SACCHAROMYCES STRAIN WITH ABILITY TO GROW ON PENTOSE SUGARS UNDER ANAEROBIC CULTIVATION CONDITIONS
The invention relates to an improved Saccharomyces strain displaying improved viability and growth during anaerobic fermentation of pentose carbon sources such as xylose and producing fermentation products such as ethanol.
Latest C5 LIGNO TECHNOLOGIES IN LUND AB Patents:
This application is a Divisional of U.S. Ser. No. 13/130,729, filed 23 May 2011, which is a national stage application of PCT/SE2009/000498 filed 20 Nov. 2009, which claims benefit of Serial No. 0802467-1, filed 24 Nov. 2008 in Sweden and which applications are incorporated herein by reference. To the extent appropriate, a claim of priority is made to each of the above disclosed applications.
FIELD OF INVENTIONThe invention relates to an improved Saccharomyces strain displaying improved viability and growth during anaerobic fermentation of pentose carbon sources such as xylose and producing fermentation products such as ethanol.
BACKGROUND OF INVENTIONBioethanol production from renewable feedstock by baker's yeast Saccharomyces cerevisiae has become an attractive alternative to fossil fuels. However, the availability of starch or sucrose based feedstock such as corn grain or sugar cane is expected to be insufficient to cover future worldwide needs for bioethanol (Gray et al., 2006. Bioethanol. Current Opinion Chemical Biology. 10(2):141-146). A foreseen solution is the utilization of lignocellulosic feedstocks, such as corn stover, wheat straw, sugar cane bagasse, wood, etc (Hahn-Hägerdal et al., 2006. Bioethanol—the fuel of tomorrow from the residues of today. Trends Biotechnol. 24(12):549-556). This requires overcoming new challenges associated with the utilization of these complex raw materials.
A substantial fraction of lignocellulosic material consists of pentoses, xylose and arabinose that need to be efficiently converted to make the bioethanol process cost-effective. Saccharomyces species cannot ferment these pentoses as such and need to be modified to be able to do that. However, attempts have been made to modify Saccharomyces strains to produce ethanol and other fermentation products such as butanol, lactate, 1,4-diacids (succinate, fumaric, malic), glycerol, sorbitol, mannitol, xylitol/arabinitol, L-ascorbic acid, xylitol, hydrogen gas, 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glutaric acid, glutamic acid, itaconic acid, levulinic acid, and 3-hydroxybutyrolactone in an efficient way. Saccharomyces cerevisiae, which can be grown on xylose aerobically and which ferments xylose to ethanol has been obtained, wherein said strain either has genes from the Pichia stipitis xylose pathway or heterologous xylose isomerase (XI) genes and overexpresses the endogenous xylulose kinase gene (Hahn-Hägerdal B, Karhumaa K, Fonseca C, Spencer-Martins I, Gorwa-Grauslund M F (2007). Such strains do not grow anaerobically on xylose as sole carbon source. However, anaerobic growth is a crucial trait for industrial fermentation processes since it renders the yeast viability and viability is directly related to the ability of the yeast to ferment efficiently. Anaerobic xylose growth by recombinant strains of S. cerevisiae has been achieved in haploid laboratory strains by random evolutionary engineering strategies (Sonderegger M, Sauer U (2003) Evolutionary engineering of Saccharomyces cerevisiae for anaerobic growth on xylose. Appl Environ Microbiol 69:1990-8; Kuyper et al (2004) Minimal metabolic engineering of Saccharomyces cerevisiae for efficient anaerobic xylose fermentation: a proof of principle. FEMS Yeast Res 4:655-64). Traits obtained via random strategies are not easily identified, and therefore such traits are difficult to transfer to other strains. Moreover laboratory strains do not ferment toxic lignocellulose hydrolysates (Karhumaa K, Garcia Sanchez R, Hahn-Hägerdal B, Gorwa-Grauslund M F (2007) Comparison of the xylose reductase-xylitol dehydrogenase and the xylose isomerase pathways for xylose fermentation by recombinant Saccharomyces cerevisiae. Microb Cell Fact 6:5).
Furthermore, when applied to polyploid and aneuploid industrial strains random strategies often result in limited improvements. Therefore there is still a need to design well-defined rational metabolic engineering strategies/technologies, which convey traits that provide Saccharomyces sp. strains with the ability to grow and ferment pentose sugars anaerobically and which can be transferred to any other polyploid and aneuploid Saccharomyces sp. strain.
SUMMARY OF THE INVENTIONThe invention relates to a method as well as to new Saccharomyces species strains with improved viability obtained by rational metabolic engineering technology that grow on pentose sugars as sole carbon sources under anaerobic conditions and that produce ethanol and other fermentation products such as butanol, lactate, 1,4-diacids (succinate, fumaric, malic), glycerol, sorbitol, mannitol, xylitol/arabinitol, L-ascorbic acid, xylitol, hydrogen gas, 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glutaric acid, glutamic acid, itaconic acid, levulinic acid, and 3-hydroxybutyrolactone and cell mass. The fact that the novel strains are obtained by rational metabolic engineering technology and lack genes expressed from multicopy plasmids, make it possible to specifically transfer the traits to any industrial polyploid and aneuploid strains.
The invention relates to a Saccharomyces sp. strain, being viable and able to grow on pentose sugars under anaerobic fermentation and comprising in the genome a xylose reductase (XR) gene having NADH-preference, wherein said gene is expressed by a constitutive promoter and increased expression of the xylitol dehydrogenase (XDH).
By using constitutive promoters or parts thereof, such as truncated versions thereof such as those of TDH3, HXT7, TEF1 and PGK1 genes for XR expression and by modifying the P. stipitis XR coenzyme preference by site-directed mutagenesis, i.e., towards NADH-preference it was for the first time possible to obtain both cell growth and ethanolic fermentation under anaerobic conditions using penstose sugars such as xylose as the sole carbon source.
By this invention Saccharomyces is forced towards NADH preference in the xylose to xylitol conversion by XR as well as a higher constitutive flux through the XR, which results in growth without air and oxygen in medium comprising pentose sugars as sole carbon sources, higher production of ethanol and other fermentation products such as butanol, lactate, 1,4-diacids (succinate, fumaric, malic), glycerol, sorbitol, mannitol, xylitol/arabinitol, L-ascorbic acid, xylitol, hydrogen gas, 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glutaric acid, glutamic acid, itaconic acid, levulinic acid, and 3-hydroxybutyrolactoneand and less by-product formation.
In a second aspect the invention relates to a method of producing ethanol/cellmass and other fermentation products comprising the steps of providing a medium comprising xylose and a Saccharomyces sp strain as defined above, adding said medium and strain to a fermentation reactor, performing fermentation with said strain under anaerobic conditions and utilising the carbon source xylose and producing ethanol and other fermentation products such as butanol, lactate, 1,4-diacids (succinate, fumaric, malic), glycerol, sorbitol, mannitol, xylitol/arabinitol, L-ascorbic acid, xylitol, hydrogen gas, 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glutaric acid, glutamic acid, itaconic acid, levulinic acid, and 3-hydroxybutyrolactone.
In a third aspect the invention relates to the use of the invented strains as well as the method disclosed herein.
In the context of the present application and invention the following definitions apply:
The term “analogue thereof” is intended to mean that part of or the entire polypeptide of a polypeptide is based on non protein amino acid residues, such as aminoisobutyric acid (Aib), norvaline gamma-aminobutyric acid (Abu) or ornitihine. Examples of other non protein amino acid residues can be found at http://www.hort.purdue.edu/rhodcv/hort640c/polyam/po00008.htm.
In the present context, amino acid names and atom names are used as defined by the Protein DataBank (PNB) (www.pdb.org), which is based on the IUPAC nomenclature (IUPAC Nomenclature and Symbolism for Amino Acids and Pep-tides (residue names, atom names etc.), Eur J Biochem., 138, 9-37 (1984) together with their corrections in Eur J Biochem., 152, 1 (1985). The term “amino acid” is intended to indicate an amino acid from the group consisting of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenyl-alanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glutamine (Gln or Q), arginine (Arg or R), serine (Ser or S), threonine (Thr or T), valine (Val or V), tryptophan (Trp or W) and tyrosine (Tyr or Y), or derivatives thereof.
The terminology used for identifying amino acid positions is illustrated as follows: K270 indicates that the position 270 is occupied by a Lysine residue in the amino acid sequence encoded by the sequence shown in SEQ ID NO:1. K270R indicates that the Lysine residue of position 270 has been substituted with an Arginine residue.
The term “overexpression/overexpressing” includes that the gene may be upregulated as well as overexpressed. This includes that the endogenous gene may be upregulated as well as a new copy of the gene may be integrated into the strain, optionally into the genome under control of a promoter wherein the promoter optionally can be a constitutive promoter.
The term “rational metabolic engineering” is intended to mean the targeted manipulation of a gene leading to among others higher or lower expression, deletion, site-directed change of nucleotide sequence such that its biological activity is altered. In contrast to random strain development methods such as mutagenesis, evolutionary engineering and cross breeding, rational metabolic engineering therefore is transferable and can be repeated in any strain of choice, including industrial polyploidy and aneuploid isolates. Thus rational metabolic engineering is intended to mean a strain engineering approach in which the resulting strain has only been subjected to modifications whose outcome in terms of genetic features can be known a priori. In addition, a rationally engineered strain is expected to have acquired only genetic features known in terms of their sequence, purposefully inserted in the form of plasmids and/or DNA fragments of known sequence yet not necessarily in terms of number of times this particular sequence is present in the new strain.
InventionThe invention relates to a method as well as to new Saccharomyces species strains with improved viability obtained by rational metabolic engineering technology, wherein said strain grow on pentose sugars as sole carbon sources under anaerobic conditions and produce ethanol and other fermentation products
The invention relates to a Saccharomyces sp. strain, being viable and grow on pentose sugars under anaerobic fermentation comprising in the genome a xylose reductase gene having NADH-preference, wherein said gene is expressed by a constitutive promoter and increased expression of the xylitol dehydrogenase (XDH). One example being that said xylose reductase gene is derived from Pichia stipitis and has the substitution K270R (XRK270R). Another example being that said xylose reductase gene is derived from Pichia stipitis and has the substitution N272D and P275Q in combination (XRN272DP275Q) or separately (XRN272D; XRP275Q).
By the development of such a new strain it is for the first time possible to have a viable strain that can grow under anaerobic conditions using solely pentose as the sugar, such as xylose and still produce high amounts of ethanol and thereby be able to use the strain for commercial purposes in fermentation for the production of for example bioethanol from pentose and hexose carbon sources.
In another embodiment the strain may also have increased level of phosphoglucomutase obtained for instance by expression of PGM2 gene with a constitutive promoter, such as those mentioned above and thereby be able to produce ethanol with higher productivity.
As an alternative may a functional equivalent derivative of any of the mentioned genes within the application be used. The term functionally equivalent derivative includes a protein with catalytic activity for the conversion of a pentose sugar into the corresponding sugar alcohol by means of NADH oxidation or a protein with catalytic activity for the conversion of glucose-1-phosphate to glucose-6-phosphate.
The invented strain(s) will allow the production of fermentation products including ethanol and cell mass under anaerobic conditions on xylose. Anaerobic growth increases cell viability and permits cell recirculation, thus saving carbon for ethanol and fermentation products production. It increases the production of ethanol and fermentation product and improves the overall process economics.
The invented strain may also overexpress the genes involved in the non-oxidative pentose phosphate pathway (PPP) overexpression of the genes transaldolase (TAL1), transketolase (TKL1), ribose 5-phosphate ketol-isomerase (RKI1) and ribulose 5-phosphate epimerase (RPE1). By combining the genomic integrated overexpression of XR with NADH preference (XRK270R or XRN272DP275Q or XRN272D or XRP275Q and/or PGM2 under a constitutive promoter and the non-oxidative PPP the xylose utilisation will be increased compared to when the different modifications are used alone.
The Saccharomyces sp. strain according the description above may also overexpress other genes such as the gene xylulokinase (XK). This will further increase the production of ethanol and other fermentation products such as ethanol, butanol, lactate, 1,4-diacids (succinate, fumaric, malic), glycerol, sorbitol, mannitol, xylitol/arabinitol, L-ascorbic acid, xylitol, hydrogen gas, 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glutaric acid, glutamic acid, itaconic acid, levulinic acid, and 3-hydroxybutyrolactone.
The genes of interest to be introduced/transformed into the Saccharomyces sp. strain may be expressed by a constitutive promoter which will result in that the xylose will continuously be utilised and that the rate of fermentation product formation including ethanol production is high. Examples of promoters are sequences based on promoters for the enzymes/proteins, glyceraldehyde-3-phosphate dehydrogenase, isozyme 3 (TDH3 or YGR192C); a truncated version of the high-affinity glucose transporter of the major facilitator superfamily (HXT7 or YDR342C); 3-phosphoglycerate kinase (PGK1 or YCR012W); and translational elongation factor EF-1 alpha (TEF1 or YPR080W). One example being that the TDH3 promoter is used to express the XRK270R gene and a truncated HXT7 promoter is used to express the PGM2 gene, wherein all genes are stably integrated into the genome of the Saccharomyces sp. strain, thus enabling straight transfer of improved traits to industrial polyploid and aneuploid strains. The promoters may be the complete promoter as ell as parts thereof. The nucleotide sequences showing the TDH3 linked to the XRK270R gene being shown in SEQ ID NO:1 and the nucleotide sequence showing HXT7 linked to the PGM2 gene being shown in SEQ ID NO:2.
The strain of the invention may be selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces bayanus and Saccharomyces carlsbergensis. For example the strain may be Saccharomyces cerevisiae which is used in the EXAMPLES. Other examples of strains are the S. cerevisiae strains DBY746, AH22, S150-2B, GPY55-15Bα, CEN.PK, TMB3500, VTT-A-63015, VTT-A-85068, VTT-c-79093) and their derivatives as well as Saccharomyces sp. 1400, 424A (LNH-ST), 259A (LNH-ST) in addition to any polyploid and aneuploid industrial Saccharomyces isolate found suitable for ethanol production from xylose.
The invented strains have improved properties compared to the wild-type original strains, i.e., consuming a higher amount of xylose faster and producing a higher amount of fermentation products such as ethanol faster. Example on how to determine the improved properties are shown in the EXAMPLES below.
The invention also relates to a method of producing cell mass and fermentation products such as ethanol, butanol, lactate, 1,4-diacids (succinate, fumaric, malic), glycerol, sorbitol, mannitol, xylitol/arabinitol, L-ascorbic acid, xylitol, hydrogen gas, 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glutaric acid, glutamic acid, itaconic acid, levulinic acid, and 3-hydroxybutyrolactone comprising the steps of: providing a medium containing xylose and a Saccharomyces sp strain as defined above, adding said medium and strain to a fermentation reactor and performing fermentation with said strain under anaerobic conditions and utilising the carbon source xylose and producing ethanol. The fermentation may be performed without addition of air, oxygen, and/or nitrogen, with carbon dioxide produced during fermentation generating an anaerobic atmosphere. The method may be a fermentation method, either a batch fed-batch, continuous or continuous fermentation with cell recirculation. The method may use xylose as the sole carbon source or mixtures of carbon sources such as glucose, mannose, galactose, xylose and arabinose. The amount of the different carbon sources depends on the raw material used, where soft woods generally contain higher amounts of the hexose sugars glucose, mannose and galactose, whereas hardwoods and agricultural crops contain higher amounts of the pentose sugars xylose and arabinose. The fermentation may take place at a temperature in the range of about 30-45° C., such as 31, 32, 33, 34, 35, 36, 37, 38, 39° C., 40° C., 41° C., 42° C., 43° C., 44° C. or 45° C. and an acidic pH, such as 6-3. The ethanol yield in the invented method using said invented Saccharomyces sp strains will be from about 0.35 g/g carbon source. Examples of yields are 0.35, 0.40, 0.45, up to 0.5 g/g sugar. The rate of ethanol production may be at least 0.1 g/g biomass/h increasing to 0.6 g/g biomass/h. The xylose consumption rates may be at least 0.28 g/g biomass/h increasing to at least 1 g/g biomass/hour.
Finally the invention relates to the use of Saccharomyces sp strains for the production of ethanol and other fermentation products as defined above.
Following examples are intended to illustrate, but not to limit, the invention in any manner, shape, or form, either explicitly or implicitly.
EXAMPLES Example 1The co-consuming xylose and arabinose Saccharomyces cerevisiae TMB 3061 (Karhumaa, Wiedemann et al. 2006) was subjected to an evolutionary engineering approach in order to increase the uptake of pentose sugars. In the resulting strain TMB3130, it was observed that the fermentation product distribution and notably the XR-driven arabitol production was greatly affected by the carbon source used for inoculum preparation (Garcia Sanchez R., Karhumaa et al. Submitted).
The xylose and arabinose consuming S. cerevisiae strain TMB 3130 is derived from strain TMB3400 that utilizes the ADH1 promoter to control the expression of the Pichia stipitis XYL1 gene that encodes XR (Wahlbom, van Zyl et al. 2003; Garcia Sanchez R., Karhumaa et al. Submitted). The ADH1 promoter has been a common choice for driving heterologous gene expression in S. cerevisiae (Ammerer 1983; Mumberg, Muller et al. 1995). Still, it was investigated whether the change in by-product distribution was caused by differences in XR activity.
Crude extracts were prepared from TMB 3130 cells grown in defined medium supplemented with 20 g/l glucose, 20 g/l xylose, 20 g/l arabinose or the mixture of 20 g/l xylose and 20 g/l arabinose and the XR and XDH activities were measured. In practice, cells grown overnight on YNB medium with glucose were used to inoculate shake flask cultures with different carbon sources: 20 g/L xylose, 20 g/L arabinose, 20 g/L glucose, or a mixture of 20 g/L xylose and 20 g/L arabinose. Next, cells were harvested in exponential phase and washed twice with water. Y-PER reagent (Pierce Biotechnology, Rockford, Ill., USA) was used to extract proteins. The protein concentration was determined with the Coomassie Plus protein assay reagent (Pierce, Rockford, Ill., USA) with bovine serum albumine as standard. XR activity was measured as previously described (Smiley and Bolen 1982; Eliasson, Christensson et al. 2000). XDH activity was adapted as previously reported (Rizzi M 1989) except using triethanolamine buffer at pH 7 (Wahlbom, van Zyl et al. 2003). The experiments were performed in biological triplicates and
- duplicate measurements with different dilutions of the extracted proteins. All assays were performed with an Ultrospec 2100 pro spectrophotometer (Amersham Biosciences, Uppsala, Sweden).
Glucose grown cells displayed a specific XR activity of 0.72±0.06 U (mg protein)−1, while the xylose and arabinose grown cells displayed considerably lower activities, 0.05±0.01 U (mg protein)−1 and 0.13±0.02 U (mg protein)−1, respectively or 0.07±0.04 U (mg protein)−1 on cells grown on the mixture of arabinose and xylose (Table 1).
The results presented for strain TMB 3130 suggest that the ADH1 promoter is not highly activated by pentose sugars. In contrast, the xylitol dehydrogenase (XDH) activity which is controlled by the PGK1 promoter in this strain was more similar for all three sugar media or in the medium with a mixture of xylose and arabinose (Table 1). In light of these results, we conclude that the ADH1 promoter is not the most appropriate to use when engineering S. cerevisiae for pentose fermentation whereas PGK1 promoter is a suitable promoter. The ADH1 promoter is not strongly activated when S. cerevisiae is grown on pentose sugars.
- Ammerer, G. (1983). “Expression of Genes in Yeast Using the Adci Promoter.”Methods in Enzymology 101: 192-201.
- Eliasson, A., C. Christensson, et al. (2000). “Anaerobic xylose fermentation by recombinant Saccharomyces cerevisiae carrying XYL1, XYL2, and XKS1 in mineral medium chemostat cultures.” Appl Environ Microbiol 66(8): 3381-6.
- Garcia Sanchez R., K. Karhumaa, et al. (Submitted). “Evolutionary engineering of a D-xylose and L-arabinose co-utilizing industrial and recombinant Saccharomyces cerevisiae strain.”
- Karhumaa, K., B. Wiedemann, et al. (2006). “Co-utilization of L-arabinose and D-xylose by laboratory and industrial Saccharomyces cerevisiae strains.” Microb Cell Fact 5: 18.
- Mumberg, D., R. Muller, et al. (1995). “Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds.” Gene 156(1): 119-22.
- Rizzi M, H. K., Erlemann P, Bui-Thahn N A, Dellweg H (1989). “Purification and properties of the NAD+-xylitol-dehydrogenase from the yeast Pichia stipitis.” J Ferment Bioeng 67: 20-24.
- Smiley, K. L. and P. L. Bolen (1982). “Demonstration of D-xylose reductase and D-xylitol dehydrogenase in Pachysolen tannophilus.” Biotech Lett 4: 607-610.
- Wahlbom, C. F., W. H. van Zyl, et al. (2003). “Generation of the improved recombinant xylose-utilizing Saccharomyces cerevisiae TMB 3400 by random mutagenesis and physiological comparison with Pichia stipitis CBS 6054.” FEMS Yeast Res 3(3): 319-26.
S. cerevisiae strains expressing XR under ADH1 and TDH3 promoters were constructed and evaluated for growth on xylose.
Strain ConstructionPlasmids and strains used in the construction are summarized in Table 2. A DNA cassette containing ADH1p-XYL1-ADH1t PGK1p-XYL2-PGK1t was inserted into YIplac211 (Gietz and Sugino, 1988) creating YIpOB2. The XYL1 gene was removed from YIpOB2 by digestion with XbaI and self-ligation to create YIpOB3. Restriction endonuclease recognition sites in primer sequences are indicated by underlined or italic letters. The glyceraldehyde-3-phosphate dehydrogenase isozyme 3 (TDH3) promoter was amplified from the vector p426GPD using primers containing restriction sites HindIII, AscI (5′-GCATAAGCTTGGCGCGCCAGTTTATCATTATCAATACTCGCCATTTC-3′) and XbaI (5′-GCATTCTAGAATCCGTCGAAACTAAGTTC-3′). The plasmid YIpOB7 was created by replacing the alcohol dehydrogenase isozyme 1 (ADH1) promoter in plasmid YIpOB3 with the TDH3 promoter PCR product using restriction sites HindIII and XbaI The Pichia stipitis XYL1 gene fragment was excised from plasmid YIpOB2 and inserted into YIpOB7 using the XbaI restriction sites creating plasmid YIpOB8. The constructed plasmids were analyzed with restriction analysis and PCR to confirm correct insertions. The inserted parts were sequenced to verify that no mutations were introduced. YIpOB2 was cleaved with restriction enzyme ApaI within the URA3 gene and transformed into TMB 3044 (Karhumaa et al., 2005), resulting in strain TMB 3321. Plasmid YIpOB8 was cleaved with restriction enzyme Eco32I within the URA3 gene and transformed into strain TMB3044 (Karhumaa et al., 2005), resulting in strain TMB3325.
Yeast cultures were inoculated with cells washed with sterile H2O to an optical density at 620 nm (OD620) of 0.2. S. cerevisiae strains TMB3321 and TMB3325 were grown aerobically in 500 ml baffled flasks containing 50 ml YNB medium, buffered to pH 5.5 with 50 mM potassium hydrogen phthalate, supplemented with 50 g l−1 xylose and 13.4 g l−1 YNB at 30° C. and 200 rpm. Each strain was cultivated in biological triplicates. Growth was determined by measuring OD620 with a Hitachi U-1800 Spectrophotometer (Hitachi Ltd., Tokyo, Japan).
Strain TMB3325, harbouring the constitutive TDH3 promoter, grew aerobically on xylose at a stable exponential growth rate of 0.18±0.01 h−1 (
- Gietz, R. D. and Sugino, A. (1988). New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74, 527-534.
- Karhumaa et al. (2005). Investigation of limiting metabolic steps in the utilization of xylose by recombinant Saccharomyces cerevisiae using metabolic engineering. Yeast. 22(5):359-368.
- Mumberg, et al. (1995). Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156:119-22.
A reporter strain for the evaluation of TDH3 promoter on different carbon sources was constructed and tested on glucose and xylose.
Strain ConstructionRestriction endonuclease recognition sites in primer sequences are indicated by underlined or italic letters. The E. coli LacZ gene was amplified by whole-cell PCR from strain BL21-DE3 (Stratagene, La Jolla, Calif., USA) with primers containing restriction sites for HindIII (5′-GCGCAAGCTTATGACCATGATTACGGATT-3′) and SalI (5′-GTGAGTCGACTTATTTTTGACACCAGACC-3′). The PCR product was inserted into the vector p426GPD (Mumberg et al., 2005) creating plasmid p426lac (Table 3). Plasmid YIpOB1 (Table 3) was integrated into strain TMB3043 (Karhumaa et al., 2005) resulting in strain TMB3320 (Table 3). TMB3320 was transformed with plasmid p426lac resulting in strain TMB3095. Strain TMB3095 is able to grow on xylose as a sole carbon source and the expression of TDH3 promoter can be measured as beta-galactosidase activity.
Reporter Gene Activity Measurement During Aerobic Growth on Xylose or GlucoseS. cerevisiae strain TMB3095, able to grow on xylose as a sole carbon source and expressing LacZ reporter gene controlled by TDH3 promoter, was grown in 1 l baffled flasks containing 0.1 l YNB medium supplemented with 50 g l−1 xylose and 13.4 g l−1 YNB or 20 g l−1 glucose and 6.7 g l−1 YNB. Crude cell extracts were prepared from cells harvested in exponential growth phase with Yeast Protein Extraction Reagent (Y-PER) (PIERCE, Rockford, Ill., USA) according to the manufacturer's instructions. Crude protein extracts were used for beta-galactosidase activity measurements as previously described (Rupp, 2002). One unit of beta-galactosidase is defined as the amount of enzyme needed to hydrolyze one nmol of 2-nitrophenyl beta-D-galactopyranoside per minute.
TMB3095 was grown aerobically in YNB medium containing 20 g l−1 glucose or 50 g l−1 xylose (
- Karhumaa et al. (2005). Investigation of limiting metabolic steps in the utilization of xylose by recombinant Saccharomyces cerevisiae using metabolic engineering. Yeast. 22(5):359-368.
- Mumberg, et al. (1995). Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156:119-22.
- Rupp (2002). LacZ assays in yeast-Quantification of β-galactosidase activity in Guthrie, C. and Fink, G. (Eds), Guide to yeast genetics and molecular cell biology, part B, Academic Press, pp. 128-129.
Escherichia coli strain DH5α (Life Technologies, Rockville, Md., USA) was used for cloning. Plasmids and S. cerevisiae strains are summarized in Table 4. All strains were stored in 15% glycerol at −80° C. E. coli was grown in LB-medium (Ausubel et al., 1995). Yeast cells from freshly streaked YPD plates (Ausubel et al., 1995) or defined mineral medium plates (Jeppsson et al., 2006) were used for inoculation. Liquid cultures of S. cerevisiae were grown in YPD medium (Ausubel et al., 1995) or defined mineral medium (Jeppsson et al., 2006). Defined mineral medium (Jeppsson et al., 2006) supplemented with 0.4 g l−1 Tween 80, 0.01 g l−1 ergosterol and 0.5 ml l−1 antifoam (Dow Corning® Antifoam RD Emulsion, VWR International Ltd, Poole, UK) was used in anaerobic fermentation.
Genetic TechniquesPlasmid DNA was prepared with the GeneJET™ Plasmid Miniprep Kit (Fermentas UAB, Vilnius, Lithuania). Agarose gel DNA extraction was made with QIAquick® Gel Extraction Kit (Qiagen GmbH, Hilden, Germany). Primers from MWG-Biotech AG (Ebersberg, Germany) and Pfu DNA Polymerase and dNTP from Fermentas (Vilnius, Lithuania) were used for polymerase chain reactions (PCR). Primers used are listed in Table 2. PCR amplification was performed in a GeneAmp PCR system 9700 (Applied Biosystems, Foster City, Calif., USA). PCR product purification was made with the E.Z.N.A.® Cycle-Pure Kit (Omega Bio-tek Inc, Doraville, Ga., USA). BigDye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) was used for DNA sequencing reactions. Sequencing was performed by BM labbet AB (Furulund, Sweden). Restriction endonucleases, Shrimp Alkaline Phosphatase and T4 DNA Ligase from Fermentas (Vilnius, Lithuania) were used for DNA manipulation. The XYL1 gene from Candida parapsilosis was commercially synthesized (GenScript Corp., Piscataway, N.J., USA) with codons optimized for S. cerevisiae expression.
Competent E. coli DH5α cells were prepared and transformed as described elsewhere (Inoue et al., 1990) and transformed E. coli strains were selected on LB plates (Ausubel et al., 1995) containing 100 mg l−1 ampicillin (IBI Shelton Scientific, Inc., Shelton, Conn.). E. coli strains were grown in LB medium containing 100 mg l−1 ampicillin for plasmid amplifications. Yeast strains were transformed with the lithium acetate method (Güldener et al., 1996) and transformed yeast strains were selected on defined mineral medium plates containing 20 g l−1 glucose.
Construction of TMB 3200The P. stipitis XYL1 gene carrying the K270R (Lys270Arg) mutation was generated by site-directed mutagenesis using the overlap extension PCR protocol (Ho et al., 1989). In the first step, two separate PCR amplifications were made using plasmid YIplac211 PGK XYL1 (K270M) (Jeppsson et al., 2006) as template, primers 5XYL1s and 3K270R (Table 5) in one reaction mix and primers 5K270R and 3XYL1s (Table 5) in the other. Primers 3K270R and 5K270R are complementary to each other. In the second step, the two PCR products were mixed with primers 5XYL1s and 3XYL1s and fused together by PCR forming XYL1 (K270R). The product was cut with BamHI and inserted after the PGK1 promoter at the BglII site of YIplac211 PGK (Jeppsson et al., 2006), resulting in YIplac211 PGK XYL1 (K270R). The mutation was verified by sequencing. YIplac211 PGK XYL1 (K270R) was cleaved with Bpu10I within the URA3 gene and transformed into TMB 3265 (Träff-Bjerre et al., 2004) resulting in TMB 3200.
Construction of TMB 3321, TMB 3322, TMB 3323 and TMB 3324Primers pY7-XR-for and pY7-XR-rev (Table 5) were used to amplify ADH1p-XYL1-ADH1t with PCR. Primers pY7-XDH-for and pY7-XDH-rev (Table 5) were used to amplify PGK1p-XYL2-PGK1t. Plasmid pY7 (Walfridsson et al., 1997) was used as a template in both cases. ADH1p-XYL1-ADH1t was digested with HindIII and PstI, and PGK1p-XYL2-PGK1t was digested with PstI and SacI. The resulting fragments were inserted into YIplac128 (Gietz and Sugino, 1988) creating YIpOB1. The DNA cassette containing ADH1p-XYL1-ADH1t PGK1p-XYL2-PGK1t was excised with HindIII and SacI and inserted into YIplac211 (Gietz and Sugino, 1988) creating YIpOB2. The XYL1 gene was removed from YIpOB2 by digestion with XbaI and self-ligation to create YIpOB3. YIplac211 PGK XYL1 (K270M), YIplac211 PGK XYL1 (K270R) and pUC57 CpXR were digested with XbaI and the XYL1 (K270M), XYL1 (K270R) and XYL1 (C. parapsilosis) fragments were inserted into the XbaI site of YIpOB3, resulting in YIpOB4, YIpOB5 and YIpOB6, respectively. Correct orientations and sequences of the inserts were verified by restriction analysis and sequencing. YIpOB2, YIpOB4, YIpOB5 and YIpOB6 were cleaved with ApaI within the URA3 gene and transformed into TMB 3044 (Karhumaa et al., 2005). This resulted in strains TMB 3321, TMB 3322, TMB 3323 and TMB 3324, respectively, henceforth referred to as Y-PsNative, Y-PsK270M, Y-PsK270R and Y-CpXR.
Strain TMB 3200 expressing the K270R mutant of P. stipitis XR (Table 4) was constructed to assess the influence of the mutation on xylose fermentation by recombinant S. cerevisiae. The strain was compared in anaerobic continuous fermentation with TMB 3001 (Eliasson et al., 2000), which carries the native P. stipitis XR, XDH and overexpressed endogenous XK. Increased ethanol yield and decreased xylitol yield was observed but the xylose utilization rate was not improved (results not shown). It was suspected that the xylose utilization rate was limited by other factors than the cofactor imbalance caused by the NAD(P)H-dependent XR and the strictly NAD+-dependent XDH.
Overexpression of XK together with the non-oxidative pentose phosphate pathway improved xylose utilization by recombinant S. cerevisiae (Karhumaa et al., 2005; Kuyper et al., 2005). Also, the deletion of the endogenous aldose reductase GRE3 minimized background XR activity and decreased xylitol formation (Träff et al., 2001). Four isogenic CEN.PK-based strains (Table 4) with these features were constructed to evaluate how the kinetic properties of XR:s affect xylose fermentation by recombinant S. cerevisiae. Strain Y-PsNative carrying the native P. stipitis XR served as a reference strain. Y-PsK270M contained the K270M mutant of P. stipitis XR that previously has been shown to reduce xylitol yield and increase ethanol yield in xylose fermentation (Jeppsson et al., 2006b). Y-PsK270R expressed the K270R mutant of P. stipitis XR and Y-CpXR contained a synthesized C. parapsilosis XYL1 gene (Lee et al., 2003) that had been codon optimized for S. cerevisiae expression.
Example 5 Anaerobic Fermentation Using Genetically Modified Strains Carrying Mutated or Native XR AnalysesGrowth was followed by measuring OD620 with a Hitachi U-1800 Spectrophotometer (Hitachi Ltd., Tokyo, Japan). Concentrations of glucose, xylose, xylitol, glycerol, pyruvate, acetate, ethanol and succinate were determined by high-performance liquid chromatography (HPLC; Waters, Milford, Mass., USA) with an Aminex HPX-87 H ion exchange column (Bio-Rad, Hercules, Calif., USA), refractive index detector (RID-6A, Shimadzu, Kyoto, Japan) and UV detector (2487, Waters). The mobile phase was 5 mM H2SO4, temperature 45° C. and flow rate 0.6 ml min−1. The composition of the outgoing gas was monitored by a Carbon Dioxide and Oxygen Monitor Type 1308 (Brüel & Kjaer, Copenhagen, Denmark). Cell dry weight was determined in triplicate by filtering a known volume of culture broth through 0.45-μm Supor® 450 Membrane filters (Pall Life Sciences, Ann Arbor, Mich., USA), after which the filters were dried in a microwave oven and weighed. The fractions of protein, polysaccharides (Herbert et al., 1971), and RNA (Benthin et al., 1991) in the biomass were determined for the continuous fermentation. A previously developed stoichiometric model (Wahlbom et al., 2001) was used to estimate the intracellular carbon fluxes in continuous fermentation.
Ethanol evaporation was determined experimentally for the setup used for continuous fermentation. Ethanol was added to a fermentor sparged with a nitrogen gas flow of 0.2 l min−1 and the ethanol concentration was measured over time. The evaporation rate followed eqn (1) with a proportionality constant of k=0.004.
dCEthanol/dt=−kCEthanol (1)
Ethanol evaporation was estimated for all continuous fermentations and constitutes together with ethanol measured by HPLC the total ethanol production.
Batch FermentationAnaerobic batch fermentation was carried out in 3-1 ADI Autoclavable Bio Reactor Systems (Applikon, Schiedam, The Netherlands) with a working volume of 1 liter. Cells were pre-cultivated in shake flasks in defined mineral medium with 20 g l−1 glucose, washed with sterile water and inoculated into the bioreactor to an optical density at 620 nm (OD620) of 0.2. Defined mineral medium with doubled concentration of all salts, trace elements and vitamins, containing 20 g l−1 glucose and 50 g l−1 xylose, was used. The temperature was 30° C., stirring was set to 200 rpm and pH 5.5 was maintained by addition of 3 M KOH. Anaerobic conditions were attained by sparging with nitrogen gas containing less than 5 ppm O2 (AGA GAS AB, Sundbyberg, Sweden) before inoculation. During fermentation, anaerobic conditions were maintained by the produced CO2 that diffused through a water lock. The experiments were performed at least in biological duplicates.
Strains Y-PsNative, Y-PsK270M and Y-PsK270R (cf example 4) were compared in anaerobic batch fermentation with 20 g l−1 glucose and 50 g l−1 xylose (
Continuous fermentation was conducted anaerobically in 2-1 Biostat®A bioreactors (B. Braun Biotech International, Melsungen, Germany) with a working volume of 1 liter. Defined mineral medium with 10 g l−1 glucose and 10 g l−1 xylose was used for pre-cultivation and continuous fermentation. Cells pre-cultivated in shake flasks and washed with sterile water were used to inoculate the bioreactor to an OD620 of 0.2. Continuous fermentation at dilution rates of 0.06 and 0.12 h−1 was started after glucose depletion. The temperature was 30° C., stirring 200 rpm and pH 5.5 was maintained by addition of 3 M KOH. Anaerobic conditions were obtained by sparging with nitrogen gas containing less than 5 ppm O2 (AGA GAS AB, Sundbyberg, Sweden) at a constant gas flow of 0.2 l min−1 controlled by mass flow meters (Bronkhorst HI-TEC, Ruurlo, the Netherlands). The off-gas condensers were cooled to 4° C., and the medium reservoirs were continuously sparged with nitrogen gas. Steady state was assumed after five residence times, and the experiments were performed in biological duplicates.
Y-PsNative and Y-PsK270R were compared in anaerobic continuous fermentation with a feed containing 10 g l−1 glucose and 10 g l−1 xylose (Table 7). The continuous fermentation results were generally in agreement with the batch fermentation results. Y-PsK270R gave 4% higher ethanol yields than Y-PsNative at both dilution rates. Y-PsK270R showed 17% and 9% higher specific xylose consumption rates and gave 60% and 78% lower xylitol yields compared to the reference strain Y-PsNative at dilution rates 0.06 h−1 and 0.12 h−1 respectively. Y-PsK270R also gave 17% and 22% lower glycerol yields than Y-PsNative at dilution rates 0.06 h−1 and 0.12 h−1 respectively.
The metabolic fluxes through Y-PsNative and Y-PsK270R where estimated using a stoichiometric model (Wahlbom et al., 2001). The flux values were normalized to a total specific sugar consumption of 100 mmol g−1 biomass h−1. The xylose fraction of the total specific sugar consumption was smaller for both strains at dilution rate 0.12 h−1 compared to 0.06 h−1. According to the model, Y-PsK270R utilized a larger fraction of NADH in the XR reaction (90 and 100%) than Y-PsNative (59 and 74%) at dilution rates 0.06 h−1 and 0.12 h−1 respectively. The model also predicted that a smaller fraction of glucose-6-phosphate entered the oxidative pentose phosphate pathway in Y-PsK270R (11% and 7%) than in Y-PsNative (14% and 12%) at dilution rates 0.06 h−1 and 0.12 h−1 respectively.
Strains were cultivated for enzyme activity measurements in defined mineral medium containing 20 g l−1 glucose and harvested in the exponential growth phase. Cells were washed with sterile water and treated with yeast protein extraction solution Y-PER (Pierce, Rockford, Ill., USA). Coomassie Protein Assay Reagent (Pierce) was used to determine protein concentration with Albumin Standard (Pierce). NAD(P)H-dependent XR activity was determined using an Ultrospec 2100 pro spectrophotometer (Amersham Biosciences, Uppsala, Sweden) operating at 30° C. and 340 nm (εNAD(P)H=6220 M−1 cm−1). Triethanolamine buffer (100 mM, pH 7.0) was used and reactions were started by the addition of xylose. Functional XR expression was confirmed using a standard assay with 200 μM NAD(P)H and 350 mM xylose as previously described (Eliasson et al., 2000). XR kinetics in crude extracts from strains Y-PsNative, Y-PsK270M and Y-PsK270R (cf example 4) were determined, with concentrations of xylose and NAD(P)H varied over at least five levels, ranging from less than half to more than 5 times the respective apparent Km value. The initial rates were fitted by unconstrained nonlinear optimization in MatLab R2006a to eqn (2), which describes the initial rate for a two substrate reaction following a compulsory-order ternary-complex mechanism (Cornish-Bowden, 2004).
ν=Vmax[A][B]/(KiAKmB+KmB[A]+KmA[B]+[A][B]) (2)
Vmax is the maximum velocity, [A] and [B] are the concentrations of NAD(P)H and xylose, respectively, KmA and KmB are the Michaelis constants of NAD(P)H and xylose, respectively, and KiA is the dissociation constant of NAD(P)H.
Crude extracts of strains Y-PsNative, Y-PsK270M, Y-PsK270R and Y-CpXR were analyzed for functional XR expression with a standard assay (200 μM NAD(P)H, 350 mM xylose) (Table 8). Y-PsK270M displayed only about 34% and 36% of the NADPH and NADH dependent XR activities compared to the reference strain Y-PsNative. In contrast, Y-PsK270R showed 2.4-fold and 3.2-fold higher NADPH and NADH dependent XR activities compared to Y-PsNative. Y-CpXR with the C. parapsilosis XYL1 did not display any significant NADPH or NADH dependent XR activity. The two P. stipitis XR mutants displayed no change of cofactor preference compared to the native XR under standard assay conditions (Table 8).
A kinetic study was made on crude extracts from strains Y-PsNative, Y-PsK270M and Y-PsK270R. The data was fitted to eqn (2) and the resulting constants are summarized in Table 8. Compared with native XR from P. stipitis, the K270M mutation resulted in a significant increase in the Km values for both NADPH and NADH. In fact, the kinetic parameters for the NADH-linked reaction catalyzed by the K270M mutant could not even be determined since this mutant could not be saturated with NADH. The K270R mutation increased the Km value for NADPH 25-fold, while the Km for NADH only increased 2-fold.
The XYL/(K270R) gene fragment was excised from plasmid YIpOB5 (Table 9) and inserted into YIpOB7 (Table 9), carrying P. stipitis XDH gene, using the XbaI restriction sites, creating plasmid YIpOB9 (Table 9), an integrative plasmid harboring XYL1 (K270R) gene under the control of TDH3 promoter and P. stipitis XYL2 gene under the control of PGK1 promoter. Strain TMB3043 (Karhumaa et al., 2005) was transformed with the integrative plasmid YIPOB9, and the new strain was named TMB3662. Strain TMB3662 was transformed with the integrative plasmid YIplac128 (Gietz and Sugino, 1988), and the new strain was named TMB3415.
Strain TMB3415 was used for two-phase aerobic/anaerobic fermentation experiments.
Aerobic growth Erlenmeyer baffled flasks and two-phase aerobic/anaerobic fermentation were performed in mineral medium (Jeppsson et al., 2006). The medium contained 60 g l−1 xylose (Acros Organics, Geel, Belgium) as sole carbon source. When used for fermentation in bioreactor, the medium was supplemented with 0.4 g l−1 Tween 80 (Sigma-Aldrich, St. Louis, USA), 0.01 g l−1 ergosterol (Alfa Aesar, Karlsruhe, Germany).
S. cerevisiae was grown aerobically in Erlenmeyer baffled flasks filled to maximum 1/10 of the volume with medium, incubated at 30° C. in a rotary shake-incubator (INR-200 shake incubator, Gallenkamp, Leicester, UK) at 200 rpm.
Two-phase aerobic/anaerobic batch fermentation was performed in 2 l working volume bioreactors (Applikon Biotechnology, Schiedam, The Netherlands), for at least 175 h in total, at 30° C., at pH 5.5 automatically controlled by addition of 3M KOH. Prior to inoculation, aerobic conditions were established by sparging sterile air at 0.4 l min−1 flow rate with constant stirring at 500 rpm.
Cells were pre-grown aerobically in shake flasks in defined mineral medium (Jeppsson at al., 2006), harvested by centrifugation, resuspended in ˜10 ml sterile medium and inoculated in the fermentor at an initial O.D.620nm of 0.2±0.02. Aerobic growth on xylose was followed by OD measurement. At O.D.620nm=1.0 air feed was switched to N2 (<5 ppm O2, AGA, Malmö, Sweden) at 0.2 l min−1 flow rate in order to establish anaerobic conditions. Oxygen free conditions were ensured by measuring the off-gas composition and the dissolved oxygen concentration in the fermentor. Anaerobic growth and ethanol production were followed for at least 165 hours. Experiments were performed at least in duplicate. A representative plot of biomass production during aerobic and anaerobic conditions is depicted in
At each sampling point, samples were drawn from the fermentors after discharging the sample tubing dead-volume, cells were quickly separated by centrifugation and the supernatant was stored at −20° C. until further analysis.
Concentrations of xylose, xylitol acetate, glycerol and ethanol were determined by high performance liquid chromatography (HPLC) (Waters, Milford, Mass., US). The compounds were separated with an Aminex HPX-87H resin-based columns (Bio-Rad, Hercules, Calif., US) preceded a Micro-Guard Cation-H guard column (Bio-Rad, Hercules, Calif., US). Separation was performed at 45° C., with 5 mM sulphuric acid at a flow rate of 0.6 ml min−1 as mobile phase. Compounds were detected by UV or refractive index detection (Shimadzu, Kyoto, Japan). Each sample was analyzed at least in duplicate.
Oxygen and CO2 concentration in the outlet exhaust of the fermentor was constantly monitored with a Carbon Dioxide and Oxygen Monitor Type 1308 (Brüel and Kjaer, Copenhagen, Denmark).
For each fermentation experiment, dry weight measurements were made in two points at least, in triplicate for each point. The end point of the aerobic phase (O.D.620nm=1.0) and the point O.D.620nm=4.0 in the anaerobic phase at were always included. For dry weight determination, a known volume of cell culture was filtered through dry pre-weighed 0.45 μm nitrocellulose filters, which were subsequently dried in a microwave oven and weighed.
The maximum specific growth rate, μ, was calculated for both the aerobic and the anaerobic phase from exponential fitting of O.D.620nm vs. time. Xylose uptake and products formation rates were calculated for the anaerobic phase by assuming a pseudo-steady state during exponential anaerobic growth, between O.D.620nm=1.0 and O.D.620nm=6.0. Pseudo-steady state was validated by observing constant consumption and production rates within the measurement range. Rates of product formation and substrate consumption were calculated by nonlinear regression on measured values of analyte and biomass concentration. Carbon balance of the calculated rates closed to 95-105%.
The calculated maximum specific growth rate for the aerobic phase was 0.2 h−1, while the calculated maximum specific growth rate for the anaerobic phase was 0.0237 h−1.
Calculated rates are reported in Table 10, where: rx, specific biomass production rate; rs, specific substrate consumption rate; re, specific ethanol production rate; rg, specific glycerol production rate; ra, specific acetate production rate; rxol, specific xylitol production rate; rco2, specific CO2 production rate; Ysx, biomass produced per unit of consumed substrate; Yse, ethanol produced per unit of consumed substrate; Ysxol, xylitol produced per unit of consumed substrate.
- Gietz, R. D. and Sugino, A. (1988). New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74, 527-534.
- Jeppsson, M., Bengtsson, O., Franke, K., Lee, H., Hahn-Hägerdal, B. and Gorwa-Grauslund, M. F. (2006). The expression of a Pichia stipitis xylose reductase mutant with higher K(M) for NADPH increases ethanol production from xylose in recombinant Saccharomyces cerevisiae. Biotechnol Bioeng 93, 665-673.
- Karhumaa et al. (2005). Investigation of limiting metabolic steps in the utilization of xylose by recombinant Saccharomyces cerevisiae using metabolic engineering. Yeast. 22(5):359-368.
- van Dijken, J. P., Bauer, J., Brambilla, L., Duboc, P., Francois, J. M., Gancedo, C., Giuseppin, M. L. F., Heijnen, J. J., Hoare, M., Lange, H. C., Madden, E. A., Niederberger, P., Nielsen, J., Parrou, J. L., Petit, T., Porro, D., Reuss, M., van Riel, N., Rizzi, M., Steensma, H. Y., Verrips, C. T., Vindeløv, J. and Pronk, J. T. (2000). An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains. Enz Microb Technol 26, 706-714.
The multicopy plasmid YEplacHXT (Karhumaa, Hahn-Hägerdal et al. 2005) was used to introduce multiple copies of PGM2 gene in strain CENPK 113-11C (Entian and Kötter 1998). The YEplacHXT vector (Karhumaa, Hahn-Hägerdal et al. 2005) was double digested with BamHI and PstI to linearize it between the HXT7′ promoter (Hauf, Zimmermann et al. 2000) and PGK terminator. Transformation of S. cerevisiae CEN-PK 113-11C with the cleaved vector YEplacHXT generated strain TMB 3126 (Table 11). The PGM2 gene was amplified from genomic DNA of TMB 3400 (Table 11) (Wahlbom, van Zyl et al. 2003) with primers that had overhangs (underlined) homologous to the end of HXT7′ promoter (5′TTTTTTAATTTTAATCAAAAAAGGATCCCCGGGCTGCAATGTCATTTC AATTGAAACG-3′) and the beginning of PGK terminator (5′CCACCACCAGTAGAGACATGGGAGATCTAGAATTCCTTTAAGTACGA A CCGTTGG-3′) to enable double recombination between PGM2 with overhangs and the linearized plasmid to form the plasmid YEplacHXT-PGM2 (Table 11) while yeast was transformed generating strain TMB 3127 (Table 11). Transformant colonies were selected on defined medium supplemented with histidine and uracil was excluded to select for recovery of auxotrophy. The YDp-H plasmid was extracted from E. coli JM101 to be used as template for amplification of the HIS3 locus by PCR with the primers his3YDpH_prom 5′GCGATTGGCATTATCAC 3′ and his3YDpH-rev 5′GCAGCTTTAAATAATCGG 3′. The HIS3 amplicon was transformed and integrated in yeast strains TMB 3126 and TMB 3127, to generate strains Control m, TMB 3128, and PGM2 m, TMB 3129, respectively (Table 11). Transformants were selected on defined mineral medium without supplementation. Plasmids were rescued and transformed into E. coli DH5α for verification. Analytical PCR of recovered plasmids confirmed that the extra copy of PGM2 under the HXT7p′ was present in PGM2 m but not in the Control m strain. TMB 3129 henceforth refer to as PGM2 m; and its corresponding control strain harbouring the multicopy plasmid YEplacHXT without the structural gene PGM2, TMB 3128, henceforth referred to as Control m (Table 11).
Genomic Integration of PGM2For the construction of the strains Control i, TMB 3135 and PGM2 i, TMB 3136 (Table 11), the HIS3 amplicon was transformed into S. cerevisiae CEN-PK 113-11C as described above to generate strain TMB 3134 (Table 11). Yeast transformants were selected on defined mineral medium supplemented with uracil. The purified plasmid YEplacHXT-PGM2 (Table 11) from strain PGM2 m was used as template to PCR amplify with PWO-polymerase the amplicon HXT7′p-PGM2-PGKt with overhangs to include Sal I restriction sites to be cloned into the integrative vector YIplac211 (Gietz and Sugino 1988) (Table 11), using primers: PGK SalI (5′ ATCTGTCGACGACATAGAAATATCGAATGG 3′) homologous to PGKt and HXT SalI (5′ ATCTGTCGACAGGAACAATTTCGGGCC 3′) homologous to HXT7′ p (homologous sequences are underlined). The PCR product HXT7′p-PGM2-PGKt and the vector YIplac211 were cleaved with restriction enzyme SalI and treated with SAP enzyme. PCR product HXT7′p-PGM2-PGKt and the cleaved vector YIplac211 were ligated with T4 ligase enzyme. The ligation mixture was transformed into E. coli DH5α competent cells and transformants were selected on LB plates with 100 mg/L ampicillin. To verify positive transformants carrying YIplac211 HXT-PGM2, several clones were selected and grown overnight on LB liquid medium with 100 mg/L ampicillin. Plasmids were extracted and cleaved with restriction enzymes to confirm the proper size of the cleaved fragments and also by analytical PCR.
Purified plasmids YIplac211 and YIplac211 HXT-PGM2 (Table 11) from E. coli were cleaved in the URA locus EcoRV and treated with SAP. Plasmids were used to transform the yeast strain TMB 3134 targeting the URA locus. Thus strain Control i, TMB 3135, was generated by integration of cleaved YIplac211 and strain PGM2 i, TMB 3136, by integration of YIplac211 HXT-PGM2 (Table 11). Transformants were selected on defined mineral medium without supplementation.
Genomic integration of HXT7′ p-PGM2-PGKt was verified by analytical PCR of genomic DNA extracted from Control i and PGM2 i.
PGM2 Overexpression in Xylose Utilizing StrainsThe xylose utilizing strain TMB 3320 (Bengtsson, Bettiga et al. Submitted) (Table 11), which has been genetically modified to improve xylose fermentation (Träff, Otero Cordero et al. 2001; Jeppsson, Johansson et al. 2002; Karhumaa, Hahn-Hägerdal et al. 2005) was transformed with EcoRV linearized plasmids YIplac211 and YIplac211 HXT-PGM2 in the URA locus (Table 11), to generate strains Control-PPP-XYL, TMB 3137, and strain PGM2-PPP-XYL, TMB 3138, respectively (Table 11).
Other xylose utilizing strains were constructed from strain CEN PK 113-11C hence harboring less genetic modifications known to favour xylose utilization. Plasmid YIpXR/XDH/XK (Eliasson, Christensson et al. 2000) (Table 11) was extracted from E. coli DH5α and cleaved with PstI in the HIS3 locus. The linearized plasmid was transformed into S. cerevisiae strain CENPK 113-11C. Transformants were selected on defined mineral medium supplemented with uracil. Integration of genes encoding the xylose pathway was verified by growth on defined medium with 50 g/l xylose. Strain CENPK 113-11C harbouring the integrated YIpXR/XDH/XK was further transformed with plasmids YIplac211 and YIplac211HXT-PGM2 (Table 11) that were cleaved in the URA-locus with EcoRV. The strain harbouring integrated YIplac211 and YIpXR/XDH/XK was named Control-XYL, TMB 3139, and the one harbouring YIplac211 HXT-PGM2 and YIpXR/XDH/XK was named PGM2-XYL, TMB 3140 (Table 11). Transformants were selected on defined mineral medium without nutrient supplementation. Positive transformants recovered uracil auxotrophy.
Genomic DNA was extracted from Control-PPP-XYL, PGM2-PPP-XYL, Control-XYL and PGM2-XYL and by analytical PCR integration events were verified.
Yeast Nitrogen Base medium (YNB) (6.7 g/1 Difco Yeast Nitrogen Base without aminoacids; Becton, Dickinson and Company, Sparks, Md., USA) was supplemented with 50 g/l xylose as sole carbon source to assess growth. YNB liquid medium was buffered with potassium hydrogen phthalate (10.21 g/l phthalate, 2.1 g/l KOH, pH 5.5) (Hahn-Hagerdal, Karhumaa et al. 2005). The concentration of YNB was doubled when the sugar concentration was more than 20 g/l to avoid nutrient limitation. Pre-cultures and aerobic batch cultivation experiments were performed at 30° C. and 180-200 rpm agitation (Gallenkamp INR-200, Leicester, UK). Pre-cultures grown in YNB with 20 g/l glucose until mid-late exponential phase overnight on 50 ml tubes with approximately 5 ml growth medium were used to inoculate aerobic batch cultures at OD620 nm0.1-0.2 in cotton-stoppered baffled 500 ml flasks with 50 ml growth medium. Aerobic growth cultures were performed at least in duplicate.
Defined mineral medium (YNB) was supplemented with aminoacids or cyclic nitrogenous bases for auxotrophic strains when required for selection. Histidine and uracil were added at a concentration of 40 mg/L and 20 mg/L, respectively (Hahn-Hagerdal, Karhumaa et al. 2005).
Plates were supplemented with 20 g/l glucose and 20 g agar/l. The μmax were determined on xylose medium for the xylose consuming strains (Table 12). Strains overexpressing the non-oxidative PPP and with Δgre3, i.e. strains Control-PPP-XYL and PGM2-PPP-XYL, had three to four fold higher growth rate on xylose than the strains Control-XYL and PGM2-XYL (Table 12), confirming that the additional genetic modifications enhance xylose consumption (Traff, Otero Cordero et al. 2001; Johansson and Hahn-Hagerdal 2002; Karhumaa, Hahn-Hagerdal et al. 2005). Strain PGM2-PPP-XYL had increased the μmax aerobically on xylose medium compared to that of Control-PPP-XYL strain.
Anaerobic Fermentation on Xylose with Strains Expressing PGM2
Anaerobic fermentation was performed in defined mineral medium (Jeppsson, Bengtsson et al. 2006). The medium was supplemented with 0.4 g/l Tween 80 and 0.01 g/l ergosterol, and 20 g/l xylose.
The pre-culture medium contained 20 g/l glucose and was buffered with phthalate buffer (10.21 g/l phthalate, 2.1 g/l KOH, pH 5.5) (Hahn-Hagerdal, Karhumaa et al. 2005). A first pre-culture was inoculated and grown until late exponential phase in 5 ml culture in 50 ml tubes. The culture was used to inoculate a second aerobic pre-culture of 100 ml in 1000 ml cotton-stoppered baffled shake flasks. Cells from the second pre-culture were grown until late exponential phase and used to inoculate anaerobic batch cultures at OD620 nm of 0.1-0.2. Cells were washed twice with sterile water and centrifuged at 5000 rpm for 10 min. Aerobic pre-cultures were grown at 30° C. (Gallenkamp INR-200, Leicester, UK) and 180-200 rpm.
Anaerobic batch fermentation was performed in either 3 L Biostat® Bio Reactors (B. Braun Biotech International, Melsungen, Germany) or 3 L Applikon® Bio Reactors (Applikon, Schiedam, The Netherlands) with a working volume of 1.5 L, at 30° C. and 200 rpm, pH was controlled at 5.5 with 3M KOH. Anaerobic conditions were obtained by flushing nitrogen gas containing less than 5 ppm O2 (AGA Gas, Sundbyberg, Sweden) from the bottom of the bio reactor at a flow rate of 0.2 l/min controlled by a gas mass flow-meter (Bronkhorst, HI-TECH, Ruurlo, The Netherlands). Outlet carbon dioxide and oxygen concentrations were monitored by a Carbon Dioxide and Oxygen Monitor type 1308 (Brüel & Kjaer, Copenhagen, Denmark).
Anaerobic fermentation experiments were performed at least in duplicate with less than 10% difference.
Results from the anaerobic batch cultivation on 20 g/l xylose with the strains Control-PPP-XYL and PGM2-PPP-XYL are shown in
PGM activity was determined in crude extracts of cells grown on YNB medium containing 20 g/l galactose or 20 g/l glucose. For every strain and condition, at least 3 independent cultures were grown and at least 2 independent enzymatic measurements were performed with different dilutions of the same cell extract. Cells were harvested in exponential phase, centrifuged at 5000 rpm for 5 min, washed with sterile water and permeabilized with Y-PER (Pierce, Rockford, Ill., USA). The protein concentration was determined with Coomassie Protein Assay Reagent (Pierce, Rockford, Ill., USA), using bovine serum albumin as standard. Phosphoglucomutase activity was determined at 30° C. by monitoring NAPDH production at 340 nm as previously described (Bro, Knudsen et al. 2005). The chemicals used to determine enzyme activity were purchased from Sigma-Aldrich (St. Louis, Mo., USA).
Two strains with different numbers of copies of the gene PGM2 were constructed with the same genetic background (cf example 9; Table 11). In both strains, PGM2 was expressed under the control of the constitutive promoter HXT7′ (Hauf, Zimmermann et al. 2000). One strain overexpressed PGM2 from a multicopy plasmid and was named PGM2 m. Its control strain Control m carried the same plasmid without the structural gene. Another strain expressed only one additional integrated copy of PGM2 and was named PGM2 i. Its corresponding control strain was Control i (Table 11).
The effect of PGM2 copy number on PGM specific activity was assessed in crude extracts of cells grown on galactose or glucose. On galactose grown cells, strains Control m and Control i displayed similar specific PGM activity, 0.33 and 0.34 U/mg protein, respectively, whereas the specific activity in PGM2 m and PGM2 i strains increased to 10.40 and 1.81 U/mg protein, respectively.
In glucose grown cells specific PGM activity had lower values than in galactose grown cells. In glucose grown cells strains Control m and Control i displayed specific PGM activity of 0.23 and 0.10 U/mg protein, respectively, whereas the specific activity in PGM2 m and PGM2 i strains increased to 4.29 and 1.47 U/mg protein, respectively.
This is an example of a study of gene dosage under the control of HXT7 truncated promoter (Hauf, Zimmermann et al. 2000) and the effect shown was an increase of the PGM activity produced by additional copies of the PGM2 gene. Specific PGM activity was also assessed on glucose grown cells, which is a commonly found sugar in lignocellulosic hydrolysate.
REFERENCES
- Bro, C., S. Knudsen, et al. (2005). “Improvement of galactose uptake in Saccharomyces cerevisiae through overexpression of phosphoglucomutase: example of transcript analysis as a tool in inverse metabolic engineering.” Appl Environ Microbiol 71(11): 6465-72.
- Hauf, J., F. K. Zimmermann, et al. (2000). “Simultaneous genomic overexpression of seven glycolytic enzymes in the yeast Saccharomyces cerevisiae.” Enzyme Microb Technol 26(9-10): 688-698.
Yeast strains and plasmids used in this study are summarized in Table 13. Escherichia coli DH5α (Life Technologies, Rockville, Md., USA) was used for sub-cloning. All strains were stored at −80° C. in 15% glycerol. E. coli was grown in LB medium (Sambrook J, Fritch E et al. 1989) with 100 mg.l−1 ampicillin. Yeast strains from frozen stocks were streaked on YNB medium (6.7 g.l−1-Difco Yeast Nitrogen Base without amino acids; Becton, Dickinson and Company, Sparks, Md., USA) supplemented with 20 g.l−1 glucose, 20 g.l−1 agar (Merck, Darmstadt, Germany) and a supplement of aminoacid/s was added when needed for auxotrophic strains (Hahn-Hägerdal, Karhumaa et al. 2005). Liquid medium was buffered at pH 5.5 for aerobic cultivations with 50 mM potassium hydrogen phthalate (Merck, Darmstadt, Germany) (Hahn-Hägerdal, Karhumaa et al. 2005) with 20 g.l−1 glucose.
Molecular Biology TechniquesAll enzymes used for cloning and restriction cleavage were obtained from Fermentas (Vilnius, Lithuania) otherwise stated. Analytical PCR was performed with Dream Taq™ Polymerase while preparative PCR before ligation or sequencing was performed with High Fidelity PCR Enzyme mix or Pwo Polymerase (Roche Diagnostics GmbH, Mannheim, Germany).
Plasmid DNA was isolated from bacteria with the GeneJET™ Plasmid Miniprep Kit from Fermentas (Vilnius, Lithuania). Purification of DNA products after restriction cleavage or PCR amplification was performed with the E.Z.N.A.® Cycle-Pure Kit (Omega Bio-tek Inc, Doraville, Ga., USA). The method used for bacterial transformation was the calcium chloride method (Dagert and Ehrlich 1979) and yeast transformation was carried out by the lithium acetate method (Gietz, Schiestl et al. 1995). Primer synthesis and sequencing was performed by Eurofins MWG Operon (Ebersberg, Germany). Yeast chromosomal DNA extraction was carried out by phenol/chloroform method.
Construction of Strains TMB 3143 and TMB 3144S. cerevisiae strains TMB 3043 and TMB 3044 that have upregulated non-oxidative pentose phosphate pathway and deleted GRE3 gene (Karhumaa, Hahn-Hägerdal et al. 2005) were used as background strains to construct strains TMB 3143 (“PGM2-PPP-XYL1 (K270R)”) and TMB 3144 (“Control-PPP-XYL1 (K270R)”) respectively (Table 13) (
A positive clone of TMB 3043 with integrated YlpOB9 was further transformed with the linearized plasmid Ylplac128 HXT-PGM2 and selection of transformants was carried out on YNB glucose plates.
The construction of Ylplac128 HXT-PGM2 was made from plasmid Ylplac128 and part of plasmid Ylplac211 HXT-PGM2 (Table 13) (
Ylplac128 HXT-PGM2 (Table 13) was linearized by restriction cleavage with AatII enzyme and used to transform strain TMB 3043 with an already integrated copy of YlpOB9.
Transformants were confirmed first by PCR amplification and then by sequencing of the chromosomally integrated genes which were PCR amplified with a proofreading DNA polymerase from extracted genomic DNA.
- Bettiga, M., O. Bengtsson, et al. (2009). “Arabinose and xylose fermentation by recombinant Saccharomyces cerevisiae expressing a fungal pentose utilization pathway.” Microbial Cell Factories 8:—.
- Dagert, M. and S. D. Ehrlich (1979). “Prolonged incubation in calcium chloride improves the competence of Escherichia coli cells.” Gene 6(1): 23-28.
- Garcia Sanchez R., Hahn-Hägerdal B., et al. (Manuscript in preparation 2008). “PGM2 overexpression improves fermentation of galactose and/or xylose.”
- Garcia Sanchez R., Hahn-Hägerdal B., et al. (Manuscript in preparation 2009). “Improvement of xylose utilization in Saccharomyces cerevisiae strains overexpressing PGM2.”
- Gietz, R. D., R. H. Schiestl, et al. (1995). “Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure.” Yeast 11(4): 355-60.
- Gietz, R. D. and A. Sugino (1988). “New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.” Gene 74(2): 527-34.
- Hahn-Hägerdal, B., K. Karhumaa, et al. (2005). “Role of cultivation media in the development of yeast strains for large scale industrial use.” Microb Cell Fact 4: 31.
- Karhumaa, K., B. Hahn-Hägerdal, et al. (2005). “Investigation of limiting metabolic steps in the utilization of xylose by recombinant Saccharomyces cerevisiae using metabolic engineering.” Yeast 22(5): 359-68.
- Sambrook J, Fritch E, et al. (1989). “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.
Yeast Nitrogen Base medium (YNB) (6.7 g.l−1 Difco Yeast Nitrogen Base without aminoacids; Becton, Dickinson and Company, Sparks, Md., USA) was used for aerobic cultivations. It was supplemented either with 50 g.l−1 xylose or 20 g.l−1 glucose. YNB medium was buffered with potassium hydrogen phthalate (10.21 g.l−1 phthalate, 2.1 g.l−1 KOH, pH 5.5) (Hahn-Hägerdal, Karhumaa et al. 2005) for liquid medium and for plates 20 g l−1 agar was added. The concentration of YNB was doubled when the sugar concentration exceeded 20 g l−1. Pre-cultures grown in YNB with 20 g.l−1 glucose until mid-late exponential phase on 50 ml tubes with 5 ml growth medium were used to inoculate aerobic batch cultures with 50 g l−1 xylose at OD620 nm 0.1-0.2 in cotton-stoppered baffled 500 ml flasks with 50 ml growth medium. Aerobic growth cultures were performed at least in biological duplicates and with a starting medium that was 10% of the volume of the flask.
Anaerobic FermentationCells were pre-cultivated aerobically on defined mineral medium (Jeppsson, Bengtsson et al. 2006) with 20 g.l−1 glucose and also buffered at pH 5.5 with 50 mM potassium hydrogen phthalate (Hahn-Hägerdal, Karhumaa et al. 2005). Anaerobic fermentation was carried out on the same defined mineral medium but supplemented with 50 g.l1 xylose, 0.4 g.l−1 Tween 80 and 0.01 g.l−1 ergosterol, and the pH was controlled by automatic addition of 3M KOH. The concentration of medium components was doubled because the sugar concentration exceeded 20 g.l−1 sugar.
Pre-cultures were grown at 30° C. on an incubator (INR-200, Gallenkamp, Leicester, United Kingdom) at 180 rpm. A freshly streaked plate with yeast was used to inoculate a first 5 ml pre-culture into a test tube. Exponentially growing cells from the first pre-culture were used to inoculate a second pre-culture in a 1000 ml shake flask. Late exponentially growing cells were harvested by centrifuging 5 min at 4000 rpm, and washed with water before being used as inoculum for anaerobic batch in 2-l Biostat®A bioreactors (B. Braun Biotech International, Melsungen, Germany) with a working volume of 1.5 l. Anaerobic conditions were attained by sparging nitrogen gas containing less than 5 ppm of O2 (AGA Gas, Sundbyberg, Sweden) from the bottom of the bioreactor at a flow rate of 0.2 l min−1 controlled by a gas mass flow-meter (Bronkhorst, HI-TECH, Ruurlo, The Netherlands). Dissolved oxygen was monitored by a probe. Outlet carbon dioxide and oxygen was monitored by an INNOVA 1313 fermentation monitor (LumaSense Technologies, Ballerup, Denmark). Anaerobic fermentation experiments were performed at least in biological duplicates. All physiological characterization of strains was performed with prototrophic strains for proper comparison of all the parameters.
ResultsStrains TMB 3143 (“PGM2-PPP-XYL1 (K270R)”) and TMB 3144 (“Control-PPP-XYL1 (K270R)”) were constructed to assess the influence of PGM2 overexpression on xylose utilization by recombinant S. cerevisiae strains. Heterologous expression of integrated copies of PGM2 and XYL1 (K270R) were under the control of constitutive promoters, the truncated HXT7 (Hauf, Zimmermann et al. 2000) and TDH3p respectively.
Strain PGM2-PPP-XYL1 (K270R), increased the flux through the xylose utilization pathway under both aerobic and anaerobic conditions.
Strain PGM2-PPP-XYL1 (K270R) grew in aerobic batch in medium with xylose (50 g.l−1) as the sole carbon source at a maximum exponential growth rate (μmax) of 0.180±0.027 h−1 while strain Control-PPP-XYL1 (K270R) had μmax of 0.123±0.029 h−1 (
Strains Control-PPP-XYL (TMB 3137) and PGM2-PPP-XYL (TMB 3138) were also included in the comparison experiment of aerobic growth on medium with xylose (50 g l−1) (
The results show that integration of either PGM2 and/or XYL1 (K270R) under the control of constitutive promoters improved growth on xylose medium (
Anaerobic fermentation on 50 g.l−1 xylose as the sole carbon source showed that strain PGM2-PPP-XYL1 (K270R) has an improved growth rate (0.060±0.025 h−1) by a factor of four comparing to that of strain Control-PPP-XYL1 (K270R) (0.015±0.008 h−1) (
Ethanol production from xylose was improved for strain PGM2-PPP-XYL1 (K270R) (Table 16). Ethanol yields/concentrations are calculated from the raw data of detected ethanol. The ethanol yield (g of ethanol g of xylose consumed−1) was 0.33±0.03 for strain Control-PPP-XYL1 (K270R) and 0.37±0.01 for strain PGM2-PPP-XYL1 (K270R). The ethanol yield (g of ethanol g of produced biomass−1) was 4.31±0.26 for strain Control-PPP-XYL1 (K270R) and 9.38±1.88 for strain PGM2-PPP-XYL1 (K270R). The final ethanol titer was 0.90±0.52 for strain Control-PPP-XYL1 (K270R) and 3.17±0.57 for strain PGM2-PPP-XYL1 (K270R).
Strain PGM2-PPP-XYL1 (K270R) had higher xylitol yield (0.22±0.01) than that of strain Control-PPP-XYL1 (K270R) (0.08±0.07) (Table 2) due to a higher amount of total xylose consumed (data not shown).
Biomass yield (g biomass g consumed xylose−1) was double for strain Control-PPP-XYL1 (K270R) (0.08±0.00) in comparison to that of strain PGM2-PPP-XYL1 (K270R) (0.04±0.01).
The acetate and glycerol yield from xylose was very similar for strains Control-PPP-XYL1 (K270R) and PGM2-PPP-XYL1 (K270R). The acetate yield was of the order of 0.01 g acetate g consumed xylose−1 and the glycerol yield was between 0.03 and 0.04 g glycerol g consumed xylose−1.
- Hahn-Hägerdal, B., K. Karhumaa, et al. (2005). “Role of cultivation media in the development of yeast strains for large scale industrial use.” Microb Cell Fact 4: 31.
- Hauf, J., F. K. Zimmermann, et al. (2000). “Simultaneous genomic overexpression of seven glycolytic enzymes in the yeast Saccharomyces cerevisiae.” Enzyme Microb Technol 26(9-10): 688-698.
- Jeppsson, M., O. Bengtsson, et al. (2006). “The expression of a Pichia stipitis xylose reductase mutant with higher K(M) for NADPH increases ethanol production from xylose in recombinant Saccharomyces cerevisiae.” Biotechnol Bioeng 93(4): 665-73.
- Runquist, D., B. Hahn-Hagerdal, et al. (2009). “Increased expression of the oxidative pentose phosphate pathway and gluconeogenesis in anaerobically growing xylose-utilizing Saccharomyces cerevisiae.” Microbial Cell Factories 8(1): 49.
Yeast strains and plasmids used in this study are summarized in Table 17. Escherichia coli DH5α (Life Technologies, Rockville, Md., USA) was used for sub-cloning. All strains were stored at −80° C. in 15% glycerol. E. coli was grown in LB medium (Sambrook J, Fritch E et al. 1989) with 100 mg.l−1 ampicillin. Yeast strains from frozen stocks were streaked on YNB medium (6.7 g.l−1 Difco Yeast Nitrogen Base without amino acids; Becton, Dickinson and Company, Sparks, Md., USA) or YPD (10 g l−1 yeast extract, 20 g l−1 peptone) supplemented with 20 g l−1 glucose, 20 g l−1 agar (Merck, Darmstadt, Germany). YPD plates were supplemented with geneticin (Gibco Invitrogen, Paisley, UK) when needed at concentrations of 150 or 200 mg l−1. Liquid medium was buffered at pH 5.5 for aerobic cultivations with 50 mM potassium hydrogen phthalate (Merck, Darmstadt, Germany) (Hahn-Hägerdal, Karhumaa et al. 2005) with 20 g l−1 glucose.
Molecular Biology TechniquesAll enzymes used for cloning and restriction cleavage were obtained from Fermentas (Vilnius, Lithuania). Analytical PCR was performed with Dream Tag™ Polymerase while preparative PCR before ligation, integration or sequencing was performed with High Fidelity PCR Enzyme.
Plasmid DNA was isolated from bacteria with the GeneJET™ Plasmid Miniprep Kit from Fermentas (Vilnius, Lithuania). Purification of DNA products after restriction cleavage or PCR amplification was performed with the E.Z.N.A.® Cycle-Pure Kit (Omega Bio-tek Inc, Doraville, Ga., USA). QIAquick® Gel Extraction Kit (Qiagen GmbH, Hilden, Germany) was used for DNA extraction from agarose gel. The method used for bacterial transformation was the calcium chloride method (Dagert and Ehrlich 1979) and yeast transformation was carried out by the lithium acetate method (Gietz, Schiestl et al. 1995). Primer synthesis and sequencing was performed by Eurofins MWG Operon (Ebersberg, Germany).
Results Plasmid ConstructionThe DNA cassette HXT7p PGM2 PGK1 t was PCR amplified having as template plasmid Ylplac 211 HXT PGM2 (Table 17) and using primers PGK SalI and HXT SalI (Table 18) which were including the restriction site SalI at the ends of the amplified DNA cassette (
The DNA cassette HXT7p PGM2 PGK1 t KanMX was PCR amplified having as template plasmid pUG6 HXT-PGM2 (Table 17) and using primers HIS3p-HXT7p FW and HIS3t-loxP RV (Table 18) which were including overhangs homologous to the HIS3 promoter and terminator of the yeast HIS3 gene to facilitate integration of the DNA cassette in the HIS3 locus of S. cerevisiae genome (
The purified DNA cassette HXT7p PGM2 PGK1 t KanMX with HIS3 overhangs was used to transform S. cerevisiae strains TMB 3400, TMB 3500 and TMB 3500 XR/XDH/XK, resulting in strains TMB 3147, TMB 3148 and TMB 3149 respectively (
Transformants were selected on YPD plates supplemented with geneticin. Positive transformants were confirmed first by PCR amplification and then by sequencing of the chromosomally integrated genes which were PCR amplified with a proofreading DNA polymerase from extracted genomic DNA.
- Almeida, J. R. M. “Unpublished work.”
- Dagert, M. and S. D. Ehrlich (1979). “Prolonged incubation in calcium chloride improves the competence of Escherichia coli cells.” Gene 6(1): 23-28.
- Eliasson, A., C. Christensson, et al. (2000). “Anaerobic xylose fermentation by recombinant Saccharomyces cerevisiae carrying XYL1, XYL2, and XKS1 in mineral medium chemostat cultures.” Appl Environ Microbiol 66(8): 3381-6.
- Garcia Sanchez R., Hahn-Hägerdal B., et al. (Unpublished work). “Construction of an industrial xylose consuming strain with PGM2 overexpression”.
- Garcia Sanchez R., Hahn-Hägerdal B., et al. (Manuscript in preparation 2008). “PGM2 overexpression improves fermentation of galactose and/or xylose.”
- Gietz, R. D., R. H. Schiestl, et al. (1995). “Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure.” Yeast 11(4): 355-60.
- Güldener, U., S. Heck, et al. (1996). “A new efficient gene disruption cassette for repeated use in budding yeast.” Nucleic Acids Research 24(13): 2519-2524.
- Hahn-Hägerdal, B., K. Karhumaa, et al. (2005). “Role of cultivation media in the development of yeast strains for large scale industrial use.” Microb Cell Fact 4: 31.
- Sambrook J, Fritch E, et al. (1989). “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.
- Wahlbom, C. F., W. H. van Zyl, et al. (2003). “Generation of the improved recombinant xylose-utilizing Saccharomyces cerevisiae TMB 3400 by random mutagenesis and physiological comparison with Pichia stipitis CBS 6054.” FEMS Yeast Res 3(3): 319-26.
S. cerevisiae strains and plasmids used in this study are summarized in Table 19. Escherichia coli was grown on liquid or solid (15 g/L agar) LB medium supplemented with 100 mg/L ampicillin. On solid medium S. cerevisiae strains were grown on YNB plates (6.7 g/L Yeast Nitrogen Base wo amino acids) supplemented with either 20 g/L glucose or 60 g/L xylose. Defined mineral medium was used for liquid cultivation of S. cerevisiae and was composed of: xylose 60 g/L (unless otherwise noted); mineral salts ((NH4)2SO4, 5 g/L; KH2PO4, 3 g/L; MgSO4.7H2O, 0.5 g/L); Tween 80 0.4 g l−1; ergosterol 0.01 g l−1 (Andreasen and Stier 1953); vitamins and trace elements (Verduyn et al. 1992). Identical medium was used for pre-culture and batch fermentation in instrumented bioreactor with the exception that 50 mM Potassium Pthalate pH 5.5 (Hahn-Hägerdal et al. 2005) was added as buffering agent in the former case. Batch cultivation was performed in an instrumented bioreactor (Applikon Biotechnology, AC Schiedam, the Netherlands) with 2 L working volume. The medium was prepared as previously described with antifoam (Dow Corning, Midland, USA) added to the reactor at a final concentration of 0.25 mL/L. Temperature was maintained at 30° C. and the pH was controlled at 5.5 through addition of 3 M KOH. During aerobic growth, the agitation rate was set to 900 rpm and the culture was sparged with air at 1 L/min. During anaerobic cultivation the agitation rate was reduced to 200 rpm and oxygen free conditions were maintained by nitrogen sparging at 0.2 L/min. CO2 production was detected online by an INNOVA 1313 fermentation monitor (LumaSense Technologies, Ballerup, Denmark). Cultures were sampled for HPLC (High Performance Liquid Chromatography), OD620nm and cell dry-weight measurements.
Library ConstructionA random library of Pichia stipitis XYL1 were generated by error-prone PCR and the MEGAWHOP strategy for whole plasmid synthesis (Miyazaki and Takenouchi 2002). Primers were constructed to amplify a region between +631 bp-+870 bp centered on the active site of XYL1. Error-prone PCR was conducted using Mutazyme II polymerase (Stratagene, Cedar Creek, Tex., USA) according to the manufacturer's instructions. The mutation frequency of the PCR reaction was set to 1.5-2 nt/amplicon by optimizing the amount of template DNA and verifying the error distribution by sequencing 7-10 transformants. Following error-prone PCR, the amplified DNA was purified using the E.Z.N.A Cycle-Pure kit (Omega Bio-tek, Doraville, Ga., USA) and used as “megaprimer” for reconstruction of the template plasmid. Whole plasmid PCR was carried out as previously described (Miyazaki and Takenouchi 2002) using YIpOB8 as template (Table 19). The following concentration of reagents were used (in 50 μL): 5 μL 10×pfu buffer, 0.25 mM dNTPs, 300 ng template plasmid, 250 ng megaprimer and 2.5 U native Pfu DNA polymerase (Fermentas, Vilnius, Lithuania). The cycle parameters where: 95° C. 2 min; 15-17 cycles of 95° C. 30 s, 60° C. 30 s, 68° C. 2 min/kb; 68° C. 7 min. Following PCR, the template DNA was digested by adding 1 μL FastDigest DpnI (Fermentas, Vilnius, Lithuania) and incubating for 1 hr at 37° C. The reconstructed mutated plasmid was concentrated by isopropanol precipitation and used to transform Escherichia coli. Transformation was performed using 80 μL Electro-10Blue competent cells (Stratagene, Cedar Creek, Tex., USA) and electroporation (17 kV/cm, 200Ω, 25 μF) in a 0.1 cm cuvette (Dower et al. 1988). The size of the library was determined by plating a small volume of appropriately diluted cells on LB ampicilin (100 mg/L) plates. The rest of the transformed cells were inoculated in 2×250 mL liquid LB ampicillin (100 mg/L) medium and grown over night at 37° C. The resulting E. coli library was stored in 15% glycerol stocks at −80° C. while plasmid DNA was harvested using the QIAfilter Plasmid Mega Kit (Qiagen, Hilden, Germany). The mutated plasmid library was used for large scale transformation (Gietz and Schiestl 2007) of Saccharomyces cerevisiae strain TMB 3044 (Table 19). The mutated plasmid library was linearized using EcoRV for integrative transformation.
Selection of the S. cerevisiae XYL1 Library
Following large-scale transformation of TMB 3044 (Table 19), cells were inoculated in an instrumented bioreactor for selection in liquid mineral medium (glucose 5 g/L and xylose 55 g/L) during aerobic conditions. After approximately 48 hrs, cell growth had reached ˜OD620 nm=40 and initial selection of the transformed S. cerevisiae library was completed. For selection of S. cerevisiae transformants carrying beneficial XYL1 mutations, conditions were changed to anaerobiosis and 95% of the culture medium was pumped out and exchanged for fresh medium (xylose 60 g/L). During anaerobic selection, cell growth was monitored through CO2 production rate, optical density (OD620 nm) and aerobic and anaerobic growth on YNB-xylose plates. When the substrate in the reactor had been consumed, as monitored through the CO2 production rate, 95% of the medium was pumped out and replaced with fresh medium.
Following 10 sequential batch cultivations under strictly anaerobic conditions, an isogenic population harbouring the same mutated XYL1 gene had been isolated. The mutated XYL1 sequence (Table 20) contained three nucleotide point mutations close to the previously characterized K270R mutation (cf example 4, 5, 6, 7) (Bengtsson et al. 2009). The mutated XYL1 gene substantially increased anaerobic growth and ethanol productivity during anaerobic batch cultivation on xylose as a sole carbon source (
- Andreasen A A, Stier T J (1953) Anaerobic nutrition of Saccharomyces cerevisiae. I. Ergosterol requirement for growth in a defined medium. J Cell Physiol 41:23-36.
- Bengtsson O, Hahn-Hägerdal B, Gorwa-Grauslund M F (2009) Xylose reductase from Pichia stipitis with altered coenzyme preference improves ethanolic xylose fermentation by recombinant Saccharomyces cerevisiae. Biotechnol Biofuels 2:9.
- Dower W J, Miller J F, Ragsdale C W (1988) High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res 16:6127-45.
- Gietz R D, Schiestl R H (2007) Large-scale high-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc 2:38-41.
- Gietz R D, Sugino A (1988) New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking 6-base pair restriction sites. Gene 74:527-534.
- Hahn-Hägerdal B, Karhumaa K, Larsson C U, Gorwa-Grauslund M F, Gorgens J, van Zyl W H (2005) Role of cultivation media in the development of yeast strains for large scale industrial use. Microb Cell Fact 4:31.
- Karhumaa K, Hahn-Hägerdal B, Gorwa-Grauslund M F (2005) Investigation of limiting metabolic steps in the utilization of xylose by recombinant Saccharomyces cerevisiae using metabolic engineering. Yeast 22:359-68.
- Miyazaki K, Takenouchi M (2002) Creating random mutagenesis libraries using megaprimer PCR of whole plasmid. BioTechniques 33:1033-4, 1036-8.
- Runquist D, Hahn-Hagerdal B, Bettiga M (2009) Increased expression of the oxidative pentose phosphate pathway and gluconeogenesis in anaerobically growing xylose-utilizing Saccharomyces cerevisiae. Microb Cell Fact 8:49.
- Verduyn C, Postma E, Scheffers W A, van Dijken J P (1992) Effect of benzoic acid on metabolic fluxes in yeasts—a continuous culture study on the regulation of respiration and alcoholic fermentation. Yeast 8:501-517.
Claims
1. A method of producing a fermentation product and cell mass comprising the steps of: wherein the Saccharomyces sp. strain comprises a genome comprising
- a) providing a medium comprising xylose and a Saccharomyces sp. strain which grows on pentose sugars under anaerobic cultivation conditions;
- b) adding the medium and strain to a fermentation reactor;
- c) performing fermentation with said strain under anaerobic conditions; and
- d) utilizing the carbon source xylose and producing a fermentation product,
- (i) a xylose reductase (XR) gene encoding an XR having NADH-preference, wherein expression of the XR gene is controlled by a constitutive promoter, and
- (ii) a xylitol dehydrogenase (XDH) gene which is expressed.
2. The method according to claim 1, wherein a gene encoding phosphoglucomutase activity is constitutively overexpressed in the Saccharomyces sp. strain.
3. The method according to claim 1, wherein the constitutive promoter is selected from the group consisting of TDH3, truncated HXT7, TEF1 and PGK1.
4. The method according to claim 1, wherein the XR gene is derived from Pichia stipitis and the XR encoded by the XR gene comprises the amino acid substitution K270R.
5. The method according to claim 1, wherein the XR gene is derived from Pichia stipitis and the XR encoded by the XR gene comprises the amino acid substitutions N272D and/or P275Q.
6. The method according to claim 1, wherein the XDH gene is constitutively overexpressed.
7. The method according to claim 1, wherein the genome comprises a gene encoding a transaldolase, wherein expression of the transaldolase gene is increased as compared to the parental strain of the Saccharomyces sp. strain.
8. The method according to claim 1, wherein the genome comprises overexpressed genes encoding transaldolase, transketolase, ribose 5-phosphate ketol-isomerase and/or ribulose 5-phosphate epimerase.
9. The method according to claim 1, wherein the genome comprises a xylulokinase (XK) gene which is overexpressed.
10. The method according to claim 1, wherein the Saccharomyces sp. strain is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces bayanus and Saccharomyces carlsbergensis.
11. A method of producing a fermentation product and cell mass, the method comprising wherein the Saccharomyces sp. strain comprises a genome comprising a xylose reductase (XR) gene encoding an XR having NADH-preference and a xylitol dehydrogenase (XDH) gene, wherein the XR and XDH genes are constitutively overexpressed.
- adding to a fermentation reactor a medium comprising xylose and a Saccharomyces sp. strain, and
- producing a fermentation product and cell mass from the xylose under anaerobic conditions,
12. The method of claim 11, wherein the XR gene is derived from Pichia stipitis and the XR encoded by the XR gene comprises the amino acid substitution K270R.
13. The method according to claim 12, wherein the genome further comprises a constitutively overexpressed phosphoglucomutase gene.
14. The method according to claim 12, wherein the genome further comprises overexpressed XK, transaldolase, transketolase, ribose 5-phosphate ketol-isomerase and ribulose 5-phosphate epimerase genes.
15. The method according to claim 14, wherein at least one gene is under the control of a constitutive promoter is selected from the group consisting of TDH3, truncated HXT7, TEF1 and PGK1.
16. The method according to claim 15, wherein the Saccharomyces sp. strain is a Saccharomyces cerevisiae strain.
17. The method according to claim 16, wherein the fermentation product is ethanol.
18. The method according to claim 17, wherein the ethanol yield is at least 0.35 g/g consumed sugar, the xylose consumption rate is at least 0.28 g/g biomass/h, or the ethanol production rate is at least 0.1 g/g biomass/h.
19. A Saccharomyces sp. strain comprising a genome comprising
- (i) a xylose reductase (XR) gene encoding an XR having NADH-preference, wherein expression of the XR gene is controlled by a constitutive promoter;
- (ii) a xylitol dehydrogenase (XDH) gene which is expressed; and
- (iii) a gene encoding phosphoglucomutase activity which is constitutively overexpressed.
20. The Saccharomyces sp. strain according to claim 19, wherein the XR gene is derived from Pichia stipitis and the XR encoded by the XR gene comprises the amino acid substitution K270R, N272D and/or P275Q.
Type: Application
Filed: Jan 25, 2013
Publication Date: Aug 1, 2013
Applicant: C5 LIGNO TECHNOLOGIES IN LUND AB (Lund)
Inventor: C5 LIGNO TECHNOLOGIES IN LUND AB (Lund)
Application Number: 13/750,405
International Classification: C12N 15/81 (20060101); C12P 7/06 (20060101);
