Molecular Determinants of Myeloma Bone Disease and Uses Thereof
The present invention is drawn to understanding lytic bone diseases. In this regard, the present invention discloses mechanism by which Wnt signaling antagonist inhibits bone differentiation. Also disclosed herein are methods for treating multiple myeloma, for restoring osteoprotegerin (OPG) expression in a cell, for inhibiting receptor activator of nuclear factor kappa B ligand (RANKL) expression in a cell, and for increasing bone mass in a subject. These methods utilize a DKK1 neutralizing antibody, an anti-sense oligonucleotide against a DKK1 gene, or a shRNA against a DKK1 gene to inhibit the activity of the DKK1 protein.
Latest BOARD OF TRUSTEES OF THE UNIVERSITY OF ARKANSAS Patents:
- SYSTEM, METHOD, AND COMPUTER PROGRAM FOR PHYSICS-BASED BINDING AFFINITY ESTIMATION
- COATINGS FOR MATERIALS TO REDUCE FRICTION AND ENERGY CONSUMPTION
- 3D Printer for Continuous Carbon Fibers
- Chip warpage reduction via raised free bending and re-entrant (auxetic) trace geometries
- Compositions and methods of enhancing immune responses to or limiting infection
This application is a divisional application under 35 U.S.C. 120 of pending U.S. application Ser. No. 13/402,698, filed Feb. 22, 2012, which is a continuation under 35 U.S.C. 120 of U.S. Ser. No. 12/008,771, filed Jan. 14, 2008, now U.S. Pat. No. 8,124,087, which is a continuation-in-part under 35 U.S.C. 120 of U.S. Ser. No. 11/588,008, filed Oct. 26, 2006, now U.S. Pat. No. 7,811,750, which is a continuation-in-part under 35 U.S.C. 120 of U.S. Ser. No. 11/176,739, filed Jul. 7, 2005, now U.S. Pat. No. 7,642,238, which is a continuation-in-part under 35 U.S.C. 120 of U.S. Ser. No. 10/727,461, filed Dec. 4, 2003, now U.S. Pat. No. 7,459,437, which claims benefit of priority under 35 U.S.C. 119(e) of U.S. provisional application Ser. No. 60/431,040, filed Dec. 5, 2002, now abandoned, the entirety of all of which are hereby incorporated by reference.
FEDERAL FUNDING LEGENDThis invention was made with governmental support under Grant Numbers CA93897, CA55819 and CA97513 awarded by the National Cancer Institute. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION1. Field of the Invention
The present invention relates generally to the study of multiple myeloma. More specifically, the present invention relates to the identification and validation of molecular determinants of myeloma bone disease through comparative global gene expression profiling and employment of the SCID-rab mouse model for primary myeloma. Further, this invention relates to methods of treatment of bone disease by stimulating bone formation and reducing bone loss via targeting molecular determinants identified by the global gene expression profiling.
2. Description of the Related Art
Multiple myeloma (MM) is a rare, yet incurable malignancy of terminally differentiated plasma cells (PC) that affects approximately 15,000 persons per year in the United States, and represents the second most common hematopoietic malignancy. Multiple myeloma represents 13% of all lymphoid malignancies in the white population and 31% of lymphoid malignancies in the black population. The malignant plasma cells home to and expand in the bone marrow causing anemia and immunosuppression due to loss of normal hematopoiesis.
Multiple myeloma is also associated with systemic osteoporosis and local bone destruction leading to debilitating bone pain and susceptibility to fractures, spinal cord compression and hypercalcemia. Myeloma is the only hematological malignancy consistently associated with lytic bone disease and local bone destruction is limited to areas adjacent to plasma cells, suggesting that the malignant plasma cells secrete factors that enhance osteoclast function and/or osteoblast anergy. The prevalence of bone disease varies with the presentation of myeloma, from smoldering myeloma, often without bone involvement, to solitary plasmacytoma, to diffused or focal multiple myeloma where systemic losses of bone mineral density or focal lytic bone lesions are seen in approximately 80% of patients.
In recent years, it has become evident that lytic bone disease is not only a consequence of myeloma, but that it is intricately involved in promoting disease progression. Change in bone turnover rates predicts clinical progression from monoclonal gammopathy of undetermined significance (MGUS) to overt myeloma by up to 3 years. While initially osteoclast and osteoblast activity are coupled, the coupling is lost with disease progression. Osteoclast activity remains increased and osteoblast activity is diminished, with lytic bone disease as the consequence. Studies in the 5T2 murine myeloma and the SCID-hu model for primary human myeloma demonstrated that inhibition of osteoclast activity is associated with inhibition of myeloma growth and reduction of myeloma tumor burden. These studies support reports that inhibition of bone resorption with bisphosphonates had an anti-myeloma effect.
Whereas the biology of osteoclasts in myeloma-associated lytic bone disease has been investigated intensively, little is known about the disease-associated changes in osteoblast activity and their underlying mechanisms. It has been suggested that in myeloma, the ability of mesenchymal stem cells to differentiate into the osteogenic lineage is impaired. However, the mechanisms responsible for such impairment have not been elucidated.
The Wnt signaling pathway is involved in both normal skeletogenesis and cancer related bone disease. The first link between Wnt signaling and human bone disease came from observations that inactivating mutations in the Wnt co-receptor, LRP5, causes the osteoporosis-pseudoglioma syndrome (OPPG) (1). The canonical Wnt signaling pathway is regulated by large number of antagonists, including the DKK family and secreted frizzled-related protein (SRFPs). To date, four Dkk proteins have been identified in mammals (2), among which Dkk1 and Dkk2 have been well characterized. Subsequently it was shown that mutations in LRP5 that causes a high bone mass phenotype were distinct from those seen in osteoporosis-pseudoglioma syndrome and prevented binding of Dickkopf-1 (DKK1), a soluble inhibitor of Wnt and high affinity ligand for LRP5 (3-4). DKK1, antagonizing the canonical Wnt pathway by binding to LRP5/6 and Kremen (5-7), blocks maturation of osteoblasts and formation of mineralized matrix (8-9).
Additionally, over-expression of DKK1 in transgenic mice leads to decreased bone mass (8 Baron and Rawadi, 2007), while deletion of a single allele of DKK1 in mouse osteoblasts results in increased bone formation and bone mass (10). The osteolytic prostate cancer line PC-3, when transfected with shRNA targeting DKK1, reverted to an osteoblastic phenotype. In addition, transfection of DKK1 into the osteoblastic prostate cancer cell line C4-2B, which normally induces a mix of osteoblastic and osteolytic lesions, caused the cells to develop osteolytic tumors in SCID mice. Thus, the role of DKK1 in promoting bone lesion development appears not to be limited to MM, but has also been indicated in prostate cancer.
In addition to inhibiting osteoblastogenesis, elevated DKK1 levels may enhance osteoclastogenesis. Thus, bone destruction, a cardinal feature of multiple myeloma (MM) may result from uncoupling of osteoclast and osteoblast activities (11-13). Osteoclasts are activated by binding of receptor activator of nuclear factor kappa B ligand (RANKL) (14-16) to its cognate receptor, RANK, while osteoprotegerin (OPG) (a soluble member of the tumor necrosis receptor super-family) (17) acts as a naturally occurring decoy receptor that competes with RANK for binding of RANKL (18). MM cells likely stimulate expression of RANKL and suppress expression of OPG by osteoblasts or their progenitors (19-20). Increased serum levels of RANKL and decreased levels of OPG have been associated with a poor prognosis in MM (21). Restoring the RANKL/OPG imbalance by RANKL antagonist or recombinant OPG not only reduce MM-associated bone lesions but also halt disease progression in animal models (20-24).
Mechanistically, regulation of osteoclastogenesis by osteoblast-derived OPG (25-27) and RANKL (26, 28-29) involves Wnt signaling, a pathway that is regulated by a large number of antagonists, including members of the Dickkopf family (10), the family of secreted frizzled-related protein (sRFPs) (2, 30), and sclerostin (31). Osteolytic bone lession (OBL) in MM cells could be linked to DKK1 secretion by tumor cells (32-35), inhibiting canonical Wnt in and differentiation of osteoblasts. Blocking DKK1 with a neutralizing antibody prevented MM-induced bone resorption in the SCID-rab model (36). Although each appear to play an role in OBL, whether DKK1 might influence RANKL/OPG expression in myeloma has never been established.
The prior art is deficient in methods to diagnose and treat multiple myeloma bone diseases. Furthermore, the prior art is also deficient in understanding the disease-associated changes in osteoblast activity and the underlying mechanisms in multiple myeloma associated lytic bone diseases. The present invention fulfills this longstanding need and desire in the art.
SUMMARY OF THE INVENTIONThe present invention is directed to a method for controlling bone loss in a subject. This method comprises the step of inhibiting a Wnt signaling antagonist at the nucleic acid or protein level. The present invention is also directed to a method of treating bone disease in a subject, comprising the step of administering to the individual a pharmacologically effective amount of an inhibitor of a Wnt signaling antagonist. Such a step results in blocking of induction of Wnt ligand, restoring the RANKL/OPG levels or both.
The present invention is also directed to a method for inhibiting tumor growth in bone of a subject. Such a method comprises the step of blocking the activity of DKK1.
The present invention is also directed to a method for screening for a compound that controls bone loss and inhibits human myeloma growth. Such a method comprises engrafting human myeloma cells in a rabbit bone implanted in a SCID-rab mouse. This is followed by administration of a candidate compound to the mouse. Subsequently, bone mineral density of the implanted bone and level of serum human monoclonal immunoglobulin in the mouse is compared with a control mouse that has not received the compound. An increase in the bone mineral density and a decrease in the level of the serum immunoglobulin in the treated mouse compared to the control mouse indicates that the compound controls bone loss and inhibits human myeloma growth. The present invention is further directed to a method of inhibiting multiple myeloma growth. Such a method comprises blocking of the DKK1 activity.
Other and further aspects, features, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of the invention. These embodiments are given for the purpose of disclosure.
So that the matter in which the above-recited features, advantages and objects of the invention as well as others which will become clear are attained and can be understood in detail, more particular descriptions and certain embodiments of the invention briefly summarized above are illustrated in the appended drawings. These drawings form a part of the specification. It is to be noted, however, that the appended drawings illustrate preferred embodiments of the invention and therefore are not to be considered limiting in their scope.
FIGS. 42A-42DD show that DKK1 blocks the osteoblast differentiation by blocking an endogenous Wnt signal being made by the osteoblast precursor.
FIGS. 42AA-42BB show that Wnt3a mediated increase in beta-catenin is independent of BMP-2. In FIG. 42AA, C2C12, hFOB1.19, MG63, and Saos-2 cells were treated with Wnt3a CM, control CM or 100 ng/ml of BMP2. Lysate protein was subjected to GST-E-cadherin assay and Immunoblotting analysis by anti-beta-catenin antibody as described in Materials and Methods. In FIG. 42BB, 50 mg aliquots of protein from cell lysates were resolved on 8% SDS-PAGE and analyzed with the indicated antibodies.
FIG. 42CC shows C2C12 cells that were transfected with wild type (TOPflash) LEF/TCF reporter luciferase constructs. After transfection, the cells were treated with 100 ng/ml of Wnt3a, BMP2 (100 ng/ml) or combined with Wnt3a and BMP2 or with Dkk1 (100 ng/ml) for 24 hours and then subjected to luciferase assay. Results are shown as mean±SD (n=3) and representative of three independent experiments. **P<0.01 versus control.
FIG. 42DD shows C2C12 cells that were treated with 100 ng/ml of Wnt3a, BMP2 (100 ng/ml) or combined BMP2 with Dkk1 at indicated time. Results are shown as mean±SD (n=3) and representative of three independent experiments. **P<0.01 and ****P<0.0001 versus control.
FIGS. 43A-43LL show that myeloma-derived DKK-1 disrupts Wnt-regulated osteoprotegerin and RANKL production by osteoblasts.
FIGS. 43W-43BB show that co-culturing osteoblast cells with DKK1 expressing MM cells inhibits Wnt3a-induced OPG. A MM cell line, OPM-2 was transfected with pEF6 vector (pEF/EV) or pEF6/DKK-1. DKK1 protein in pEF/EV or pEF/DKK1 was determined (
FIGS. 43CC-43FF show that neutralization of DKK1 rescues OPG expression in osteoblasts grown in the presence of MM sera or primary MM cells. C2C12 cells were treated with rWnt3a or vehicle after prior treatment with bone marrow sera from MM patients (n=8) containing low (L) (2.7 to 8.5 ng/ml) or high (H) (104.5 to 273.5 ng/ml) concentration of DKK1 or recombinant DKK1 (100 ng/ml) as positive control for 48 hours. The cells were treated with rWnt3a or control vehicle after prior treatment with 25% sera from MM patients (n=21) containing mouse Ig or anti-DKK1 antibody for 48 hrs. C2C12 cells were co-cultured with CD138 positive plasma cells from MM in the presence or absence of Wnt3a, control IgG or anti-DKK1 antibody. OPG mRNA was determined by qPCR from the RNA, and OPG protein measured by ELISA of cell culture supernatants (FIGS. 43CC-43FF). **P<0.01, ***P<0.001, ****p<0.00001 versus control.
FIGS. 43GG-43LL shows that DKK1 and sera from MM pateints inhibits Wnt3a-induced suppression of RANKL in osteoblast. C2C12 (FIG. 43GG), Saos-2 (FIG. 43HH) and MG63 (FIG. 43II) cells were treated with Wnt3a-CM or Cont-CM after prior treatment with 100 ng/ml of DKK1 protein for 48 hours. RANKL mRNA was analyzed by qPCR. C2C12 cells transfected with empty vector (pEF/EV) or the vector carrying DKK1 cDNA (pEF/DKK1) were cultured in the presence of 100 ng/ml of BMP-2 and presence or absence of rWnt3a protein (100 ng/ml). The RNA and supernatant were harvested and subjected to (FIG. 43JJ) qPCR of RANKL mRNA (FIG. 43KK) or ELISA for RANKL protein (FIG. 43LL). C2C12 cells were treated with Wnt3a protein after prior incubation with sera from MM pateints (n=8) containing lower (<10 ng/ml) or higher concentration of DKK1 (>100 ng/ml) for 48 hours (FIG. 43LL). RANKL mRNA was analyzed by qPCR. The results are shown as mean±SD (n=3). *P<0.01, **P<0.001, versus control.
The present invention demonstrates that the secreted WNT signaling antagonists DKK-1 and FRZB mediate bone destruction seen in multiple myeloma. These data strongly implicate these factors in causing osteoblast anergy and contributing to multiple myeloma bone disease by suppressing the normal compensatory bone production that follows bone loss.
The role of multiple myeloma plasma cells in stimulating osteoclast activity has been intensely investigated and several key links established. Data presented herein provide for the first time evidence of a possible mechanistic explanation of osteoblast dysfunction in multiple myeloma. These are significant observations in that inhibition of WNT signaling causes defects in osteoblast function. The secreted DKK-1 and FRZB could account for both the systemic osteoporosis seen in multiple myeloma as well as the exaggerated local bone destruction proximal to plasma cells foci.
Importantly, DKK-1 and FRZB act to inhibit WNT signaling through independent mechanisms, indicating that their co-expression may have synergistic effects. Thus, these genes could be used to predict extent of bone disease and future risk of developing bone disease. Moreover, inhibitors of these proteins could be used to block bone disease. It is also possible that these factors play a role in osteoporosis in the general population.
WNT Signaling PathwayWnt genes comprise a large family of secreted polypeptides that are expressed in spatially and tissue-restricted patterns during vertebrate embryonic development. Mutational analysis in mice has shown the importance of Wnts in controlling diverse developmental processes such as patterning of the body axis, central nervous system and limbs, and the regulation of inductive events during organogenesis. The Wnt family of secreted growth factors initiates signaling via the Frizzled (Fz) receptor and its coreceptor, LDL receptor-related protein 5 or 6 (LPR5 or LRP6), presumably through Fz-LPR5/LRP6 complex formation induced by Wnt.
Secreted antagonists of Wnt include Frizzled (Fz)-related proteins (FRPs), Cerberus, Wnt inhibitory factor (WIF) and Dickkopf (DKK). Frizzled (Fz)-related proteins, Cerberus and Wnt inhibitory factor have all been shown to act by binding and sequestering Wnt. Unlike Wnt antagonists which exert their effects by molecular mimicry of Fz or Wnt sequestration through other mechanisms, Dickkopf-1 (DKK-1) specifically inhibits canonical Wnt signalling by binding to the LPR5/LRP6 component of the receptor complex.
DKK-1 is a head inducer secreted from the vertebrate head organizer and induces anterior development by antagonizing Wnt signaling. DKK-1 is a high-affinity ligand for LRP6 and inhibits Wnt signaling by preventing Fz-LRP6 complex formation induced by Wnt. DKK-1 binds neither Wnt nor Fz, nor does it affect Wnt-Fz interaction. DKK-1 function in head induction and Wnt signaling inhibition strictly correlates with its ability to bind LPR5/LRP6 and to disrupt the Fz-LPR5/LRP6 association. LPR5/LRP6 function and DKK-1 inhibition appear to be specific for the Wnt/Fz beta-catenin pathway. These findings thus reveal a novel mechanism for Wnt signal modulation.
WNT Signaling and Osteoblast DifferentiationRecent studies have shown that the Wnt signaling pathway is critical for osteoblast differentiation and function. Mice with a targeted disruption in the gene for low-density lipoprotein receptor-related protein 5 (LRP5) developed a low bone mass phenotype. LRP5 is expressed in osteoblasts and is required for optimal Wnt signaling in osteoblasts. In vivo and in vitro analyses indicated that this phenotype becomes evident postnatally, and it was secondary to decreased osteoblast proliferation and function in a Cbfa1-independent manner. In humans, mutations in LRP5 cause the autosomal recessive disorder osteoporosis-pseudoglioma syndrome (OPPG). Osteoporosis-pseudoglioma syndrome carriers have reduced bone mass when compared to age- and gender-matched controls.
Importantly, separate and distinct mutations in LRP result in a high bone mass phenotype. In contrast to the osteopororsis-psuedoglioma mutations, the high bone mass traits are gain of function mutations. Markers of bone resorption were normal in the affected subjects, whereas markers of bone formation such as osteocalcin were markedly elevated. Levels of fibronectin, a known target of signaling by Wnt, were also elevated. In vitro studies showed that the normal inhibition of Wnt signaling by Dickkopf-1 (DKK-1) was defective in the presence of the mutation and that this resulted in increased signaling due to unopposed Wnt activity. These findings demonstrated the role of altered LRP5 function in high bone mass and point to DKK as a potential target for the prevention or treatment of osteoporosis.
WNT Signaling and Bone Disease in Multiple MyelomaIndirect evidence of a role of DKK-1 in osteoblast function has been provided by identification of gain of function mutations in LRP-5 being linked to a high bone mass phenotype. In addition, targeted disruption of secreted firzzled-related protein (SFRP-1), a homologue of FRZB (SFRP-3), leads to decreased osteoblast and osteocyte apoptosis and increased trabecular bone formation.
A quantitative trait loci (QTL) influencing bone mass has been localized to the LRP-5 region, suggesting that the population at large have different risk of developing osteoporosis. It is conceivable that multiple myeloma bone disease may be influenced by the combined effects of DKK-1/FRZB expression with an inherited predisposition to low bone mass conferred by inherited LRP-5 alleles. Multiple myeloma cases may be genotyped for LRP-5 allele variations and correlate this information with bone disease, and DKK-1 and FRZB expression.
Monoclonal gammopathy of undetermined significance (MGUS), a plasma cell dyscrasia that is predisposed to develop into multiple myeloma, is differentiated from multiple myeloma by the lack of obvious bone disease. The significance of discovering DKK-1 and/or FRZB expression in a third of monoclonal gammopathy of undetermined significance is unclear but could suggest that these cases may be at higher risk for developing multiple myeloma. As with multiple myeloma, this predisposition may also be related to inherited LRP5 alleles. Alternatively, these monoclonal gammopathy of undetermined significance cases could have underlying preclinical bone disease that is not yet apparent by radiological scans.
Data presented herein suggests a model for how DKK-1 expression by multiple myeloma plasma cells can be linked to multiple myeloma disease growth control and bone destruction and how these two phenomena can be integrated by one molecule. In the model, primary multiple myeloma express high levels of DKK and these levels can be increased with drug therapies used to treat the disease. High levels of DKK-1 likely induce apoptosis of multiple myeloma cells and could explain the relatively slow progression of the disease in its early phase as cell growth is tempered by high rate of DKK-1 induced apoptosis. However, as the disease progresses there is an osteoclast-induced reduction in JUN and DKK-1 that eventually develops into a constitutive loss of JUN and DKK-1 expression as seen in extramedullary disease.
Thus, if one were to view DKK-1 expression from the perspective of the multiple myeloma plasma cells, high levels of DKK-1 expression could be seen as positive feature of the disease. However, with the mesenchymal cell lineage being exquisitely sensitive to DKK-1 induced apoptosis, the high levels of this secreted product likely has a double edge to it in that it also induces massive programmed cell death of osteoblast precursors and possibly even mesenchymal stem cells. It is expected that high levels of DKK-1 early in the disease could lead to a permanent loss of mesenchymal stem cells, a notion supported by the observed lack of bone repair after remission induction or during disease progression when osteoclasts likely suppress DKK-1 secretion by multiple myeloma plasma cells. Thus, exploitation of this knowledge might lead to the development of new therapies for multiple myeloma that accentuate DKK-1's effects on multiple myeloma plasma cells, but at the same time prevent DKK's bone damaging effects on osteoblast or their precursors.
The present invention also describes a molecular mechanism by which DKK1 likely inhibits osteoblast differentiation and contributes to myeloma bone disease. Initial experiments (
It has been reported that exogenous Dkk1 blocks Wnt3a-induced stabilization of beta-catenin and inhibits activation of the canonical Wnt pathway in MM cells (37-38). In the present invention (
Although osteoblasts clearly respond to Wnt3a by enhanced activation of the canonical Wnt/beta-catenin pathway, Wnt3a alone had no apparent effect on differentiation of osteoblast precursors as reflected by ALP production. Surprisingly, Dkk1 (or Dkk2) significantly blocked BMP-2-induced differentiation (
Since Dkk1 can block BMP-2 induced ALP production and Wnt signaling is necessary to induce differentiation, the possibility exists for cross regulation between these two pathways. Experiments to test this hypothesis revealed that BMP-2 treatment alone did not induce increased levels of beta-catenin over steady state (
In contrast to the lack of cross regulation described above, other studies have suggested that BMP-2 increases endogenous Wnt mRNA expression to promote increased ALP activity (44,79). Furthermore, BMP-2 and a beta-catenin mutant with constitutive transcriptional activity (DeltaN151) synergized to stimulate ALP activity, osteocalcin gene expression, and matrix mineralization (45). However, in the present experiments, BMP-2 did not induce increased stabilization of cytosolic, free beta-catenin in mouse and human pre-osteoblast cells, nor BMP-2 alone is able induced TCF/LEF transcriptal activity, nor did BMP-2synerzies Wnt3a-ainduced TCF/LEF activity indicating that, under these conditions, BMP-2 is unlikely to alter baseline or steady state levels of Wnt signaling sufficient, and required, for BMP-2 induced differentiation. It appears that cross talk between BMP-2 and a canonical Wnt pathway does not occur at, or above, the analyzed downstream targets of each signaling pathway. Consistent with this hypothesis, Nakashima and colleagues have previously reported that BMP-2 alone failed to increase TCF/LEF activity (46) although these two pathways are required for preosteoblast differentiation. Moreover, Mhalaviele and colleagues provided in vivo evidence that BMP-2 does not influence TCF/LEF activity related to that activated by beta-catenin mutant (ΔN151) in C3H10T1/2 cells (45). However, the possibility that interactions between Wnt and BMP-2 signaling pathways occur through alternate cascades cannot be excluded. In fact, in other systems, it has been reported that beta-catenin and LEF/TCF form complexes with Smads (47). Additionally, Wnt3a and BMP-2 (48) can induce expression of the ID2 gene and both induced MSX1 gene expression (49). Further studies will be required to clarify these differences.
Since it is thought that LRP5 or LRP6 can act redundantly, the reasons for observing an almost complete loss of BMP-2 induced ALP activity, when only one of the two was silenced are not clear. It may be that the amount of LRP5 or LRP6 on cell surface tightly regulates Wnt signaling required for BMP-2 induced ALP. While required, either alone is not sufficient. Indeed, Wnt-1 induced TCF/LEF transcriptional activity was almost completed blocked in fibroblast in LRP6 null mice in the presence of LRP5 (41). On the other hand, expression of loss-function of LRP5 mutant almost completely abolishes BMP-2 induced ALP activity in the presence of LRP6 in ST2 pluripotent bone marrow stromal cells (1). Another explanation could be that the trafficking of LRP5 and LRP6 on the cell surface might regulate Wnt signaling. This is consistent with recent studies that show that R-Spondin-1 regulates LRP6 cell surface levels of LRP6 by interfering with Dkk1/Kremen-mediated internalization of LRP6. Further studies will be needed to distinguish these hypotheses
In conclusion the above studies have revealed that autocrine Wnt signaling in osteoblasts is necessary to promote BMP-2-mediated differentiation of pre-osteoblast cells, while Wnt signaling alone is not capable of inducing such differentiation. Dkk1 inhibits this process and may be a key factor regulating pre-osteoblast differentiation, thereby emphasizing the importance of Dkk1 as a molecular target for novel therapeutic approaches to modulate myeloma bone disease.
The present invention also demonstrates that DKK1 may contribute to osteolytic bone lesion in MM by attenuating Wnt signaling in osteoblasts that prevents their differentiation and hence alters the expression of OPG and RANKL in favor of RANKL, which in turn leads to increased osteoclastogenesis in the local environment surrounding the plasma cell foci within the bone. The evidence supporting this model are the following: 1) DKK1 inhibits Wnt3a-induced stabilization of beta-catenin and reduces free-beta-catenin in both mouse and human osteoblast cells, 2) exogenous administration of DKK1 or constitutive expression of DKK1 dramatically diminished Wnt3a induced OPG expression in osteoblasts, 3) silencing DKK1 expression in human osteoblast-like cells expressing endogenous DKK1 increases sensitivity and reaction to Wnt3a stimulation as determined by increases in OPG expression, 4) MM bone marrow serum containing high DKK1 blocked Wnt3-mediated OPG expression, 5) mimicking the interaction between osteoblasts and MM cells in the bone marrow, a co-culture system also revealed that the DKK1-secreting OPM-2 MM cell line and primary CD138-selected plasma cells from MM patients dramatically attenuated Wnt3a-induced OPG mRNA and protein production by osteoblasts, and 6) a neutralizing DKK1-antibody could restore OPG expression in osteoblasts that was inhibited by the presence of MM bone marrow serum or primary MM plasma cells. Taken together, these results support the notion that DKK1 interrupts Wnt signaling-regulated bone resorption through regulation of osteoclastogenesis by inhibiting OPG expression. Indeed, OPG levels are decreased in myeloma serum relative to healthy controls (50,51). The importance of OPG is evidenced by the fact that administration of recombinant OPG or OPG peptidomimetic, OP34, can inhibit bone resorption and MM-associated osteolytic bone disease in murine models (22,52). In fact, Wnt signaling appears to indirectly inhibit osteoclastogenesis as well. It was observed that supernatants from osteoblast cells transfected with domain negative beta-catenin contain higher RANKL and lower OPG levels and these supernatants increase human osteoclasts from CD34 mononuclear cells isolated from bone marrow of MM patients relative to control supernatant. This is consistent with in-vivo data that show that deletion of beta-catenin results in marked increase in osteoclast cell number (26).
In contrast to the inhibitory effect of DKK1 on Wnt-stimulated OPG expression in osteoblast cells interacting with MM cells, DKK1 restores RANKL expression in osteoblast cells. Supporting this hypothesis are the following observations: 1) DKK1 significantly reversed Wnt3a-mediated downregluation of RANKL expression in mouse and human osteoblast-like cell lines, and 2) overexpression of DKK1 in osteoblast cells and MM serum with high DKK1 levels reversed Wnt3a-mediated downregulation of RANKL expression in mouse and human osteoblast-like cell lines. These results are consistent with studies in which DKK1 increases RANKL expression in the mouse osteoblast cell line C3H10T1/2. A role of Wnt signaling in the regulation of RANKL expression was first recognized by Holmen and colleagues who reported that an increase in canonical Wnt signaling by deletion of the Wnt inhibitory molecule APC results in an increase in RANKL expression in normal osteoblast cells in mice (Holmen et al., 2005). More recently, Spencer and colleagues illustrated that the human RANKL promoter contains TCF/LEF binding sites and overexpression of full-length beta-catenin inhibits RANKL promoter activity through a currently unknown mechanism in MC3T3-E1 cells (29). Although the source of RANKL is controversial, several groups have reported a role for RANKL in MM-triggered bone lesions. RANKL is upregulated in myeloma cells (19,20) and increased levels of RANKL in MM serum is used as prognostic index for indicating a survival in MM patients (21).
To reach comparable levels of beta-catenin stabilization, higher concentrations of Wnt3a were required in human osteoblasts than mouse osteoblasts, which may be attributable to dramatically higher levels (approximately 50-fold) of endogenous DKK1 in human osteoblast lines, since mouse and human lines have similar expression patterns of endogenous Wnt ligands and LRP5/6 co-receptor and Fz receptors. Consequently, ectopic constitutive expression of DKK1 in mouse C2C12 cells, which lack DKK1 expression, blocked Wnt3a-induced OPG expression to an extent similar to that seen with human osteoblast cells, which express high levels of endogenous DKK1. In contrast, knockdown of endogenous DKK1 expression in human osteoblast cells restored sensitivity to Wnt3a stimulation as exhibited by an increase in OPG expression. Thus, endogenous DKK1 in osteoblasts appears to be a key factor determining sensitivity to exogenous Wnt stimulation. The difference in DKK1 expression between these cells might represent the different specific stage of osteoblast differentiation that the cells represent, as the mouse osteoblast progenitor cell line C2C12 represents more immature progenitor cell the human osteosarcoma cells used (53). This notion is supported by the fact that DKK1 expression is high in late-stage osteoblast cell line KS463 (9). One can not exclude the possibility that this difference might reflect differences between mouse and man as human bone marrow derived mesenchymal cells express high levels of DKK1 (33) and DKK1 regulates human, but not mouse, mesenchymal cell differentiation into adipocytes or osteoblasts. Hence, the endogenous DKK1 levels in osteoblast cells should be considered an important factor when selecting as a model for studies role of Wnt signaling in regulation of OPG and RANKL
Although Wnt3a regulates both OPG and RANKL expression and DKK1 interrupts this process, it is interesting to note that Wnt3a stimulation had stronger effects on OPG expression than that of RANKL in these experiments. Wnt3a induced a much higher increase in OPG expression in response to Wnt3a compared with the inhibitory effect on RANKL expression. In addition, while anti-DKK1 antibody restored DKK1-suppressed OPG expression, it had no effect on DKK1-mediated increase of RANKL in osteoblast cells in coculture with primary MM cells. Thus, OPG seems to be more sensitive to Wnt signaling than RANKL. However, it has clearly been shown that overexpression of DKK1 and blockage of endogenous canonical Wnt signaling by expression of dominant negative beta-catenin significantly increases RANKL mRNA and protein. Thus, it is likely that DKK1-mediated suppression of OPG, rather than its effect to release a block to RANKL expression, may be the more important event contributing to MM OBL. However, the possibility that endogenous Wnt ligands regulate OPG and RANKL and as such regulate homeostasis of osteoclastogenesis in normal physiological conditions cannot be excluded since osteoblast cells express many Wnt ligands. Another possibility that was not addressed herein was whether endogenous Wnt signaling modulates RANKL expression at levels that are bellow the levels of sensitivity of current methods used to detect RANKL protein. This is supported by the fact that constitutive expression of DKK1 and lack of transcriptional activity of beta-catenin in osteoblast cells restores RANKL expression.
It is noteworthy that Gunn and colleagues have shown that conditioned media from MSCs can induce multiple myeloma cells lines to produce DKK1 and that these cells also produce high levels of IL-6 (54,55) a myeloma growth factor (56). Importantly, Gunn et al showed that IL-6-dependent myeloma cell lines growth in MSC conditioned media and that this growth is inhibited when a neutralizing antibody to IL-6 is added to the cultures.
Furthermore, the present invention also demonstrated that blocking of DKK1 activity in primary human myeloma-bearing SCID-rab mice was associated with increased osteoblast numbers and reduced osteoclast activity. This decreased osteoclast numbers in myelomatous bones from SCID-Hu mice could be due to a reduction of RANKL and increase in OPG. These effects resulted in prevention of bone resorption, increased bone formation and most importantly inhibition of tumor burden. The present invention also establishes, that Multiple Myeloma bone disease and tumor growth are interdependent, as blocking DKK1 activity, was accompanied by inhibition of Multiple Myeloma by blocking DKK1 activity progression. These in vivo data confirmed that DKK1 is critical factor involved in myeloma bone disease and tumor progression. Thus, therapeutic approaches to inhibit DKK1 activity in patients with myeloma will not only improve skeletal complications and quality of life but also help control myeloma. In addition, the present invention also demonstrated, that blocking of DKK1 activity in SCID-rab mice had bone anabolic effects on non-myelomatous bones, suggesting that DKK1 neutralization may have broad applications in bone disorders.
Taken together, the present invention proposes a working hypothesis that myeloma-derived DKK1 can act as a master regulator of OBL and myeloma disease survival. DKK1-mediated inhibition of Wnt-regulated osteoblast differention results in a loss of their functional activity to replace bone resorbed by osteoclasts. This leads to increased expression of IL-6, an essential survival factor for myeloma. This block of Wnt signaling also leads to a loss of expression of OPG and increased expression of RANKL. It is contemplated that the shift in the RANKL-to-OPG ratios, at the site of boney plasmacytomas, being propagated by high local concentrations of IL-6, results in increased local osteoclastogenesis and increased bone resorption with no anabolic response. Thus, DKK1 represents an important new and therapeutically tractable target as has been suggested herein and by preclinical studies.
In one embodiment of the present invention, there is provided a method for controlling bone loss in a subject, comprising the step of inhibiting a WNT signaling antagonist at the nucleic acid or protein level. Specifically, the inhibition of Wnt signaling antagonist may block induction of Wnt ligand, restore RANKL/OPG levels or both. Examples of WNT signaling antagonist may include but are not limited to soluble frizzled related protein 3 (SFRP-3/FRZB) or the human homologue of Dickkopf-1 (DKK1). The inhibition at the nucleic acid level may be due to Wnt antagonist specific peptide nucleic acid or siRNA. Alternatively, the inhibition at the protein level may be due to said Wnt antagonist specific antibodies, anti-sense oligonucleotides or small molecule inhibitors. Examples of subjects who may benefit from such a method may include but are not limited to ones with multiple myeloma, osteoporosis, post-menopausal osteoporosis and malignancy-related bone loss. The malignancy-related bone loss may be caused by breast cancer metastasis to the bone or prostate cancer metastasis to the bone.
In another embodiment of the present invention, there is a method for treating bone disease in a subject, comprising the step of: administering to the subject a pharmacologicallly effective amount of an inhibitor of a WNT signaling antagonist such that the administration blocks induction of Wnt ligand, restores RANKL/OPG levels or both. Examples of the WNT signaling antagonist may include but are not limited to soluble frizzled related protein 3 (SFRP-3/FRZB) or the human homologue of Dickkopf-1 (DKK1). The inhibitor may inhibit the Wnt signaling antagonist at the nucleic acid or protein level. Examples of the inhibitor at the nucleic acid level and protein level and those individuals benefitting from such a method are same as discussed supra. Additionally, the inhibitor may treat the bone disease by preventing bone resorption, increasing bone formation or both.
In yet another embodiment of the present invention, there is a method for inhibiting tumor growth in bone of a subject, the method comprising the step of blocking the activity of DKK1. Generally, the DKK1 activity is blocked by administering anti-DKK1 antibodies, DKK1 anti-sense oligonucleotides or small molecule inhibitor to the subject. Moreover, a subject who will benefit from such a method although not limited to includes one who has multiple myeloma, metastatic breast cancer or prostate cancer.
In another embodiment of the present invention, there is a method for screening for a compound that controls bone loss and inhibits human myeloma cell growth, comprising:engrafting human myeloma cells in a rabbit bone implanted in a SCID-rab mouse, administering the compound to the mouse; and comparing bone mineral density of the implanted bone and level of serum human monoclonal immunoglobulin in the mouse with a control SCID-rab mouse that has not received the compound, where an increase in the bone mineral density and a decrease in the level of serum immunoglobulin in the treated mouse compared to the control mouse indicates that the compound controls bone loss and inhibits human myeloma growth. Generally, the compound is an inhibitor of WNT signaling antagonist. Specifically, the WNT signaling antagonist is human homologue of Dickkopf-1 (DKK1) or soluble frizzled related protein 3 (SFRP-3/FRZB).
In yet another embodiment of the present invention, there is a method for inhibiting multiple myeloma growth in a subject suffering from multiple myeloma, said method comprising the step of blocking the activity of DKK1. This method may further comprise increasing osteoblastogenesis and decreasing osteoclastogenesis. The increase in osteoblastogenesis and the decrease in osteoclastogenesis is due to blocking of induction of Wnt ligand, restoring RANKL/OPG levels or both. Examples of inhibitors blocking the DKK1 activity are the same as discussed supra.
As used herein, the term, “a” or “an” may mean one or more. As used herein in the claim(s), when used in conjunction with the word “comprising”, the words “a” or “an” may mean one or more than one. As used herein “another” or “other” may mean at least a second or more of the same or different claim element or components thereof. As discussed herein, the inhibitor of Wnt antagonist described herein may be used in vitro or ex vivo by exposing the cell culture to the composition in a suitable medium. In vivo may be achieved by any known methods in the art.
The inhibitor of Wnt antagonist described herein or known in the art may be administered independently one or more times to achieve, maintain or improve upon a therapeutic effect. It is well within the skill of an artisan to determine dosage or whether a suitable dosage of such an inhibitor comprises a single administered dose or multiple administered doses. An appropriate dosage depends on the subject's health, the repair of the lytic bone lesion and prevention of tumor progression, the route of administration and the formulation used.
The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. One skilled in the art will appreciate readily that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those objects, ends and advantages inherent herein. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.
Example 1 Patients174 patients with newly diagnosed multiple myeloma, 16 patients with monoclonal gammopathy of undetermined significance, 9 with Waldenström's macroglobulinemia, and 45 normal persons were studied. Table 1 shows the characteristics of the patients with multiple myeloma.
Images were reviewed, without prior knowledge of gene expression data, using a Canon PACS (Picture Archiving and Cataloging System). MRI scans were performed on 1.5 Tesla GE Signa™ scanners. X-rays were digitized from film in accordance with American College of Radiology standards. MRI scans and x-rays were linked to the Canon PACS system using the ACR's DICOM (Digital Imaging and Communications in Medicine) standard. Imaging was done in accordance with manufacturers' specifications. MRI images were created with pre- and post-gadolinium T1-weighting and STIR (short-tau inversion recovery) weighting.
Example 3 Plasma Cell Isolation and Gene Expression ProfilingFollowing Ficoll-Hypaque gradient centrifugation, plasma cells obtained from the bone marrow were isolated from the mononuclear cell fraction by immunomagnetic bead selection using a monoclonal mouse anti-human CD138 antibody (Miltenyi-Biotec, Auburn, Calif.). More than 90 percent of the cells used for gene expression profiling were plasma cells, as shown by two-color flow cytometry using CD138+/CD45− and CD38+/CD45− markers, the presence of cytoplasmic immunoglobulin light chains by immunocytochemistry, and morphology by Wright-Giemsa staining. Total RNA was isolated with RNeasy Mini Kit (Qiagen, Valencia, Calif.). Preparation of labeled cRNA and hybridization to U95Av2 microarrays containing approximately 10,000 genes (Affymetrix, Santa Clara, Calif.) was performed as previously described (57,58). RNA amplification was not required.
Example 4 ImmunohistochemistryAn antibody from a goat that was immunized against the entire human DKK1 protein (R&D Systems, Minneapolis, Minn.) was diluted 1:200 in Tris-buffer and added to formalin-fixed, paraffin-embedded bone marrow biopsy sections for 2 hours at room temperature. Adjacent sections were stained with H & E. Antigen-antibody reactions were developed with DAB (after biotinylated anti-goat antibody [Vector Laboratories, Burlingame, Calif.] [1:400 dilution] and streptavidin-horse radish peroxidase [Dako] staining), and counterstained with Hematoxylin-2.
Example 5 Enzyme Linked Immunosorbent Assay (ELISA)Nunc-Immuno MaxiSorp surface microtiter plates were coated with 50 ml of anti-DKK1 antibody at 1 mg/ml in 1× phosphate buffered saline, pH 7.2 at 4° C. overnight, and blocked with 4 percent bovine serum albumin. Bone marrow plasma was diluted 1:50 in dilution buffer (1× phosphate buffered saline+0.1 Tween-20+1 percent bovine serum albumin). A total of 50 μl was loaded per well and incubated overnight at 4° C., washed and incubated with biotinylated goat anti-human DKK1 IgG (R&D Systems) diluted to 0.2 mg/ml in dilution buffer, followed by addition of 50 μl of 1:10,000 dilution of streptavidin-horse radish peroxidase (Vector Laboratories), all according to manufacturer's recommendations. Color development was achieved with the OPD substrate system (Dako) based on manufacturer's instructions. Serial dilutions of recombinant human DKK1 (R&D Systems) were used to establish a standard curve. The cell line T293, which does not express endogenous DKK1 and T293 with stably transfected DKK1 (59) were used to validate the ELISA assay.
Example 6 Osteoblast Differentiation AssaysC2C12 mesenchymal precursor cells (American Type Tissue Culture, Reston, Va.) were cultured in DMEM (Invitrogen, Carlsbad, Calif.) supplemented with 10 percent heat-inactivated fetal calf serum. Alkaline phosphatase activity in C2C12 cells was measured as described (60,61). Cell lysates were analyzed for protein content using the micro-BCA assay kit (Pierce, Rockford, Ill.).
Example 7 Statistical AnalysesBone disease in multiple myeloma patients was modeled using logistic regression. Independent variables considered were gene expression intensity values (average difference calls) from ˜10,000 genes (12,625 probe sets) measured using version 5.01 MAS (Affymetrix, Santa Clara, Calif.) from 174 cases of newly diagnosed multiple myeloma. The “Signal”, a quantitative measure of gene expression, for each probe set was transformed to log2 before entry into the logistic regression model and permutation-adjustment analysis. There was no prior hypothesis with regard to genes that might be associated with bone disease in myeloma. As a result a univariate model of bone disease for each of the 12,625 probe sets was used. Candidate genes were refined using t-tests with permutation-adjusted significance levels (62). The Westfall and Young analysis was used to adjust for the multiple univariate hypothesis tests. Group differences in DKK1 signal and DKK1 protein levels were tested using the Wilcoxon rank sum test. Significant differences in patient characteristics by status of bone disease were tested using either the Fisher's exact test or the chi-square test. Expression intensities of genes identified by logistic regression were visualized with Clusterview (63). Spearman's correlation coefficient was used to measure correlation of gene expression and protein levels. Significant differences, in osteoblast differentiation, between the control and each experimental condition were tested using the Wilcoxon rank sum test; separate comparisons were made for each unique C2C12 experiment. Two-sided p-values less than 0.05 were considered significant and two-sided p-values less than 0.10 were considered marginally significant.
Example 8 Gene Expression Profiling of Myeloma CellsTo identify genes that were overexpressed and associated with the presence of bone lesions, comparing microarray data from patients with or without bone lesions were performed. As MRI-defined focal lesions of bone can occur before radiologically identifiable lytic lesions, T1-weighted and STIR-weighted imaging to evaluate bone lesions were used. The gene expression patterns of approximately 10,000 genes in purified plasma cells from the marrow of patients with no bone lesions (n=36) and those with 1 or more (1+) MRI-defined focal lesions (n=137) were modeled by logistic regression analysis. The model identified 57 genes that were expressed differently (P<0.0001) in the two groups of patients (
Monoclonal gammopathy of undetermined significance (MGUS) is a plasma cell dyscrasia without lytic bone lesions and can precede multiple myeloma. In 15 of 16 cases of MGUS, DKK1 was expressed by bone marrow plasma cells at levels comparable to those in multiple myeloma with no MRI or x-ray lesions of bone (
In order to further identify the molecular determinants of lytic bone disease, the expression profiles of ˜12,000 genes in CD138-enriched plasma cells from newly diagnosed multiple myeloma patients exhibiting no radiological evidence of lytic lesions on bone surveys (n=28) were compared to those with 3 lytic lesions (n=47). The Chi-square test of absolute calls (a qualitative measure of gene expression) was used to identify 30 genes that distinguished the two forms of disease (P<0.05). The Wilcoxon Rank Sum (WRS) test of the signal call (a quantitative measure of gene expression) revealed that 104 genes (49 up- and 55 down-regulated) differentiated the two disease subtypes (P<0.001).
The Chi-square test identified the RHAMM proto-oncogene as the most significant discriminator between the two groups. It was expressed in only 7 of 28 patients with no bone disease compared with 34 of 47 patients with bone disease (
PTTG1 (securin) involved in chromosome segregation was identified by WRS as the most significant discriminating gene (P=4×10−6). It was called present in 11% of no lytic lesion group but present in 50% of the lytic lesion group (
In addition, 4 so called “spike genes” were identified that were more frequently found in lytic lesion group versus no lytic lesion group (p<0.05): IL6, showing spikes in 0/28 no lytic lesion group and 7/47 lytic lesion group (p=0.032); Osteonidogen (NID2) showing spikes in 0/28 no lytic lesion group and 7/47 lytic lesion group (p=0.032); Regulator of G protein signaling (RGS13) showing spikes in 1/28 no lytic lesion group and 11/47 lytic lesion group (p=0.023); and pyromidinergic receptor P2Y (P2RY6) showing spikes in 1/28 no lytic lesion group and 1/47 lytic lesion group (p=0.023).
Thus, these data suggest that gene expression patterns may be linked to bone disease. In addition to being potentially useful as predictors of the emergence of lytic bone disease and conversion from monoclonal gammopathy of undetermined significance to overt multiple myeloma, they may also identify targets for potential intervention.
Example 10 DDK1 and FRZB Tend to be Expressed at Higher Levels in Plasma Cells from Focal Lesions than from Random MarrowGiven the relationship of DKK-1 and FRZB to lytic lesions, DKK-1 and FRZB expressions were compared in plasma cells derived from random bone marrow aspirates of the iliac crest with those derived by CT-guided fine needle aspiration of focal lesions of the spine. These results showed significantly higher levels of expression in plasma cells from focal lesions.
Example 11 DKK-1 and FRZB are not Expressed in Plasma Cells from Waldenström's MacroglobulinemiaWaldenström's macroglobulinemia is a rare plasma cell dyscrasia characterized by a monoclonal IgM paraproteinemia and lymphoplasmacytic infiltration of bone marrow, lymph nodes and spleen. Its clinical presentation is variable as is the clinical course, yet unlike multiple myeloma, bone lesions are rare. Although global gene expression profiling of CD138-enriched bone marrow plasma cells from 10 cases of Waldenström's Macroglobulinemia reveled gross abnormalities, these cells, like normal bone marrow plasma cells, lack expression of FRZB and DKK (
Endothelin 1 is a 21 amino acids vasoconstrictor. Two receptors for endothelin, receptors A and B, have been identified. Breast and prostate cancer cells can produce endothelin 1, and increased concentrations of endothelin 1 and endothelin receptor A have been found in advanced prostate cancer with bone metastases. Breast cancer cells that produced endothelin 1 caused osteoblastic metastases in female mice. Conditioned media and exogenous endothelin 1 stimulated osteoblasts proliferation and new bone formation in mouse calvariae cultures (
Table 3 shows that the expression of endothelin receptor B (ENDRB) was correlated with that of DKK-1. Endothelin receptor B was a ‘spike’ gene in one third of newly diagnosed multiple myeloma (
DKK-1 expression is massively upregulated by UV irradiation and several other gentoxic stimuli. To see if multiple myeloma plasma cells also upregulate the genes in response to drugs used to treat this disease, gene expression profiling of multiple myeloma plasma cells was performed before and after 48 hour in vivo treatment with thalidomide (
The close relationship between myeloma cells and osteoclasts is expressed clinically by the association of debilitating lytic bone destruction with multiple myeloma. The development of lytic bone lesions is caused by the activation of osteoclasts through direct and indirect interactions with myeloma plasma cells. The critical role of osteoclasts in the survival and growth of myeloma cells and in sustaining the disease process has been gleaned clinically and demonstrated in vivo in experimental models such as the SCID-hu model for primary human myeloma.
In order to investigate the molecular consequences of multiple myeloma plasma cell/osteoclast interactions, an ex vivo system was developed in which CD138-enriched multiple myeloma plasma cells were co-cultured with osteoclasts derived from multiple myeloma peripheral blood stem cells or PBSCs and MNC from healthy donors. CD138-enriched multiple myeloma plasma cells co-cultured with human osteoclasts derived from peripheral blood stem cells from normal donors or multiple myeloma patients maintained their viability and proliferative activity as indicated by annexin V flow cytometry, BrdU labeling index and [3H]TdR incorporation for as long as 50 days. Purity level of plasma cells before and after co-cultures was greater than 95% as determined by CD38/CD45 flow cytometry.
Microarray analyses of the expression of ˜12,000 genes in 12 multiple myeloma plasma cells were performed before and after 4 day co-culture. Heirarchical cluster analysis of the 12 multiple myeloma plasma cells pairs and 150 newly diagnosed multiple myeloma plasma cells using 7,913 probes sets (genes) revealed that whereas the pre-co-culture samples were distributed amongst 3 major cluster groups, the post-co-culture samples clustered tightly together in 2 of the major branches. An analysis of the significant gene expression changes after co-culture showed that 95 probe sets (genes) changed 2- to 50-fold (77 up- and 18 down-regulated) in at least 8 of the 12 multiple myeloma plasma cells after co-culture. CD138-enriched plasma cells from 5 healthy donors showed identical shifts in many of the same genes, suggesting that multiple myeloma plasma cells do not exhibit altered responses to osteoclasts. However, normal plasma cells as opposed to their malignant counterparts did not survive in long term co-cultures with osteoclasts.
The most striking changes were in the up-regulation of the chemokines GRO1, GRO2, GRO3, SCYA2, SCYA8, SCYA18, and IL8. Other notable genes included the chemokine receptor CCR1, osteopontin (SPP1), the integrins ITGB2 and ITGB5, matrix metalloproteinase 9 (MMP9), cathepsin K (CTSK) and cathepsin L (CTSL). Surprisingly, a large number of osteoclast-related genes were among the 77 up-regulated genes. The down-regulated genes included cyclin B (CCNB1), the cyclin B specific ubiquitin ligase UBE2C, the TSC-22 homologue DSIPI, and JUN, JUND, FOS, and FOSB.
Gene expression changes were also tested in 10 osteoclast cultured alone and after co-culture with multiple myeloma plasma cells. Twenty-four genes (14 up- and 10 down-regulated) changed 2- to 10-fold in at least 7 of 10 osteoclasts after co-culture. There were no significant differences in gene expression between multiple myeloma plasma cells cultured with osteoclasts derived from multiple myeloma patients or from healthy donors, suggesting that multiple myeloma osteoclasts are not qualitatively different than those derived from normal donors.
No significant changes in gene expression were observed when multiple myeloma plasma cells were cultured in media derived from a co-culture experiment, suggesting that contact is important. Given the low ratio of multiple myeloma plasma cells to osteoclasts in the co-culture experiments (1000:1), it is unlikely that all plasma cells can be in contact with the osteoclasts simultaneously. Thus, it is likely that some intercellular communication between multiple myeloma plasma cells in contact with osteoclasts and those other multiple myeloma plasma cells occurs.
It is known that osteoclasts play a major role in multiple myeloma bone disease as well as providing multiple myeloma with anti-apoptotic signals. Recent studies have shown that JUN directly regulates DKK-1 expression and that JUN and DKK-1 control apoptosis.
To determine if osteoclasts may prevent apoptosis of multiple myeloma plasma cells by modulating JUN and DKK-1, gene expression profiling was performed on purified plasma cells from 12 primary multiple myeloma cases before and after 48 hours of co-culture with in vitro derived osteoclasts. Multiple myeloma plasma cells in the co-culture had significantly higher long-term viability than cells cultured alone. Gene expression profiling of multiple myeloma plasma cells before and after osteoclast co-culture revealed that JUN, FOS, and FOSB were 3 of 40 genes down-regulated more than 2-fold in all cases (n=12/12). Hierarchical cluster analysis of HMCL and primary multiple myeloma cells with 95 genes significantly modulated in multiple myeloma plasma cells after co-culture revealed a striking similarity between HMCL, primary multiple myeloma co-cultured with osteoclasts and a subset of newly diagnosed multiple myeloma in that these cell types had relatively low levels of c-JUN and c-FOS.
Importantly, whereas primary multiple myeloma cells show a high degree of spontaneous apoptosis when cultured alone, multiple myeloma plasma cells cultured in the presence of osteoclasts can survive indefinitely. These data support a link between JUN and DKK-1 and also suggest that loss of JUN and DKK expression in multiple myeloma may be associated with disease progression as extramedulalary diseasse and HMCL, which are invariably derived from extramedullary disease, lack both JUN and DKK. It is interesting to speculate that one of the major influences of osteoclasts on multiple myeloma growth and behavior is to downregulate JUN and DKK-1, which directly affects plasma cells apoptosis. Treatment of HMCL and primary multiple myeloma/osteoclasts co-cultures with DKK-1 is expected to result in apoptosis of multiple myeloma plasma cells. DKK-1 will likely have no effect on the osteoclasts, as these cells do not express the Wnt co-receptor LRP-5. Normal bone marrow derived plasma cells also do not express DKK-1 and may help explain their long-lived nature.
Example 15 Synthesis of DKK1 Protein by Plasma CellsSerial sections from bone marrow biopsies of 65 cases of multiple myeloma were stained for the presence of DKK1. The plasma cells in these cases contained DKK1 in a manner consistent with the gene expression data (
An enzyme-linked immunosorbent assay (ELISA) showed that the concentration of DKK1 protein in the bone marrow plasma from 107 of the 173 newly diagnosed multiple myeloma patients for which gene expression data was also available, was 24.02 ng/ml (S.D. 49.58). In contrast, DKK1 was 8.9 ng/ml (S.D. 4.2) in 14 normal healthy donors, 7.5 ng/ml (S.D. 4.5) in 14 cases of MGUS, and 5.5 ng/ml (S.D. 2.4) in 9 cases of Waldenström's macroglobulinemia. DKK1 gene expression and the level of DKK1 in the bone marrow plasma were positively correlated (r=0.65, P<0.001) in the 107 cases of myeloma (
In 68 patients in whom both DKK1 protein levels in the bone marrow plasma and the presence of bone lesions were determined, DKK1 protein in patients with 1+ MRI and no x-ray lesions differ significantly compared to patients with no MRI and no x-ray lesions (median level: 20 ng/ml vs. 9 ng/ml; p=0.002), but does not differ significantly compared to patients with 1+ MRI and 1+ x-ray lesions (median level: 20 ng/ml vs. 14 ng/ml; p=0.36) (
Bone morphogenic protein-2 can induce differentiation of the uncommitted mesenchymal progenitor cell line C2C12 (53) into osteoblasts through a mechanism that involves Wnt/beta-catenin signaling (64,65). Alkaline phosphatase, a specific marker of osteoblast differentiation, was undetectable in C2C12 cells grown in 5 percent fetal calf serum for 5 days (
Expression of the DKK1 by multiple myeloma cells has been shown to correlate with lytic bone disease in multiple myeloma. Furthermore, as discussed supra, it was observed that alkaline phosphatase production was inhibited in presence of recombinant human DKK1. Hence, the present invention further investigated the mechanism by which DKK1 contributed to this process.
Cells and Cell CultureMouse pluripotent mesenchymal precursor cell line C2C12 and the human osteoblast cell line hFOB1.19 were purchased from America Type Culture Collection (Manassas, Va.). C2C12, MG63, Saos-2, and 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Invitrogen, Carlsbad, Calif.) containing 10% heat-inactivated FBS, penicillin (100 U/ml), streptomycin (100 mg/ml), and 4 mM L-glutamine. Cells were maintained at 37° C. and humidified with 95% air and 5% CO2 for cell culture. hFOB1.19 was cultured in a 1:1 mixture of Ham's F12 and DMEM with 10% FBS in the presence of 0.3 mg/ml G418.
Constructs and TransfectantsTo generate dominant negative (DN)-beta-catenin stable clones, C2C12 cells were transfected with pcDNA4 vector or a vector containing DN-beta-catenin cDNA (3) using lipofectimine (Invitrogen) following manufacturer's instructions. After transfection, stable clones were generated by growing the cells in DMEM containing 10% FBS in the presence of Neocin (1 mg/ml) for two weeks. Stable Dkk1 and Dkk2 expressing clones generated in C2C12 and OPM-2 cells were previously described (38).
Preparation of Conditioned MediumConditioned medium (CM) containing Wnt3a, Dkk1, Dkk2 and or appropriate control constructs was prepared as previously described (38). Dkk1 and Dkk2 proteins in CM were detected by immunoblotting using anti-V5 (explain what anti-V5 is specific for)) and anti-Dkk1 antibodies by ELISA. The supernatant from culture medium was concentrated five-fold by using a YM-30 column (66). Dkk1 levels in bone marrow plasma from MM patients was detected by ELISA.
Immunoblotting Analysis:Cells were incubated in MEM, Wnt3a CM, control CM, or with recombinant Wnt3a for indicated times. For inhibition studies, cells were pretreated with purified recombinant Dkk1 at indicated concentrations or Dkk1 CM, Dkk2 CM, or bone marrow plasma with low or high concentrations of Dkk1 protein for one hour. Following treatment, cells were lysed as described (66). Cell lysates were separated by SDS-PAGE and transferred to Immobilon polyvinylidene difluoride membranes (Millipore, Bedford, Mass.). Immunoblotting was performed using the indicated antibodies.
GST-E-Cadherin Binding AssayThe GST-E-cadherin binding assay was performed as described (5). Briefly, the beta-catenin binding site of E-cadherin as a GST-fusion protein was purified using GST beads. GST-E-cadherin was used to precipitate uncomplexed beta-catenin present in 500 mg of cell lysate. Precipitated beta-catenin was detected by immunoblotting using a beta-catenin monoclonal antibody. Non-phosphorylated beta-catenin was detected with a monoclonal antibody specific for beta-catenin dephosphorylated at residues of 27-37 (Alexis, San Diego, Calif.).
Enzyme-Linked Immunosorbent AssayMicrotiter plates were coated with 50 μl of anti-Dkk1 antibody (R&D Systems, Minneapolis, Minn.) according to manufacturer recommendations. Bone marrow plasma (1:50) in dilution buffer was added and incubated overnight at 4° C. Plates were washed and incubated with biotinylated goat anti-human Dkk1 IgG (R&D Systems, Minneapolis, Minn.) followed by streptavidin-horseradish peroxidase (Vector Laboratories), according to manufacturer recommendations.
Luciferase Reporter Gene AssayCells plated at 5×104 per well in a 12-well plate were transiently co-transfected with 1 mg/ml of either TOPflash, FOPflash (81), or Cbfa-1-luc (kindly provided by Dr. Ying Zhang, NCI, NIH) and 50 ng of pSV-beta-galactosidase vector to normalize for transfection efficiency using Lipofectamine according to manufacturer instructions (Invitrogen). Following transfection, cells were exposed to Wnt3a CM or control CM for 24 hr prior to luciferase assay. Luciferase activity was measured as previously described (38).
Alkaline Phosphatase (ALP) AssayCells were cultured in DMEM with 2% horse serum including either BMP-2 (200 ng/ml), Wnt3a CM, BPM-2 plus Dkk1, or BMP-2 plus Wnt3a CM for 72 or 96 hr followed by lysis in 150 ml of lysis buffer (20 mM Tris HCl, pH 8 and 150 mM NaCl, 0.2% NP40). ALP activity was measured using ALP kit (Diagnostic Chemical Limited, Exton, Pa.) according to manufacturer instructions. Absorbance of the samples was determined with a Spectra Max340 Microplate Spectrophotometer (Molecular Devices, Sunnyvale, Calif.) at 402 nm. Cell lysates were analyzed for protein content with using the micro-BCA assay kit (Pierce, Rockford, Ill.).
RT-PCR Analysis:First strand cDNA synthesis was performed as previously described. (31) All PCR reactions began with a first cycle at 95° C. for 3 min and a final cycle at 72° C. for 10 minutes with an additional 35 cycles at 94° C./30 s, 60° C./45 s, 72° C./1 min. Primer sequences for the indicated human genes are as described (38). Primers, including Fz (Table 4), TCF and Dkk (Table 5) were designed using a primer pair program in the MacVector (City) software based on gene sequences from the NIH Gene Bank (www.ncbi.nim.nih.gov).
PCR fragments were subcloned using TOPO-TA cloning vector according to manufacturer instructions (Invitrogen) and sequence analysis performed as previously described (38). Data analysis was performed using MacVactor software and comparisons made with NCBI BLAST (www.ncbi.nlm.nih.gov/blast/).
Real-Time Quantitative PCROne microgram of total RNA was reverse transcribed into total cDNA. Quantitative PCR (qPCR) was performed using an ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, Calif.). The reaction mixture contained 1 ml of cDNA, dedicated buffers with specific primers and probes (5′-labeled by 6-carboxy-fluorescein and 3′-labeld by 1-carboxy-teteramethyrhdamine), and DNA polymerase in a total 20 ml volume. Following 2 min incubation at 50° C. and 10 min incubation at 95° C. for denaturing, the reaction was subjected to 40-cycle amplification at 95° C. for 15 second to denature and at 60° C. for 1 min for annealing/extension. Each cDNA sample was analyzed in triplicate in parallel with GAPDH as a control. Changes in mRNA concentration were determined by subtracting the CT (threshold cycle) of target gene from the CT of GAPDH (A=CT gene-CT GAPDH). The mean of Δ control was subtracted from the ΔSiLRP5/6 reaction (mean Δ control−ΔSiLRP5/6=e) The difference was calculated as 2e by the 2−
Chemical synthesis of siRNA specific to LRP5/6, GFP, and control siRNA were purchased from Qiagen (Valencia, Calif.). The siRNA were transiently transfected into C2C12 using Lipofectamine according to manufacturer instructions (Invitrogen). RNA was isolated after 24, 48 or 72 hours then subjected to RT-PCR or qPCR for determination of efficacy of target gene silencing.
Statistical AnalysisStatistical significance of differences between experimental groups was analyzed by a Student's t-test using the Microsoft Excel software statistical package. Significant p values were less than 0.05 by two-tailed test.
Expression of Wnt Receptors and Co-Receptors in OB CellsRT-PCR was used to evaluate the presence of Wnt receptor mRNA in C2C12, hFO1.19, and two human osteoblast-like cells lines, MG63 and Saos-2. Analysis using primers for all Fz family members (
Having demonstrated the presence of Fz and LRP receptors, we sought to determine whether a functional canonical Wnt/beta-catenin pathway was present by first examining the status of downstream beta-catenin. Because osteoblasts express high levels of cadherin proteins (including beta-catenin) (67), especially in the form of membrane-bound protein (68), the GST-E-cadherin binding assay was used to separate cytosolic, free (uncomplexed) beta-catenin from the membrane bound form. Examination of Wnt3a treatment effects revealed significant increases of free b-catenin appearing in a time-dependent manner (
RT-PCR analysis of TCF/LEF family members revealed expression of TCF1, 3, 4, and LEF1 mRNA in C2C12 cells (
To examine the effect of Dkk1 in OBs, cells were incubated with increasing amounts of Dkk1 prior to Wnt3a treatment. As shown in
To determine whether Dkk1 expression by MM cells might have similar effects on functional Wnt signaling in the bone marrow microenvironment, the following experiments were performed. First, stable Dkk1-expressing clones were generated in the OPM2 MM cell line and lysates containing Dkk1 used to determine the effect on Wnt3a-induced stabilization of b-catenin in C2C12 cells. The presence of Dkk1 protein in cell lysates from stable OPM-2 clones was determined by Western blot analysis with anti-V5 antibody (
Given the characterization of a functional Wnt signaling pathway in mouse and human pre- and osteoblast-like cells, experiments were undertaken to identify the biological effects associated with this pathway. C2C12 cells were selected as a model since following reasons. First, they undergo pre-osteoblast differentiation in the presence of BMP-2 (70). Second, they express less Dkk1 mRNA and protein, compared with other human cell lines and primal human mesenchymal cells and finally they react with addition of Dkk1 more sensitively that human other lines (
To address the role of autocrine Wnt-b-catenin signaling in pre-osteoblast differentiation, C2C12 cells were transfected with a dominant negative (DN)-b-catenin construct which lacks TCF/LEF binding sites and inhibits transcriptional activity (71). DN-beta-catenin expression was confirmed by western blot analysis with anti-X-press antibody (
Inhibition of ALP Activity by siRNA Specifically Targeting LRP5/6
To determine the specific role of Wnt receptors in mesenchymal cell differentiation in vitro, we used siRNA specific for LRP5 and LRP6 to down regulate gene expression. As shown in
To address the question of whether the Wnt and BMP-2 pathways were involved in cross-regulation and co-regulation of downstream elements and/or if Dkk1 directly interferes with BMP-2 signaling to inhibit osteoblast differentiation, the effects of BMP-2 on b-catenin stabilization were first analyzed. As shown in FIG. 42AA, treatment of all pre-osteoblast cell lines with BMP-2 for 8, 24, and 48 hrs did not result in changes in b-catenin as compared to Wnt3a treated controls. BMP-2 alone did not induce TCT/LEF transcriptional activity, nor did it synergize Wnt3a-stimulated TCF/LEF transcriptional activity as determined by luciferase activity in C2C12 cells transfected with TOPflash constructs (FIG. 42BB). Thus, BMP-2 did not activate the Wnt-beta-catenin pathway at the beta-catenin and TCF/LEF levels. Experiments were next implemented to determine whether Wnt and Dkk1 directly regulate BMP-2 signaling. First, BMPR-I and -II were immunoprecipitated from C2C12 cell lysates followed by blotting with antibodies to LRP5 and LRP6. Complexes of LRP5/6 and BMPR-I/-II were not found following either Wnt3a or Dkk1 treatment. Similar results were obtained in 293T cells transiently transfected with plasmid containing LRP5/6 cDNA. To ascertain whether Wnt3a can activate BMP-2 downstream targets, Smad phosphorylation was analyzed using antibodies specific to p-Smad1-S463/465. Wnt3a did not induce phosphorylation of Smad1 in C2C12 cells (FIG. 42BB) nor Smads5 and 8 as assessed with antibodies to p-Smad5-S463/463, and p-Smad8-S4261428 in contrast to BMP-2 controls. Because BMP-2 also increases Smad6 gene expression, which serves as inhibitor of BMP-2 signaling (72), the present invention examined if Wnt and Dkk1 affects its expression. As expected, BMP-2 induced increase in Smad6 mRNA in a time-dependent manner in C2C12 cells as measured by qPCR analysis (FIG. 42AD). However, neither Wnt3a alone nor Dkk1 affected BMP-2-induced Smad6 gene expression. Finally, the effect of Wnt3a and Dkk1 on transcriptional activity of Cbfa-1/Runx2 was investigated by transiently transfecting C2C12 with a luciferase reporter construct, Cbfa-1-Luc and treating with Wnt3a and Dkk1. Cell lysates assayed for luciferase revealed no change in activity indicating the Wnt3 role in osteoblast differentiation is independent of Cbfa-1/Run2 transcriptional activity. Taken together, these results suggest that Wnt does not activate downstream elements in the BMP-2 pathway, BMP-2 does not activate downstream elements in the Wnt pathway, and Dkk1 does not directly inhibit BMP-2 signaling.
Example 19 Effect of Myeloma Derived DKK-1 on Wnt-Regulated Osteoprotegerin and RANKL Production by OsteoblastsThe present invention examined the influence of DKK1 on RANKL/OPG expression in myeloma.
Primary Myeloma Cells and Established Myeloma Cell-LinesPrimary plasma cells (PC) were obtained from heparinized bone marrow (BM) aspirates from multiple myeloma (MM) patients during scheduled clinic visits. Mononuclear cells were isolated from BM of MM pateints using a Ficoll-Hypaque density gradient centrifugation. PC isolation from mononuclear cell fraction was performed by immunomagnetic bead selection with monoclonal mouse antihuman CD138 antibodies using the AutoMACs automated separation system (Miltenyi-Biotec, Auburn, Calif.). PC purity of more than 85% homogeneity was confirmed by 2-color flow cytometry using CD138+/CD45 and CD38+/CD45 criteria (Becton Dickinson, San Jose, Calif.), immunocytochemistry for cytoplasm light-chain immunoglobulin (Ig), and morphology by Wright-Giemsa staining.
Cell lines: Human MM cell line, OPM-2 was cultured in RPMI1640 as previously described (38). Mouse pluripotent mesenchymal precursor cell line C2C12 that has the potential of differentiating into osteoblast in the presence of BMP-2 (53) and human osteoblast cell line hFOB1.19 were purchased from America Type Culture Collection (Manassas, Va.). C2C12 and human osteoblast-like cell line, Saos-2 and MG63 were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Invitrogen, Carlsbad, Calif.) containing 10% heat-inactivated FBS, penicillin (100 U/ml), streptomycin (100 mg/ml), and 4 mM L-glutamine. Cells were maintained at 37° C. and humidified with 95% air and 5% CO2 for cell culture.
Coculture SystemC2C12 cells were cultured in 6-well plates in DMEM with 10% FBS and maintained at subconfluence. MM cells (5×105/ml) were seeded on the C2C12 in the presence or absence of Wnt3a-CM or Cont-CM for indicated times. For coculture with primary cells, CD138 positive cells were cultured on of the C2C12 monolayer for 72 hours in the presence or absence of rWnt3a with and without anti-DKK1 antibody (R&D System) for 48 hours. Total RNA was isolated using TRIZOL reagent (Invitrogen). Supernatants were harvested for protein analysis.
Constructs and TransfectantsA MM cell line, OPM-2, stably expressing DKK1 was generated as previously described (38). Functional DKK1 protein was determined by blocking Wnt3a induced TCF/LEF transcriptional activity using the TOPflash luciferase assay as previously described. To generate a DKK1 expressing osteoblast cell line, C2C12 cells were transfected, using Lipofectamine (Invitrogen-Life Technologies, Inc.), with a pEF-V5 vector or the same vector carrying a DKK1 cDNA, according to manufacturer's instructions. Clonal cell lines were generated by limited dilution in growth media containing blasticidin. Positive clones were detected by anti-V5 antibody with Western blotting analysis. DKK1 protein concentration in supernatant cultured positive clones was measured by ELISA analysis. Functional DKK1 protein was determined by analyzing the effect on stabilization of free beta-catenin as previously described (73).
Preparation of Conditioned MediumWnt3a conditioned medium (Wnt3a-CM) or control (Cont-CM) was prepared as described (38). Briefly, Wnt3a-producing L cells (stably transfected with Wnt3a cDNA kindly provided by Dr Shinji Takata) or control L cells were cultured to confluence in DMEM medium supplemented with 10% FCS after which the medium was replaced with serum-free DMEM. The culture supernatant was collected after 72 hours and designated Wnt3a-CM and Cont-CM, respectively. The concentration of Wnt3a in Wnt3a-CM was evaluated by correlating β-catenin stabilization with that of recombinant Wnt3a (R&D Systems, Minneapolis, Minn.). The concentration in 100% CM equates to the 150 to 200 ng/ml of recombinant Wnt3a. DKK1 conditioned medium (DKK1-CM) and control medium (Cont-CM) were prepared as described previously. DKK1 protein in DKK1-CM, Cont-CM, supernatant from culture media of C2C12, MG63, and Saos-2 cells, and sera from MM pateints were measured by ELISA analysis as described previously.
Immunoblottinq Analysis and GST-E-Cadherin Binding AssayProteins from cell lysates derived from C2C12 and OPM-2 cells expressing DKK1 or empty vector were separated by SDS-PAGE and transferred to Immobilon polyvinylidene difluoride membranes (Millipore, Bedford, Mass.). Immunoblotting was performed using the indicated antibodies as previously described (74). The GST-E-cadherin binding assay was performed as described (5). Briefly, proteins were isolated from cells that had been treated with recombinant Wnt3a for indicated times. The beta-catenin binding site of E-cadherin as a GST-fusion protein was purified using GST beads. GST-E-cadherin was used to precipitate uncomplexed beta-catenin in 500 mg of cell lysate. Precipitated beta-catenin was detected by immunoblotting analysis using a b-catenin monoclonal antibody (74).
Enzyme-Linked Immunosorbent AssayMicrotiter plates were coated with 50 μl of anti-DKK1 antibody (R&D Systems, Minneapolis, Minn.) according to manufacturer recommendations. Bone marrow serum (1:50) in dilution buffer was added and incubated overnight at 4° C. Plates were washed and incubated with biotinylated goat anti-human DKK1 IgG (R&D Systems, Minneapolis, Minn.) followed by streptavidin-horseradish peroxidase (Vector Laboratories), according to manufacturer recommendations. The concentrations of OPG and RANKL proteins in cultured supernatant were measured using the kits from according to manufacturer recommendations (R&D Systems, Minneapolis, Minn.).
RT-PCR Analysis and DNA Sequence AnalysisTotal RNA was isolated using TRIzol reagent (Invitrogen). First strand cDNA synthesis was performed as previously described (38). All PCR reactions began with a first cycle at 95° C. for 3 min and a final cycle at 72° C. for 10 minutes with an additional 35 cycles at 94° C./30 s, 60° C./45 s, 72° C./1 min. Primers, including human and mouse DKKs were designed using the ‘primer pair program’ using MacVector software (74) based on gene sequences from the NCBI Gene Bank (www.ncbi.nlm.nih.gov). Primer sequences and expected sizes of DNA fragments amplified for the indicated mouse and human genes are listed in Table 6. PCR fragments were subcloned using TOPO-TA cloning vector according to manufacturer instructions (Invitrogen) and sequence analysis performed as previously described (38). Data analysis was performed using MacVactor software and comparisons made with NCBI BLAST (www.ncbi.nlm.nih.gov/blast/).
One microgram of total RNA was reverse transcribed into total cDNA. Quantitative PCR (qPCR) was performed using an ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, Calif.). The reaction mixture contained 1 ml of cDNA, dedicated buffers with specific primers and probes (5′-labeled by 6-carboxy-fluorescein and 3′-labeled by 1-carboxy-teteramethyrhdamine), and DNA polymerase in a total 20 ml volume. Following 2 min incubation at 50° C. and 10 min incubation at 95° C. for denaturing, the reaction was subjected to 40-cycle amplification at 95° C. for 15 s to denature and at 60° C. for 1 min for annealing/extension. Each cDNA sample was analyzed in triplicate in parallel with GAPDH as a control. Changes in mRNA concentration were determined by subtracting the CT (threshold cycle) of target gene from the CT of GAPDH (Δ=CT gene-CT GAPDH). The mean of Δ control was subtracted from the ΔSiLRP5/6 reaction (mean Δ control−ΔSiLRP5/6=e) The difference was calculated as 2e by the 2-ΔΔCT (75).
Silencing DKK1 Expression by DKK1 Short Hairpin RNAA sequence previously shown be an effective siRNA specific to human DKK1 gene (5′-CAATGGTCTGGTACTTATTCCCGAAGGATTAAGTACCAGACCATTGCACC-3′; SEQ ID NO: 45) (80) was used to design a synthetic double-stranded oligonucleotide sequence for short hairpin RNA (shRNA) knockdown studies, as described (82) and designed shDKK1. A control oligonucleotide sequence not matching any sequence in the human genome (5′-GATCCCCGACACGCGACTTGTACCACTTCAAGAGAGTGGTACAAGTCGGTCGTCTTTT TA-3′; SEQ ID NO: 46) was used as a control shRNA sequence (designated as shCont). Both double-stranded shRNA sequences were obtained from Integrated DNA Technologies (Coralville, Iowa). The double-stranded oligonucleotides were cloned into pLVTHM, and virus was generated by cotransfection of 293T cells with the pLVTHM vector and helper plasmids pMD2G and pCMV-dR8.91 (all kindly provided by Dr Didier Trono, University of Geneva, Switzerland). The crude lentivirus was concentrated from cultured supernatant of the 293T cells and filtered (0.45 μm) and viral titers were determined by measuring the percent of green fluorescent protein (GFP)—positive cells present 48 hours after infection of 293T cells. The Saos-2 and MG63 cells were infected with lentivirus supernatant for indicated times. The efficiency of infection with shDKK1 and shCont virus was determined by counting the percent of green fluorescent protein (GFP) positive cells by fluorescence microscopy. Total RNA, isolated after 24, 48 or 72 hours was subjected to RT-PCR and qPCR to determine of the degree of target gene silencing. After 72 hours after infection supernatants of the cells were subject to ELISA analysis to determine DKK1 protein concentration.
Statistical AnalysisStatistical significance of differences between experimental groups was analyzed by a Student's t-test using the Microsoft Excel software statistical package. Significant p values were less than 0.05 by two-tailed test.
Wnt3a Induces OPG mRNA and Protein Levels in Osteoblasts
Wnt3a stimulated OPG mRNA expression in a dose-dependent and time-dependent fashion in murine mesenchymal osteoblast-precursor C2C12 cells (
Using recombinant DKK1 protein, b-catenin level was reduced (using the pull-down assay) in C2C12 (
The present invention examined differences in response to Wnt3a stimulation relative to DKK1 concentrations required for Wnt3a inhibition between these cell lines. Examining endogenous DKK mRNA status by RT-PCR analysis across cell lines revealed that C2C12 cells had lower levels of DKK1 than DKK2 and DKK3 (
DKK1 Silencing by shRNA Restores Sensitivity to Wnt3a Stimulation in Saos-2 Cells
To further confirm that impaired Wnt3a signaling can be related to endogenous DKK1, DKK1-specific shRNA silencing experiments were carried out. Endogenous DKK1 mRNA in Saos-2 cells was inhibited shDKK1, as determined by RT-PCR, but not by a non-specific shRNA (
Co-Culture with MM Cells Expressing DKK1 Prevents Wnt3a-Induced OPG in Osteoblasts
To determine whether DKK1 expression by MM cells interferes with Wnt3a-induced OPG transcription in the bone marrow microenvironment, OPM-2 MM cells stably expressing DKK1 were produced as confirmed by demonstrating an inhibition of TCF/LEF transcriptional activity relative to controls (38). Supernatants of OPM-2/DKK1 clones contained the DKK1 protein as determined by Western blot analysis with anti-V5 antibody (
The same experiment was repeated with DKK1-expressing primary MM plasma cells from 5 patients. Results were similar to those obtained with OPM-2/DKK1 cells: a Wnt3a-induced OPG increase was significantly inhibited in C2C12 cells both at the mRNA (FIG. 43AA) and protein (
Previous studies have shown that DKK1 in sera from MM patients inhibits osteoblast differentiation (32) and bone formation (33) which was shown to occur through a DKK1-mediated attenuation of Wnt3a-induced stabilization of b-catenin. Similar to the presence of 100 ng/ml of DKK1 in culture media, treatment of C2C12 cells with sera from bone marrow of eight MM patients containing high levels of DKK1, all in excess of 100 ng/ml of DKK1 (designated MMSH), significantly inhibited Wnt3a-induced increase in OPG mRNA (FIG. 43CC). The observation that sera containing less than 10 ng/ml of DKK1 protein (MMSL) still inhibited Wnt3a-induced OPG transcription might suggest that factors besides DKK1 may contribute to interference with Wnt3a-induced OPG expression.
To verify that DKK1 in sera of MM patients was contributing to the suppression of Wnt3a-mediated OPG expression in osteoblasts, the MM serum was preincubated with a neutralizing antibody specific to DKK1. Compared to control IgG antibody, pretreatment of C2C12 cells with anti-DKK1 antibody significantly rescued Wnt3a-induced OPG mRNA (FIGS. 43DD and 43EE) and protein expression (FIG. 43FF). Collectively, these results suggest that DKK1-expressed by MM cells can negatively regulate Wnt3a-mediated OPG secretion in osteoblasts.
Wnt3a-Mediated Inhibition of RANKL is Blocked by DKK1 from MM Cells
Since indirect activation of Wnt signaling by inhibition of GSK3beta has been reported to regulate RANKL in MC3T3-E1 osteoblasts (Spencer et al., 2006), the effect of DKK1 on this process was examined herein as another potential mechanism underlying MM bone disease. Treatment of C2C12 cells with Wnt3a for 48 hours resulted in a significant decrease in RANKL mRNA (FIG. 43GG), which could be restored by pretreatment of cells with DKK1. Similar results were observed in DKK1-pretreated Saos-2 (FIG. 43HH) and MG63 cells (FIG. 43II). To further confirm the role of DKK1 on this process, DKK1-overexpressing C2C12 cells was employed, in which high DKK1 concentrations can abrogate Wnt3a signaling (see
Recent clinical and experimental studies suggest that myeloma bone disease drives tumor progression. Growth of myeloma cells from a subset of patients was inhibited by inhibitors of osteoclast activity (23). Although isolated osteoclasts support survival and proliferation of myeloma cells, osteoblasts have a negative impact on myeloma. Additionally, studies focusing on cell-signaling molecules have demonstrated that myeloma cells produce the Wnt signaling inhibitor DKK1 that inhibits osteoblast differentiation in vitro (32) and that immature as opposed to mature, osteoblasts produce elevated levels of RANKL and IL-6 (76). Moreover, synthesis of osteoprotegerin (OPG), a soluble receptor of RANKL and potent osteoclast induction signal, is dependent on canonical Wnt signaling in osteoblasts (25). Furthermore, DKK1 has been shown to mediate mesenchymal stem cell proliferation in favor of differentiation (54).
Therefore, whether inhibition of Wnt signaling and osteoblast differentiation by DKK1 resulted in increased activity of osteoblast precursors that induced a cascade of events leading to myeloma disease progression was examined. Additionally, shifts in bone marrow concentrations of secreted factors DKK1, RANKL, OPG and IL-6 contributes to myeloma cell growth and an absolute shift in numbers of mature and immature osteoblasts and osteoclasts that favors bone destruction and myeloma cell growth.
A neutralizing antibody against DKK1 was used in a xenograft SCID-rab mouse model for primary human myeloma (77) to examine the effect of DKK1 inhibition on myeloma-induced bone disease and the association between increased osteoblast activity and tumor growth. This system is a second generation of the SCID-Hu model (78). In these systems, myeloma cells from patients with myeloma engraft in transplanted bone and produce typical disease manifestations including induction of osteolystic bone lesions.
Briefly, SCID-rab host mice were constructed by subcutaneous implantation of rabbit bones (
For each patient's cells, one SCID-rab mouse with established myeloma was injected with anti-DKK1 antibodies (R&D Systems) into the surrounding area of the implanted bone and another served as control and received a non-specific IgG antibody. The mice received polyclonal anti-DKK1 antibody at a concentration of 50 μg/injection/3 times a week in 4 experiments. In 3 experiments, the experimental mice received monoclonal anti-DKK1 antibody at concentration of 100 μg/injection/5 times a week. Experiments were continued for 4-6 weeks. No drug-related toxicity was observed during the experimental period. The growth of myeloma cells, bone resorption and formation, osteoclast and osteoblast numbers were then determined. The effect of treatment on bone mineral density (BMD) and tumor burden were analyzed using Student paired t-test.
The osteoclast numbers were determined by staining rabbit bone sections for TRAP and TRAP-expressing multinucleated osteoclasts were counted in 4 non-overlapping myelomatous bone surface areas of control and anti-DKK1 treated mice. Additionally, mature osteoblasts were identified by immunohistochemical staining of rabbit bone sections for osteocalcin and osteoblast numbers were counted in 4 non-overlapping myelomatous bone surface areas of these mice.
Treatment with anti-DKK1 resulted in increased number of osteocalcin-expressing osteoblasts and reduced TRAP-expressing osteoclasts (
Next, whether anti-DKK1 effect on the osteoclast and osteoblast activity affected myeloma-induced bone loss in these mice was assessed. Bone resorption and formation was visualized by X-ray radiographs and quantified by measuring bone mineral density (BMD) of the implanted bone before the start of the treatment and at the end of each experiment. In control mice, the impanted rabbit bone mineral density was reduced during the experimental period. The bone mineral density in bones treated with anti-DKK1 was increased by >8% from pretreatment level (p<0.04) indicative of increased bone formation (
Furthermore, myeloma tumor burden gradually increased in all control mice with time. In distinct contrast, an inhibition of tumor burden in 4 of 7 experiments and retardation of growth in the other 3 experiments was observed in mice treated with anti-DKK1 antibody. Overall, myeloma growth in mice treated with control and anti-DKK1 antibodies increased by 331% ad 162%, respectively (
The effects of the neutralizing antibody against DKK1 were determined in SCID-rab mouse, constructed by subcutaneous implantation of rabbit bones (
- 1. Gong et al., 2001 Cell 107:513-523.
- 2. Kawano, Y., and Kyota, R. 2003. J Cell Sci 116:2627-2634.
- 3. Boyden et al., 2002, N. Engl. J. Med. 346:1513-1521.
- 4. Little, et al. 2002. Am J Hum Genet 70:11-19.
- 5. Bafico et al., 1998, Oncogene, 16(21): 2819-25.
- 6. Mao, et al. 2002. Nature 417:664-667.
- 7. Mao et al., 2001, Nature 411:321-325.
- 8. Baron, R., and Rawadi, G. 2007. Endocrinology 148:2635-2643.
- 9. Van der Horst et al., 2005, J Bone Miner Res 10(10): 1867-77.
- 10. Morvan et al., 2006, J. Bone Miner. Res. 21:934-945.
- 11. Bataille, et al 1991. J Clin Invest 88:62-66.
- 12. Roodman, G. D. 2004. Blood Cells Mol Dis 32:290-292.
- 13. Taube, et al 1992. Eur J Haematol 49:192-198.
- 14. Anderson, et al., 1997 Nature 390:175-179.
- 15. Kong, et al. 1999. Nature 397:315-323.
- 16. Lacey, et al. 1998. Cell 93:165-176.
- 17. Simonet, et al. 1997. Cell 89:309-319.
- 18. Suda, et al 1999. Endocr Rev 20:345-357.
- 19. Giuliani et al., 2001, Blood 98:3527-3533.
- 20. Pearse et al., 2001, Proc. Natl. Acad. Sci.U.S.A 98:11581-11586.
- 21. Terpos, et al. 2003. Blood 102:1064-1069.
- 22. Vanderkerken, et al 2003. Cancer Res 63:287-289.
- 23. Yaccoby et al., 2002, Br. J Hematol 116:278-290.
- 24. Oyajobi, et al 2001. Cancer Res 61:2572-2578.
- 25. Glass et al., 2005, Dev Cell 8:751-764.
- 26. Holmen, et al. 2005. J Biol Chem 280:21162-21168.
- 27. Jackson, et al. 2005. Bone 36:585-598.
- 28. Galli, et al. 2006. Dev Dyn 235:681-690.
- 29. Spencer et al., G J, 2006, J. Cell Sci. 119:1283-1296.
- 30. Finch, et al. 1997. Proc Natl Aced Sci USA 94:6770-6775
- 31. Semenov, et al. 2005. J Biol Chem 280:26770-26775.
- 32. Tian et al., 2003, N Engl J Med 349: 2483-2494.
- 33. Giuliani, et al 2007. Cancer Res 67:7665-7674.
- 34. Haaber, et al 2007. Br J Haematol.
- 35. Politou et al., 2006, Int. J. Cancer 119:1728-1731
- 36. Yaccoby et al. 2007. Blood 109:2106-2111.
- 37. Qiang and Rudikoff, 2004, Front Biosci 9: 1000-1010.
- 38. Qiang et al., 2003, Oncogene, 22: 1536-45.
- 39. Li et al., 2005, Nat Genet 37(9):945-952.
- 40. Kato et al., 2002, J Cell Biol, 157(2): 103-114.
- 41. Kokubu et al., 2004, development, 131: 5469-80.
- 42. Li et al., 2006, Bone 39:754-766.
- 43. Canalis et al., 2003, Endocr Rev 24 92): 218-35.
- 44. Rawadi et al. 2003, Bone Miner Res, 18(10); 1842-1853.
- 45. Mhalaviele et al., 2005. J Cell Biochem 94 (2): 403-18.
- 46. Nakashima et al., 2005, J Biol Chem, 94(2): 403-18.
- 47. Hu et al., 2005, Development 132(1): 215-25.
- 48. Willert et al., 2002, BMC Dev Biol 2: 8-15.
- 49. Binato et al., 2006, Biochem J 393: 141-50.
- 50. Lipton, et al 2002. Clin Cancer Res 8:2306-2310.
- 51. Seidel, et al 2001. Blood 98:2269-2271.
- 52. Heath, et al 2007. Cancer Res 67:202-208.
- 53. Katagiri, et al. 1994. J Cell Biol 127:1755-1766.
- 54. Gregory et al., 2003, J Biol Chem 278:28067-28078.
- 55. Gunn, et al 2006. Stem Cells 24:986-991.
- 56. Kishimoto, T. 2005. Annu Rev Immunol 23:1-21.
- 57. Zhan et al., 2002, Blood 99:1745-1757.
- 58. Zhan et al., 2003, Blood 101:1128-1140.
- 59. Fedi et al., 1999, J Biol Chem 274:19465-72.
- 60. Gallea et al., 2001, Bone 28:491-8.
- 61. Spinella-Jaegle et al., 2001, Bone 29:323-30.
- 62. Westfall and Young. Resampling-Based Multiple Testing: Examples and Methods for p-Value Adjustment. Hoboken, N.J.: Wiley-Interscience, 360 (1993).
- 63. Golub et al., 1999, Science 286:531-7.
- 64. Bain et al., 2003, Biochem Biophys Res Commun 301:84-91.
- 65. Roman-Roman et al. Wnt-Mediated Signalling Via LRP5 and Beta-Catenin Induce Osteoblast Differentiation and Mediates the Effects of BMP2, American Society of Bone Mineral Research, 2002.
- 66. Qiang et al., 2002, Blood, 99: 4138-46.
- 67. Cheng et al., 1998, J Bone Miner Res, 13: 633-44.
- 68. Nelson and Nusse, 2004, Science, 202(5663): 1483-1487.
- 69. Van Noort et al., 2002, J Biol Chem 277(20): 17901-5.
- 70. Nishimura et al., 1998, J Biol Chem 273: 872-9.
- 71. Chung et al., 2002, Blood, 100(3): 982-90.
- 72. Iton et al., 2001, Embo J, 20(15): 4132-4142.
- 73. Qiang et al., 2008, Blood, 112(2): 374-382.
- 74. Qiang, et al., 2005. Blood 106:1786-1793.
- 75. Livak and Schmittgen, 2001. Methods 25:402-408.
- 76. Gunn et al., 2004, DKK1 and IL-6 in Mesenchymal and Non-Hematopoetic Stem Cells: Focus on Adult Stem Cells, New Orleans, La., Oct. 14-16, 2004.
- 77. Yata & Yaccoby, 2004, Leukemia, 18:1891-1897.
- 78. Yaccoby et al., 1998, Blood 92: 2908-2913.
- 79. Chen et al., 2006, J Biol chem 282: 526-33.
- 80. Hall et al., 2005, Cancer Res. 65:7554-7560.
- 81. Korinek et al., 1997, Methods 15(4): 402-8.
- 82. Szulc, et al 2006. Nat Methods 3:109-116.
Claims
1. A method for treating a multiple myeloma in an subject, wherein the multiple myeloma is characterized by increased DKK1 expression or activity in a subject, comprising the step of:
- administering to the subject an amount of an anti-DKK1 antibody that is pharmacologically effective to inhibit an activity of the DKK1 protein.
2. The method of claim 1, wherein the multiple myeloma is smoldering myeloma, solitary plasmacytoma, diffused multiple myeloma, multiple myeloma with osteopenia, newly diagnosed multiple myeloma, or focal multiple myeloma.
3. The method of claim 1, wherein the treatment of the subject with an anti-DKK1 antibody inhibits myeloma growth.
4. The method of claim 1, wherein the DKK-1 protein is encoded by the DKK1 gene of SEQ ID NO: 47.
5. A method for restoring osteoprotegerin (OPG) expression in a cell, comprising the step of:
- contacting the cell with a DKK-1 neutralizing antibody, an anti-sense oligonucleotide against a DKK-1 gene, or a small hairpin RNA (shRNA) against a DKK-1 gene, wherein the contacting agent inhibits the activity of the Dkk1 protein.
6. The method of claim 5, wherein the DKK1 protein is encoded by the DKK1 gene with a sequence shown in SEQ ID NO: 47.
7. The method of claim 5, wherein the shRNA binds to the sequence consisting of SEQ ID NO: 45 in the DKK1 gene sequence.
8. A method for inhibiting receptor activator of nuclear factor kappa B ligand (RANKL) expression in a cell, comprising the step of:
- contacting the cell with a DKK1 neutralizing antibody, an anti-sense oligonucleotide against a DKK1 gene, or a shRNA against a DKK1 gene, wherein the contacting agent inhibits the activity of the DKK1 protein.
9. The method of claim 8, wherein the DKK1 protein is encoded by the DKK1 gene with a sequence shown in SEQ ID No: 47.
10. The method of claim 8, wherein the shRNA binds to the sequence consisting of SEQ ID NO: 45 in the DKK1 gene sequence.
11. A method for increasing osteoblast activity in a subject exhibiting increased DKK1 activity or expression, comprising the step of:
- administering to the subject an agent that is a DKK1 shRNA that binds a DKK1 protein consisting of the sequence encoded by the DKK1 gene consisting of the sequence shown in SEQ ID NO: 45, wherein the agent inhibits the activity of the DKK1 protein.
12. The method of inhibiting osteoclast activity in an individual, exhibiting increased DKK1 activity or expression, comprising the step of:
- administering to the subject an agent that is a DKK1 shRNA that binds DKK1 protein consisting of the sequence encoded by the DKK1 gene consisting of the sequence shown in SEQ ID NO: 45, wherein the agent inhibits the activity of the DKK1 protein.
13. The method of increasing bone mass in a subject, exhibiting increased DKK1 activity or expression, comprising the step of:
- administering to the subject an agent that is a DKK1 shRNA that binds a DKK1 protein consisting of the sequence encoded by the DKK1 gene consisting of the sequence shown in SEQ ID NO: 45, wherein the agent inhibits the activity of the DKK1 protein.
Type: Application
Filed: Jan 30, 2015
Publication Date: May 21, 2015
Applicant: BOARD OF TRUSTEES OF THE UNIVERSITY OF ARKANSAS (Little Rock, AR)
Inventors: John D. Shaughnessy, JR. (Frederick, MD), Bart Barlogie (Little Rock, AR), Ya-Wei Qiang (Little Rock, AR)
Application Number: 14/610,687
International Classification: C07K 16/18 (20060101); C12N 15/113 (20060101);