TREATING CANCER WITH VIRAL NUCLEIC ACID

This document provides methods and materials related to the use of nucleic acid coding for viruses to reduce the number of viable cancer cells within a mammal. For example, methods for using infectious nucleic acid to treat cancer, engineered viral nucleic acid, methods for making engineered viral nucleic acid, methods for identifying infectious nucleic acid for treating cancer, methods and materials for controlling virus-mediated cell lysis, and methods and materials for assessing the control of virus-mediated cell lysis are provided.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATION(S)

This application claims priority to U.S. Application No. 60/902,200 filed on Feb. 20, 2007 and U.S. Application No. 61/009,968 filed on Jan. 4, 2008. The entire disclosure of these earlier applications are incorporated herein by reference.

BACKGROUND

1. Technical Field

This document relates to methods and materials involved in treating cancer with viral nucleic acid (e.g., nucleic acid coding for a picornavirus).

2. Background Information

The use of viruses to infect and kill cancer cells has been studied for many years. Typically, viruses known to infect and kill cancer cells are referred to as oncolytic viruses. The use of oncolytic viruses in this type of cancer therapy is generally different from their use in gene therapy. In gene therapy, a virus is primarily a delivery vehicle, used to deliver a corrective gene or chemotherapeutic agent to a cancer cell.

SUMMARY

This document provides methods and materials related to the use of nucleic acid coding for viruses to reduce the number of viable cancer cells within a mammal. For example, this document provides methods for using infectious nucleic acid to treat cancer, engineered viral nucleic acid, methods for making engineered viral nucleic acid, methods for identifying infectious nucleic acid for treating cancer, methods and materials for controlling virus-mediated cell lysis, and methods and materials for assessing the control of virus-mediated cell lysis.

In general, one aspect of this document features a method for treating cancer present in a mammal. The method comprises, or consists essentially of, administering, to the mammal, an effective amount of nucleic acid coding for a virus (e.g., a picornavirus) under conditions wherein cancer cells present within the mammal undergo cell lysis as a result of synthesis of virus (e.g., picornavirus) from the nucleic acid, thereby reducing the number of viable cancer cells present within the mammal. The mammal can be a human. The effective amount can be between about 3×1010 and about 3×1014 virus genome copies. The picornavirus can be a coxsackievirus. The cancer cells can be myeloma, melanoma, or breast cancer cells. The nucleic acid can comprise, or consist essentially of, a microRNA target element comprising at least a region of complementary to a microRNA present in non-cancer cells. A reduced number of non-cancer cells present within the mammal can undergo cell lysis as compared to the number of non-cancer cells that would undergo cell lysis when the nucleic acid lacks the microRNA target element. The microRNA can be a tissue-specific microRNA. The microRNA can be a muscle-specific, brain-specific, or heart-specific microRNA.

In another aspect, this document features an isolated nucleic acid coding for a virus and comprising a microRNA target element having at least a region that is complementary to at least a region of a microRNA present in non-cancer cells and that is heterologous to the virus. The virus can be a picornavirus. The virus can be a coxsackievirus. The virus can be a poliovirus. The microRNA can be a tissue-specific microRNA. The microRNA can be a muscle-specific, brain-specific, or heart-specific microRNA.

In another aspect, this document features an isolated nucleic acid coding for a virus and comprising a microRNA target element having at least a region that is complementary to at least a region of a cancer-specific microRNA and that is heterologous to the virus. The nucleic acid, when administered to a mammal having cancer, can be expressed in cancer cells. Expression of the nucleic acid can be restricted to cancer cells containing the cancer-specific microRNA when the nucleic acid is administered to a mammal having said cancer cells.

In another aspect, this document features a method of assessing coxsackievirus-mediated cell lysis of non-cancer cells. The method comprises, or consists essentially of:

(a) administering nucleic acid coding for a coxsackievirus to a mammal, and

(b) determining whether or not the mammal develops myositis, paralysis, or death, wherein the presence of the myositis, paralysis, or death indicates that the nucleic acid causes coxsackievirus-mediated cell lysis of non-cancer cells, and wherein the absence of the myositis, paralysis, and death indicates that the nucleic acid lacks significant coxsackievirus-mediated cell lysis of non-cancer cells. The mammal can be a mouse. The nucleic acid can comprise a microRNA target element that is complementary to a microRNA present in non-cancer cells or cancer cells and that is heterologous to the coxsackievirus. The microRNA can be a tissue-specific microRNA or a cancer-specific microRNA. The microRNA can be a muscle-specific microRNA.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

DESCRIPTION OF THE DRAWINGS

FIG. 1 contains four line graphs plotting the TCID50 value on H1-HeLa cells for supernatant and cleared lysate samples collected from the indicated multiple myeloma cell line infected with CVA21 and cultured for the indicated time.

FIG. 2 contains photographs of histological analysis of hind limb muscle for treated and untreated mice.

FIG. 3 contains two graphs plotting tumor volume at the indicated days for CVA21-treated (top) and untreated (bottom) mice.

FIG. 4 contains graphs plotting tumor volume at the indicated days for mice treated intratumorally with the indicated amount of infectious RNA encoding a coxsackievirus.

FIG. 5 is a graph plotting tumor volume at the indicated days for mice treated intravenously with 50 μg of infectious RNA encoding a coxsackievirus.

FIG. 6 contains schematic diagrams of lentiviral transfer plasmids encoding (A) eGFP tagged with four tandem copies of control or muscle-specific microRNA target elements or (B) firefly luciferase.

FIG. 7 contains bar graphs plotting GFP (top) and luciferase (bottom) activity for non-muscle (HeLa, 3T3) and muscle (TE671, L6) cells transduced with eGFP-encoding lentiviral vectors tagged with control microRNA target elements (miR142-3p) or muscle-specific microRNA target elements (miR133,miR-206,miR133/206) microRNA targets and non-tagged luciferase vectors. Top: Cells were grown in DMEM plus 10 percent FBS and harvested at 72 hours for flow analysis. Bottom: Cells were grown in DMEM plus 10 percent FBS and harvested at 72 hours for luciferase assay.

FIG. 8 contains bar graphs plotting GFP (top) and luciferase (bottom) activity for non-muscle (HeLa, 3T3) and muscle (TE671, L6) cells transduced with eGFP-encoding lentiviral vectors tagged with control microRNA target elements (miR142-3p) or muscle-specific microRNA target elements (miR133,miR-206,miR133/206) microRNA targets and non-tagged luciferase vectors. Top: Cells were grown in differentiation medium that increases the expression of muscle-specific miRNAs and harvested for flow analysis of GFP expression. Bottom: Cells were grown in differentiation medium that increases the expression of muscle-specific miRNAs and harvested for luciferase assay.

FIG. 9 is a graph plotting percent inhibition of eGFP expression in muscle cell lines versus averaged control cell lines.

FIG. 10 contains color photographs of phase contrast (upper) and GFP immunofluorescence (lower) of 3T3 cells transduced with eGFP expressing lentiviral vectors tagged with control or muscle-specific microRNA target elements and grown in growth media.

FIG. 11 contains color photographs of phase contrast (upper) and GFP immunofluorescence (lower) of HeLa cells transduced with eGFP expressing lentiviral vectors tagged with control or muscle-specific microRNA target elements and grown in growth media.

FIG. 12 contains color photographs of phase contrast (upper) and GFP immunofluorescence (lower) of 293T cells transduced with eGFP expressing lentiviral vectors tagged with control or muscle-specific microRNA target elements and grown in growth media.

FIG. 13 contains color photographs of phase contrast (upper) and GFP immunofluorescence (lower) of TE 671 cells transduced with eGFP expressing lentiviral vectors tagged with control or muscle-specific microRNA target elements and grown in growth media.

FIG. 14 contains color photographs of phase contrast (upper) and GFP immunofluorescence (lower) of L6 cells (rat myoblast) transduced with eGFP expressing lentiviral vectors tagged with control or muscle-specific microRNA target elements and grown in growth media.

FIG. 15 contains color photographs of phase contrast (upper) and GFP immunofluorescence (lower) of 3T3 cells transduced with eGFP expressing lentiviral vectors tagged with control or muscle-specific microRNA target elements and grown in differentiation media.

FIG. 16 contains color photographs of phase contrast (upper) and GFP immunofluorescence (lower) of HeLa cells transduced with eGFP expressing lentiviral vectors tagged with control or muscle-specific microRNA target elements and grown in differentiation media.

FIG. 17 contains color photographs of phase contrast (upper) and GFP immunofluorescence (lower) of TE 671 cells transduced with eGFP expressing lentiviral vectors tagged with control or muscle-specific microRNA target elements and grown in differentiation media to induce higher expression of muscle-specific miRNAs.

FIG. 18 contains color photographs of phase contrast (upper) and GFP immunofluorescence (lower) of L6 cells (rat myoblast to myotube) transduced with eGFP expressing lentiviral vectors tagged with control or muscle-specific microRNA target elements and grown in differentiation media.

FIG. 19 contains schematic diagrams of enterovirus and cardiovirus genomes identifying examples of insertion sites for microRNA target elements.

FIG. 20 is a schematic of RNA secondary structure of the 5′UTR of a picornavirus (Belsham and Sonnenberg; Microbiological Reviews, September 1996, p. 499-511).

FIG. 21 is a schematic of RNA secondary structure of a virus containing a reverse complementarity region and a microRNA target element (modified from Belsham and Sonnenberg, 1996).

FIG. 22 is a schematic of the RNA of FIG. 21 with a 5′UTR conformation in the absence of miRNA.

FIG. 23 is a schematic of the RNA of FIG. 21 with a 5′UTR conformation in the presence of miRNA.

FIG. 24 is a schematic of the putative secondary structure of Hepatitis C Virus 5′UTR containing miRT. Shaded area represents seed sequence to which RISC can bind. (RNA secondary structure from Vienna RNA Structure Prediction Web Interface: http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi).

FIG. 25 is a schematic of the putative secondary structure of Hepatitis C Virus 5′UTR lacking miRT. This schematic simulates these nucleotides being unavailable for base pairing due to RISC binding.

FIG. 26 is a schematic of normal secondary structure of coxsackievirus A21 5′UTR.

FIG. 27 is a schematic of altered secondary structure of coxsackievirus A21 5′UTR with RC region introduced against stem loop 5 and insertion of miR155T.

FIGS. 28-31 are schematics of RNA secondary structure.

FIG. 32 is a schematic of coxsackievirus A21 genome and an altered coxsackievirus A21 genome.

FIG. 33 contains a schematic diagram of microRNA targeted CVA21 (A); one step growth curves of WT, miRT, and RevT viruses in H1-HeLa cells (B), MeI 624 cells (C), Kas 6/1 cells (D), and H1-HeLa+miR-133 and miR-206 mimics (E); a bar graph assessing viability 24 hrs. post viral infection at MOI=1.0 with WT, miRT, or RevT CVA21 pretreated for 4 hrs. with 200 nM miRNA mimics (F), a bar graph of viral titers collected 24 hrs. post infection from supernatants of cells infected with WT, miRT, or RevT CVA21 in the presence of miRNA mimics (G), and a bar graph of in vitro survival of non muscle (H1-HeLa) or muscle (TE671) cells as determined by MTT assay when transfected with 1 μg WT or miRT CVA21 RNA in 24 well plates (H). *=p<0.01 from WT; *=<0.01 from miRNA control.

FIG. 34 contains three graphs plotting tumor volume at the indicated days for SCID mice, which are carrying SQ multiple myeloma xenografts, that were treated with Opti-MEM control (A), 1×106 WT CVA21 (B), and 1×106 miRT CVA21 (C); two Kaplan-Meier survival graphs of mice treated with 1 intratumoral dose of 1×106 WT CVA21 or miRT CVA21 (D), or 1×106 WT CVA21, miRT CVA21, or RevT CVA21 (E); a graph of viral titers collected from mice treated with WT or miRT CVA21 (F); and a sequence alignment of 3′NTR inserts from viruses collected from mouse # 1-11 serum on day 45 (G).

FIG. 35 contains four graphs plotting tumor volume at the indicated days for SCID mice, which are carrying SQ Kas 6/1 xenografts, treated with Opti-MEM control (A), 1×106 WT CVA21 (B), 1×106 muscle specific miRT virus (C), or 1×106 revertant virus (D), and a Kaplan-Meier survival curve for control, WT CVA21, miRT virus, or revertant treated mice (E).

FIG. 36 contains three graphs plotting tumor volume at the indicated days for SCID mice, which are carrying SQ MeI 624 melanoma xenografts, that were treated with Opti-MEM control (A), 1e6 WT CVA21 (B), or 1e6 miRT CVA21 (C), and a Kaplan-Meier survival graph of control, WT CVA21, or miRT virus treated mice (D).

FIG. 37 contains a schematic diagram of lentiviral vector with revertant target (A), a sequence alignment of muscle specific miR-133/206T and Revertant virus (B), and a bar graph of GFP expression in cells transduced at MOI=3.0 with lentiviral vectors containing hematopoetic cell specific miR-142-3p, muscle specific miR-133/206, and revertant target elements (C).

 DETAILED DESCRIPTION

This document provides methods and materials related to the use of nucleic acid coding for viruses to reduce the number of viable cancer cells within a mammal. For example, this document provides methods for using viral nucleic acid to reduce the number of viable cancer cells within a mammal. Nucleic acid coding for any appropriate virus can be used to reduce the number of viable cancer cells within a mammal. In some cases, nucleic acid coding for a picornavirus can be used. A picornavirus can be an enterovirus (e.g., bovine enterovirus, human enterovirus A, human enterovirus B, human enterovirus C, human enterovirus D, human enterovirus E, poliovirus, porcine enterovirus A, and porcine enterovirus B), a rhinovirus (e.g., human rhinovirus A and human rhinovirus B), a cardiovirus (e.g., encephalomyocarditis virus and theilovirus), an apthovirus (e.g., equine rhinitis A virus and foot-and-mouth disease virus), an hepatovirus (e.g., hepatitis A virus), a parechovirus (e.g., human parechovirus and ljungan virus), an erbovirus (e.g., equine rhinitis B virus), a kobuvirus (e.g., aichi virus), or a teschovirus (e.g., porcine teschovirus 1-7 and porcine teschovirus). In some cases, nucleic acid coding for a coxsackievirus A21 (Shafren et al., Clin. Cancer Res., 10(1 Pt. 1):53-60 (2004)), coxsackievirus B3 (Suskind et al., Proc. Soc. Exp. Biol. Med., 94(2):309-318 (1957)), poliovirus type III (Pond and Manuelidis, Am. J. Pathol., 45:233-249 (1964)), echovirus I (Shafren et al., Int. J. Cancer, 115(2):320-328 (2005)), or an encephalomyocarditis virus type E (Adachi et al., J. Neurooncol., 77(3):233-240 (2006)) can be used. Other viruses having nucleic acid that can be used to reduce the number of viable cancer cells can be identified using the screening methods provided in Example 1.

Other viruses having nucleic acid that can be used to reduce the number of viable cancer cells include, without limitation, Adenoviridae viruses such as mastadenoviruses (e.g., bovine adenovirus A, bovine adenovirus B, bovine adenovirus C, canine adenovirus, equine adenovirus A, equine adenovirus B, human adenovirus C, human adenovirus D, human adenovirus E, human adenovirus F, ovine adenovirus A, ovine adenovirus B, porcine adenovirus A, porcine adenovirus B, porcine adenovirus C, tree shrew adenovirus, goat adenovirus, guinea pig adenovirus, murine adenovirus B, murine adenovirus C, simian adenovirus, and squirrel adenovirus), aviadenoviruses (e.g., fowl adenovirus A, fowl adenovirus B, fowl adenovirus C, fowl adenovirus D, fowl adenovirus E, goose adenovirus, duck adenovirus B, turkey adenovirus B, pigeon adenovirus), atadenoviruses (e.g., ovine adenovirus D, duck adenovirus A, bovine adenovirus D, possum adenovirus, bearded dragon, adenovirus, bovine adenovirus E, bovine adenovirus F, cervive adenovirus, chameleon adenovirus, gecko adenovirus, snake adenovirus), siadenoviruses (e.g., frog adenovirus and turkey adenovirus A), and white sturgeon adenoviruses; Coronaviridae viruses such as coronaviruses (e.g. canine coronavirus, feline coronavirus, human coronavirus 229E, porcine epidemic diarrhea virus, transmissible gastroenteritis virus, bovine coronavirus, human coronavirus OC3, human enteric coronavirus, porcine hemagglutinating encephalomyelitis virus, puffinosis coronavirus, sars coronavirus, infectious bronchitis virus, pheasant coronavirus, turkey coronavirus, rabbit coronavirus) and toroviruses (e.g., bovine torovirus, equine torovirus, human torovirus, and porcine torovirus); Flaviviridae viruses such as flaviviruses (e.g., gadgets gulley virus, kyasanur forest disease virus, langat virus, louping ill virus, omsk hemorrhage fever virus, powassan virus, royal farm virus, tick-borne encephalitis virus, kadam virus, meadam virus, saumarez reef virus, tyuleniy virus, aroa virus, dengue virus, kedougou virus, cacipacore virus, japanese encephalitis virus, koutango virus, murray valley encephalitis virus, St. Louis encephalitis virus, usutu virus, west nile virus, Yaounde virus, kokobera virus, bagaza virus, illheus virus, israel turkey meningoencephalomyelitis virus, ntaya virus, tembusu virus, zika virus, banzi virus, bouboui virus, edge hill virus, jugra virus, saboya virus, sepik virus, uganda S virus, wesselsbron virus, yellow fever virus, entebbe bat virus, yokose virus, apoi virus, cowbone ridge virus, jutiapa virus, modoc virus, sal vieja virus, san perlita virus, bukalasa bat virus, carey island virus, Dakar bat virus, Montana myotis leukoenchephalitis virus, phnom penh bat virus, rio bravo virus, cell fusing agent virus, and tamana bat virus), pestiviruses (e.g., border disease virus, bovine viral diarrhea virus 1, bovine viral diarrhea virus 2, classical swine fever virus, and pestivirus of giraffe), hepaciviruses (e.g., hepatitis C virus, GB virus B), GB virus A, and GB virus C; Hepadnaviridae viruses such as orthohepadnaviruses (e.g., hepatitis B virus, ground squirrel hepatitis B virus, woodchuck hepatitis B virus, woolly monkey hepatitis B virus, and arctic squirrel hepatitis virus) and avihepadnaviruses (e.g., duck hepatitis B virus); hepevirdae viruses such as hepeviruses (e.g., hepatitis E virus); Papillomaviridae viruses such as alphapapillomaviruses (e.g., human papillomavirus 32, human papillomavirus 10, human papillomavirus 61, human papillomavirus 2, human papillomavirus 26, human papillomavirus 53, human papillomavirus 18, human papillomavirus 7, human papillomavirus 16, human papillomavirus 6, human papillomavirus 34, human papillomavirus 54, human papillomavirus cand90, human papillomavirus 71, and rhesus monkey papillomavirus), betapapillomaviruses (e.g., human papillomavirus 5, human papillomavirus 9, human papillomavirus 49, human papillomavirus cand92, and human papillomavirus cand96), gammapapillomaviruses (e.g., human papillomavirus 4, human papillomavirus 48, human papillomavirus 50, human papillomavirus 60, and human papillomavirus 88), deltapapillomaviruses (e.g., european elk papillomavirus, deer papillomavirus, ovine papillomavirus 1, and bovine papillomavirus 1), epsilonpapillomaviruses (e.g., bovine papillomavirus 5), zetapapillomaviruses (e.g., equine papillomavirus 1), etapapillomaviruses (e.g., fringella coelebs papillomavirus), thetapapillomaviruses (e.g, psittacus erithicus timneh papillomavirus), iotapapillomaviruses (e.g., mastomys natalensis papillomavirus), kappapapillomaviruses (e.g., cottontail rabbit papillomavirus and rabbit oral papillomavirus), lambdapapillomaviruses (e.g., canine oral papillomavirus and feline papillomavirus), mupapillomaviruses (e.g., human papillomavirus 1 and human papillomavirus 63), nupapillomaviruses (e.g., human papillomavirus 41), xipapillomaviruses (e.g., bovine papillomavirus 3), omikronpapillomaviruses (e.g., phoecona spinipinnis), and pipapillomaviruses (e.g., hamster oral papillomavirus); Parvoviridae viruses such as parvoviruses (e.g., chicken parvovirus, feline panleukopenia virus, hb parvovirus, h-1 parvovirus, killham rat virus, lapine parvovirus, luiii virus, minute virus of mice, mouse parvovirus 1, porcine parvovirus, rt parvovirus, tumor virus x, hamster parvovirus, rat minute virus 1, and rat parvovirus 1), erythroviruses (e.g., human parvovirus b19, pig-tailed macaque parvovirus, rhesus macaque parvovirus, simian parvovirus, bovine parvovirus type 3, and chipmunk parvovirus), dependoviruses (e.g., aav-1, aav-2, aav-3, aav-4, aav-5, avian aav, bovine aav, canine aav, duck aav, equine aav, goose parvovirus, ovine aav, aav-7, aav-8, and bovine parvovirus 2), amdoviruses (e.g., aleutian mink disease virus), bocaviruses (e.g., bovine parvovirus and canine minute parvovirus), densoviruses (e.g., galleria mellonella densovirus, junonia coenia densovirus, diatraea saccharalis densovirus, pseudoplusia includens densovirus, and toxorhynchites splendens densovirus), iteraviruses (e.g., bombyx mori densovirus, casphalia extranea densovirus, and sibine fusca densovirus), brevidensoviruses (e.g., aedes aegypti densovirus and aedes albopictus densovirus), and pefudensoviruses (e.g., periplaneta fuliginosa densovirus); Polyomaviridae viruses such as polyomaviruses (e.g., african green monkey polyomavirus, baboon polyomavirus 2, bk polyomavirus, bovine polyomavirus, budgerigar fledgling disease polyomavirus, hamster polyomavirus, human polyomavirus, jc polyomavirus, murine pneumotropic virus, murine pneumotropic virus, murine polyomavirus, rabbit kidney vacuolating virus, simian virus 12, and simian virus 40); Togaviridae viruses such as alphaviruses (e.g., aura virus, barmah forest virus, bebaru virus, cabassou virus, chikungunya virus, eastern equine encephalitis virus, everglades virus, fort morgan virus, getah virus, highlands j virus, mayaro virus, middelburg virus, mosso das pedras virus, mucambo virus, ndumu virus, o'nyong-nyong virus, pixuna virus, rio negro virus, ross river virus, salmon pancreas disease virus, semliki forest virus, sindbis virus, southern elephant seal virus, tonate virus, tonate virus, una virus, venezuelan equine encephalitis virus, western equine encephalitis virus, and whataroa virus), rubiviruses (e.g., rubella virus), and triniti virus; Arteriviridae viruses such as arteriviruses (e.g., equine arteritis virus, lactate dehydrogenase-elevating virus, porcine reproductive and respiratory syndrome virus, and simian hemorrhagic fever virus); Caliciviridae viruses such as vesiviruses (e.g., feline calicivirus, vesicular exanthema of swine virus, and san miguel sea lion virus), lagoviruses (e.g., european brown hare syndrome virus and rabbit hemorrhagic disease virus), noroviruses (e.g., norwalk virus), and sapoviruses (e.g., sapporo virus); Retroviruses such as mammalian type B (e.g., mouse mammary tumor virus) and type C retroviruses (e.g., murine leukemia virus), Avian type C retroviruses (e.g., avian leukocis virus), type D retroviruses (e.g., squirrel monkey retrovirus, Mason-Pfizer monkey virus, langur virus, and simian type D virus), BLV-HTLV retroviruses (e.g., bovine leukemia virus), lentiviruses (e.g., bovine, equine, feline, ovinecaprine, and primate lentiviruses), and spumaviruses (e.g., simian foamy virus); and Astroviridae viruses such as mamastroviruses (e.g., bovine astrovirus, feline astrovirus, human astrovirus, ovine astrovirus, porcine astrovirus, and mink astrovirus) and avastroviruses (e.g., chicken astrovirus, duck astrovirus, and turkey astrovirus).

Nucleic acid coding for a virus can be administered directly to cancer cells (e.g., by intratumoral administration) or can be administered systemically (e.g., by intravenous, intraperitoneal, intrapleural, or intra-arterial administration). The amount of nucleic acid administered to a mammal can range from about 10 ng to about 1 mg (e.g., from 100 ng to 500 μg, from about 250 ng to about 250 μg, from about 500 ng to about 200 μg, or from about 1 μg to about 100 μg) per kg of body weight. In some cases, from about 100 ng to about 500 μg of nucleic acid coding for a virus can be administered as a single intratumoral dose. In some cases, the amount of nucleic acid administered to a mammal can be equal to a virus genome copy number of between about 3×1010 to about 3×1014 genome copies (e.g., between about 3×1010 to about 3×1013, between about 3×1010 to about 3×1012, between about 3×1011 to about 3×1014, between about 3×1011 to about 3×1013, or between about 3×1011 to about 3×1011 genome copies). For example, nucleic acid provided herein can be administered in an amount such that about 3×1011 virus genome copies are delivered to a mammal. In some cases, the amount of administered nucleic acid can be between about 3×1010 to about 3×1014 virus genome copies per kg of body weight.

Nucleic acid coding for a virus can contain sequences for either wild-type virus or for an engineered virus. For example, nucleic acid coding for a wild-type coxsackievirus A21 virus can be used to reduce the number of viable cancer cells within a mammal. In some cases, nucleic acid coding for a virus can contain nucleic acid sequences designed to control the expression of the viral polypeptides. For example, a nucleic acid provided herein can code for a virus and can contain nucleic acid encoding a polypeptide (e.g., a single chain antibody polypeptide that binds to a target cell receptor) designed to alter the virus' cell specificity at the level of virus entry. In some cases, a nucleic acid provided herein can code for a virus and can contain tissue-specific promoters to direct expression in desired cancer cells.

As described herein, nucleic acid coding for a virus can be designed to contain a microRNA target element (miRT) such that a corresponding microRNA (miRNA, specific miRNAs denoted as miR-#) present within a non-tumor cell can reduce virus gene expression, virus replication, or virus stability in that non-tumor cell. MicroRNAs are small, 21-23 nucleotide, highly conserved regulatory RNAs that can mediate translational repression or, in some cases, mRNA destruction by RISC-induced cleavage. MicroRNAs are present within many mammalian cells and can have a tissue-specific tissue distribution. As such, microRNAs can be used to modulate the tropism of a replicating virus to provide a targeting approach for any virus. The ability of nucleic acid coding for a virus to result in non-tumor cell lysis can be reduced using a microRNA target element having at least a region that is complementary to a microRNA present in the non-tumor cells. For example, coxsackievirus A21 can infect muscle cells. Thus, microRNA target elements that are complementary to microRNAs present in muscle cells can be incorporated into coxsackievirus A21 nucleic acid to reduce muscle cell lysis. Similarly, the safety of vaccines can be improved by modulating the tropism of a virus. For example, a neuronal and/or brain microRNA target element can be incorporated into the polio virus to reduce the incidence of poliomyelitis induced by the oral polio vaccine.

This same approach can be used to reduce non-tumor cell lysis by other viral nucleic acids. For example, microRNA target elements having at least a region that is complementary to the microRNAs set forth in Table 1 can be used to reduce cell lysis of the indicated tissue for the listed viruses as well as for other viruses. Other examples of microRNA target elements that can be designed to reduce viral-mediated cell lysis include, without limitation, those having at least a region complementary to a tissue-specific microRNA listed in Table 2. In some cases, nucleic acid provided herein can code for a virus and contain a microRNA target element having at least a region complementary to a classified tissue-specific microRNA. MicroRNA target elements can have complete complementarity to a microRNA. In some cases, a microRNA target element can contain mismatches in its complementarity to a microRNA provided that it contains complete complementarity to a seed sequence (e.g., base pairs 2-7) of the microRNA. See, e.g., Lim et al., Nature, 433(7027):769-73 (2005)).

TABLE 1 Silencing via incorporated microRNA target elements. Virus Tissue microRNA Coxsackievirus A21 Muscle miR-1 Coxsackievirus A21 Muscle miR-133 Coxsackievirus A21 Muscle miR-206 Coxsackievirus B3, Brain miR-101 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-124a,b Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-125 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-128 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-131 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-132 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-134 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-135 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-138 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-153 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-183 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-1b-2 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-219 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-9 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-95 Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Brain miR-99b Encephalomyocarditis-E Poliovirus III Echovirus I Coxsackievirus B3, Heart miR-1 Echovirus I Coxsackievirus B3, Heart miR-133 Echovirus I Coxsackievirus B3, Heart miR-206 Echovirus I Coxsackievirus B3, Heart miR-208 Echovirus I

TABLE 2 Classified tissue-specific microRNAs. miRNA Tissue Sequence Reference miR-1 Muscle UGGAAUGUAAAGAAGUAUGUA Rao et al., Proc. (SEQ ID NO: 21) Nat'l. Acad. Sci., 103: 8721-8726 (2006). miR-101 Brain UACAGUACUGUGAUAACUGAAG Lagos-Quintana et (SEQ ID NO: 22) al., Curr. Biol., 12: 735-739 (2002). miR-122a Liver UGGAGUGUGACAAUGGUGUUUG Fu et al., FEBS Lett., U (SEQ ID NO: 23) 579: 3849-3854 (2005). miR- Brain UUAAGGCACGCGGUGAAUGCCA Lagos-Quintana et 124a, b (SEQ ID NO: 24) al., Curr. Biol., 12: 735-739 (2002). miR-125 Brain UCCCUGAGACCCUUUAACCUGUG Liu et al., Proc. (SEQ ID NO: 25) Nat'l. Acad. Sci., 101: 9740-9744 (2004). miR- Digestive UCGUACCGUGAGUAAUAAUGC Shingara et al., RNA, 126AS (SEQ ID NO: 26) 11: 1461-1470 (2005). miR-127 Spleen UCGGAUCCGUCUGAGCUUGGCU Lagos-Quintana et (SEQ ID NO: 27) al., Curr. Biol., 12: 735-739 (2002). miR-128 Brain UCACAGUGAACCGGUCUCUUUC Liu et al., Proc. (SEQ ID NO: 28) Nat'l. Acad. Sci., 101: 9740-9744 (2004). miR-130 Lung CAGUGCAAUGUUAAAAGGGCAU Sempere et al., (SEQ ID NO: 29) Genome Biol., 5: R13 (2004). miR-132 Brain UAACAGUCUACAGCCAUGGUCG Lagos-Quintana et (SEQ ID NO: 30) al., Curr. Biol., 12: 735-739 (2002). miR-133 Muscle UUGGUCCCCUUCAACCAGCUGU Rao et al., Proc. (SEQ ID NO: 31) Nat'l. Acad. Sci., 103: 8721-8726 (2006). miR-134 Brain UGUGACUGGUUGACCAGAGGG Schratt et al., (SEQ ID NO: 32) Nature, 439: 283-289 (2006). miR-135 Brain UAUGGCUUUUUAUUCCUAUGUGA Sempere et al., (SEQ ID NO: 33) Genome Biol., 5: R13 (2004). miR-138 Brain AGCUGGUGUUGUGAAUC Obernosterer et al., (SEQ ID NO: 34) RNA, 12: 1161-1167 (2006). miR-142s Hematopoetic CAUAAAGUAGAAAGCACUAC Chen et al., Science, 5p, 3p (SEQ ID NO: 35) 303: 83-86 (2004). UGUAGUGUUUCCUACUUUAUGGA (SEQ ID NO: 36) miR-143 Digestive UGAGAUGAAGCACUGUAGCUCA Shingara et al., RNA, (SEQ ID NO: 37) 11: 1461-1470 (2005). miR-145 Digestive GUCCAGUUUUCCCAGGAAUCCCU Shingara et al., RNA, U (SEQ ID NO: 38) 11: 1461-1470 (2005). miR-148 Liver, UCAGUGCACUACAGAACUUUGU Shingara et al., RNA, Stomach (SEQ ID NO: 39) 11: 1461-1470 (2005). miR-15 B-cell UAGCAGCACAUAAUGGUUUGUG Calin et al., Proc. (Down- lymphocytic (SEQ ID NO: 40) Nat'l. Acad. Sci., regulated) leukemia 99: 15524-15529 (2002). miR-150 Spleen UCUCCCAACCCUUGUACCAGUG Shingara et al., RNA, (SEQ ID NO: 41) 11: 1461-1470 (2005). miR-151 Spleen ACUAGACUGAAGCUCCUUGAGG Sempere et al., (SEQ ID NO: 42) Genome Biol., 5: R13 (2004). miR-152 Liver UCAGUGCAUGACAGAACUUGGG Sempere et al., (SEQ ID NO: 43) Genome Biol., 5: R13 (2004). miR-153 Brain UUGCAUAGUCACAAAAGUGA Sempere et al., (SEQ ID NO: 44) Genome Biol., 5: R13 (2004). miR-155 Burkitt's UUAAUGCUAAUCGUGAUAGGGG Metzler et al., Genes Lymphoma (SEQ ID NO: 45) Chromosomes Cancer, 39: 167-169 (2004). miR-16 B-cell UAGCAGCACGUAAAUAUUGGCG Calin et al., Proc. (Down- lymphocytic (SEQ ID NO: 46) Nat'l. Acad. Sci., regulated) leukemia 99: 15524-15529 (2002). miR-17-5p Lymphoma CAAAGUGCUUACAGUGCAGGUAG He et al., Nature, U (SEQ ID NO: 47) 435: 828-833 (2005). miR-181 Hematopoetic AACAUUCAACGCUGUCGGUGAGU Chen et al., Science, (SEQ ID NO: 48) 303: 83-86 (2004). miR-183 Brain UAUGGCACUGGUAGAAUUCACUG Sempere et al., (SEQ ID NO: 49) Genome Biol., 5: R13 (2004). miR-18a, b Lymphoma UAAGGUGCAUCUAGUGCAGAUA He et al., Nature, (SEQ ID NO: 50) 435: 828-833 (2005). UAAGGUGCAUCUAGUGCAGUUA (SEQ ID NO: 51) miR-192 Kidney CUGACCUAUGAAUUGACAGCC Sempere et al., (SEQ ID NO: 52) Genome Biol., 5: R13 (2004). miR-194 Kidney UGUAACAGCAACUCCAUGUGGA Sun et al., Nucleic (SEQ ID NO: 53) Acids Res., 32: e188 (2004). miR-195 Hematopoetic UAGCAGCACAGAAAUAUUGGC Baskerville et al., (SEQ ID NO: 54) RNA, 11: 241-247 (2005). miR-199 Liver CCCAGUGUUCAGACUACCUGUUC Sempere et al., (SEQ ID NO: 55) Genome Biol., 5: R13 (2004). miR-19a, b Lymphoma UGUGCAAAUCUAUGCAAAACUGA He et al., Nature, (SEQ ID NO: 56) 435: 828-833 (2005). UGUGCAAAUCCAUGCAAAACUGA (SEQ ID NO: 57) miR-204 Kidney UUCCCUUUGUCAUCCUAUGCCU Sun et al., Nucleic (SEQ ID NO: 58) Acids Res., 32: e188 (2004). miR-204 Testis UUCCCUUUGUCAUCCUAUGCCU Baskerville et al., (SEQ ID NO: 59) RNA, 11: 241-247 (2005). miR-206 Muscle UGGAAUGUAAGGAAGUGUGUGG Rao et al., Proc. (SEQ ID NO: 60) Nat'l. Acad. Sci., 103: 8721-8726 (2006). miR-208 Heart AUAAGACGAGCAAAAAGCUUGU Sempere et al., (SEQ ID NO: 61) Genome Biol., 5: R13 (2004). miR-212 Spleen UAACAGUCUCCAGUCACGGCC Sempere et al., (SEQ ID NO: 62) Genome Biol., 5: R13 (2004). miR-215 Liver AUGACCUAUGAAUUGACAGAC Sempere et al., (SEQ ID NO: 63) Genome Biol., 5: R13 (2004). miR-215 Kidney AUGACCUAUGAAUUGACAGAC Sun et al., Nucleic (SEQ ID NO: 64) Acids Res., 32: e188 (2004). miR-216 Pancreas UAAUCUCAGCUGGCAACUGUG Sood et al., Proc. (SEQ ID NO: 65) Nat'l. Acad. Sci., 103: 2746-2751 (2006). miR-219 Brain UGAUUGUCCAAACGCAAUUCU Sempere et al., (SEQ ID NO: 66) Genome Biol., 5: R13 (2004). miR-221 Hematopoetic AGCUACAUUGUCUGCUGGGUUUC Felli et al., Proc. (SEQ ID NO: 67) Nat'l. Acad. Sci., 102: 18081 18086 (2005). miR-222 Hematopoetic AGCUACAUCUGGCUACUGGGUCU Felli et al., Proc. C (SEQ ID NO: 68) Nat'l. Acad. Sci., 102: 18081 18086 (2005). miR-223 Hematopoetic UGUCAGUUUGUCAAAUACCCC Chen et al., Science, (SEQ ID NO: 69) 303: 83-86 (2004). miR-24 Lung UGGCUCAGUUCAGCAGGAACAG Sempere et al., (SEQ ID NO: 70) Genome Biol., 5: R13 (2004). miR-25 Lymphoma CAUUGCACUUGUCUCGGUCUGA He et al., Nature, (SEQ ID NO: 71) 435: 828-833 (2005). miR-30b, c Kidney UGUAAACAUCCUACACUCAGCU Sempere et al., (SEQ ID NO: 72) Genome Biol., 5: R13 UGUAAACAUCCUACACUCUCAGC (2004). (SEQ ID NO: 73) miR-32 Lung UAUUGCACAUUACUAAGUUGC Sempere et al., (SEQ ID NO: 74) Genome Biol., 5: R13 (2004). miR-375 Pancreas UUUGUUCGUUCGGCUCGCGUGA Poy et al., Nature, (SEQ ID NO: 75) 432: 226-230 (2004). miR-7 Pituitary UGGAAGACUAGUGAUUUUGUUG He et al., Nature, (SEQ ID NO: 76) 435: 828-833 (2005). miR-9 Brain UCUUUGGUUAUCUAGCUGUAUGA Sun et al., Nucleic (SEQ ID NO: 77) Acids Res., 32: e188 (2004). miR-95 Brain UUCAACGGGUAUUUAUUGAGCA Babak et al., RNA, (SEQ ID NO: 78) 10: 1813-1819 (2004). miR-99b Brain CACCCGUAGAACCGACCUUGCG Liu et al., Proc. (SEQ ID NO: 79) Nat'l. Acad. Sci., 101: 9740-9744 (2004).

Common molecular cloning techniques can be used to insert microRNA target elements into nucleic acid coding for viruses. A nucleic acid provided herein can contain one microRNA target element or multiple microRNA target elements (e.g., two, three, four, five, six, seven, eight, nine, ten, 15, 20, 25, 30, or more microRNA target elements). For example, a viral nucleic acid can contain microRNA target elements inserted into both the 5′ and 3′ untranslated regions (UTR) in sections with limited secondary structure. In some cases, in the 5′UTR, microRNA target elements can be inserted upstream of the IRES. In some cases, in the 3′UTR, microRNA target elements can be inserted adjacent to the stop codon of a polypeptide or polyprotein. In some cases, microRNA target elements can be inserted in an arrangement as shown in FIG. 19 or FIG. 33A.

In some cases, microRNA target elements that are complementary to microRNAs that are ubiquitously expressed in normal cells with limited expression in tumor cells can be used to direct cell lysis to tumor cells and not non-tumor cells. For example, when using nucleic acid coding for a virus to treat B-cell lymphocytic leukemia, the viral nucleic acid can be designed to contain microRNA target elements complementary to microRNAs that are ubiquitously expressed in normal tissue while being down-regulated in B-cell lymphocytic leukemia cells. Examples of such microRNAs include, without limitation, miR-15 and miR-16.

In some cases, a microRNA target element having at least a region of complementarity to a cancer-specific microRNA can be used to direct cell lysis to tumor cells. For example, nucleic acid coding for a virus can include microRNA target elements to direct microRNA-mediated targeting. Viruses such as picornaviruses (e.g., CVA21) can translate in a cap-independent way. Namely, the viral Internal Ribosome Entry Site (IRES) can recruit transcription factors and ribosomes to the viral RNA where it is then translated. In addition, a cloverleaf structure on the tip of the 5′UTR can play a role in picornavirus replication (Barton et al., EMBO J., 20:1439-1448 (2001)). The following strategies are designed to conditionally distort the traditional secondary structure adopted by a virus (e.g., CVA21) in the 5′UTR in order to achieve a targeted oncolytic. These strategies are based, in part, upon RISC binding to the viral genome, but causing little, or no, miRNA-mediated cleavage. Rather, RISC in this situation has been manipulated to be a mediator of steric hindrance as the targets introduced can lack complete homology required for RNA cleavage.

Strategy: Disruption of Viral IRES

By introducing binding elements of reverse complementarity to elements within the viral IRES (now called Reverse Complement “RC” region) at stem loops III, IV, and V, viral RNA can adopt a structure unlikely to recruit ribosomes (e.g., a malformed IRES), resulting in the inhibition of viral translation. Then, by introducing an adjacent region containing a microRNA target element sequence between an RC region and a stem loop of the IRES to which the RC region is targeted, RISC recruitment by the endogenous microRNA to the introduced microRNA target element can disrupt the altered (engineered) secondary structure (FIG. 20).

Wild-type secondary structure can once again be adopted in the presence of RISC, and a virus can be obtained that conditionally translates only in the presence of the microRNA whose target has been introduced into the viral genome. With oncogenic miRNAs identified, expressed exclusively (or at least in much larger numbers) in neoplastic tissues, the resulting virus can be a tumor-specific oncolytic.

A reverse complement to part of stem loop V can be introduced upstream in the 5′UTR (FIG. 21). In between engineered RC region and stem loop V, a micoRNA target element (miRT) can be inserted. With reference to FIG. 21, the heavy gray line represents an engineered reverse complement, thin gray represents a microRNA target element, and the second heavy gray line corresponds to the microRNA target element that can base pair with the engineered reverse complement (note that this sequence need not be altered, rather just the cognate for introduced sequence). Since sequences can be designed such that Watson-Crick base pairing between the two heavy gray sequences is more thermodynamically favored than the wild-type situation, a new stem loop can be preferentially formed unless a factor is present to disrupt this new base pairing (i.e., RISC binding to miRT).

In a normal cell, stem loop V can be altered due to base pairing between introduced RC region (in gray), engineered to complement previous stem loop V. MicroRNA target element is shown in light gray, not bound by RISC as the target element is coding for a microRNA absent in these cells. A new, inhibitory, loop can be formed in this situation (FIG. 22).

In a cancer cell expressing a microRNA for an engineered microRNA target element, the microRNA whose target has been engineered into the viral genome can bind RISC (FIG. 23). The association of RISC with this target can disrupt the aberrant base pairing, and the normal IRES structure can be restored. This strategy can be used to disrupt loop III, IV, or V, or any combination thereof.

To construct nucleic acids for this strategy, unique restriction sites can be introduced into a virus sequence (e.g., CVA 21 5′UTR) at locations such as (a) upstream of stem loop III, (b) between stem loops III and IV, and/or (c) between stem loops IV and V. Combinations of reverse complementary (RC) regions and microRNA target elements (miRTs) can be introduced into the new restriction sites. The RC regions can be designed against regions that are found in stem loops III, IV, or V, that are >7 by in length, and that contain from 0-80% mismatch to determine the optimal sequence able to be disrupted by RISC binding. MicroRNA target elements for any cancer-specific microRNA (e.g., two cancer-specific microRNAs such as miR-155 and miR-21) can be introduced adjacent to reverse complementary regions. These can contain from nothing but seed sequence matches (e.g., base pairs 2-7) up to 100% homology.

Strategy: Disruption of 5′ Cloverleaf Motif

This strategy involves not disrupting binding of ribosomes to the IRES, but rather disrupting the 5′ cloverleaf (stem loops I, II in schematic picture) found to be a cis-acting element required for picornavirus replication. Hepatitis C Virus, a flavivirus, appears to require a target sequence for a liver-specific microRNA in the 5′UTR of the viral genome for viral accumulation in the liver (Jopling et al., Science, 309:1577-1581 (2005)). The binding of RISC to its target element can allow a new secondary structure to be formed that mimics the 5′ cloverleaf formed in picornaviruses. The 5′UTR of Hepatitis C Virus is, in fact, more similar to picornaviruses than other flaviviruses in that it lacks a 5′ cap and translates utilizing a viral IRES. Though there is little sequence homology between the Hepatitis C 5′UTR and that of the picornaviruses, secondary structure analysis reveals that masking the sequence to which RISC binds causes the formation of a cloverleaf structure comparable to that of the picornaviruses (FIGS. 24-27).

The formation of the cloverleaf found in Coxsackievirus A21 can be disrupted selectively by the inclusion of a microRNA target element in this region, along with a sequence that can be reverse complementary to elements within the cloverleaf. In the absence of RISC binding, secondary structure can be altered, while in the presence of RISC binding, it can assume wild-type base pairing.

Two different strategies can be use for the disruption of the 5′ terminal cloverleaf motif:

A) Creation of Hepatitis C Virus/Coxsackievirus A21 5′UTR Chimera

1. Overlap Extension PCR to introduce miR-155T or miR-21T in place of miR-122T found in Hep C 5′UTR

2. PCR can be used to introduce portions Hepatitis C Virus 5′UTR into Coxsackievirus A21

    • i) Portions of Hep C 5′UTR can be used in place of portions of CVA21 5′UTR by (gray below represents Hepatitis C virus contribution of cloverleaf motif) (FIG. 28).
    • ii) Hep C region can be introduced adjacent to engineered RC region that complements portion of CVA cloverleaf motif (FIG. 29).

B) Insertion of RC Regions Up and Downstream of Cloverleaf

1. Unique restriction sites can be inserted before cloverleaf motif and/or after cloverleaf motif

2. Disrupting Sequences (RC regions) and miRTs can be introduced into unique restriction sites.

i. in the case of insertion before cloverleaf motif, miRT can be adjacent to RC region on 3′ side (FIG. 30).

ii. in the case of insertion after cloverleaf motif, miRT can be adjacent to RC region on 5′ side (FIG. 31).

To construct nucleic acids for this strategy, reverse complementary (RC) regions can be designed against portions of cloverleaf motif, can be >7 base pairs in length, and can contain from 0-80% mismatch to determine the optimal sequence able to be disrupted by RISC binding. MicroRNA target elements for any cancer-specific microRNA (e.g., two cancer-specific microRNAs such as miR-155 and miR-21) and for control microRNA can be introduced adjacent to RC regions. These can contain from nothing but seed sequence matches (e.g., base pairs 2-7) up to 100% homology.

Screening Strategy:

In order to screen the candidates obtained, a system can be used whereby the capsid proteins VP1, VP2, and VP3 are replaced by the luciferase gene (FIG. 32). In polioviruses, this system can retain the enzymatic activity of luciferase (Porter et al., Virology, 243:1-11 (1998)). In this strategy, cancer-specific miRNAs miR-155 and miR-21 can be used for screening purposes to determine possible secondary structures that cause translation in the presence and translational inhibition in absence of these miRNAs. These are not intended to be limiting, but rather, can be used as tools to screen secondary structure.

1. Construction of Stable Cell Line Expressing Cancer-Specific microRNA

Briefly, HeLa cells can be transduced with lentiviral vector expressing miR-155, miR-21, or control pri-miRNA sequence driven by a Pol II promoter. Endogenous cellular processing pathway by Drosha and Dicer result in expression of mature siRNAs analogous to mature microRNAs. Note that these cell lines can be engineered to express these pseudo-miRNAs and endogenous forms of these specific miRNAs are not expressed.

2. Transfection of Engineered Viral RNA in Control & miR-155 and miR-21 Expressing Cells

RNA can be isolated from clones from the above strategies using Ambion in vitro Maxiscript transcription kit. RNA can be transfected with Minis Trans-IT mRNA transfection kit into control and cancer-specific microRNA expressing HeLa cell lines.

3. Luciferase Assay

Luciferase assay can be performed on cell lines 1-72 hours post transfection. Positive response can be measured by a 3 fold higher production of luciferase in miR-155 or miR-21 expressing cell lines over control miRNA expressing lines. To screen for putative tumor-specific oncolytics, the above assay can provide an artificial method of simulating the microRNA pathway. Use of lentiviral vectors to express siRNAs that mimic microRNAs, however, can express these small regulatory RNAs in higher copy number than are expressed in the cancers. The following can be a protocol to screen obtained oncolytics in the presence of microRNAs expressed in various copy numbers.

4. Testing for CPE with WT CVA21 in miR-155 and miR-21 Expressing Cell Lines

After titration on suitable cell line, 1.0 TCID50/cell can be added and CPE determined 48 hours post infection by MTT assay on cell lines expressing miR-155 (e.g., Raji, OVI-Ly3, L428, KMH2, L1236, and L591) and cells lines expressing miR-21 (e.g., U373, A172, LN229, U87, LN428, LN308).

CPE of >90% can correspond to a cell line that can be used in the analysis of previously identified, putative, tumor-specific oncolytics.

5. Transfection of Viral RNA in Identified Cell Line from Above Either Containing Antisense 2′O-methyl Oligoribonucleotides (2′OMe) Against miR-155, miR-21, or Ubiquitous miRNA

The addition of antisense 2′OMe-RNA can be used to inactivate specifically its cognate microRNA (Meister et al., RNA, 10:544-550 (2004)). Using this strategy, cell lines that specifically inactivate the activity of endogenously expressed miRNAs (in wild type copy numbers) can be obtained and used to show efficacy in this system.

6. Luciferase Assay

Luciferase assay can be performed on cell lines in the absence/presence of antisense 2′OMe-miR-155 or antisense 2′OMe-miR-21. Positive responses can be measured by a 3 fold higher production of luciferase in the absence of antisense 2′OMe-miR-155 or antisense 2′OMe-miR-21 in expressing cell lines over luciferase production in the presence of antisense 2′OMe-miR-155 or antisense 2′OMe-miR-21.

7. Insertion Sequences Cloned into Wild-Type CVA-21

Identified insertion sequences that elicited a positive response in both lentiviral vector expression screening and using 2′O-methyl oligoribonucleotides can be cloned back into capsid-expressing Coxsackievirus A21. New microRNA target elements can be inserted in place of miR-155 or miR-21 used for screening purposes.

8. Screening Via INA Screening Assay

The methods and materials provided herein can be used to screen for oncolytic activity. The obtained viruses can be propagated in the presence of miR-155, miR-21 or other inserted oncogenic microRNA target elements.

Examples of cancer-specific microRNAs include, without limitation, those listed in Table 3.

TABLE 3 Cancer-specific microRNAs. microRNA Cancer miR-25 Lymphoma miR-21 Glioblastoma (+/−Breast Cancer) miR-19a,b Lymphoma miR-18a,b Lymphoma miR-17-5p Lymphoma miR-155 Burkitt's Lymphoma

When assessing nucleic acid for the ability to reduce the number of viable cancer cells within a mammal, any appropriate cancer model can be used. For example, a SCID mouse model containing implanted tumor cells such as those listed in Table 4 can be used.

TABLE 4 Tumor model cell lines. Cancer Tumor Type Cell Line Breast Human Xenograft BT-474 Breast Human Xenograft MCF7/S Breast Human Xenograft MCF7/TAMR-1 Breast Human Xenograft MCF7/Mitox Breast Human Xenograft MCF7/D40 Breast Human Xenograft MDA-MB-231 Breast Human Xenograft MDA-MB-435 Breast Human Xenograft ZR-75-1 Breast Human Xenograft ACC3199 Breast Human Xenograft T-47D Cervix Human Xenograft HeLa Cervix Human Xenograft Ca Ski Cervix Human Xenograft SiHa Cervix Human Xenograft C-33A Colon Human Xenograft CaCo-2 Colon Human Xenograft HCA-7 Colon Human Xenograft HCT 116 Colon Human Xenograft HT-29 Colon Human Xenograft SW480 Colon Human Xenograft SW620 Colon Human Xenograft DLD-1 Colon Human Xenograft LoVo Colon Mouse Allograft CT26.WT Fibrosarcoma Human Xenograft HT-1080 Glioblastoma Human Xenograft U-87 MG Glioblastoma Human Xenograft SF 767 Leukemia Human Xenograft HL-60, Leukemia Human Xenograft K562/S Leukemia Human Xenograft K562/MDR Leukemia Human Xenograft KG-1 Leukemia Human Xenograft OCI-AML3 Leukemia Tumor Supressor KO NF-1 Mutant Liver Human Xenograft SK-HEP-1 Liver Human Xenograft HC-4 Liver Human Xenograft HepG2 Liver Human Xenograft Hep 3B Lung Human Xenograft A549 Lung Human Xenograft MV522 Lung Human Xenograft NCI-H1299 Lung Human Xenograft NCI-H460 Lung Human Xenograft NCI-H1975 Lung Mouse Allograft PC-6 Lung Mouse Allograft LL/2 Lung Human Xenograft NCI-H69/S Lung Human Xenograft H69AR Lung Human Xenograft SHP-77 Lung Human Xenograft DMS 53 Lung Human Xenograft DMS 153 Lung Human Xenograft DMS 114 Lymphoma Human Xenograft Daudi Lymphoma Human Xenograft OCILY8 Lymphoma Human Xenograft Raji Lymphoma Human Xenograft Granta 519 Lymphoma Human Xenograft Granta 4 Lymphoma Human Xenograft KARPAS-299 Lymphoma Human Xenograft CA46 Lymphoma Human Xenograft U937 Lymphoma Human Xenograft H33HJ-JA1 Melanoma Human Xenograft A-375 Melanoma Human Xenograft DH903 Melanoma Human Xenograft JH1308 Melanoma Human Xenograft KD1592 Melanoma Human Xenograft PS1273 Melanoma Human Xenograft WM1791C Melanoma Human Xenograft LOX IMVI Melanoma Human Xenograft SBL2 Melanoma Mouse Allograft B16-F0 Melanoma Human Xenograft SK-MEL-5 Myeloma Human Xenograft 8226/S Myeloma Human Xenograft 8226/V Myeloma Human Xenograft 8228/Dox40 Myeloma Human Xenograft ARH-77 Myeloma Human Xenograft ARHD60 Myeloma Human Xenograft Kas-6/1 Myeloma Human Xenograft KMM-1 Neuroblastoma Human Xenograft SK-N-SH Osteosarcoma Human Xenograft Saos-2 Osteosarcoma Human Xenograft U-2 OS Ovarian Human Xenograft A2780 Ovarian Human Xenograft OVCAR-3 Ovarian Human Xenograft SK-OV-3 Ovarian Human Xenograft IGROV1 Ovarian Human Xenograft OV202 Pancreatic Human Xenograft AsPC-1 Pancreatic Human Xenograft BxPC-3 Pancreatic Human Xenograft CFPAC-1 Pancreatic Human Xenograft HPAF-II Pancreatic Human Xenograft MIA PaCa-2 Pancreatic Human Xenograft PANC-1 Pancreatic Human Xenograft SU.86.86 Pancreatic Human Xenograft Capan-2 Prostate Human Xenograft DU 145 Prostate Human Xenograft LNCaP Prostate Human Xenograft PC-3 Renal Human Xenograft A-498 Renal Human Xenograft ACHN Renal Human Xenograft 786-O Renal Human Xenograft Caki-1 Stomach Human Xenograft KATO III Uterine Human Xenograft RL 95.2 Uterine Human Xenograft MES-SA

The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

EXAMPLES Example 1 Screening for Infectious Nucleic Acid that Can be Used to Treat Cancer

The following screening assay is used to identify infectious nucleic acid that can be used to treat cancer. First, virus particles are obtained and assessed in vitro using a lysis assay performed with human cancer cells. Briefly, after titrating virus particles on a suitable cell line, 1.0 TCID50/cell of virus particles is added to a panel of human cancer cell lines, and the cytopathic effect (CPE) is measured 48 hours post infection using an MTT assay as described elsewhere ((Mossman, J. Immunol. Methods, 65:55-63 (1983)). Viruses that exceed a CPE of >90 percent for any particular cell line are considered as putative oncolytics and proceed to in vivo screening in rodent models.

The following is performed to assess in vivo oncolytic effects. Briefly, SCID mice are inoculated with 106 cancer cells (e.g., a cancer cell line listed in Table 4). When tumors reach 0.5 cm in diameter, putative oncolytic viruses are inoculated into the mice at low dose (e.g., 103 TCID50 for intratumoral injections; 104 TCID50 for intravenous injections; or 105 TCID50 for intraperitoneal injections). The tumors are measured to determine whether or not the administered virus caused a reduction in tumor size. Viruses that cause tumor reduction within two weeks are then screened by direct injection of viral nucleic acid.

To assess the direct injection of viral nucleic acid, tumors are established in SCID mice as above. Then, 1, 2, 4, 8, 16, and 32 μg of viral nucleic acid is intratumorally injected in a total volume of 100 μL, of OptiMEM® (a chemically-defined medium; Invitrogen™). The titer of virus within serum is determined after seven days. A positive response is achieved when a titer of virus particles in serum is equal to or greater than 103 TCID50 and an overall reduction of tumor size that is greater than 30 percent.

Example 2 Multiple Myeloma Cells are Highly Susceptible to Coxsackievirus Infection

Coxsackievirus A21 (CVA21; Kuykendall strain) was purchased from ATCC. CVA21 was propagated on H1-HeLa cells (ATCC) by plating cells at 75 percent confluence 24 hours prior to infection. Cells were infected with CVA21 at MOI 0.1 for two hours at 37° C. Unincorporated virus was removed by replacing the growth media. Infected cells were checked regularly over 48 hours for CPE. When 90 percent of cells had detached, the remaining cells were scraped from the flask, and the cell pellet was harvested. These cells were then resuspended in one to two mL of OptiMEM® (Invitrogen) and subjected to three freeze-thaw cycles. Cell debris was removed by centrifugation, and the cleared cell lysate containing virus was aliquoted and stored at −80° C.

Titration of CVA21 was performed on H1-HeLa cells. Cells were plated in 96 well plates at 50 percent confluence. After 24 hours, serial ten-fold dilutions (−2 to −10) were made of the virus; 100 μL, of each dilution was added to each of eight duplicate wells. Following incubation at 37° C. for 72 hours, wells were fixed and stained (0.1% crystal violet, 20% methanol, 4% paraformaldehyde). Wells were then accessed for CPE manifest as non-staining areas devoid of viable cells. If purple staining cells were seen on 75 percent or less of the well surface, then the well was scored positive. TCID50 values were determined using the Spearman and Kärber equation.

One-step growth curves were performed using four multiple myeloma cell lines (JJN-3, KAS6/1, MM1, ARH-77). Each cell line was incubated with CVA21 at a MOI of 3.0 for 2 hours at 37° C. Following this incubation, cells were centrifuged, and unincorporated virus was removed. Cells were resuspended in fresh growth media and plated in 24 well plates with eight wells for each cell line tested. At predetermined time-points (2, 4, 6, 12, 24, 36, 48, and 72 hours), cells and growth media were harvested from one well for each cell line. Cells were separated from growth media (supernatant) with fresh growth media being added to cell pellet. Both fractions were frozen at −80° C.

At the completion of all time-points, the samples were thawed, and the cell pellets were cleared from the samples by centrifugation providing a cleared cell lysate fraction and a media supernatant fraction. The titer was determined for both fractions.

All myeloma cell lines exhibited rapid and high titer propagation of CVA21 with three of the four cell lines approaching plateau by 12 hours with titers as high as 107 to 108 TCID50 per mL (FIG. 1). All titers remained steady out to the 72 hour time point. These results demonstrate that multiple myeloma cell lines are highly susceptible to CVA21 infection and rapidly propagate this virus.

Example 3 Coxsackievirus-Mediated Tumor Regression is Associated with Viremia and Myositis

An in vivo study was completed in SCID mice. Mice were irradiated (150 cGy) 24 hours prior to the subcutaneous implantation of 107 KAS6/1 cells into the right flank. When tumors reached an average size of 0.5 cm, mice were treated with two injections (48 hours apart) of CVA21, each 5.6×105 TCID50. The mice were divided into three groups, Opti-MEM control (no virus), intratumoral (IT) delivery, and intravenous (IV) delivery. Tumors began regressing by day 8 at which time the mice began dragging their hind limbs. Over the next 48 hours, the mice wasted and became weak being unable to reach food or water due to progressive limb weakness. At around day 10, the mice either died or had to be euthanized. In all treated mice, the pattern was the same: tumor regression coincided with hind limb paralysis followed by wasting and euthanasia or death.

Mouse tissue was harvested and applied to a monolayer of H1-HeLa cells to check for recovery of live virus from tissues. The control mouse tissues exhibited no CPE. With virus treated mice, virus was recovered from residual tumor tissue as well as from adjacent and distant skeletal muscle tissue. Other tissues including heart, brain, liver, and spleen were negative (Table 5).

TABLE 5 CPE of mouse tissue overlays on H1-HeLa cells Mice Tumor Liver Spleen Brain Muscle IV virus #1 +++ − − − ++ IV virus #2 +++ − − − ++ IV virus #3 +++ − − − ++ IT virus #1 +++ − − − ++ No virus #1 − − − − − Viral recovery was considered negative (−) if no CPE was observed by 96 hrs. (++) denotes >50% CPE observed within 24 hrs. (+++) denotes >50% CPE observed within 12 hrs

In another in vivo study, mice were euthanized at the time point of tumor regression/hind limb paralysis, and their tissues prepared for histological examination. The pathology results indicated that virus-treated mice had significant myositis in their hind limb muscles (FIG. 2).

The analysis of tumor volume revealed regression of all tumors treated with one intratumoral dose of CVA21 (FIG. 3). By day 7, tumors were regressing, and mice exhibited signs of hind limb paralysis associated with viremia causing myositis. All treated mice were dead by day 10, while control mice had big tumors but were otherwise healthy. Blood drawn from treated mice three and seven days post treatment exhibited titers of CVA21 that ranged from 3×105 to 3×106 per mL (Table 6).

TABLE 6 Serum titers of CVA21 in treated and control mice (TCID50) Control mice CVA21 treated mice 72 hours post treatment 0 ± 0 1.08e6 ± 3.15e5  1 week post treatment 0 ± 0 3.16e6 ± 0

As described above, the effect of CVA21 on multiple myeloma cell lines and xenografts was examined. CVA21 was propagated and titered on H1-HeLa cells. FACScan analysis was performed with human multiple myeloma cell lines (KAS6/1, MM1, JJN-3, ARH-77). All the cell lines tested were found to express surface receptors for both DAF and ICAM-1, making them viable candidates for CVA21 infection. The in vitro studies revealed that cell lines incubated with decreasing amounts of CVA21 exhibit rapid cytopathic effect in doses as low as MOI=0.0014 for three of the cell lines tested (dose for CPE with JJN-3 was MOI=0.028). With in vivo studies in SCID mice bearing human myeloma xenografts, tumors quickly and completely responded to CVA21 (both IV and IT administration). As promptly as the tumors regressed, the mice became sick with hind-limb paralysis and quickly died. Pathology reports revealed complete ablation of all tumor tissue but also signs of widespread myositis in muscle tissues. CVA21 virus was recovered from muscle biopsies but there was no evidence of CNS infection. Toxicity was observed in tumor bearing animals with a CVA21 dose as low as 560 TCID50. In an attempt to ameliorate the myositis, adenoviruses coding for mouse IFNγ was administered prior to CVA21 therapy. Blood levels of IFNγ, were measured by ELISA and were 1500-3000 pg/mL compared to 150 pg/mL in untreated control mice. There was little impact on tumor response or survival. These results demonstrate that CVA21 can be a potent anti-myeloma agent.

Example 4 Low Doses of Coxsackievirus Cause Tumor Regression

Four tumor bearing mice (KAS6/1 tumor cells) were treated by intratumoral injections with low dose CVA21: two mice with 5,600 TCID50 and two mice with 560 TCID50. By day 6, all of the treated tumors began getting soft and started regressing. Between days 7-9, all mice exhibited signs of virema with hind limb paralysis and wasting. At this point, all mice met the sacrifice criteria and were euthanized by day 12.

Example 5 Infectious RNA Encoding a Coxsackievirus Causes Tumor Regression, Viremia, and Myositis

CVA21 infectious RNA was synthesized by in vitro transcription of a CVA21 plasmid DNA (obtained from Eckhard Wimmer). The CVA21 DNA was linearized by cutting with Mlu 1 restriction enzyme upstream of the T7 promoter site. This digest was terminated by ethanol precipitation. The transcription reaction was then assembled using the Ambion (Austin, Tex.) MEGAscript® kit. Briefly, the linearized DNA was mixed with reaction buffer, ribonucleotide solutions, and enzyme. Transcription was allowed to proceed at 37° C. for three hours. The sample was then treated with DNase 1 to remove the template DNA. Ambion's MEGAclear™ purification kit was used to purify the RNA for in vitro or in vivo studies. CVA21 RNA samples were quantitated by UV absorbance. The purity and size of the transcription product were assessed by formaldehyde gel electrophoresis. Activity of the CVA21 transcript was assessed by transfecting RNA into H1-HeLa cells using the Minis (Madison, Wis.) TranIT®-mRNA Transfection Kit and monitoring cells for CPE and for release of titratable CVA21 virus.

To test the effectiveness of CVA21 infectious RNA to cause the same tumor destruction as CVA21 virus, SCID mice bearing KAS6/1 subcutaneous xenografts were given intratumoral injections of CVA21 RNA at increasing doses (0, 1 μg, 2 μg, 4 μg, 8 μg, 16 μg, and 32 μg). Tumors were measured daily, and mice were monitored for signs of hind limb paralysis. Blood was also drawn from mice at days 3, 7, 10, 14, 17, and 21 to monitor serum titers of CVA21 virus. All mice in the groups that received 4 μg or more of RNA had tumor regression, viremia, and myositis causing hind limb paralysis and death (Table 7 and FIG. 4). Two mice in each of the 1 μg and 2 μg groups exhibited tumor regression and hind limb paralysis, but tumors progressed in the other mice in those groups as well as in non-treated mice. These non-responding animals did not exhibit signs of myositis and were euthanized when their tumors were greater than 10 percent of body weight.

TABLE 7 Mean virus titers in mouse serum/group (TCID50). RNA (μg) 3 day 7 day 10 day 14 day 17 day 21 day 0 0 0 0 0 0 0 1 5e2 6e4 1e5 6e4 0 0** 2 5e2 0 1e6 6e4 8e4 8e4 4 1e6 1e6 6e6 1e6 7e5 3e5** 8 2e6 7e4 7e4 1e6 3e4** 3e4** 16 2e4 6e5 8e5 3e5** 3e4** 0** 32 6e4 2e5 1e6 1e5 3e6** **Denotes more than 50% of mice dead in group

In another study, two mice bearing myeloma xenografts were tested to determine whether CVA21 infectious RNA given intravenously initiates the oncolytic intratumoral CVA21 infection. Two SCID mice bearing KAS6/1 subcutaneous xenografts were each given an intravenous tail vein injection of a solution containing 50 μg CVA21 RNA. By day 4 post injection of the RNA, both mice had measurable viral titers in their serum (TCID50=3×105 per mL). In addition, tumor regression began around day 7 with hind limb paralysis at day 9 followed by death at day 10 with serum virus titers at 3×106 TCID50 (Table 8 and FIG. 5).

TABLE 8 Progression of infection in mice treated intravenously with infectious viral RNA. Day 4 serum Tumor Hind Death TCID50 regression limb paralysis (Serum TCID50) Mouse 1 3e5 Day 8 Day 10 Day 11 Mouse 2 3e5 Day 6 Day 10 Day 11 (3e6)

Example 6 microRNA-Dependent Silencing in Muscle

A microRNA-dependent technique for controlling viral gene expression was developed to control effects associated with viral expression in non-tumor cells (e.g., myositis associated with CVA21 therapy). Coxsackievirus A21, a picornavirus with a 7.4 kb genome, is not well suited for the incorporation of trackable transgenes. Therefore, to test the ability of microRNA target elements to confer tissue-specific silencing of a virus in vitro, GFP-tagged plasmids and lentiviral vectors expressing GFP were generated. Three highly conserved, muscle-specific microRNAs (miR-1, miR-133, and miR-206) were selected as potential modulators of gene expression, and target elements complementary to these microRNA sequences were incorporated into the 3′UTR of GFP. Immunofluorescence and flow-cytometric analysis revealed microRNA target element-dependent suppression of gene expression in the muscle cells, while controls with hematopoetic cell-specific microRNA target elements remained unaffected. Induction of higher levels of miR-1, miR-133, and miR-206 in muscle cells amplified this effect. These results demonstrate that the incorporation of microRNA target elements into the viral genome provides an effective approach by which tissue tropism of oncolytic viruses can be altered.

Materials and Methods

Cell culture, transfections, and lentiviral vector production. HeLa, L6, TE-671, C2C12, 293T, and 3T3 cells were obtained from American Type Culture Collection and were maintained in DMEM supplemented with 10% FBS (also referred to as Growth Medium) in 5% CO2. Cells were differentiated in DMEM supplemented with 2% horse serum for four days. Transfections were performed using the Promega (Madison, Wis.) Calcium Phosphate ProFection mammalian Transfection System with a total of 3 μg of DNA per well in a six-well plate. Briefly, cells were transfected at 24 hours after being plated in 2 mL of medium at 0.25×106 cells/well. Cells were harvested or used for immunofluorescence 72 hours after transfection. Lentiviral vectors were obtained by transfection of 10 μg of each lentiviral transfer plasmid (pHR-sin-CSGW dlNot1 or pHR-sin-F.Luc) provided by Y. Ikeda and lentiviral packaging plasmid (CMV ΔR8.91), and 3 μg VSV-G packaging construct pMD.G in a T75 flask. Supernatant was harvested at 72 hours post transfection, and filtered through a 0.45 micron syringe filter.

Plasmid Construction. microRNA sequences were obtained from the Sanger Institute miRBase database (internet site “microrna.sanger.ac.uk/sequences/”). Oligos were annealed in equimolar amounts in STE Buffer by heating to 94° C. followed by gradual cooling at bench top. Oligos were designed using methods described elsewhere (Brown et al., Nat. Med., 12:585-591 (2006)). The following oligos were used for annealing. The underlined sequences represent microRNA target elements. The annealed oligos were cloned into XhoI/NotI site of pHR-sin-CSGW dlNot1, and lentiviral vectors were produced.

Briefly, four tandem copies of target elements for miR-133 and miR206 were incorporated into the 3′UTR of the lentiviral vector. A hematopoetic cell-specific microRNA target element for miR142-3P was incorporated in the same fashion and used as a control. Two further constructs were generated incorporating two tandem copies of two muscle-specific microRNA target elements (miR1 and miR-133 to form construct miR1/133T, and miR133 and 206 to form miR133/206T; FIG. 6A).

miR133 Sense #1: (SEQ ID NO: 1) 5′-GGCCGCACAGCTGGTTGAAGGGGACCAACGATACAGCTGGTTGAAG GGGACCAAACCGGT-3′ Sense #2: (SEQ ID NO: 2) 5′-ACAGCTGGTTGAAGGGGACCAATCACACAGCTGGTTGAAGGGGACCA AC-3′ Anti-sense #1: (SEQ ID NO: 3) 5′-TTGGTCCCCTTCAACCAGCTGTATCGTTGGTCCCCTTCAACCAGCTG TGC-3′ Anti-sense #2: (SEQ ID NO: 4) 5′-TCGAGTTGGTCCCCTTCAACCAGCTGTGTGATTGGTCCCCTTCAACC AGCTGTACCGGT-3′ miR206 Sense #1: (SEQ ID NO: 5) 5′-GGCCGCCCACACACTTCCTTACATTCCACGATCCACACACTTCCTTA CATTCCAACCGGT-3′ Sense #2: (SEQ ID NO: 6) 5′-CCACACACTTCCTTACATTCCATCACCCACACACTTCCTTACATTCC AC-3′ Anti-sense #1: (SEQ ID NO: 7) 5′-TGGAATGTAAGGAAGTGTGTGGATCGTGGAATGTAAGGAAGTGTGTG GGC-3′ Anti-sense #2: (SEQ ID NO: 8) 5′-TCGAGTGGAATGTAAGGAAGTGTGTGGGTGATGGAATGTAAGGAAGT GTGTGGACCGGT-3′ miR1/133 Sense #1: (SEQ ID NO: 9) 5′-GGCCGCTACATACTTCTTTACATTCCACGATTACATACTTCTTTACA TTCCAACCGGT-3′ Sense #2: (SEQ ID NO: 10) 5′-ACAGCTGGTTGAAGGGGACCAATCACACAGCTGGTTGAAGGGGACC AAC-3′ Anti-sense #1: (SEQ ID NO: 11) 5′-TGGAATGTAAAGAAGTATGTAATCGTGGAATGTAAAGAAGTATGTA GC-3′ Anti-sense #2: (SEQ ID NO: 12) 5′-TCGAGTTGGTCCCCTTCAACCAGCTGTGTGATTGGTCCCCTTCAACC AGCTGTACCGGT-3′ miR133/206 Sense #1: (SEQ ID NO: 13) 5′-GGCCGCACAGCTGGTTGAAGGGGACCAACGATACAGCTGGTTGAAGG GGACCAAACCGGT-3′ Sense #2: (SEQ ID NO: 14) 5′-CCACACACTTCCTTACATTCCATCACCCACACACTTCCTTACATTCC AC-3′ Anti-sense #1: (SEQ ID NO: 15) 5′-TTGGTCCCCTTCAACCAGCTGTATCGTTGGTCCCCTTCAACCAGCTG TGC-3′ Anti-sense #2: (SEQ ID NO: 16) 5′-TCGAGTGGAATGTAAGGAAGTGTGTGGGTGATGGAATGTAAGGAAGT GTGTGGACCGGT-3′ miR142-3p Sense #1: (SEQ ID NO: 17) 5′-GGCCGCTCCATAAAGTAGGAAACACTACACGATTCCATAAAGTAGGA AACACTACAACCGGT-3′ Sense #2: (SEQ ID NO: 18) 5′-TCCATAAAGTAGGAAACACTACATCACTCCATAAAGTAGGAAACACT ACAC-3′ Anti-sense #1: (SEQ ID NO: 19) 5′-TGTAGTGTTTCCTACTTTATGGAATCGTGTAGTGTTTCCTACTTTAT GGAGC-3′ Anti-sense #2: (SEQ ID NO: 20) 5′-TCGAGTGTAGTGTTTCCTACTTTATGGAGTGATGTAGTGTTTCCTAC TTTATGGAACCGGT-3′

Luciferase assays and flow cytometry. 2.5×105 cells were plated in 6 well plates with DMEM+10% FBS and infected with HIV-based lentiviral vectors containing a luciferase gene. 72 hours post transfection, half of the cells were harvested for flow cytometry, and the remaining half were used for a luciferase assay. For the luciferase assay, cells were lysed in 1 percent triton-X 100 in PBS. Luciferase levels were quantified using the TopCount microplate luminescence counter. Cells for flow cytometry were fixed in 4 percent paraformaldehyde in PBS, washed, and resuspended in PBS+2 percent FBS, and GFP was quantified using a Becton Dickinson FACScan flow cytometer. Flow data was analyzed using the BD CellQuest Software.

Results

Muscle microRNA target element incorporation suppresses transgene expression in muscle cells. A total of five cell lines were used to test the constructed microRNA target element-tagged lentiviral vectors. The human cell lines H1-HeLa and 293T, along with the mouse cell line 3T3 were used as controls as they are not of muscle origin, while the human rhabdomyosarcoma line TE671 and the rat myoblast line L6 were used as muscle cells expressing miR-1, miR-133, and miR-206 (Anderson et al., Nucleic Acids Res., 34:5863-5871 (2006)). Cell lines were transduced with lentiviral vectors expressing muscle or control microRNA target elements in the 3′UTR of GFP and a control containing a non-tagged luciferase encoding vector (FIG. 6B). Flow cytometry analysis revealed marked inhibition of GFP expression specifically in muscle cells in vectors containing target elements for miR-206 and a combination of target elements of both miR-133 and miR-206. Luciferase assay results indicated that this effect was directed only towards those transgenes containing muscle-specific microRNA target elements as luciferase expression remained constant in all cells (FIGS. 7, 9, and 10-18).

Increased microRNA expression results in increased microRNA target element-mediated suppression. To determine if the microRNA-mediated silencing can be enhanced by a more robust expression of muscle specific microRNAs, cells were cultured in the presence of differentiation medium, which can increase expression of muscle-specific microRNAs (Anderson et al., Nucleic Acids Res., 34:5863-5871 (2006)). By increasing the expression of microRNAs, the number of RNA-Induced Silencing Complexes (RISCs) is potentially greatly increased as is the potential for overcoming the effect of saturation of the microRNA pathway, should such a saturation occur. When cultured in the absence of FBS and in the presence of horse serum, microRNA-mediated silencing of GFP expression increased by about 1.5 and 3 fold in TE671 and L6 cells, respectively (FIGS. 8 and 9).

Taken together, the results provided herein demonstrate that target elements for tissue-specific microRNAs can be incorporated into viral nucleic acid to control virus stability, viral replication, and viral gene expression. By incorporating target elements for tissue-specific microRNAs into the genome of a virus, one can modulate the stability of not only viral transcripts, but also the actual template from which transcripts are derived.

Example 7 microRNA Regulated CVA21

MicroRNAs are emerging as new potent and active cellular regulators. To show that naturally occurring and differentially expressed miRNAs can be exploited to modulate the tropism of a replicating virus, an miRNA-regulated CVA21 was constructed. Two copies each of the target sequences coding for miR-133 and miR-206 were inserted in the 3′NTR of CVA21.

Materials and Methods

Recombinant CVA21 construction. The following sequences were cloned into the 3′NTR of pGEM-CVA21 (obtained from Matthias Gromeier) in between by 7344/7345 by overlap extension PCR. As indicated above, miR-142 3pT is a hematopoeitic cell specific control, while miR133T, miR206T, miR133/206T are muscle specific.

(SEQ ID NO: 80) TCCATAAAGTAGGAAACACTACACGATTCCATAAAGTAGGAAACACTACA CTGGAGTCCATAAAGTAGGAAACACTACATCACTCCATAAAGTAGGAAAC ACTACA (miR-142 3pT) (SEQ ID NO: 81) ACAGCTGGTTGAAGGGGACCAACGATACAGCTGGTTGAAGGGGACCAACT GGAGACAGCTGGTTGAAGGGGACCAATCACACAGCTGGTTGAAGGGGACC AA (miR 133T) (SEQ ID NO: 82) CCACACACTTCCTTACATTCCACGATCCACACACTTCCTTACATTCCACT GGAGCCACACACTTCCTTACATTCCATCACCCACACACTTCCTTACATTC CA (miR 206T) (SEQ ID NO: 83) ACAGCTGGTTGAAGGGGACCAACGATACAGCTGGTTGAAGGGGACCAACT GGAGCCACACACTTCCTTACATTCCATCACCCACACACTTCCTTACATTC CA (miR 133/206T)

Virus and Viral RNA production. Viral RNA was produced using Ambion Megascript and Megaclear T7 polymerase kit according to the manufacturer's instructions. One μg RNA/well was transfected into H1-HeLa cells in 12 well plates using the Minis (Madison, Wis.) TranIT®-mRNA transfection reagent. After incubating for 24 hours, wells were scraped and cell pellets harvested. Cell pellets were subjected to three freeze/thaw cycles in liquid N2, cell debris was cleared by centrifugation, and the resulting cleared lysate was added to H1-HeLa cells in a T-75 flask. For CVA21 miRT, three passages were required to obtain suitable titers of virus.

CVA21 Titration. Titration of CVA21 was performed on H1-HeLa cells. Cells were plated in 96 well plates at 50% confluence. After 24 hours, serial ten-fold dilutions (−2 to −10) were made of the virus; 100 μL of each dilution were added to each of eight duplicate wells. Following incubation at 37° C. for 72 hours, wells were fixed and stained (0.1% crystal violet, 20% methanol, 4% paraformaldehyde). Wells then were assessed for CPE manifest as non-staining areas devoid of viable cells. If purple staining cells were seen on 75% or less of the well surface, then the well was scored positive. TCID50 values were determined using the Spearman and Kärber equation.

One Step Growth Curves. Each cell line was incubated with CVA21 at a MOI (multiplicity of infection) of 3.0 for 2 hours at 37° C. Following this incubation, cells were centrifuged, and unincorporated virus was removed. Cells were resuspended in fresh growth media at predetermined time-points (2, 4, 6, 18, 12, 24, hours), cells pellets were harvested and frozen at −80° C. At the completion of all time-points, the cell pellets were thawed. Cell debris was cleared from each cell pellet by centrifugation to provide a cleared cell lysate fraction.

miRNA mimics. miRNA mimics were purchased from Dharmacon, Inc. (Lafayette, Colo.). The control miRNA mimic corresponded to a C. elegans miRNA with no predicted miRTs in mammalian cells. miRNA mimics were transfected with Mims TranIT®-mRNA transfection reagent at a 200 nM concentration. Four hours post mimic transfection, cells were infected with WT, miRT, or RevT CVA21 at MOI=1.0. After 24 hrs. post infection, cells were harvested for an MTT viability assay and supernatant was harvested for titration.

In Vivo Experiments. CB17 ICR-SCID mice were obtained from Harlan (Indianapolis, Ind.). Mice were irradiated and implanted with 5e6 Kas 6/1 or MeI 624 cells in the right flank. When tumors reached an average of 0.5×5 cm, tumors were treated with 1e6 CVA21. Tumor volume was measured using a hand held caliper and blood was collected by retroorbital bleeds. Histological and pathological analysis of mice was performed by Mayo Clinic Scottsdale Research Histology after terminal perfusion with 4% paraformaldehyde.

Results

Two copies each of the target sequences coding for miR-133 and miR-206 were inserted in the 3′NTR of CVA21 (see FIG. 33A). The miRT virus was rescued by RNA transfection in H1-HeLa cells and its replication kinetics were compared with those of the parental WT strain of CVA21. As shown in FIGS. 33B, 33C and 33D, the growth kinetics of these two viruses are indistinguishable on H1-HeLa, Mel-624 and Kas 6/1 cells and did not differ from the growth of a control virus (RevT) carrying a control insert in the 3′NTR (see below).

To determine whether the lytic effects of the miRT CVA21 recombinant virus could be controlled by muscle-specific miRNAs, CVA21-susceptible H1-HeLa cells were infected with test and control viruses (moi=1.0) after first transfecting them with microRNA mimics corresponding to miR-133, 206, or with a control mimic corresponding to a C. elegans miRNA that has no identified target in mammalian cells. Mimics of miR-133 or miR-206 each partially protected the H1-HeLa cells from viral lysis by miRT CVA21 with miR-206 providing greater protection than miR-133. When cells were exposed simultaneously to both of the muscle specific miRNA mimics, they appeared to be fully resistant to the retargeted virus such that cell viability was not significantly different from mock infected cells (p=0.49) (FIG. 33F).

To determine whether propagation of the miRT CVA21 virus was efficiently blocked by the muscle-specific microRNAs in a sequence-specific manner, the supernatant virus titers also were measured in this experiment. Virus titers in the supernatants of cells infected with miRT CVA21 were substantially decreased by miR-133 (two log reduction) or miR-206 (three log reduction) when the mimics were applied individually, but were decreased to undetectable levels (>five log reduction) in the presence of both muscle-specific mimics (FIG. 33G). It also was confirmed that cells could be significantly protected by endogenously encoded miRNAs by transfecting infectious RNA for WT and miRT CVA21 in H1-HeLa or the muscle cell line TE-671. As shown in FIG. 33H, endogenously encoded and expressed miRNAs significantly protected muscle cells from cytopathic effects of miRT CVA21 (p<0.01).

To investigate if miRT CVA21 retained oncolytic in vivo efficacy and if it provided a protection phenotype against fatal myositis, immunodeficient mice carrying subcutaneous xenografts derived from human myeloma or melanoma cell lines were infected (FIG. 34A-C, FIG. 35A-D, FIG. 36A-C). Mice carrying established subcutaneous tumors were treated with a single intratumoral dose of 106 TCID50 of each virus and monitored for tumor growth and survival. WT treated animals had quick and in some cases complete tumor regression, but all developed generalized muscle paralysis and were euthanized in less than 15 days. Animals treated with the miRT virus, however, had slow but eventually complete tumor regression and significantly increased survival as compared to WT treated animals (FIG. 34D) (p<0.001).

Histological analysis of muscle tissue in mice treated with WT virus again showed massive infiltration and necrosis while animals treated with miRT virus were rescued from this phenotype. Though survival was statistically significant (p<0.001 vs control and WT CVA21), a small number of mice developed tremors and labored breathing and, in 2 cases, paralysis and were euthanized (FIG. 34D). Pathologic examination of these mice indicated that this was symptomatic of a polio-like myelitis rather than myositis. To determine if this was caused by a persistant viremia that may have allowed a retrograde axonal transport of the virus to occur, viral titers present in mouse serum were examined.

Serum collected from all mice was analyzed at two-week intervals after CVA21 treatment. Mice treated with miRT CVA21 had initial high level viremia, consistent with the viremia seen in WT CVA21 treated animals (FIG. 34F). In some animals, this viremia persisted enabling the analysis of the stability of the miRT insert. Though RNA interference against vertebrate viruses is not generally accepted as naturally occurring by microRNA targets encoded within viral genomes, the results show that engineered microRNA targets in viruses are capable of regulation by miRNA primed RNAi machinery.

To the essence of whether vertebrate viruses evolved to avoid miRTs within their viral genomes and to test if insertion of miRTs can provide a long-term means of targeting, stability of the insertions was examined 45 days after virus administration (FIG. 34G). Because of the nature of the replication cycles of both Kas 6/1 myeloma cells and CVA21, there is an assurance of a high amount of viral turnover. This, combined with the high error rate of RNA-dependent RNA polymerases provided opportunity for the virus to mutate the inserted sequence. In animals that had viremia, 6/11 animals maintained 100% sequence identity with the original sequence; 3 animals had >80% sequence homology with the inserted miRTs, 1 animal retained only 68% of the inserted target, and one animal had limited sequence retention (RevT). All animals maintained perfect homology in the flaking 3Dpol and 3′NTR sequence to the WT virus. Though there was a significant amount of target retention in this experiment, the terminal point in this study was 70 days, at which point the major substrate for viral replication (hsICAM-1 positive Kas 6/1 cells) in mice was no longer present. To address the possibility that the altered in vivo host range properties of the miRT virus might be a nonspecific consequence of placing a 100 base insert into its 3′UTR, the RevT virus (so called because of the revertant phenotype it displayed in mice) was characterized. This virus carries a 3′NTR insert with the identical insertion site to the microRNA targeted virus, but retains only minimal homology to the original microRNA target sequence (FIG. 37B). The RevT insert was cloned into the lentiviral GFP reporter vector (FIG. 37A) and demonstrated that it was unable to mediate muscle cell-specific silencing of lentiviral gene expression (FIG. 37C). Finally, the RevT virus was administered by intratumoral inoculation to mice bearing large subcutaneous KAS6/1 myeloma xenografts, at the same time treating control groups of mice with the wild type and microRNA retargeted viruses. As shown in FIG. 34E and FIG. 35, the in vivo behavior of the RevT virus was indistinguishable from that of the wild type virus. All RevT-challenged animals died within 14 days of virus administration from severe, generalized myositis. These in vivo results confirm and extend the conclusion of the in vitro studies: that the host range of a pathogenic RNA virus can be controlled by cellular microRNAs.

Other Embodiments

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. A method for treating cancer present in a mammal, wherein said method comprises administering, to said mammal, an effective amount of nucleic acid coding for a picornavirus under conditions wherein cancer cells present within said mammal undergo cell lysis as a result of synthesis of picornavirus from said nucleic acid, thereby reducing the number of viable cancer cells present within said mammal.

2. The method of claim 1, wherein said mammal is a human.

3. The method of claim 1, wherein said effective amount is between about 3×1010 and about 3×1014 virus genome copies.

4. The method of claim 1, wherein said picornavirus is a coxsackievirus.

5. The method of claim 1, wherein said cancer cells are myeloma, melanoma, or breast cancer cells.

6. The method of claim 1, wherein said nucleic acid comprises a microRNA target element comprising at least a region of complementary to a microRNA present in non-cancer cells.

7. The method of claim 6, wherein a reduced number of non-cancer cells present within said mammal undergo cell lysis as compared to the number of non-cancer cells that would undergo cell lysis when said nucleic acid lacks said microRNA target element.

8. The method of claim 6, wherein said microRNA is a tissue-specific microRNA.

9. The method of claim 6, wherein said microRNA is a muscle-specific, brain-specific, or heart-specific microRNA.

10. An isolated nucleic acid coding for a virus and comprising a microRNA target element having at least a region that is complementary to at least a region of a microRNA present in non-cancer cells and that is heterologous to said virus.

11. The isolated nucleic acid of claim 10, wherein said virus is a picornavirus.

12. The isolated nucleic acid of claim 10, wherein said virus is a coxsackievirus.

13. The isolated nucleic acid of claim 10, wherein said virus is a poliovirus.

14. The isolated nucleic acid of claim 10, wherein said microRNA is a tissue-specific microRNA.

15. The isolated nucleic acid of claim 10, wherein said microRNA is a muscle-specific, brain-specific, or heart-specific microRNA.

16. An isolated nucleic acid coding for a virus and comprising a microRNA target element having at least a region that is complementary to at least a region of a cancer-specific microRNA and that is heterologous to said virus.

17. The isolated nucleic acid of claim 16, wherein said nucleic acid, when administered to a mammal having cancer, is expressed in cancer cells.

18. The isolated nucleic acid of claim 16, wherein expression of said nucleic acid is restricted to cancer cells containing said cancer-specific microRNA when said nucleic acid is administered to a mammal having cancer.

19. A method of assessing coxsackievirus-mediated cell lysis of non-cancer cells, wherein said method comprises:

(a) administering nucleic acid coding for a coxsackievirus to a mammal, and
(b) determining whether or not said mammal develops myositis, paralysis, or death, wherein the presence of said myositis, paralysis, or death indicates that said nucleic acid causes coxsackievirus-mediated cell lysis of non-cancer cells, and wherein the absence of said myositis, paralysis, and death indicates that said nucleic acid lacks significant coxsackievirus-mediated cell lysis of non-cancer cells.

20. The method of claim 19, wherein said mammal is a mouse.

21. The method of claim 19, wherein said nucleic acid comprises a microRNA target element that is complementary to a microRNA present in non-cancer cells and that is heterologous to said coxsackievirus.

22. The method of claim 21, wherein said microRNA is a tissue-specific microRNA.

23. The method of claim 21, wherein said microRNA is a muscle-specific microRNA.

Patent History
Publication number: 20100111873
Type: Application
Filed: Feb 20, 2008
Publication Date: May 6, 2010
Inventors: Stephen J. Russell (Rochester, MN), Elizabeth J. Kelly (Rochester, MN), Elizabeth M. Hadac (Oronoco, MN)
Application Number: 12/528,047
Classifications
Current U.S. Class: Testing Efficacy Or Toxicity Of A Compound Or Composition (e.g., Drug, Vaccine, Etc.) (424/9.2); 514/44.00R; N-glycosides, Polymers Thereof, Metal Derivatives (e.g., Nucleic Acids, Oligonucleotides, Etc.) (536/22.1)
International Classification: A61K 49/00 (20060101); A61K 31/7052 (20060101); C07H 21/00 (20060101); A61P 35/00 (20060101);