PAN-LYSSAVIRUS VACCINES AGAINST RABIES

Described herein are recombinant rabies viruses encoding rabies virus glycoprotein and at least one heterologous glycoprotein from another lyssavirus, such as Mokola virus, Lagos bat virus and/or West Caucasian bat virus. In particular embodiments, the recombinant rabies virus includes two or three heterologous lyssavirus glycoproteins. The disclosed recombinant rabies viruses can be used as pan-lyssavirus vaccines to provide protection against lyssaviruses that cause rabies.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS REFERENCE TO RELATED APPLICATIONS

This is a continuation of U.S. patent application Ser. No. 13/806,622, filed Dec. 21, 2012, which is the U.S. National Stage of International Application No. PCT/US2011/041579, filed Jun. 23, 2011, published in English under PCT Article 21(2), which claims the benefit of U.S. Provisional Application No. 61/358,288, filed Jun. 24, 2010. All of the above-referenced applications are herein incorporated by reference in their entirety.

FIELD

This disclosure concerns recombinant rabies viruses and their use as pan-lyssavirus vaccines for protection against lyssavirus infections.

BACKGROUND

The genus Lyssavirus is a member of the Rhabdoviridae family within the order Mononegavirales (viruses with a single-stranded, negative sense genome). Lyssaviruses are the etiological agents of rabies encephalitis in warm-blooded animals and humans (Tordo et al., “Lyssaviruses” In Fauquet et al. eds. Virus taxonomy: the classification and nomenclature of viruses. The 8th Report of the International Committee on Taxonomy of Viruses. San Diego: Oxford Academic, 2006, pages 623-629; World Health Organization Expert Consultation on Rabies, 5-8 Oct. 2004, first report, World Health Organization Technical report series 931, Geneva: World Health Organization, 2005, pages 15-19). Lyssavirus species include rabies virus (RABV; genotype 1), Lagos bat virus (LBV; genotype 2), Mokola virus (MOKV; genotype 3), Duvenhage virus (DUVV; genotype 4), European bat lyssavirus-1 (EBLV-1; genotype 5), European bat lyssavirus-2 (EBLV-2; genotype 6), Australian bat lyssavirus (ABLV; genotype 7) and four additional species isolated from bats in central Asia and Russia (Aravan virus—ARAV; Khujand virus—KHUV; Irkut virus—IRKV; and West Caucasian bat virus—WCBV) (Kuzmin et al., Emerg. Infect. Dis. 14(12):1887-1889, 2008; Weyer et al., Epidemiol. Infect. 136:670-678, 2007; Kuzmin and Rupprecht, “Bat rabies” In Rabies, 2nd Edition, New York, Academic Press, 2007, pages 259-307, Jackson and Wunner, eds.).

Based on phylogeny, immunogenicity and virulence of lyssavirus isolates, two lyssavirus phylogroups have been proposed (Badrane et al., J. Virol. 75:3268-3276, 2001). The division into phylogroups generally correlates with the pattern of vaccine cross-protection observed for lyssaviruses (Badrane et al., J. Virol. 75:3268-3276, 2001; Hanlon et al., Virus Res. 111:44-54, 2005; Nel et al., Expert Rev. Vaccines 4:553-540, 2005). Phylogroupl includes genotypes 1, 4, 5, 6 and 7, as well as ARAV, KHUV and IRKV (Kuzmin et al., Virus Res. 97:65-79, 2003; Kuzmin et al., Virus Res. 111:28-43, 2005; Hanlon et al., Virus Res. 111:44-54, 2005). Currently available commercial vaccines and biologicals are considered to be effective against infections of viruses from this phylogroup (Nel et al., Expert Rev. Vaccines 4:553-540, 2005). However, these vaccines and biologics for rabies do not offer full protection against infection with viruses outside of lyssavirus phylogroup 1 (i.e., genotypes 2 and 3). In addition, WCBV is recognized as the most divergent lyssavirus and exhibits limited relatedness to genotype 2 and 3 viruses. Previous studies have demonstrated little or no cross-neutralization of anti-RABV sera with WCBV (Botvinkin et al., Emerg. Infect. Dis. 9:1623-1625, 2003; Hanlon et al., Virus Res. 111:44-54, 2005).

Thus, a need exists to develop a rabies vaccine that can protect against a broad spectrum of lyssaviruses, particularly WCBV and lyssaviruses of genotypes 2 and 3.

SUMMARY

Disclosed herein are recombinant rabies viruses having glycoprotein genes from at least two different lyssaviruses. The disclosed viruses can be used as pan-lyssavirus vaccines to provide protection against infection by multiple genotypes of lyssavirus.

Provided herein are recombinant rabies viruses. In some embodiments, the genome of the recombinant rabies virus includes rabies virus nucleoprotein (N), phosphoprotein (P), matrix protein (M), RNA-dependent RNA polymerase (L) and glycoprotein (G) genes and at least one, at least two or at least three different heterologous lyssavirus glycoprotein genes. In some embodiments, the lyssavirus is selected from LBV, MOKV, DUVV, EBLV-1, EBLV-2, ABLV, ARAV, KHUV, IRKV and WCBV. In particular embodiments, the lyssavirus is selected from LBV, MOKV and WCBV.

Further provided is a vector comprising a full-length rabies virus antigenomic DNA. In some embodiments, the antigenomic DNA includes rabies virus N, P, M, L and G genes, and the vector further includes at least one, at least two, or at least three different heterologous lyssavirus G genes. Also provided are cells comprising a rabies virus vector described herein.

Also provided are compositions comprising one or more recombinant rabies viruses described herein and a pharmaceutically acceptable carrier. Methods of eliciting an immune response in a subject against lyssavirus by administering to the subject one or more of the recombinant rabies viruses disclosed herein is further provided.

The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1A: Schematic illustration of the ERA transcription plasmid. Positions of the hammerhead ribozymes and antigenomic ERA genome are indicated graphically. Relative positions of the N, P, M G and L proteins are shown in a 5′ to 3′ direction.

FIG. 1B: Schematic diagram of the construction of the full-length ERA rabies virus genomic cDNA plasmid pTMF. RT-PCR products F1 and F2 fragments, and restriction enzyme recognition sites (Nhe1, Kpn1, Blp1, Pst1 and Not1) are shown. RdRz-hammerhead and HDVRz-hepatitis delta virus ribozymes are indicated. The diamond symbols indicate that Kpn1 or Pst1 sites were deleted, and the vertical arrows indicate that Nhe1 or Not1 sites were left intact.

FIG. 2: Schematic illustration of the proposed mechanism of NLST7 RNA polymerase autogene action by pNLST7 plasmids. The DNA-transfection reagent complex is taken into cells by endocytosis. The majority of the DNA released from lysosomes and endosomes is retained in the cell cytoplasm. A limited amount of plasmid is transferred to the nucleus: 1) through a CMV immediate early promoter, the NLST7 gene is transcribed by cellular RNA polymerase II; 2) mature NLST7 mRNA is transported from the nucleus to the cytoplasm for NLST7 RNA polymerase synthesis; 3) newly synthesized NLST7 RNA polymerase is translocated to the nucleus, while a trace amount of NLST7 remains in the cytoplasm; and 4) NLST7 RNA polymerase initiates transcription through a pT7 promoter. By posttranscriptional modifications, additional NLST7 mRNA is produced for protein synthesis, thus increasing virus recovery efficiency.

FIG. 3: Schematic diagram of ten derivative ERA virus genomes. The size of each gene is not drawn to scale. Symbol “*” denotes mutations of G at amino acid residue 333 (referred to herein as G333) and “Ψ” indicates the Psi-region.

FIG. 4: Schematic of the construction of ERA-3G. The G333 mutation is introduced into the ERA backbone and two transcriptional (trans) units are added. The transcriptional units are introduced between the P and M genes and between the G and L genes. The MOKV and WCBV G genes are cloned into the transcriptional units to form a recombinant ERA rabies virus with three glycoprotein genes (ERA-3G).

FIG. 5: Schematic of the construction of ERA-4G. The G333 mutation is introduced into the ERA backbone and three transcriptional (trans) units are added. The transcriptional units are introduced between the N and P genes, between the P and M genes, and between the G and L genes. The LBV, MOKV and WCBV G genes are cloned into the transcriptional units to form a recombinant ERA rabies virus with four glycoprotein genes (ERA-4G).

SEQUENCE LISTING

The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on Dec. 17, 2015, 135 KB, which is incorporated by reference herein. In the accompanying sequence listing:

SEQ ID NO: 1 is the nucleotide sequence of recombinant rabies virus ERA recovered by reverse genetics. Nucleotides 4370-4372 of the recombinant virus have been changed (relative to the wild-type virus) from aga to gag, which introduces an Arg to Glu amino acid change in the G protein at residue 333.

SEQ ID NO: 2 is the amino acid sequence of the rabies virus ERA N protein.

SEQ ID NO: 3 is the amino acid sequence of the rabies virus ERA P protein.

SEQ ID NO: 4 is the amino acid sequence of the rabies virus ERA M protein.

SEQ ID NO: 5 is the amino acid sequence of the rabies virus ERA G protein mutated at amino acid position 333 (from Arg to Glu).

SEQ ID NO: 6 is the amino acid sequence of the rabies virus ERA L protein.

SEQ ID NO: 7 is the amino acid sequence of the wild-type rabies virus ERA G protein.

SEQ ID NOs: 8-11 are the nucleotide sequences of RT-PCR primers for amplification of full-length rabies virus genomic cDNA.

SEQ ID NOs: 12-15 are oligonucleotide sequences used to synthesize hammerhead and hepatitis delta virus ribozymes.

SEQ ID NOs: 16-40 are the nucleotide sequences of PCR primers.

SEQ ID NOs: 41 and 42 are the nucleotide sequences of transcription units for incorporating heterologous ORFs.

SEQ ID NOs: 43 and 44 are the nucleotide sequences of RT-PCR primers for amplification of the MOKV G gene.

SEQ ID NOs: 45 and 46 are the nucleotide sequences of RT-PCR primers for amplification of the WCBV G gene.

SEQ ID NOs: 47 and 48 are the nucleotide and amino acid sequences, respectively, of MOKV G.

SEQ ID NOs: 49 and 50 are the nucleotide and amino acid sequences, respectively, of WCBV G.

SEQ ID NOs: 51 and 52 are the nucleotide sequences of RT-PCR primers for amplification of the LBV G gene.

SEQ ID NOs: 53 and 54 are the nucleotide and amino acid sequences, respectively, of LBV G.

DETAILED DESCRIPTION I. Abbreviations

ABLV Australian bat lyssavirus

ARAV Aravan virus

CMV cytomegalovirus

DFA direct fluorescent antibody

DUVV Duvenhage virus

EBLV-1 European bat lyssavirus-1

EBLV-2 European bat lyssavirus-2

ERA Evelyn-Rokitnicki-Abelseth

FFU focus-forming unit

G glycoprotein

i.m. intramuscular

IRES internal ribosome entry site

IRKV Irkut virus

KHUV Khujand virus

L RNA-dependent RNA polymerase

LBV Lagos bat virus

M matrix protein

MOKV Mokola virus

N nucleoprotein

NLS nuclear localization signal

ORF open reading frame

P phosphoprotein

PAGE polyacrylamide gel electrophoresis

RABV rabies virus

RNP ribonucleoprotein

RABV rabies virus

WCBV West Caucasian bat virus

II. Terms and Methods

Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:

Adjuvant: A substance or vehicle that non-specifically enhances the immune response to an antigen. Adjuvants can include a suspension of minerals (alum, aluminum hydroxide, or phosphate) on which antigen is adsorbed; or water-in-oil emulsion in which antigen solution is emulsified in mineral oil (for example, Freund's incomplete adjuvant), sometimes with the inclusion of killed mycobacteria (Freund's complete adjuvant) to further enhance antigenicity. Immunostimulatory oligonucleotides (such as those including a CpG motif) can also be used as adjuvants (for example, see U.S. Pat. Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; 6,339,068; 6,406,705; and 6,429,199). Adjuvants also include biological molecules, such as co-stimulatory molecules. Exemplary biological adjuvants include IL-2, RANTES, GM-CSF, TNF-α, IFN-γ, G-CSF, LFA-3, CD72, B7-1, B7-2, OX-40L and 41 BBL.

Administer: As used herein, administering a composition, such as a vaccine, to a subject means to give, apply or bring the composition into contact with the subject. Administration can be accomplished by any of a number of routes, such as, for example, topical, oral, subcutaneous, intramuscular, intraperitoneal, intravenous, intrathecal and intramuscular.

Animal: Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term mammal includes both human and non-human mammals. The term “animal” includes both human and veterinary subjects, for example, humans, non-human primates, dogs, cats, horses, raccoons, bats, rats, mice, foxes, squirrels, opossum, coyotes, wolves and cows.

Antibody: A protein (or protein complex) that includes one or more polypeptides substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.

The basic immunoglobulin (antibody) structural unit is generally a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kDa) and one “heavy” (about 50-70 kDa) chain. The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms “variable light chain” (VL) and “variable heavy chain” (VH) refer, respectively, to these light and heavy chains.

As used herein, the term “antibody” includes intact immunoglobulins as well as a number of well-characterized fragments. For instance, Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to target protein (or epitope within a protein or fusion protein) would also be specific binding agents for that protein (or epitope). These antibody fragments are as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab′, the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab′ fragments are obtained per antibody molecule; (3) (Fab′)2, the fragment of the antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; (4) F(ab′)2, a dimer of two Fab′ fragments held together by two disulfide bonds; (5) Fv, a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (6) single chain antibody, a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. Methods of making these fragments are routine (see, for example, Harlow and Lane, Using Antibodies: A Laboratory Manual, CSHL, New York, 1999).

Antibody binding affinity: The strength of binding between a single antibody binding site and a ligand (e.g., an antigen or epitope). The affinity of an antibody binding site X for a ligand Y is represented by the dissociation constant (Kd), which is the concentration of Y that is required to occupy half of the binding sites of X present in a solution. A smaller Kd indicates a stronger or higher-affinity interaction between X and Y and a lower concentration of ligand is needed to occupy the sites. In general, antibody binding affinity can be affected by the alteration, modification and/or substitution of one or more amino acids in the epitope recognized by the antibody paratope. Binding affinity can be measured using any technique known in the art, such as end-point titration in an Ag-ELISA assay.

Antigen: A compound, composition, or substance that can stimulate the production of antibodies or a T-cell response in an animal, including compositions that are injected or absorbed into an animal. An antigen reacts with the products of specific humoral or cellular immunity, including those induced by heterologous immunogens.

Antigenomic: In the context of a virus with a negative-strand RNA genome (such as the genome of a lyssavirus), “antigenomic” refers to the complement (positive strand) of the negative strand genome.

Attenuated: In the context of a live virus, such as a rabies virus, the virus is attenuated if its ability to infect a cell or subject and/or its ability to produce disease is reduced (for example, eliminated). Typically, an attenuated virus retains at least some capacity to elicit an immune response following administration to an immunocompetent subject. In some cases, an attenuated virus is capable of eliciting a protective immune response without causing any signs or symptoms of infection.

Epitope: An antigenic determinant. These are particular chemical groups, such as contiguous or non-contiguous peptide sequences, on a molecule that are antigenic, that is, that elicit a specific immune response. An antibody binds a particular antigenic epitope based on the three dimensional structure of the antibody and the matching (or cognate) three dimensional structure of the epitope.

Evelyn-Rokitnicki-Abelseth (ERA): The ERA strain of rabies virus was derived from the Street-Alabama-Dufferin (SAD) strain, first isolated from a rabid dog in Alabama (USA) in 1935. The ERA strain was derived after multiple passages of SAD rabies virus in mouse brains, baby hamster kidney (BHK) cells, and chicken embryos.

Fusion protein: A protein generated by expression of a nucleic acid sequence engineered from nucleic acid sequences encoding at least a portion of two different (heterologous) proteins. To create a fusion protein, the nucleic acid sequences must be in the same reading frame and contain no internal stop codons in that frame.

Heterologous: As used herein, a “heterologous nucleic acid sequence” is a nucleic acid sequence that is derived from a different source, species or strain. In some embodiments described herein, the heterologous nucleic acid sequence is a nucleic acid sequence encoding a glycoprotein from a lyssavirus other than rabies virus ERA. In the context of a recombinant ERA rabies virus, a heterologous nucleic acid sequence is any nucleic acid sequence that is not derived from the ERA rabies virus.

Immune response: A response of a cell of the immune system, such as a B-cell, T-cell, macrophage or polymorphonucleocyte, to a stimulus such as an antigen. An immune response can include any cell of the body involved in a host defense response, including for example, an epithelial cell that secretes an interferon or a cytokine. An immune response includes, but is not limited to, an innate immune response or inflammation. As used herein, a protective immune response refers to an immune response that protects a subject from infection (prevents infection or prevents the development of disease associated with infection).

Immunize: To render a subject protected from a disease (for example, an infectious disease), such as by vaccination.

Immunogen: A compound, composition, or substance which is capable, under appropriate conditions, of stimulating an immune response, such as the production of antibodies or a T-cell response in an animal, including compositions that are injected or absorbed into an animal. As used herein, an “immunogenic composition” is a composition comprising an immunogen.

Immunogenic composition: A composition useful for stimulating or eliciting a specific immune response (or immunogenic response) in a vertebrate. In some embodiments, the immunogenic composition includes a recombinant rabies virus, such as a recombinant rabies virus expressing one or more heterologous glycoproteins (such as the glycoproteins from MOKV, LBV or WCBV). In some embodiments, the immunogenic response is protective or provides protective immunity, in that it enables the animal to better resist infection with or disease progression from the pathogen against which the immunogenic composition is directed (e.g., rabies virus and other lyssaviruses). One specific example of a type of immunogenic composition is a vaccine.

In some embodiments, an “effective amount” or “immune-stimulatory amount” of an immunogenic composition is an amount which, when administered to a subject, is sufficient to engender a detectable immune response. Such a response may comprise, for instance, generation of antibodies specific to one or more of the epitopes provided in the immunogenic composition. Alternatively, the response may comprise a T-helper or CTL-based response to one or more of the epitopes provided in the immunogenic composition. In other embodiments, a “protective effective amount” of an immunogenic composition is an amount which, when administered to an animal, is sufficient to confer protective immunity upon the animal.

Inhibiting or treating a disease: Inhibiting the full development of a disease or condition, for example, in a subject who is at risk for a disease. One specific example of a disease is rabies. “Treatment” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. As used herein, the term “ameliorating,” with reference to a disease, pathological condition or symptom, refers to any observable beneficial effect of the treatment. The beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, a reduction in the number of relapses of the disease, an improvement in the overall health or well-being of the subject, or by other parameters well known in the art that are specific to the particular disease.

Isolated: An “isolated” or “purified” biological component (such as a nucleic acid, peptide, protein, protein complex, or particle) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, that is, other chromosomal and extra-chromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins that have been “isolated” or “purified” thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids or proteins. The term “isolated” or “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, an isolated biological component is one in which the biological component is more enriched than the biological component is in its natural environment within a cell, or other production vessel. Preferably, a preparation is purified such that the biological component represents at least 50%, such as at least 70%, at least 90%, at least 95%, or greater, of the total biological component content of the preparation.

Label: A detectable compound or composition that is conjugated directly or indirectly to another molecule to facilitate detection of that molecule. Specific, non-limiting examples of labels include fluorescent tags, enzymatic linkages, and radioactive isotopes.

Lyssavirus: A genus of viruses that is part of the Rhabdoviridae family within the order Mononegavirales (viruses with a single-stranded, negative sense genome). Lyssaviruses are the etiological agents of rabies encephalitis in warm-blooded animals and humans. Lyssavirus species include rabies virus (RABV; genotype 1), Lagos bat virus (LBV; genotype 2), Mokola virus (MOKV; genotype 3), Duvenhage virus (DUVV; genotype 4), European bat lyssavirus-1 (EBLV-1; genotype 5), European bat lyssavirus-2 (EBLV-2; genotype 6) Australian bat lyssavirus (ABLV; genotype 7) and four additional species isolated from bats in central Asia and Russia (Aravan virus—ARAV; Khujand virus—KHUV; Irkut virus—IRKV; and West Caucasian bat virus—WCBV) (Kuzmin et al., Emerg. Infect. Dis. 14(12):1887-1889, 2008; Weyer et al., Epidemiol. Infect. 136:670-678, 2007; Kuzmin and Rupprecht, “Bat rabies” In Rabies, 2nd Edition, New York, Academic Press, 2007, pages 259-307, Jackson and Wunner, eds.).

ORF (open reading frame): A series of nucleotide triplets (codons) coding for amino acids without any termination codons. These sequences are usually translatable into a peptide.

Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame. If introns are present, the operably linked DNA sequences may not be contiguous.

Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in this disclosure are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds or molecules, proteins or antibodies that bind these proteins, viruses or vectors, and additional pharmaceutical agents.

In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

Plasmid: A circular nucleic acid molecule capable of autonomous replication in a host cell.

Polypeptide: A polymer in which the monomers are amino acid residues joined together through amide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used, the L-isomers being preferred for many biological uses. The terms “polypeptide” or “protein” as used herein are intended to encompass any amino acid molecule and include modified amino acid molecules. The term “polypeptide” is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced.

Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original protein, that is, the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. Examples of conservative substitutions are shown below.

Original Residue Conservative Substitutions Ala Ser Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp His Asn; Gln Ile Leu, Val Leu Ile; Val Lys Arg; Gln; Glu Met Leu; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu

Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.

Amino acids are typically classified in one or more categories, including polar, hydrophobic, acidic, basic and aromatic, according to their side chains. Examples of polar amino acids include those having side chain functional groups such as hydroxyl, sulfhydryl, and amide, as well as the acidic and basic amino acids. Polar amino acids include, without limitation, asparagine, cysteine, glutamine, histidine, selenocysteine, serine, threonine, tryptophan and tyrosine. Examples of hydrophobic or non-polar amino acids include those residues having nonpolar aliphatic side chains, such as, without limitation, leucine, isoleucine, valine, glycine, alanine, proline, methionine and phenylalanine. Examples of basic amino acid residues include those having a basic side chain, such as an amino or guanidino group. Basic amino acid residues include, without limitation, arginine, homolysine and lysine. Examples of acidic amino acid residues include those having an acidic side chain functional group, such as a carboxy group. Acidic amino acid residues include, without limitation aspartic acid and glutamic acid. Aromatic amino acids include those having an aromatic side chain group. Examples of aromatic amino acids include, without limitation, biphenylalanine, histidine, 2-napthylalananine, pentafluorophenylalanine, phenylalanine, tryptophan and tyrosine. It is noted that some amino acids are classified in more than one group, for example, histidine, tryptophan, and tyrosine are classified as both polar and aromatic amino acids. Additional amino acids that are classified in each of the above groups are known to those of ordinary skill in the art.

Substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, seryl or threonyl, is substituted for (or by) a hydrophobic residue, for example, leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, for example, glutamyl or aspartyl; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine.

Promoter: A promoter is an array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription. A promoter also optionally includes distal enhancer or repressor elements. A “constitutive promoter” is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an “inducible promoter” is regulated by an external signal or molecule (for example, a transcription factor).

Purified: The term “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified peptide, protein, virus, or other active compound is one that is isolated in whole or in part from naturally associated proteins and other contaminants. In certain embodiments, the term “substantially purified” refers to a peptide, protein, virus or other active compound that has been isolated from a cell, cell culture medium, or other crude preparation and subjected to fractionation to remove various components of the initial preparation, such as proteins, cellular debris, and other components.

Rabies: A viral disease that causes acute encephalitis (inflammation of the brain) in warm-blooded animals. Rabies is zoonotic (transmitted by animals), most commonly by a bite from an infected animal but occasionally by other forms of contact. Rabies is almost frequently fatal if post-exposure prophylaxis is not administered prior to the onset of severe symptoms. Rabies is caused by viruses of the Lyssavirus genus.

Rabies virus (RABV or RABV): A member of the Rhabdoviridae family having a non-segmented RNA genome with negative sense polarity. Rabies virus is the prototype of the Lyssavirus genus. The rabies virus Evelyn-Rokitnicki-Abelseth (ERA) strain is a strain derived from the Street-Alabama-Dufferin (SAD) strain, first isolated from a rabid dog in Alabama (USA) in 1935. The ERA strain was derived after multiple passages of SAD RABV in mouse brains, baby hamster kidney (BHK) cells, and chicken embryos. The complete genomic sequence of the ERA strain is disclosed in PCT Publication No. WO 2007/047459, and the sequence of the ERA strain recovered by reverse genetics is set forth herein as SEQ ID NO: 1.

Recombinant: A recombinant nucleic acid, protein or virus is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques. In some embodiments, recombinant rabies virus is generated using reverse genetics, such as the reverse genetics system described in PCT Publication No. WO 2007/047459. In some examples, the recombinant rabies viruses comprise one or more mutations in a viral virulence factors, such as glycoprotein. In other examples, the recombinant rabies viruses comprise a heterologous gene, such as a sequence encoding a glycoprotein from another lyssavirus (such as Mokola virus, West Caucasian bat virus or Lagos bat virus).

Reverse genetics: Refers to the process of introducing mutations (such as deletions, insertions or point mutations) into the genome of an organism or virus in order to determine the phenotypic effect of the mutation. For example, introduction of a mutation in a specific viral gene enables one to determine the function of the gene.

Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.

Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman (Adv. Appl. Math., 2:482, 1981); Needleman and Wunsch (J. Mol. Biol., 48:443, 1970); Pearson and Lipman (Proc. Natl. Acad. Sci., 85:2444, 1988); Higgins and Sharp (Gene, 73:237-44, 1988); Higgins and Sharp (CABIOS, 5:151-53, 1989); Corpet et al. (Nuc. Acids Res., 16:10881-90, 1988); Huang et al. (Comp. Appls. Biosci., 8:155-65, 1992); and Pearson et al. (Meth. Mol. Biol., 24:307-31, 1994). Altschul et al. (Nature Genet., 6:119-29, 1994) presents a detailed consideration of sequence alignment methods and homology calculations.

The alignment tools ALIGN (Myers and Miller, CABIOS 4:11-17, 1989) or LFASTA (Pearson and Lipman, 1988) may be used to perform sequence comparisons (Internet Program© 1996, W. R. Pearson and the University of Virginia, “fasta20u63” version 2.0u63, release date December 1996). ALIGN compares entire sequences against one another, while LFASTA compares regions of local similarity. These alignment tools and their respective tutorials are available on the Internet at the NCSA website. Alternatively, for comparisons of amino acid sequences of greater than about 30 amino acids, the “Blast 2 sequences” function can be employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the “Blast 2 sequences” function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). The BLAST sequence comparison system is available, for instance, from the NCBI web site; see also Altschul et al., J. Mol. Biol., 215:403-10, 1990; Gish and States, Nature Genet., 3:266-72, 1993; Madden et al., Meth. Enzymol., 266:131-41, 1996; Altschul et al., Nucleic Acids Res., 25:3389-402, 1997; and Zhang and Madden, Genome Res., 7:649-56, 1997.

Orthologs (equivalent to proteins of other species) of proteins are in some instances characterized by possession of greater than 75% sequence identity counted over the full-length alignment with the amino acid sequence of specific protein using ALIGN set to default parameters. Proteins with even greater similarity to a reference sequence will show increasing percentage identities when assessed by this method, such as at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, or at least 98% sequence identity. In addition, sequence identity can be compared over the full length of one or both binding domains of the disclosed fusion proteins.

When significantly less than the entire sequence is being compared for sequence identity, homologous sequences will typically possess at least 80% sequence identity over short windows of 10-20, and may possess sequence identities of at least 85%, at least 90%, at least 95%, or at least 99% depending on their similarity to the reference sequence. Sequence identity over such short windows can be determined using LFASTA; methods are described at the NCSA website. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided. Similar homology concepts apply for nucleic acids as are described for protein. An alternative indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions.

Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that each encode substantially the same protein.

Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.

Therapeutically effective amount: A quantity of a specified agent sufficient to achieve a desired effect in a subject being treated with that agent. For example, this may be the amount of a recombinant rabies virus useful for eliciting an immune response in a subject and/or for preventing infection by rabies virus and other lyssaviruses. Ideally, in the context of the present disclosure, a therapeutically effective amount of a recombinant rabies virus is an amount sufficient to increase resistance to, prevent, ameliorate, and/or treat infection caused by one or more lyssaviruses in a subject without causing a substantial cytotoxic effect in the subject. The effective amount of a recombinant rabies virus useful for increasing resistance to, preventing, ameliorating, and/or treating infection in a subject will be dependent on, for example, the subject being treated, the manner of administration of the therapeutic composition and other factors. In some embodiments, the recombinant rabies viruses described herein comprise a nucleic acid sequence encoding one or more glycoproteins from a lyssavirus other than rabies virus ERA.

Vaccine: A preparation of immunogenic material capable of stimulating an immune response, administered for the prevention, amelioration, or treatment of infectious or other type of disease (such as cancer). The immunogenic material may include attenuated or killed microorganisms (such as attenuated viruses), or antigenic proteins, peptides or DNA derived from them. Vaccines may elicit both prophylactic (preventative) and therapeutic responses. Methods of administration vary according to the vaccine, but may include inoculation, ingestion, inhalation or other forms of administration. Inoculations can be delivered by any of a number of routes, including parenteral, such as intravenous, subcutaneous or intramuscular. Vaccines may be administered with an adjuvant to boost the immune response.

Vector: A nucleic acid molecule that can be introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication (DNA sequences that participate in initiating DNA synthesis). A vector may also include one or more selectable marker genes and other genetic elements known in the art.

Virus: Microscopic infectious organism that reproduces inside living cells. A virus typically consists essentially of a core of nucleic acid (single- or double-stranded RNA or DNA) surrounded by a protein coat, and in some cases lipid envelope, and has the ability to replicate only inside a living cell. “Viral replication” is the production of additional virus by the occurrence of at least one viral life cycle.

Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. Hence “comprising A or B” means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

III. Overview of Several Embodiments

Disclosed herein are recombinant rabies viruses having glycoprotein (G) genes from at least two different lyssaviruses. The disclosed viruses can be used as pan-lyssavirus vaccines to provide protection against infection by multiple genotypes of lyssavirus. Prior to the present disclosure, no vaccines had been described that protect against West Caucasian bat virus and/or lyssaviruses of genotypes 2 (Lagos bat virus) and 3 (Mokola virus). Thus, the recombinant rabies viruses described herein represent a significant advance in the development of vaccines for the prevention of rabies.

The recombinant rabies viruses exemplified herein are generating using a previously described reverse genetics system based on the ERA strain of rabies virus (PCT Publication No. WO 2007/047459). However, other reverse genetics systems for rabies virus (see, for example, Ito et al., J. Virol. 75(19):9121-9128) could be used to generate recombinant viruses having multiple lyssavirus G genes.

Provided herein is a recombinant rabies virus, wherein the genome of the recombinant rabies virus comprises rabies virus nucleoprotein (N), phosphoprotein (P), matrix protein (M), RNA-dependent RNA polymerase (L) and glycoprotein (G) genes and at least one, at least two or at least three different heterologous lyssavirus glycoprotein genes, wherein the lyssavirus is selected from Lagos bat virus (LBV), Mokola virus (MOKV), Duvenhage virus (DUVV), European bat lyssavirus-1 (EBLV-1), European bat lyssavirus-2 (EBLV-2), Australian bat lyssavirus (ABLV), Aravan virus (ARAV), Khujand virus (KHUV), Irkut virus (IRKV) and West Caucasian bat virus (WCBV). In particular embodiments, the lyssavirus is selected from LBV, MOKV and WCBV.

In some embodiments, the recombinant rabies virus comprises two heterologous G genes. In particular examples, the two heterologous G genes are from MOKV and WCBV. In other examples, the two heterologous G genes are from LBV and MOKV. In yet other examples, the two heterologous G genes are from LBV and WCBV.

In some embodiments, the recombinant rabies virus comprises three heterologous G genes. In particular examples, the three heterologous G genes are from LBV, MOKV and WCBV.

In some embodiments in which the recombinant rabies virus comprises a MOKV G gene, the nucleotide sequence of the MOKV G gene is at least 80%, is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 47. In some embodiments in which the recombinant rabies virus comprises a WCBV G gene, the nucleotide sequence of the WCBV G gene at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 49. In some embodiments in which the recombinant rabies virus comprises the LBV G gene, the nucleotide sequence of the LBV G gene is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 53.

In some examples, the MOKV G gene comprises the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene comprises the nucleotide sequence of SEQ ID NO: 49 and/or the LBV G gene comprises the nucleotide sequence of SEQ ID NO: 53. In particular examples, the MOKV G gene consists of the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene consists of the nucleotide sequence of SEQ ID NO: 49 and/or the LBV G gene consists of the nucleotide sequence of SEQ ID NO: 53.

The heterologous G genes can be cloned into the rabies virus genome in any suitable location, and in any order, to allow for expression of the heterologous proteins without altering expression of the endogenous rabies virus genes. In some embodiments, heterologous G genes are inserted between the rabies virus P and M genes, between the rabies virus G and L genes and/or between the rabies virus N and P genes. In particular examples, the recombinant rabies virus comprises two heterologous G genes and the heterologous G genes are located between the rabies virus P and M genes and between the G and L genes. In other examples, the recombinant rabies virus comprises three heterologous G genes and the three heterologous G genes are located between the rabies virus N and P genes, between the rabies virus P and M genes and between the rabies virus G and L genes.

Insertion of heterologous genes into the rabies virus genome can be facilitated by synthesizing a transcriptional unit. The transcriptional unit is inserted at the desired gene junction and the heterologous G gene is cloned into the transcriptional unit. In some embodiments, the nucleotide sequence of the transcriptional unit is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO: 42. In some examples, the transcriptional unit comprises the nucleotide sequence of SEQ ID NO: 42.

In some embodiments, the genome of the recombinant rabies virus is derived from the rabies virus ERA strain. In some embodiments, the nucleotide sequence of the ERA strain genome comprises a sequence that is at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO: 1. In particular examples, the nucleotide sequence of the ERA strain genome comprises SEQ ID NO: 1.

In some embodiments, the recombinant rabies virus includes one or more attenuating mutations. In exemplary embodiments, the rabies virus glycoprotein comprises a Glu at amino acid position 333 (SEQ ID NO: 5).

Further provided is a vector comprising a full-length rabies virus antigenomic DNA, wherein the antigenomic DNA comprises rabies virus N, P, M, L and G genes, and wherein the vector further comprises at least one, at least two, or at least three different heterologous lyssavirus G genes, wherein the lyssavirus is selected from LBV, MOKV, DUVV, EBLV-1, EBLV-2, ABLV, ARAV, KHUV, IRKV and WCBV. In particular embodiments, the lyssavirus is selected from LBV, MOKV and WCBV.

In some embodiments, the vector comprises two different heterologous lyssavirus G genes. In particular examples, the two heterologous G genes are MOKV and WCBV G genes. In other examples, the two heterologous G genes are MOKV and LBV G genes. In other examples, the two heterologous G genes are LBV and WCBV G genes.

In some embodiments, the vector comprises three heterologous G genes. In particular examples, the three heterologous G genes are from LBV, MOKV and WCBV.

In some embodiments in which the vector comprises a MOKV G gene, the nucleotide sequence of the MOKV G gene is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 47. In some embodiments in which the vector comprises a WCBV G gene, the nucleotide sequence of the WCBV G gene is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 49. In some embodiments in which the vector comprises the LBV G gene, the nucleotide sequence of the LBV G gene is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 53.

In some examples, the MOKV G gene comprises the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene comprises the nucleotide sequence of SEQ ID NO: 49 and/or the LBV G gene comprises the nucleotide sequence of SEQ ID NO: 53. In particular examples, the MOKV G gene consists of the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene consists of the nucleotide sequence of SEQ ID NO: 49 and/or the LBV G gene consists of the nucleotide sequence of SEQ ID NO: 53.

The heterologous G genes can be cloned into the vector encoding the rabies virus genome in any suitable location, and in any order, to allow for expression of the heterologous proteins without altering expression of the endogenous rabies virus genes. In some embodiments, heterologous G genes are inserted between the rabies virus P and M genes, between the rabies virus G and L genes and/or between the rabies virus N and P genes. In particular examples, the recombinant rabies virus comprises two heterologous G genes and the heterologous G genes are located between the rabies virus P and M genes and between the G and L genes. In other examples, the recombinant rabies virus comprises three heterologous G genes and the three heterologous G genes are located between the rabies virus N and P genes, between the rabies virus P and M genes and between the rabies virus G and L genes.

In some embodiments, rabies virus antigenomic DNA inserted in the vector is derived from the rabies virus ERA strain. In some examples, the nucleotide sequence of the ERA strain antigenomic DNA comprises a sequence that is at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO: 1. In particular examples, the nucleotide sequence of the ERA strain antigenomic DNA comprises SEQ ID NO: 1.

Further provided herein is a cell comprising one or more rabies virus vectors disclosed herein.

Also provided are compositions comprising the recombinant rabies viruses described herein and a pharmaceutically acceptable carrier. In some embodiments, the compositions further comprise an adjuvant.

Also contemplated are compositions comprising multiple recombinant rabies viruses, each encoding at least one heterologous G gene. In some embodiments, the compositions comprise (i) a first recombinant rabies virus, wherein the genome of the first recombinant rabies virus comprises a rabies virus G gene and at least one heterologous lyssavirus G gene; and (ii) a second recombinant rabies virus, wherein the genome of the second recombinant rabies virus comprises at least one G gene from a different lyssavirus (i.e. a lyssavirus G gene that is not in the first recombinant rabies virus); wherein the lyssavirus is selected from LBV, MOKV, DUVV, EBLV-1, EBLV-2, ABLV, ARAV, KHUV, IRKV and WCBV. In particular embodiments, the lyssavirus is selected from LBV, MOKV and WCBV. In some examples, the second recombinant rabies virus also includes a rabies virus G gene. In some examples, the first and/or second recombinant rabies virus comprises at least two heterologous G genes.

In some examples, the composition comprises (i) a first recombinant rabies virus, wherein the genome of the first recombinant rabies virus comprises a rabies virus G gene and a G gene from MOKV and WCBV; and (ii) a second recombinant rabies virus, wherein the genome of the second recombinant rabies virus comprises a G gene from LBV.

Further provided is a method of eliciting an immune response in a subject against lyssavirus by administering to the subject one or more recombinant rabies viruses or compositions disclosed herein. In some embodiments, the immune response in the subject against lyssavirus protects the subject against infection by at least three different genotypes of lyssavirus. In some embodiments, the immune response in the subject against lyssavirus protects the subject against infection by at least four different genotypes of lyssavirus. In some embodiments, the subject is a human. In other embodiments, the subject is a non-human animal.

IV. Determinants of Rabies Virus Pathogenicity

Rabies virus (RABV) is a rhabdovirus—a non-segmented RNA virus with negative sense polarity. Within the Rhabdoviridae family, rabies virus is the prototype of the Lyssavirus genus. Lyssaviruses are composed of two major structural components, a nucleocapsid or ribonucleoprotein (RNP), and an envelope in the form of a bilayer membrane surrounding the RNP core. The infectious component of all rhabdoviruses is the RNP core, which consists of the negative strand RNA genome encapsidated by nucleoprotein (N) in combination with RNA-dependent RNA-polymerase (L) and phosphoprotein (P). The membrane surrounding the RNP contains two proteins, the trans-membrane glycoprotein (G) and the matrix (M) protein, located at the inner site of the membrane. Thus, the viral genome codes for these five proteins: the three proteins in the RNP (N, L and P), the matrix protein (M), and the glycoprotein (G).

The molecular determinants of pathogenicity of various rabies virus strains have not been fully elucidated. RABV pathogenicity was attributed to multigenic events (Yamada et al., Microbiol. Immunol. 50:25-32, 2006). For example, some positions in the RABV genome if mutated, affect viral transcription or replication, reducing virulence. Mutations at serine residue 389 of the phosphorylation site in the N gene (Wu et al., J. Virol. 76:4153-4161, 2002) or GDN core sequence of the highly conserved C motif in the L gene (Schnell and Conzelmann, Virol. 214:522-530, 1995) dramatically reduced RABV transcription and replication.

The G protein, also referred to as spike protein, is involved in cell attachment and membrane fusion of RABV. The amino acid region at position 330 to 340 (referred to as antigenic site III) of the G protein has been identified as important for virulence of certain strains of RABV. Several studies support the concept that the pathogenicity of fixed RABV strains is determined by the presence of arginine or lysine at amino acid residue 333 of the glycoprotein (Dietzschold et al., Proc. Natl. Acad. Sci. USA 80: 70-74, 1983; Tuffereau et al., Virology 172: 206-212, 1989).

This phenomenon seems to apply at least to fixed rabies viruses such as CVS, ERA, PV, SAD-B19 and HEP-Flury strains (Anilionis et al., Nature 294:275-278, 1981; Morimoto et al., Virology 173:465-477, 1989). For example, rabies vaccine viruses possessing an amino acid differing from Arg at position 333 of the glycoprotein are described, for instance, in WO 00/32755 (describing RABV mutants in which all three nucleotides in the G protein Arg333 codon are altered compared to the parent virus, such that the Arg at position 333 is substituted with another amino acid); European Patent 350398 (describing an avirulent RABV mutant SAG1 derived from the Bern SAD strain of RABV, in which the Arg at position 333 of the glycoprotein has been substituted to Ser); and European patent application 583998 (describing an attenuated RABV mutant, SAG2, in which the Arg at position 333 in the G protein has been substituted by Glu).

Other strains, such as the RC-HL strain, possess an arginine residue at position 333 of the G, but do not cause lethal infection in adult mice (Ito et al., Microl. Immunol. 38:479-482, 1994; Ito et al., J. Virol. 75:9121-9128, 2001). As such, the entire G may contribute to the virulence of RABV, although the determinants or regions have not been fully elucidated.

The G gene encodes the only protein that induces viral neutralizing antibody. At least three states of RABV glycoprotein are known: the native state (N) being responsible for receptor binding; an active hydrophobic state (A) necessary in the initial step in membrane fusion process (Gaudin, J. Cell Biol. 150:601-612, 2000), and a fusion inactive conformation (I). Correct folding and maturation of the G protein play important roles for immune recognition. The three potential glycosylated positions in ERA G extracellular domain occur at Asn37, Asn247 and Asn319 residues (Wojczyk et al., Glycobiology. 8: 121-130, 1998). Nonglycosylation of G not only affects conformation, but also inhibits presentation of the protein at the cell surface.

It has been previously demonstrated (see PCT Publication No. WO 2007/047459, which is incorporated herein by reference) that expression of G enhances the anti-RABV immune response. In addition, introduction of an Arg to Glu mutation at amino acid position 333 of RABV ERA glycoprotein results in an attenuated virus (referred to as ERAg3). This attenuated virus is capable of eliciting significant titers of neutralizing antibodies in animals and conferring protection against wild-type virus challenge. Furthermore, as described in PCT Publication No. WO 2007/047459, a recombinant RABV comprising two copies of glycoprotein with the G333 mutation is particularly useful as a vaccine due to its ability to elicit high titers of neutralizing antibodies without morbidity or mortality. In some examples herein, a recombinant rabies virus comprising the G333 mutation in glycoprotein is used as a platform to introduce one or more (such as one, two or three) additional G genes from one or more different genotypes of lyssavirus. However, one of ordinary skill in the art will recognize that any one of a number of recombinant rabies viruses can be used to incorporate heterologous sequences using the reverse genetics systems disclosed in PCT Publication No. WO 2007/047459 (or another rabies virus reverse genetics system) as summarized below.

V. Rabies Virus Reverse Genetics System

RNA cannot readily be manipulated directly by molecular biological methods. Traditional RNA virus vaccines are from naturally attenuated isolates, which are difficult to control and provide unpredictable results. Reverse genetics technology makes it possible to manipulate RNA viruses as DNA, which can be mutated, deleted or reconstructed according to deliberate designs. Every gene function can be studied carefully, independently, and in concert, which benefits vaccine development. Reverse genetics involves reverse transcription of the RNA viral genome into cDNA, and cloning into a vector, such as a plasmid. After transfection of host cells, the vector is transcribed into RNA, to be encapsidated by viral structural proteins, which can also be supplied by plasmids. The encapsidated RNA forms a ribonucleoprotein complex, which results in virions that can be recovered.

An efficient reverse genetics system based on the rabies virus ERA strain is described in PCT Publication No. WO 2007/047459, which is incorporated herein by reference. This rabies reverse genetics system is useful for a variety of purposes, including to attenuate ERA virus in a defined manner for vaccine development and to produce ERA virus vectors for expression of heterologous proteins, such as a protein from another lyssavirus for the generation of a pan-lyssavirus vaccine.

The reverse genetics system disclosed in PCT Publication No. WO 2007/047459 has some or all of the following characteristics, illustrated schematically in FIG. 1A using the exemplary ERA strain antigenomic cDNA.

The rabies virus reverse genetics system is based on a full length transcription plasmid plus a plurality of helper plasmids (e.g., five helper plasmids). The helper plasmids encode the N, P and L proteins, and optionally the G protein, as well as the T7 polymerase. Although the G protein is not necessary for virus rescue, it improves virus recovery efficiency or virus budding when included in transfection.

Transcription involves both cellular RNA dependent RNA polymerase II, which is available in mammalian cells, and T7 RNA polymerase, which is supplied by pNLST7 plasmids. The dual polymerases result in virus recovery efficiency that is both high and stable.

In the transcription plasmid, hammerhead and hepatitis delta virus ribozymes flank a rabies virus (e.g., ERA strain) antigenomic cDNA, enabling the production of authentic 5′ and 3′ ends of antigenomic viral RNA by transcription. The first ten nucleotides of the hammerhead sequence are designed to be complementary to the first ten nucleotides of the antisense genomic sequence.

Two modified T7 RNA polymerase constructs support virus recovery more efficiently than the wild type T7 RNA polymerase applied previously. One T7 RNA polymerase has been mutated from the first ATG to AT. The second T7 RNA polymerase has an eight amino acid nuclear localization signal (NLS) derived from the SV40 virus large T antigen fused after the first ATG from the parental T7. Addition of the NLS results in the T7 RNA polymerase being present predominantly in the nucleus. Following transfection mechanism of the NLS modified plasmid, the DNA/transfection reagent complex binds to the surface of the cell. Through endocytosis, the complex is taken into the endosome/lysosome, and the DNA is released into the cytosol. In the absence of the NLS, the majority of the transfected plasmids are retained in the cytosol and only a small percentage of the released DNA reaches the nucleus, where it is transcribed into RNA. After protein synthesis, the NLST7 RNA polymerase is transported back to the cell nucleus, and the helper plasmids (with T7/CMV promoters) in the nucleus will be transcribed by both NLST7 and cellular polymerase II. Thus, more mRNAs of the helper plasmids and cRNA of the full-length pTMF or its derivatives are synthesized and result in high efficiency of virus recovery.

After the initial expression of NLST7 by the CMV promoter, NLST7 polymerase binds to pT7 for transcription of the NLST7 gene. Through modification of the transcripts in the nucleus, more NLST7 mRNA is synthesized, resulting in greater expression of NLST7 polymerase. The pT7 of the NLST7 polymerase as well as of the full length antigenomic transcription unit is under the control of the NLST7 polymerase, which acts as an “autogene.” The autogene mechanism of NLST7 RNA polymerase is illustrated in FIG. 2. After expression of T7 RNA polymerase in the nucleus, the transfected T7 constructs continue to transcribe full length RNA template for N protein encapsidation and/or L protein binding, enhancing virus recovery efficiency.

The T7 polymerase, and all other plasmids, except the N protein encoding plasmid pTN, are placed under control of both CMV and T7 transcriptional regulatory elements. The N protein encoding nucleic acid is under the control of a T7 promoter and is translated in cap-independent manner based on an IRES (internal ribosome entry site). Cellular RNA polymerase II alone can help the recovery of RABV if all the plasmids were cloned under the control of the CMV promoter. In the ERA reverse genetics system disclosed in PCT Publication No. WO 2007/047459, only pTN is under the control of the T7 promoter and is translated in a cap-independent manner. All other constructs are under control of both CMV and the T7 transcriptional regulatory elements. Typically, in RABV, N synthesis is abundant and the ratio among N, P and L is approximately 50:25:1. To mimic the wild type viral transcription and assembly in RABV reverse genetics, N expression should be the highest. With the aid of NLST7 polymerase and IRES translation mode, N protein is expressed efficiently after plasmid transfection. This reduces competition for transcription with housekeeping genes in host cells, because the T7 transcription initiation signal does not exist in mammalian cells, and results in increased efficiency of T7 transcription.

In addition, as described in PCT Publication No. WO 2007/047459, to enhance production of viral proteins, the helper plasmids can be constructed to incorporate a Kozak sequence that has been optimized for the translation efficiency for each protein encoding sequence. After five days post-transfection in the ERA reverse genetics system, the rescued viruses reliably and repeatably grew to 107 FFU/ml without further amplification.

Recombinant rabies viruses with favorable properties for vaccination can be designed using, for example, the reverse genetics system disclosed in PCT Publication No. WO 2007/047459. Modified strains having mutated glycoproteins are particularly suited for use as immunogenic compositions. This RABV reverse genetics system also enables a rabies virus vector system for foreign (heterologous) gene expression. An extra transcription unit was previously demonstrated to be functional in two different locations after incorporation into the RABV ERA genome. Thus, the RABV reverse genetics system provides a means for introducing heterologous proteins. In some examples, the heterologous protein is a glycoprotein from a lyssavirus other than the RABV ERA strain.

VI. Administration and Use of Recombinant Rabies Virus Compositions

The recombinant rabies viruses provided herein comprise at least one heterologous nucleic acid sequence encoding a glycoprotein from a lyssavirus other than RABV ERA. The immunogenic compositions provided herein are designed to provide protection to multiple lyssavirus genotypes, and in some cases, provide protection against all 11 known lyssavirus genotypes. The immunogenic compositions provided herein are contemplated for use with both human and non-human animals.

The immunogenic formulations may be conveniently presented in unit dosage form and prepared using conventional pharmaceutical techniques. Such techniques include the step of bringing into association the active ingredient and the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers. Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets commonly used by one of ordinary skill in the art.

In certain embodiments, unit dosage formulations are those containing a dose or unit, or an appropriate fraction thereof, of the administered ingredient. It should be understood that in addition to the ingredients particularly mentioned above, formulations encompassed herein may include other agents commonly used by one of ordinary skill in the art.

The compositions provided herein, including those for use as immunogenic compositions, may be administered through different routes, such as oral, including buccal and sublingual, rectal, parenteral, aerosol, nasal, intramuscular, subcutaneous, intradermal, and topical. They may be administered in different forms, including but not limited to solutions, emulsions and suspensions, microspheres, particles, microparticles, nanoparticles, and liposomes. In some embodiments, the immunogenic compositions are administered orally.

The volume of administration will vary depending on the route of administration. Those of ordinary skill in the art will know appropriate volumes for different routes of administration.

Administration can be accomplished by single or multiple doses. The dose administered to a subject in the context of the present disclosure should be sufficient to induce a beneficial therapeutic response over time, such as to prevent lyssavirus infection or the development of rabies. The dose required may vary depending on, for example, the age, weight and general health of the subject.

The amount of immunogenic composition in each dose is selected as an amount that induces an immunostimulatory response without significant, adverse side effects. Such amount will vary depending upon which specific composition is employed and how it is administered. Initial doses may range from about 1 μg to about 1 mg, with some embodiments having a range of about 10 μg to about 800 and still other embodiments a range of from about 25 μg to about 500 μg. Following an initial administration of the immunogenic composition, subjects may receive one or several booster administrations, adequately spaced. Booster administrations may range from about 1 μg to about 1 mg, with other embodiments having a range of about 10 μg to about 750 μg, and still others a range of about 50 μg to about 500 μg. Periodic boosters at intervals of 1-5 years, for instance three years, may be desirable to maintain the desired levels of protective immunity. In preferred embodiments, subjects receive a single dose of an immunogenic composition.

Provided herein are pharmaceutical compositions (also referred to as immunogenic or immunostimulatory compositions) which include a therapeutically effective amount of a recombinant RABV alone or in combination with a pharmaceutically acceptable carrier. In some embodiments, the recombinant RABV comprises a heterologous protein, such as glycoprotein from another lyssavirus that causes rabies.

Pharmaceutically acceptable carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The carrier and composition can be sterile, and the formulation suits the mode of administration. The composition can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, and magnesium carbonate. Any of the common pharmaceutical carriers, such as sterile saline solution or sesame oil, can be used. The medium can also contain conventional pharmaceutical adjunct materials such as, for example, pharmaceutically acceptable salts to adjust the osmotic pressure, buffers, preservatives and the like. Other media that can be used with the compositions and methods provided herein are normal saline and sesame oil.

The recombinant RABVs described herein can be administered alone or in combination with other therapeutic agents to enhance antigenicity. For example, the recombinant viruses can be administered with an adjuvant, such as Freund incomplete adjuvant or Freund's complete adjuvant.

Optionally, one or more cytokines, such as IL-2, IL-6, IL-12, RANTES, GM-CSF, TNF-α, or IFN-γ, one or more growth factors, such as GM-CSF or G-CSF; one or more molecules such as OX-40L or 41 BBL, or combinations of these molecules, can be used as biological adjuvants (see, for example, Salgaller et al., 1998, J. Surg. Oncol. 68(2):122-38; Lotze et al., 2000, Cancer J. Sci. Am. 6(Suppl 1):S61-6; Cao et al., 1998, Stem Cells 16(Suppl 1):251-60; Kuiper et al., 2000, Adv. Exp. Med. Biol. 465:381-90). These molecules can be administered systemically (or locally) to the host.

A number of means for inducing cellular responses, both in vitro and in vivo, are known. Lipids have been identified as agents capable of assisting in priming CTL in vivo against various antigens. For example, as described in U.S. Pat. No. 5,662,907, palmitic acid residues can be attached to the alpha and epsilon amino groups of a lysine residue and then linked (for example, via one or more linking residues, such as glycine, glycine-glycine, serine, serine-serine, or the like) to an immunogenic peptide. The lipidated peptide can then be injected directly in a micellar form, incorporated in a liposome, or emulsified in an adjuvant. As another example, E. coli lipoproteins, such as tripalmitoyl-S-glycerylcysteinlyseryl-serine can be used to prime tumor specific CTL when covalently attached to an appropriate peptide (see, Deres et al., Nature 342:561, 1989). Further, as the induction of neutralizing antibodies can also be primed with the same molecule conjugated to a peptide which displays an appropriate epitope, two compositions can be combined to elicit both humoral and cell-mediated responses where that is deemed desirable.

The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.

EXAMPLES Example 1 Construction of Plasmids for a Reverse Genetics System for Rabies Virus

This example describes the design and development of a reverse genetics system for rabies virus. Rabies virus strain ERA was obtained from the ATCC and was prepared as described (Wu et al., J. Virol. 76, 4153-4161, 2002). To obtain virus genome full-length virus cDNA, BSR cells (a clone of baby hamster kidney, BHK, cells) were infected with ERA strain virus and grown in Dulbecco's minimal essential medium supplemented with 10% of fetal bovine serum. Supernatants were recovered and subjected to centrifugation at 22,000 g for 1 hour. The virus pellets were collected for viral genomic RNA purification by use of a RNA virus extraction kit purchased from Qiagen (Valencia, Calif.) according to the manufacturer's instructions. The integrity of viral genomic RNA was confirmed by gel electrophoresis. Viral genomic cDNA was transcribed with the first-strand cDNA synthesis kit from Life Technologies (Carlsbad, Calif.). The reverse transcription (RT) reaction mixture was applied to amplification by the polymerase chain reaction (PCR) for the synthesis of full-length viral genomic cDNA, N, P, G and L genes, respectively. For assembling the full-length virus genomic cDNA, a pTMF plasmid was constructed in four sequential steps as illustrated schematically in FIG. 1B. Superscript III reverse transcriptase and proof reading platinum pfx polymerase (Life Technologies, Carlsbad, Calif.) were applied for cDNA transcript synthesis and consecutive PCR amplifications. For reverse transcription reactions, 1 μg of purified genomic RNA was used in the RT reaction mix and incubated at 50° C. for 80 min, followed by heating at 85° C. for 5 minutes to inactivate Superscript III. After the RT reaction, 1 unit of RNaseH was added to digest template RNA in the cDNA-RNA hybrids.

To generate full-length virus genomic cDNA, two overlapping fragments were amplified by RT-PCR as follows: Fragment1 (F1) was RT-PCR amplified with primers: Le5-Kpn (CCGGGTACCACGCTTAAC AACCAGATCAAAGA; SEQ ID NO: 8, Kpn1 recognition site shown in bold) and Le3-Blp (TAGGTCGCTTGCTAAGCACTCCTGGTAGGAC; SEQ ID NO: 9, Blp1 recognition site shown in bold). Fragment 2 (F2) was RT-PCR amplified with primers: Tr5-Blp (GTCCTACCAGGAGTGCTTAGCAAGCGACCTA; SEQ ID NO: 10, Blp1 recognition site shown in bold) and Tr3-Pst (AAAACTGCAGACGCTTAACAAATAAACAACAAAA; SEQ ID NO: 11, Pst1 recognition site shown in bold). After successful synthesis of the above two fragments, F1 digested by Kpn1 and Blp1 restriction enzymes was subjected to gel purification and cloned to pBluescriptIISK(+) phagemid (Stratagene, La Jolla, Calif.) to form the pSKF1 plasmid. The gel purified F2 fragment, cut by Blp1 and Pst1 was consecutively cloned to the pSKF1 plasmid to form the full-length viral antigenomic cDNA. Hammerhead ribozyme (oligo1, CAAGGCTAGCTGTTAAGCGTCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAA TTCCTATAGTCGGTACCACGCT; SEQ ID NO: 12, Nhe1 and Kpn1 recognition sites shown in bold; oligo2, AGCGTGGTACCGACTATAGGAATTCCTTTCCTATAGTTTCGTCCTCACGGACTCATCAG ACGCTTAACAGCTAGCCTTG; SEQ ID NO: 13, Kpn1 and Nhe1 recognition sites shown in bold) was synthesized containing a Nhe1 recognition site at the 5′ end and a Kpn1 site at the 3′ end. This was fused ahead of the 5′ end of the F1 fragment. A hepatitis delta virus ribozyme (oligo3, GACCTGCAGGGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCGA AGGAGGACGCACGTCCACTCGGATGGCTAAGGGAGGGCGCGGCCGCACTC; SEQ ID NO: 14, Pst1 and Not1 recognition sites shown in bold; oligo4, GAGTGCGGCCGCGCCCTCCCTTAGCCATCCGAGTGGACGTGCGTCCTCCTTCGGATGC CCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCCTGCAGGTC; SEQ ID NO: 15, Not1 and Pst1 recognition sites shown in bold) (Symons, Annu. Rev. Biochem. 61: 641-671, 1992) was synthesized, having a Pst1 site at its 5′ end and a Not1 site at its 3′ end, and was fused to the 3′ end of the F2 fragment. The connective Kpn1 recognition site, between the hammerhead ribozyme and the F1 fragment, and the Pst1 site between the F2 fragment and the hepatitis delta virus ribozyme, were deleted by site-directed mutagenesis. The full-length viral antigenomic cDNA was sandwiched by the hammerhead and hepatitis delta virus ribozymes. This was removed and cloned to the pBluescriptIISK(+) phagemid to make a pSKF construct. The full viral antigenomic cDNA with two ribozymes was fused downstream of the T7 transcription initiation site under control of the CMV immediate-early promoter in pcDNA3.1/Neo (+) plasmid (Life Technologies, Carlsbad, Calif.). This last step finished the construction of the pTMF plasmid.

The wild type ERA viral genome includes a polyA tract of eight residues (polyA8) in the intergenic region between the G and Psi regions. To distinguish the rescued ERA (rERA) virus from the parental strain, a stretch of seven A (polyA7) was introduced to the pTMF construct by deletion of one A instead of the original polyA8. After rERA virus was recovered, RT-PCR was performed and subsequent sequence data confirmed the existence of the introduced poly A7 sequence marker.

pTN plasmid: The N gene was amplified by RT-PCR with primers (5N: ACCACCATGGATGCCGACAAGATTG; SEQ ID NO: 16, Nco1 recognition site and start codon shown in bold; and 3N: GGCCCATGGTTATGAGTCACTCGAATATGTCTT; SEQ ID NO: 17, Nco1 recognition site and stop codon shown in bold) and cloned to the pCITE-2a(+) (Cap-Independent Translation Enhancer) plasmid (Novagen, Madison Wis.).

pMP plasmid: the P gene was amplified by RT-PCR with primers (5P: TTGGTACCACCATGAGCAAGATCTTTGTCAATC; SEQ ID NO: 18, Kpn1 recognition site and start codon shown in bold; and 3P: GGAGAGGAATTCTTAGCAAGATGTATAGCGATTC; SEQ ID NO: 19, EcoR1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

pMG plasmid: the G gene was amplified by RT-PCR with primers (5G: TTGGTACCACCATGGTTCCTCAGGCTCTCCTG; SEQ ID NO: 20, Kpn1 recognition site and start codon shown in bold; and 3G: AAAACTGCAGTCACAGTCTGGTCTCACCCCCAC; SEQ ID NO: 21, Pst1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

pML plasmid: the L gene was amplified by RT-PCR with primers (5L: ACCGCTAGCACCACCATGCTCGATCCTGGAGAGGTC; SEQ ID NO: 22, Nhe1 recognition site and start codon shown in bold; and 3L: AAAACTGCAGTCACAGGCAACTGTAGTCTAGTAG; SEQ ID NO: 23, Pst1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

pT7 plasmid: genomic DNA from bacteria BL-21 (Novagene, Madison, Wis.) was extracted with the Dneasy Tissue Kit (Qiagen, Valencia, Calif.) according to the manufacturer's instructions. The T7 RNA polymerase gene was amplified from the purified genomic DNA by PCR with primers (5T7: TCGCTAGCACCACCATGAACACGATTAACATCGCTAAG; SEQ ID NO: 24, Nhe1 recognition site and start codon shown in bold; and 3T7: GATGAATTCTTACGCGAACGCGAAGTCCGACTC; SEQ ID NO: 25, EcoR1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

pNLST7 plasmid: an eight amino acid nuclear location signal (NLS), derived from SV40 large T antigen, was added to the N terminus of the T7 RNA polymerase by PCR amplification, using the pT7 plasmid as the template, with primers (5T7NLS: TCGCTAGCCACCATGCCAAAAAAGAAGAGAAAGGTAGAAAACACGATTAACATCGCT AAGAAC; SEQ ID NO: 26, NLS shown in bold and 3T7 primer). The amplified fragment was designated NLST7, and was cloned to pcDNA3.1/Neo (+) to form the pNLST7 construct.

pGFP plasmid: Monster Green Fluorescent Protein (GFP) plasmid phMGFP was purchased from Promega (Madison, Wis.). The GFP gene was amplified by PCR with primers (GFP5: AAAACTGCAGGCCACCATGGGCGTGATCAAG; SEQ ID NO: 27, Pst1 recognition site and start codon shown in bold; and GFP3: CCGCTCGGTACCTATTAGCCGGCCTGGCGGG; SEQ ID NO: 28, Kpn1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

All plasmid constructs were sequenced at least three times to confirm the absence of unexpected mutations or deletions after cloning, site-directed mutagenesis, or gene deletion. Additionally, the presence of a marker sequence consisting of a polyA tract having seven adenosine residues rather than the eight residues observed in the wild type ERA genome between the glycoprotein and Psi region was confirmed.

Example 2 Defined Modification of Rabies Virus Evelyn-Rokitnicki-Abelseth (ERA) Strain

In addition to the parental ERA virus strain described above, derivative virus strains were developed using the reverse genetics system disclosed herein. Several exemplary modified viruses were produced, namely ERA—(deletion of the whole psi-region), ERAgreen1 (green florescent protein gene inserted in ERA viral genome psi region), ERAgreen2 (green florescent protein gene inserted in phosphoprotein and matrix protein intergenic region), ERA2g (containing an extra copy of glycoprotein in the psi-region), ERAg3 (with a mutation at amino acid 333 in glycoprotein), ERA2g3 (with an extra copy of mutated glycoprotein at Aa333 in psi-region), ERA-G (with glycoprotein deleted) ERAgm (M and G genes switched in the genome), and ERAgmg (two copies of G in the rearranged ERAgm construct) These derivatives are illustrated schematically in FIG. 3. By optimizing the growth conditions as described, all of the rescued viruses can be obtained at virus titers of 109 to 1010 ffu/ml in both tissue culture flasks and bioreactors.

Gene Deletion and Site-Directed Mutagenesis in the Reverse Genetics System

Deletion of the Psi Region of the Rabies Virus ERA Genome

The complete Psi-region of the rabies virus ERA genome was deleted as follows: 3′Δψ fragment was amplified using pTMF as template by PCR with primers (5Δψ: CCCTCTGCAGTTTGGTACCGTCGAGAAAAAAACATTAGATCAGAAG; SEQ ID NO: 29, Pst1 and Kpn1 recognition sites shown in bold; and Le3-Blp primer) and was cloned to pCR-BluntII-TOPO vector (Life Technologies, Carlsbad, Calif.) for the construction of pPΔ5ψ plasmid. The 5′Δψ fragment was amplified using the same template by PCR with primers (SnaB5: ATGAACTTTCTACGTAAGATAGTG; SEQ ID NO: 30, SnaB1 recognition site shown in bold; and 3Δψ: CAAACTGCAGAGGGGTGTTAGTTTTTTTCAAAAAGAACCCCCCAAG; SEQ ID NO: 31, Pst1 recognition site shown in bold) was successively cloned to the above pPΔ5ψ plasmid to finish the construction of the pPΔψ plasmid. The fragment recovered by SnaB1 and Pst1 restriction enzyme digestion from the pPΔψ plasmid substituted the counterpart in the pSKF construct to make the pSKFΔψ plasmid. The whole DNA fragment containing the ERA genomic cDNA, digested by Nhe1 and Not1 from pSKFΔψ plasmid, was re-cloned to the pcDNA3.1/Neo (+) plasmid to finalize the construction of pTMFΔψ. For verification of the rescued strain lacking Psi, designated Era-, primers covering the Psi-region were applied in RT-PCR with total RNA from ERA-infected BSR cells. A 400 bp fragment corresponding to the Psi region was amplified only from rERA virus, but not from ERA. Sequence data verified the complete deletion of the Psi-region.

Deletion of the Glycoprotein Gene in the Rabies Virus ERA Genome:

The 5′gΔψ fragment was amplified using pSKF as template by PCR with primers (SnaB5 primer, and 3Δg: CAAACTGCAGAGGGGTGTTAGTTTTTTTCACATCCAAGAGGATC; SEQ ID NO: 32). After digestion by SnaB1 and Pst1 restriction enzymes, this recovered fragment was cloned to replace its counterpart in the pSKFΔψ construct. The 3′gΔψ fragment was amplified using the same template by PCR with primers (5Δg: CCTCTGCAGTTTGGTACCTTGAAAAAAACCTGGGTTCAATAG; SEQ ID NO: 33, and Le3-Blp primer), and was consecutively cloned to the modified pSKFΔψ, to replace its counterpart. The final fragment, recovered by SnaB1 and Blp1 restriction enzymes cut from this pSKFΔψ without the G gene, was re-cloned to pcDNA3.1/Neo (+) plasmid to form the pTMFΔg construct for virus recovery.

Glycoprotein Gene Site-Directed Mutagenesis:

Site directed mutagenesis to introduce a three nucleotide change from AGA to GAG at amino acid position 333 of the glycoprotein was performed as previously described (Wu et al., J. Virol. 76: 4153-4161, 2002). The primers in the mutagenesis reaction were M5G primer: CTCACTACAAGTCAGTCGAGACTTGGAATGAGATC (SEQ ID NO: 34, the three mutated nucleotides shown in bold) and M3G primer: GACTGACTTTGAGTGAGCATCGGCTTCCATCAAGG (SEQ ID NO: 35). For the recovered strain (ERAg3), three nucleotide changes from AGA to GAG at amino acid position 333 (aa333) were confirmed by sequencing after RT-PCR with primers 5G and 3G. After confirmation by DNA sequencing, the mutated G was cloned back to the pTMF plasmid to make the pTMFg3 construct for virus recovery. The glycoprotein encoded by this mutated G gene is represented by SEQ ID NO: 7.

Incorporation of an Exogenous ORF into ERA Rabies Virus Genome

To express exogenous ORFs in RABV, an extra transcription unit with Pst1 and Kpn1 recognition sites were created and incorporated at the Psi or P-M gene intergenic regions, respectively. In brief, for creation of an extra transcription unit at the Psi-region, the same steps were followed, except for the 5Δψ fragment amplification step, the 3Δψ primer was changed to 3Δψcis: CCAAACTGCAGCGAAAGGAGGGGTGTTAGTTTTTTTCATGATGAACCCCCCAAGGGGA GG (SEQ ID NO: 36). The final construct without the Psi-region, but with an extra transcription unit, was designated as pMTFΔψcis. The GFP, ERA G, or mutated G at amino acid residues 333 were cloned to this transcriptional unit to form pMTFgfp1, pMTF2g, pMTFg3, pMTF2g3 constructs, respectively, for virus rescue.

To incorporate an extra transcription unit to the P-M intergenic region, the cisp5 fragment was amplified using pMTF as template with primers cis55: GACTCACTATAGGGAGACCCAAGCTGGCTAGCTGTTAAG (SEQ ID NO: 37), cis53: CCAAACTGCAGCGAAAGGAGGGGTGTTAGTTTTTTTCATGTTGACTTTAGGACATCTCG G (SEQ ID NO: 38), and was cloned in substitution of its counterpart in the pMTF plasmid. The cisp3 fragment was amplified and cloned in a similar way with primers cis35: CCTTTCGCTGCAGTTTGGTACCGTCGAGAAAAAAACAGGCAACACCACTGATAAAATG AAC (SEQ ID NO: 39) and cis33: CCTCCCCTTCAAGAGGGCCCCTGGAATCAG (SEQ ID NO: 40). After assembling the cisp5 and cisp3 fragments together, the final construct was designated as pMTFcisp, for accepting ORFs. The recombinant construct containing the GFP gene was named pTMFgfp2 for virus recovery.

To produce an ERA derivative, designated ERAgm, in which the glycoprotein encoding sequence was reversed in order with the matrix protein encoding sequence, the glycoprotein gene was deleted as described above. The G gene (amplified as disclosed above) was then inserted between P and M genes, yielding a rabies virus genome in the order of N-P-G-M-L. Similarly, the same strategy was applied to produce the ERAg3m derivative, in which the glycoprotein has a triple nucleotide mutation at 333 amino acid residue (from AGA to GAG) by substituting the G gene produced by site directed mutagenesis as described above. To produce the ERAgmg construct, an extra copy of glycoprotein gene was inserted between P and M genes, and made the rabies virus genome in the order of N-P-G-M-G-L.

An extra transcription unit was modified and incorporated into two different regions of the ERA genome, namely psi-region and P-M intergenic region. When heterologous ORFs are incorporated into these transcription units, designated trans 1 and trans 2, respectively, efficient production of the encoded product results.

Sequence of the transcription unit is: CTAACACCCCTCCTTTCGCTGCAGTTTGGTACCGTCGAGAAAAAAA (SEQ ID NO: 41, Pst1 and Kpn1 were underlined).

Example 3 Recovery of Parental and Derivative Viruses

This example describes the recovery of parental ERA virus and exemplary derivatives using the reverse genetics system disclosed herein. BSR cells were transfected at near 80% confluence in six-well-plates with viral full length transcription plasmid pTMF (pTMFΔψ, pTMFg3, pTMF2g, pTMF2g3, pTMFgfp1, pTMFgfp2, pTMFΔg, pTMFgm, or pTMFgmg, respectively) at 3 μg/well, together with five helper plasmids: pTN (1 μg/well), pMP (0.5 μg/well), pML (0.5 μg/well), pMG (0.5 μg/well) and pNLST7 (1 μg/well) by TransIT-LT1 reagent (Mirus, Madison, Wis.) following the protocol recommended by the manufacturer. Four days after transfection, 1 ml of fresh BSR cell suspension (about 5×105 cells) was added to each well. Cells were incubated at 37° C., 5% CO2 for 3 days. Cell supernatants were collected for virus titration.

To titrate the recovered virus, monolayers of BSR cells in LAB-TEK eight-well-plates (Naperville, Ill.) were infected with serial 10-fold dilutions of virus supernatant and incubated at 37° C., 0.5% CO2 for 48 h. Cells were fixed in 80% chilled acetone at room temperature for 1 h and stained with FITC-labeled anti-rabies virus N monoclonal antibody at 37° C. for 30 minutes. After three rinses of the plates with PBS, stained foci were counted using direct fluorescent microscopy. Details for direct RABV fluorescent assay (DFA) can be found on the World Wide Web at cdc.gov/ncidod/dvrd/rabies/professional/publications/DFA-diagnosis/DFA_protocol.htm.

All of the viruses except ERA-G were recovered at high titer from cultured BSR cells as indicated in Table 1. Surprisingly, rearrangement and switching of the G gene with the M gene did not hinder recovery of recombinant derivative ERA virus. Rearrangement of the G gene in the RABV genomes was previously not believed feasible due to cell death from overexpression of G protein (Faber et al., J. Virol. 76:3374-3381, 2002). However, these results demonstrate that rearrangement is possible in the ERA strain. Accordingly, it is likely that RABV gene shuffling is possible not only for the G gene, but also for other genes as well.

The ERA-G (without G) virus was recovered after plasmid transfection following the same procedure as for the other viral constructs rescue, but virus foci were very limited and restrained in local areas after the first round of transfection. The rescued virus was not capable of spreading further to the nearby healthy BSR cells even after one week of incubation at 37° C., 5% CO2. Infection of normal BSR cells with the above transfection supernatants presented single cell staining in the DFA test, which suggested the recovered virus was incapable of spread. The ERA-G virus was amplified using a BHK cell line that constitutively expresses ERA G (PCT Publication No. WO 2007/047459). By indirect fluorescent assay screening, a pool of BHK cells expressing G were selected and maintained for amplification of ERA-G virus. With the aid of the BHK-G cell line, ERA-G virus grew to 107 ffu/ml. Total RNA from ERA-G virus-infected BHK-G cells was extracted for Northern blot analysis with a G gene probe. The G gene was absent in the viral genomic RNA, however G mRNA was detected, which came from infected supportive BHK-G cells. In purified ERA-G viral genomic RNA, no hybridization signal was detected by G probe, indicating the deletion of the G gene in the ERA genome.

Example 4 Growth of Rescued ERA Virus and its Derivatives to High Titer in a Bioreactor

In oral vaccine development, high virus titer is typically required to elicit reliable immunity after administration. This example demonstrates that the ERA virus and derivatives can be grown to high titer in a bioreactor at volumes applicable to commercial scale-up. All 10 rescued ERA viruses were amplified in a bioreactor, CELLine AD1000 (IBS Integra Bioscience, Chur, Switherland) to titers ranging from 107 to 1010 ffu/ml. In brief, BSR cells were transfected with the exemplary antigenome transcription vectors and helper vectors, as described above. Cells were inoculated at a multiplicity of infection of 1 virion per cell, at a concentration of 106 cells/ml in one tenth the bioreactor vessel volume. Transfected cells were grown at 37° C., 5% CO2 in DMEM supplemented with 10% fetal bovine serum. The supernatant was harvested every three to five days for between two and three harvests. The deficient ERA-G grew less well compared with other viruses, with only 108 ffu/ml for the ERA-G (Table 1).

TABLE 1 Full-length plasmid constructs and corresponding rescued viruses Titers Titers Plasmid Rescued ffu/ml from ffu/ml in constructs viruses cultured cells bioreactors pTMF rERA   5 × 107    3 × 1010 pTMFΔψ ERA- 6.3 × 107  3.2 × 1010 pTMFg3 ERAg3   3 × 106 1.8 × 109 pTMFgfp1 ERAgreen1 3.5 × 106 5.6 × 109 pTMFgfp2 ERAgreen2   2 × 107 6.2 × 109 pTMF2g ERA2g 1.6 × 106 3.9 × 109 pTMF2g3 ERA2g3   8 × 107 4.6 × 109 pTMFΔg ERA-G 1.2 × 102 1.5 × 107 pTMFgm ERAgm 5.31 × 106  1.9 × 109 pTMFgmg ERAgmg 3.1 × 106 1.2 × 109

Example 5 Expression of Exogenous Proteins from Extra Transcriptional Units in Rabies Virus

This example demonstrates the expression of recombinant proteins from a heterologous ORF inserted into a rabies virus vector. In this example, the ERA virus vector is used as a prototype rabies virus vector. To construct ERA virus as a vector for accepting ORFs, a conservative RABV transcriptional unit between the N and P genes was modified and introduced into the ERA genome at two different locations: 1) at the psi region (trans 1), and 2) at the P-M intergenic region (trans 2). The transcriptional unit was designed to possess two unique restriction enzyme recognition sites to facilitate introduction of heterologous polynucleotide sequences (TTTTTTTGATTGTGGGGAGGAAAGCGACGTCAAACCATGGCAGCTCTTTTTTT; SEQ ID NO: 42, Pst1 and Kpn1 sites shown in bold).

In a first example, the GFP gene was cloned into this unit for virus recovery, since GFP expression could be observed directly under a UV microscope when the transfected BSR cells were still incubating. Expression of the GFP protein was directly visible by fluorescent microscopy with an excitation filter of 470±20 nm. The ERAgreen2 (GFP gene inserted after P gene in RABV genome-trans 2)-infected cells showed clear green foci after three days of plasmid transfection, while ERAgreen1 (GFP gene inserted after G gene in the “traditional” Ψ region-trans 1) did not present obvious green foci until five days post-transfection. The introduced transcriptional unit was functional in the RABV genome at both locations, although expression and accumulation was apparent more rapidly when GFP was expressed from trans 2. Thus, these results also indicate that the level of expression from a heterologous ORF can be modulated by selecting the transcription unit into which the ORF is cloned.

In other examples, 1) an additional copy of ERA G; or 2) an additional copy of ERA G with an amino acid substitution at position 333, was incorporated into the ERA viral genome. The successfully rescued viruses were named ERA2g and ERA2g3, respectively. Since quantitation of viral G expression was not practical, the relative increase in expression levels of G in ERA2g and ERA2g3-infected cells was confirmed by Northern-blot with a G probe. In brief, the ERA G gene probe was labeled using the Dig DNA Labeling Kit (Roche, Indianapolis, Ind.) and imaged with Dig Nucleic Acid Detection Kit (Roche, Indianapolis, Ind.) and was measured by density spectrophotometry. The tandem linked G genes in the recovered viruses were also confirmed by RT-PCR with 5G and 3G primers. A predominant band indicating a single G copy was observed at 1.5 kb. In addition, a second weaker band was observed at approximately 3.0 kb indicative of the two Gs in a tandem arrangement.

These results demonstrate that introduction of transcription units into the ERA genome can be used to express diverse heterologous proteins from introduced ORFs. Furthermore, expression of the protein encoded by the heterologous ORF is modulated by the position into which the ORF is inserted. Thus, ERA virus is a widely adaptable vector for the expression of recombinant proteins.

Example 6 Construction and Characterization of Recombinant Rabies Virus with Three Glycoprotein Genes

This example describes the generation and characterization of a recombinant ERA strain rabies virus encoding three different glycoprotein genes. The recombinant virus, referred to as ERA-3G, comprises rabies virus glycoprotein, Mokola virus (MOKV) glycoprotein and West Caucasian bat virus (WCBV) glycoprotein. The cloning strategy for ERA-3G is shown in FIG. 4. The rabies virus reverse genetics system used to generate this virus in described in the Examples above. ERA-3G includes the attenuating mutation in the glycoprotein gene that results in an arginine to glutamic acid change at amino acid residue 433 of the protein (SEQ ID NO: 5).

The G genes from MOKV and WCBV were cloned into the ERA backbone by RT-PCR using viral genomic RNA as template from virus-infected cells. The following primers were used for amplification of the glycoprotein genes:

MokolaG5 - (SEQ ID NO: 43) CGACTGCAGATGAATATACCTTGCTTTGTTGTGATTC MokolaG3 - (SEQ ID NO: 44) CGTGGTACCTCATGTACCTGGAAGCCCTTTATAGGACTC WCBVG5 - (SEQ ID NO: 45) CATCTGCTAGCAATGGCTTCCTACTTTGCGTTG WCBVG3 - (SEQ ID NO: 46) TTCAATGGTACCTTATTGGGCAGTTTGTCCCTT

The amplified G genes for MOKV (SEQ ID NO: 47) and WCBV (SEQ ID NO: 49) were confirmed by sequencing. Two extra transcription units were synthesized (each with the sequence of SEQ ID NO: 42) and introduced into the gene junctions between the phosphoprotein (P) and the matrix protein (M), and the G and the RNA dependent RNA polymerase (L) (FIG. 4). The MOKV G was cloned into the gene junction between the P and M, and WCBV G into the gene junction between the G and L in the ERA genome backbone.

Recombinant virus was recovered by transfection of the above described construct into BSR cells using the method described in Example 3. Approximately 5-7 days following transfection, BSR cells were fixed for DFA staining using FITC-conjugated anti-rabies antibodies.

The recovered ERA-3G virus was characterized with a one-step growth curve in BSR cells. Virus titer was evaluated at 24, 48, 72, 96 and 120 hours after infection. At the 72, 96 and 120 hour time points, virus titer in bioreactor incubation ranged from 108 to 109 focus forming unit (ffu)/ml.

ERA-3G virus was then tested in a hamster model to determine whether vaccination with ERA-3G provides protection against challenge with RABV, LBV, MOKV and/or WCBV. Nine hamsters were vaccinated (i.m.) with either ERA-3G, RabAvert™ (Chiron Corporation, Emeryville, Calif.), or IMRAB™ (Merial, Duluth, Ga.). RabAvert™ was administered on days 0, 7 and 14, while ERA-3G and IMRAB™ were administered on day 0. Animals were challenged with RABV, LBV, MOK or WCBV on day 22. Control animals received no vaccine. The results of the challenge experiment are shown in Table 2.

TABLE 2 Survivorship of hamsters after pre-exposure vaccination and i.m. challenge with several lyssaviruses Group RABV (I-151) LBV (SA) MOK (SA) WCBV RabAvert ™ 9/9 0/9 0/9 5/9 IMRAB ™ 9/9 1/9 0/9 3/9 ERA-3G 9/9 1/9 9/9 9/9 Control 0/9 0/9 0/9 1/9

The results demonstrate that ERA-3G provides complete protection against RABV, MOK and WCBV. In contrast, the currently available vaccines RabAvert™ and IMRAB™, provide protection only against RABV.

For animal vaccine development, ERA-3G will be adapted to growth in chicken embryo fibroblast (CEF) and Vero cells. It is believed that ERA-3G will grow to high titers ranging from 108 to 109 ffu/ml in the BSR cells for animal vaccine development. For human vaccine development, ERA-3G will be adapted to CEF and Vero cells. It is believed that ERA-3G titers in the CEF and BSR cells after adaptation will be comparable to virus growth in BSR cells. The purity of ERA-3G will be verified, and the seed virus will be prepared for industrial production. Potential mycoplasma contamination will be tested using a standard PCR method.

Example 7 Construction and Characterization of Recombinant Rabies Virus with Four Glycoprotein Genes

This example describes the generation and characterization of a recombinant ERA strain rabies virus encoding three different glycoprotein genes. The recombinant virus, referred to as ERA-4G, comprises rabies virus glycoprotein, Lagos bat virus (LBV) glycoprotein, MOKV glycoprotein and WCBV glycoprotein. The cloning strategy for ERA-4G is shown in FIG. 5. The rabies virus reverse genetics system used to generate this virus in described in the Examples above. ERA-4G includes the attenuating mutation in the G gene that results in an arginine to glutamic acid change at amino acid residue 433 of the protein (SEQ ID NO: 5).

The G genes from LBV, MOKV and WCBV were cloned into the ERA backbone by RT-PCR using viral genomic RNA as template from virus-infected cells. The following primers were used for amplification of the glycoprotein genes:

LagosG5 - (SEQ ID NO: 51) CGACTGCAGATGAGTCAACTAAATTTGATACCCTTTTTC LagosG3 - (SEQ ID NO: 52) CCGTACGTATCAGACATTAGAGGTACCCTTATAAGATTCCCA MokolaG5 - (SEQ ID NO: 43) CGACTGCAGATGAATATACCTTGCTTTGTTGTGATTC MokolaG3 - (SEQ ID NO: 44) CGTGGTACCTCATGTACCTGGAAGCCCTTTATAGGACTC WCBVG5 - (SEQ ID NO: 45) CATCTGCTAGCAATGGCTTCCTACTTTGCGTTG WCBVG3 - (SEQ ID NO: 46) TTCAATGGTACCTTATTGGGCAGTTTGTCCCTT

The amplified G genes for LBV (SEQ ID NO: 53), MOKV (SEQ ID NO: 47) and WCBV (SEQ ID NO: 49) were confirmed by sequencing. Three extra transcription units were synthesized (each with the sequence of SEQ ID NO: 42) and introduced into the gene junctions between the N and P genes, between the P and M genes, and the G and L genes (FIG. 5). The LBV G was cloned into the gene junction between N and P, MOKV G was cloned into the gene junction between P and M, and WCBV G was cloned into the gene junction between the G and L in the ERA genome backbone.

Recombinant virus was recovered by transfection of the above described construct into BSR cells using the method described in Example 3. Approximately 5-7 days following transfection, BSR cells were fixed for DFA staining using FITC-conjugated anti-rabies antibodies.

The recovered ERA-4G virus was characterized with a one-step growth curve in BSR cells. Virus titer was determined at 24, 48, 72, 96 and 120 hours after infection. The results are shown in Table 3 below.

TABLE 3 Growth of ERA-4G in BSR cells Timepoint (h) 24 48 72 96 120 Titer (ffu/ml) 1 × 103 5 × 103 1.2 × 105 1.3 × 107 3.2 × 105

ERA-4G virus will be tested in a hamster model to determine whether vaccination with ERA-4G confers protection against challenge with lyssaviruses RABV, LBV, MOKV and WCBV. The vaccination and challenge experiment will be performed as described for ERA-3G in Example 6.

For animal vaccine development, ERA-4G will be adapted to growth in chicken embryo fibroblast (CEF) and Vero cells. It is believed that ERA-4G will grow to high titers ranging from 108 to 109 ffu/ml in the BSR cells for animal vaccine development. For human vaccine development, ERA-4G will be adapted to CEF and Vero cells. It is believed that ERA-4G titers in the CEF and BSR cells after adaptation will be comparable to virus growth in BSR cells. The purity of ERA-4G will be verified, and the seed virus will be prepared for industrial production. Potential mycoplasma contamination will be tested using a standard PCR method.

In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

1. A recombinant rabies virus, the genome of which comprises rabies virus nucleoprotein (N), phosphoprotein (P), matrix protein (M), RNA-dependent RNA polymerase (L) and glycoprotein (G) genes and at least two different heterologous lyssavirus G genes, wherein the lyssavirus is selected from the group consisting of Lagos bat virus (LBV), Mokola virus (MOKV), Duvenhage virus (DUVV), European bat lyssavirus-1 (EBLV-1), European bat lyssavirus-2 (EBLV-2), Australian bat lyssavirus (ABLV), Aravan virus (ARAV), Khujand virus (KHUV), Irkut virus (IRKV) and West Caucasian bat virus (WCBV).

2. The recombinant rabies virus of claim 1, comprising two different heterologous lyssavirus G genes and the two heterologous G genes are MOKV and WCBV G genes.

3. The recombinant rabies virus of claim 2, wherein the nucleotide sequence of the MOKV G gene is at least 95% identical to the nucleotide sequence of SEQ ID NO: 47, the nucleotide sequence of the WCBV G gene is at least 95% identical to the nucleotide sequence of SEQ ID NO: 49, or both.

4. The recombinant rabies virus of claim 2, wherein the MOKV G gene comprises the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene comprises the nucleotide sequence of SEQ ID NO: 49, or both.

5. The recombinant rabies virus of claim 2, wherein the two heterologous G genes are located between the rabies virus P and M genes and between the rabies virus G and L genes.

6. The recombinant rabies virus of claim 1, wherein the genome is derived from the rabies virus ERA strain.

7. The recombinant rabies virus of claim 1, wherein the rabies virus glycoprotein comprises a Glu at amino acid position 333 (SEQ ID NO: 5).

8. A vector comprising a full-length rabies virus antigenomic DNA, wherein the antigenomic DNA comprises rabies virus N, P, M, L and G genes, and at least two different heterologous lyssavirus G genes, wherein the lyssavirus is selected from LBV, MOKV, DUVV, EBLV-1, EBLV-2, ABLV, ARAV, KHUV, IRKV and WCBV.

9. The vector of claim 8, comprising two different heterologous lyssavirus G genes and the two heterologous G genes are MOKV and WCBV G genes.

10. The vector of claim 9, wherein the nucleotide sequence of the MOKV G gene is at least 95% identical to the nucleotide sequence of SEQ ID NO: 47, the nucleotide sequence of the WCBV G gene is at least 95% identical to the nucleotide sequence of SEQ ID NO: 49, or both.

11. The vector of claim 9, wherein the MOKV G gene comprises the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene comprises the nucleotide sequence of SEQ ID NO: 49, or both.

12. The vector of claim 9, wherein the two heterologous G genes are located between the rabies virus P and M genes and between the rabies virus G and L genes.

13. The vector of claim 8, wherein the antigenomic DNA is derived from the rabies virus ERA strain.

14. A cell comprising the vector of claim 8.

15. A composition comprising the recombinant rabies virus of claim 1 and a pharmaceutically acceptable carrier.

16. A method of eliciting an immune response in a subject against lyssavirus, comprising administering to the subject the recombinant rabies virus of claim 1.

17. The method of claim 16, wherein the immune response in the subject against lyssavirus protects the subject against infection by at least three different genotypes of lyssavirus.

Patent History
Publication number: 20160114026
Type: Application
Filed: Dec 22, 2015
Publication Date: Apr 28, 2016
Applicant: The United States of America, as represented by the Secretary, Department of Health and Human Serv (Bethesda, MD)
Inventors: Xianfu Wu (Atlanta, GA), Charles E. Rupprecht (Lawrenceville, GA), Ivan V. Kuzmin (Galveston, TX)
Application Number: 14/978,135
Classifications
International Classification: A61K 39/205 (20060101); C07K 14/005 (20060101); C12N 7/00 (20060101);