Method for generating transcriptionally active DNA fragments
A method for producing transcriptionally active DNA molecules, comprising (PCR) amplification of said DNA molecule in the presence of a first DNA fragment (F1), second DNA fragment (F2), first primer (P1), a second primer (P2), a third primer (P3), and a fourth primer (P4) wherein: F1 comprises a promoter sequence; F2 comprises a terminator sequence; P1 is complementary to the 5′ end of F1; P2 is complementary to the 5′ end of F2; P3 comprises a first region complementary to the 3′ end of F1 and a second region complementary to the 5′ end of said DNA molecule; P4 comprises a first region complementary to the 3′ end of F2 and a second region complementary to the 3′ end of said DNA molecule.
The present application is a continuation of U.S. patent application Ser. No. 09/919,758, filed Jul. 31, 2001, which is a continuation of U.S. patent application Ser. No. 09/535,262, filed Mar. 23, 2000, now U.S. Pat. No. 6,680,977, which claims priority to U.S. Provisional Application Ser. No. 60/125,953, filed Mar. 24, 1999, each of which is hereby expressly incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION1. Field of the Invention
The present invention relates to a method for generating transcriptionally active DNA fragments. More specifically, the method relates to synthesis of a DNA fragment by polymerase chain reaction (PCR) using nested primers, promoter sequences and terminator sequences.
2. Description of the Related Art
In addition to the tremendous progress made in the past few years in sequencing the human genome, efforts have also been made to sequence other organisms that are of biomedical importance. For example, complete genomic sequences have been obtained for Borrelia burgdorferi (cause of Lyme disease), Chlamydia, Heliobacter pylori and Mycobacterium tuberculosis. The fast-growing sequence information provides immense opportunities to reveal the basic biology of related organisms at the gene/molecular level and to develop novel therapeutics or vaccines against various pathogens.
However, this vast sequence information also mandates a much more efficient and streamlined way to screen and identify genes of interest from tens of thousands of candidate genes. The conventional approach to gene screening and identification involves generation of a cDNA library, subcloning the DNA inserts into plasmid vectors (expression vectors), purifying plasmid DNA from bacteria for each individual cDNA clone and transfecting animal cells or tissues for functional analysis of the encoded gene product. This method, even in conjunction with the use of polymerase chain reaction (PCR) to generate cDNA fragments to allow directional and in-frame cloning, is still time consuming, costly and difficult to automate.
The present invention provides a simple, rapid method for the generation of transcriptionally active DNA fragments.
SUMMARY OF THE INVENTIONOne embodiment of the present invention is a method for generating a transcriptionally active DNA molecule, comprising polymerase chain reaction (PCR) amplification of said DNA molecule in the presence of a first DNA fragment (F1), second DNA fragment (F2), first primer (P1), a second primer (P2), a third primer (P3) and a fourth primer (P4) wherein: F1 comprises a promoter sequence; F2 comprises a terminator sequence; P1 is complementary to the 5′ end of F1; P2 is complementary to the 3′ end of F2; P3 comprises a first region complementary to the 3′ end of F1 and a second region complementary to the 5′ end of said DNA molecule; P4 comprises a first region complementary to the 5′ end of F2 and a second region complementary to the 3′ end of said DNA molecule, whereby a transcriptionally active DNA molecule is produced by said PCR amplification. Preferably, F1 is the cytomegalovirus IE promoter. In one aspect of this preferred embodiment, the transcriptionally active DNA molecule encodes a therapeutic gene. The method may further comprise the step of adding a PNA tail to the 5′-end of P1 and P2 prior to the PCR amplification. Preferably, a thymidine base immediately precedes the region of complementarity between the third primer P3 and the first DNA fragment F1. In another aspect of this preferred embodiment, a thymidine base immediately precedes the region of complementarity between the fourth primer P3 and the second DNA fragment F2. The method may also further comprise the step of adding a PNA clamp to said transcriptionally active DNA molecule after said PCR amplification. Preferably, the method further comprises the step of adding a PNA molecule via a linker (PNA clamp tail) to primers P1 and P2 prior to the PCR amplification.
BRIEF DESCRIPTION OF THE DRAWINGS
The present invention provides a simple, efficient method for generating transcriptionally active DNA fragments which can be readily transfected into animal cells or tissues by conventional nucleic acid transfection techniques, without the need for subcloning into expression vectors and purification of plasmid DNA from bacteria. The transcriptionally active DNA fragments are synthesized by polymerase chain reaction (PCR) amplification of any gene of interest using nested oligonucleotide primers and two DNA fragments, one of which comprises an active transcription promoter sequence and one of which comprises a basic transcription terminator element. A first primer is complementary to the DNA fragment comprising the promoter; a second primer is complementary to the DNA fragment comprising the terminator; a third primer is complementary to both the promoter sequence and one end of the gene of interest; and a fourth primer is complementary to both the terminator sequence and the other end of the gene of interest. These promoters, genes and terminators are linked in an expression cassette as shown in
As used herein, the term “promoter” is a DNA sequence which extends upstream from the transcription initiation site and is involved in binding of RNA polymerase. The promoter may contain several short (<10 base pair) sequence elements that bind transcription factors, generally dispersed over >200 base pairs. A promoter that contains only elements recognized by general and upstream factors is usually transcribed in any cell type. Such promoters may be responsible for expression of cellular genes that are constitutively expressed (sometimes called housekeeping genes). There are also tissue-specific promoters limited to particular cell types, such as the human metallothionein (MT) promoter which is upregulated by heavy metal ions and glucocorticoids.
As used herein, the term “terminator” is a DNA sequence represented at the end of the transcript that causes RNA polymerase to terminate transcription. This occurs at a discrete site downstream of the mature 3′ end which is generated by cleavage and polyadenylation.
The present method can be used to quickly generate nuclease-resistant and transcriptionally active linear DNA molecules which express any desired gene with any known sequence. The linear DNA can then be delivered into animal cells or tissues for functional analysis, vaccination and other pharmaceutical applications. This method also avoids problems associated with bacterial growth such as toxicity and stability. This method can also be completely automated for use in high-throughput screening methods.
Referring now to
The second intermediate is formed by hybridization of the first intermediate with fragments F1 and F2 via their complementary promoter and terminator sequences (darkened regions), followed by PCR amplification from primers P3 and P4, resulting in a DNA segment comprising the entire F1, F2 and Gene X.
In the last step of the reaction, PCR amplification of the second intermediate using primers P1 and P2 results in amplified amounts of the complete transcriptionally active DNA fragment.
The method of the invention may be performed by adding all of the components in a single reaction mixture. Alternatively, two separate PCR reactions can be performed. In the first reaction, the template gene, P3 and P4 are used first. The product of this reaction is then used as a template for a second PCR reaction involving fragments F1 and F2, plus primers P1 and P2.
The generation of final products using the nested PCR method describe above is dependent on the sequences of the F1 or F2 fragments at the junction between the region overlapping P3 and P4, respectively. This is due, at least in part, to the addition of an extra adenosine base (A) at the 3′ end of the PCR fragment by Taq DNA polymerase which is commonly used in PCR protocols. This could produce a mismatch between the PCR intermediate generated by P3/P4 and fragments F1 and F2.
Thus, in a preferred embodiment, the overlap between the PCR intermediate (P3 primer) and F1, and P4/F2, is designed such that a thymidine base (T) immediately precedes the overlap region in fragments F1 and F2 (
Peptide nucleic acids (PNA) are nucleic acid analogs in which the entire deoxyribose-phosphate backbone has been exchanged with a chemically completely different, but structurally homologous, polyamide (peptide) backbone containing 2-aminoethyl glycine units. Unlike DNA, which is highly negatively charged, the PNA backbone is neutral. Therefore, there is much less repulsive energy between complementary strands in a PNA-DNA hybrid than the comparable DNA-DNA hybrid, and consequently they are much more stable.
In addition, molecules called PNA “clamps” have been synthesized which have two identical PNA sequences joined by a flexible hairpin linker containing three 8-amino-3,6-dioxaoctanoic acid units. When a PNA clamp is mixed with a complementary homopurine or homopyrimidine DNA target sequence, a PNA-DNA-PNA triplex hybrid can form which is extremely stable (Bentin et al., Biochemistry 35:8863-8869, 1996; Egholm et al., Nucleic Acids Res. 23:217-222, 1995; Griffith et al., J. Am. Chem. Soc. 117:831-832, 1995). The sequence-specific and high affinity duplex and triplex binding of PNA have been extensively described (Nielsen et al., Science 254 :1497-1500, 1991; Egholm et al., J. Am. Chem. Soc. 114 :9677-9678, 1992; Egholm et al., Nature 365:566-568, 1993; Almarsson et al., Proc. Natl. Acad Sci. U.S.A. 90:9542-9546, 1993; Demidov et al., Proc. Natl. Acad. Sci. U.S.A. 92:2637-2641, 1995). They have also been shown to be resistant to nuclease and protease digestion (Demidov et al., Biochem. Pharm. 48:1010-1013, 1994).
A representative PNA clamp is shown in
The use of PNA tails, PNA clamps and PNA “clamp tails” to protect the ends of the transcriptionally active PCR fragments which are described above is illustrated in
An alternate PNA protection approach is shown in
Although the use of the CMV IE promoter and an artificial mammalian transcriptional terminator elements are exemplified herein, the use of any eukaryotic promoter and terminator is within the scope of the present invention. Suitable promoters for use in the present invention include, for example, SV40, rous sarcoma virus (RSV), retroviral long terminal repeats (LTR), muscle creatine kinase promoter, actin promoter, elongation factor promoter, synthetic promoters, tissue-specific promoters, and the like. Suitable terminator sequences include SV40 transcription terminator, bovine growth hormone (BGH) terminator, synthetic terminators, and the like. These promoter and terminator sequences can be obtained by restriction enzyme digestion of commercially available plasmids and cDNA molecules, or can be synthesized using an automated DNA synthesizer using methods well known in the art.
Any desired gene may be amplified and coupled to active promoter and terminator sequences using the method of the present invention. In a preferred embodiment, the gene encodes a gene product which is absent or present at reduced levels in an organism. Nonlimiting examples of these gene products are the cystic fibrosis transmembrane regulator (CFTR), insulin, dystrophin, interleukin-2, interleukin-12, erythropoietin, gamma interferon, and granulocyte macrophage colony stimulating factor (GM-CSF).
Although any transfection method well known in the art may be used to transfect the transcriptionally active PCR fragments of the invention into cells or tissues including calcium phosphate precipitation, electroporation and DEAE-dextran, cationic lipid-mediated transfection is preferred. Gene delivery systems are described by Felgner et al. (Hum. Gene Ther. 8:511-512, 1997) and include cationic lipid-based delivery systems (lipoplex), polycation-based delivery systems (polyplex) and a combination thereof (lipopolyplex). Cationic lipids are described in U. S. Pat. Nos. 4,897,355 and 5,459,127, the entire contents of which are hereby incorporated by reference.
EXAMPLE 1 Production of Transcriptionally Active PCR Fragments The following components are combined in a 100 μl reaction volume: DNA fragment F1 (4 ng) which comprises a region of high transcriptional potency (−240 to +60) from the human cytomegalovirus (CMV) immediate early gene (IE) promoter/enhancer, DNA fragment F2 (4 ng), a 55 base pair oligonucleotide encoding an artificial mammalian transcription terminator element (5′-CACAAAAAACCAACACACAGATCTCTAGAGCTCTGATCTTTTATTAGCCA GAAGT-3′; SEQ ID NO: 4), 400 ng primer P1 (5′-TCTCTCTACGTATTAGTCATCG-3′; SEQ ID NO: 5), 400 ng primer P2 (5′-TCACAAAAAACCAACACACAG-3′; SEQ ID NO: 6), 4 ng primer P3 and 4 ng primer P4. The P1 and P2 primer sequences correspond to the 5′ end of fragment F1 and the 5′ end of fragment F2, respectively (
PCR is performed as follows: denaturation for 30 seconds at 94° C., annealing for 45 seconds at 55° C. and extension for three minutes at 72° C. for 25-30 cycles. The size of the final produce is verified by 1% agarose gel electrophoresis. The amplified PCR fragment is cleaned and purified using a commercial PCR cleaning kit (e.g., Qiagen), and can be used for in vitro or in vivo transfection of cells or tissues.
EXAMPLE 2The green fluorescent protein (GFP, 700 bp) was used as a target gene. The F1 fragment was a 600 bp fragment of the CMV immediate early gene promoter (from −550 to +50). A 50 bp oligonucleotide containing a modified rabbit beta-globin gene transcription terminator was used as primer 2. Two different versions of these primers were designed so that the overlap between F1 and the intermediate GFP PCR fragment was either preceded with or without a thymidine base. After the PCR reaction was carried out according to the conditions described in Example 1, the products were analyzed by electrophoresis. When a thymidine base preceded the overlap region in F1, a clean major PCR fragment of about 1.4 kb was produced, representing the GFP coding region flanked by CMV promoter (F1) and the transcription terminator, whereas if a base other than thymidine preceded the overlapping region, no product was generated. The fragment generated by nested PCR was then transfected into Cos-7 cells and the expression of GFP was monitored by fluorescence microscopy. The results showed that the intensity and frequency of GFP-expressing cells was almost the same between cells transfected with the PCR fragment and a supercoiled plasmid DNA in which the same CMV promoter was driving expression of the GFP gene. Thus, the present method produces DNA fragments which are transcriptionally active.
While particular embodiments of the invention have been described in detail, it will be apparent to those skilled in the art that these embodiments are exemplary rather than limiting, and the true scope of the invention is that defined in the following claims.
Claims
1. A method for amplifying a transcriptionally-active polynucleotide, comprising:
- PCR-amplifying a first fragment of DNA with a first primer pair, wherein the first primer pair, upon such amplification, adds to first and second ends of the first fragment predetermined first and second regions of complementarity, to form a second DNA fragment having said first region of complementarity at a first end and a second region of complementarity at a second end of said second DNA fragment;
- providing a promoter-containing sequence and a terminator-containing sequence, said promoter-containing sequence further including a region complementary to said first region of complementarity, and said terminator-containing sequence further including a region complementary to said second region of complementarity;
- joining said promoter-containing sequence to said first end of said second DNA fragment and said terminator-containing sequence to said second end of said second DNA fragment to form said third DNA fragment; and
- PCR-amplifying said third DNA fragment.
2. The method of claim 1, wherein said joining comprises joining in the presence of polymerase said promoter-containing sequence to said first end of said second DNA fragment and said terminator-containing sequence to said second end of said second DNA fragment to form said third DNA fragment.
3. The method of claim 1, wherein said promoter-containing sequence and said terminator-containing sequence further comprise a non-DNA, binding moiety capable of interacting with said second DNA fragment.
4. The method of claim 3, wherein said non-DNA, binding moiety comprises a PNA molecule.
Type: Application
Filed: Jun 26, 2006
Publication Date: Oct 26, 2006
Inventors: Xiaowu Liang (La Jolla, CA), Philip Felgner (Rancho Santa Fe, CA)
Application Number: 11/475,794
International Classification: C12Q 1/68 (20060101); C12P 19/34 (20060101);