TGF∃1 truncation by a hybridization SELEX experiment were cloned and sequenced.
RNA Sequences from the Truncation SELEX by Hybrid Selection
Twenty four clones from the Rd1-VEGF and Rd1-ct-VEGF were sequenced, and 70 clones from the Rd2-TGF∃1 truncation by hybridization SELEX pools were sequenced. The sequences obtained, and their alignment, suggested family classification, and binding properties are summarized in Tables 9-11.
Greater than half of the sequences from the two VEGF experiments could be classified into Family 1 and Family 3 identified in the previous SELEX experiment with VEGF (Ruckman et al. (1998) J. Biol. Chem. 273:20556-67). The remaining ligands represent orphan sequences although some have some limited homology to ligands from Family 2 of the original SELEX experiment. Family 2 from the Rd1-VEGF pool contained isolates of frequent ligands from the original SELEX experiment, namely VT30.3 and VT30.1. Interestingly their relative frequencies is opposite from the relative frequency seen in the original SELEX experiment but consistent in their binding phenotype in the presence or absence of their fixed sequences.
Sequences from the Rd2-TGF∃1 truncation by hybridization SELEX pool can be assigned into ten groups, namely 9 families and a group of orphans. The largest family contains ligands that have been identified as nitrocellulose binding molecules in previous experiments (TGF∃1 patent). The remaining families are rather small and they could be clonal derivatives of unique sequences by PCR mutations. Families 1 and 5 resemble families 3 and 1, respectively, from the TGF∃1 SELEX described in U.S. patent application Ser. No. 09/046,247, filed Mar. 23, 1998.
Binding Properties of Ligands from the Truncation SELEX by Hybrid Selection
The binding activity of several ligands was determined by nitrocellulose filter binding, and data are summarized in Tables 9-11.
Binding activities of ligands from the VEGF experiments were compared in the presence or absence of fixed sequences. Several ligands were also analyzed in the same way from the starting pool (Rd12 VT30) as shown in Table 12. Ligands from all pools included example of both monophasic and biphasic binding. Each ligand was then scored and classified into five groups as follows: (1) ligands that lose significant affinity for VEGF upon removal of their fixed sequences; (2) molecules with affinities for VEGF somewhat affected (positively or negatively) upon removal of their fixed sequences; (3) molecules that gain significant affinity for VEGF upon removal of their fixed sequences; (4) molecules with affinities for VEGF not affected upon removal of their fixed sequences; and (5) non-binding ligands either with or without fixed sequences. For quantitative comparison, the data were analyzed in % plateau vs Kd values (
Since in the original TGF∃1 SELEX we did not isolate any truncatable ligands, finding any truncatable ligand in the truncation SELEX pools would be an indication of the successful application of the methods described here. The binding of the ligands from the TGF∃1 truncation SELEX was determined only after RNaseH digestions and the data are summarized in Table 11. More than half (52%) of ligands tested bound the target with high affinity in the absence of fixed sequences. Sample binding curves are shown in
Ligation of 3′ Primer Binding Sequence
One of the essential steps of the truncation SELEX by ligation process is the introduction of the 3′ fixed sequence at the 3′ end of the selected RNA by ligation. The ability of T4 RNA ligase to catalyze such a reaction utilizing RNA transcripts ,generated by two different templates (35N-Nae and 35N-Bsm) was determined as shown in
Ligation of 5′ Primer Binding Sequence
A second essential step of the truncation SELEX by ligation process is the introduction of the 5′ fixed sequence to the selected RNA. There are two ways that this can be accomplished. One way is to attach the 5′ fixed sequence to the 5′ end of the selected RNA using T4 DNA ligase and a bridge oligonucleotide. The second way relies on the same type of reaction where the complement of the 5′ fixed sequence is attached to the 3′ end of the cDNA copy of the selected RNA. This cDNA copy is generated following ligation of the 3′ fixed sequence as described above and RT reaction using a primer complementary to the introduced 3′ fixed sequence. Both of these approaches were tested (
For ligation at the 5′ end of 2′F modified RNA, lightly body labeled transcript generated as above on the 35N Bsm template was used. This transcript was then phosphatased by calf intestinal alkaline phosphatase (Roche Molecular Biochemicals, cat#1097075) as described above to remove the phosphate structures generated by transcription initiation (usually a tri- or di-phosphate). The phosphatased RNA was then kinased with T4 polynucleotide kinase and y32P-ATP as described above and then used as a substrate in ligation reactions with T4 DNA ligase from two vendors (Roche Molecular Biochemicals, cat#0481220 and New England Biolabs, cat#202S) containing the oligonucleotide 5G7NOT7 and the bridge oligonucleotide 5G7RC at 20 and 50 fold excess over the RNA, respectively (sequences of DNA oligonucleotides used are shown in
For ligation at the 3′ end of the cDNA, 2′F RNA transcripts from VT30 round 12 pool were reverse transcribed using appropriate primer in the presence of α-32P-dCTP (NEN, 800 Ci/mmol cat#BLU013A). Labeled cDNA was ligated to preannealed 5G7RC Linker/5′N7 or 5N7 Linker/5N7 bridge as described in Example 3 and ligation products were analyzed on denaturing (7M urea) 10% polyacrylamide gels. The linker oligonucleotides were in 2- or 5-fold excess over the cDNA while the bridge oligos were at 3- or 7.5 fold excess. The data shown in
Truncation SELEX by Ligation
We applied the truncation SELEX by ligation protocol to three pools namely, the same two pools used for the truncation SELEX by hybrid selection protocol and in addition the round 12 30N-TGF∃1pool.
For generating the 3′ fixed sequence we used oligo 3G7RC (Table 13) for the VEGF pool while 3G7RCD was used for the TGF∃1 pools. The reason for using 3G7RCD was to avoid repetitions of the sequence 5′CA at the end of the library with each SELEX round due to the RNaseH digestion leaving behind the CA sequence from the fixed sequence. To ensure better efficiency at each round, the starting library was modified by removing a significant portion of 5′ fixed sequence leaving behind the 5′GGGAG transcription initiation site as follows. RNA transcripts from each of the starting pools were RNaseH digested at their 5′ ends, reverse transcribed using a primer complementary to the 3′ fixed sequence, and resulting cDNAs were ligated to the 5N7-Linker/5N7-Bridge set of oligos (
At each round, affinity selections were done as described in Example 3. The conditions of affinity selections are summarized in Tables 6C and 6D. The RNA used at each round was generated by RNaseH digestion at the 3′ fixed sequence as described in Example 3.
As seen in Tables 6C and 6D improving signal to noise ratios and an increase of the amount of RNA binding to the target was observed suggesting the selection process was successful. The starting 5′ truncated starting VEGF pool (designated T1), VEGF round 1 (designated T2), VEGF round 2 (designated T3), TGF∃1-30N round 2, and TGF∃1-40N round 2 pools were cloned and sequenced. The pools from these rounds were chosen for cloning and sequencing based on their binding properties.
EXAMPLE 9RNA Sequences from the Truncation SELEX by Ligation
With the Truncation SELEX by Hybridization protocol it was easy to determine the effect of the selection process on the ligand frequency with respect to the effect of the fixed sequences on their binding activity. This was feasible since the cloned ligands contained both fixed sequences. With the Truncation SELEX by Ligation protocol as it was applied here, this was not feasible because the starting pool was truncated at the 5′ end removing the bulk of the 5′ fixed sequence. To determine the effect of the ligation protocol on the phenotype frequency of selected VEGF ligands, the starting 5′ truncated pool as well as the pools from round 1 and round 2 were cloned and sequenced. 43, 22, and 21 ligands were sequenced from the starting 5′truncated, round 1 and round 2 VEGF pools, respectively. With the TGF∃1 experiment, the ability to identity truncatable molecules was of interest and not in the comparison of phenotype frequencies. Therefore, only the final pools, namely round 2 from both the 30N and 40N experiment were sequenced.
The obtained sequences, their alignment, suggested family classification, and binding properties are summarized in Tables 14-18.
The starting 5′ truncated VEGF pools contained ligands that could be assigned into the three families identified previously (Ruckman et al. (1998) J. Biol. Chem. 273:20556-67) and into a fourth family and a group of orphan sequences pyrimidine rich at their 3′ ends. The conserved sequence found at the 5′ end of members of family 4 is identical to the sequence of the 3′ fixed sequence and most likely this family might represent an artifact of the ligation reactions. As with the unmodified VT30 pool, members of family 2 are rare with only one example found. The majority of sequences in this starting pool contain the 3′ fixed sequence 5′CA probably a remnant of the 3′ terminal sequence removed during the process of construction of this pool. In both of the selected VEGF pools, the frequency of the first three families is increased compared to the starting pool especially for family 2 while the frequency of the orphan sequences was decreased. The selected pools also contained versions of ligand VT30.3 with additional sequences at both ends. Ligand VT30.3 was found in high frequency in the first SELEX experiment (Ruckman et al. (1998) J. Biol. Chem. 273:20556-67). The majority of ligands from the round 2 pool contain multiple copies of the sequence 5′CA at their 3′ ends, presumably a remnant of the RNaseH digested 3′ fixed sequence, which was added with each ligation step and left behind after each RNaseH digestion.
Sequences from the Rd2-30N TGF∃1 truncation by ligation SELEX pool can be assigned into three groups, namely 2 families and a group of orphans. The orphan group contains ligands that have been identified as nitrocellulose binding molecules in previous experiments described in U.S. patent application Ser. No. 09/046,247, filed Mar. 23, 1998. The remaining two families contain several highly homologous members that could be clonal derivatives of one or a few unique sequences by PCR mutations. Family 2 contains ligands that were identified at very low frequency in the first TGF∃1 SELEX experiment described in U.S. patent application Ser. No. 09/046,247, filed Mar. 23, 1998. Namely, there is a group of sequences (20, 27, 19, 12, 34, and 3) that share a large block of common sequence in the majority of the molecule differing only by two bases (5′CA) at their 3′ end and 1-8 bases at their 5′ end possibly due to ligation artifacts. Their common sequence is identical to the sequence of ligand 30-32 isolated in our first SELEX experiment with TGF∃1 described in U.S. patent application Ser. No. 09/046,247, filed Mar. 23, 1998. Ligands from family one are highly conserved (and could be derivatives of a single sequence found in the starting random RNA pool) and were not isolated before. Since we use DNA oligo without the CA sequence at its 5′ end for ligation at the 3′ end o′ TGF∃1 selected RNA, the isolated ligands from the Rd2-30N TGF∃1 truncation by Ligation SELEX pool do not contain the sequence 5′CA at their 3′ ends.
Sequences from the Rd2-40N TGF∃1 truncation by ligation SELEX pool can be assigned into seven families. These families are rather small and they could be clonal derivatives of one or a few unique sequences by PCR mutations. The last family contains ligands with sequences characteristic of nitrocellulose binders. All the ligands from family 1 contain the 3′ fixed sequence of the N7 series at their 5′ end and the majority of them contain at their 3′ ends a large portion of the T7 promoter. Thus, these ligands must represent artifacts of the ligation reactions. Family two contains ligands of the same class as ligands from family 2 of the Rd2-30N TGF∃1 truncation by ligation SELEX pool but the majority of them contain the 3′ fixed sequence at their 5′ ends. Therefore they could be contaminants from the 30N pool that were modified due to undesirable ligation side reactions. Family 2, however, contains three ligands that could be true isolates from the 40N pool. The other families contain ligands that were not identified in U.S. patent application Ser. No. 09/046,247, filed Mar. 23, 1998. Family four contains members that are longer than expected by ten bases. As with the ligands from the 30N pool, the ligands from the 40N pool do not contain the sequence 5′CA at their 3′ end, but unlike the 30N ligands the 40N ligands have a somewhat heterogeneous 5′ initiator sequence.
EXAMPLE 10Binding Properties of Ligands from the Truncation SELEX by Ligation
The binding activity of several ligands from the Truncation SELEX by Ligation experiments was determined by nitrocellulose filter binding and data are summarized in Tables 14-18.
Binding activities of ligands from the VEGF experiments were determined with or without the 3′ fixed sequence. Ligands from all pools included examples of both monophasic and biphasic binding. Example binding curves are as shown in
As with the truncation SELEX by hybridization experiment, the binding of the ligands from the TGF∃1 truncation by ligation SELEX was determined only after RNaseH digestions to remove the 3′ fixed sequence and the data are summarized in Tables 17 and 18. The majority of selected ligands tested bound the target with high affinity in the absence of the 3′ fixed sequence. Sample binding curves are shown in
Truncation SELEX with DNA Libraries
The truncation SELEX process described herein is designed for use with RNA (native or modified) libraries. With slight modification, this approach can be applied to ssDNA libraries. These modifications could be applied to templates engineered to include restriction enzyme recognition sites at the junction of the random region with the 5′ and 3′ fixed sequences (
The data presented in Examples 3-11 clearly demonstrate the feasibility of isolating nucleic acid ligands that utilize just the random region for high affinity binding to their target. To isolate such nucleic acid ligands it is not necessary to start with unselected pools. When starting with evolved pools, selection could happen relatively fast within 1-2 rounds. Two different approaches were described, one based on hybrid selection of complementary full-length molecules and the other based on enzymatic generation of primer binding sites to allow PCR amplification. Both methods gave similar results.
Screening for Ligands of a Certain Size
The experimental demonstration of the method shown in
Minimum size fragments can also be identified in pools of molecules containing truncatable ligands to reasonable frequencies. As shown the reconstruction experiment in
Alkaline hydrolysis is routinely used to create the random cleavage ladders, but it creates homogeneous ladders only with RNA. Modified RNA at the 2′ position of pyrimidines (lives sequence specific incomplete ladders while DNA is not susceptible to alkaline hydrolysis. We tested a group of nucleases for their ability to generate random complete ladders with 2′F-pyrimidine modified RNA. Enzymes tested were mung bean nuclease, nuclease S1, snake venom phosphodiesterase, nuclease S7, and nuclease P1. Only snake venom phosphodiesterase, nuclease S7, and nuclease P1 resulted in homogeneous laddering of the oligonucleotide used (
The consensus binding site elements (
The sites shown double-underlined and in boldface (9, 10 and 19) correspond to SELEX isolates 5, 1 and 3 in TABLE 1. The consensus binding site elements (
The consensus binding site elements (
Bridge/Linker sequences used to ligate at the 3′end of truncated cDNA. Set two was used to constract the starting library only while set one
1Protein concentration in nanomolar
2RNA concentration in nanomolar
3Bound RNA expressed as % of max
4Signal to noise
5Use of nitrocellulose prefiltered RNA
6Use of preblocked nitrocellulose with BSA
7Volume in ml of buffer wash
8Volume in ml of 0.5M urea wash (— indicates no urea wash)
9Pool carried forward to the next round (comb. means that the pools were combined before taken to the next round)
1Protein concentration in nanomolar
2RNA concentration in nanomolar
3Bound RNA expressed as % of max
4Signal to noise
5Use of nitrocellulose prefiltered RNA
6Use of preblocked nitrocellulose with BSA
7Volume in ml of buffer wash
8Volume in ml of 0.5 M urea wash
9Pool carried forward to the next round (comb. means that the pools were combined before taken to the next round)
1Protein concentration in nanomolar
2RNA concentration in nanomolar
3Bound RNA expressed as % of max
4Signal to noise
5Use of nitrocellulose prefiltered RNA
6Use of preblocked nitrocellulose with BSA
7Volume in ml of buffer wash
8Volume in ml of 0.5M urea wash
9Pool carried forward to the next round (comb. means that the pools were combined before taken to the next round)
10Not determined
1Protein concentration in nanomolar
2RNA concentration in nanomolar
3Bound RNA expressed as % of max
4Signal to noise
5Use of nitrocellulose prefiltered RNA
6Use of preblocked nitrocellulose with BSA
7Volume in ml of buffer wash
8Volume in ml of 0.5 M urea wash
9Pool carried forward to the next round (comb. means that the pools were combined before taken to the next round)
10 Not determined
B is biotin. A, G, C, and U are 2′-O-methyl-2′deoxy-ribo-adenosine, -guanosine, -cytidine, or -uridine, respectively, while a, g, c, and t are 2-deoxy-ribo-adenosine, -guanosine, -cytidine, or -thymidine, respectively.
Sequence shown is only from the random region of the molecules. Identical sequences are indicate by additional designation numbers. Ligands that were also found in the first SELEX experiment (Ruckman et al., J. Biol. Chem. 273:20556-67, 1998) are shown by paraenthases with their designation from the first SELEX experiment. Phenotypes were classified according to five groups as follows: (1) Molecules that lose significant affinity for VEGF upon removal of their fixed sequences; (2) Molecules
Sequence shown is only from the random region of the molecules. Identical sequences are indicate by additional designation numbers. Phenotypes were classified according to five groups as follows: (1) Molecules that lose significant affinity for VEGF upon removal of their fixed sequences; (2) Molecules with aflinities for VEGF somewhat affected (positively or negatively) upon removal of their fixed sequences; (3) Molecules that gain significant affinity for VEGF upon removal of their fixed
Sequence shown is only from the random region of the molecules. Identical sequences are indicate by additional designation numbers. Ligand affinities were determined by nitrocellulose filter binding following removal of fixed sequences and are indicated by Kd and plateaue values obtained. NB indincate ligands unable to bind the target under the experimental conditions used. Stars (*) indicates repeats of binding experiments where we are showing the best determined values for Kds and plateaues.
Sequence information shown is from published work (Ruckman et al., J. Biol. Chem. 273:20556-67, 1998). Sequence shown is only from the random region of the molecules except for VT30.44 where the required for binding portion of the 5′ fixed sequence is also shown in lower case. Identical sequences are indicated by additional designation numbers. Phenotypes were determined by filter binding and were classified according to five groups as follows: (1) molecules that lose significant
Sequence shown is only from the random region of the molecules. All ligands start with 5′GGGAG except T1-37 and T1-35 which start with 5′GGGAT and 5′GGGA, respectively. Identical sequences are indicate by additional designation numbers. Phenotypes were classified according to five groups as follows: (1) Molecules that lose significant affinity for VEGF upon removal of their fixed sequences; (2) Molecules with affinities for VEGF somewhat affected (positively or negatively) upon removal of
Sequence shown is only from the random region of the molecules. Identical sequences are indicate by additional designation numbers. Ligands that were also found in the first SELEX experiment (Ruckman et al., .1. Biol. Chem. 273:20556-67, 1998) are shown by parentheses with their designation from the first SELEX experiment. Phenotypes were determined by filter binding and were classified according to five groups as follows: (1) Molecules that lose significant affinity for VEGF upon removal of their
Sequence shown is only from the random region of the molecules. All ligands start with 5′GGGAG except T3-11 which starts with 5′GGGAA. Identical sequences are indicate by additional designation numbers. Ligands that were also found in the first SELEX experiment (Ruckman et al., J. Biol. Chem. 273:20556-67, 1998) are shown by parentheses with their designation from the first SELEX experiment. Phenotypes were determined by filter binding and were classified according to five groups
Sequence shown is only from the random region of the molecules. All ligands start with 5′GGGAG except 30NtruncNc-9 and 30NtruncNc-18 which stail with 5′GGGTC and GGGA, respectively. Identical sequences are indicate by additional designation numbers. Ligand affinities were determined by nitrocellulose filter binding following removal of fixed sequences and are indicated by Kd and plateau values obtained. NB indicate ligands unable to bind the target under the experimental conditions used.
Sequence shown is from the initiator sequence (usually 5′GGGAG) and random region of the molecules. Identical sequences are indicate by additional designation numbers. Ligand affinities were determined by nitrocellulose filter binding following removal of fixed sequences and are indicated by Kd and plateau values obtained. For biphasic binding, low affinity Kd and plateau values are in parentheses. NB indicate ligands unable to bind the target under the experimental conditions used.
Claims
1-10. (canceled)
11. A method for identifying nucleic acid ligands of a target compound, said method comprising:
- a) providing an candidate mixture of nucleic acids of differing sequences comprising randomized sequences,
- b) contacting said candidate mixture with a target under conditions favorable for binding between the target and members of the candidate mixture;
- c) partitioning those nucleic acids with higher affinity for the target from those nucleic acids with lesser affinity to the target to generate an enriched candidate mixture;
- d) ligating nucleic acids in said enriched candidate mixture to a 3′ primer binding site using RNA ligase to generate a ligation product;
- e) reverse transcribing the ligation product using the 3′ primer to generate cDNA;
- f) ligating the cDNA to a DNA oligonucleotide encoding the T7 promoter to generate a new dsDNA candidate mixture;
- g) transcribing the new candidate mixture to generate a new RNA candidate mixture;
- h) removing the 3′ primer binding site to yield a ligand-enriched mixture of nucleic acids, whereby nucleic acid ligands of the target compound may be identified.
12. The method of claim 11 further comprising the step:
- i) repeating steps b) through h) using the ligand enriched mixture of each successive repeat as many times as required to yield a desired level of ligand enrichment, whereby nucleic acid ligands of the target compound may be identified.
13. The method of claim 11 wherein said candidate mixture is prepared from a template comprising a region of conserved sequence and a region of randomized sequence.
14. The method of claim 13, wherein said conserved sequence is a restriction site, and wherein said preparation comprises digesting the candidate mixture with a restriction enzyme and transcribing the digested candidate mixture.
15. The method of claim 11 wherein said candidate mixture is prepared by providing a candidate mixture of nucleic acids of differing sequences comprising 3′-region of conserved sequence, 5′-region of conserved sequence, and a region of randomized sequence, and removing the 3′-region of conserved sequence and the 5′-region of conserved sequence by enzymatic digestion.
16. The method of claim 15, comprising:
- a) providing an RNA candidate mixture comprising a 3′-region of conserved sequence, a 5′-region of conserved sequence and a region of randomized sequence;
- b) generating a cDNA candidate mixture from the RNA candidate mixture;
- c) transcribing the cDNA candidate mixture to generate an RNA transcript;
- d) removing the 5′ region of conserved sequence with RNaseH to generate digested RNA;
- e) reverse transcribing the digested RNA to generate cDNA;
- f) optionally ligating a 3′-primer binding site to the cDNA;
- g) ligating the generated cDNA to a DNA oligonucleotide encoding the T7 promoter-initiator to generate a ligation product;
- h) amplifying the ligation product to generate a new dsDNA candidate mixture lacking at least part of the 5′-region of conserved sequence;
- i) transcribing the dsDNA to generate a 5′-truncated transcript; and
- j) digesting the 3′end of the 5′-truncated transcript to generate a truncated RNA candidate mixture.
17. The method of claim 16, wherein the 3′-region of conserved sequence comprises a primer binding site.
18. The method of claim 17, wherein step d) further comprises removing the 3′ region of conserved sequence with RNaseH.
Type: Application
Filed: Feb 15, 2005
Publication Date: Jun 23, 2005
Applicant:
Inventors: Nikos Pagratis (Boulder, CO), Larry Gold (Boulder, CO), Timur Shtatland (Boulder, CO), Brenda Javornik (Boulder, CO)
Application Number: 11/058,726