Antisense oligonucleotide against human acetylcholinesterase (AChE) and uses thereof
The invention relates to an antisense oligonucleotide targeted to the coding region of the human acetylcholinesterase (AChE), which selectively suppresses the AChE-R isoform of the enzyme. The antisense oligonucleotide is intended for use in the treatment and/or prevention of neuromuscular disorders, preferably myasthenia gravis. In addition, it can penetrate the blood-brain barrier (BBB) and destroy AChE-R within central nervous system neurons, while also serving as a carrier to transport molecules across the BBB.
Latest Patents:
- RADAR APPARATUS AND METHOD FOR OPERATING A RADAR APPARATUS
- DETERMINING THE PHASE SHIFT MATRIX FOR ACTIVE-TAG ENHANCED INTELLIGENT REFLECTIVE SURFACES
- VEHICLE DETECTION SENSOR AND VEHICLE DETECTION SENSOR PROGRAM
- METHOD AND SYSTEM FOR DETERMINING DEVICE ORIENTATION WITHIN AUGMENTED REALITY APPLICATIONS
- ELECTRONIC DEVICE, MOBILE APPARATUS, TRANSPARENT OBJECT DETECTION METHOD AND IMAGE CORRECTION METHOD
The present invention relates to a synthetic antisense oligodeoxynucleotide targeted to the common coding domain of human acetylcholinesterase (AChE) mRNA, and to pharmaceutical or medical compositions comprising the same, particularly for the treatment and/or prevention of a progressive neuromuscular disorder.
BACKGROUND OF THE INVENTIONAll publications mentioned throughout this application are fully incorporated herein by reference, including all references cited therein.
Neuromuscular junctions (NMJ) are highly specialized, morphologically distinct, and well-characterized cholinergic synapses [Hall and Sanes (1993) Cell 72 Suppl., 99-121]. Chronic impairments in NMJ activity induce neuromuscular disorders characterized by progressive deterioration of muscle structure and function. The molecular and cellular mechanisms leading from compromised NMJ activity to muscle wasting have not been elucidated.
One such disorder is myasthenia gravis (MG), caused by a defect in neuromuscular transmission mediated by auto-antibodies that severely reduce the number of functional post-synaptic muscle nicotinic acetylcholine receptors (nAChR) [Drachman D. G. (1994) N. Engl. J. Med. 330, 1797-1810; Vincent A. (1999) Curr. Opin. Neurol. 12, 545-551]. MG is characterized by fluctuating muscle weakness that may be transiently improved by inhibitors of acetylcholinesterase (AChE) [Penn A. S. and Rowland L. P. (1995) Myasthenia Gravis In: Meritt's Textbook of Neurology, 9th Edition, Williams and Wilkins, Baltimore, section XVII, 754-761]. The characteristic electrodiagnostic abnormality is a progressive, rapid, decline in the amplitude of compound muscle action potentials (CMAP) evoked by repetitive nerve stimulation at 3 or 5 Hz. To date, the standard treatment for MG includes immunosuppressive therapy combined with chronic administration of multiple daily doses of peripheral AChE inhibitors such as pyridostigmine (Mestinon™). While AChE inhibitors effectively restore muscle performance in MG patients, their effects are short-lived, calling for the development of additional effective treatment.
Antisense technology offers an attractive, gene-based alternative to conventional anti-cholinesterase therapeutics. Antisense technology exploits the rules of Watson-Crick base pairing to design short oligonucleotides, 15-25 residues in length, whose sequence is complementary to that of a target mRNA [Agrawal S, and Kandimalla E. R. (2000) Mol. Med. Today, 6, 72-81]. Stretches of double-stranded RNA, resulting from hybridization of the antisense oligonucleotide (ASON) with its target, activate RNAse H [Crooke S. T. (2000) Methods Enzymol. 313, 3-45] and promote specific degradation of the duplex mRNA. As antisense therapeutics target RNA rather than proteins, they offer the potential to design highly specific drugs with effective concentrations in the nanomolar range [Galyam N. et al. (2001) Antisense Nucleic Acid Drug Dev. 11, 51-57]. Phosphorothioated and 3′ terminally protected 2′-O-methyl antisense oligonucleotides targeted to mouse AChE mRNA were shown to be effective in blocking AChE expression in vitro in cultured human and rodent cells [Koenigsberger C. et al. (1997) J. Neurochem. 69, 1389-1397; WO 98/26062; Grisaru D. et al. (2001) Mol. Med. 7, 93-105], and in vivo in brain [Shohami E. et al. (2000) J. Mol. Med. 78, 278-236; Cohen et al. (2002) Molecular Psychiatry, in press], muscle [Lev-Lehman E. et al. (2000) J. Mol. Neurosci. 14, 93-105] and bone marrow [Grisaru et al. (2001) ibid.].
The inventors have recently observed that treatment with the irreversible cholinesterase inhibitor diisopropylfluorophosphonate (DFP) induces overexpression of an otherwise rare, non-synaptic alternative splicing variant of AChE, AChE-R, in brain [Kaufer D. et al. (1998) Nature, 393, 373-377] and intestine [Shapira M. et al. (2000) Hum. Mol. Genet. 9, 1273-1282]. Muscles from animals treated with DFP also overexpressed AChE-R, accompanied by exaggerated neurite branching, disorganized wasting fibers and proliferation of NMJs. Partially protected 2′-O-methyl antisense oligonucleotides targeted to mouse AChE mRNA suppressed feedback upregulation of AChE and ameliorated DFP-induced NMJ proliferation [Lev-Lehman et al. (2000) ibid.]. These observations demonstrated that cholinergic stress elicits overexpression of AChE-R in muscle and that antisense oligonucleotides can suppress such AChE-R excess and prevent its deleterious outcome.
As mentioned above, the characteristic electrodiagnostic abnormality is a progressive, rapid decline in the amplitude of muscle action potentials evoked by repetitive nerve stimulation at 3 or 5 Hz. This myasthenic fatigue is caused by decrease in the number of AChR molecules available at the post-synaptic site. Inhibiting anti-AChR antibodies are present in 85% to 90% of patients [Vincent, A. (1999) id ibid].
Patients with MG, but not with congenital myasthenias due to other causes [Triggs et al. (1992) Muscle Nerve 15, 267-72], display a transient clinical response to AChE inhibitors such as edrophonium. The available anti-AChE drugs are the first line of treatment, but most patients require further help. This includes drastic measures, such as plasma exchange, thymectomy and immunosuppression. Unfortunately, all of the currently employed MG drug regimens. are associated with deleterious long-term consequences. These include disturbance of neuromuscular transmission, exacerbation and induction of MG symptoms. Also, the otherwise safe use of common drugs such as anti-infectives, cardiovascular drugs, anticholinergics, anticonvulsants, antirheumatics and others has been reported to worsen the symptoms of MG patients [Wittbrodt (1997) Arch. Intern. Med., 157, 399-408].
While the neuromuscular malfunctioning associated with MG can be transiently alleviated by systemic chronic administration of carbamate acetylcholinesterase (AChE) inhibitors (e.g. pyridostigmine), the inventors have found that pyridostigmine induces a feedback response leading to excess AChE accumulation [Friedman et al. (1996) Nature Medicine 2, 1382-1385; Kaufer et al. (1998) id ibid; Meshorer, E. et al. (2002) Science 295, 508-12]. This suggested that the chronic use of such inhibitors would modify the cholinergic balance in the patients' neuromuscular system and would require increased doses of these drugs; it also provided an explanation of the highly variable dose regimen employed in MG patients; and it called for the development of an alternative approach to suppress acetylcholine hydrolysis.
AChE-encoding RNA is subject to 3′ alternative splicing yielding mRNAs encoding a “synaptic” (S) isoform, containing exons 1-4 and 6, also designated E6 mRNA herein, an “erythrocytic” (E) isoform, containing exons 1-6, also designated E5 mRNA herein, and the “readthrough” AChE-R derived from the 3′-unspliced transcript, containing exons 1-6 and the pseudo-intron I4, also designated I4 mRNA herein.
Transgenic mice overexpressing human AChE-S in spinal cord motoneurons, but not in muscle, displayed progressive neuromotor impairments that were associated with changes in NMJ ultrastructure [Andres, C. et al. (1997) Proc. Natl. Acad. Sci. USA 94, 8173-8178]. However, it was not clear whether the moderate extent of overexpressed AChE in muscle was itself sufficient to mediate this severe myopathology. In rodent brain, the inventors found previously that both traumatic stress and cholinesterase inhibitors induce dramatic calcium-dependent overexpression of AChE-R [Kaufer, et al. (1998) id ibid.], associated with neuronal hypersensitivity to both cholinergic agonists and antagonists [Meshorer et al. (2002) id ibid].
Chronic AChE excess was found to cause progressive neuromotor deterioration in transgenic mice and amphibian embryos [Ben Aziz-Aloya et al. (1993) Proc. Natl. Acad. Sci. USA, 90, 2471-2475; Seidman et al. (1994) J. Neurochem. 62, 1670-1681; Seidman, et al. (1995) Mol. Cell. Biol. 15, 2993-3002; Andres, C. et al. (1997) Proc. Natl. Acad. Sci. USA 94, 8173-8178; Sternfeld et al. (1998) J. Neurosci. 18, 1240-1249]. Also, myasthenic patients suffer acute crisis events, with a reported average annual incidence of 2.5% [Berrouschot et al. (1997) Crit. Care Med. 25, 1228-35] associated with respiratory failure reminiscent of anti-AChE intoxications.
In one approach, the prior art teaches that chemically protected RNA aptamers capable of blocking the autoantibodies to the nicotinic Acetylcholine Receptor (nAChR) may be developed and used to treat MG. This approach has several drawbacks in that the RNA aptamers do not have the amplification power characteristic of the RNAse-inducing antisense agents and in that it fails to address the problem of the feedback responses in MG.
The present inventors have previously found that antisense oligonucleotides against the common coding region of AChE are useful for suppressing AChE production [WO 98/26062]. This publication also teaches that antisense oligonucleotides against the human AChE are useful in the treatment of memory deficiencies as observed in transgenic mice that expressed human AChE in their brain. The observed effects (see Table 4-5 in WO 98/26062) are similar in their effect, yet considerably longer in the duration of their action than the prior art AChE inhibitor tacrine (see FIG. 9B in WO 98/26062).
In view of the above, it is desirable to further improve the treatment approaches for MG and other diseases involving impairment in neuromuscular transmission. The prior art treatment involving the use of AChE inhibitors is afflicted with undesirable side effects because of the induction of AChE and neuromuscular impairments by such inhibitors; and because it is subject to variable efficacy under altered mental state (stress).
WO01/36627 teaches that morphological and functional changes in the NMJ correlate with overexpression of a specific isoform of AChE mRNA, viz., the “readthrough” isoform containing the pseudo-intron 14 in the mature mRNA. Said PCT application also shows that antisense oligonucleotides directed to the common coding region of AChE may be used to specifically destroy AChE-R mRNA, and that AChE antisense agents are by far superior to conventional AChE enzyme inhibitor drugs in the treatment of neuromuscular disorders. The superiority of these antisense agents may be due to the fact that conventional enzyme inhibitors actively induce I4 AChE mRNA overexpression. According to the teachings of WO01/36627, this may lead to detrimental changes in the NMJ. This consequence of treatment may be entirely avoided by using the antisense agents of WO01/36627.
The Blood-Brain Barrier (BBB) maintains a homeostatic environment in the central nervous system (CNS). The capillaries that supply the blood to the brain have tight junctions which block the passage of most molecules through the capillary endothelial membranes. While the membranes do allow passage of lipid soluble materials, water soluble materials do not generally pass through the BBB. Mediated transport mechanisms exist to transport the water soluble glucose and essential amino acids through the BBB. Active support mechanisms remove molecules which become in excess, such as potassium, from the brain [for general review see Betz et al., Blood-Brain-Cerebrospinal Fluid Barriers, Chapter 32, in Basic Neurochemistry, 5th ed., Eds Siegel, Albers Agranoff, Molinoff, pp. 681-701; Goldstein and Betz (1986) Scientific American, September, pp. 74-83].
The BBB impedes the delivery of drugs to the CNS. Methods have been designed to deliver needed drugs such as direct delivery within the CNS by intrathecal delivery can be used with, for example, an Omaya reservoir. U.S. Pat. No. 5,455,044 provides for the use of a dispersion system for CNS delivery [for description of other CNS delivery mechanisms, see U.S. Pat. No. 5,558,852, Betz et al., ibid., and Goldstein and Betz, ibid.]. Tavitan et al. [Tavitan et al. (1998) Nat Med 4(4): 467-71] observed that 2′-O-methyl oligonucleotides are able to penetrate into the brain. Other systems make use of specially designed drugs that utilize the structure and function of the BBB itself to deliver the drugs, for example by designing lipid soluble drugs or by coupling to peptides that can penetrate the BBB.
It has been shown that stress affects the permeability of the BBB [Sharma H. S. et al. (1992) Prog. Brain Res. 91, 189-196; Ben-Nathan D. et al. (1991) Life. Sci. 489, 1493-1500]. Further, in mammals, acute stress elicits a rapid, transient increase in released acetylcholine with a corresponding phase of increased neuronal excitability [Imperato A. et al. (1991) Brain Res. 538, 111-117]. It has been previously observed by the present inventors that the AChE-R isoform and the 14 peptide of AChE can act as stress mimicking agents and rupture the BBB. These findings formed the basis for PCT application WO98/22132, the contents of which are fully incorporated herein by reference. WO98/22132 relates to compositions for facilitating the passage of compounds through the BBB, comprising the AChE-R splice variant and/or the peptide I4.
In search for an antisense oligonucleotide targeted against a domain of the human AChE, which may be particularly acceptable in human therapy, the inventors have now found, and this is an object of the present invention, that a synthetic antisense oligodeoxynucleotide having the nucleotide sequence: 5′-CTGCCACGTTCTCCTGCACC-3′, herein designated SEQ ID NO:1, is not only useful in selectively suppressing the production of the AChE-R isoform, but also possesses cross-species specificity, which enables its use in rodent animal models of various diseases and, moreover, remarkably appears to penetrate the BBB, and may thus be useful in treatment of diseases of the central nervous system, alone or in combination with other therapeutic agents. The finding that the novel antisense of the invention can penetrate the BBB was unexpected, particularly in view of the expectation that the BBB would be impermeable to large polar molecules.
The application of antisense technology to the treatment of nervous system disorders has, until recently, been considered to be limited by the lack of adequate systems for delivering oligonucleotides to the brain. Nevertheless, several attempts have been made to circumvent this difficulty [reviewed in Seidman S. et al. (1999) Antisense Nucl. Acid Drug Devel, 9, 333-340]. Access of chemical agents circulating in the blood to the interstitial spaces of the brain is restricted by the biomechanical barrier known as the BBB. The strong anionic character of the phosphodiester backbone makes oligonucleotides especially poor at crossing the BBB. In vivo pharmacokinetic studies have demonstrated that less than 0.01% of a systemically injected dose of a phosphorothioate antisense oligonucleotide may reach the brain, where its residence time may be as little as 60 min. A research solution to this problem in the laboratory is direct bypass of the BBB by intracranial injection of oligonucleotides. Using published stereotactic coordinates for both rats and mice, oligonucleotides can be delivered by single injections, by repeated administration through an implanted cannula, or by continuous infusion using an osmotic mini-pump such as Alzet (Alza, Palo Alto, Calif.). Oligonucleotides can either be delivered into the CSF or directly into the brain region of interest. In general, oligonucleotides are considered to remain relatively localized following intraparenchymal administration. Thus, a single injection of 24 μg of an antisense oligonucleotide targeted to the cAMP-response element (CREB) into rat amygdala was reported to diffuse only 0.72±0.04 μl around the injection site, exerting region-specific effects on conditioned taste aversion (CTA). Injection of the same oligonucleotide into the basal ganglia 2 mm above the amygdala had no effect on CTA. Similarly, specific effects on behavior were reported following the injection of antisense oligonucleotides against the stress-associated transcription factor c-fos into the medial frontal cortex (single administration; 10 μg), following delivery of oligonucleotides against the neurotransmitter-synthesizing enzyme glutamate decarboxylase into the ventromedial hypothalamus (single administration; 1 μg), and following 5 days continuous infusion of oligonucleotides targeted to mRNA encoding the cAMP-responsive transcription factor CREB into the locus coeruleus (20 μg/day). It was further reported that wide distribution of oligonucleotides in the brain (up to 443 μl around the site of injection after 48 hrs) could be achieved by direct, high-flow intraparenchymal microinfusion. In that case, the average tissue concentration of oligonucleotide was calculated to be between 3-15 μM—well within what is considered physiologically significant. Regarding uptake into neurons, it was shown that neurons in the striatum of rats preferentially take up oligonucleotides compared to glia. Despite the general retention of oligonucleotides around the injection site reported in that study, some signal was observed to be transported along projection pathways to distant sites. However, to be effective therapeutically, oligonucleotides should be prepared in a way that would enable their stability and free penetrance into the central nervous system following intravenous injection, or yet more preferably, following oral administration. Thus, the present invention is aimed at a novel, preferably nuclease protected antisense oligodeoxynucleotide targeted to the common coding domain of human AChE, which selectively suppresses the production of AChE-R, with rapid and long-lasting clinical improvements in muscle function, which possesses cross-species specificity and can penetrate the BBB and destroy AChE-R mRNA within central nervous system neurons.
SUMMARY OF THE INVENTIONThe invention relates to a pharmaceutical or medical composition for the treatment and/or prevention of a progressive neuromuscular disorder, comprising as active ingredient a synthetic antisense oligodeoxynucleotide targeted against human AChE mRNA having the nucleotide sequence:
The antisense oligonucleotide preferably causes preferential destruction of AChE-R mRNA, possesses cross-species specificity, was demonstrated to cause no toxicity in rodents or primates, and can penetrate the BBB in primates (monkeys) via both i.v. and p.o. administration routes.
In a preferred embodiment, the synthetic antisense oligodeoxynucleotide having the nucleotide sequence designated SEQ ID NO:1 is nuclease resistant. The nuclease resistance may be achieved by modifying the antisense oligodeoxynucleotide of the invention so that it comprises partially unsaturated aliphatic hydrocarbon chain and one or more polar or charged groups including carboxylic acid groups, ester groups, and alcohol groups.
In particular embodiments, the nuclease resistant antisense oligodeoxynucleotide of the invention has at least one of the last three 3′-terminus nucleotides is 2′-O-methylated, preferably the last three 3′-terminus nucleotides are 2′-O-methylated. Alternatively, the nuclease resistant antisense oligodeoxynucleotide of the invention may have at least one of the last 3′-terminus nucleotides fluoridated. Still alternatively, the nuclease resistant antisense oligodeoxynucleotide of the invention has phosphorothioate bonds linking between at least two of the last 3′-terminus nucleotide bases, preferably has phosphorothioate bonds linking between the last four 3′-terminal nucleotide bases. Still alternatively, nuclease resistance may be achieved by the synthetic nuclease resistant antisense oligodeoxynucleotide of the invention having a nucleotide loop forming sequence at the 3′-terminus, for example a 9-nucleotide loop having the nucleotide sequence CGCGAAGCG (SEQ ID NO:2).
The synthetic nuclease resistant antisense oligodeoxynucleotide of the invention is capable of selectively modulating mammalian AChE production, particularly selectively modulating primate AChE production in neurons residing in the central nervous system, including human AChE of interneurons.
In a further aspect, the invention relates to a pharmaceutical composition comprising an antisense oligodeoxynucleotide of the invention, and optionally further comprising pharmaceutically acceptable adjuvant, carrier or diluent.
In a preferred embodiment, the pharmaceutical composition of the invention comprises an antisense oligodeoxynucleotide of SEQ ID NO:1, which is 2′-O-methylated on at least one, preferably the three last 3′-terminus nucleotides.
The pharmaceutical composition of the invention is useful in the treatment and/or prevention of a progressive neuromuscular disorder, for improving stamina and/or for use in decreasing chronic muscle fatigue.
The pharmaceutical composition of the invention may be for a once daily use by a patient of a dosage between about 0.001 μg/g and about 50 μg/g of active ingredient, preferably a dosage of active ingredient of about 0.01 to about 5.0 g/g, more preferably a dosage of active ingredient of about 0.15 to about 0.5 μg/g.
The pharmaceutical composition of the invention is particularly intended for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder is associated with an excess of AChE mRNA or protein. Such a disorder may be, for example, a progressive neuromuscular disorder, wherein said disorder is associated with an excess of AChE-R mRNA.
The pharmaceutical composition of the invention is thus particularly suitable for treating or preventing a progressive neuromuscular disorder, wherein said disorder is associated with impairment of cholinergic transmission.
Of particular interest are pharmaceutical compositions for the treatment of a progressive neuromuscular disorder, wherein said disorder involves muscle distortion, muscle re-innervation or NMJ abnormalities, for example myasthenia gravis, Eaton-Lambert disease, muscular dystrophy, amyotrophic lateral sclerosis, post-traumatic stress disorder (PTSD), multiple sclerosis, dystonia, post-stroke sclerosis, post-injury muscle damage, post-surgery paralysis, excessive re-innervation, and post-exposure to AChE inhibitors.
The pharmaceutical composition of the invention is also useful in improving stamina in physical exercise or in decreasing muscle fatigue.
In addition, the invention relates to a pharmaceutical composition comprising an antisense oligodeoxynucleotide as denoted by SEQ ID NO:1, for facilitating passage of compounds through the BBB, optionally further comprising additional pharmaceutically active agent and/or pharmaceutically acceptable adjuvant, carrier or diluent. The additional pharmaceutically active agent is a compound to be transported through the BBB, wherein said compound may be contrast agents used for central nervous system imaging, agents that function to block the effects of abused drugs, antibiotics, chemotherapeutic drugs and vectors to be used in gene therapy. This composition would function primarily by suppressing the production of AChE-R, which is apparently involved in BBB maintenance.
The invention will be described in more detail in the following detailed description and on hand of the following figures.
Separation of rat serum was performed in non-denaturing polyacrylamide gel, and the gel tested for immunoreactive AChE-R. An EAMG rat had considerably higher level of the rapidly migrating rR variant than a control rat.
Abbreviations: electroph., electrophoresis; cont., control.
Antibodies targeted to the pseudo-intron 4′-derived C-terminal peptide served to detect the AChE-R protein, and cRNA probes to exon 6 and pseudo-intron 4′ label the two transcripts (asterisks).
Abbreviations: healt., healthy; r., rat; prot., protein.
Abbreviations: ser., serum; t., time; dep., dependence; neostig., neostigmine; resp., response; h., hours; perc., percent; cont., control; rat., ratio; bas., baseline.
Experimental autoimmune myasthenic gravis (EAMG) rats with varying severity of clinical symptoms and healthy Lewis rats were prodded to run on an electrically powered treadmill (25 m/min, inset) until visibly fatigued. Presented is the average time (sec.±SEM) rats were able to run before and 24 h following i.v. administration of 250 μg/kg rEN101. Note that running time for EAMG rats decreased with disease severity, and increased for each group treated with rEN101.
Abbreviations: trml., treadmill; treat., treatment; h., hour; clin., clinical; stat., status; run., running; t., time; sec., seconds.
EAMG rats received rEN101 once daily for up to 4 days by intravenous injection (25 μg/kg) or via oral gavage (50 μg/kg), or pyridostigmine (1000 μg/kg) by oral gavage. The CMAP ratio was determined 1 and 5 h following the first drug administration and then every 24 h, prior to the administration of the subsequent dose.
Abbreviations: sing., single; dos., dose; rep., repeated; d., daily; pyridostig., pyridostigmine; h., hours; rat., ratio; bas., baseline; ab., above.
Abbreviations: surv., survival; clin., clinical; stat., status; stam., stamina; an., animals; al., alive; sc., score; run., running; t., time; sec., seconds; w., weeks; sal., saline; pyridostig., pyridostigmine.
At the neuromuscular junction, acetylcholine (ACh) released from the motoneuron terminal (top) into the synaptic cleft travels towards the muscle postsynaptic membrane (below). There, it interacts with nAChR to initiate an inward ion current and elicit muscle action potentials. ACh is subsequently hydrolyzed by synapse-bound AChE-S. Subsynaptic muscle nuclei (ellipses) produce, in addition to the primary AChE-S mRNA transcript, the normally rare AChE-R mRNA with its alternative 3′-end. This transcript translates into soluble, secretory AChE-R monomers. Myasthenic autoimmune antibodies toward nAChR block the initiation of action potentials, mimicking an ACh-deficient state. The cholinergic imbalance results in AChE-R accumulation that enhances ACh destruction, leading to muscle fatigue. Chemical anticholinesterases (indented circles) non-selectively block both AChE-S and AChE-R, which transiently increases ACh levels, yet further intensifies AChE-R overproduction. In contrast, the antisense agent EN101 selectively induces AChE-R mRNA destruction, preventing AChE-R synthesis while maintaining AChE-S and sustaining normal neuromuscular transmission.
Shown are representative fields from spinal cord sections of hEN101-treated monkeys following in situ hybridization with AChE-R or AChE-S cRNA probes. Note that AChE-R mRNA labeling decreased, but AChE-S mRNA levels appeared unchanged. An increasing dose of o.g.-administered hEN101 suppressed AChE-R mRNA more effectively, suggesting dose-dependence. Administration of the higher dose via i.v. appeared more effective than the o.g. route.
Abbreviations: d., day.
Spinal cord neurons from hematoxylin-eosin stained monkey sections were divided by size into cells with perikaryal diameters of <40, 40 to 70 and >70 μm. The percent of cells within each size group that were positively labeled for AChE-R mRNA was recorded in 5 different fields of 1 mm2 each, for each hEN101 treatment. Note that hEN101 effectiveness was apparently highest in the relatively small interneurons, and lowest in the largest motoneurons.
Abbreviations: pos., positive; cel., cell; siz., size; gr., group; bo., body; diam., diameter; nv., naïve.
Abbreviations: t., time; fol., following; treat., treatment; hrs., hours.
Abbreviations: cont., control.
For the purposes of clarity, the following abbreviations and terms are defined herein:
-
- AChE: acetylcholinesterase
- AChE-R: acetylcholinesterase, “readthrough” variant or isoform, its mRNA includes pseudo-intron 14
- AChE-S: acetylcholinesterase, synaptic variant or isoform
- AS-ON: antisense oligonucleotide
- BBB: blood-brain barrier
- CMAP: compound muscle action potential
- CNS: central nervous system
- EAMG rat: rats wherein experimental autoimmune myasthenia gravis has been induced
- EN101: may also be referred as AS3; antisense oligonucleotide targeted against human, rat or mouse (hEN101, rEN101 or mEN101, respectively) AChE mRNA
- EN102: may also be referred as -AS1, antisense oligonucleotide targeted against AChE mRNA, at a different region than EN101
- MG: myasthenia gravis, a neuromuscular junction disease
- i.v.: intravenous
- o.g.: oral gavage
- p.o.: per os
Antisense oligonucleotide: A nucleotide comprising essentially a reverse complementary sequence to a sequence of AChE mRNA. The nucleotide is preferably an oligodeoxynucleotide, but also ribonucleotides or nucleotide analogues, or mixtures thereof, are contemplated by the invention. The antisense oligonucleotide may be modified in order to enhance the nuclease resistance thereof, to improve its membrane crossing capability, or both. The antisense oligonucleotide may be linear, or may comprise a secondary structure. It may also comprise enzymatic activity, such as ribozyme activity.
Progressive neuromuscular disorder: A disorder or condition associated with excess AChE mRNA or protein production, characterized by changes in the morphology of the NMJ and impairment in neuromuscular transmission. The neuromuscular disorder may involve muscle distortion, muscle re-innervation or NMJ abnormalities. More preferably, the progressive neuromuscular disorder is myasthenia gravis, muscular dystrophy, multiple sclerosis, amyotrophic lateral sclerosis, post-traumatic stress disorder (PTSD), or dystonia.
The present invention relates to a novel antisense oligodeoxynucleotide substantially as denoted by SEQ ID NO:1, also designated herein as hEN101.
In addition to the part of the sequence which is complementary to AChE sequence, the antisense oligonucleotide of the invention may also comprise RNA sequences with enzymatic nucleolytic activity, or may be linked to such sequences. Preferred nucleolytic sequences are ribozyme sequences, which were shown to specifically interact with mRNA transcripts. They are ribonucleic acid sequences, including RNase active sites flanked by antisense oligonucleotides [Haseloff and Gerlach (1988) Nature 3, p. 585, Sarver et al. (1990) Science 247, p. 1222]. Preferred ribozymes are hammerhead ribozymes [Conaty et al. (1999) Nucleic Acids Res. 27, 2400-2407; and Xu et al. (1999) Endocrinology, 140, 2134-44]. Another preferred ribozyme is the hairpin ribozyme structure, e.g., as derived from tobacco ringspot virus satellite RNA [see Perez-Ruiz (1999) Antisense Nucleic Acid Drug Dev., 9, 33-42].
The novel antisense oligodeoxynucleotide of the invention corresponds to the reverse complement of human AChE mRNA sequence, from nucleotide 795-5′ to nucleotide 3′-814 (
The antisense oligodeoxynucleotide of the invention is preferably nuclease resistant. There are a number of modifications that impart nuclease resistance to a given oligonucleotide. Reference is made to WO 98/26062, which publication discloses that oligonucleotides may be made nuclease resistant e.g., by replacing phosphodiester internucleotide bonds with phosphorothioate bonds, replacing the 2′-hydroxy group of one or more nucleotides by 2′-O-methyl groups, or adding a nucleotide sequence capable of forming a loop structure under physiological conditions to the 3′ end of the antisense oligonucleotide sequence. An example for a loop forming structure is the sequence 5′ CGCGAAGCG (SEQ ID NO:2), which may be added to the 3′ end of a given antisense oligonucleotide to impart nuclease resistance thereon.
The cells on which the antisense oligonucleotide of the invention exerts its effects are preferably muscle cells and cells of the NMJ, including the nerve axons and endplate structures.
Using the antisense oligonucleotides according to the invention, it is expected that AChE-R amount and AChE-R mRNA levels are reduced in central nervous system neurons by at least about 30%, preferably by at least about 40%, and more preferably by at least about 50%, within 24 hr of the treatment, and by about 80% under repeated treatment. This reduction was shown by fluorescent in situ hybridization (FISH) and immune labeling and its effectiveness was confirmed by electrophysiology and tread mill tests. It exceeded by far all previous reports of AS-ON destruction of AChE-R mRNA in other cells and tissues.
In yet another embodiment of the invention, the preferred treatment window of candidate oligonucleotides is evaluated by FISH. The technique of in situ hybridization is well known to the man of skill in the art, and is described e.g., In situ Hybridization, Wilkinson, D. G. (Ed.) ISBN: 0199633274; In situ Hybridization for the Brain, Wisden W., Morris B. J. (Eds.), ISBN: 0127599207, PCR in situ Hybridization: A Practical Approach (Practical Approach Series 186), Herrington C. S., John O'Leary J., (Eds.) ISBN:019963632X. Detailed protocols relating to in situ hybridization using non-radioactively labeled probes are available from Microsynth GmbH (Balgach, Switzerland).
Labeled AChE-R cRNA sequences may be used as probes for in situ hybridization. The ACHE cRNA probe preferably comprises I4 pseudo-intron sequences.
In a preferred embodiment of the invention, the AChE mRNA determination is carried out by using in situ RT-PCR, which technique is described, e.g., in the above-mentioned references, see also PCR in situ hybridization: Protocols and Applications, 3rd ed., by Nuovo, G. J. Lippincott, Raven Press, New York (1996).
Phosphorothioate-modified oligonucleotides are generally regarded as safe and free of side effects. Peng et al. teach that undesired in vivo side effects of phosphorothioate antisense oligonucleotides may be reduced when using a mixed phosphodiester-phosphorothioate backbone. The antisense oligonucleotides of the present invention have been found to be effective as partially phosphorothioates and yet more effective as partially 2′-O-methyl protected oligonucleotides. WO 98/26062 teaches that AChE antisense oligonucleotides containing three phosphorothioate bonds out of about twenty internucleotide bonds are generally safe to use in concentrations of between about 1 and 10 μM. However, for long-term applications, oligonucleotides that do not release toxic groups when degraded may be preferred. These include 2′-O-methyl protected oligonucleotides, but not phosphorothioate oligonucleotides. A further advantage of 2′-O-methyl protection over phosphorothioate protection is the reduced amount of oligonucleotide that is required for AChE suppression. This difference is thought to be related to the improved stability of the duplexes obtained when the 2′-O-methyl protected oligonucleotides are used [Lesnik, E. A. & Freier, S. M., Biochemistry 37, 6991-7, (1998)]. An alternative explanation for the greater potency of the 2′-O-methyl oligonucleotides is that this modification may facilitate penetration of the oligonucleotide chain through the cell membrane. A further advantage of 2′-O-methyl protection is the better protection against nuclease-mediated degradation that it confers, thus extending the useful life time of antisense oligonucleotides protected in this way.
In accordance with the invention, the dosage of the antisense oligodeoxynucleotide is about 0.001 to 50 μg oligonucleotide per gram of body weight of the treated animal. Preferably, the dosage is about 0.01 to about 5.0 μg/g. More preferably, the dosage is between about 0.05 to about 0.7 μg/g. Thus, the optimal dose range is between 50-500 g/kg of body weight of the treated subject, for rats, monkeys and also humans.
The antisense oligonucleotide of the invention is provided for use in the treatment of a disorder that involves excessive AChE mRNA production.
The disorder is preferably a disorder involving functional and morphological changes in the NMJ.
The progressive neuromuscular disorder preferably involves overexpression of AChE-R mRNA.
More preferably, the disorder is selected from, but not limited to, multiple sclerosis, PTSD, myasthenia gravis, muscular dystrophy, amyotrophic lateral sclerosis, dystonia, muscle distortion, muscle re-innervation or excessive muscle innervation.
The excessive muscle innervation is selected preferably from, but not limited to, excessive innervation after trauma, preferably after amputation.
In one aspect, the invention relates to a pharmaceutical composition for the treatment and/or prevention of a progressive neuromuscular disorder, for improving stamina in physical exercise and/or for use in decreasing chronic muscle fatigue, comprising as active ingredient the synthetic antisense oligodeoxynucleotide hEN101, as denoted by SEQ ID NO:1, and optionally further comprising additional therapeutic agents and/or pharmaceutically acceptable carriers, excipients and/or diluents. Preferably, said pharmaceutical composition is for the treatment and/or prevention of myasthenia gravis.
The progressive neuromuscular disorder to be treated and/or prevented by the pharmaceutical composition of the invention is associated with an excess of AChE or protein. Usually, said excessive AChE will be the AChE-R variant or isoform.
In addition, said progressive neuromuscular disorder to be treated and/or prevented by the pharmaceutical composition of the invention is associated with impairment of the cholinergic transmission. Said disorder may involve muscle distortion, muscle re-innervation, or neuromuscular junction (NMJ) abnormalities.
The pharmaceutical composition of the invention is for use in the treatment and/or prevention of a disorder such as myasthenia gravis (MG), Eaton-Lambert disease, muscular dystrophy, amyotrophic lateral sclerosis (ALS), post-traumatic stress disorder (PTSD), multiple sclerosis (MS), dystonia, post-stroke sclerosis, post-injury muscle damage, excessive re-innervation, post-surgery paralysis of unknown origin and post-exposure to AChE inhibitors.
In one embodiment, the pharmaceutical composition of the invention is for daily use by a patient in need of such treatment, at a dosage of active ingredient between about 0.001 μg/g and about 50 μg/g. Preferably, the treatment and/or prevention comprises administering a dosage of active ingredient of about 0.01 to about 5.0 μg/g. Most preferably, said dosage of active ingredient is of between about 0.05 to about 0.70 μg/g, and even most preferably, the dosage is from 0.15 to 0.50 μg/g of body weight of the patient.
As may be seen in Example 11 and
The pharmaceutical composition of the invention may optionally comprise at least one additional active agent. Said active agent may be, for example, AChE inhibitors used for the treatment of neuromuscular disorders.
In a further aspect, the invention relates to a pharmaceutical composition comprising an antisense oligodeoxynucleotide as denoted by SEQ ID NO:1, for facilitating passage of compounds through the BBB, optionally further comprising additional pharmaceutically active agent and/or pharmaceutically acceptable adjuvant, carrier or diluent. The additional pharmaceutically active agent is a compound to be transported through the BBB. These pharmaceutical compositions of the invention may be used for treatment of disorders associated with the central nervous system, particularly such disorders that require administration of an active agent into the CNS, for example, for the treatment of brain tumors. Conventional chemotherapeutic agents do not pass the BBB, and are therefore ineffective [de Angelis, L. M., N. Engl. J. Med. 433, 114-123 (2001)]. As the antisense oligonucleotide of the invention has been shown to penetrate the BBB, brain tumors could be treated by injection or oral administration of the antisense oligonucleotide of the invention, preventing or reducing the need for methods requiring invasion of the CNS. Antisense oligonucleotides can be made tumor-specific [Ratajczak M. Z. et al. Proc. Natl. Acad. Sci. USA 89, 11823-11827 (1992)]; therefore should they be found to pass the BBB, they may be both specific and effective. Thus, the additional pharmaceutical agents comprised in these compositions of the invention may be, for example carcinostatic and metastatic drugs.
A number of compounds are needed for the diagnostic or treatment of conditions affecting the central nervous system, wherein the BBB would normally impede their delivery. These conditions can include any disease or pathology, which include but are not limited to infections, neurochemical disorders, brain tumors and gliomas, demyelination, other neuropathies, encephlopathies, coma, ischemia, hypoxia, epilepsy, dementias, cognitive disorders, neuropsychiatric disorders (as for example depression, anxiety, schizofrenia and the like), as well as genetic disorders. Thus, said compounds or additional pharmaceutically active agent to be transported across the BBB may be, for example, contrast agents (dyes) used for central nervous system imaging, drugs such as antibiotics or chemotherapeutics, gene therapy vectors, or even agents that function to block the effects of abused drugs. The administration and dosage of these compounds shall be according to what is known in medical practice, which generally should take into account the clinical condition of the patient in need of such treatment, as well as said patient's age, sex, body weight and other factors known to be important in the medical practice. The site and method of administration should also be chosen accordingly. The pharmaceutically effective amount for purposes herein is thus determined by such considerations as are known in the art. The compound can be administered in several ways as described for the delivery of the composition (see below).
The compound to be transported through the BBB may be administered simultaneously with the composition of the invention or can be administered at some point during the biologically effective period of the action of the composition. In other words, the composition of the invention facilitates the disruption of the BBB, i.e. it opens the BBB, for a period of time depending on its dose and the compound can then be administered during this “open” period.
In order to be effective, the antisense oligonucleotide of the invention, also when comprised in a pharmaceutical composition of the invention, must travel across cell membranes. In general, antisense oligonucleotides have the ability to cross cell membranes, apparently by a saturable uptake mechanism linked to specific receptors. As antisense oligonucleotides are single-stranded molecules, they are to a degree hydrophobic, which enhances passive diffusion through membranes. Modifications may be introduced to an antisense oligonucleotide to improve its ability to cross membranes. For instance, the oligonucleotide molecule may be linked to a group comprising optionally partially unsaturated aliphatic hydrocarbon chain and one or more polar or charged groups such as carboxylic acid groups, ester groups, and alcohol groups. Alternatively, oligonucleotides may be linked to peptide structures, which are preferably membranotropic peptides. Such modified oligonucleotides penetrate membranes more easily, which is critical for their function and may therefore significantly enhance their activity. Palmityl-linked oligonucleotides have been described by Gerster et al. [Anal. Biochem. 262, 177-84 (1998)]. Geraniol-linked oligonucleotides have been described by Shoji et al. [J. Drug Target 5, 261-73 (1998)]. Oligonucleotides linked to peptides, e.g., membranotropic peptides, and their preparation have been described by Soukchareun et al. [Bioconjug. Chem. 9, 466-75 (1998)]. Modifications of antisense molecules or other drugs that target the molecule to certain cells and enhance uptake of the oligonucleotide by said cells are described by Wang, J. [Controlled Release 53, 39-48 (1998)].
Any of the compositions of the invention are for use by injection, topical administration or oral uptake. Preferred uses of the pharmaceutical compositions of the invention by injection are subcutaneous injection, intraperitoneal injection, and intramuscular injection. As shown in the following Examples, oral administration proved very effective, it is much easier to prescribe and meet patient compliance, and it involves more easy handling.
The compositions of the present invention suitable for oral administration may be presented as discrete units such as capsules, sachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The active ingredient may also be presented as a bolus, electuary or paste. A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (e.g., povidone, gelatin, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (e.g., sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose) surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile. Tablets may optionally be provided with an enteric coating, to provide release in parts of the gut other than the stomach.
The pharmaceutical compositions of the invention generally comprise a buffering agent, an agent which adjusts the osmolarity thereof, and optionally, one or more carriers, excipients and/or additives as known in the art, e.g., for the purposes of adding flavors, colors, lubrication, or the like to the pharmaceutical composition. A preferred buffering agent is phosphate-buffered saline solution (PBS), which solution is also adjusted for osmolarity.
Carriers may include starch and derivatives thereof, cellulose and derivatives thereof, e.g., microcrystalline cellulose, xantham gum, and the like. Lubricants may include hydrogenated castor oil and the like.
A preferred pharmaceutical formulation is one lacking a carrier. Such formulations are preferably used for administration by injection, including intravenous injection.
The preparation of pharmaceutical compositions is well known in the art and has been described in many articles and textbooks, see e.g., Remington's Pharmaceutical Sciences, Gennaro A. R. ed., Mack Publishing Co., Easton, Pa., 1990, and especially pp. 1521-1712 therein.
Additives may also be designed to enhance uptake of the antisense oligonucleotide across cell membranes. Such agents are generally agents that will enhance cellular uptake of double-stranded DNA molecules. For instance, certain lipid molecules have been developed for this purpose, including the transfection reagents DOTAP (Roche Diagnostics), Lipofectin, Lipofectam, and Transfectam, which are available commercially. For a comparison of various of these reagents in enhancing antisense oligonucleotide uptake see e.g., Quattrone et al. [Biochemica 1, 25, (1995)] and Capaccioli et al. [Biochem. Biophys. Res. Comm. 197, 818 (1993). The antisense oligonucleotide of the invention may also be enclosed within liposomes. The preparation and use of liposomes, e.g., using the above mentioned transfection reagents, is well known in the art. Other methods of obtaining liposomes include the use of Sendai virus or of other viruses. Examples of publications disclosing oligonucleotide transfer into cells using the liposome technique are e.g., Meyer et al. [J. Biol. Chem. 273, 15621-7 (1998)], Kita and Saito [Int. J. Cancer 80, 553-8 (1999)], Nakamura et al. [Gene Ther. 5, 1455-61 (1998)] Abe et al. [Antivir. Chem. Chentother. 9, 253-62 (1998)], Soni et al. [Hepatologv, 28, 1402-10 (1998)], Bai et al. [Ann. Thorac. Surg. 66, 814-9 (1998) and see also discussion in the same journal p. 819-20], Bochot et al. [Pharm. Res. 15, 1364-9 (1998)], Noguchi et al. [FEBS Lett. 433, 169-73 (1998)], Yang et al. [Circ. Res. 83, 552-9 (1998)], Kanamaru et al. [J. Drug Target. 5, 235-46 (1998)] and references therein. The use of Lipofectin in liposome-mediated oligonucleotide uptake is described in Sugawa et al. [J. Neurooncol. 39, 237-44 (1998)]. The use of fusogenic cationic-lipid-reconstituted influenza virus envelopes (cationic virosomes) is described in Waelti et al. [Int. J. Cancer, 77, 728-33 (1998)].
The above-mentioned cationic or nonionic lipid agents not only serve to enhance uptake of oligonucleotides into cells, but also improve the stability of oligonucleotides that have been taken up by the cell.
The invention also relates to a method for the treatment or prevention of a progressive neuromuscular disorder or other disease involving excessive production of AChE-R mRNA, comprising administering the oligodeoxynucleotide of the invention or a pharmaceutical composition of the invention or of any of the preferred embodiments thereof, to a patient in need thereof.
Lastly, the invention relates to a method of administering to a patient in need of such treatment a therapeutic agent for treatment of a disorder or disease of the CNS, comprising the steps of administering to said patient the antisense oligodeoxynucleotide of the invention and said therapeutic agent. The administration of the therapeutic agent may be simultaneous with the administration of that of the antisense oligodeoxynucleotide of the invention, or preceding or following the same. Rupture of the BBB by the antisense oligodeoxynucleotide of the invention will facilitate the passage of the therapeutic agent across the BBB and into the CNS, where its effect is required.
Disclosed and described, it is to be understood that this invention is not limited to the particular examples, process steps, and materials disclosed herein as such process steps and materials may vary somewhat. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only and not intended to be limiting since the scope of the present invention will be limited only by the appended claims and equivalents thereof.
It must be noted that, as used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise.
Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
The following Examples are representative of techniques employed by the inventors in carrying out aspects of the present invention. It should be appreciated that while these techniques are exemplary of preferred embodiments for the practice of the invention, those of skill in the art, in light of the present disclosure, will recognize that numerous modifications can be made without departing from the spirit and intended scope of the invention.
EXAMPLES Experimental Procedures Animals:Rats: EAMG was induced in female Lewis rats (120-150 g) purchased from the Jackson Laboratory (Bar Harbor, Me.), and housed in the Animal Facility at the Hebrew University Faculty of Medicine, in accordance with NIH guidelines. Control FVB/N mice were subjected to confined swim stress as described [Kaufer et al., 1998 id ibid.]. Transgenic FVB/N mice overexpressing AChE-R were as detailed [Sternfeld et al. (2000) Proc. Natl. Acad. Sci. USA 97, 8647-8652].
Monkeys: Purpose-bred female and male 15 month-old Cynomolgus monkeys were used.
Oligonucleotides: HPLC-purified, GLP grade oligonucleotides (purity >90% as verified by capillary electrophoresis) were purchased from Hybridon, Inc. (Worchester, USA). Lyophilized oligonucleotides were resuspended in sterile double distilled water (24 mg/ml), and stored at −20° C. The oligonucleotides were prepared with phosphodiester linkages at all but the three terminal 3′ positions at which 2′-O-methyl ribonucleotide substitutions were made. The primary sequences used in this study were:
Stability of hEN101: hEN101 was found to be stable (>90% of original concentration) after storage for 2 h in human plasma with EDTA at room temperature, following three freeze/thawing cycles, or after 1 month at −20° C. Exposure at room temperature to Li-heparin-treated blood caused a decay of hEN101 with a half-life in the order of 30 min.
Antibodies: Rabbit polyclonal antibodies against the C-terminal AChE-R were prepared and purified as described [Sternfeld et al. (2000) ibid.]. Goat polyclonal anti-AChR (C-20, S.C.-1448) antibodies were from Santa Cruz, (Santa Cruz, Calif.).
Induction of EAMG: Torpedo acetylcholine receptor (T-AChR) was purified from T. californica electroplax by affinity chromatography on neurotoxin-Sepharose resin, as previously described [Boneva, N. et al. (2000) Muscle & Nerve 23, 1204-8]. Rats were immunized with 40 μg of purified T-AChR emulsified in complete Freund's adjuvant supplemented with 1 mg of M. tuberculosis H37Ra (Difco, Detroit Mich.). The animals were injected subcutaneously in the hind footpads and a booster injection of the same amount was given after 30 days. A third injection was administered to animals that did not develop EAMG after the second injection. Animals were weighed and inspected weekly during the first month and daily after the booster immunization, for evaluation of muscle weakness. The clinical status of the rats was graded according to: 0—Without definite weakness (treadmill running time, 23±3 min); mild (1)—weight loss >3% during a week, >10 min. running time on treadmill; moderate (2)—moderate weakness accompanied by weak grip or cry with fatigue, weight loss of 5-10%, 3-5 min. running on treadmill; moderate-severe (3)-moderate to severe weakness, hunched back posture at rest, head down and forelimb digit flexed, tremulous ambulation, 10% body weight loss, 1-2 min. run on treadmill); severe (4)—severe general weakness, no cry or grip, treadmill running time <1 min, weight loss >10%; (5)—death.
Anti-AChR antibody determination: Serum was assayed by direct radioimmunoassay, using 125I-α bungarotoxin (BgT) bound to T-AChR and to rat (R) AChR [Boneva et al. (2000) id ibid]. All the EAMG rats displayed high anti-T-AChR or anti-R-AChR titers, with serum mean±standard error (SE) values of 82.1±16.0 nM for anti-T-AChR antibodies and 19.9±1.8 nM for anti-R-AChR. Human serum was tested for the level of anti-AChR antibodies as previously described [Drachman, D. B. (1994) N Engl J Med 330, 1797-810].
Quantification of nAChR: AChR concentration in the gastrocnemius and tibialis muscles was determined using 125I-α-BgT binding followed by precipitation by saturated ammonium sulfate as described previously [Boneva et al. (2000) id ibid].
Immunocytochemistry: Muscle sections were deparaffinized with xylene and were re-hydrated in graded ethanol solutions (100%, 90%, 70%) and PBS. Heat-induced antigen retrieval was performed by microwave treatment (850 W for rapid boil following 10 min in reduced intensity) in 500 ml of 0.01M citrate buffer pH 6.0. Slides were cooled to room temperature and rinsed in double distilled water. Non-specific binding was blocked by 4% normal donkey serum in PBS with 0.3% Triton X-100 and 0.05% Tween 20 (1 hr at room temperature). Biotinylated primary antibody was diluted (1:100 and 1:30 for rabbit anti-AChE-R [Sternfeld et al. (2000) id ibid] and goat anti-nAChR, respectively) in the same buffer and slides were incubated 1 hr at room temperature following overnight incubation at 4° C. Sections were rinsed and incubated with alkaline phosphatase-conjugated secondary antibody, diluted in the same blocking buffer 1 hr at room temperature and then overnight at 4° C. Detection was with the alkaline phosphatase substrate Fast Red (Roche Diagnostics, Mannheim, Germany). Slides were simultaneously transferred to a stop solution (25 mM EDTA, 0.05% Triton X-100, 1 mM levamisole in PBS, pH 7.2), rinsed in PBS and cover-slipped with Immunomount (Shandon).
For spinal cord sections, primary mouse anti-SC35 antibody was diluted (1:100) in the same buffer as the previous primary antibodies, and slides were incubated 1 h at room temperature following overnight incubation at 4° C. Sections were rinsed and incubated with peroxidase conjugated goat anti-mouse secondary antibody, diluted in the same blocking buffer, for 1 h at room temperature and then overnight at 4° C. Detection was performed with DAB substrate (Sigma). Slides were cover-slipped with Immunomount (Shandon, Pittsburgh, Pa.).
Electromyography: Rats were anesthetized by i.p. injection of 2.5 mg/Kg pentobarbital, immobilized, and subjected to repetitive sciatic nerve stimulation, using a pair of concentric needle electrodes at 3 Hz. Baseline compound muscle action potential (CMAP) was recorded by a concentric needle electrode placed in the gastrocnemius muscle, following a train of repetitive nerve stimulations at supramaximal intensity. Decrease (percent) in the amplitude of the fifth vs. the first muscle action potential was determined in two sets of repetitive stimulations for each animal. A reduction of 10% or more was considered indicative of neuromuscular transmission dysfunction.
Drug administration: Intravenous injections and blood sampling for anti-AChR antibodies testing were via the right jugular vein under anesthesia. For oral administration, a special needle for oral gavage feeding was used, which is curved with a ball end (Stoelting, Wood Dale Ill.). Mestinon® was administered in a dose of 1 mg/kg/day, and purchased from Hoffmann La-Roche, Basel, Switzerland.
Exercise training on treadmill: To establish a clinical measure of neuromuscular performance in EAMG rats, a treadmill assay was performed. Animals were placed on an electrically powered treadmill [Moran et al. (1996) J Therm Biol 21, 171-181] at 25 m/min (a physical effort of moderate intensity) until visibly fatigued. The amount of time the rats were able to run was recorded before and after anti-sense or Mestinon® treatment.
In situ hybridization: Tissues were fixed in 4% paraformaldehyde and cut into 7 Lm paraffin embedded sections. Spinal cord sections were deparaffinized, rehydrated using serial ethanol dilutions and permeabilized with proteinase K (10 μg/ml at room temp.). Slides were exposed to 5′ biotinylated, fully 2′-oxymethylated AChE-R or AChE-S-specific 50-mer cRNA probes complementary to human ACHE pseudo-intron 4 or exon 6, respectively [Grisaru et al. (2001) id ibid.]. Hybridization was performed overnight at 52° C. in hybridization mixture containing 10 μg/ml probe, 50 μg/ml yeast tRNA, 50 μg/ml heparin and 50% formamide in 375 mM Na chloride, 37.5 mM Na citrate, pH 4.5. For monkey sections, the probe was constructed according to the human AChE-R sequence; for rat sections, according to the mouse sequence. Slides were washed to remove non-hybridized probe, blocked with 1% skim milk containing 0.01% Tween-20 and 2 mM levamisole, an alkaline phosphatase inhibitor used to suppress non-specific staining and incubate with streptavidin-alkaline phosphatase (Amersham Pharmacia). Fast Red™substrate (Roche Diagnostics) was used for detection. DAPI staining (Sigma Chemical Co., St. Louis, Mo., USA) served to visualize nuclei. Microscope images were analyzed with Image Pro Plus 4.0 (Media Cybernetics) software.
Serum analyses: Blood samples drawn from EAMG rats and MG patients were subjected to non-denaturing gel electrophoresis as described [Kaufer et al. (1998) id ibid], as well as to catalytic activity measurements of AChE [Shapira et al. (2000) id ibid]. Iso-OMPA (tetraisopropylpyrophosphoramide, 5×10-5 μM), was used to block butyrylcholinesterase activity in the serum samples. For activity staining on polyacrylamide gels [Kaufer et al. (1998) id ibid] we used 510-6 M iso-OMPA.
Protocol for Phase Ib Clinical Trial of MG patients using hEN101: Patients were hospitalized and pyridostigmine was discontinued for 12-18 hours before EN101 testing. Assessment of MG status was performed first at entry, then after pyridostigmine stoppage, and regularly after EN101 treatment using a Quantitative MG (QMG) score. Escalating oral doses of EN101 (10-150 g/kg) were given in the first day (day 1), followed by a daily dose of 500 μg/kg for 3 days (days 2-4). Days 5 and 6 were washout period without pyridostigmine, and restitution of pyridostigmine occurred when it became necessary. Patients were monitored for 1 month thereafter, with three visits as out-patients.
The following parameters were used as inclusion criteria:
-
- Class II and above, according to MGFA classification (myasthenia gravis standard clinical classification of the disease severity score);
- Age 18-70;
- Seropositive for AChR antibodies;
- Patients under pyridostigmine (180 mg/day) treatment without concomitant immunosuppressants;
- Stable for 3 months, with no PE (plasma exchange) for 6 months;
- No other major or active diseases.
Evaluation of the MG status of each patient was based on the following parameters:
- (a) QMG scoring (maximum value of 9), based on the measurements of:
- Fatigue in each limb (4);
- Fatigue of the neck (1);
- Swallowing rate (1);
- Power in the hands (2);
- Respirometry (1).
- These measurements were taken daily, 4 times per day, and averaged for days 2-6.
- (b) Patient's subjective report;
- (c) Vital signs, clinical chemistry, hematology, urinalysis, ECG and physical examination, recorded daily.
As previously shown by the inventors, the AChE-R variant migrates on non-denaturing polyacrylamide gels faster than the tetrameric synaptic enzyme, AChE-S [Kaufer et al. (1998) id ibid.], and it is present in the serum of MG patients [WO01/36627]. Similarly, immunoblot analysis confirmed that in EAMG rats, as compared with healthy rats, there was a massive increase in serum AChE-R (
Expression of alternative AChE variants (
In situ hybridization using variant-selective probes showed that AChE-S mRNA was sub-synaptically located in muscles from both untreated and r-invEN102-treated, healthy and EAMG rats (
The soluble and secretory nature of AChE-R predicted that it would degrade acetylcholine before it reaches the post-synaptic membrane, limiting receptor activation. To test this hypothesis, rEN101 antisense oligonucleotide was used, which is capable of selective suppression of AChE-R production [Galyam, N. et al. (2001) Antisense Nucl Acid Drug Dev 11, 51-57]. AChE-R suppression was tested in healthy and EAMG rats with reduced muscle nAChR levels (
Quantification by densitometry of an immunoblot analysis confirmed the increase of serum AChE-R in EAMG and the efficacy of a single i.v. injection of 250 μg/Kg rEN101, but not r-invEN102, in reducing its serum level 24 h later (
Unlike anticholinesterases, which block all AChE variants, rEN101 was shown to selectively suppress muscle AChE-R production [Lev-Lehman et al. (2000) id ibid]. Therefore, retrieval of stable CMAP in rEN101-treated EAMG rats may attest to the causal role of AChE-R in the neuromuscular malfunctioning that is characteristic of the myasthenic phenotype. To test this concept, rEN101 was injected i.v. at doses ranging from 10-500 μg/Kg (2 to 20 nmol/rat). rEN101 did not affect CMAP in healthy animals, but retrieved stable CMAP ratios within 1 h (
Both the extent and the duration of CMAP correction were dose dependent. For example, 500 μg/Kg conferred 72 h rectification of CMAP up to 125% of baseline, while 50 μg/Kg was effective for only 24 h. rEN102, a 3′ protected AS-ON targeting a sequence unique to rAChE-R mRNA (previously referred to as AS1) [Grifman and Soreq (1997) id ibid], induced similar rectification of CMAP decline in EAMG rats, confirming the relevance of AChE-R as a contributing element to this effect. Comparable amounts of r-invEN102, did not improve muscle function, attesting to the sequence specificity of the AS-ON treatment (Table 1). Dose response curves revealed that up to 5 h following an injection, rEN101 produced a saturable response with IC50 of <10 μg/Kg. This effect appeared to be superimposed on a longer lasting and less concentration-dependent effect, which showed no saturation in the range studied (
Placed on a treadmill at 25 m/min, healthy rats ran for 23.0±3.0 min, after which time they displayed visible signs of fatigue. Starting at 5 h, and for at least 24 h following administration of 250 μg/Kg rEN101, EAMG rats demonstrated improved performance on the treadmill. Running time increased from 247±35, 179±21 and 32±6 sec to 488±58, 500±193 and 212±59 sec for animals at disease grades 2, 3 and 4, respectively (average values for 6-9 animals per group.) Healthy animals, in contrast, were not significantly affected by rEN101 injection (
Others have demonstrated efficacy of orally administered 2′-oxymethyl protected AS-ON agents [Monia, B. P. (1997) Ciba Found. Symp. 209, 107-119]. Therefore, the inventors tested this mode in the EAMG model. Based on their own findings, the inventors selected the dose of 50 μg/Kg of rEN101, which was administered to EAMG rats once a day via oral gavage, and CMAP was measured 1, 5, and 24 h later. This dose was as effective as 25 μg/Kg administered i.v. (Table 1 and
Human EN 101 (hEN101) (0.25 μg/g, single dose) was administered orally to rats with EAMG of medium severity (score 2.5-3.5), which implied the symptoms defined as “moderate” hereunder. The results are summarized in Table 1. Time from treatment is noted above; together with the treadmill running time in sec. Animals were inspected at each time point for evaluation of muscle weakness. The clinical status of the rats was graded according to: (0)—Without definite weakness (treadmill running time, 23±3 min); Mild (1)—weight loss >3% during a week, >10 min. running time on treadmill; Moderate (2)—moderate weakness accompanied by weak grip or cry with fatigue, weight loss of 5-10%, 3-5 min. running on treadmill; Moderate-severe (3)-moderate to severe weakness, hunched back posture at rest, head down and forelimb digit flexed, tremulous ambulation, 10% body weight loss, 1-2 min. run on treadmill); Severe (4)—severe general weakness, no cry or grip, treadmill running time <1 min, weight loss >10%; Death (5). Each line represents an individual rat. It is to be noted that the clinical score (in parentheses) was reduced in all of the treated animals, which reflects time improvement, and that running time was significantly increased for over and 24 hr for most of the animals and for two of the tested animals also at 48 h.
These results show that like the rat EN101 (see treadmill example, above), the human EN101 antisense oligodeoxynucleotide of the invention promoted muscle stamina in EAMG induced rats.
A study of the potential efficacy as well as toxicity of hEN101 was conducted on 4 week-old Crl:CD rats. To groups of 12 animals (6 males, 6 females) were administered 0.0 (saline only), 0.50 or 2.50 μg/g/day of hEN101 by oral gavage (o.g.), 0.50 μg/g/day of rEN101 by o. g., or 0.50 μg/g/day of rEN101 or hEN101 by i.v. injection. Additionally, there was a control group that was not injected. For 7 days the animals were checked for gross signs of toxicity: mortality, body weight, food consumption, ophtalmology, hematology (peripheral blood), and blood chemistry. At 7 days they were sacrificed and examined post mortem for macroscopic pathology and organ weight. Fixed sections of brain (cerebellum, cerebrum, midbrain, medulla), heart (auricular and ventricular regions), kidneys (cortex, medulla, papilla regions), liver (all main lobes), lungs (two major lobes, including bronchi), lymph nodes (mandibular and mesenteric), spinal cord (transverse and longitudinal sections at cervical, lumbar and thoracic levels), caecum, colon, duodenum, ileum, jejunum, esophagus, rectum, spleen and stomach (keratinized, glandular and antrum) were stained with hematoxylin/eosin to reveal necrosis or cell death.
Mandibular lymph nodes were examined for the effect of EN101 on AChE-R mRNA. Compared to the saline-injected control, rEN101 (oral or i.v.) or hEN101 (i.v.) were inconsistent in depressing AChE-R mRNA levels within these lymph nodes (data not shown). In contrast, the administration of rEN101 (oral or i.v.) or hEN101 (i.v.) did not affect the expression of the AChE-S synaptic variant of AChE in these mandibular lymph nodes (data not shown). Thus, the antisense oligodeoxynucleotide of the invention may be used to suppress the AChE-R variant without affecting the expression of the synaptic variant, i.e. without adversely affecting cholinergic transmission.
Example 7 AChE-R Suppression Modifies the Course of EAMG PathophysiologyAs shown in Example 5, unlike anti-cholinesterases, rEN101 afforded long-term maintenance of stable CMAP. This further enabled the inventors to test whether the cholinergic imbalance contributes to the physiological deterioration that is characteristic of EAMG. Rats were first treated with rEN101 once a day for 5 days, CMAPs being determined prior to each treatment. Both the efficacy of rEN101 in retrieving normal CMAP and its capacity to reduce the inter-animal variability in CMAP values reached similar levels to those of pyridostigmine (
By using MG and EAMG as case studies for evaluating the consequences of chronic neuromuscular imbalance at the level of gene expression, the inventors confirmed that the AChE-R variant is systemically elevated in MG and EAMG. Moreover, the inventors showed that antisense suppression of AChE-R normalized NMJ responses to repeated nerve stimulation, promoting muscle strength, and recuperating a healthier status in animals otherwise too weak even to eat. These observations support the idea that AChE-R plays a direct role in MG pathophysiology and call for evaluation of the rationale of long-term mRNA-targeted therapy for imbalanced cholinergic function at NMJs.
Example 8 Oral Administration of hEN101 to Cynomolgus MonkeysThis experiment was conducted with six (3 males and 3 females) purpose-bred 15 month-old (young adult) Cynomolgus monkeys, divided in three groups (1, 2 and 3) of one male and one female each. Groups 1 and 2 received hEN101 daily by o.g. for a period of 7 days, at a concentration of 0.15 and 0.50 μg/g/day, respectively. Group 3 received daily i.v. injections of hEN101 for a period of 7 days at a dosage of 0.50 μg/g/day.
Over a 12 hour period, plasma samples were obtained during the second treatment day to investigate the toxicokinetic profile at each dosage. The toxicology study consisted of checking the animals during the 7 days of treatment for gross signs of toxicity by the following parameters: mortality, body weight, food consumption, electrocardiography, blood pressure, hematology (peripheral blood), and blood chemistry. At 7 days the monkeys were sacrificed and examined post-mortem for macroscopic pathology and organ weight. Fixed sections of brain (cerebellum, cerebrum, midbrain, medulla), caecum, colon, duodenum, heart (auricular and ventriclar regions), ileum, jejunum, kidneys (cortex, medulla. papilla regions), liver (two main lobes), lungs (two major lobes, including bronchi), lymph nodes (mandibular and mesenteric), esophagus, rectum, sciatic nerve, skeletal muscle (thigh), spinal cord (transverse and longitudinal sections at cervical level), spleen and stomach (body and antrum) were stained with hematoxylin/eosin to reveal necrosis or cell death.
These clinical investigations revealed no toxicological effects by any of the treatment protocols. Post-mortem there were no treatment-related effects other than slight healing erosions in the body of the stomach, which are possibly associated with treatment, in 1 of 2 animals in each group, and some irritation of the perivascular tissue at the site of intravenous injection.
Paraffin-embedded 7 μm spinal cord sections were examined by in situ hybridization for the levels of AChE-R and AChE-S mRNA. Under all three regimens (oral 0.15 and 0.50, and i.v. 0.50 μg/g/day), there was no apparent reduction in AChE-S mRNA (
AChE-R-positive sections from monkey spinal cords were analyzed for the relation between cell body diameter and percentage of AChE-R positive cells (
In the 12 hr following the second day administration of hEN101, monkey plasma samples were collected and stored. Plasma cholinesterase activities were measured by spectrophotometry assessing the rate of hydrolysis of acetylthiocholine (measured by the Ellman assay, which quantifies the hydrolysis of acetylthiocholine) [Ellman, G. L., et al. (1961), Biochem. Pharmacol. 7, 88-95], in the absence or presence of iso-OMPA (a selective butyrylcholinesterase, BChE, inhibitor). Total activity, largely due to serum BChE, was generally unchanged (
Contrary to the effect of hEN101 on monkey spinal cord neurons, rEN101 does not suppress AChE-R mRNA in the rat spinal cord (
16 patients with stable generalized MG requiring constant AChE inhibitors (pyridostigmine) for daily function were recruited, after approval by human ethics committees of the respective hospitals involved in the present trial (Hadassah Medical Center, Jerusalem, Israel and Greater Manchester Neurosciences Center, Hope Hospital, Salford, England).
Analysis of the results obtained from the Clinical trial showed that in 15 out of 16 patients, the initial deterioration in MG status after stopping pyridostigmine was followed by a clear symptomatic improvement due to hEN101. As an example,
Thus, hEN101 appears to be powerfully effective in reversing symptoms in patients with stable MG. The present study showed that hEN101 has potential advantages over conventional cholinesterase inhibitors with respect to dosing, specificity, side-effect profile, duration of efficacy and treatment regimen.
Claims
1. A synthetic antisense oligodeoxynucleotide targeted against human AChE mRNA having the nucleotide sequence: 5′ CTGCCACGTTCTCCTGCACC 3′. (SEQ ID NO: 1)
2. A synthetic nuclease resistant antisense oligodeoxynucleotide having the nucleotide sequence: 5′ CTGCCACGTTCTCCTGCACC 3′. (SEQ ID NO: 1)
3. A synthetic antisense oligodeoxynucleotide of claim 2, which is a modified oligodeoxynucleotide comprising partially unsaturated aliphatic hydrocarbon chain and one or more polar or charged groups including carboxylic acid groups, ester groups, and alcohol groups.
4. A synthetic nuclease resistant antisense oligodeoxynucleotide of claim 2 or 3, wherein at least one of the three 3′-terminus nucleotides is 2′-O-methylated.
5. A synthetic nuclease resistant antisense oligodeoxynucleotide of claim 4, in which the last three 3′-terminus nucleotides are 2′-O-methylated.
6. A synthetic nuclease resistant antisense oligodeoxynucleotide of claim 2, wherein at least one nucleotide is fluoridated.
7. A synthetic nuclease resistant antisense oligodeoxynucleotide of claim 2 or claim 3, having phosphorothioate bonds linking between at least two of the last 3′-terminus nucleotide bases.
8. A synthetic nuclease resistant antisense oligodeoxynucleotide of claim 7, having phosphorothioate bonds linking between the last four 3′-terminus nucleotide bases.
9. A synthetic nuclease resistant antisense oligodeoxynucleotide of claim 3, having a nucleotide loop forming sequence at the 3′-terminus.
10. A synthetic nuclease resistant antisense oligodeoxynucleotide of claim 9, wherein said loop is a 9-nucleotide loop having the nucleotide sequence CGCGAAGCG (SEQ ID NO:2).
11. A synthetic nuclease resistant antisense oligodeoxynucleotide of any one of claims 1 to 10, capable of selectively modulating human AChE production.
12. A synthetic nuclease resistant antisense oligodeoxynucleotide of claim 11, capable of selectively modulating human AChE production in the central nervous system.
13. A pharmaceutical composition comprising the antisense oligonucleotide hEN101, defined by SEQ ID NO:1.
14. The pharmaceutical composition of claim 13, for the treatment and/or prevention of a progressive neuromuscular disorder, for improving stamina and/or for use in chronic muscle fatigue.
15. The pharmaceutical composition of claim 13 for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder is selected from myasthenia gravis, Eaton-Lambert disease, muscular dystrophy, amyotrophic lateral sclerosis, post-traumatic stress disorder (PTSD), multiple sclerosis, dystonia, post-stroke sclerosis, post-injury muscle damage, excessive re-innervation, post-surgery paralysis of unknown origin, and post-exposure to AChE inhibitors.
16. The pharmaceutical composition of claim 13, for the treatment and/or prevention of myasthenia gravis.
17. The pharmaceutical composition of claim 13, for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder is associated with an excess of AChE mRNA or protein.
18. The pharmaceutical composition of claim 13, for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder is associated with an excess of AChE-R mRNA.
19. The pharmaceutical composition of claim 13, for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder is associated with impairment of cholinergic transmission.
20. The pharmaceutical composition of claim 13, for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder involves muscle distortion, muscle re-innervation or neuro-muscular junction (NMJ) abnormalities.
21. The pharmaceutical composition of any one of claims 13-20, which is for daily use by a patient of a dosage of active ingredient between about 0.001 μg/g and about 50 μg/g.
22. The pharmaceutical composition of anyone of claims 13-20, wherein the treatment and/or prevention comprises administering a dosage of active ingredient of about 0.01 to about 5.0 μg/g.
23. The pharmaceutical composition of any one of claims 13-20, wherein the treatment and/or prevention comprises administering a dosage of active ingredient of about 0.15 to about 0.50% g/g.
24. The pharmaceutical composition of claim 13, optionally comprising at least one additional active agent.
25. A pharmaceutical composition comprising an antisense oligodeoxynucleotide as denoted by SEQ ID NO:1, for facilitating passage of compounds through the BBB, optionally further comprising additional pharmaceutically active agent to be transported through the BBB, and/or pharmaceutically acceptable adjuvant, carrier or diluent.
26. The pharmaceutical composition of claim 25, wherein said additional pharmaceutically active agent is selected from any one of contrast agents used for central nervous system imaging, agents that function to block the effects of abused drugs, antibiotics, chemotherapeutic drugs and vectors to be used in gene therapy.
27. A method of preparation of a pharmaceutical composition comprising the step of admixing the antisense oligonucleotide hEN101, defined by SEQ ID NO:1, with a pharmaceutically acceptable adjuvant, carrier or diluent, and optionally with at least one additional active agent.
28. The method of claim 27, wherein said composition is intended for the treatment and/or prevention of a progressive neuromuscular disorder, for improving stamina and/or for use in chronic muscle fatigue.
Type: Application
Filed: Oct 7, 2008
Publication Date: Nov 12, 2009
Applicant:
Inventors: Hermona Soreq (Jerusalem), Shlomo Saidman (Gush Etzion), Jackiline Saidman (Gush Etzion), Tama Evron (Mevasseret Zion)
Application Number: 12/287,274
International Classification: A61K 31/7088 (20060101); C07H 21/04 (20060101); A61P 21/00 (20060101); A61P 21/04 (20060101); A61P 25/00 (20060101);