GENE FOR CONTROLLING ERECTNESS GROWTH OF RICE LEAF BLADES AND APPLICATION THEREOF
A gene for controlling the building of architecture of gramineous crops and application thereof. The gene CYC U4;1 (Os10g41430) has a specific expression in a rice pulvinus (which is believed to have a specific expression in other gramineous crops), with a CDS sequence as shown in SEQ ID NO: 2, and an encoded amino acid sequence as shown in SEQ ID NO: 3. Also a promoter sequence of the gene, with the sequence as shown in SEQ ID NO: 1. Transgenic lines obtained by cloning a promoter and full-length CDS of CYC U4;1 to pCAMBIA1301 and transferring this into rice Nipponbare are all characterized by having smaller leaf-stem angles than those of wild rice, accordingly, the expression level of the gene CYC U4;1 can be increased or decreased with genetic engineering technology to control the plant architecture development, thereby improving the plant architecture and increasing the density of germplasm.
Latest Patents:
The subject application is a continuation of PCT/CN2016/080098 filed on Apr. 23, 2016 and claims priority on Chinese application no. 201510219253.2 filed on Apr. 29, 2015. The contents and subject matter of the PCT and Chinese priority application are incorporated herein by reference.
TECHNICAL FIELDThe present invention relates to plant genetic engineering, particularly, a gene and a vector containing the gene or a homologous gene thereof and the application for regulating leaf erectness of plants in agricultural production.
BACKGROUND OF INVENTIONThe architecture of crops is a key characteristic for high-yield breeding. Leaf erectness (or the leaf-stem angle) is one of the important characteristics for plant architecture development. The field planting density of crops may be increased with a proper leaf-stem angle to further promote the utilization ratio of light energy and increase the yield of crops. The leaf pulvinus plays a key role in leaf erectness, and its development directly affects the leaf erectness. Therefore, finding and utilizing the key gene affecting the leaf erectness (or the leaf-stem angle) is the key to improve the rice architecture for promoting the breeding via molecular design and increasing the rice yield per unit area.
The leaf pulvinus of monocotyledonous plants is an intermediate hub connecting the leaf blade and leaf sheath and serves as a basic structure for forming the leaf-stem angle. As a mechanical mechanism, the leaf pulvinus promotes the leaf blade to bend towards an abaxial direction when the leaf blade and the leaf sheath undergo complete elongation, therefore, the development of leaf pulvinus closely relates to the leaf erectness. Both brassinosteroids (BR) synthesis and signaling pathways play an important and unique role in regulating the leaf erectness in monocotyledons, however, the underlying cytology and molecular mechanisms are unknown. It is reported that mutants in BR synthesis pathway, d2, dwarf4, d11, and brd2, are all characterized by erect leaves. A positive-regulator-deficient mutant in the BR signaling pathway is also characterized by a small leaf-stem angle and erecting leaf, such as receptor mutants d61, dlt, d1, and tud1. The transgenic plants of OsBAK1 and OsGSK2, which are obtained by homologous cloning, exhibit changes in the leaf-stem angle. The leaf erectness may also be promoted by suppressing the gene expression of the positive regulator OsBZR1 at the downstream of the rice BR signaling pathway via RNAi technology. Moreover, a gain-of-function mutant lic-1, a negative regulator of the BR signaling pathway, is also characterized by a small leaf-stem angle and erecting leaf. A gain-of-function mutant ili1-D is characterized by a large leaf-stem angle due to the amplification of a BR signal. In addition, a target gene OsIBH1 of OsBZR1 is directly involved in the leaf erectness regulation in rice; and the external application of BR enlarged leaf angles of wild type and BR-synthesis mutants, and the BR signaling mutant, such as a receptor mutant d61, is almost unaffected.
In addition to the brassinosteroids pathways, other signaling pathways are also involved in the regulation of the leaf-stem angle. Although the genes of the BR-related pathways play a significant role in regulating the rice leaf angles, other independent pathways are also involved in the regulation of such biological characters. When decreasing the expression level of SPINDLY (SPY), a negative regulated gibberellin signal, the leaf-stem angle can be increased. However, the leaf-stem angle of the rice may be increased due to the over-expression of a family member OsIAA1, a negative regulator in auxin signaling pathway. LC1, encoding a gene for regulating the auxin homeostasis, determines the rice leaf-stem angle by regulating the cell elongation in the leaf pulvinus. Rice leaf inclination2 (LC2), a VIN3-analogous protein, may also enlarge the leaf-stem angle after mutation. A gene ILA1, a member in Group C of a MAPKKK family, has a high expression in a vascular bundle of the leaf pulvinus, and the insertional mutation of ILA1 thereof leads to the decrease of the contents of major components including fibrin and xylan in the cell wall of the leaf pulvinus, resulting in the reduction of the mechanical strength of the leaf pulvinus and the increase of the leaf angle. A mutant of LPA1, a Loose Plant Architecture1 in the rice, is characterized as a loose architecture with both the tiller angle and leaf-stem angle increased.
Leaf erectness has been demonstrated to be closely related with the crop yields. There is a broad application prospect in the crop yields by using the gene in the BR-related pathway as a target gene for improving the rice architecture. For example, the expression of endogenous OsBRI1 of the rice is partially suppressed by introducing an intracellular region (OsACTIN::OsBRI1-KD) of OsBRI1 as driven by a rice actin promoter with a co-suppression strategy, thereby an erect leaf transgenic line is isolated from the offspring; and the yield is estimated to increase by about 35% and 26% through close planting. Through field experiments, it has been demonstrated that the yield may be increased by up to 32% by the reasonable close planting of the mutant based on a BR synthesis pathway OsDWARF4 of the rice. 244 RIL groups from Zhenshan 97B and Miyan 46 are genetically analyzed in terms of the flag leaf angle and the main ear output. Five QTLs for controlling the flag leaf angle have been detected in total on chromosomes 1, 3, 5 and 11, where the QTL for controlling the flag leaf angle (FLA) and seed setting percentage (SF) have been detected simultaneously at an interval RM24-RM294A of the chromosome 1, with opposite additive effect directions. It demonstrates that the flag leaf angle is in negative correlation with the yield, and it is favorable to increase the seed settling percentage by properly reducing the flag leaf angle of the rice, and to finally increase the yield.
SUMMARY OF THE INVENTIONThe present invention provides a gene for controlling rice leaf erectness development, in which with a reverse genetics method, a gene, specifically expressing in a leaf pulvinus, is screened through the specific gene expression chip analysis of a rice leaf and pulvinus, and the promoter of CYC U4;1 is proved to have a specific expression in the sclerenchyma cell of leaf pulvinus by utilizing a pCYCU4-GUS transgenic line and in situ hybridization; and by transgenically increasing the expression level of CYC U4;1 and decreasing the expression level of CYC U4;1 with RNAi technology, the gene CYC U4;1 is proved to be capable of controlling the rice leaf erectness development. The present invention provides a vector containing the gene or a homologous gene thereof and an application involving regulating the leaf erectness of plants by utilizing the gene or a functional analog thereof in agricultural production.
One object of the present invention is to provide a gene CYC U4;1 for controlling the leaf erectness in rice. The gene is identified from a specific expression chip of a rice leaf pulvinus and is isolated and cloned. The promoter region of CYC U4;1 as shown in SEQ ID NO: 1, the CDS nucleotide sequence of CYC U4;1 as shown in SEQ ID NO: 2 and the amino acid sequence of CYC U4;1 as shown in SEQ ID NO: 3.
Another object of the present invention is to provide an application of the gene CYC U4;1 to controlling of the rice leaf erectness. A leaf-stem angle may be reduced by over-expression of the CYC U4;1 driven by the native promoter (with the sequence as shown in SEQ ID NO: 1) of the gene CYC U4;1, thereby improving the architecture of rice varieties and increasing the plant density per unit area.
To achieve the objects as described above, a technical solution employed by the present invention is as follows.
Using a gene specific expression chip assay in rice leaf blades and pulvini the inventor created, a gene CYC U4;1 with a specific expression at the leaf pulvinus is selected from differentially expressed genes of the chip with a reverse genetics method, and the specific expression of CYC U4;1 at the leaf pulvinus is verified with real-time qRT-PCR. A gene CYC U4;1 for controlling erectness development of rice leaves is obtained with the following method.
The total volume of a reaction system is 50 μl, with a template including Nipponbare cDNA 1 ul (about 50 ng), 10×KOD enzyme reaction buffer (5 μl), 25 mM MgCL2 (2 μl), 5 mM dNTP (5 μl), 5 uM primers (5 μl) (with a stepwise PCR means, primers CYCU4-U having SEQ ID NO: 4 and CYCU4-L-1 having SEQ ID NO: 5 are used the first time, and primers CYCU4-U having SEQ ID NO: 4 and CYCU4-L-2 having SEQ ID NO: 6 are used the second time, with each primer at 2.5 μl), KOD enzyme (1 μl), and the balance of ddH2O (sterile deionized water) which is added till the total volume of 50 μl.
A reaction procedure is as follows: denaturing at 94° C. for 5 min, 94° C. for 30 sec, 55° C. for 1 min and 68° C. for 2 min for 35 cycles in total, and elongating at 68° C. for 10 min. The primers are described as follows:
A gene sequence containing the nucleotide as described in SEQ ID NO: 2 is finally obtained, and a protein sequence encoded by the gene is as shown in SEQ ID NO: 3.
The present invention also provides the promoter region (with the sequence as shown in SEQ ID NO: 1) of the gene CYC U4;1, a nucleotide sequence (with the sequence as shown in SEQ ID NO: 2) corresponding to an amino acid sequence as shown in SEQ ID NO: 3, as well as a protein having the same function, which is obtained by modifying the sequence as shown in SEQ ID NO: 3.
An application of the gene CYC U4;1 to controlling the erectness of the rice leaves comprises cloning a promoter and full-length CDS of CYC U4;1 to pCAMBIA1301 and transferring it into the Nipponbare, and transgenic lines obtained are characterized by having a smaller leaf-stem angle than those of wild rice (Nipponbare), therefore, the leaf-stem angle may be reduced with this method to increase the planting density.
Compared with the prior art, the present invention has the following advantages:
1. CYC U4;1 is a gene having a specific expression only in the leaf pulvinus of rice in a seedling stage, which makes it possible to only change the leaf-stem angle of the crops by using the gene without affecting other characters.
2. As an effective gene for changing the leaf-stem angle, CYC U4;1 may directly affect the specific cell division at the leaf pulvinus to further change the leaf-stem angle of the crops;
3. At present, the molecular mechanism of the leaf erectness regulated by brassinosteroids to further increase the yield of crops is still not clear, and the gene uncovered the cellular and molecular mechanism that brassinosteroids regulated the erectness of the leaves.
The present invention is further illustrated in the following embodiments.
Embodiment 1A gene CYC U4;1 for controlling erectness development of rice leaves is obtained by using a gene specific expression chip in leaf blades and pulvini created by the inventors, and a gene CYC U4;1 with a specific expression at the leaf pulvinus is selected from differentially expressed genes of the chip with a reverse genetics method, and the specific expression of CYC U4;1 at the leaf pulvinus is verified with real-time qRT-PCR.
The details are as follows. A gene CYC U4;1 for controlling erectness development of rice leaves is obtained with the following method. The total volume of a reaction system is 50 μl, with a template including Nipponbare CDNA 1 ul (about 50 ng), 10×KOD enzyme reaction buffer (5 μl), 25 mM MgCL2 (2 μl), 5 mM dNTP (5 μl), 5 uM primers (5 μl) (with a stepwise PCR means, primers CYCU4-U having SEQ ID NO: 4 and CYCU4-L-1 having SEQ ID NO: 5 are used the first time, and primers CYCU4-U having SEQ ID NO: 4 and CYCU4-L-2 having SEQ ID NO: 6 are used the second time, with each primer at 2.5 μl), KOD enzyme (1 μl) and the balance of ddH2O (sterile deionized water) which is added to the total volume of 50 μl.
The reaction procedure is as follows: denaturing at 94° C. for 5 min, 94° C. for 30 sec, 55° C. for 1 min and 68° C. for 2 min for 35 cycles in total, and elongating at 68° C. for 10 min.
The primers used are as follows:
A sequence of the gene CYC U4;1 containing the nucleotide as described in SEQ ID NO: 2 is finally obtained, and an amino acid sequence encoded with the gene is as shown in SEQ ID NO: 3.
Real time qRT-PCT is used to verify the specific expression of CYC U4;1 in a rice pulvinus as follows:
A leaf blade and a leaf pulvinus are taken from the rice seedling of Nipponbare growing for one week, the total RNA is extracted with a TiangenRNApre Plant Kit (Tiangen), then a first-chain cDNA is synthesized with a Takara PrimeScript First-strand cDNA synthesis kit (TaKaRa), and the relative expression level of CYCY U4;1 in the leaf blade and leaf pulvinus is detected by the real-time quantitative PCR. The primers for the real-time quantitative PCR are as follows: CYCU4;1: R—TGAGGTGGACTTCCTCTTTG (SEQ ID NO: 7); F—CCAGGTAGGTCATCTCGCTC (SEQ ID NO: 8). It is found that the gene CYC U4;1 has a specific expression at the leaf pulvinus as shown in
The application of the gene CYC U4;1 to controlling of the erectness of the rice leaves is performed in a process as follows:
1) Building of Plant Expression Vector pCYCU4;1-GUS
A promoter region of CYC U4;1 is amplified, and a fragment is cloned to a pCAMBIA1300GN GUS vector (Ren Z H, Gao J P, Li L G, et al. A rice level quantitative trait locus for salt tolerance encodes a sodium transporter [J]. Nature genetics, 2005, 37(10): 1141-1146) by using a HindIII/BamH1 enzyme digestion site.
The promoter region of CYC U4;1 is obtained by means of the following.
The total volume of a reaction system is 50 μl, with a template including a Nipponbare genome DNA 1 ul (about 50 ng), 1×KOD enzyme reaction buffer (5 μl), 25 mM MgCL2 (2 μl), 5 mM dNTP (5 μl), 5 uM primers (5 μl) (primers pCYCU4-U having SEQ ID NO: 9 and pCYCU4-L having SEQ ID NO: 10, each of 2.5 μl), KOD enzyme (1 μl) and the balance of ddH2O (sterile deionized water) which is added to the total volume of 50 μl. The reaction procedure is as follows: denaturing at 94° C. for 5 min, 94° C. for 30 sec, 55° C. for 1 min and 68° C. for 2 min for 35 cycles in total, and elongating at 68° C. for 10 min.
The primers used are as follows:
The promoter region of the gene CYC U4;1 as shown in SEQ ID NO: 1 is finally obtained.
2) Building of Plant Expression Vector pCYCU4::CYC U4;1
The promoter region of CYC U4;1 is amplified with a stepwise method (a method for amplifying the promoter region is the same as Step 1)), a fragment is cloned to pCAMBIA1301 by using a HindIII/BamH1 enzyme digestion site to obtain pCAMBIA1301-pCYCU4;1, then a full-length cDNA (as shown in SEQ ID NO: 2) of CYC U4;1 connected with a FLAG label is cloned to pCAMBIA1301-pCYCU4;1 by using Sac1/Xba1 to obtain a plant expression vector pCYCU4::CYC U4;1, which is transferred into the Nipponbare.
3) Building of Plant Expression Vector RNAi-CYC U4;1
CYC U4;1 (345-639 bp) is cloned to an RNAi vector pTCK303 by using Kpn1/BamH1 and Sac1/Spe1 enzyme digestion sites and then transferred into the Nipponbare.
4) Genetic Transformation of Rice
In Steps 1) to 3), the transformation of the rice is performed with a genic transformation method mediated with agrobacterium EHA105, with the details as follows:
{circle around (1)} Callus induction. Rice seeds are shelled, and clear saturated grains are soaked in 70% ethanol for 1 min at first and rinsed 1 to 2 times with sterile water; and then, the grains are soaked in an NaClO solution containing 2% active chlorine (in case of 40 ml of NaClO solution containing the active chlorine of more than 5.2%, 60 ml water is added) added with 1 to 3 drops of Tween 20, for 30 min (generally 40 min, and 1 h at the most). Shaking is performed from time to time and then sterile water is used for rinsing 4 to 5 times. The grains are poured onto a sterilized flat plate and dried with filter paper for about 1 hour. The grains are placed into an N6D solid culture medium (10 grains/25 ml/bottle), with seed embryos facing upwards or in contact with the culture medium, and cultured in darkness at 28° C. for 25 to 30 d. The N6D2 culture medium includes N6 salts and vitamins, 0.5 g/l of casein hydrolysate, 30 g/l of cane sugar, 2 mg/l of 2,4-D, and 2.5 g/l of Phytagel (Sigma), at pH5.8.
{circle around (2)} Culture of agrobacteria and co-culture of rice calluses. A sterilized spoon is used to obtain the agrobacteria by scraping, and the agrobacterium is slightly tapped to a loose state against a tube wall with a spoon back, with OD600=0.8-1.0. The pre-cultured calluses are aired on the sterile filter paper and then centralized in a vessel and transferred into an agrobacteria solution in one step, a centrifugal tube is slightly rotated to uniformly distribute the agrobacterial solution, and standing is performed for about 15 to 20 min. The agrobacteria solution is poured out, the calluses are placed on the sterile filter paper for 1.5 h to ensure that the agrobacteria solution is completely absorbed, then transferred into ½ N6D AS and cultured in darkness at 20° C. for 2-3 days, and the agrobacteria can be removed when a bacterial film appears at a place where the calluses are in contact with the culture medium. A ½ N6D AS culture medium includes N6D2, 10 g/l of glucose, and 100˜400 μmol/l of acetosyringone (added on the spot when in use), at pH5.2.
{circle around (3)} Removal of agrobacteria. The calluses subjected to co-culture are added into a 50 ml centrifugal tube and cleaned more than 3 times with sterile water until the liquid is clear. The sterile water is poured out, and the calluses are cultured with N6D+Cn (500 mg/L) (or AP500 ml/L) at 100 rpm for 15-20 min for 2 to 3 times. The calluses are placed on the sterile filter paper and dried for about 2 h as appropriate. The dried calluses are transferred into N6D-AS and cultured in darkness at 28° C. for 7 to 10 d with the addition of cephalosporin Cn (250 mg/L).
{circle around (4)} Screening of calluses. The calluses which are not contaminated by the agrobacteria are picked out, and combined with Cn250 mg/L and Hn (50 mg/L) during the first time for screening for 15 to 20 d. For the second time, the operation is the same as above except for that Cn is not added, instead hygromycin (Hn) is added, and all the calluses are transferred again completely for 15 to 20 d. For the third time, the new calluses are chosen out and screened with Hn for 15 to 20 d. It is not necessary to arrange the order as above, however, the screening time for the calluses on the Hn shall be ensured to be at least above 45 d, and it would be best to screen the newly grown calluses picked out for the third time for 20 d. An N6D screening culture medium includes N6D+Cn (250 mg/L)+Hn (50 mg/L) at PH=5.8-5.9.
{circle around (5)} Differentiation and rooting. All the calluses screened the fourth time are transferred into MS and cultured in darkness with Hn (50 mg/L) for pre-differentiation (at PH 5.9) for 12 to 15 d. Fresh well-growing calluses are chosen and transferred into MS (PH 6.0) for light culture for 15 to 20 d. Green buds can be seen growing, and the culture medium is generally changed every 15 d. The green buds growing to more than 1 cm are chosen, with surplus surrounding calluses stripped and the roots cut-off (with about 0.5 cm left), and are transferred into a test tube for rooting culture in ½ MS. An MS differentiation culture medium includes MS salts and vitamins, 2 g/l of casein hydrolyzate, 30 g/l of cane sugar, 25 g/L of sorbitol, 2 mg/l of 6-BA, 0.5 mg/l of NAA, 0.2 mg/l of Zeatin, 0.5 mg/l of KT, 3.0 g/l of Phytagel (pH 5.8), 50 mg/l of hygromycin B, and 200 mg/l of cephalosporin; and a ½ MS rooting culture medium includes ½MS salts, MS vitamins, 30 g/l of cane sugar, 1 mg/l of paclobutrazol, 0.5 mg/l of NAA, 50 mg/l of hygromycin, and 2.5 g/l of Phytagel, at pH 5.8.
5) Transplanting, Identification of Expression Level and Phenotype Analysis.
40 lines are genetically built from each of the rooting transgenic plants and transplanted in a greenhouse, and leaf blades are taken to undergo expression level identification based on real-time qRT-PCR and GUS staining analysis. RNAi-CYCU4;1: R—GTCGCCTACATCTACCTC (having SEQ ID NO: 11); F—GATAATTCATCTCCATCAAGC (having SEQ ID NO: 12).
6) Results:
(1) By transferring the obtained vector into the rice Nipponbare and with a pCYCU4;1::GUS transgenic rice report system, it is indicated that CYC U4;1 is mainly expressed in the leaf pulvinus as shown in
(2) By cloning the promoter and full-length CDS of CYC U4;1 to pCAMBIA1301 and transferring this into the Nipponbare, the transgenic lines obtained are characterized by having a smaller leaf-stem angle than those of wild rice (Nipponbare) as shown in
(3) By cloning CYC U4;1 (345-639 bp) to the RNAi vector pTCK303 to make an RNAi (RNA interference) experiment on the rice Nipponbare, it is found that the rice successfully transgenically transformed by RNAi has a larger leaf-stem angle than that of the wild rice (Nipponbare) as shown in
(4) By the phenotype and expression level analysis of the plurality of obtained independent pCYCU4::CYCU4;1 and RNAi-CYC U4;1 transgenic lines, it shows that the expression level of CYC U4;1 is related to the magnitude of the leaf-stem angle of the rice as shown in
Claims
1. A protein having SEQ ID NO: 3.
2. A gene encoding the protein as described in claim 1.
3. The gene according to claim 2, having SEQ ID NO: 2.
4. A promoter of the gene as described in claim 2, wherein the promoter has a sequence as shown in SEQ ID NO: 1.
5. A promoter of the gene as described in claim 3, wherein the promoter has a sequence as shown in SEQ ID NO: 1.
6. A method for controlling leaf erectness development of rice plants according to claim 1, comprising
- applying the protein as described in claim 1 in a rice plant.
7. A method for controlling leaf erectness development of rice plants according to claim 2, comprising
- expressing a gene as described in claim 2 in a rice plant.
8. A method for improving architecture of rice varieties and increasing planting density per unit area according to claim 1, comprising
- applying the protein as described in claim 1 in a rice plant.
9. A method for improving architecture of rice varieties and increasing planting density per unit area according to claim 2, comprising
- expressing a gene as described in claim 2 in a rice plant.
10. A method for decreasing leaf-stem angles of rice according to claim 1, comprising
- applying the protein as described in claim 1 in a rice plant.
11. A method for decreasing leaf-stem angles of rice according to claim 3, comprising
- expressing a gene as described in claim 3 in a rice plant.
12. A method for decreasing leaf-stem angles of rice according to claim 4, comprising
- applying the promoter as described in claim 4 of the gene in a rice plant.
13. A method for improving architecture of graminaceous crops according to claim 1, comprising
- applying the protein as described in claim 1 in a rice plant.
14. A method for improving architecture of graminaceous crops according to claim 3, comprising
- expressing a gene as described in claim 3 in a rice plant.
15. A method for improving architecture of graminaceous crops according to claim 4, comprising
- applying the promoter as described in claim 4 of the gene in a rice plant.
16. A gene having a nucleotide sequence that is at least 50% homology with the nucleotide sequence as shown in SEQ ID NO: 2.
17. A protein having an amino acid sequence that is at least 50% homology with the amino acid sequence as shown in SEQ ID NO: 3.
Type: Application
Filed: Oct 30, 2017
Publication Date: May 10, 2018
Applicant:
Inventors: Xuelu WANG (Wuhan), Shiyong SUN (Wuhan)
Application Number: 15/798,384
