METHODS AND COMPOSITIONS FOR THE INHIBITION OF HIV-1 REPLICATION
This invention relates to methods and compositions for the attenuation of HIV-1 replication in human cells, and especially in human macrophages. The invention particularly concerns the use of inhibitors of P21 (CDKNIA) expression to attenuate such replication. The invention particularly concerns the use of antisense P21 oligonucleotides, siRNA and/or 2-cyano-3,12-dioxooleana-1,9-dien28-oic (CDDO) to attenuate such replication.
This application claims priority to U.S. Patent application Ser. No. 60/516,734 (filed on Nov. 4, 2004), which application is herein incorporated by reference.
STATEMENT OF GOVERNMENTAL INTERESTThis invention was funded by the National Institutes of Health, Department of Health and Human Services. The United States Government has certain rights to this invention.
FIELD OF THE INVENTIONThis invention relates to methods and compositions for the attenuation of HIV-1 replication in human cells, and especially in human macrophages. The invention particularly concerns the use of inhibitors of P21 (CDKN1A) expression to attenuate such replication. The invention particularly concerns the use of antisense P21 oligonucleotides and/or 2-cyano-3,12-dioxooleana-1,9-dien-28-oic (CDDO) to attenuate such replication.
BACKGROUND OF THE INVENTIONHuman immunodeficiency virus-1 (HIV-1) is the causative agent of acquired immune deficiency syndrome (AIDS) and related disorders (Gallo, R. C. et al. (1983) “Isolation of human T-cell leukemia virus in acquired immune deficiency syndrome (AIDS),” Science 220(4599):865-7; Barre-Sinoussi, F. et al. “I
T lymphocytes and macrophages expressing CD4 and the seven transmembrane chemokine co-receptors CXCR4 and CCR5 are susceptible to HIV-1 infection (Berger, E. A. at al. (1999) “C
The persistence of HIV during highly active antiviral therapy, and poor susceptibility of macrophages to antiviral therapy (Igarashi, T. at al. (2001) “M
Attempts to treat HIV infection have focused on the development of drugs that disrupt the viral infection and replication cycle (see, Mitsuya, H. at al. (1991) “T
Unfortunately, although considerable effort has been expended to design effective therapeutics, no curative anti-retroviral drugs against AIDS currently exist. All available therapies are marred by substantial adverse side effects, and by the capacity of HIV to rapidly mutate into forms that are refractive to treatment (Miller, V. et al. (2001) “M
By monitoring virus production by multiple parameters including RNA, p24 antigen expression and ultra-structural detection of viral particles it has been possible to characterize the temporal events associated with the initial virus-macrophage encounter leading to massive viral replication. In parallel, macrophage changes in gene expression subsequent to virus-receptor interaction have been compared to uninfected cells by cDNA expression array. Analysis of 1200 genes at multiple intervals from initial HIV-1 binding through levels of massive replication (10-14 days) reveals a profile of gene modulation, which favored virus life cycle, and could influence recruitment and infection of additional HIV-1 host cells. One gene found to be consistently expressed following virus binding and re-expressed at the peak of HIV-1 replication is CDKN1A, also known as p21, Cip1 (Cdk interacting protein), or Waf1 (wild type p53-activated fragment), a protein associated with cell cycle regulation, anti-apoptotic response and cell differentiation (Dotto, G. P. (2000) “
In contrast to CD4+ lymphocytes, HIV-1 infected macrophages typically resist cell death, support viral replication, and facilitate HIV-1 transmission. To elucidate how the virus commandeers macrophage intracellular machinery for its benefit, HIV-1 infected human monocyte-derived macrophages have been analyzed for viral-induced gene transcription by cDNA expression array. HIV-1 infection induces the transcriptional regulation of genes associated with host defense, signal transduction, apoptosis and cell cycle, including cyclin-dependent kinase inhibitor p21. CDKN1A/p21 expression follows a bimodal pattern with maximum levels occurring during HIV-1 replication. Treatment of macrophages with p21 anti-sense oligonucleotides or siRNA directed against p21 inhibits HIV-1 replication. Furthermore, the synthetic triterpenoid and peroxisome proliferator-activated receptor gamma (PPARg) ligand, 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO), which influences p21 expression, drives a dose dependent suppression of viral replication. These data implicate p21 as a pivotal macrophage facilitator of viral replication. Moreover, regulators of p21; such as CDDO, provide an interventional approach to modulate HIV-1 replication.
This invention thus relates to methods and compositions for the attenuation of immunodeficiency virus replication in cells, and especially in macrophages. The invention particularly concerns the use of inhibitors of P21 (CDKN1A) expression to attenuate such replication. The invention particularly concerns the use of antisense P21 oligonucleotides, siRNA and/or 2-cyano-3,12-dioxooleana-1,9-dien-28-oic (CDDO) to attenuate such replication. The invention finds use in the treatment of AIDS, and in the treatment of lymphoma, especially in HIV-infected individuals.
In detail, the invention concerns a method of attenuating the transmission or infection of an immunodeficiency virus into a cell comprising providing to the cell an inhibitor of p21, wherein the inhibitor is provided in an amount and duration sufficient to cause an attenuation of at least 50% in the transmission or infection of the virus relative to an untreated cell. The invention particularly concerns the embodiments of such method wherein the immunodeficiency virus is a human immunodeficiency virus (HIV), and the cell is a human cell; wherein the immunodeficiency virus is a feline immunodeficiency virus (FIV), and the cell is a feline cell; or wherein the immunodeficiency virus is a simian immunodeficiency virus (SIV), and the cell is a simian cell.
The invention further provides a method of treating AIDS in an individual, comprising providing to HIV-1 infected cells of said individual an amount of a p21 inhibitor sufficient to attenuate the propagation of HIV, wherein said inhibitor is provided in an amount and duration sufficient to cause an attenuation of at least 50% in said propagation of HIV relative to untreated cells.
The invention particularly concerns the embodiments of such methods wherein the inhibitor of p21 is a polynucleotide, and especially wherein the polynucleotide is complementary to a portion of a p21 gene or p21 cDNA molecule.
The invention particularly concerns the embodiments of such methods wherein the p21 gene or p21 cDNA is of a human p21 gene or p21 cDNA molecule, or of a non-human animal or is a variant of a non-human p21 gene or p21 cDNA molecule.
The invention further concerns a method of treating AIDS in an individual, comprising providing to HIV-1 infected cells of the individual, or providing to HIV-1 susceptible cells of the individual prior to the infection of such cells by HIV-1, an amount of a p21 inhibitor sufficient to attenuate the propagation of HIV, wherein the inhibitor is provided in an amount and duration sufficient to cause an attenuation of at least 50% in the propagation of HIV relative to untreated cells.
The invention particularly concerns the embodiments of such methods wherein the polynucleotide comprises at least 10 contiguous nucleotides of SEQ NO.:4 (and in particular wherein the polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:8 or SEQ ID NO.:10) or at least 10 contiguous nucleotides of SEQ ID NO.:6 (and in particular wherein the polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:7 or SEQ NO.:9).
The invention further concerns the embodiments of the above methods wherein the inhibitor of p21 is a protein or organic molecule other than a polynucleotide, and in particular concerns the embodiment of such method wherein the inhibitor is 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO), or a salt or derivative thereof.
The invention further concerns a pharmaceutical composition comprising an inhibitor of p21 and an excipient or carrier, wherein the inhibitor is present in an amount sufficient to attenuate the propagation of HIV, wherein the inhibitor is present in the composition in an amount sufficient to cause an attenuation of at least 50% in the propagation of HIV relative to untreated cells.
The invention particularly concerns the embodiments of such composition wherein the inhibitor of p21 is a polynucleotide, and especially wherein the polynucleotide is complementary to a portion of a p21 gene or p21 cDNA molecule. The invention particularly concerns the embodiments of such compositions wherein the p21 gene or p21 cDNA is of a human p21 gene or p21 cDNA molecule, or of a non-human animal or is a variant of a non-human p21 gene or p21 cDNA molecule. The invention further particularly concerns an inhibitor of an upstream or downstream modulator of p21 production or action (i.e., a p21 inhibitor molecule.
The invention further particularly concerns the embodiments of such compositions wherein the polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:4 (and in particular wherein the polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:8 or SEQ ID NO.:10) or at least 10 contiguous nucleotides of SEQ ID NO.:6 (and in particular wherein the polynucleotide comprises at least 10 contiguous nucleotides of SEQ NO.:7 or SEQ ID NO.:9).
The invention further concerns the embodiments of the above compositions wherein the inhibitor of p21 is a protein or organic molecule other than a polynucleotide, and in particular concerns the embodiment of such method wherein the inhibitor is 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO), or a salt or derivative thereof.
The present invention relates to methods and compositions for the attenuation of HIV-1 replication in human cells, and especially in human macrophages. As used herein, such “attenuation” is preferably of a magnitude sufficient to mediate a reduction of at least 50%, more preferably 60%, most preferably 80%, or greater in the replication, propagation or transmission of HIV.
The present invention derives in part from the recognition that the replication of human cells has been found to be tightly coordinated by the expression and interaction of an array of cell cycle regulatory proteins. Any of the genes described herein that are induced by HIV-1 are potentially able to serve as tagets for achieving the inhibition of HIV-1. CDKN1A, also known as p21Cip1 (Cdk interacting protein), or Waf1 (wild type p53-activated fragment), is one of these proteins (Dotto, G. P. (2000) “p21(WAP1/C
HIV-1 and p21 are discussed in U.S. Pat. Nos. 6,359,124; 5,965,722; 5,889,156; 6,548,657; 6,511,847; 6,489,163; 6,410,010; 6,379,965; 6,204,248; 6,133,444; 6,069,134; 5,866,698; 5,861,290; 5,834,440; 5,795,870; 5,766,882; 5,747,469; and 5,693,769.
Although macrophages express the requisite CD4 and chemokine co-receptors making them susceptible targets, and R5 viral variants are preferentially transmitted, it has remained a challenge to identify HIV-1 positive macrophages early after viral exposure in mucosal tissues (Schacker, T. et al. (2001) “P
One aspect of the present invention relates to the recognition that HIV-1 infection stimulates the expression of p21 (CDKN1A) protein in human macrophages (Vazquez, N. et al. (October 2002) “HIV-1 Enhancement of CDKN1A (p21) in Human Macrophages Is Associated with Viral Replication,” 5th Intl. Workshop on HIV, Cells of Macrophage/Dendritic Lineage and Other Reservoirs, Rome, Italy).
The Vpr gene product of HIV-1 has been found to prevent cell proliferation by activating p21 expression, suggesting that the upregulation of p21 by HIV-1 Vpr may have important consequences in HIV-1 pathogenesis (Chowdhury I. H. et al. (2003) “HIV-1 V
Additionally, Clark, E. et al. disclosed that the treatments (such as gamma irradiation) that cause a loss of cell cycle control at the G1/S checkpoint cause HIV-1 infected cells to lose p21 function, and undergo apoptosis (Clark E et al. (2000) “L
Antisense oligonucleotides of p21 have been used to affect cell-cycle transit in astrocytoma cells. (Jinbo Liu, et al. (2000) “A
The present invention thus particularly concerns the use of one or more p21 inhibitors to prevent or attenuate the infection of additional host cells, and as such to provide a therapy for AIDS and its simian and feline counterparts.
As used herein, the term “p21 inhibitor” is intended to denote any of a variety of molecules that function to suppress or prevent p21 activity. Such inhibitors can be, for example, transcriptional inhibitors, such as promoter blockers, RNAi molecules, antisense polynucleotides of the p21 gene or cDNA, or allelic or non-human species variants thereof. Alternatively, such molecules can comprise translational inhibitors of p21, molecules that inhibit or otherwise interfere with p21 function, etc.
As used herein, an allelic variant of a p21 polynucleotide is a polynucleotide having the sequence of a naturally occurring allele of the p21 gene or cDNA thereof, or of a non-naturally occurring polynucleotide that is 80% homologous, and more preferably 90% homologous, and most preferably comprises a sequence that has at least 10, and more preferably, at least 20 contiguous nucleotides that are identical in sequence to a portion of a naturally occurring p21 gene or cDNA. Examples of such sequences include NCBI accession Nos. BC000312 and BC013967. As used herein, a non-human species variant of a p21 polynucleotide is a polynucleotide having the sequence of the p21 gene or cDNA of a non-human animal, for example a mouse or rat. Examples of such sequences include NM 007669 and U24174.
Antisense molecules suitable for use in the present invention can be identified as polynucleotide molecules having a length of 10-250, or more preferably 10-150, and most preferably, 10-100 nucleotides that are complementary to a portion of SEQ ID NO.:3 (the human p21 gene, see Xiong, Y. et al. (1993) “
Preferred p21 inhibitors of the present invention thus include polynucleotide fragments of SEQ ID NO: 4 (the antisense complement of SEQ ID NO.:3), or allelic or non-human species variants thereof:
The murine p21 sequence is provided below:
The antisense murine p21 sequence is provided below:
Of particular interest are antisense oligonucleotides that have a nucleotide sequence of 10, and more preferably 20, nucleotides within the sequence 1751-1850 or 1351-1450 of SEQ ID NO.:6, or of variants or fragments thereof that possess the ability to inhibit p21 expression and/or HIV replication or transmission. Such variants include oligonucleotides that are complementary to a corresponding region of the human p21 gene, or to non-human homologs as well as oligonucleotides that are composed of at least 10 of the nucleotide residues of 1751-1850 or 1351-1450 of SEQ ID NO.: 6. As an example, SEQ ID NO.:7: 5′-TGTCAGGCTGGTCTGCCTCC-3′, is an antisense oligonucleotide of SEQ ID NO.: 6 (shown underlined in SEQ ID NO.: 6) that possesses the ability to inhibit p21 expression and/or HIV replication or transmission. An example of a variant of this sequence is the corresponding sequence of the human p21 antisense sequence: SEQ ID NO. 8: TGTCATGC TGGTCTGCCG CC, shown underlined in SEQ ID NO.:4).
As a further example, the antisense oligonucleotide, SEQ ID NO. 9: 5′-ACATCACCAGGATTGGACAT-3′, is fragment of SEQ ID NO.: 6 (shown double underlined in SEQ ID NO.: 6) that possesses the ability to inhibit human p21 expression and/or HIV replication or transmission. An example of a variant of this sequence is the corresponding sequence of the human p21 antisense sequence: SEQ ID NO. 10: ACATCCCCAGCCGGTTCTGACAT, shown double underlined in SEQ ID NO.:4).
Additional examples of preferred p21 inhibitors of the present invention include polynucleotide fragments of SEQ ID NO.: 11 (the antisense complement of the promoter region of the p21 gene (SEQ ID NO.:12)) or allelic or non-human species variants thereof, as well as promoter blockers, and other transcriptional or translational repressors of the p21 gene.
Additional examples of preferred p21 inhibitors of the present invention include protein and other non-polynucleotide inhibitors of transcription, translation of the p21 gene, inhibitory p21 mimetics, or inhibitors of the transport or processing of the expressed p21 gene product (SEQ ID NO.: 13).
Preferred inhibitors thus include triterpenoids, especially oleanane triterpenoids, and particularly the oleanane triterpenoid 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO), and analogs thereof (see, for example, Stadheim, T. A. et al. (2002) “T
Molecules that inhibit or otherwise interfere with p21 function include binding ligands of p21 protein, including antibodies, or fragments thereof that bind to p21 protein. Suitable antibodies may be derived from human antisera, from non-human mammalian origin, or may be monoclonal, recombinant, single-chain, or humanized. Antigen-binding fragments of such antibodies (e.g., Fab and F(ab)2 fragments) may alternatively be employed. If desired, such administration can be provided in concert with other p21 inhibitors.
COMPOSITIONS OF THE PRESENT INVENTIONIn one embodiment of the present invention, non-polynucleotide p21 inhibitors may be employed. Alternatively, or conjunctively, one or more of the above-described p21 inhibitor molecules will comprise a polynucleotide or polynucleotide construct that may be administered to a recipient prior to the commencement of HIV infection, or subsequent to the onset of such infection. In accordance with the methods of the present invention, a single polynucleotide, polynucleotide construct, or composition comprising a polynucleotide or polynucleotide construct containing more than one polynucleotide sequence encoding one or more molecules may be administered. Alternatively, more than one polynucleotide, polynucleotide construct, or composition comprising a polynucleotide or polynucleotide construct; each containing polynucleotide sequences encoding one or more molecules may be co-administered or sequentially administered.
The p21 inhibitor compound(s) of the present invention may be provided to recipients using the principles of genetic therapy or as pharmaceutical compositions.
In accordance with the principles of genetic therapy, the compositions of the present invention will comprise one or more nucleic acid molecules (preferably DNA molecule(s)) that encode p21-inhibitor compound(s). Preferably, such nucleic acid Molecules will be incorporated into a recombinant expression vector such as a chimeric virus, a plasmid DNA, etc., and will optionally be operatively linked to one or more regulatory elements (promoters, translation initiation sites, etc.) so as to permit the transcription of the nucleic acid molecule in a recipient cell. The promoter may be a cell-specific promoter that directs substantial transcription of the DNA only in predetermined cells. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRS) from retroviruses, e.g., RSV, HTLVI, HIVI, MPSV and the immediate early promoter of the cytomegalovirus (CMV IEP). Alternatively, the administered nucleic acid molecules will not contain such regulatory elements, and will require cellular processes (such as recombination, integration into nuclear or mitochondrial DNA, etc.) in order to produce RNA transcripts.
Suitable DNA virus genomes include herpesvirus genomes, adenovirus genomes, adeno-associated virus genomes, and poxvirus genomes. However, cellular elements can also be used (e.g., the human actin promoter, metallothionein promoter). In humans, CMV IEP is preferred. Suitable expression vectors for use in practicing the present invention include, for example, vectors such as PSVL and PMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109), VR1051, VR1055, and pcDNA3 (Invitrogen, San Diego, Calif.). In a preferred embodiment, such cytomegalovirus (CMV)-derived vectors, such as VRC8100, VRC 8103, VRC8106, VRC 8107, or VRC8108 are employed. All forms of DNA, whether replicating or non-replicating, preferably which do not become integrated into the genome, and which are expressible, are within the methods and compositions contemplated by the invention.
In one embodiment, a polynucleotide or polynucleotide construct of the present invention is RNA. Preferably in this embodiment, the RNA is in the form of messenger RNA (mRNA). Methods for introducing RNA sequences into vertebrate cells is described in U.S. Pat. No. 5,580,859. Alternatively, the RNA may be in the form of an RNA virus genome. Preferably an RNA virus genome of the present invention is noninfectious, (i.e., does not result in the production of infectious virus particles in vertebrate cells). Suitable RNA virus genomes include, but are not limited to, alphavirus genomes, picornavirus genomes, and retrovirus genomes. Methods for the in vivo introduction of non-infectious viral genomes to vertebrate tissues are well known to those of ordinary skill in the art and are described, e.g., in Altman-Harnamdzic, S., et al. (1997) “E
The nucleic acid molecules of such compositions may be single stranded or double-stranded, and may be circular or linear. The term “nucleic acid” is intended to encompass a singular nucleic acid molecule as well as plural nucleic acid molecules, and to refer to an isolated molecule or construct, e.g., virus genomes (preferably non-infectious), messenger RNA (mRNA), plasmid DNA (pDNA), or derivatives of pDNA (e.g., minicircles as described in (Darquet, A-M et al., (1997) “A N
Methods of gene therapy are reviewed by Relph, K. et al. (2004) “R
If the p21 inhibitor compound(s) of the present invention is/are administered as a pharmaceutical composition, such pharmaceutical composition can be formulated according to known methods for preparing pharmaceutical compositions, whereby the substance to be delivered is combined with a pharmaceutically acceptable carrier vehicle, Suitable vehicles and their preparation are described, for example, in Remington's Pharmaceutical Sciences, 16th Edition, A. Osol, Ed., Mack Publishing Co., Easton, Pa. (1980), and Remington's Pharmaceutical Sciences, 19th Edition, A. R. Gennaro, Ed., Mack Publishing Co., Easton, Pa. (1995).
The amount of a polynucleotide or polynucleotide construct or other p21 inhibitor included in such a composition depends on factors including the age and weight of the subject, the delivery method and route, the type of treatment desired, and the type of polynucleotide or polynucleotide construct or other p21 inhibitor being administered. In general, a composition of the present invention that includes polynucleotide or polynucleotide constructs will contain from about 1 ng to about 30 mg of such polynucleotide or polynucleotide construct, more preferably, from about 100 ng to about 10 mg of such polynucleotide or polynucleotide construct. Certain preferred compositions of the present invention may include about 1 ng of such polynucleotide or polynucleotide construct, about 5 ng of such polynucleotide or polynucleotide construct, about 10 ng of such polynucleotide or polynucleotide construct, about 50 ng of such polynucleotide or polynucleotide construct, about 100 ng of such polynucleotide or polynucleotide construct, about 500 ng of such polynucleotide or polynucleotide construct, about 1 μg of such polynucleotide or polynucleotide construct, about 5 ng of such polynucleotide or polynucleotide construct, about 10 μg of such polynucleotide or polynucleotide construct, about 50 μg of such polynucleotide or polynucleotide construct, about 100 μg of such polynucleotide or polynucleotide construct, about 150 μg of such polynucleotide or polynucleotide construct, about 200 μg of such polynucleotide or polynucleotide construct, about 250 μg of such polynucleotide or polynucleotide construct, about 300 μg of such polynucleotide or polynucleotide construct, about 350 μg of such polynucleotide or polynucleotide construct, about 400 μg of such polynucleotide or polynucleotide construct, about 450 μg of such polynucleotide or polynucleotide construct, about 500 μg of a polynucleotide, about 550 μg of such polynucleotide or polynucleotide construct, about 600 μg of such polynucleotide or polynucleotide construct, about 650 μg of such polynucleotide or polynucleotide construct, about 700 μg of such polynucleotide or polynucleotide construct, about 750 μg of such polynucleotide or polynucleotide construct, about 800 μg of such polynucleotide or polynucleotide construct, about 850 μg of a polynucleotide, about 900 μg of such polynucleotide or polynucleotide construct, about 950 μg of such polynucleotide or polynucleotide construct, about 1 mg of such polynucleotide or polynucleotide construct, about 5 mg of such polynucleotide or polynucleotide construct, about 10 mg of such polynucleotide or polynucleotide construct, about 15 mg of such polynucleotide or polynucleotide construct, about 20 mg of such polynucleotide or polynucleotide construct, about 25 mg of such polynucleotide or polynucleotide construct, or about 30 mg of such polynucleotide or polynucleotide construct.
Nucleic acids and/or polynucleotides and/or polynucleotide constructs of the present invention, e.g., plasmid DNA, derivatives of plasmid DNA, mRNA, linear DNA, viral genomes, or polynucleotide fragments contained therein may be formulated into any of the various compositions and may be used in any of the methods disclosed herein. As used herein, the term “polynucleotide fragment” refers to a polynucleotide that is either a portion of a gene, cDNA or RNA molecule, or a complement of such Molecules, and which possesses a length of at least 10 nucleotide residues, at least 15 nucleotide residues, at least 20 nucleotide residues, at least 25 nucleotide residues, at least 35 nucleotide residues, at least 50 nucleotide residues, at least 75 nucleotide residues, at least at least 100 nucleotide residues, at least 150 nucleotide residues, or at least 200 nucleotide residues.
For aqueous compositions used in vivo, use of sterile pyrogen-free water is preferred. Such formulations will contain an effective amount of such polynucleotide or polynucleotide construct together with a suitable salt and/or auxiliary agent as disclosed herein, in order to prepare pharmaceutically acceptable compositions suitable for optimal administration to a vertebrate. Insoluble polynucleotides or polynucleotide constructs may be solubilized in a weak acid or weak base, and then diluted to the desired volume, for example, with an aqueous solution of the present invention. The pH of the solution may be adjusted as appropriate. In addition, a pharmaceutically acceptable additive can be used to provide an appropriate osmolarity.
As used herein a “salt” is a substance produced from the reaction between acids and bases which comprises a metal (cation) and a nonmetal (anion). Salt crystals may be “hydrated” i.e., contain one or more water molecules. Such hydrated salts, when dissolved in an aqueous solution at a certain molar concentration, are equivalent to the corresponding anhydrous salt dissolved in an aqueous solution at the same molar concentration. For the present invention, salts which are readily soluble in an aqueous solution are preferred.
The terms “saline” or “normal saline” as used herein refer to an aqueous solution of about 145 mM to about 155 mM sodium chloride, preferably about 154 mM sodium chloride. The terms “phosphate buffered saline” or PBS″ refer to an aqueous solution of about 145 mM to about 155 mM sodium chloride, preferably about 154 mM sodium chloride, and about 10 mM sodium phosphate, at a pH ranging from about 6.0 to 8.0, preferably at a pH ranging from about 6.5 to about 7.5, most preferably at pH 7.2.
Such compositions of the present invention may include one or more transfection facilitating materials that facilitate delivery of polynucleotides or polynucleotide constructs to the interior of a cell, and/or to a desired location within a cell. Examples of the transfection facilitating materials include, but are not limited to lipids, preferably cationic lipids; inorganic materials such as calcium phosphate, and metal (e.g., gold or tungsten) particles (e.g., “powder” type delivery solutions); peptides, including cationic peptides, targeting peptides for selective delivery to certain cells or intracellular organelles such as the nucleus or nucleolus, and amphipathic peptides, i.e. helix forming or pore forming peptides; basic proteins, such as histories; asialoproteins; viral proteins (e.g., Sendai virus coat protein); pore-forming proteins; and polymers, including dendrimers, star-polymers, “homogenous” poly-amino acids (e.g., poly-lysine, poly-arginine), “heterogenous” poly-amino acids (e.g., mixtures of lysine & glycine), co-polymers, polyvinylpyrrolidinone (PVP), and polyethylene glycol (PEG). Furthermore, those auxiliary agents of the present invention which facilitate and enhance the entry of a polynucleotide or polynucleotide construct into vertebrate cells in vivo, may also be considered “transfection facilitating materials.”
Certain embodiments of the present invention may include lipids as a transfection facilitating material, including cationic lipids (e.g., DMRIE, DOSPA, DC-Chol, GAP-DLRIE), basic lipids (e.g., steryl amine), neutral lipids (e.g., cholesterol), anionic lipids (e.g., phosphatidyl serine), and zwitterionic lipids (e.g., DOPE, DOPC).
Examples of cationic lipids are 5-carboxyspermylglycine dioctadecylamide (DOGS) and dipalmitoyl-phophatidylethanolamine-5-carboxy-spermylamide (DPPES). Cationic cholesterol derivatives are also useful, including {3 β-[N-N′,N′-dimethylamino)ethane]-carbomoyl}-cholesterol (DC-Chol). Dimethyldioctdecyl-ammonium bromide (DDAB), N-(3-aminopropyl)-N,N-(bis-(2-tetradecyloxyethyl))-N-methyl-ammonium bromide (PADEMO), N-(3-aminopropyl)-N,N-(bis-(2-dodecyloxyethyl))-N-methyl-1-ammonium bromide (PADELO), N,N,N-tris-(2-dodecyloxy)ethyl-N-(3-amino)pro-pyl-ammonium bromide (PATELO), and N1-(3-aminopropyl)((2-dodecyloxy)e-thyl)-N2-(2-dodecyloxy)ethyl-1-piperazinaminium bromide (GALOE-BP) can also be employed in the present invention.
Non-diether cationic lipids, such as DL-1,2-dioleoyl-3-dimethylaminopropyl-β-hydroxyethylammonium (DORI diester), 1-O-oleyl-2-oleoyl-3-dimethylaminopropyl-3-hydroxyethylammonium (DORI ester/ether), and their salts promote in vivo gene delivery. Preferred cationic lipids comprise groups attached via a heteroatom attached to the quaternary ammonium moiety in the head group. A glycyl spacer can connect the linker to the hydroxyl group.
Cationic lipids for use in certain embodiments of the present invention include DMRIE ((±)-N-(2-hydroxyethyl)-N,N-dimethyl-2-,3-bis(tetradecyloxy)-1-propanaminium bromide), and GAP-DMORIE ((+)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(syn-9-tetradeceneyloxy)-1-pro-panaminium bromide), as well as (±)-N,N-dimethyl-N-[2-(sperminecarboxamido)et-hyl]-2,3-bis(dioleyloxy)-1-propaniminium pentahydrochloride (DOSPA), (±)-N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanimini-um bromide (β-aminoethyl-DMRIE or βAE-DMRIE) (Wheeler, et al., Biochim. Biophys. Acta 1280:1-11 (1996)), and (±)-N-(3-aminopropyl)-N,-N-dimethyl-2,3-bis(dodecyloxy)-1-propaniminium bromide (GAP-DLRIE) (Wheeler, et al., Proc. Natl. Acad. Sci. USA 93:11454-11459 (1996)), which have been developed from DMRIE. Other examples of DMRIE-derived cationic lipids that are useful for the present invention are (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-(bis-decyloxy)-1-propanaminium bromide (GAP-DDRIE), (±)-N-(3-aminopropyl)-N,-N-dimethyl-2,3-(bis-tetradecyloxy)-1-propanaminium bromide (GAP-DMRIE), (±)-N-((N″-methyl)-N′-ureyl)propyl-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide (GMU-DMRTE), (±)-N-(2-hydroxyethyl)-N,N-dimeth-yl-2,3-bis(dodecyloxy)-1-propanaminium bromide (DLRIE), and (±)-N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis-([Z]-9-octadecenyloxy)prop-yl-1-propaniminium bromide (HP-DORIE).
A cationic lipid that may be used in concert with the p21 inhibitor polynucleotide compositions of the present invention is a “cytofectin.” As used herein, a “cytofectin” refers to a subset of cationic lipids which incorporate certain structural features including, but not limited to, a quaternary ammonium group and/or a hydrophobic region (usually with two or more alkyl chains), but which do not require amine protonation to develop a positive charge. Examples of cytofectins may be found, for example, in U.S. Pat. No. 5,861,397. Cytofectins that may be used in the present invention, include DMRIE ((±)-N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-pr-opanaminium bromide), GAP-DMORIE (±)-N-(3-aminopropyl)-N,N-dimethyl-2,-3-bis(syn-9-tetradeceneyloxy)-1-propanaminium bromide), and GAP-DLRIE ((±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-(bis-dodecyloxy)-1-propanaminium bromide).
The cationic lipid may be mixed with one or more co-lipids. The term “co-lipid” refers to any hydrophobic material which may be combined with the cationic lipid component and includes amphipathic lipids, such as phospholipids, and neutral lipids, such as cholesterol. Cationic lipids and co-lipids may be mixed or combined in a number of ways to produce a variety of non-covalently bonded macroscopic structures, including, for example, liposomes, multilamellar vesicles, unilamellar vesicles, micelles, and simple films. A preferred class of co-lipids are the zwitterionic phospholipids, which include the phosphatidylethanolamines and the phosphatidylcholines. Most preferably, the co-lipids are phosphatidylethanolamines, such as, for example, DOPE, DMPE and DPyPE. DOPE and DPyPE are particularly preferred. The most preferred co-lipid is DPyPE, which comprises two phytanoyl substituents incorporated into the diacylphosphatidylethanolamine skeleton. The cationic lipid:co-lipid molar ratio may range from about 9:1 to about 1:9, or from about 4:1 to about 1:4, or from about 2:1 to about 1:2, or about 1:1. In order to maximize homogeneity, such cationic lipid and co-lipid components may be dissolved in a solvent such as chloroform, followed by evaporation of the cationic lipid/co-lipid solution under vacuum to dryness as a film on the inner surface of a glass vessel (e.g., a Rotovap round-bottomed flask). Upon suspension in an aqueous solvent, the amphipathic lipid component molecules self-assemble into homogenous lipid vesicles. These lipid vesicles may subsequently be processed to have a selected mean diameter of uniform size prior to complexing with, for example, plasmid DNA according to methods known to those skilled in the art. For example, the sonication of a lipid solution is described in Feigner, P. L., et al. (1987) “L
In some embodiments, such polynucleotide or polynucleotide construct(s) are combined with lipids by mixing, for example, a plasmid DNA solution and a solution of cationic lipid:co-lipid liposomes. Preferably, the concentration of each of the constituent solutions is adjusted prior to mixing such that the desired final plasmid DNA/cationic lipid:co-lipid ratio and the desired plasmid DNA final concentration will be obtained upon mixing the two solutions. For example, if the desired final solution is to be 2.5 mM sodium phosphate, the various components of the composition, e.g., plasmid DNA, cationic lipid:co-lipid liposomes, and any other desired auxiliary agents, transfection facilitating materials, or additives are each prepared in 2.5 mM sodium phosphate and then simply mixed to afford the desired complex. Alternatively, if the desired final solution is to be, e.g., 2.5 mM sodium phosphate, certain components of the composition, e.g., the auxiliary agent and/or cationic lipid:co-lipid liposomes, is prepared in a volume of water which is less than that of the final volume of the composition, and certain other components of the composition, e.g., the plasmid DNA, is prepared in a solution of sodium phosphate at a higher concentration than 2.5 mM, in a volume such that when. the components in water are added to the components in the sodium phosphate solution, the final composition is in an aqueous solution of 2.5 mM sodium phosphate. For example, the plasmid DNA could be prepared in 5.0 mM sodium phosphate at one half the final volume, the auxiliary agent and/or cationic lipid:co-lipid liposome is prepared in water at one half the final volume, and then these two elements are mixed together to produce the final composition. The cationic lipid:co-lipid liposomes are preferably prepared by hydrating a thin film of the mixed lipid materials in an appropriate volume of aqueous solvent by vortex mixing at ambient temperatures for about 1 minute. The thin films are prepared by admixing chloroform solutions of the individual components to afford a desired molar solute ratio followed by aliquoting the desired volume of the solutions into a suitable container. The solvent is removed by evaporation, first with a stream of dry, inert gas (e.g. argon) followed by high vacuum treatment.
A transfection facilitating material can be used alone or in combination with one or more other transfection facilitating materials. Two or more transfection facilitating materials can be combined by chemical bonding (e.g, covalent and ionic such as in lipidated polylysine, PEGylated polylysine) (Toncheva, V., et al. (1998) “N
Other hydrophobic and amphiphilic additives, such as, for example, sterols, fatty acids, gangliosides, glycolipids, lipopeptides, liposaccharides, neobees, niosomes, prostaglandins and sphingolipids, may also be included in the compositions of the present invention. In such compositions, these additives may be included in an amount between about 0.1 mol % and about 99.9 mmol % (relative to total lipid). Preferably, these additives comprise about 1-50 mol % and, most preferably, about 2-25 mol %. Preferred additives include lipopeptides, liposaccharides and steroids.
In embodiments of the present invention in which non-polynucleotide p21 inhibitors are provided, such compounds can be formulated according to known methods for preparing such pharmaceutical compositions, whereby the substance to be delivered is combined with a pharmaceutically acceptable carrier vehicle. Suitable vehicles and their preparation are described, for example, in Remington's Pharmaceutical Sciences, 16th Edition, A. Osol, Ed., Mack Publishing Co., Easton, Pa. (1980), and Remington's Pharmaceutical Sciences, 19th Edition, A. R. Gennaro, Ed., Mack Publishing Co., Easton, Pa. (1995). The amount of such compounds included in such a composition depends on factors including the age and weight of the subject, the delivery method and route, the type of treatment desired, and the type of polynucleotide or polynucleotide construct or other p21 inhibitor being administered. In general, a composition of the present invention that includes such inhibitors will contain from about 1 ng to about 30 mg, and more preferably, from about 100 ng to about 10 mg of such inhibitor. Certain preferred compositions of the present invention may include about 1 ng of such inhibitor, about 5 ng of such inhibitor, about 10 ng of such inhibitor, about 50 ng of such inhibitor, about 100 ng of such inhibitor, about 500 ng of such inhibitor, about 1 μg of such inhibitor, about 5 μg of such inhibitor, about 10 pg of such inhibitor, about 50 μg of such inhibitor, about 100 μg of such inhibitor, about 150 μg of such inhibitor, about 200 μg of such inhibitor, about 250 μg of such inhibitor, about 300 μg of such inhibitor, about 350 pg of such inhibitor, about 400 μg of such inhibitor, about 450 pg of such inhibitor, about 500 μg of a polynucleotide, about 550 μg of such inhibitor, about 600 pg of such inhibitor, about 650 μg of such inhibitor, about 700 pg of such inhibitor, about 750 μg of such inhibitor, about 800 pg of such inhibitor, about 850 pg of a polynucleotide, about 900 μg of such inhibitor, about 950 pg of such inhibitor, about 1 mg of such inhibitor, about 5 mg of such inhibitor, about 10 mg of such inhibitor, about 15 mg of such inhibitor, about 20 mg of such inhibitor, about 25 mg of such inhibitor, or about 30 mg of such inhibitor.
Such compositions may be formulated into any of the various compositions and may be used in any of the methods disclosed herein. For aqueous compositions used in vivo, use of sterile pyrogen-free water is preferred. Such formulations will contain an effective amount of such inhibitor together with a suitable salt and/or auxiliary agent as disclosed herein, in order to prepare pharmaceutically acceptable compositions suitable for optimal administration to a vertebrate. Insoluble inhibitors may be solubilized in a weak acid or weak base, and then diluted to the desired volume, for example, with an aqueous solution of the present invention. The pH of the solution may be adjusted as appropriate. In addition, a pharmaceutically acceptable additive can be used to provide an appropriate osmolarity. Alternatively, lipids and lipid vehicles (as discussed above) may be used to facilitate the inhibitor administration. Other hydrophobic and amphiphilic additives, such as, for example, sterols, fatty acids, gangliosides, glycolipids, lipopeptides, liposaccharides, neobees, niosomes, prostaglandins and sphingolipids, may also be included in such compositions of the present invention. In such compositions, these additives may be included in an amount between about 0.1 mol % and about 99.9 mol % (relative to total lipid). Preferably, these additives comprise about 1-50 mol % and, most preferably, about 2-25 mol %. Preferred additives include lipopeptides, liposaccharides and steroids.
Pharmaceutical Compositions
The pharmaceutical composition of the present invention may be in the form of an emulsion, gel, solution, suspension, etc. In addition, the pharmaceutical composition can also contain pharmaceutically acceptable additives including, for example, diluents, binders, stabilizers, and preservatives. Administration of pharmaceutically acceptable salts of the polynucleotides described herein is preferred. Such salts can be prepared from pharmaceutically acceptable non-toxic bases including organic bases and inorganic bases. Salts derived from inorganic bases include sodium, potassium, lithium, ammonium, calcium, magnesium, and the like. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, basic amino acids, and the like. Preferred salts include but are not limited to sodium phosphate, sodium acetate, sodium bicarbonate, sodium sulfate, sodium pyruvate, potassium phosphate, potassium acetate, potassium bicarbonate, potassium sulfate, potassium pyruvate, disodium DL-α-glycerol-phosphate, and disodium glucose-6-phosphate. “Phosphate” salts of sodium or potassium can be either the monobasic form, e.g., NaHPO4, or the dibasic form, e.g., Na2HPO4, but a mixture of the two, resulting in a desired pH, is most preferred. The most preferred salts are sodium phosphate or potassium phosphate. As used herein, the terms “sodium phosphate” or “potassium phosphate,” refer to a mixture of the dibasic and monobasic forms of each salt to present at a given pH.
Additional embodiments of the present invention are drawn to pharmaceutical compositions comprising one or more p21 inhibitor molecules and an auxiliary agent. The present invention is further drawn to methods to use such compositions, methods of making such compositions, and pharmaceutical kits. As used herein, an “auxiliary agent” is a substance included in a composition for its ability to enhance, relative to a composition which is identical except for the inclusion of the auxiliary agent, the effectiveness of a p21 inhibitor molecule. Auxiliary agents of the present invention include nonionic, anionic, cationic, or, zwitterionic surfactant or detergents, with nonionic, anionic, cationic, or zwitterionic surfactant or detergents, with nonionic surfactant or detergents being preferred, chelators, DNAse inhibitors, agents that aggregate or condense nucleic acids, emulsifying or solubilizing agents, wetting agents, gel-forming agents, and buffers.
Suitable auxiliary agents include non-ionic detergents and surfactant such as poloxaners. Poloxamers are a series of non-ionic surfactant that are block copolymers of ethylene oxide and propylene oxide. The poly(oxyethylene) segment is hydrophillic and the poly(oxypropylene) segment is hydrophobic. The physical forms are liquids, pastes or solids. The molecular weight ranges from 1000 to greater than 16000. The basic structure of a poloxaner is HO—[CH2CH2O]X—[CH2CHO(CH3)]y—[CH2CH2O]x—H, where x and y represent repeating units of ethylene oxide and propylene oxide respectively. Thus, the propylene oxide (PO) segment is sandwiched between two ethylene oxide (EO) segments, (EO-PO-EO). The number of x's and y's distinguishes individual poloxamers. If the ethylene oxide segment is sandwiched between two propylene oxide segments, (PO-BO-PO), then the resulting structure is a reverse poloxaner. The basic structure of a reverse poloxamer is HO—[CH(CH3)CH2O)]x—[CH2CH2O]y—[CH2C-HO(CH3)]x—H.
Poloxamers that may be used in concert with the methods and compositions of the present invention include, but are not limited to commercially available poloxamers such as Pluronic® L121 (avg. MW:4400), Pluronic® L101 (avg. MW:3800), Pluronic® L81 (avg. MW:2750), Pluronic® L61 (avg. MW:2000), Pluronic® L31 (avg. MW: 1100), Pluronic® L122 (avg. MW:5000), Pluronic® L92 (avg. MW:3650), Pluronic® L72 (avg. MW:2750), Pluronic® L62 (avg. MW:2500), Pluronic® L42 (avg. MW:1630), Pluronic® L63 (avg. MW:2650), Pluronic® L43 (avg. MW: 1850), Pluronic® L64 (avg. MW:2900), Pluronic® L44 (avg. MW:2200), Pluronic® L35 (avg. MW:1900), Pluronic® P123 (avg. MW:5750), Pluronic® P103 (avg. MW:4950), Pluronic® P104 (avg. MW:5900), Pluronic® P84 (avg. MW:4200) Pluronic® P105 (avg. MW:6500), Pluronic® P85 (avg. MW:4600), Pluronic® P75 (avg. MW:4150), Pluronic® P65 (avg. MW:3400), Pluronic® F127 (avg. MW: 12600), Pluronic® F98 (avg. MW: 13000), Pluronic® F87 (avg. MW:7700), Pluronic® F77 (avg. MW:6600), Pluronic® F 108 (avg. MW: 14600), Pluronic® F98 (avg. MW: 13000), Pluronic® F88 (avg. MW: 11400), Pluronic® F68 (avg. MW:8400), and Pluronic® F38 (avg., MW:4700).
Reverse poloxamers of the present invention include, but are not limited to Pluronic® R31R1 (avg. MW:3250), Pluronic® R25R1 (avg. MW: 2700), Pluronic® R17R1 (avg. MW:1900), Pluronic® R31R2 (avg. MW:3300), Pluronic® R25R2 (avg. MW:3100), Pluronic® R17R2 (avg. MW:2150), Pluronic® R12R3 (avg. MW:1800) Pluronic® R31R4 (avg. MW:4150), Pluronic® R25R4 (avg. MW:3600), Pluronic® R22R4 (avg. MW:3350), Pluronic® R17R4 (avg. MW:3650), Pluronic® R25R5 (avg. MW:4320), Pluronic® R10R5 (avg. MW:1950), Pluronic® R25R8 (avg. MW:8850), Pluronic® R17R8 (avg. MW:7000), Pluronic® R10R8 (avg. MW:4550).
Other commercially available poloxamers include compounds that are block copolymer of polyethylene and polypropylene glycol such as Synperonic® L121, Synperonic® L122, Synperonic® P104, Synperonic® P105, Synperonic® P123, Synperonic® P85, and Synperonic® P94; and compounds that are nonylphenyl polyethylene glycol such as Synperonic® NP10, Synperonic® NP30, and Synperonic® NP5.
Suitable auxiliary agents include non-ionic detergents and surfactants such as Pluronic® F68, Pluronic® F77, Pluronic® F108, Pluronic® F127, Pluronic® P65, Pluronic® P85, Pluronic® P103, Pluronic® P104, Pluronic® P105, Pluronic® P123, Pluronic® L31, Pluronic® L43; Pluronic® L44, Pluronic® L61, Pluronic® L62, Pluronic® L64, Pluronic® L81, Pluronic® L92, Pluronic® L101, Pluronic® L121, Pluronic® R17R4, Pluronic® 125R4, Pluronic® R25R2, IGEPAL CA 630®, NONIDET NP-40, Nonidet® P40, Tween-20®, Tween-80®, Triton X-100®, Triton X-114™, Thesit®; the anionic detergent sodium dodecyl sulfate (SDS); the sugar stachyose; the condensing agent DMSO; and the chelator/DNAse inhibitor EDTA. Even more preferred are the auxiliary agents Nonidet® P40, Triton X-100®, Pluronic® F68, Pluronic® F77, Pluronic® F108, Pluronic® P65, Pluronic® P103, Pluronic® L31, Pluronic® L44, Pluronic® L61, Pluronic® L64, Pluronic® L92, Pluronic® R17R4, Pluronic® R25R4 and Pluronic® R25R2. Most preferred auxiliary agent is Pluronic® R25R2.
Optimal concentrations of auxiliary agents of the present invention are disclosed in U.S. Patent Application Publication No. 20020019358 and PCT Publication WO0180897A3. For example, in certain embodiments, pharmaceutical compositions of the present invention comprise about 5 ng to about 30 mg of a suitable polynucleotide or a polynucleotide construct, and/or a non-polynucleotide p21 inhibitor, and about 0.001% (w/v) to about 2.0% (w/v) of Pluronic® R 25R4, preferably about 0.002% (w/v) to about 1.0% (w/v) of Pluronic® R 25R4, more preferably about 0.01% (w/v) to about 0.01% (w/v) of Pluronic® R 25R4, with about 0.01% (w/v) of Pluronic® R 25R4 being the most preferred; about 0.001% (w/v) to about 2.0% (w/v) of Pluronic® R 25R2, preferably about 0.001% (w/v) to about 1.0% (w/v) of Pluronic® R 25R2, more preferably about 0.001% (w/v) to about 0.1% (w/v) of Pluronic® R 25R2, with about 0.01% (w/v) of Pluronic® R 25R2 being the most preferred.
Administration of the Pharmaceutical Compositions of the Present Invention
The pharmaceutical compositions of the present invention may be administered by any suitable means, for example, inhalation, or intradermally, intracavity (e.g., oral, vaginal, rectal, nasal, peritoneal, ventricular, or intestinal), intradermally, intramuscularly, intranasally, intraocularly, intraperitoneally, intrarectally, intratracheally, intravenously, orally, subcutaneously, transdermally, or transmucosally (i.e., across a mucous membrane) in a dose effective for the production of neutralizing antibody and resulting in protection from infection or disease. The present pharmaceutical compositions can generally be administered in the form of a spray for intranasal administration, or by nose drops, inhalants, swabs on tonsils, or a capsule, liquid, suspension or elixirs for oral administration. The pharmaceutical compositions may be in the form of single dose preparations or in multi-dose flasks. Reference is made to Remington's Pharmaceutical Sciences, Mack Publising Co., Easton, Pa., Osol (ed.) (1980).
Administration can be into one or more tissues including but not limited to muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, e.g., myocardium, endocardium, and pericardium; lymph nodes, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary; uterus, rectum, nervous system, eye, gland, or connective tissue. Furthermore, in the methods of the present invention; the pharmaceutical compositions may be administered to any internal cavity of a mammal, including, but not limited to, the lungs, the mouth, the nasal cavity, the stomach, the peritoneal cavity, the intestine, any heart chamber, veins, arteries, capillaries, lymphatic cavities, the uterine cavity, the vaginal cavity, the rectal cavity, joint cavities, ventricles in brain, spinal canal in spinal cord, and the ocular cavities. Any mode of administration can be used so long as the mode results in prophylactic or therapeutic efficacy. Methods to detect such a response include serological methods, e.g., western blotting, molecular (transcriptional) staining tissue sections by immunohistochemical methods, and measuring the activity of the polypeptide. Pharmaceutical DNA compositions and methods of their manufacture and delivery that may be used in accordance with the present invention are disclosed in U.S. Pat. Nos. 5,589,466; 5,620,896; 5,641,665; 5,703,055; 5,707,812; 5,846,946; 5,861,397; 5,891,718; 6,022,874; 6,147,055; 6,214,804; 6,228,844; 6,399,588; 6,413,942; 6,451,769, European Patent Documents EP1165140A2; EP1006796A1 and EP0929536A1; and PCT Patent Publications WO00/57917; WO00/73263; WO01/09303; WO03/028632; WO94/29469; WO95/29703; and WO98/14439.
Administration may be by needle injection, catheter infusion, biolistic injectors, particle accelerators (e.g., “gene guns” or pneumatic “needleless” injectors) Med-E-Jet (Vahlsing, H., et al. (1994) “I
Thus, in one embodiment, administration is into muscle tissue, i.e., skeletal muscle, smooth muscle, or myocardium. Most preferably, the muscle is skeletal muscle. For polynucleotide constructs in which the polynucleotide or polynucleotide construct is DNA, the DNA can be operably linked to a cell-specific promoter that directs substantial transcription of the DNA only in predetermined cells. In certain embodiments, a polynucleotide construct, or composition comprising an polynucleotide or polynucleotide construct, is delivered to any tissue including, but not limited to those disclosed herein, such that the polynucleotide or polynucleotide construct is free from association with liposomal formulations and charged lipids. Alternatively, the polynucleotide, polynucleotide construct, or composition is delivered to a tissue other than brain or nervous system tissue, for example, to muscle, skin, or blood, in any composition as described herein.
Preferably, the pharmaceutical composition is delivered to the interstitial space of a tissue. “Interstitial space” comprises the intercellular, fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone. It is similarly the space occupied by the plasma of the circulation and the lymph fluid of the lymphatic channels.
Nucleic acid pharmaceutical compositions, preferably in the form of plasmid D
The nature of the electric field generated in accordance with such methods is determined by the nature of the tissue, the size of the selected tissue and its location. The use of insufficient or excessive field strength is to be avoided. As used herein, a field strength is excessive if it results in the lysing of cells. A field strength is insufficient if it results in a reduction of efficacy of 90% relative to the maximum efficacy obtainable. The electrodes may be mounted and manipulated in many ways known in the art. The waveform of the electrical signal provided by the pulse generator can be an exponentially decaying pulse, a square pulse, a unipolar oscillating pulse train or a bipolar oscillating pulse train. The waveform, electric field strength and pulse duration are dependent upon the type of cells and the DNA that are to enter the cells via electrical-mediated delivery and thus are determined by those skilled in the art in consideration of these criteria. Any number of known devices may be used for delivering polynucleotides and generating the desired electric field. Examples of suitable devices include, but are not limited to, a single needle probe, a bipolar probe and a combination needle and plate probe. Alternatively, methods such as continuous-flow electroporation may be employed (See, U.S. Pat. Nos. 6,485,961; 6,090,617; 6,074,605; 5,720,921; 5,612,207; and 5,098,843).
The compositions of the present invention can be lyophilized to produce pharmaceutical compositions in a dried form for ease in transportation and storage. The pharmaceutical compositions of the present invention may be stored in a sealed vial, ampule or the like. In the case where the pharmaceutical composition is in a dried form, the composition is dissolved or suspended (e.g., in sterilized distilled water) before administration. An inert carrier such as saline or phosphate buffered saline or any such carrier in which the pharmaceutical compositions has suitable solubility, may be used.
Further, the pharmaceutical compositions may be prepared in the form of a mixed composition that contains one or more additional constituents so long as such additional constituents do not interfere with the effectiveness of the p2.1 inhibitor and the side effects and adverse reactions are not increased additively or synergistically. The pharmaceutical compositions of the present invention can be associated with chemical moieties which may improve the composition's solubility, absorption, biological half life, etc. The moieties may alternatively decrease the toxicity of the pharmaceutical compositions, eliminate or attenuate any undesirable side effect of the pharmaceutical compositions, etc. Moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences (1980). Procedures for coupling such moieties to a molecule are well known in the art.
Determining an effective amount of a composition depends upon a number of factors including, for example, the chemical structure and biological activity of the substance, the age and weight of the subject, the precise condition requiring treatment and its severity, and the route of administration. Based on the above factors, determining the precise amount, number of doses, and timing of doses are within the ordinary skill in the art and will be readily determined by the attending physician or veterinarian.
In one embodiment, the pharmaceutical compositions of the present invention are administered free from association with liposomal formulations, charged lipids, or transfection-facilitating viral particles. In another embodiment, the compositions of the present invention are administered free from association with any delivery vehicle now known in the art that can facilitate entry into cells.
As used herein, “ex vivo” cells are cells into which the pharmaceutical compositions are introduced, for example, by transfection, lipofection, electroporation, bombardment, or microinjection. The cells containing the pharmaceutical compositions are then administered in vivo into mammalian tissue (see, for example, see Belldegrun, A., et al. (1993) “H
In the “local delivery” embodiment of the present invention, a pharmaceutical composition is administered in vivo, such that the p21 inhibitor is incorporated into the local cells at the site of administration. The pharmaceutical compositions can be administered either within ex vivo cells or free of ex vivo cells or ex vivo cellular material. Preferably, the polynucleotide construct is administered free of ex vivo cells or ex vivo cellular material.
The pharmaceutical compositions can be solubilized in a buffer prior to administration. Suitable buffers include, for example, phosphate buffered saline (PBS), normal saline, Tris buffer, and sodium phosphate vehicle (100-150 mM preferred). Insoluble polynucleotides can be solubilized in a weak acid or base, and then diluted to the desired volume with a neutral buffer such as PBS. The pH of the buffer is suitably adjusted, and moreover, a pharmaceutically acceptable additive can be used in the buffer to provide an appropriate osmolarity within the lipid vesicle. Preferred salt solutions and auxiliary agents are disclosed herein.
A systemic delivery embodiment is particularly preferred for treating non-localized disease conditions. A local delivery embodiment can be particularly useful for treating disease conditions that might be responsive to high local concentration. When advantageous, systemic and local delivery can be combined. U.S. Pat. Nos. 5,589,466, 5,693,622, 5,580,859, 5,703,055, and PCT publication WO94/29469 provide methods for delivering compositions comprising naked DNA, or DNA cationic lipid complexes to mammals.
Compositions used in the present invention can be formulated according to blown methods. Suitable preparation methods are described, for example, in Remington's Pharmaceutical Sciences, 16th Edition, A. Osol, ed., Mack Publishing Co., Easton, Pa. (1980), and Remington's Pharmaceutical Sciences, 19th Edition, A. R. Gennaro, ed., Mack Publishing Co., Easton, Pa. (1995), both of which are incorporated herein by reference in their entireties. Although the composition is preferably administered as an aqueous solution, it can be formulated as an emulsion, gel, solution, suspension, lyophilized form, or any other form known in the art. According to the present invention, if the composition is formulated other than as an aqueous solution, it will require resuspension in an aqueous solution prior to administration. In addition, the composition may contain pharmaceutically acceptable additives including, for example, diluents, binders, stabilizers, and preservatives.
The present invention also provides kits for use in treating infection comprising an administration means and a container means containing a pharmaceutical composition of the present invention. Preferably, the container in which the composition is packaged prior to use will comprise a hermetically sealed container enclosing an amount of the lyophilized formulation or a solution containing the formulation suitable for a pharmaceutically effective dose thereof, or multiples of an effective dose. The composition is packaged in a sterile container, and the hermetically sealed container is designed to preserve sterility of the pharmaceutical formulation until use. Optionally, the container can be associated with administration means and/or instruction for use.
Having now generally described the invention, the same will be more readily understood through reference to the following examples, which are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.
Example 1 Materials and Methods for the Analysis Of Temporal Events Associated with the Initial Virus-Macrophage EncounterA. Purification of Human Monocytes by Counterflow Centrifugal Elutriation
Human peripheral blood cells are obtained by leukapheresis from normal volunteers in the Department of Transfusion Medicine at the National Institutes of Health (Bethesda, Md.) and diluted in endotoxin-free PBS without Ca2+ and Mg2+ (BioWhittaker, Walkersville, Md.) for density sedimentation. The monocytes in the mononuclear cell layer are purified by counterflow centrifugal elutriation within 4 hr after leukapheresis (Wahl, S. M. et al. (1984) “I
B. HIV-1 Infection of Human Monocyte-Derived Macrophages
Monocytes are plated in 6 well plates (Corning Costar Corporation, Cambridge, Mass.), at 6×106 cells/well or in Lab-Tek chamber slides (Naperville, Ill.) at 1.5×106/chamber in Dulbecco's modified Eagle's medium (DMEM) with 2 mM L-glutamine and 10 μg/ml gentamicin (BioWhittaker) or in other suitable vessels. After adherence (4-6 hr at 37° C. and 5% CO2), 10% human AB-serum (Sigma, St. Louis, Mo.) is added to the culture medium. Cells are cultured 5-10 days to allow differentiation into macrophages before being infected with HIV-1BaL TCID50=1000-5000 (Advanced Biotechnologies Inc., Columbia, Md.) or other M tropic. (R5) virus for 90 minutes at 37° C. The levels of endotoxin are below the limit of detection in virus preparations. Unbound virus is removed by washing the cells with media and refeeding with complete DMEM containing 10% human serum. Control populations of adherent macrophages are mock-infected and cultured in parallel. Every 3 to 4 days, half the medium is removed for virus assay and replaced with fresh complete medium for two weeks. Supernatant p24 antigen is assayed using the p24 core profile enzyme-linked immunosorbent assay (ELISA) kit (Perkin-Elmer Life Sciences, Wilmington, Del.). As described below, in certain experiments, macrophages are pre-treated with 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO) or a CDDO analog (di-CDDO) for 45 minutes prior to exposure to HIV-1. Additionally, macrophages are treated with p21 anti-sense phosphorothioate oligonucleotides:
or negative control oligonucleotide:
(sequence obtained from Dr. Argyrios N. Theofilopoulos, The Scripps Research Institute, La Jolla, Calif.) after HIV-1 infection and at the time of refeeding the cultures and tested for viral replication at day 12. SEQ NOS. 7 and 9 are derived from the murine p21 antisense sequence, yet are effective in inhibiting human p21 expression and the replication and transmission of HIV.
C. Northern Blot Analysis and RNase Protection Assay (RPA)
Total cellular RNA is extracted from adherent control or infected monocytes with the RNeasy minikit (Qiagen, Valencia, Calif.) and analyzed by northern blot (Wahl, S. M. et al. (1998) “M
D. cDNA Expression Array
The Altlas human cDNA Expression Array 1.2 I (Clontech, Palo Alto, Calif.) (catalog #7850-1) is performed using 5 μg of DNase digested total RNA as described by Greenwell-Wild, T. at al. (2002) “M
E. Transmission Electron Microscopy (TEM)
Gluteraldehyde-fixed uninfected and infected cells are postfixed in OsO4, dehydrated through graded ethanol and propylene oxide, embedded in Spurr's epoxy, and thick-and thin-sectioned. Thin sections are placed on copper grids, stained with uranyl acetate and lead citrate, and viewed in a Zeiss EM10 microscope (LEO Electron Microscope; Oberkochen, Germany).
F. Immunofluorescence Microscopy
Uninfected and HIV-1 infected macrophages that have been cultured for twelve days are washed twice with PBS, fixed with 2% paraformaldehyde in PBS, washed and incubated in 100 mM glycine in PBS for 20 min, followed by 0.5% Triton-X-100 for 10 min and rinsed with PBS. Cells are then labeled with rabbit anti-p21 antibody, at 5 μg/ml (Santa Cruz Biotechnology, Santa Cruz, Calif.) in PBS containing 5% donkey serum (Jackson ImmunoResearch Laboratories, Inc., West Grove, Pa.) for 1 hr, washed extensively, then incubated with Texas-Red conjugated secondary antibody at 3 μg/ml at room temperature (Molecular Probes, Eugene, Oreg.). Non-specific background is determined using an irrelevant rabbit isotype control antibody and secondary antibody alone at the same concentrations above. Images are captured using a Leica TCS-4D confocal microscope system with a Kr-Af laser on a DMR upright microscope using a 40×, 1.0 numerical aperture objective. Fluorescence intensity analysis, is performed using confocal microscopy and Metamorph analysis (Universal Imaging, Downington, Pa.).
G. Immunoprecipitation and Western Blot Analysis
Whole cell lysates are generated using a lysis buffer that consisted of 1% Nonidet P-40, 150 mM NaCl, 20 mM Tris-HCl (pH, 7.5), 10 mM NaF, 10 mM NaPPi, 2.5 nM EDTA, 1 mM Na3VO4, 0.2 mM 3, 4 dichloroisocoumarin, 1 mM phenylmethylsulfonyl fluoride, 100 ug/ml chymostatin and 1× complete protease inhibitor (BoehringerMannheim, Indianapolis, Ind.). CDKNIA is immunoprecipitated from cell lysates using an anti-CDKN1A antibody conjugated to agarose (Santa Cruz Biotechnology) and incubated with constant rotation at 4° C. for 2 hours. Immunoprecipitates are electrophoresed onto Tricine gels (Invitrogen, Carlsbad, Calif.), transferred to nitrocellulose membrane and immunoblotted with anti-CDKN1A (BD Pharmingen). Immunoblots are developed using enhanced chemiluminescence and the Super-Signal substrate according to manufacturer's instructions (Pierce Chemical Co, Rockford, Ill.).
Example 2 Results of the Analysis of Temporal Events Associated with the Initial Virus-Macrophage EncounterA. Kinetics of HIV-1 Replication in Adherent Macrophages
Elutriated monocytes are adhered for 7 days, exposed to an R5 HIVBaL for 90 minutes, washed and the kinetics of cellular and viral changes are monitored. HIV-1 RNA is typically detected on day 5, becoming increasingly apparent by 10-16 days after initial exposure to the virus (
B. Initial Gene Expression in HIV-1-Infected Macrophage Populations
To examine the host factors underlying viral propagation, transcriptional pathways that are activated downstream of the CD4-HIV-1 co-receptor binding/signaling event are examined by cDNA expression arrays. Compared with the control mock-infected macrophage population, an early and transient gene expression profile occurs, followed by a delayed pattern that emerges in association with viral replication. Within 3-6 hours upregulated genes defined as exhibiting a ≧2 fold increase above baseline in ≧4 donors (134 of 1200 interrogated) are associated predominantly with signal transduction pathways (24%) and transcription (25%) (
In addition to genes involved in transcription and signal transduction, multiple genes associated with cell cycle, apoptosis, and cellular recruitment (Table 1), including chemokines (IL-8, MCP-1, and MRP14) involve viral replication (Lane, B. R. et al. (2001) “I
Although gene expression for caspases 3, 4 and 8 is increased, genes encoding factors that contribute to cellular resistance to apoptosis including IEX-1L and bcl-x (Wu, M. X. et al. (1998) “IEX-1L, A
HO-1, together with increased glutathione synthetase (Table 1) may help provide a balance and protect the macrophage from oxidative stress generated by the virus (Mialocq, P. et al. (2001) “O
C. Kinetics of HIV-1 Induced Gene Expression
The initial pattern of expression observed following binding of HIV-1 to macrophages in 4-7 donors, consistent with receptor engagement, is transient and by 24 hr, a restricted number of genes remain or are newly elevated (Table 2).
Of considerable interest are the limited detectable alterations in gene expression in the cells between 3-5 days after infection, preceding evidence of viral replication. Concomitant with evidence of the HIV replicative cycle (
D. Increased CDKN1A Gene and Protein Expression In Virus Infected Macrophages
Although all of the virus-induced genes discussed above can be exploited as targets for drugs that would inhibit HIV-1 propagation, the unique biphasic expression pattern of CDKN1A makes it a preferred gene for inhibiting HIV, but does not rule out the additional genes as potential regulatory candidates. Because it is rapidly upregulated following HIV-1 binding/entry and then again during the emergence of viral replication (
To determine whether the increased p21 influenced viral life cycle, the cells are treated with two distinct p21 anti-sense oligonucleotides (SEQ ID NO 7 and SEQ ID NO. 9). Both oligonucleotides reduce viral replication as assessed by p24 levels, most evident at day 12 when untreated cells show substantial HIV-1 production. In contrast, a missense control oligonucleotide (SEQ ID NO. 13) did not suppress HIV-1 p24 (
E. Effect of CDDO on HIV-1 Replication
The ability of p21 oligonucleotides to block HIV-1 replication prompted the exploration of potential therapeutically relevant mechanisms of modulating p21 to inhibit HIV-1. It has been reported that peroxisome proliferator-activated receptor gamma (PPARγ) ligands, one of which includes the synthetic triterpenoid CDDO, modulate p21 activity (Wang, Y. et al. (2000) “A
Gene silencing was carried out using SMARTpool™ si RNA duplexes (Dharmacon Research, Inc.; Smart Pool siRNA p21 waf1; Catalog No. M-003471-00-05), which targets CDKN1A. A non-specific si RNA pool (Dharmacon) was also utilized as a negative control.
After preparing siRNA:Lipofectamine 2000 complexes cells were transfected according to manufacture's instructions (Invitrogen-Life
Technologies). Macrophages were infected after four days of transfection. The results of siRNA for p21 and its effect on HIV infection are shown in
P21 specific oligonucleotides (SEQ ID NO. 7 and SEQ NO. 9, 50 nM), but not control oligonucleotide (SEQ ID NO. 14) are found to inhibit HIV-1 growth in replicate cultures as determined by p24 levels (day 12 shown) (% of positive HIV control, no oligo treatment) (
Macrophages were also treated with p21 siRNA duplexes (5 nM) five days prior to HIV infection and the effect on HIV-growth was determined (% of positive HIV control, no siRNA treatment) (representative experiment, n=3) (
The results obtained with the antisense oligonucleotides were confirmed using gene silencing technology. Macrophages treated with CDKN1A si RNA duplexes, show a reduction in HIV-1 replication as determined by p24 ELISA on 14 day supernatants. This is not the case if macrophages are treated with a non-specific si RNA duplex control.
Example 4 Analysis of Effect of Vpr on p21 ExpressionAs indicated above, the HIV-1 Vpr gene product has been found to prevent cell proliferation by activating p21 expression (Chowdhury I. H. at al (2003) “HIV-1 V
The expression of p21 and GADPH in these cells was evaluated using PCR. For such experiments, macrophages are infected with the wild virus type clone pNLAD8, or pNLAD8 Vpr minus (#1) or pNLAD8-delta R (#2) R5 macrophage tropic viruses and 12 day supernatants analyzed by p24 ELISA (
The present invention demonstrates that HIV-1 infection promotes successful viral replication by modulating macrophage gene transcription. In comparison to previous studies, using viral envelope gp120 (Popik, W. et al. (2000) “E
Macrophages can co-exist with the virus for a prolonged time, during which they contribute to the pathogenesis of AIDS, acting as Viral reservoirs and transmitting HIV-1 to neighboring cells. Although proapoptotic genes for caspase 3, 4 and g were upregulated within 3 hours after infection, the antiapoptotic genes bcl-x, DAD1 and IEX-1L (Wu, M. X. et al. (1998) “IEX-1L,
As indicated above, following the initial HIV-1 induced burst of gene expression (6-24 hr), little evidence of transcriptional activity occurred until the onset of viral replication, when an increase in host molecules was again detected (day 7-14). The lack of induction of new host molecules during this interim period may allow the infected cells to escape immune surveillance while the virus initiates its life cycle to commence replication. Once ready to replicate, new transcription may be essential to facilitate the replicative process. For example the data indicate CDKN1A/p21 as a host molecule critical to viral replication in macrophages. CDKN1A is a cyclin-dependent kinase inhibitor induced during G1 cell cycle arrest by p53-dependent pathway following DNA damage, as well as p53-independent pathways involving growth factors
Dotto, G. P. (2000) “p21(WAP1/CI
While the initial enhancement of p21 gene expression likely represents a downstream consequence of CCR5/G protein signaling, the rise in gene transcription could be due to either intracellular or extracellular viral signals. Definition of such factors may provide a means of altering host involvement in viral infection and replication kinetics, possibly in conjuction with antiviral therapy. The presence of p21 in the nucleus has been related to its cell cycle functions (Dotto, G. P. (2000) “
Since the macrophage represents a key target for HIV-1 infection and one of the major obstacles in eradicating the virus even during H
Finally, since anti-HIV therapy is limited by the side effects that have accompanied conventional anti-retroviral drugs, and the constant emergence of drug-resistant HIV strains, CDDO provides an important candidate drug to target HIV-1, particularly in conjunction with additional anti-viral therapy, to prevent or attenuate the infection of new viral hosts.
All publications and patent documents mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent document was specifically and individually indicated to be incorporated by reference.
While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth.
Claims
1. A method of attenuating the transmission or infection of an immunodeficiency virus into a cell comprising providing to said cell an inhibitor of p21, wherein said inhibitor is a polynucleotide provided in an amount and duration sufficient to cause an attenuation of at least about 50% in said transmission or infection of said virus relative to an untreated cell.
2. The method of claim 1, wherein said immunodeficiency virus is human immunodeficiency virus (HIV), and said cell is a human cell.
3. (canceled)
4. The method of claim 2, wherein said polynucleotide is complementary to a portion of a p21 gene or p21 cDNA molecule.
5. The method of claim 4, wherein said p21 gene or p21 cDNA is of a human p21 gene or p21 cDNA molecule.
6. The method of claim 5, wherein said polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:4.
7. The method of claim 6, wherein said polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:8 or SEQ ID NO.:10.
8. The method of claim 4, wherein said p21 gene or p21 cDNA is of a non-human animal or is a variant of a non-human p21 gene or p21 cDNA molecule.
9. The method of claim 8, wherein said polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:6.
10. The method of claim 9, wherein said polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:7 or SEQ ID NO.:9.
11.-12. (canceled)
13. A method of treating AIDS in an individual, comprising providing to HIV-1 infected cells of said individual, or to HIV 1 susceptible cells of such individual, an amount of a p21 inhibitor sufficient to attenuate the propagation of HIV, wherein said inhibitor is a polynucleotide provided in an amount and duration sufficient to cause an attenuation of at least 50% in said propagation of HIV relative to untreated cells.
14. (canceled)
15. The method of claim 13, wherein said polynucleotide is complementary to a portion of a p21 gene or p21 cDNA molecule.
16. The method of claim 15, wherein said p21 gene or p21 cDNA is of a human p21 gene or p21 cDNA molecule.
17. The method of claim 16, wherein said polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:4.
18. The method of claim 17, wherein said polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:8 or SEQ ID NO.:10.
19. The method of claim 15, wherein said p21 gene or p21 cDNA is of a non-human animal or is a variant of a non-human p21 gene or p21 cDNA molecule.
20. The method of claim 19, wherein said polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:6.
21. The method of claim 20, wherein said polynucleotide comprises at least 10 contiguous nucleotides of SEQ ID NO.:7 or SEQ ID NO.:9.
22.-34. (canceled)
Type: Application
Filed: Oct 12, 2012
Publication Date: May 9, 2013
Applicant: The United States of America, as represented by Secretary, Department of Health & Human Services (Rockville, MD)
Inventor: The United States Of America, as Represented By The Secretary, Department Of Health & Human Services (Rockville, MD)
Application Number: 13/650,526
International Classification: C12N 15/113 (20060101);