Nucleic acids encoding lettuce big-vein viral proteins and utilization thereof
The coat protein of lettuce big-vein virus (LBVV) was purified from highly purified LBVV, and its partial amino acid sequences were determined. An RNA encoding the coat protein of LBVV was cloned by polymerase chain reaction using primers designed based on the determined amino acid sequences information, and its primary structure was elucidated. Moreover, the present inventors succeeded not only in isolating RNA molecules of a plurality of LBVV-encoded proteins, including LBVV polymerase, by carrying out 3′RACE and 5′RACE using primers designed based on the resulting sequence information, but also in determining their primary structure. It was found that the use of these made it possible to produce lettuce resistant to LBVV and to diagnose infections with LBVV.
Latest National Agricultural Research Organization Patents:
- Flower-bud formation suppressor gene and early flowering plant
- Nucleic acids encoding lettuce big-vein viral proteins and utilization thereof
- Flower-bud formation suppressor gene and early flowering plant
- Micro gravity environmental control apparatus and micro gravity environmental control method
- Method for preventing the release of gramineous plant pollens
The present application is a divisional of U.S. patent application Ser. No. 10/276,968, having a 35 U.S.C. § 371 date of Jan. 17, 2003, the disclosure of which is incorporated by reference herein in its entirety. U.S. patent application Ser. No. 10/276,968 is a 35 U.S.C. § 371 national phase filing of International Application No. PCT/JP01/04268, filed May 22, 2001. PCT/JP01/04268 claims priority to JP 2000-154440, filed May 22, 2000 and JP 2001-65339, filed Mar. 8, 2001.
TECHNICAL FIELDThe present invention relates to nucleic acids encoding lettuce big-vein viral proteins, proteins encoded by the nucleic acids, and their production and use.
BACKGROUND ARTLettuce big-vein virus (LBVV) is a virus belonging to Varicosavirus, is composed of two RNAs (7.0 kb and 6.5 kb RNA), and retains a coat protein of 48 kDa. LBVV is a soil-borne virus that is spread in the soil by Olpidum brassicae, and occurs in the United States, Australia, New Zealand, Japan and Europe. Since this virus infects lettuce and remarkably lowers its quality and yield, it is a serious problem in lettuce production.
Unfortunately, there has not yet been reported the existence of a gene that makes lettuce resistant to this virus. Although several cultivars such as Entree, Sea Green and Pacific are commercially available as LBVV-resistant cultivars, their resistance is low. Thus, there has not yet been found a radical solution to disease damage caused by LBVV.
Elucidation of the virus genetic information is an important step in preventing disease damage caused by the virus. However, isolation and purification of LBVV are extremely difficult for reasons such as the instability of the viral particles, tendency for viral particles to readily aggregate with each other, and extremely low concentration of the virus in plants. Although, so far, two successful examples of purification of the virus have been reported (S. Kuwata et al., (1983), Annals of the Phytopathological Society of Japan, 49, 246-251; and, H. J. Vetten et al. (1987), Journal of Phytopathology, 120, 53-59), the reproducibility is low and the purified amounts are extremely low. Consequently, as to LBVV, no genetic information has been elucidated at all.
DISCLOSURE OF THE INVENTIONThe present invention has been achieved in consideration of the above circumstances, and objectives of the present invention are to isolate lettuce big-vein viral (LBVV) proteins and nucleic acids that encode the proteins and to elucidate the structure thereof. In addition, another objective of the present invention is to endow lettuce with resistance to LBVV through expression of the nucleic acid or its antisense nucleic acid in lettuce. Moreover, still another objective of the present invention is to provide a method of diagnosing infection with LBVV by detecting the nucleic acid or a protein encoded by the nucleic acid.
LBVV is an RNA virus, and it is likely that, if a DNA encoding a protein of the virus or its antisense DNA is expressed in a plant, the production and function of LBVV proteins can be inhibited at the transcription level or translation level (P. F. Tennant et al., (1994), Phytopathology, 84, 1359-1366; C. C. Huntley & T. C. Hall, (1993), Virology, 192, 290-297; D. C. Baulcombe, (1996), The Plant Cell, 8, 1833-1844).
The present inventors focused on this idea, and isolated the genes encoding LBVV proteins in order to produce lettuce resistant to LBVV.
Specifically, the present inventors first obtained highly purified LBVV, and then applied this to SDS-polyacrylamide gel electrophoresis to detect the coat protein that constitutes the virus. The detected coat protein was purified and then decomposed into peptides, followed by determination of the partial amino acid sequences of the peptides by the Edman's method. Moreover, an RNA encoding the coat protein of LBVV was cloned by polymerase chain reaction (PCR) using primers designed on the basis of information from the determined amino acid sequences, followed by determination of its nucleotide sequence.
Next, in order to determine the gene that encodes the full-length coat protein of LBVV, RNAs were prepared from purified virus and from leaf infected with the virus that had exhibited obvious symptoms of infection, and 3′RACE and 5′RACE were carried out using these RNA molecules. As a result, the present inventors have succeeded not only in isolating the RNA molecule that encodes LBVV coat protein, but also in determining its primary structure. Moreover, by genome walking method, the present inventors have succeeded in isolating RNA molecules encoding four other non-structural proteins of LBVV and in determining their primary structures as well.
Similarly, the present inventors also succeeded in isolating an RNA molecule that encodes a polymerase protein from highly purified LBVV.
The isolated RNA molecule or its antisense molecule is able to endow lettuce plants with resistance to LBVV by its expression, and thereby, it is possible to improve lettuce productivity. In addition, genetic diagnosis of LBVV can also be carried out by designing and using a primer specific to LBVV based on sequence information of the isolated RNA molecules. Furthermore, the antisera that bind to LBVV proteins can be produced based on the resulting sequence information, and these can be used for serological diagnosis of LBVV.
The present invention was completed on the basis of the above findings, and provides LBVV proteins, nucleic acids encoding the proteins, and their production and use.
More specifically, the present invention provides the following:
(1) a nucleic acid encoding a protein of lettuce big-vein virus, said nucleic acid selected from the group consisting of:
(a) a nucleic acid encoding a protein comprising the amino acid sequence of any one of SEQ ID NOs: 2 through 6 and SEQ ID NO: 13; and
(b) the nucleic acid of (a) comprising the coding region of the nucleotide sequence of SEQ ID NO: 1 or 12;
(2) the nucleic acid according to (1), wherein the nucleic acid is an RNA;
(3) the nucleic acid according to (1), wherein the nucleic acid is a DNA;
(4) a DNA encoding a sense RNA complementary to a complementary strand of the nucleic acid according to (2);
(5) a DNA encoding an antisense RNA complementary to the nucleic acid according to (2);
(6) a DNA encoding an RNA having ribozyme activity that specifically cleaves the nucleic acid according to (2);
(7) a vector comprising the nucleic acid according to (3);
(8) a transformed cell comprising the nucleic acid according to (3), or the vector according to (7);
(9) a protein encoded by the nucleic acid according to (1);
(10) an antibody that binds to the protein of (9);
(11) a method of producing the protein according to (9), wherein said method comprises the steps of:
(a) culturing the transformed cell of (8); and
(b) recovering an expressed protein from said transformed cell or its culture supernatant;
(12) a vector comprising the DNA according to any one of (4) through (6);
(13) a transformed lettuce cell that comprises the nucleic acid according to (1), the DNA according to any one of (4) through (6), or the vector according to (7) or (12);
(14) a transformed lettuce plant comprising the transformed lettuce cell according to (13);
(15) a transformed lettuce plant that is a progeny or a clone of the transformed lettuce plant according to (14);
(16) a propagation material of the transformed lettuce plant according to (14) or (15); and
(17) a method of diagnosing infection caused by the lettuce big-vein virus wherein said method comprises the step of:
detecting the nucleic acid of (1), or detecting the protein of (9) in lettuce cells; in Olpidum brassicae, a fungal vector of lettuce big-vein virus; or in soil comprising the fungal vector.
The present invention provides LBVV proteins and nucleic acids encoding the proteins. The nucleotide sequence of cDNA that encodes LBVV proteins isolated by the present inventors and that is included in the present invention is shown in SEQ ID NO: 1, and the amino acid sequences of the proteins encoded by the cDNA are shown in SEQ ID NOs: 2 through 6. The isolated cDNA is a 6078 nucleotides sequence and encodes five proteins. Protein 1 (coat protein: Example 1) has a translation initiation site at nucleotide 209 and encodes 397 amino acids (the isolated clone was named “LBVV-cp”/SEQ ID NO: 2); protein 2 (Example 3) has a translation initiation site at nucleotide 1492 and encodes 333 amino acids (SEQ ID NO: 3); protein 3 (Example 3) has a translation initiation site at nucleotide 2616 and encodes 290 amino acids (SEQ ID NO: 4); protein 4 (Example 3) has a translation initiation site at nucleotide 3842 and encodes 164 amino acids (SEQ ID NO: 5); and protein 5 (Example 3) has a translation initiation site at nucleotide 4529 and encodes 368 amino acids (SEQ ID NO: 6).
In addition, the nucleotide sequence of cDNA (Example 4) that encodes a polymerase of LBVV isolated by the present inventors and that is also included in the present invention is shown in SEQ ID NO: 12, and the amino acid sequence of the protein encoded by the cDNA is shown in SEQ ID NO: 13 (the isolated clone was named “LBVV-L”). The isolated cDNA is a 6793 nucleotides sequence, has a translation initiation site at nucleotide 337, and encodes 2040 amino acids.
Moreover, the present inventors have revealed that LBVV is a negative-strand RNA virus that contains more positive-strands in its viral particles than usual.
This is the first example of demonstrating the genes and protein primary structures of LBVV.
Nucleic acids encoding LBVV-cp protein (LBVV protein 1), LBVV proteins 2 to 5, or LBVV-L protein according to the present invention include a DNA and an RNA. The DNA includes a cDNA and a chemically synthesized DNA, and the RNA includes a viral genomic RNA, mRNA, and synthetic RNA. A nucleic acid of the present invention can be prepared using conventional means by a person with ordinary skill in the art. Specifically, a first strand DNA can be synthesized by carrying out a reverse transcription reaction using, as a template, (1) an RNA prepared by de-proteinizing purified virus by a method such as the SDS-phenol method or (2) the total nucleic acids extracted from a virus-infected leaf by the CTAB method and so on and using a primer designed from the sequence of a nucleic acid of the present invention or a random primer. From the first strand DNA prepared by this method, a second strand DNA can be synthesized according to the method of Gubler & Hoffman (U. Gubler and B. J. Hoffman, (1983), Gene 25, 263-269), and the nucleic acid of the present invention can be cloned in various commercially available plasmids or phagemid vectors. Alternatively, a DNA encoding an RNA of the virus can be amplified by polymerase chain reaction using a primer designed from the sequence of a nucleic acid of the present invention and using the first strand DNA as a template, and the nucleic acid of the present invention can be cloned by TA cloning using the pGEM®-T vector and so on or by cloning in various commercially available plasmid vectors by adding a restriction enzyme site to the primer.
A nucleic acid of the present invention can also be used for the preparation of recombinant protein and for the production of lettuce resistant to LBVV.
A recombinant protein is usually prepared by inserting a DNA encoding a protein of the present invention into an appropriate expression vector, introducing the vector into an appropriate cell, culturing the transformed cells, allowing the cells to express the recombinant protein, and purifying the expressed protein. A recombinant protein can be expressed as a fusion protein with other proteins so as to be easily purified, for example, as a fusion protein with maltose binding protein in Escherichia coli (New England Biolabs, USA, vector pMAL series), as a fusion protein with glutathione-S-transferase (GST) (Amersham Pharmacia Biotech, vector pGEX series), or tagged with histidine (Novagen, pET series). The host cell is not limited so long as the cell is suitable for expressing the recombinant protein. It is possible to utilize yeasts or various animal, plant, or insect cells by change the expression vector, besides the above described E. coli. A vector can be introduced into a host cell by a variety of methods known to one skilled in the art. For example, a transformation method using calcium ions (Mandel, M. and Higa, A. (1970) Journal of Molecular Biology, 53, 158-162, Hanahan, D. (1983) Journal of Molecular Biology, 166, 557-580) can be used to introduce a vector into E. coli. A recombinant protein expressed in host cells can be purified and recovered from the host cells or the culture supernatant thereof by known methods. When a recombinant protein is expressed as a fusion protein with maltose binding protein or other partners, the recombinant protein can be easily purified by affinity chromatography.
The resulting protein can be used to prepare an antibody that binds to the protein. For example, a polyclonal antibody can be prepared by immunizing immune animals, such as rabbits, with a purified protein of the present invention or its portion, collecting blood after a certain period, and removing clots. A monoclonal antibody can be prepared by fusing myeloma cells with the antibody-forming cells of animals immunized with the above protein or its portion, isolating a monoclonal cell expressing a desired antibody (hybridoma), and recovering the antibody from the cell. The obtained antibody can be utilized to purify or detect a protein of the present invention. The antibody of the present invention includes antiserum, polyclonal antibody, monoclonal antibody, and fragment thereof.
In the case of producing LBVV-resistant lettuce, a DNA that represses the production and function of LBVV proteins should be introduced into lettuce cells, and the resulting transformed lettuce cells should be regenerated.
A DNA encoding an RNA that hybridizes with either strand (sense strand or complementary strand) of an RNA encoding LBVV proteins can be used as the DNA that represses the production and function of the LBVV proteins.
Examples of a DNA encoding an RNA that hybridizes with viral genomic sense strand and with mRNAs include a DNA that encodes an antisense RNA that is complementary to the transcription product of a DNA encoding the protein described in any one of SEQ ID NOs: 2 through 6 and SEQ ID NO: 13 isolated by the present inventors (preferably, a DNA comprising a coding region of the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 12). Herein, the term “complementary” also means not completely complementary so long as the production of LBVV proteins can be effectively inhibited. The transcribed RNA has preferably 90% or more complementarity and most preferably 95% or more complementarity to the RNA encoding the target LBVV protein. Herein, the term “complementarity” refers to the percentage of the number of nucleotides that form complementary base pairs, to the total number of base pairs in a region where the two sequences correspond to each other, in the case that the sequences are aligned so that the number of complementary base pairs may be maximized.
The DNA that encodes a sense RNA complementary to a complementary strand of RNA encoding the protein described in any one of SEQ ID NOs: 2 through 6 and SEQ ID NO: 13 isolated by the present inventors (preferably, an RNA comprising a coding region of the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 12) can be used as a DNA encoding an RNA that hybridizes with a complementary strand of viral genomic RNA. Herein, the term “complementary” also means not completely complementary so long as the production of LBVV proteins can be effectively inhibited. The transcribed sense RNA has preferably 90% or more complementarity and most preferably 95% or more complementarity to the RNA (complementary strand) encoding the target LBVV protein.
In order to effectively inhibit the expression of the target gene, the above descried antisense and sense DNAs should be at least 15 nucleotides long, more preferably at least 100 nucleotides long, and still more preferably at least 500 nucleotides long. These DNAs are generally shorter than 5 kb, and preferably shorter than 2.5 kb.
In addition, it is likely that a DNA encoding a ribozyme that cleaves at least one of the strands of an RNA that encodes LBVV proteins can be used as a DNA that represses the production of the LBVV proteins.
A ribozyme is an RNA molecule that has catalytic activities. There are many ribozymes having various activities. Research on the ribozymes as RNA cleaving enzymes has enabled the design of a ribozyme that site-specifically cleaves RNA. While some ribozymes of the group I intron type or the MIRNA contained in RNaseP consist of 400 nucleotides or more, others belonging to the hammerhead type or the hairpin type have an activity domain of about 40 nucleotides (Makoto Koizumi and Eiko Ohtsuka (1990) Tanpakushitsu Kakusan Kohso (Nucleic acid, Protein, and Enzyme) 35: 2191-2200).
The self-cleavage domain of a hammerhead type ribozyme cleaves at the 3′ side of C15 of the sequence G13U14C15. Formation of a nucleotide pair between U14 and A at the ninth position is considered important for the ribozyme activity. Furthermore, it has been shown that the cleavage also occurs when the nucleotide at the 15th position is A or U instead of C (M. Koizumi et al. (1988) FEBS Letters, 228: 228-230). If the substrate binding site of the ribozyme is designed to be complementary to the RNA sequences adjacent to the target site, one can create a restriction-enzyme-like RNA cleaving ribozyme which recognizes the sequence UC, UU, or UA within the target RNA (M. Koizumi et al. (1988) FEBS Letters, 239: 285; Makoto Koizumi and Eiko Ohtsuka (1990) Tanpakushitsu Kakusan Kohso (Protein, Nucleic acid, and Enzyme), 35: 2191-2200; M. Koizumi et al. (1989) Nucleic Acids Research, 17: 7059-7071). For example, in LBVV-cp gene, LBVV protein 2 to 5 genes, or LBVV-L gene (SEQ ID NO: 1 or 12), there are a plurality of sites that can be used as the ribozyme target.
The hairpin type ribozyme is also useful in the present invention. A hairpin type ribozyme can be found, for example, in the minus strand of the satellite RNA of Tobacco ringspot virus (J. M. Buzayan, Nature 323: 349-353 (1986)). This ribozyme has also been shown to target-specifically cleave RNA (Y. Kikuchi and N. Sasaki (1992) Nucleic Acids Research, 19: 6751-6775; Yo Kikuchi (1992) Kagaku To Seibutsu (Chemistry and Biology) 30: 112-118).
The ribozyme designed to cleave the target is fused with a promoter, such as the cauliflower mosaic virus 35S promoter, and with a transcription termination sequence, so that it will be transcribed in plant cells. However, if extra sequences have been added to the 5′ end or the 3′ end of the transcribed RNA, the ribozyme activity can be lost. In this case, one can place an additional trimming ribozyme, which functions in cis to perform the trimming on the 5′ or the 3′ side of the ribozyme portion, in order to precisely cut the ribozyme portion from the transcribed RNA containing the ribozyme (K. Taira et al. (1990) Protein Eng. 3: 733-738; A. M. Dzaianott and J. J. Bujarski (1989) Proc. Natl. Acad. Sci. USA 86: 4823-4827; C. A. Grosshands and R. T. Cech (1991) Nucleic Acids Research, 19: 3875-3880; K. Taira et al. (1991) Nucleic Acid Research, 19: 5125-5130). Multiple sites within the target gene can be cleaved by arranging these structural units in tandem to achieve greater effects (N. Yuyama et al., Biochem. Biophys. Res. Commun. 186: 1271-1279 (1992)). By using such ribozymes, it is possible to specifically cleave the transcription products of the target gene in the present invention, thereby repressing the expression of the gene.
Vectors used for the transformation of lettuce cells are not limited so long as the vector can express an inserted DNA in the cells. For example, vectors comprising promoters for constitutive gene expression in lettuce cells (e.g., cauliflower mosaic virus 35S promoter); and promoters inducible by exogenous stimuli can be used. Examples of suitable vectors include pBI binary vector. The “lettuce cell” into which the vector is to be introduced includes various forms of lettuce cells, such as cultured cell suspensions, protoplasts, leaf sections, and callus.
A vector can be introduced into lettuce cells by known methods, such as the polyethylene glycol method, polycation method, electroporation, Agrobacterium mediated transfer, and particle bombardment. For example, the method described in the literature (S. Z. Pang et al., (1996), The Plant Journal, 9, 899-909) is a preferable one.
Regeneration of a lettuce plant from transformed lettuce cells can be carried out by methods known to a person with ordinary skill in the art according to the type of lettuce cells. Examples of preferable regeneration methods are described in the literature (S. Enomoto, et al., (1990), Plant Cell Reports, 9, 6-9).
Once a transformed lettuce plant in which the DNA of the present invention is introduced into the genome is obtained, it is possible to gain progenies from that plant by sexual propagation. Alternatively, plants can be mass-produced from propagation materials (for example, seeds, tubs, callus, protoplast, and so on) obtained from the plant, or progenies or clones thereof. The present invention includes plant cells transformed with the DNA of the present invention; plants including these cells; progenies and clones of the plants; and propagation materials of the plants and their progenies and clones.
In addition, the present invention provides a method of diagnosing infection with LBVV. One embodiment of the diagnostic method of the present invention comprises detecting, using a primer or probe, a LBVV RNA or an RNA encoding the viral protein. Nucleic acid comprising at least 15 nucleotides homologous or complementary to a DNA encoding the LBVV protein described in any one of SEQ ID NOs: 2 through 6 and 13 can be used for the probe or primer. The nucleic acid is preferably nucleic acid that specifically hybridizes with a DNA encoding the LBVV protein described in any one of SEQ ID NOs: 2 through 6 and 13.
The primer or probe may be labeled as necessary. Examples of labels include a radioactive label.
In this diagnosis, for example, a test sample is prepared from lettuce suspected of being infected with lettuce big-vein virus, Olpidum harboring the virus, or soil containing the virus, and PCR using the above primer or northern blotting using the above probe is carried out on the sample.
Another mode of the diagnostic method of the present invention is a method characterized by detecting LBVV proteins using antibody. Antibody used in this diagnosis can be prepared, for example, by synthesizing peptide using the antigenic region estimated from the resulting amino acid sequences (any of SEQ ID NOs: 2 through 6 and 13), by binding the peptide to a carrier protein such as KLH or BSA, and by immunizing rabbits with this. In addition, the antibody can also be produced by tagging LBVV proteins with histidine using the QIAexpress Type IV Kit (QIAGEN), by expressing the tagged protein in E. coli, and by immunizing rabbits with the resulting protein. The antibody may be labeled as necessary. Examples of labels include an enzyme label. In addition, instead of directly labeling the antibody itself, the antibody may be labeled via a substance such as protein A that binds to the antibody, followed by detection of the target protein.
In this diagnosis, a test sample is prepared from, for example, lettuce suspected of being infected with lettuce big-vein virus, Olpidum harboring the virus, or soil containing the virus, and then, ELISA or western blotting is carried out on the sample using the above antibody.
BEST MODE FOR CARRYING OUT THE INVENTIONThe present invention is specifically illustrated below with reference to the examples, but is not construed as being limited thereto.
EXAMPLE 1 Cloning of Coat Protein Gene of Lettuce Big-Vein Virus (LBVV)Contaminated soil was sampled from a lettuce (cultivar: Cisco) field in Kagawa Prefecture, Japan that exhibited characteristic big-vein symptoms in 1997. The virus was maintained in resting spores in dry soil kept in the laboratory. Cisco, a cultivar of lettuce, was used for virus purification, and the virus was inoculated by regular transfer in soil.
Virus purification was carried out by modifying the method of Kuwata et al. (S. Kuwata, et al., (1983), Annals of the Phytopathological Society of Japan, 49, 246-251). The First step of sedimenting virions by low-speed centrifugation was omitted. The virus fraction was obtained by treating with 1% Triton-X and 1% Briji-35, followed by C2SO4 density gradient centrifugation. When the purified virus obtained by this purification method was subjected to SDS-polyacrylamide electrophoresis, only a single 48 kDa band was detected. In addition, since only clusters of LBVV particles were observed by electron microscopy while other impurities were not observed, the resulting virus was presumed to have considerably high purity.
After treatment of the purified virus with Proteinase K-SDS, extraction of viral nucleic acid was carried out by phenol/chloroform and ethanol precipitation. The purified viral nucleic acid was used for synthesis of first strand cDNA after denaturing with dimethylsulfoxide. Poly(A)+ RNA was isolated from the virus-infected lettuce leaf that exhibited obvious big-vein symptoms by using the Dynabeads® mRNA DIRECT™ Kit (Dynal®). Synthesis of first strand cDNA was performed by carrying out a reverse transcription reaction with SUPERSCRIPT™ II Rnase H− Reverse Transcriptase (Gibco BRL) using a random primer or an Oligo-dT-Bam HI primer.
Determination of the internal amino acid sequences of LBVV coat protein was carried out in the manner described below. After purified LBVV was subjected to 12.5% SDS-polyacrylamide electrophoresis, the polypeptides were transferred to a nitrocellulose membrane and the band of interest was cut out followed by carboxymethylation, and treatment with lysyl endopeptidase. After the treatment, 38 peptide fragments of the LBVV coat protein were obtained by reverse phase HPLC, and the amino acid sequences of several internal peptide fragments were determined.
5LB111 primer (GARWSITGGGAYGAYGARWSIAC/SEQ ID NO: 7) and 3LB171 primer (GCRTCDATRTARTCIACICCIGG/SEQ ID NO: 8) were designed based on ESWDDESTIAMP (SEQ ID NO: 17) and NLEVPGVDYIDA (SEQ ID NO: 18) of the resulting amino acid sequences. PCR was carried out using these primers and Takara Taq (Takara), a 274 bp PCR product was obtained. The resulting PCR product was cloned using pGEM®-T Easy Vector Systems (Promega) and its nucleotide sequence was determined.
In order to determine the full-length coat protein gene of LBVV, 3′RACE or 5′RACE were aimed using an RNA from the purified virus or a Poly(A)+ RNA from the LBVV-infected leaf. In the case of 3′RACE, 891-bp PCR product was obtained using a Poly(A)+ RNA from the LBVV-infected leaf, and using Olido-dT-Bam HI primer and 5LB171 primer (AAYYTIGARGTICCIGGIGTIGA/SEQ ID NO: 9). In the case of 5′RACE, a 760-bp PCR product was obtained with the 5′RACE System for Rapid Amplification of cDNA Ends, Version 2.0 (Gibco BRL) using an RNA from purified virus or a Poly(A)+ RNA from the LBVV-infected leaf, and using 3LB5R4 primer (GTTTTTGACCCTGATAG/SEQ ID NO: 10) and 3LB5R5 primer (GTCGACTCTAGACACTTGTTGTTTGTCGTG/SEQ ID NO: 11). The resulting PCR products were cloned using pGEM®-T Easy Vector Systems (Promega), and the nucleotide sequences were determined for at least six clones or more. In addition, the 500- to 700-bp PCR products from the region in the vicinity of the coat protein gene were recloned using mutually overlapping virus-specific primers. At least three clones were sequenced from each region, and the nucleotide sequence of coat protein gene was confirmed.
A 1425 nucleotides sequence was determined using the above method. This gene had a translation initiation site at nucleotide 209, and encoded 397 amino acids (see SEQ ID NO: 1).
EXAMPLE 2 Production of Transformed Lettuce(1) Sterilization and Culturing of Lettuce Seeds
Lettuce seeds were immersed for several seconds in 70% ethanol followed by treating for 15 minutes in a sterilization solution (10% sodium hypochlorite, 0.05% Tween-20). Next, the seeds were rinsed with sterilized water, seeded on Hyponex agar medium (prepared by dissolving 3.0 g of Hyponex powder, 10.0 g of sucrose and 8.0 g of agar in one liter of distilled water and then adjusting the pH to 5.8 with 1 N NaOH) in a plant box, and grown for about 2 weeks under the light condition at 25 to 28° C. until the true leaf reached about 5 cm.
(2) Culturing and Inoculation of Agrobacterium
Agrobacterium was inoculated into YEB liquid medium (prepared by dissolving 1.0 g of yeast extract, 5.0 g of beef extract, 5.0 g of peptone, 5.0 g of sucrose and 0.5 g of MgSO4.7H2O in one liter of distilled water and then adjusting the pH to 7.0 with 1N NaOH) comprising 250 μg/ml streptomycin, 5 μg/ml rifampicin and 50 μg/ml kanamycin, and then cultured with shaking overnight at 28° C. The Agrobacterium culture liquid was then sub-cultured to fresh YEB medium (comprising the above-mentioned antibiotics) and additionally cultured with shaking for one day at 28° C.
The young lettuce plants in which the true leaf had grown to about 5 cm were transferred to plastic Petri dishes, the true leaf was cut into pieces measuring about 5 mm, and the pieces of the leafs were immersed for 1 minute in Agrobacterium culture liquid diluted ten-fold. Next, the pieces were arranged on Murashige & Skoog medium (MS medium) (pH 5.8) comprising 3% sucrose, 0.5 ppm benzyladenine phosphate (BAP), 0.1 ppm naphthalene acetic acid (NAA) and 0.8% agar at 15 to 20 pieces/plate and co-cultured for 2 days at 25° C. under 2000 lux condition. After the co-culturing, the pieces were cultured under sterile conditions for 7 days in MS medium (pH 5.8) comprising 3% sucrose, 0.5 ppm BAP, 0.1 ppm NAA, 250 μg/ml carbenicillin and 0.8% agar.
(3) Selection and Culturing of Transformants
After sterile culture, the pieces were transferred to MS medium (pH 5.8) comprising 3% sucrose, 0.5 ppm BAP, 0.1 ppm NAA, 250 μg/ml carbenicillin, 50 μg/ml kanamycin and 0.8% agar and cultured at 25° C. under 2000 lux condition. The pieces were sub-cultured about every 2 weeks, and regeneration was observed after about 2 to 3 months from those plants that were inoculated with Agrobacterium.
The re-differentiated individuals were transferred to MS medium (pH 5.8) comprising 3% sucrose, 0.3 ppm BAP, 500 μg/ml carbenicillin and 0.8% agar, and were sub-cultured about every 2 weeks. When the re-differentiated individuals reached a size of about 3 cm, the cutting of them were inserted and planted into ½-fold MS agar medium comprising 500 μg/ml of carbenicillin and allowed to take root.
(4) Lettuce Acclimation and Seed Sampling
In the state in which the re-differentiated individuals took root and the shoots had grown to 1 to 2 cm, the shoots were cut, and the cuttings were planted and allowed to take root in vermiculite immersed in a 500-fold diluted aqueous solution of Hyponex. The plants were acclimated by gradually opening the cover of the plant box to provide ventilation. After the plants had been sufficiently acclimated, they were permanently planted in Polypot comprising Kureha Horticultural Soil (Kureha engei baido) in a closed greenhouse (maximum air temperature: 30° C., natural photoperiod). Then, they were allowed to be bolting and flowering, and seeds were sampled.
EXAMPLE 3 Cloning of LBVV RNA2 GeneContaminated soil was sampled from a lettuce (cultivar: Cisco) field in Kagawa Prefecture, Japan that exhibited characteristic big-vein symptoms in 1997. The virus was maintained in resting spores in dry soil kept in the laboratory. Cisco, a cultivar of lettuce, was used for virus purification, and the virus was inoculated by regular transfer in soil.
Virus purification and RNA purification were carried out in accordance with Example 1. Synthesis of cDNA and determination of nucleotide sequence were carried out in accordance with the method of C. F. Fazeli & M. A. Rezaian (Journal of General Virology, 81, 605-615) using a genome walking method, in which the sequence is extended by synthesizing primer to the downstream direction. First, virus-specific 5LB5R3 primer (AGCTCTGAACAACGACATG/SEQ ID NO: 16) was produced based on Example 1, and a first cDNA was synthesized with SUPERSCRIPT™ II RNase H− Reverse Transcriptase using an RNA from the purified LBVV as a template. Next, a second cDNA was synthesized with Klenow Fragment (Takara) using universal primer dN6 (5′-GCCGGAGCTCTGCAGAATTCNNNNNN-3′/SEQ ID NO: 14). After removing excess primer with the GlassMax DNA Isolation Spin Cartridge System (Gibco BRL), PCR was carried out using the virus-specific primer and universal primer (5′-GCCGGAGCTCTGCAGAATTC-3′/SEQ ID NO: 15) and the resulting PCR product was cloned using pGEMO-T Easy Vector Systems. Then, the nucleotide sequence was determined. The same procedure was then repeated four times to determine up to 5177 nucleotides. Determination of the 3′-terminus of RNA2 was carried out by 5′RACE (Note: since purified LBVV RNA contains both a positive-strand and a negative-strand, not only the 5′-terminus but also 3′-terminus can be determined by 5′RACE), and a 6078 nucleotides sequence was determined that comprised genes for five proteins encoded by LBVV (SEQ ID NO: 1). Furthermore, the 500- to 700-bp PCR products from RNA2 were recloned using mutually overlapping virus specific primers. At least three clones were sequenced from each region, and the nucleotide sequence of RNA2 was confirmed.
A 6078 nucleotides sequence was determined using the above method. This gene encoded five proteins. Protein 1 (coat protein: Example 1) had a translation initiation site at nucleotide 209 and encoded 397 amino acids (SEQ ID NO: 2), protein 2 had a translation initiation site at nucleotide 1492 and encoded 333 amino acids (SEQ ID NO: 3), protein 3 had a translation initiation site at nucleotide 2616 and encoded 290 amino acids (SEQ ID NO: 4), protein 4 had a translation initiation site at nucleotide 3842 and encoded 164 amino acids (SEQ ID NO: 5), and protein 5 had a translation initiation site at nucleotide 4529 and encoded 368 amino acids (SEQ ID NO: 6). When the homology of the amino acid sequences was compared with other viruses, only protein 1 (coat protein) was observed to be homologous to the nucleocapsid protein (coat protein) of viruses belonging to the family Rhabdoviridae.
EXAMPLE 4 Cloning of LBVV Polymerase GeneContaminated soil was sampled from a lettuce (cultivar: Cisco) field in Kagawa Prefecture, Japan that exhibited characteristic big-vein symptoms in 1997. The virus was maintained in resting spores in dry soil kept in the laboratory. Cisco, a cultivar of lettuce, was used for virus purification, and the virus was inoculated by regular transfer in soil.
Virus purification was carried out in the same manner as the procedure for virus purification of Example 1. Extraction of highly pure LBVV RNA was carried out in the manner described below. After treatment of the purified virus with Proteinase K-SDS, it was extracted with phenol/chloroform and precipitated with ethanol. Next, after the viral nucleic acid was treated with DNase and further purified with The RNaid® Kit (BIO 101), a 7.3 kb RNA of two LBVV RNAs was isolated by 1% agarose gel (SeaPlaque GTG agarose, FMC) electrophoresis and used for synthesis of cDNA. Synthesis of cDNA was carried out in accordance with the method of P. Froussard (Nucleic Acids Research, 20, 2900). In brief, a first cDNA was synthesized with the SUPERSCRIPT™ II RNase H− Reverse Transcriptase using universal primer-dN6 (5′-GCCGGAGCTCTGCAGAATTCNNNNNN-3′/SEQ ID NO: 14). Next, a second cDNA was synthesized with Klenow Fragment, PCR was carried out using universal primer (5′-GCCGGAGCTCTGCAGAATTC-3′/SEQ ID NO: 15), and the resulting PCR product was cloned using pGEM®-T Easy Vector Systems Then, the nucleotide sequence was determined.
Eight partial LBVV polymerase gene fragments of about 500 bp were obtained. Both terminals of the polymerase gene were filled by 5′RACE and the gaps between the fragments were filled in by RT-PCR, thereby determining a 6793 nucleotides sequence that contained the full-length polymerase gene (SEQ ID NO: 12). Furthermore, the 500- to 700-bp PCR products from polymerase gene were recloned using mutually overlapping virus-specific primers. At least three clones were sequenced from each region, and the nucleotide sequence of polymerase gene was confirmed.
This gene encoded 2040 amino acids with a translation initiation site at nucleotide 337 (SEQ ID NO: 13). When the homology of the amino acid sequence was compared with other viruses, it was confirmed that the protein is homologous to the polymerases of viruses belonging to the family Mononegavirales, especially, viruses belonging to the family Rhabdoviridae, and retained four motifs considered to be responsible for polymerase activity.
INDUSTRIAL APPLICABILITYAccording to the present invention, nucleic acids encoding proteins of LBVV were isolated, and their primary structure was elucidated. It therefore became possible to produce a lettuce plant having resistance to the virus by expressing the nucleic acid or its antisense nucleic acid in lettuce. In addition, it became possible to make a diagnosis of infection with LBVV by detecting the nucleic acid or protein encoded thereby.
Claims
1-17. (canceled)
18. An isolated nucleic acid encoding a protein of lettuce big-vein virus, said nucleic acid selected from the group consisting of:
- (a) a nucleic acid encoding a protein comprising the amino acid sequence of SEQ ID NO: 13; and
- (b) the nucleic acid of (a) comprising the coding region of the nucleotide sequence of SEQ ID NO: 12.
19. The nucleic acid according to claim 18, wherein the nucleic acid is an RNA.
20. The nucleic acid according to claim 18, wherein the nucleic acid is a DNA.
21. An isolated DNA encoding an RNA that suppresses the production of a lettuce big-vein virus protein comprising the amino acid sequence of SEQ ID NO:13, wherein the DNA is any one of the following (a) to (d):
- (a) a DNA encoding a sense RNA which has a complementarity of 90% of more to a completely complementary strand of the RNA according to claim 19;
- (b) a DNA encoding an antisense RNA which has a complementarity of 90% or more to the RNA according to claim 19;
- (c) a DNA encoding a sense RNA which is completely complementary to a completely complementary strand of the RNA according to claim 19; and
- (d) a DNA encoding an antisense RNA which is completely complementary to the RNA according to claim 19.
22. A vector comprising the nucleic acid according to claim 20.
23. A transformed cell comprising the nucleic acid according to claim 20.
24. A method of producing a protein, wherein said method comprises the steps of:
- (a) culturing the transformed cell of claim 23; and
- (b) recovering an expressed protein from said transformed cell or its culture supernatant.
25. A vector comprising the DNA according to claim 21.
26. A transformed lettuce cell that comprises the nucleic acid according to claim 18.
27. A transformed lettuce cell that comprises the DNA according to claim 21.
28. A transformed lettuce cell that comprises the vector according to claim 22 or claim 25.
29. A transformed lettuce plant comprising the transformed lettuce cell according to claim 26 or claim 27.
30. A transformed lettuce plant comprising the transformed lettuce cell according to claim 28.
31. A transformed lettuce plant that is a progeny or a clone of the transformed lettuce plant according to claim 29.
32. A transformed lettuce plant that is a progeny or a clone of the transformed lettuce plant according to claim 30.
33. A propagation material of the transformed lettuce plant according to claim 29, wherein the propagation material comprises said nucleic acid.
34. A propagation material of the transformed lettuce plant according to claim 30, wherein the propagation material comprises said nucleic acid.
35. A propagation material of he transformed lettuce plant according to claim 31, wherein the propagation material comprises said nucleic acid.
36. A propagation material of the transformed lettuce plant according to claim 32, wherein the propagation material comprises said nucleic acid.
37. A transformed cell comprising the vector according to claim 22.
38. A method of producing a protein, wherein said method comprises the steps of:
- (a) culturing the transformed cell of claim 37; and
- (b) recovering an expressed protein from said transformed cell or its culture supernatant.
Type: Application
Filed: Apr 25, 2007
Publication Date: Nov 15, 2007
Applicant: National Agricultural Research Organization (Ibaraki)
Inventors: Takahide Sasaya (Kagawa), Hiroki Koganezawa (Hiroshima)
Application Number: 11/790,420
International Classification: C12P 1/00 (20060101); C07H 21/04 (20060101); C12N 15/00 (20060101); C12N 5/00 (20060101);