GENETIC POLYMORPHISMS ASSOCIATED WITH STROKE, METHODS OF DETECTION AND USES THEREOF

Abstract

The present invention provides compositions and methods based on genetic polymorphisms that are associated with vascular diseases such as stroke. In particular, the present invention relates to genetic polymorphisms that have utility for such uses as predicting disease risk or predicting an individual's response to a treatment such as statins, including groups of polymorphisms that may be used as a signature marker set for such uses, as well as nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation application of U.S. non-provisional application Ser. No. 14/886,595, filed on Oct. 19, 2015, which is a continuation of U.S. non-provisional application Ser. No. 13/655,905, filed on Oct. 19, 2012, which is a continuation application of U.S. non-provisional application Ser. No. 12/389,313, filed on Feb. 19, 2009, which claims priority to U.S. provisional application Ser. No. 61/066,584, filed on Feb. 20, 2008, the contents of each of which are hereby incorporated by reference in their entirety into this application.

FIELD OF THE INVENTION

The present invention is in the field of vascular disease, particularly stroke, and drug response, particularly response to statin treatment. In particular, the present invention relates to specific single nucleotide polymorphisms (SNPs) in the human genome, and their association with vascular disease, including but not limited to cerebrovascular diseases such as stroke, and/or variability in responsiveness to statin treatment (including preventive treatment) between different individuals. The SNPs disclosed herein can be used, for example, as targets for diagnostic/prognostic reagents as well as for therapeutic agents. In particular, the SNPs of the present invention are useful for identifying an individual who is at an increased or decreased risk of having a stroke, for early detection of stroke risk, for providing clinically important information for the prevention and/or treatment of stroke, for predicting the seriousness or consequences of stroke in an individual, for determining the prognosis of an individual's recovery from stroke, for screening and selecting therapeutic agents, and for predicting a patient's response to therapeutic agents such as evaluating the likelihood of an individual responding positively to statins, particularly for the treatment or prevention of stroke. The SNPs disclosed herein are also useful for human identification applications. Methods, assays, kits, and reagents for detecting the presence of these polymorphisms and their encoded products are provided.

BACKGROUND OF THE INVENTION

Stroke and Other Vascular Diseases

Vascular diseases encompass a number of related pathologies including cerebrovascular diseases such as stroke, as well as carotid artery disease, coronary artery disease, peripheral artery disease, aortic aneurysm, and vascular dementia.

Stroke is a prevalent and serious cerebrovascular disease. It affects 4.7 million individuals in the United States, with 500,000 first attacks and 200,000 recurrent cases yearly. Approximately one in four men and one in five women aged 45 years will have a stroke if they live to their 85th year. About 25% of those who have a stroke die within a year. In fact, stroke is the third leading cause of mortality in the United States and is responsible for 170,000 deaths a year. Among those who survive a stroke attack, 30 to 50% do not regain functional independence. Stroke therefore is the most common cause of disability and the second leading cause of dementia (Heart Disease and Stroke Statistics—2004 Update, American Heart Association).

Stroke occurs when an artery bringing oxygen and nutrients to the brain either ruptures, causing hemorrhagic stroke, or gets occluded, causing ischemic stroke. Ischemic stroke can be caused by thrombi formation at the site of an atherosclerotic plaque rupture (this type of ischemic stroke is interchangeably referred to as thrombotic or atherothrombotic stroke) or by emboli (clots) that have travelled from another part of the vasculature (this type of ischemic stroke is referred to as embolic stroke), often from the heart (this type of embolic stroke may be referred to as cardioembolic stroke). In both ischemic and hemorrhagic stroke, a cascade of cellular changes due to ischemia or increased cranial pressure leads to injuries or death of the brain cells. In the United States, the majority (about 80-90%) of stroke cases are ischemic (Rathore, et al., Stroke 33:2718-2721 ((2002)), including 30% large-vessel thrombotic (also referred to as large-vessel occlusive disease), 20% small-vessel thrombotic (also referred to as small-vessel occlusive disease), and 30% embolic or cardiogenic (caused by a clot originating from elsewhere in the body, e.g., from blood pooling due to atrial fibrillation, or from carotid artery stenosis). The ischemic form of stroke results from obstruction of blood flow in cerebral blood vessels, and it shares common pathological etiology with atherosclerosis and thrombosis.

About 10-20% of stroke cases are of the hemorrhagic type (Rathore, et al., Stroke 33:2718-2721 ((2002)), involving bleeding within or around the brain. Bleeding within the brain is known as cerebral hemorrhage, which is often linked to high blood pressure. Bleeding into the meninges surrounding the brain is known as a subarachnoid hemorrhage, which could be caused by a ruptured cerebral aneurysm, an arteriovenous malformation, or a head injury. The hemorrhagic stroke, although less prevalent, poses a greater danger. Whereas about 8% of ischemic stroke cases result in death within 30 days, about 38% of hemorrhagic stroke cases result in death within the same time period (Collins, et al., J. Clin. Epidemiol. 56:81-87 (2003)).

Known risk factors for stroke can be divided into modifiable and non-modifiable risk factors. Older age, male sex, black or Hispanic ethnicity, and family history of stroke are non-modifiable risk factors. Modifiable risk factors include hypertension, smoking, increased insulin levels, asymptomatic carotid disease, cardiac vessel disease, and hyperlipidemia.

Multiple reports based on twin studies (Brass et al., Stroke. 1992; 23:221-223 and Bak et al., Stroke. 2002; 33:769-774) and family studies (Welin L, et al. N Engl J Med. 1987; 317:521-526 and Jousilahti et al., Stroke. 1997; 28:1361-136) have shown that genetics contributes to risk of stroke independently of traditional risk factors. A number of genetic markers have been reported to be associated with stroke and some examples of stroke-related markers include MTHFR, ACE, NOTCH3, IL-6, PON1, fibrinogen-beta, and lipoprotein lipase (Casas, et al., Arch. Neural., 61:1652-1661 (2004)).

The acute nature of stroke leaves physicians with little time to prevent or lessen the devastation of brain damage. Strategies to diminish the impact of stroke include prevention and treatment with thrombolytic and, possibly, neuroprotective agents. The success of preventive measures will depend on the identification of risk factors in individual patients and means to modulate their impact.

Although some risk factors for stroke are not modifiable, such as age and family history, other underlying pathology or risk factors of stroke such as atherosclerosis, hypertension, smoking, diabetes, aneurysm, and atrial fibrillation, are chronic and amenable to effective life-style changes, pharmacological, and interventional as well as surgical treatments. Early recognition of patients with informative risk factors, and especially those with a family history, using a non-invasive test of genetic markers associated with stroke will enable physicians to target the highest risk individuals for aggressive risk reduction.

Thus, there is a need for the identification of new genetic markers that are predictive of an individual's predisposition to the development of stroke and other vascular diseases. Furthermore, the discovery of genetic markers which are useful in identifying individuals who are at an increased risk of having a stroke may lead to, for example, better preventive and therapeutic strategies, economic models, and health care policy decisions.

Reduction of coronary and cerebrovascular events and total mortality by treatment with HMG-CoA reductase inhibitors (statins) has been demonstrated in a number of randomized, double blinded, placebo-controlled prospective trials (Waters, D. D., Clin Cardiol, 2001. 24(8 Suppl): p. III3-7, Singh, B. K. and J. L. Mehta, Curr Opin Cardiol, 2002. 17(5): p. 503-11). These drugs have their primary effect through the inhibition of hepatic cholesterol synthesis, thereby upregulating LDL receptors in the liver. The resultant increase in LDL catabolism results in decreased circulating LDL, a major risk factor for vascular disease.

In addition to LDL-lowering, a variety of potential non-lipid lowering effects have been suggested to play a role in cardiovascular risk reduction by statins. These include anti-inflammatory effects on various vascular cell types including foam cell macrophages, improved endothelial responses, inhibition of platelet reactivity thereby decreasing hypercoaguability, and many others (Puddu, P., G. M. Puddu, and A. Muscari, Acta Cardiol, 2001. 56(4): p. 225-31, Albert, M. A., et al., JAMA, 2001. 286(1): p. 64-70, Rosenson, R. S., Curr Cardiol Rep, 1999. 1(3): p. 225-32, Dangas, G., et al., Thromb Haemost, 2000. 83(5): p. 688-92, Crisby, M., Drugs Today (Barc), 2003. 39(2): p. 137-43, Liao, J. K., Int J Clin Pract Suppl, 2003(134): p. 51-7). However, because hypercholesterolemia is a factor in many of these additional pathophysiologic mechanisms that are reversed by statins, many of these statin benefits may be a consequence of LDL lowering.

Statins can be divided into two types according to their physicochemical and pharmacokinetic properties. Statins such as lovastatin, simvastatin, atorvastatin, and cerevastatin are hydrophobic in nature and, as such, diffuse across membranes and thus are highly cell permeable. Hydrophilic statins such as pravastatin are more polar, such that they utilize specific cell surface transporters for cellular uptake (Ziegler, K. and W. Stunkel, Biochim Biophys Acta, 1992. 1139(3): p. 203-9, Yamazaki, M., et al., Am J Physiol, 1993. 264(1 Pt 1): p. G36-44, Komai, T., et al., Biochem Pharmacol, 1992. 43(4): p. 667-70). The latter statin utilizes a transporter, OATP2, the tissue distribution of which is confined to the liver and, therefore, they are relatively hepato-specific inhibitors (Hsiang, B., et al., J Biol Chem, 1999. 274(52): p. 37161-8). The former statins, which do not utilize specific transport mechanisms, are available to all cells and they can directly impact a much broader spectrum of cells and tissues. These differences in properties may influence the spectrum of activities that each statin possesses. Pravastatin, for instance, has a low myopathic potential in animal models and myocyte cultures compared to other hydrophobic statins (Masters, B. A., et al., Toxicol Appl Pharmacol, 1995. 131(1): p. 163-74. Nakahara, K., et al., Toxicol Appl Pharmacol, 1998. 152(1): p. 99-106, Reijneveld, J. C., et al., Pediatr Res, 1996. 39(6): p. 1028-35).

Evidence from gene association studies is accumulating to indicate that responses to drugs are, indeed, at least partly under genetic control. As such, pharmacogenetics—the study of variability in drug responses attributed to hereditary factors in different populations—may significantly assist in providing answers toward meeting this challenge (Roses, A. D., Nature, 2000. 405(6788): p. 857-65, Mooser, V., et al., J Thromb Haemost, 2003. 1(7): p. 1398-1402, Humma, L. M. and S. G. Terra, Am. J. Health Syst Pharm, 2002. 59(13): p. 1241-52). Numerous associations have been reported between selected genotypes, as defined by SNPs and other sequence variations, and specific responses to cardiovascular drugs. Polymorphisms in several genes have been suggested to influence responses to statins including CETP (Kuivenhoven, J. A., et al., N Engl J Med, 1998. 338(2): p. 86-93), beta-fibrinogen (de Maat, M. P., et al., Arterioscler Thromb Vasc Biol, 1998. 18(2): p. 265-71), hepatic lipase (Zambon, A., et al., Circulation, 2001. 103(6): p. 792-8), lipoprotein lipase (Jukema, J. W., et al., Circulation, 1996. 94(8): p. 1913-8), glycoprotein IIIc (Bray, P. F., et al., Am J Cardiol, 2001. 88(4): p. 347-52), stromelysin-1 (de Maat, M. P., et al., Am J Cardiol, 1999. 83(6): p. 852-6), and apolipoprotein E (Gerdes, L. U., et al., Circulation, 2000. 101(12): p. 1366-71, Pedro-Botet, J., et al., Atherosclerosis, 2001. 158(1): p. 183-93). Some of these variants were shown to effect clinical events while others were associated with changes in surrogate endpoints.

Thus, there is also a need to identify genetic markers for stratifying stroke patients based on their likelihood of responding to drug therapy, particularly statin treatment.

SNPs

The genomes of all organisms undergo spontaneous mutation in the course of their continuing evolution, generating variant forms of progenitor genetic sequences (Gusella, Ann. Rev. Biochem. 55, 831-854 (1986)). A variant form may confer an evolutionary advantage or disadvantage relative to a progenitor form or may be neutral. In some instances, a variant form confers an evolutionary advantage to the species and is eventually incorporated into the DNA of many or most members of the species and effectively becomes the progenitor form. Additionally, the effects of a variant form may be both beneficial and detrimental, depending on the circumstances. For example, a heterozygous sickle cell mutation confers resistance to malaria, but a homozygous sickle cell mutation is usually lethal. In many cases, both progenitor and variant forms survive and co-exist in a species population. The coexistence of multiple forms of a genetic sequence gives rise to genetic polymorphisms, including SNPs.

Approximately 90% of all polymorphisms in the human genome are SNPs. SNPs are single base positions in DNA at which different alleles, or alternative nucleotides, exist in a population. The SNP position (interchangeably referred to herein as SNP, SNP site, SNP locus, SNP marker, or marker) is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of the populations). An individual may be homozygous or heterozygous for an allele at each SNP position. A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP is an amino acid coding sequence.

A SNP may arise from a substitution of one nucleotide for another at the polymorphic site. Substitutions can be transitions or transversions. A transition is the replacement of one purine nucleotide by another purine nucleotide, or one pyrimidine by another pyrimidine. A transversion is the replacement of a purine by a pyrimidine, or vice versa. A SNP may also be a single base insertion or deletion variant referred to as an “indel” (Weber et al., “Human diallelic insertion/deletion polymorphisms”, Am J Hum Genet 2002 October; 71(4):855-82).

A synonymous codon change, or silent mutation/SNP (terms such as “SNP”, “polymorphism”, “mutation”, “mutant”, “variation”, and “variant” are used herein interchangeably), is one that does not result in a change of amino acid due to the degeneracy of the genetic code. A substitution that changes a codon coding for one amino acid to a codon coding for a different amino acid (i.e., a non-synonymous codon change) is referred to as a missense mutation. A nonsense mutation results in a type of non-synonymous codon change in which a stop codon is formed, thereby leading to premature termination of a polypeptide chain and a truncated protein. A read-through mutation is another type of non-synonymous codon change that causes the destruction of a stop codon, thereby resulting in an extended polypeptide product. While SNPs can be bi-, tri-, or tetra-allelic, the vast majority of the SNPs are bi-allelic, and are thus often referred to as “bi-allelic markers”, or “di-allelic markers”.

As used herein, references to SNPs and SNP genotypes include individual SNPs and/or haplotypes, which are groups of SNPs that are generally inherited together. Haplotypes can have stronger correlations with diseases or other phenotypic effects compared with individual SNPs, and therefore may provide increased diagnostic accuracy in some cases (Stephens et al. Science 293, 489-493, 20 Jul. 2001). As used herein, the term “haplotype” refers to a set of two or more alleles on a single chromosome. The term “diplotype” refers to a combination of two haplotypes that a diploid individual carries. The term “double diplotype”, also called “two-locus diplotype”, refers to a combination of diplotypes at two distinct loci for an individual.

Causative SNPs are those SNPs that produce alterations in gene expression or in the expression, structure, and/or function of a gene product, and therefore are most predictive of a possible clinical phenotype. One such class includes SNPs falling within regions of genes encoding a polypeptide product, i.e. cSNPs. These SNPs may result in an alteration of the amino acid sequence of the polypeptide product (i.e., non-synonymous codon changes) and give rise to the expression of a defective or other variant protein. Furthermore, in the case of nonsense mutations, a SNP may lead to premature termination of a polypeptide product. Such variant products can result in a pathological condition, e.g., genetic disease. Examples of genes in which a SNP within a coding sequence causes a genetic disease include sickle cell anemia and cystic fibrosis.

Causative SNPs do not necessarily have to occur in coding regions; causative SNPs can occur in, for example, any genetic region that can ultimately affect the expression, structure, and/or activity of the protein encoded by a nucleic acid. Such genetic regions include, for example, those involved in transcription, such as SNPs in transcription factor binding domains, SNPs in promoter regions, in areas involved in transcript processing, such as SNPs at intron-exon boundaries that may cause defective splicing, or SNPs in mRNA processing signal sequences such as polyadenylation signal regions. Some SNPs that are not causative SNPs nevertheless are in close association with, and therefore segregate with, a disease-causing sequence. In this situation, the presence of a SNP correlates with the presence of, or predisposition to, or an increased risk in developing the disease. These SNPs, although not causative, are nonetheless also useful for diagnostics, disease predisposition screening, and other uses.

An association study of a SNP and a specific disorder involves determining the presence or frequency of the SNP allele in biological samples from individuals with the disorder of interest, such as stroke and related pathologies and comparing the information to that of controls (i.e., individuals who do not have the disorder; controls may be also referred to as “healthy” or “normal” individuals) who are preferably of similar age and race. The appropriate selection of patients and controls is important to the success of SNP association studies. Therefore, a pool of individuals with well-characterized phenotypes is extremely desirable.

A SNP may be screened in diseased tissue samples or any biological sample obtained from a diseased individual, and compared to control samples, and selected for its increased (or decreased) occurrence in a specific pathological condition, such as stroke. Once a statistically significant association is established between one or more SNP(s) and a pathological condition (or other phenotype) of interest, then the region around the SNP can optionally be thoroughly screened to identify the causative genetic locus/sequence(s) (e.g., causative SNP/mutation, gene, regulatory region, etc.) that influences the pathological condition or phenotype. Association studies may be conducted within the general population and are not limited to studies performed on related individuals in affected families (linkage studies).

Clinical trials have shown that patient response to treatment with pharmaceuticals is often heterogeneous. There is a continuing need to improve pharmaceutical agent design and therapy. In that regard, SNPs can be used to identify patients most suited to therapy with particular pharmaceutical agents (this is often termed “pharmacogenomics”). Similarly, SNPs can be used to exclude patients from certain treatment due to the patient's increased likelihood of developing toxic side effects or their likelihood of not responding to the treatment. Pharmacogenomics can also be used in pharmaceutical research to assist the drug development and selection process. (Linder et al. (1997), Clinical Chemistry, 43, 254; Marshall (1997), Nature Biotechnology, 15, 1249; International Patent Application WO 97/40462, Spectra Biomedical; and Schafer et al. (1998), Nature Biotechnology, 16: 3).

SUMMARY OF THE INVENTION

The present invention relates to the identification of SNPs, unique combinations of SNPs, and haplotypes or diplotypes of SNPs, that are associated with stroke (e.g., an increased or decreased risk of having a stroke), and/or with drug response, particularly response to statin treatment (including preventive treatment) such as for the treatment or prevention of stroke. The polymorphisms disclosed herein are directly useful as targets for the design of diagnostic and prognostic reagents and the development of therapeutic and preventive agents, such as for use in determining an individual's predisposition to having a stroke, and for treatment or prevention of stroke and related pathologies such as other vascular diseases, as well as for predicting a patient's response to therapeutic agents such as statins, particularly for the treatment or prevention of stroke. Furthermore, the polymorphisms disclosed herein may also be used for predicting an individual's responsiveness to statins for the treatment or prevention of disorders other than stroke, such as cancer, and may also be used for predicting an individual's responsiveness to drugs other than statins that are used to treat or prevent stroke.

Based on the identification of SNPs associated with stroke, and/or response to statin treatment, the present invention also provides methods of detecting these variants as well as the design and preparation of detection reagents needed to accomplish this task. The invention specifically provides, for example, SNPs associated with stroke, and/or responsiveness to statin treatment, isolated nucleic acid molecules (including DNA and RNA molecules) containing these SNPs, variant proteins encoded by nucleic acid molecules containing such SNPs, antibodies to the encoded variant proteins, computer-based and data storage systems containing the novel SNP information, methods of detecting these SNPs in a test sample, methods of identifying individuals who have an altered (i.e., increased or decreased) risk of having a first or recurrent stroke, methods for prognosing the severity or consequences of stroke, methods of treating an individual who has an increased risk for stroke, and methods for identifying individuals (e.g., determining a particular individual's likelihood) who have an altered (i.e., increased or decreased) likelihood of responding to statin treatment (or more or less likely to experience undesirable side effects from a treatment), particularly statin treatment of stroke, based on the presence or absence of one or more particular nucleotides (alleles) at one or more SNPs disclosed herein or the detection of one or more encoded variant products (e.g., variant mRNA transcripts or variant proteins), methods of screening for compounds useful in the treatment or prevention of a disorder associated with a variant gene/protein, compounds identified by these methods, methods of treating or preventing disorders mediated by a variant gene/protein, etc. The present invention also provides methods for identifying individuals who possess SNPs that are associated with an increased risk of stroke, and yet can benefit from being treated with statin because statin treatment can lower their risk of stroke.

The exemplary utilities described herein for the stroke-associated SNPs and statin response-associated SNPs disclosed herein apply to both first (primary) and recurrent stroke. For example, the SNPs disclosed herein can be used for determining the risk for a first stroke in an individual who has never had a stroke in the past, and can also be used for determing the risk for a recurrent stroke in an individual who has previously had a stroke.

The present invention further provides methods for selecting or formulating a treatment regimen (e.g., methods for determining whether or not to administer statin treatment to an individual who has previously had a stroke, or who is at risk for having a stroke in the future, methods for selecting a particular statin-based treatment regimen such as dosage and frequency of administration of statin, or a particular form/type of statin such as a particular pharmaceutical formulation or statin compound, methods for administering an alternative, non-statin-based treatment to individuals who are predicted to be unlikely to respond positively to statin treatment, etc.), and methods for determining the likelihood of experiencing toxicity or other undesirable side effects from statin treatment, etc. The present invention also provides methods for selecting individuals to whom a statin or other therapeutic will be administered based on the individual's genotype, and methods for selecting individuals for a clinical trial of a statin or other therapeutic agent based on the genotypes of the individuals (e.g., selecting individuals to participate in the trial who are most likely to respond positively from the statin treatment and/or excluding individuals from the trial who are unlikely to respond positively from the statin treament). The present invention further provides methods for reducing an individual's risk of having a stroke by administering statin treatment, including preventing a first or recurrent stroke by administering statin treatment, when said individual carries one or more SNPs identified herein as being associated with stroke risk or stroke statin response.

In certain exemplary embodiments of the invention, the SNP is selected from the group consisting of the following (the name of the gene, or chromosome, that contains the SNP is indicated in parentheses): rs3900940/hCV7425232 (MYH15), rs3814843/hCV11476411 (CALM1), rs2200733/hCV16158671 (chromosome 4q25), and rs10757274/hCV26505812 (chromosome 9p21), and combinations of any number of these SNPs, as well as any of these SNP in combination with other genetic markers. Exemplary embodiments of the invention provide compositions (e.g., detection reagents and kits) and methods of using these SNPs for stroke-related utilities, such as for determining an individual's risk of having a stroke or whether an individual will benefit from treatment with statins or other therapies. For example, certain embodiments provide methods of using any of rs3900940/hCV7425232 (MYH15), rs3814843/hCV11476411 (CALM1), rs2200733/hCV16158671 (chromosome 4q25), and/or rs10757274/hCV26505812 (chromosome 9p21) for determining stroke risk in an individual, and methods of using rs10757274/hCV26505812 (chromosome 9p21) for determining whether an individual will benefit from statin treatment.

In Tables 1-2, the present invention provides gene information, transcript sequences (SEQ ID NOS:1-80), encoded amino acid sequences (SEQ ID NOS:81-160), genomic sequences (SEQ ID NOS:260-435), transcript-based context sequences (SEQ ID NOS:161-259) and genomic-based context sequences (SEQ ID NOS:436-1566) that contain the SNPs of the present invention, and extensive SNP information that includes observed alleles, allele frequencies, populations/ethnic groups in which alleles have been observed, information about the type of SNP and corresponding functional effect, and, for cSNPs, information about the encoded polypeptide product. The transcript sequences (SEQ ID NOS:1-80), amino acid sequences (SEQ ID NOS:81-160), genomic sequences (SEQ ID NOS:260-435), transcript-based SNP context sequences (SEQ ID NOS:161-259), and genomic-based SNP context sequences (SEQ ID NOS:436-1566) are also provided in the Sequence Listing.

In certain exemplary embodiments, the invention provide methods for identifying an individual who has an altered risk for having a first or recurrent stroke, in which the method comprises detecting a single nucleotide polymorphism (SNP) in any of the nucleotide sequences of SEQ ID NOS:1-80 and 161-1566, particularly as represented by any of the genomic context sequences of SEQ ID NOS:436-1566, in said individual's nucleic acids, wherein the SNP is specified in Table 1 and/or Table 2, and the presence of the SNP is indicative of an altered risk for stroke in said individual. In certain exemplary embodiment of the present invention, SNPs that occur naturally in the human genome are provided as isolated nucleic acid molecules. These SNPs are associated with stroke and related pathologies such as other vascular diseases. Other vascular diseases include, but are not limited to, cerebrovascular disease, carotid artery disease, coronary artery disease, peripheral artery disease, aortic aneurysm, and vascular dementia. In particular the SNPs are associated with either an increased or decreased risk of having a stroke. As such, they can have a variety of uses in the diagnosis and/or treatment of stroke and related pathologies. One aspect of the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence in which at least one nucleotide is a SNP that is propriatory to Applera, or Celera. In an alternative embodiment, a nucleic acid of the invention is an amplified polynucleotide, which is produced by amplification of a SNP-containing nucleic acid template. In another embodiment, the invention provides for a variant protein that is encoded by a nucleic acid molecule containing a SNP disclosed herein.

In yet another embodiment of the invention, a reagent for detecting a SNP in the context of its naturally-occurring flanking nucleotide sequences (which can be, e.g., either DNA or mRNA) is provided. In particular, such a reagent may be in the form of, for example, a hybridization probe or an amplification primer that is useful in the specific detection of a SNP of interest. In an alternative embodiment, a protein detection reagent is used to detect a variant protein that is encoded by a nucleic acid molecule containing a SNP disclosed herein. A preferred embodiment of a protein detection reagent is an antibody or an antigen-reactive antibody fragment.

Various embodiments of the invention also provide kits comprising SNP detection reagents, and methods for detecting the SNPs disclosed herein by employing detection reagents. In a specific embodiment, the present invention provides for a method of identifying an individual having an increased or decreased risk of having a stroke by detecting the presence or absence of one or more SNP alleles disclosed herein. Preferably, the SNP allele can be an allele of a SNP selected from the group consisting of the following (the name of the gene, or chromosome, that contains the SNP is indicated in parentheses): rs3900940/hCV7425232 (MYH15), rs3814843/hCV11476411 (CALM1), rs2200733/hCV16158671 (chromosome 4q25), and rs10757274/hCV26505812 (chromosome 9p21), and combinations of any number of these SNPs, as well as any of these SNP in combination with other genetic markers.

In another embodiment, a method for diagnosing stroke or related pathologies by detecting the presence or absence of one or more SNPs or SNP alleles disclosed herein is provided. In another embodiment, the invention provides a method of identifying an individual having an altered (either increased or decreased) risk of having a stroke by detecting the presence or absence of one or more SNPs or SNP alleles disclosed herein. Thus, an exemplary embodiment of the invention provides a method of identifying an individual who has an increased risk of having a stroke by determining which nucleotide (allele) is present at one or more SNPs disclosed herein. An alternative exemplary embodiment of the invention provides a method of identifying an individual who has a decreased risk of having a stroke by determining which nucleotide (allele) is present at one or more SNPs disclosed herein.

The nucleic acid molecules of the invention can be inserted in an expression vector, such as to produce a variant protein in a host cell. Thus, the present invention also provides for a vector comprising a SNP-containing nucleic acid molecule, genetically-engineered host cells containing the vector, and methods for expressing a recombinant variant protein using such host cells. In another specific embodiment, the host cells, SNP-containing nucleic acid molecules, and/or variant proteins can be used as targets in a method for screening and identifying therapeutic agents or pharmaceutical compounds useful in the treatment of stroke and related pathologies such as other vascular diseases.

An aspect of this invention is a method for treating or preventing a first or recurrent stroke in a human subject wherein said human subject harbors a SNP, gene, transcript, and/or encoded protein identified in Tables 1-2, which method comprises administering to said human subject a therapeutically or prophylactically effective amount of one or more agents (e.g., statins) counteracting the effects of the disease, such as by inhibiting (or stimulating) the activity of the gene, transcript, and/or encoded protein identified in Tables 1-2.

Another aspect of this invention is a method for identifying an agent useful in therapeutically or prophylactically treating stroke and related pathologies in a human subject wherein said human subject harbors a SNP, gene, transcript, and/or encoded protein identified in Tables 1-2, which method comprises contacting the gene, transcript, or encoded protein with a candidate agent (e.g., a statin) under conditions suitable to allow formation of a binding complex between the gene, transcript, or encoded protein and the candidate agent and detecting the formation of the binding complex, wherein the presence of the complex identifies said agent.

Another aspect of this invention is a method for treating stroke and related pathologies in a human subject, which method comprises:

(i) determining that said human subject harbors a SNP, gene, transcript, and/or encoded protein identified in Tables 1-2, and

(ii) administering to said subject a therapeutically or prophylactically effective amount of one or more agents (e.g., statins) counteracting the effects of the disease.

Yet another aspect of this invention is a method for evaluating the suitability of a patient for stroke treatment comprising determining the genotype of said patient with respect to a particular set of SNP markers, said SNP markers comprising a plurality of individual SNPs (e.g., about 2-7 SNPs) in Tables 1-2, and calculating a score using an appropriate algorithm based on the genotype of said patient, the resulting score being indicative of the suitability of said patient undergoing stroke treatment.

Another aspect of the invention is a method of treating a stroke patient comprising administering an appropriate drug in a therapeutically effective amount to said stroke patient whose genotype has been shown to contain a plurality of SNPs as described in Table 1 or Table 2.

Another aspect of the invention is a method for identifying a human who is likely to benefit from statin treatment (as used herein, “treatment” includes preventive as well as therapeutic treatment), in which the method comprises detecting the presence of a statin response-associated SNP (e.g., an allele associated with increased statin benefit) disclosed herein in said human's nucleic acids, wherein the presence of the SNP indicates that said human is likely to benefit from statin treatment.

Another aspect of the invention is a method for identifying a human who is likely to benefit from statin treatment, in which the method comprises detecting the presence of a SNP that is in LD with a statin response-associated SNP disclosed herein in said human's nucleic acids, wherein the presence of the SNP indicates that said human is likely to benefit from statin treatment.

Exemplary embodiments of the invention include methods of using a statin response-associated SNP disclosed herein for determining whether an individual will benefit from statin treatment (e.g., determining whether an individual should be administered statin to reduce their likelihood of having a stroke). The statin response-associated SNPs disclosed here can be used for predicting response to any statin (HMG-CoA reductase inhibitors), including but not limited to, pravastatin (Pravachol®), atorvastatin (Lipitor®), storvastatin, rosuvastatin (Crestor®), fluvastatin (Lescol®), lovastatin (Mevacor®), and simvastatin (Zocor®), as well as combination therapies that include a statin such as simvastatin+ezetimibe (Vytorin®), lovastatin+niacin extended-release (Advicor®), and atorvastatin+amlodipine besylate (Caduet®).

In certain exemplary embodiments of the invention, methods are directed to the determination of which patients would have greater protection against stroke when they are given an intensive statin treatment as compared to a standard statin treatment. In certain embodiments, the statin can comprise a statin selected from the group consisting of atorvastatin, pravastatin, and storvastatin. In certain embodiments, intensive statin treatment comprises administering higher doses of a statin and/or increasing the frequency of statin administration as compared with standard statin treatment. In certain further embodiments, intensive statin treatment can utilize a different type of statin than standard statin treatment; for example, atorvastatin can be used for intensive statin treatment and pravastatin can be used for standard statin treatment.

Many other uses and advantages of the present invention will be apparent to those skilled in the art upon review of the detailed description of the preferred embodiments herein. Solely for clarity of discussion, the invention is described in the sections below by way of non-limiting examples.

Description of the File Contained on the CD-R Named CD000022ORD-CDR

The CD-R named CD000022ORD-CDR contains the following text (ASCII) file:

1) File SEQLIST_CD000022ORD.txt provides the Sequence Listing. The Sequence Listing provides the transcript sequences (SEQ ID NOS:1-80) and protein sequences (SEQ ID NOS:81-160) as shown in Table 1, and genomic sequences (SEQ ID NOS:260-435) as shown in Table 2, for each stroke-associated gene that contains one or more SNPs of the present invention. Also provided in the Sequence Listing are context sequences flanking each SNP, including both transcript-based context sequences as shown in Table 1 (SEQ ID NOS:161-259) and genomic-based context sequences as shown in Table 2 (SEQ ID NOS:436-1566). The context sequences generally provide 100 bp upstream (5′) and 100 bp downstream (3′) of each SNP, with the SNP in the middle of the context sequence, for a total of 200 bp of context sequence surrounding each SNP.

File SEQLIST_CD000022ORD.txt is 21,295 KB in size, and was created on Feb. 18, 2009. A computer readable format of the sequence listing is also submitted herein on a separate CDR labeled CRF. The information recorded in the CRF CDR is identical to the sequence listing as provided on the CDR Duplicate Copy 1 and Duplicate Copy 2.

The material contained on the CD-R labeled CRF is hereby incorporated by reference pursuant to 37 CFR 1.77(b)(4).

Description of Table 1 and Table 2

Table 1 and Table 2 disclose the SNP and associated gene/transcript/protein information of the present invention. For each gene, Table 1 and Table 2 each provide a header containing gene/transcript/protein information, followed by a transcript and protein sequence (in Table 1) or genomic sequence (in Table 2), and then SNP information regarding each SNP found in that gene/transcript.

NOTE: SNPs may be included in both Table 1 and Table 2; Table 1 presents the SNPs relative to their transcript sequences and encoded protein sequences, whereas Table 2 presents the SNPs relative to their genomic sequences (in some instances Table 2 may also include, after the last gene sequence, genomic sequences of one or more intergenic regions, as well as SNP context sequences and other SNP information for any SNPs that lie within these intergenic regions). SNPs can readily be cross-referenced between Tables based on their hCV (or, in some instances, hDV) identification numbers.

The gene/transcript/protein information includes:

• • a gene number (1 through n, where n=the total number of genes in the Table)
  • a Celera hCG and UID internal identification numbers for the gene
  • a Celera hCT and UID internal identification numbers for the transcript (Table 1 only)
  • a public Genbank accession number (e.g., RefSeq NM number) for the transcript (Table 1 only)
  • a Celera hCP and UID internal identification numbers for the protein encoded by the hCT transcript (Table 1 only)
  • a public Genbank accession number (e.g., RefSeq NP number) for the protein (Table 1 only)
  • an art-known gene symbol
  • an art-known gene/protein name
  • Celera genomic axis position (indicating start nucleotide position-stop nucleotide position)
  • the chromosome number of the chromosome on which the gene is located
  • an OMIM (Online Mendelian Inheritance in Man; Johns Hopkins University/NCBI) public reference number for obtaining further information regarding the medical significance of each gene
  • alternative gene/protein name(s) and/or symbol(s) in the OMIM entry

NOTE: Due to the presence of alternative splice forms, multiple transcript/protein entries can be provided for a single gene entry in Table 1; i.e., for a single Gene Number, multiple entries may be provided in series that differ in their transcript/protein information and sequences.

Following the gene/transcript/protein information is a transcript sequence and protein sequence (in Table 1), or a genomic sequence (in Table 2), for each gene, as follows:

• • transcript sequence (Table 1 only) (corresponding to SEQ ID NOS:1-80 of the Sequence Listing), with SNPs identified by their IUB codes (transcript sequences can include 5′ UTR, protein coding, and 3′ UTR regions). (NOTE: If there are differences between the nucleotide sequence of the hCT transcript and the corresponding public transcript sequence identified by the Genbank accession number, the hCT transcript sequence (and encoded protein) is provided, unless the public sequence is a RefSeq transcript sequence identified by an NM number, in which case the RefSeq NM transcript sequence (and encoded protein) is provided. However, whether the hCT transcript or RefSeq NM transcript is used as the transcript sequence, the disclosed SNPs are represented by their IUB codes within the transcript.)
  • the encoded protein sequence (Table 1 only) (corresponding to SEQ ID NOS:81-160 of the Sequence Listing)
  • the genomic sequence of the gene (Table 2 only), including 6 kb on each side of the gene boundaries (i.e., 6 kb on the 5′ side of the gene plus 6 kb on the 3′ side of the gene) (corresponding to SEQ ID NOS:260-435 of the Sequence Listing).

After the last gene sequence, Table 2 may include additional genomic sequences of intergenic regions (in such instances, these sequences are identified as “Intergenic region:” followed by a numerical identification number), as well as SNP context sequences and other SNP information for any SNPs that lie within each intergenic region (and such SNPs are identified as “INTERGENIC” for SNP type).

NOTE: The transcript, protein, and transcript-based SNP context sequences are provided in both Table 1 and in the Sequence Listing. The genomic and genomic-based SNP context sequences are provided in both Table 2 and in the Sequence Listing. SEQ ID NOS are indicated in Table 1 for each transcript sequence (SEQ ID NOS:1-80), protein sequence (SEQ ID NOS:81-160), and transcript-based SNP context sequence (SEQ ID NOS:161-259), and SEQ ID NOS are indicated in Table 2 for each genomic sequence (SEQ ID NOS:260-435), and genomic-based SNP context sequence (SEQ ID NOS:436-1566).

The SNP information includes:

• • context sequence (taken from the transcript sequence in Table 1, and taken from the genomic sequence in Table 2) with the SNP represented by its IUB code, including 100 bp upstream (5′) of the SNP position plus 100 bp downstream (3′) of the SNP position (the transcript-based SNP context sequences in Table 1 are provided in the Sequence Listing as SEQ ID NOS:161-259; the genomic-based SNP context sequences in Table 2 are provided in the Sequence Listing as SEQ ID NOS:436-1566).
  • Celera hCV internal identification number for the SNP (in some instances, an “hDV” number is given instead of an “hCV” number)
  • SNP position [position of the SNP within the given transcript sequence (Table 1) or within the given genomic sequence (Table 2)]
  • SNP source (may include any combination of one or more of the following five codes, depending on which internal sequencing projects and/or public databases the SNP has been observed in: “Applera”=SNP observed during the re-sequencing of genes and regulatory regions of 39 individuals, “Celera”=SNP observed during shotgun sequencing and assembly of the Celera human genome sequence, “Celera Diagnostics”=SNP observed during re-sequencing of nucleic acid samples from individuals who have a disease, “dbSNP”=SNP observed in the dbSNP public database, “HGBASE”=SNP observed in the HGBASE public database, “HGMD”=SNP observed in the Human Gene Mutation Database (HGMD) public database, “HapMap”=SNP observed in the International HapMap Project public database, “CSNP”=SNP observed in an internal Applied Biosystems (Foster City, Calif.) database of coding SNPS (cSNPs)) (NOTE: multiple “Applera” source entries for a single SNP indicate that the same SNP was covered by multiple overlapping amplification products and the re-sequencing results (e.g., observed allele counts) from each of these amplification products is being provided).

For the following SNPs provided in Table 1 and/or 2, the SNP source falls into one of the following three categories: 1) SNPs for which the SNP source is only “Applera” and none other, 2) SNPs for which the SNP source is only “Celera Diagnostics” and none other, and 3) SNPs for which the SNP source is both “Applera” and “Celera Diagnostics” but none other (the hCV identification number and SEQ ID NO for the SNP's genomic context sequence in Table 2 are indicated): hCV22275299 (SEQ ID NO:482), hCV25615822 (SEQ ID NO:639), hCV25651109 (SEQ ID NO:840), hCV25951678 (SEQ ID NO:1013), and hCV25615822 (SEQ ID NO:1375). These SNPs have not been observed in any of the public databases (dbSNP, HGBASE, and HGMD), and were also not observed during shotgun sequencing and assembly of the Celera human genome sequence (i.e., “Celera” SNP source).

• • Population/allele/allele count information in the format of [population1(first_allele,countlsecond_allele,count)population2(first_allele,countlsecond_allele,count) total (first_allele,total countlsecond_allele,total count)]. The information in this field includes populations/ethnic groups in which particular SNP alleles have been observed (“cau”=Caucasian, “his”=Hispanic, “chn”=Chinese, and “afr”=African−American, “jpn”=Japanese, “ind”=Indian, “mex”=Mexican, “ain”=“American Indian, “cra”=Celera donor, “no_pop”=no population information available), identified SNP alleles, and observed allele counts (within each population group and total allele counts), where available [“-” in the allele field represents a deletion allele of an insertion/deletion (“indel”) polymorphism (in which case the corresponding insertion allele, which may be comprised of one or more nucleotides, is indicated in the allele field on the opposite side of the “|”); “-” in the count field indicates that allele count information is not available]. For certain SNPs from the public dbSNP database, population/ethnic information is indicated as follows (this population information is publicly available in dbSNP): “HISP1”=human individual DNA (anonymized samples) from 23 individuals of self-described HISPANIC heritage; “PAC1”=human individual DNA (anonymized samples) from 24 individuals of self-described PACIFIC RIM heritage; “CAUL 1”=human individual DNA (anonymized samples) from 31 individuals of self-described CAUCASIAN heritage; “AFR1”=human individual DNA (anonymized samples) from 24 individuals of self-described AFRICAN/AFRICAN AMERICAN heritage; “P1”=human individual DNA (anonymized samples) from 102 individuals of self-described heritage; “PA130299515”; “SC_12_A”=SANGER 12 DNAs of Asian origin from Corielle cell repositories, 6 of which are male and 6 female; “SC_12_C”=SANGER 12 DNAs of Caucasian origin from Corielle cell repositories from the CEPH/UTAH library. Six male and 6 female; “SC_12_AA”=SANGER 12 DNAs of African-American origin from Corielle cell repositories 6 of which are male and 6 female; “SC_95_C”=SANGER 95 DNAs of Caucasian origin from Corielle cell repositories from the CEPH/UTAH library; and “SC_12_CA”=Caucasians−12 DNAs from Corielle cell repositories that are from the CEPH/UTAH library (six male and six female).

NOTE: For SNPs of “Applera” SNP source, genes/regulatory regions of 39 individuals (20 Caucasians and 19 African Americans) were re-sequenced and, since each SNP position is represented by two chromosomes in each individual (with the exception of SNPs on X and Y chromosomes in males, for which each SNP position is represented by a single chromosome), up to 78 chromosomes were genotyped for each SNP position. Thus, the sum of the African-American (“afr”) allele counts is up to 38, the sum of the Caucasian allele counts (“cau”) is up to 40, and the total sum of all allele counts is up to 78.

(NOTE: semicolons separate population/allele/count information corresponding to each indicated SNP source; i.e., if four SNP sources are indicated, such as “Celera”, “dbSNP”, “HGBASE”, and “HGMD”, then population/allele/count information is provided in four groups which are separated by semicolons and listed in the same order as the listing of SNP sources, with each population/allele/count information group corresponding to the respective SNP source based on order; thus, in this example, the first population/allele/count information group would correspond to the first listed SNP source (Celera) and the third population/allele/count information group separated by semicolons would correspond to the third listed SNP source (HGBASE); if population/allele/count information is not available for any particular SNP source, then a pair of semicolons is still inserted as a place-holder in order to maintain correspondence between the list of SNP sources and the corresponding listing of population/allele/count information)

• • SNP type (e.g., location within gene/transcript and/or predicted functional effect) [“MIS-SENSE MUTATION”=SNP causes a change in the encoded amino acid (i.e., a non-synonymous coding SNP); “SILENT MUTATION”=SNP does not cause a change in the encoded amino acid (i.e., a synonymous coding SNP); “STOP CODON MUTATION”=SNP is located in a stop codon; “NONSENSE MUTATION”=SNP creates or destroys a stop codon; “UTR 5”=SNP is located in a 5′ UTR of a transcript; “UTR 3”=SNP is located in a 3′ UTR of a transcript; “PUTATIVE UTR 5”=SNP is located in a putative 5′ UTR; “PUTATIVE UTR 3”=SNP is located in a putative 3′ UTR; “DONOR SPLICE SITE”=SNP is located in a donor splice site (5′ intron boundary); “ACCEPTOR SPLICE SITE”=SNP is located in an acceptor splice site (3′ intron boundary); “CODING REGION”=SNP is located in a protein-coding region of the transcript; “EXON”=SNP is located in an exon; “INTRON”=SNP is located in an intron; “hmCS”=SNP is located in a human-mouse conserved segment; “TFBS”=SNP is located in a transcription factor binding site; “UNKNOWN”=SNP type is not defined; “INTERGENIC”=SNP is intergenic, i.e., outside of any gene boundary]
  • Protein coding information (Table 1 only), where relevant, in the format of [protein SEQ ID NO:#, amino acid position, (amino acid-1, codon1) (amino acid-2, codon2)]. The information in this field includes SEQ ID NO of the encoded protein sequence, position of the amino acid residue within the protein identified by the SEQ ID NO that is encoded by the codon containing the SNP, amino acids (represented by one-letter amino acid codes) that are encoded by the alternative SNP alleles (in the case of stop codons, “X” is used for the one-letter amino acid code), and alternative codons containing the alternative SNP nucleotides which encode the amino acid residues (thus, for example, for missense mutation-type SNPs, at least two different amino acids and at least two different codons are generally indicated; for silent mutation-type SNPs, one amino acid and at least two different codons are generally indicated, etc.). In instances where the SNP is located outside of a protein-coding region (e.g., in a UTR region), “None” is indicated following the protein SEQ ID NO.

Description of Table 3

Table 3 provides sequences (SEQ ID NOS:1567-1914) of exemplary primers that can be used to assay certain SNPs by allele-specific PCR, such as for stroke-related uses.

Table 3 provides the following:

• • the column labeled “Marker” provides an hCV identification number for each SNP that can be detected using the corresponding primers.
  • the column labeled “Alleles” designates the two alternative alleles (i.e., nucleotides) at the SNP site. These alleles are targeted by the allele-specific primers (the allele-specific primers are shown as Primer 1 and Primer 2). Note that alleles may be presented in Table 3 based on a different orientation (i.e., the reverse complement) relative to how the same alleles are presented in Tables 1-2.
  • the column labeled “Primer 1 (Allele-Specific Primer)” provides an allele-specific primer that is specific for an allele designated in the “Alleles” column.
  • the column labeled “Primer 2 (Allele-Specific Primer)” provides an allele-specific primer that is specific for the other allele designated in the “Alleles” column.
  • the column labeled “Common Primer” provides a common primer that is used in conjunction with each of the allele-specific primers (i.e., Primer 1 and Primer 2) and which hybridizes at a site away from the SNP position.

All primer sequences are given in the 5′ to 3′ direction.

Each of the nucleotides designated in the “Alleles” column matches or is the reverse complement of (depending on the orientation of the primer relative to the designated allele) the 3′ nucleotide of the allele-specific primer (i.e., either Primer 1 or Primer 2) that is specific for that allele.

Description of Table 4

Table 4 provides a list of LD SNPs that are related to and derived from certain interrogated SNPs. The interrogated SNPs, which are shown in column 1 (which indicates the hCV identification numbers of each interrogated SNP) and column 2 (which indicates the public rs identification numbers of each interrogated SNP) of Table 4, are statistically significantly associated with stroke as shown in the tables. These LD SNPs are provided as an example of SNPs which can also serve as markers for disease association based on their being in LD with an interrogated SNP. The criteria and process of selecting such LD SNPs, including the calculation of the r² value and the r² threshold value, are described in Example Eight, below.

In Table 4, the column labeled “Interrogated SNP” presents each marker as identified by its unique hCV identification number. The column labeled “Interrogated rs” presents the publicly known identifier rs number for the corresponding hCV number. The column labeled “LD SNP” presents the hCV numbers of the LD SNPs that are derived from their corresponding interrogated SNPs. The column labeled “LD SNP rs” presents the publicly known rs number for the corresponding hCV number. The column labeled “Power” presents the level of power where the r² threshold is set. For example, when power is set at 0.51, the threshold r² value calculated therefrom is the minimum r² that an LD SNP must have in reference to an interrogated SNP, in order for the LD SNP to be classified as a marker capable of being associated with a disease phenotype at greater than 51% probability. The column labeled “Threshold r²” presents the minimum value of r² that an LD SNP must meet in reference to an interrogated SNP in order to qualify as an LD SNP. The column labeled “r²” presents the actual r² value of the LD SNP in reference to the interrogated SNP to which it is related.

Description of Tables 5-38

Table 5 provides baseline characteristics of ARIC participants in the ischemic stroke study.

Table 6 provides SNPs associated with incident ischemic stroke in the ARIC study.

See Example One for further information relating to Tables 5-6.

Tables 7, 8, and 9 provide SNPs, identified from among the 51 SNPs analyzed in ARIC participants, that predict ischemic stroke risk that were identified by Cox proportional hazard analysis as each having a two-sided p-value of <0.2 after adjusting for age and sex and also a hazard ratio (HRR)>1.0 in whites (Table 7), blacks (Table 8), and both whites and blacks (Table 9) (the p-values shown in Tables 7-9 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values). See “Supplemental Analysis of SNPs in the ARIC Study” section for further information relating to Tables 7-9.

Table 10 provides baseline characteristics of CHS participants in the ischemic stroke study.

Table 11 provides SNPs associated with incident ischemic stroke in white participants of CHS.

Table 12 provides SNPs associated with incident ischemic stroke in African American participants of CHS.

Table 13 shows that Val allele homozygotes of ABCG2 Val12Met, compared with the Met allele carriers, are associated with increased risk of incident ischemic stroke in both white and African American Participants of CHS.

See Example Two for further information relating to Tables 10-13.

Table 14 provides three SNPs that predict ischemic stroke risk that were identified by Cox proportional hazard analysis as each having one-sided p-values of <=0.05 in whites after adjusting for age and sex, and also after adjusting for traditional risk factors. See “Supplemental Analysis of SNPs in the CHS Study” section for further information relating to Table 14.

Table 15 provides characteristics of noncardioembolic stroke cases and healthy controls in the Vienna Stroke Registry (VSR) study.

Table 16 provides characteristics of six SNPs tested for association with noncardioembolic stroke in VSR.

Table 17 provides results of analysis for association of six SNPs with noncardioembolic stroke in VSR. In Table 17, individuals with missing genotype or traditional risk factor information were excluded from case and control counts; Model 1 was adjusted for age and sex; Model 2 was adjusted for age, sex, smoking, hypertension, diabetes, dyslipidemia, and BMI; and “q” is the false discovery rate q value.

See Example Three for further information relating to Tables 15-17.

Table 18 provides SNPs associated (2-sided p-value of <0.2) with ischemic stroke (labeled “ischemic” in the “outcome” column), atherothrombotic stroke (labeled “athero” in the “outcome” column), and/or early-onset stroke (labeled “early-onset” in the “outcome” column) in the VSR study either before or after adjustment for traditional risk factors (results after adjustment are labeled “yes” and results before adjustment are labeled “no” in the “adjust?” column) (the p-values shown in Table 18 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values). See “Supplemental Analysis of SNPs in the Vienna Stroke Registry” section for further information relating to Table 18.

Table 19 (provided as Tables 19A-C to reduce the table width, thus the order of the rows corresponds to the same markers and studies across each of Tables 19A-C) provides 61 SNPs that were associated with stroke risk in the UCSF/CCF study (1-sided p<0.05 or 2-sided p<0.1) and had the same risk allele as in the VSR study. Table 19 provides the stroke association data in both the UCSF/CCF and the VSR studies. In Table 19A, the column labeled “RefAllele” refers to the major allele and the column labeled “Allele” refers to the alternative (minor) allele. Where the “OR” (in Table 19C) is greater than one, carrying the minor allele has greater stroke risk compared to carrying the major (reference) allele, so the minor allele would be the risk allele. Where the “OR” (in Table 19C) is less than one, the major allele would be the risk allele. See Example Four below for further information relating to Table 19.

Tables 20-21 provide SNPs that showed significant association with stroke risk in the German West Study (which may be interchangeably referred to herein as the “Muenster” Stroke Study). Table 20 provides SNPs associated with stroke risk that have the same risk allele and 2-sided p-values that are less than 0.1 (equivalent to 1-sided p-values that are less than 0.05), and Table 21 provides SNPs associated with stroke risk that have the same risk allele and 2-sided p-values that are between 0.1 and 0.2 (equivalent to 1-sided p-values that are between 0.05 and 0.1). In Tables 20-21, the following abbreviations are used for the endpoints in the column labeled “outcome”: “ischemic_stk”=ischemic stroke, “nonce_stk”=noncardioembolic stroke (ischemic strokes that were not cardioembolic in origin), “CE_stk”=cardioembolic stroke, “athero_stk”=atherothrombotic stroke, “lacunar_stk”=Lacunar stroke, “nohd_stk”=no heart disease stroke (ischemic stroke cases excluding those with a history of heart disease), “recurrent_stk”=recurrent stroke (stroke cases that also had a prior history of stroke), and “EO_stk”=early onset stroke (cases that are younger than the median age of all cases, and controls that were older than the median age of all controls). See Example Five below for further information relating to Tables 20-21.

Tables 22-32 and 37-38 provide SNPs associated with stroke risk or stroke statin response (SSR) in two pravastatin trials: CARE (“Cholesterol and Recurrent Events” study, which is comprised of individuals who have had an MI) and PROSPER (“Prospective Study of Pravastatin in the Elderly at Risk” study, which is comprised of elderly individuals with or without a history of cardiovascular disease). SNPs that were significantly associated with stroke risk in CARE are provided in Tables 22, 24, and 26. SNPs that were significantly associated with SSR in CARE are provided in Tables 23, 25, and 27. Results of the analysis of the MYH15 SNP (rs3900940/hcv7425232) for association with stroke risk in CARE are provided in Table 28. SNPs that were significantly associated with stroke risk in PROSPER are provided in Table 29 (which lists SNPs having P_all<0.2, which is the p-value based on the entire study cohort) and Table 30 (which lists SNPs having P_placebo<0.2, which is the p-value based on just the placebo group). SNPs that were significantly associated with SSR in PROSPER are provided in Table 31 (which lists SNPs having P_int<0.1) and Table 32 (which lists SNPs having P_int<0.2), which provide results of analyses of pravastatin-treated versus placebo-treated individuals. Tables 37-38 provide the results of further analyses of the chromosome 9p21 SNP rs10757274 (hCV26505812) for association with SSR in CARE (Table 37) and PROSPER (Table 38), including both unadjusted and adjusted analyses (adjusted for factors such as age, gender, smoking status, hypertension, diabetes, BMI, and LDL and HDL levels). Table 37 provides results in CARE, and Table 38 provides results in PROSPER (whether each analysis is unadjusted or adjusted is indicated in the “adjust” column in Table 37, or by “unadj” and “adj” column labels in Tables 38).

With respect to Tables 22-32 and 37-38, the columns labeled “Genotype” (in Tables 22-28 and 37), “Geno_Placebo” (in Tables 29-30 and 38), and “Geno_Resp” (in Tables 31-32 and 38) indicate the genotype which the given stroke risk or SSR results correspond to. All the p-values (including P_int values) provided in Tables 22-32 and 37-38 are two-sided p-values (two-sided p-value cutoffs of 0.1 and 0.2 are equivalent to one-sided p-value cutoffs of 0.05 and 0.1, respectively). In Tables 23, 25, 27, 31-32, and 37-38 (which include results pertaining to SSR), the p-value (which is labeled “p-value” in Tables 23, 25, 27, and 37, and labeled “p_resp” in Tables 31-32 and 38) refers to the significance of the statin benefit (i.e., the HR of pravastatin-treated versus placebo-treated carriers of a given genotype), whereas the P_int value (which is labeled as “pval_intx” in Tables 23, 25, 27, and 37, and labeled “p_int_resp” in Tables 31-32 and 38) refers to the significance of the genotype by treatment interaction, i.e., the significance of the difference in statin response among three groups defined by the three genotypes (homozygotes of each of the two alternative alleles, plus heterozygotes, as indicated in the column labeled “Genotype” or “Geno”) or two groups defined by the carriers and noncarriers of one or the other allele (“Dom” or “Rec”, as indicated in the column labeled “Mode”). In Tables 29-32 and 38, the columns labeled “LOWER_PLACEBO” and “UPPER_PLACEBO” (Tables 29-30 and 38), and “LOWER_RESP” and “UPPER_RESP” (Tables 31-32 and 38), refer to the lower and upper 95% confidence intervals for the hazard ratios. See Example Six below for further information relating to Tables 22-32 and 37-38.

Tables 33-36 provide SNPs that showed significant association with stroke risk in the Cardiovascular Health Study (CHS). Specifically, SNPs that are associated with stroke risk in white or black individuals with 2-sided p-values less than 0.1 (equivalent to 1-sided p-values less than 0.05) are provided in Table 33 (white individuals) and Table 34 (black individuals), and SNPs that are associated with stroke risk in white or black individuals with 2-sided p-values between 0.1 and 0.2 (equivalent to 1-sided p-values between 0.05 and 0.1) are provided in Table 35 (white individuals) and Table 36 (black individuals). Association was analyzed for three related stroke end points, which are indicated in Tables 33-36 by the following abbreviations in the column labeled “endpt”: “stroke”=stroke (all subtypes), “ischem”=ischemic stroke (excludes hemorrhagic stroke), and “athero”=atherothrombotic stroke (excludes hemorrhagic stroke and cardioembolic stroke). See Example Seven below for further information relating to Tables 33-36.

In the tables, the following abbreviations may be used: “ProbChiSq”=p-value, “PVALUE_2DF” or “2DF P-VALUE”=p-value with two degrees of freedom, “PVAL_INTX” or “P_INT_RESP”=P_int (the significance of the genotype by treatment interaction—see description of Tables 23, 25, 27, 31-32, and 37-38 above), “std.ln(OR)”=the standard deviation of the natural log of the OR, “Hom”=homozygotes, “Het”=heterozygotes, “cnt”=count, “frq”=frequency, “dom”=dominant, “rec”=recessive, “gen”=genotypic, “add”=additive, “HW”=Hardy-Weinberg, “TIA”=transient ischemic stroke (also known as a mini stroke), “events”=number of strokes (including TIA) in the study cohort, “DIAB”, “DIABADA”, or “DIABETES_1”=diabetes, “HTN” or “HYPERTEN_1”=hypertension, “ENDPT4F1”=endpoint of stroke or TIA (offical endpoint of the CARE Study), “TIMEVAR”=length of time from baseline to the time of event/endpoint, “TIMETO_EP4F1”=length of time from baseline to the time of endpoint ENDPT4F1 (stroke or TIA), “TRF”=traditional risk factors, “BMI”=body mass index, “AGEBL”=age, “GEND01”=gender, “PRESSM” or “CURRSMK”=smoking status, “LDLADJBL” or “BASE_LDL”=low-density lipoprotein (LDL) cholesterol, and “HDL44BL” or “BASE_HDL”=high-density lipoprotein (HDL) cholesterol (“BASE_LDL” and “BASE_HDL” adjustments are based on continuous variables rather than discrete cutoffs). Two-“sided” p-values may be interchangeably referred to as two-“tailed” p-values.

Throughout the tables, “HR” or “HRR” refers to the hazard ratio, “OR” refers to the odds ratio, terms such as “90% CI” or “95% CI” refer to the 90% or 95% confidence interval (respectively) for the hazard ratio or odds ratio (“CI”/“confidence interval” and “CL”/“confidence limit” may be used herein interchangeably), and terms such as “OR99CI.L” and “OR99CI.U” refer to the lower and upper 99% confidence intervals (respectively) for the odds ratio. Hazard ratios (“HR” or “HRR”) or odds ratios (OR) that are greater than one indicate that a given allele (or combination of alleles such as a haplotype, diplotype, or two-locus diplotype) is a risk allele (which may also be referred to as a susceptibility allele), whereas hazard ratios or odds ratios that are less than one indicate that a given allele is a non-risk allele (which may also be referred to as a protective allele). For a given risk allele, the other alternative allele at the SNP position (which can be derived from the information provided in Tables 1-2, for example) may be considered a non-risk allele. For a given non-risk allele, the other alternative allele at the SNP position may be considered a risk allele.

Thus, with respect to disease risk (e.g., stroke), if the risk estimate (odds ratio or hazard ratio) for a particular allele at a SNP position is greater than one, this indicates that an individual with this particular allele has a higher risk for the disease than an individual who has the other allele at the SNP position. In contrast, if the risk estimate (odds ratio or hazard ratio) for a particular allele is less than one, this indicates that an individual with this particular allele has a reduced risk for the disease compared with an individual who has the other allele at the SNP position.

With respect to drug response (e.g., response to a statin), if the risk estimate (odds ratio or hazard ratio) of those treated with pravastatin compared with those treated with a placebo within a particular genotype is less than one, this indicates that an individual with this particular genotype would benefit from the drug (an odds ratio or hazard ratio equal to one would indicate that the drug has no effect). As used herein, the term “benefit” (with respect to a preventive or therapeutic drug treatment) is defined as achieving a reduced risk for a disease that the drug is intended to treat or prevent (e.g., stroke) by administrating the drug treatment, compared with the risk for the disease in the absence of receiving the drug treatment (or receiving a placebo in lieu of the drug treatment) for the same genotype. The term “benefit” may be used herein interchangeably with terms such as “respond positively” or “positively respond”.

For stroke risk and statin response associations based on samples from the CARE and PROSPER trials described herein, stroke risk is assessed by comparing the risk of stroke for a given genotype with the risk of stroke for a reference genotype either in the placebo arm of the trial or in the whole study population of the trial, and statin response is assessed by comparing the risk of stroke in the pravastatin arm of the trial with the risk of stroke in the placebo arm of the trial for the same genotype.

BRIEF DESCRIPTION OF THE FIGURES

FIGS. 1a-1b show a comparison of Kaplan-Meier estimates of the cumulative incidence of ischemic stroke among Val allele homozygotes of the AB CG2 Val12Met SNP (rs2231137/hCV15854171) and among Met allele carriers in white (FIG. 1a) and in African American (FIG. 1b) participants of CHS (see Example Two).

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS OF THE INVENTION

The present invention provides SNPs associated with stroke risk, and SNPs that are associated with an individual's responsiveness to therapeutic agents, particularly statins, which may be used for the treatment (including preventive treatment) of stroke. The present invention further provides nucleic acid molecules containing SNPs, methods and reagents for the detection of the SNPs disclosed herein, uses of these SNPs for the development of detection reagents, and assays or kits that utilize such reagents. The SNPs disclosed herein are useful for diagnosing, prognosing, screening for, and evaluating predisposition to stroke and related pathologies in humans. The drug response-associated SNPs disclosed herein are particularly useful for predicting, screening for, and evaluating response to statin treatment, particularly treatment or prevention of stroke using statins, in humans. Furthermore, such SNPs and their encoded products are useful targets for the development of therapeutic and preventive agents.

A large number of SNPs have been identified from re-sequencing DNA from 39 individuals, and they are indicated as “Applera” SNP source in Tables 1-2. Their allele frequencies observed in each of the Caucasian and African-American ethnic groups are provided. Additional SNPs included herein were previously identified during shotgun sequencing and assembly of the human genome, and they are indicated as “Celera” SNP source in Tables 1-2. Furthermore, the information provided in Table 1-2, particularly the allele frequency information obtained from 39 individuals and the identification of the precise position of each SNP within each gene/transcript, allows haplotypes (i.e., groups of SNPs that are co-inherited) to be readily inferred. The present invention encompasses SNP haplotypes, as well as individual SNPs.

Thus, the present invention provides individual SNPs associated with stroke, and/or drug response (particularly statin response), as well as combinations of SNPs and haplotypes in genetic regions associated with stroke, polymorphic/variant transcript sequences (SEQ ID NOS:1-80) and genomic sequences (SEQ ID NOS:260-435) containing SNPs, encoded amino acid sequences (SEQ ID NOS: 81-160), and both transcript-based SNP context sequences (SEQ ID NOS:161-259) and genomic-based SNP context sequences (SEQ ID NOS:436-1566) (transcript sequences, protein sequences, and transcript-based SNP context sequences are provided in Table 1 and the Sequence Listing; genomic sequences and genomic-based SNP context sequences are provided in Table 2 and the Sequence Listing), methods of detecting these polymorphisms in a test sample, methods of determining the risk of an individual of having a stroke, methods of determining if an individual is likely to respond to a particular treatment such as statins (particularly for treating or preventing stroke), methods of screening for compounds useful for treating disorders associated with a variant gene/protein such as stroke, compounds identified by these screening methods, methods of using the disclosed SNPs to select a treatment/preventive strategy or therapeutic agent (e.g., a statin), methods of treating or preventing a disorder associated with a variant gene/protein, and methods of using the SNPs of the present invention for human identification.

For example, certain embodiments provide methods of using any of rs3900940/hCV7425232 (MYH15), rs3814843/hCV11476411 (CALM1), rs2200733/hCV16158671 (chromosome 4q25), and/or rs10757274/hCV26505812 (chromosome 9p21) for determining stroke risk in an individual, and methods of using rs10757274/hCV26505812 (chromosome 9p21) for determining whether an individual will benefit from statin treatment.

Since vascular disorders/diseases share certain similar features that may be due to common genetic factors that are involved in their underlying mechanisms, the SNPs identified herein as being particularly associated with stroke may be used as diagnostic/prognostic markers or therapeutic targets for other vascular diseases such as coronary heart disease (CHD), atherosclerosis, cardiovascular disease, congestive heart failure, congenital heart disease, and pathologies and symptoms associated with various heart diseases (e.g., angina, hypertension), as well as for predicting responses to drugs such as statins that are used to treat cardiovascular diseases.

The present invention further provides methods for selecting or formulating a treatment regimen (e.g., methods for determining whether or not to administer statin treatment to an individual who has previously had a stroke, or who is at risk for having a stroke in the future, methods for selecting a particular statin-based treatment regimen such as dosage and frequency of administration of statin, or a particular form/type of statin such as a particular pharmaceutical formulation or statin compound, methods for administering an alternative, non-statin-based treatment to individuals who are predicted to be unlikely to respond positively to statin treatment, etc.), and methods for determining the likelihood of experiencing toxicity or other undesirable side effects from statin treatment, etc. The present invention also provides methods for selecting individuals to whom a statin or other therapeutic will be administered based on the individual's genotype, and methods for selecting individuals for a clinical trial of a statin or other therapeutic agent based on the genotypes of the individuals (e.g., selecting individuals to participate in the trial who are most likely to respond positively from the statin treatment and/or excluding individuals from the trial who are unlikely to respond positively from the statin treatment).

The present invention provides novel SNPs associated with stroke and related pathologies, as well as SNPs that were previously known in the art, but were not previously known to be associated with stroke or response to statin treatment. Accordingly, the present invention provides novel compositions and methods based on the novel SNPs disclosed herein, and also provides novel methods of using the known, but previously unassociated, SNPs in methods relating to evaluating an individual's likelihood of having a first or recurrent stroke, prognosing the severity of stroke in an individual, or prognosing an individual's recovery from stroke, and methods relating to evaluating an individual's likelihood of responding to statin treatment (particularly statin treatment, including preventive treatment, of stroke). In Tables 1-2, known SNPs are identified based on the public database in which they have been observed, which is indicated as one or more of the following SNP types: “dbSNP”=SNP observed in dbSNP, “HGBASE”=SNP observed in HGBASE, and “HGMD”=SNP observed in the Human Gene Mutation Database (HGMD).

Particular SNP alleles of the present invention can be associated with either an increased risk of having a stroke (or related pathologies), or a decreased risk of having a stroke. SNP alleles that are associated with a decreased risk of having a stroke may be referred to as “protective” alleles, and SNP alleles that are associated with an increased risk of having a stroke may be referred to as “susceptibility” alleles, “risk” alleles, or “risk factors”. Thus, whereas certain SNPs (or their encoded products) can be assayed to determine whether an individual possesses a SNP allele that is indicative of an increased risk of having a stroke (i.e., a susceptibility allele), other SNPs (or their encoded products) can be assayed to determine whether an individual possesses a SNP allele that is indicative of a decreased risk of having a stroke (i.e., a protective allele). Similarly, particular SNP alleles of the present invention can be associated with either an increased or decreased likelihood of responding to a particular treatment or therapeutic compound (e.g., statins), or an increased or decreased likelihood of experiencing toxic effects from a particular treatment or therapeutic compound. The term “altered” may be used herein to encompass either of these two possibilities (e.g., an increased or a decreased risk/likelihood).

Those skilled in the art will readily recognize that nucleic acid molecules may be double-stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand. In defining a SNP position, SNP allele, or nucleotide sequence, reference to an adenine, a thymine (uridine), a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule also defines the thymine (uridine), adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid molecule. Thus, reference may be made to either strand in order to refer to a particular SNP position, SNP allele, or nucleotide sequence. Probes and primers, may be designed to hybridize to either strand and SNP genotyping methods disclosed herein may generally target either strand. Throughout the specification, in identifying a SNP position, reference is generally made to the protein-encoding strand, only for the purpose of convenience.

References to variant peptides, polypeptides, or proteins of the present invention include peptides, polypeptides, proteins, or fragments thereof, that contain at least one amino acid residue that differs from the corresponding amino acid sequence of the art-known peptide/polypeptide/protein (the art-known protein may be interchangeably referred to as the “wild-type”, “reference”, or “normal” protein). Such variant peptides/polypeptides/proteins can result from a codon change caused by a nonsynonymous nucleotide substitution at a protein-coding SNP position (i.e., a missense mutation) disclosed by the present invention. Variant peptides/polypeptides/proteins of the present invention can also result from a nonsense mutation, i.e., a SNP that creates a premature stop codon, a SNP that generates a read-through mutation by abolishing a stop codon, or due to any SNP disclosed by the present invention that otherwise alters the structure, function/activity, or expression of a protein, such as a SNP in a regulatory region (e.g. a promoter or enhancer) or a SNP that leads to alternative or defective splicing, such as a SNP in an intron or a SNP at an exon/intron boundary. As used herein, the terms “polypeptide”, “peptide”, and “protein” are used interchangeably.

As used herein, an “allele” may refer to a nucleotide at a SNP position (wherein at least two alternative nucleotides are present in the population at the SNP position, in accordance with the inherent definition of a SNP) or may refer to an amino acid residue that is encoded by the codon which contains the SNP position (where the alternative nucleotides that are present in the population at the SNP position form alternative codons that encode different amino acid residues). An “allele” may also be referred to herein as a “variant”. Also, an amino acid residue that is encoded by a codon containing a particular SNP may simply be referred to as being encoded by the SNP.

A phrase such as “as represented by”, “as shown by”, “as symbolized by”, or “as designated by” may be used herein to refer to a SNP within a sequence (e.g., a polynucleotide context sequence surrounding a SNP), such as in the context of “a polymorphism as represented by position 101 of SEQ ID NO:X or its complement”. Typically, the sequence surrounding a SNP may be recited when referring to a SNP, however the sequence is not intended as a structural limitation beyond the specific SNP position itself. Rather, the sequence is recited merely as a way of referring to the SNP (in this example, “SEQ ID NO:X or its complement” is recited in order to refer to the SNP located at position 101 of SEQ ID NO:X, but SEQ ID NO:X or its complement is not intended as a structural limitation beyond the specific SNP position itself). A SNP is a variation at a single nucleotide position and therefore it is customary to refer to context sequence (e.g., SEQ ID NO:X in this example) surrounding a particular SNP position in order to uniquely identify and refer to the SNP. Alternatively, a SNP can be referred to by a unique identification number such as a public “rs” identification number or an internal “hCV” identification number, such as provided herein for each SNP (e.g., in Tables 1-2).

With respect to an individual's risk for a disease or predicted drug responsiveness (e.g., based on the presence or absence of one or more SNPs disclosed herein in the individual's nucleic acid), terms such as “assigning” or “designating” may be used herein to characterize the individual's risk for the disease.

As used herein, the term “benefit” (with respect to a preventive or therapeutic drug treatment) is defined as achieving a reduced risk for a disease that the drug is intended to treat or prevent (e.g., stroke) by administrating the drug treatment (e.g., a statin), compared with the risk for the disease in the absence of receiving the drug treatment (or receiving a placebo in lieu of the drug treatment) for the same genotype. The term “benefit” may be used herein interchangeably with terms such as “respond positively” or “positively respond”.

As used herein, the terms “drug” and “therapeutic agent” are used interchangeably, and may include, but are not limited to, small molecule compounds, biologics (e.g., antibodies, proteins, protein fragments, fusion proteins, glycoproteins, etc.), nucleic acid agents (e.g., antisense, RNAi/siRNA, and microRNA molecules, etc.), vaccines, etc., which may be used for therapeutic and/or preventive treatment of a disease (e.g., stroke).

The statin response-associated SNPs disclosed herein are useful with respect to any statin (HMG-CoA reductase inhibitor), including but not limited to pravastatin (Pravachol®), atorvastatin (Lipitor®), storvastatin, rosuvastatin (Crestor®), fluvastatin (Lescol®), lovastatin (Mevacor®), and simvastatin (Zocor®), as well as combination therapies that include a statin such as simvastatin+ezetimibe (Vytorin®), lovastatin+niacin extended-release (Advicor®), and atorvastatin+amlodipine besylate (Caduet®).

Furthermore, the drug response-associated SNPs disclosed herein may also be used for predicting an individual's responsiveness to drugs other than statins that are used to treat or prevent stroke, and these SNPs may also be used for predicting an individual's responsiveness to statins for the treatment or prevention of disorders other than stroke, particularly cancer. For example, the use of statins in the treatment of cancer is reviewed in: Hindler et al., “The role of statins in cancer therapy”, Oncologist. 2006 March; 11(3):306-15; Demierre et al., “Statins and cancer prevention”, Nat Rev Cancer. 2005 December; 5(12):930-42; Stamm et al., “The role of statins in cancer prevention and treatment”, Oncology. 2005 May; 19(6):739-50; and Sleijfer et al., “The potential of statins as part of anti-cancer treatment”, Eur J Cancer. 2005 March; 41(4):516-22, each of which is incorporated herein by reference in their entirety.

Drug response with respect to statins may be referred to herein as “stroke statin response” or “SSR”.

The various methods described herein, such as correlating the presence or absence of a polymorphism with an altered (e.g., increased or decreased) risk (or no altered risk) for stroke (and/or correlating the presence or absence of a polymorphism with the predicted response of an individual to a drug such as a statin), can be carried out by automated methods such as by using a computer (or other apparatus/devices such as biomedical devices, laboratory instrumentation, or other apparatus/devices having a computer processor) programmed to carry out any of the methods described herein. For example, computer software (which may be interchangeably referred to herein as a computer program) can perform the step of correlating the presence or absence of a polymorphism in an individual with an altered (e.g., increased or decreased) risk (or no altered risk) for stroke for the individual. Computer software can also perform the step of correlating the presence or absence of a polymorphism in an individual with the predicted response of the individual to a therapeutic agent (such as a statin) or other treatment. Accordingly, certain embodiments of the invention provide a computer (or other apparatus/device) programmed to carry out any of the methods described herein.

Reports, Programmed Computers, Business Methods, and Systems

The results of a test (e.g., an individual's risk for stroke or an individual's predicted drug responsiveness such as statin response, based on assaying one or more SNPs disclosed herein, and/or an individual's allele(s)/genotype at one or more SNPs disclosed herein, etc.), and/or any other information pertaining to a test, may be referred to herein as a “report”. A tangible report can optionally be generated as part of a testing process (which may be interchangeably referred to herein as “reporting”, or as “providing” a report, “producing” a report, or “generating” a report).

Examples of tangible reports may include, but are not limited to, reports in paper (such as computer-generated printouts of test results) or equivalent formats and reports stored on computer readable medium (such as a CD, USB flash drive or other removable storage device, computer hard drive, or computer network server, etc.). Reports, particularly those stored on computer readable medium, can be part of a database, which may optionally be accessible via the internet (such as a database of patient records or genetic information stored on a computer network server, which may be a “secure database” that has security features that limit access to the report, such as to allow only the patient and the patient's medical practioners to view the report while preventing other unauthorized individuals from viewing the report, for example). In addition to, or as an alternative to, generating a tangible report, reports can also be displayed on a computer screen (or the display of another electronic device or instrument).

A report can include, for example, an individual's risk for stroke, or may just include the allele(s)/genotype that an individual carries at one or more SNPs disclosed herein, which may optionally be linked to information regarding the significance of having the allele(s)/genotype at the SNP (for example, a report on computer readable medium such as a network server may include hyperlink(s) to one or more journal publications or websites that describe the medical/biological implications, such as increased or decreased disease risk, for individuals having a certain allele/genotype at the SNP). Thus, for example, the report can include disease risk or other medical/biological significance (e.g., drug responsiveness, etc.) as well as optionally also including the allele/genotype information, or the report may just include allele/genotype information without including disease risk or other medical/biological significance (such that an individual viewing the report can use the allele/genotype information to determine the associated disease risk or other medical/biological significance from a source outside of the report itself, such as from a medical practioner, publication, website, etc., which may optionally be linked to the report such as by a hyperlink).

A report can further be “transmitted” or “communicated” (these terms may be used herein interchangeably), such as to the individual who was tested, a medical practitioner (e.g., a doctor, nurse, clinical laboratory practitioner, genetic counselor, etc.), a healthcare organization, a clinical laboratory, and/or any other party or requester intended to view or possess the report. The act of “transmitting” or “communicating” a report can be by any means known in the art, based on the format of the report. Furthermore, “transmitting” or “communicating” a report can include delivering a report (“pushing”) and/or retrieving (“pulling”) a report. For example, reports can be transmitted/communicated by various means, including being physically transferred between parties (such as for reports in paper format) such as by being physically delivered from one party to another, or by being transmitted electronically or in signal form (e.g., via e-mail or over the internet, by facsimile, and/or by any wired or wireless communication methods known in the art) such as by being retrieved from a database stored on a computer network server, etc.

In certain exemplary embodiments, the invention provides computers (or other apparatus/devices such as biomedical devices or laboratory instrumentation) programmed to carry out the methods described herein. For example, in certain embodiments, the invention provides a computer programmed to receive (i.e., as input) the identity (e.g., the allele(s) or genotype at a SNP) of one or more SNPs disclosed herein and provide (i.e., as output) the disease risk (e.g., an individual's risk for stroke) or other result (e.g., disease diagnosis or prognosis, drug responsiveness, etc.) based on the identity of the SNP(s). Such output (e.g., communication of disease risk, disease diagnosis or prognosis, drug responsiveness, etc.) may be, for example, in the form of a report on computer readable medium, printed in paper form, and/or displayed on a computer screen or other display.

In various exemplary embodiments, the invention further provides methods of doing business (with respect to methods of doing business, the terms “individual” and “customer” are used herein interchangeably). For example, exemplary methods of doing business can comprise assaying one or more SNPs disclosed herein and providing a report that includes, for example, a customer's risk for stroke (based on which allele(s)/genotype is present at the assayed SNP(s)) and/or that includes the allele(s)/genotype at the assayed SNP(s) which may optionally be linked to information (e.g., journal publications, websites, etc.) pertaining to disease risk or other biological/medical significance such as by means of a hyperlink (the report may be provided, for example, on a computer network server or other computer readable medium that is internet-accessible, and the report may be included in a secure database that allows the customer to access their report while preventing other unauthorized individuals from viewing the report), and optionally transmitting the report. Customers (or another party who is associated with the customer, such as the customer's doctor, for example) can request/order (e.g., purchase) the test online via the internet (or by phone, mail order, at an outlet/store, etc.), for example, and a kit can be sent/delivered (or otherwise provided) to the customer (or another party on behalf of the customer, such as the customer's doctor, for example) for collection of a biological sample from the customer (e.g., a buccal swab for collecting buccal cells), and the customer (or a party who collects the customer's biological sample) can submit their biological samples for assaying (e.g., to a laboratory or party associated with the laboratory such as a party that accepts the customer samples on behalf of the laboratory, a party for whom the laboratory is under the control of (e.g., the laboratory carries out the assays by request of the party or under a contract with the party, for example), and/or a party that receives at least a portion of the customer's payment for the test). The report (e.g., results of the assay including, for example, the customer's disease risk and/or allele(s)/genotype at the assayed SNP(s)) may be provided to the customer by, for example, the laboratory that assays the SNP(s) or a party associated with the laboratory (e.g., a party that receives at least a portion of the customer's payment for the assay, or a party that requests the laboratory to carry out the assays or that contracts with the laboratory for the assays to be carried out) or a doctor or other medical practitioner who is associated with (e.g., employed by or having a consulting or contracting arrangement with) the laboratory or with a party associated with the laboratory, or the report may be provided to a third party (e.g., a doctor, genetic counselor, hospital, etc.) which optionally provides the report to the customer. In further embodiments, the customer may be a doctor or other medical practitioner, or a hospital, laboratory, medical insurance organization, or other medical organization that requests/orders (e.g., purchases) tests for the purposes of having other individuals (e.g., their patients or customers) assayed for one or more SNPs disclosed herein and optionally obtaining a report of the assay results.

In certain exemplary methods of doing business, kits for collecting a biological sample from a customer (e.g., a buccal swab for collecting buccal cells) are provided (e.g., for sale), such as at an outlet (e.g., a drug store, pharmacy, general merchandise store, or any other desirable outlet), online via the internet, by mail order, etc., whereby customers can obtain (e.g., purchase) the kits, collect their own biological samples, and submit (e.g., send/deliver via mail) their samples to a laboratory which assays the samples for one or more SNPs disclosed herein (such as to determine the customer's risk for stroke) and optionally provides a report to the customer (of the customer's disease risk based on their SNP genotype(s), for example) or provides the results of the assay to another party (e.g., a doctor, genetic counselor, hospital, etc.) which optionally provides a report to the customer (of the customer's disease risk based on their SNP genotype(s), for example).

Certain further embodiments of the invention provide a system for determining an individual's stroke risk, or whether an individual will benefit from statin treatment (or other therapy) in reducing stroke risk. Certain exemplary systems comprise an integrated “loop” in which an individual (or their medical practitioner) requests a determination of such individual's stroke risk (or drug response, etc.), this determination is carried out by testing a sample from the individual, and then the results of this determination are provided back to the requestor. For example, in certain systems, a sample (e.g., blood or buccal cells) is obtained from an individual for testing (the sample may be obtained by the individual or, for example, by a medical practitioner), the sample is submitted to a laboratory (or other facility) for testing (e.g., determining the genotype of one or more SNPs disclosed herein), and then the results of the testing are sent to the patient (which optionally can be done by first sending the results to an intermediary, such as a medical practioner, who then provides or otherwise conveys the results to the individual), thereby forming an integrated loop system for determining an individual's stroke risk (or drug response, etc.). The portions of the system in which the results are transmitted (e.g., between any of a testing facility, a medical practitioner, and/or the individual) can be carried out by way of electronic or signal transmission (e.g., by computer such as via e-mail or the internet, by providing the results on a website or computer network server which may optionally be a secure database, by phone or fax, or by any other wired or wireless transmission methods known in the art).

Isolated Nucleic Acid Molecules and SNP Detection Reagents & Kits

Tables 1 and 2 provide a variety of information about each SNP of the present invention that is associated with stroke, including the transcript sequences (SEQ ID NOS:1-80), genomic sequences (SEQ ID NOS:260-435), and protein sequences (SEQ ID NOS:81-160) of the encoded gene products (with the SNPs indicated by IUB codes in the nucleic acid sequences). In addition, Tables 1 and 2 include SNP context sequences, which generally include 100 nucleotide upstream (5′) plus 100 nucleotides downstream (3′) of each SNP position (SEQ ID NOS:161-259 correspond to transcript-based SNP context sequences disclosed in Table 1, and SEQ ID NOS:436-1566 correspond to genomic-based context sequences disclosed in Table 2), the alternative nucleotides (alleles) at each SNP position, and additional information about the variant where relevant, such as SNP type (coding, missense, splice site, UTR, etc.), human populations in which the SNP was observed, observed allele frequencies, information about the encoded protein, etc.

Isolated Nucleic Acid Molecules

The present invention provides isolated nucleic acid molecules that contain one or more SNPs disclosed Table 1 and/or Table 2. Preferred isolated nucleic acid molecules contain one or more SNPs identified as Applera or Celera proprietary. Isolated nucleic acid molecules containing one or more SNPs disclosed in at least one of Tables 1-2 may be interchangeably referred to throughout the present text as “SNP-containing nucleic acid molecules”. Isolated nucleic acid molecules may optionally encode a full-length variant protein or fragment thereof. The isolated nucleic acid molecules of the present invention also include probes and primers (which are described in greater detail below in the section entitled “SNP Detection Reagents”), which may be used for assaying the disclosed SNPs, and isolated full-length genes, transcripts, cDNA molecules, and fragments thereof, which may be used for such purposes as expressing an encoded protein.

As used herein, an “isolated nucleic acid molecule” generally is one that contains a SNP of the present invention or one that hybridizes to such molecule such as a nucleic acid with a complementary sequence, and is separated from most other nucleic acids present in the natural source of the nucleic acid molecule. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule containing a SNP of the present invention, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. A nucleic acid molecule can be fused to other coding or regulatory sequences and still be considered “isolated”. Nucleic acid molecules present in non-human transgenic animals, which do not naturally occur in the animal, are also considered “isolated”. For example, recombinant DNA molecules contained in a vector are considered “isolated”. Further examples of “isolated” DNA molecules include recombinant DNA molecules maintained in heterologous host cells, and purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the isolated SNP-containing DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.

Generally, an isolated SNP-containing nucleic acid molecule comprises one or more SNP positions disclosed by the present invention with flanking nucleotide sequences on either side of the SNP positions. A flanking sequence can include nucleotide residues that are naturally associated with the SNP site and/or heterologous nucleotide sequences. Preferably the flanking sequence is up to about 500, 300, 100, 60, 50, 30, 25, 20, 15, 10, 8, or 4 nucleotides (or any other length in-between) on either side of a SNP position, or as long as the full-length gene or entire protein-coding sequence (or any portion thereof such as an exon), especially if the SNP-containing nucleic acid molecule is to be used to produce a protein or protein fragment.

For full-length genes and entire protein-coding sequences, a SNP flanking sequence can be, for example, up to about 5 KB, 4 KB, 3 KB, 2 KB, 1 KB on either side of the SNP. Furthermore, in such instances, the isolated nucleic acid molecule comprises exonic sequences (including protein-coding and/or non-coding exonic sequences), but may also include intronic sequences. Thus, any protein coding sequence may be either contiguous or separated by introns. The important point is that the nucleic acid is isolated from remote and unimportant flanking sequences and is of appropriate length such that it can be subjected to the specific manipulations or uses described herein such as recombinant protein expression, preparation of probes and primers for assaying the SNP position, and other uses specific to the SNP-containing nucleic acid sequences.

An isolated SNP-containing nucleic acid molecule can comprise, for example, a full-length gene or transcript, such as a gene isolated from genomic DNA (e.g., by cloning or PCR amplification), a cDNA molecule, or an mRNA transcript molecule. Polymorphic transcript sequences are provided in Table 1 and in the Sequence Listing (SEQ ID NOS:1-80), and polymorphic genomic sequences are provided in Table 2 and in the Sequence Listing (SEQ ID NOS:260-435). Furthermore, fragments of such full-length genes and transcripts that contain one or more SNPs disclosed herein are also encompassed by the present invention, and such fragments may be used, for example, to express any part of a protein, such as a particular functional domain or an antigenic epitope.

Thus, the present invention also encompasses fragments of the nucleic acid sequences provided in Tables 1-2 (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566) and their complements. A fragment typically comprises a contiguous nucleotide sequence at least about 8 or more nucleotides, more preferably at least about 12 or more nucleotides, and even more preferably at least about 16 or more nucleotides. Further, a fragment could comprise at least about 18, 20, 22, 25, 30, 40, 50, 60, 80, 100, 150, 200, 250 or 500 (or any other number in-between) nucleotides in length. The length of the fragment will be based on its intended use. For example, the fragment can encode epitope-bearing regions of a variant peptide or regions of a variant peptide that differ from the normal/wild-type protein, or can be useful as a polynucleotide probe or primer. Such fragments can be isolated using the nucleotide sequences provided in Table 1 and/or Table 2 for the synthesis of a polynucleotide probe. A labeled probe can then be used, for example, to screen a cDNA library, genomic DNA library, or mRNA to isolate nucleic acid corresponding to the coding region. Further, primers can be used in amplification reactions, such as for purposes of assaying one or more SNPs sites or for cloning specific regions of a gene.

An isolated nucleic acid molecule of the present invention further encompasses a SNP-containing polynucleotide that is the product of any one of a variety of nucleic acid amplification methods, which are used to increase the copy numbers of a polynucleotide of interest in a nucleic acid sample. Such amplification methods are well known in the art, and they include but are not limited to, polymerase chain reaction (PCR) (U.S. Pat. Nos. 4,683,195; and 4,683,202; PCR Technology: Principles and Applications for DNA Amplification, ed. H. A. Erlich, Freeman Press, NY, NY, 1992), ligase chain reaction (LCR) (Wu and Wallace, Genomics 4:560, 1989; Landegren et al., Science 241:1077, 1988), strand displacement amplification (SDA) (U.S. Pat. Nos. 5,270,184; and 5,422,252), transcription-mediated amplification (TMA) (U.S. Pat. No. 5,399,491), linked linear amplification (LLA) (U.S. Pat. No. 6,027,923), and the like, and isothermal amplification methods such as nucleic acid sequence based amplification (NASBA), and self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87: 1874, 1990). Based on such methodologies, a person skilled in the art can readily design primers in any suitable regions 5′ and 3′ to a SNP disclosed herein. Such primers may be used to amplify DNA of any length so long that it contains the SNP of interest in its sequence.

As used herein, an “amplified polynucleotide” of the invention is a SNP-containing nucleic acid molecule whose amount has been increased at least two fold by any nucleic acid amplification method performed in vitro as compared to its starting amount in a test sample. In other preferred embodiments, an amplified polynucleotide is the result of at least ten-fold, fifty-fold, one hundred-fold, one thousand-fold, or ten thousand-fold increase as compared to its starting amount in a test sample. In a typical PCR amplification, a polynucleotide of interest is often amplified at least fifty thousand-fold in amount over the unamplified genomic DNA, but the precise amount of amplification needed for an assay typically depends on the sensitivity of the subsequent detection method used.

Generally, an amplified polynucleotide is at least about 16 nucleotides in length. More typically, an amplified polynucleotide is at least about 20 nucleotides in length. In a preferred embodiment of the invention, an amplified polynucleotide is at least about 30 nucleotides in length. In a more preferred embodiment of the invention, an amplified polynucleotide is at least about 32, 40, 45, 50, or 60 nucleotides in length. In yet another preferred embodiment of the invention, an amplified polynucleotide is at least about 100, 200, 300, 400, or 500 nucleotides in length. While the total length of an amplified polynucleotide of the invention can be as long as an exon, an intron or the entire gene where the SNP of interest resides, an amplified product is typically up to about 1,000 nucleotides in length (although certain amplification methods may generate amplified products greater than 1000 nucleotides in length). More preferably, an amplified polynucleotide is not greater than about 600-700 nucleotides in length. It is understood that irrespective of the length of an amplified polynucleotide, a SNP of interest may be located anywhere along its sequence.

In a specific embodiment of the invention, the amplified product is at least about 201 nucleotides in length, comprises one of the transcript-based context sequences or the genomic-based context sequences shown in Tables 1-2. Such a product may have additional sequences on its 5′ end or 3′ end or both. In another embodiment, the amplified product is about 101 nucleotides in length, and it contains a SNP disclosed herein. Preferably, the SNP is located at the middle of the amplified product (e.g., at position 101 in an amplified product that is 201 nucleotides in length, or at position 51 in an amplified product that is 101 nucleotides in length), or within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, or 20 nucleotides from the middle of the amplified product (however, as indicated above, the SNP of interest may be located anywhere along the length of the amplified product).

The present invention provides isolated nucleic acid molecules that comprise, consist of, or consist essentially of one or more polynucleotide sequences that contain one or more SNPs disclosed herein, complements thereof, and SNP-containing fragments thereof.

Accordingly, the present invention provides nucleic acid molecules that consist of any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS:81-160). A nucleic acid molecule consists of a nucleotide sequence when the nucleotide sequence is the complete nucleotide sequence of the nucleic acid molecule.

The present invention further provides nucleic acid molecules that consist essentially of any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS:81-160). A nucleic acid molecule consists essentially of a nucleotide sequence when such a nucleotide sequence is present with only a few additional nucleotide residues in the final nucleic acid molecule.

The present invention further provides nucleic acid molecules that comprise any of the nucleotide sequences shown in Table 1 and/or Table 2 or a SNP-containing fragment thereof (transcript sequences are provided in Table 1 as SEQ ID NOS:1-80, genomic sequences are provided in Table 2 as SEQ ID NOS:260-435, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:161-259, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:436-1566), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS:81-160). A nucleic acid molecule comprises a nucleotide sequence when the nucleotide sequence is at least part of the final nucleotide sequence of the nucleic acid molecule. In such a fashion, the nucleic acid molecule can be only the nucleotide sequence or have additional nucleotide residues, such as residues that are naturally associated with it or heterologous nucleotide sequences. Such a nucleic acid molecule can have one to a few additional nucleotides or can comprise many more additional nucleotides. A brief description of how various types of these nucleic acid molecules can be readily made and isolated is provided below, and such techniques are well known to those of ordinary skill in the art (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY).

The isolated nucleic acid molecules can encode mature proteins plus additional amino or carboxyl-terminal amino acids or both, or amino acids interior to the mature peptide (when the mature form has more than one peptide chain, for instance). Such sequences may play a role in processing of a protein from precursor to a mature form, facilitate protein trafficking, prolong or shorten protein half-life, or facilitate manipulation of a protein for assay or production. As generally is the case in situ, the additional amino acids may be processed away from the mature protein by cellular enzymes.

Thus, the isolated nucleic acid molecules include, but are not limited to, nucleic acid molecules having a sequence encoding a peptide alone, a sequence encoding a mature peptide and additional coding sequences such as a leader or secretory sequence (e.g., a pre-pro or pro-protein sequence), a sequence encoding a mature peptide with or without additional coding sequences, plus additional non-coding sequences, for example introns and non-coding 5′ and 3′ sequences such as transcribed but untranslated sequences that play a role in, for example, transcription, mRNA processing (including splicing and polyadenylation signals), ribosome binding, and/or stability of mRNA. In addition, the nucleic acid molecules may be fused to heterologous marker sequences encoding, for example, a peptide that facilitates purification.

Isolated nucleic acid molecules can be in the form of RNA, such as mRNA, or in the form DNA, including cDNA and genomic DNA, which may be obtained, for example, by molecular cloning or produced by chemical synthetic techniques or by a combination thereof (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY). Furthermore, isolated nucleic acid molecules, particularly SNP detection reagents such as probes and primers, can also be partially or completely in the form of one or more types of nucleic acid analogs, such as peptide nucleic acid (PNA) (U.S. Pat. Nos. 5,539,082; 5,527,675; 5,623,049; 5,714,331). The nucleic acid, especially DNA, can be double-stranded or single-stranded. Single-stranded nucleic acid can be the coding strand (sense strand) or the complementary non-coding strand (anti-sense strand). DNA, RNA, or PNA segments can be assembled, for example, from fragments of the human genome (in the case of DNA or RNA) or single nucleotides, short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic nucleic acid molecule. Nucleic acid molecules can be readily synthesized using the sequences provided herein as a reference; oligonucleotide and PNA oligomer synthesis techniques are well known in the art (see, e.g., Corey, “Peptide nucleic acids: expanding the scope of nucleic acid recognition”, Trends Biotechnol. 1997 June; 15(6):224-9, and Hyrup et al., “Peptide nucleic acids (PNA): synthesis, properties and potential applications”, Bioorg Med Chem. 1996 January; 4(1):5-23). Furthermore, large-scale automated oligonucleotide/PNA synthesis (including synthesis on an array or bead surface or other solid support) can readily be accomplished using commercially available nucleic acid synthesizers, such as the Applied Biosystems (Foster City, Calif.) 3900 High-Throughput DNA Synthesizer or Expedite 8909 Nucleic Acid Synthesis System, and the sequence information provided herein.

The present invention encompasses nucleic acid analogs that contain modified, synthetic, or non-naturally occurring nucleotides or structural elements or other alternative/modified nucleic acid chemistries known in the art. Such nucleic acid analogs are useful, for example, as detection reagents (e.g., primers/probes) for detecting one or more SNPs identified in Table 1 and/or Table 2. Furthermore, kits/systems (such as beads, arrays, etc.) that include these analogs are also encompassed by the present invention. For example, PNA oligomers that are based on the polymorphic sequences of the present invention are specifically contemplated. PNA oligomers are analogs of DNA in which the phosphate backbone is replaced with a peptide-like backbone (Lagriffoul et al., Bioorganic & Medicinal Chemistry Letters, 4: 1081-1082 (1994), Petersen et al., Bioorganic & Medicinal Chemistry Letters, 6: 793-796 (1996), Kumar et al., Organic Letters 3(9): 1269-1272 (2001), WO96/04000). PNA hybridizes to complementary RNA or DNA with higher affinity and specificity than conventional oligonucleotides and oligonucleotide analogs. The properties of PNA enable novel molecular biology and biochemistry applications unachievable with traditional oligonucleotides and peptides.

Additional examples of nucleic acid modifications that improve the binding properties and/or stability of a nucleic acid include the use of base analogs such as inosine, intercalators (U.S. Pat. No. 4,835,263) and the minor groove binders (U.S. Pat. No. 5,801,115). Thus, references herein to nucleic acid molecules, SNP-containing nucleic acid molecules, SNP detection reagents (e.g., probes and primers), oligonucleotides/polynucleotides include PNA oligomers and other nucleic acid analogs. Other examples of nucleic acid analogs and alternative/modified nucleic acid chemistries known in the art are described in Current Protocols in Nucleic Acid Chemistry, John Wiley & Sons, N.Y. (2002).

The present invention further provides nucleic acid molecules that encode fragments of the variant polypeptides disclosed herein as well as nucleic acid molecules that encode obvious variants of such variant polypeptides. Such nucleic acid molecules may be naturally occurring, such as paralogs (different locus) and orthologs (different organism), or may be constructed by recombinant DNA methods or by chemical synthesis. Non-naturally occurring variants may be made by mutagenesis techniques, including those applied to nucleic acid molecules, cells, or organisms. Accordingly, the variants can contain nucleotide substitutions, deletions, inversions and insertions (in addition to the SNPs disclosed in Tables 1-2). Variation can occur in either or both the coding and non-coding regions. The variations can produce conservative and/or non-conservative amino acid substitutions.

Further variants of the nucleic acid molecules disclosed in Tables 1-2, such as naturally occurring allelic variants (as well as orthologs and paralogs) and synthetic variants produced by mutagenesis techniques, can be identified and/or produced using methods well known in the art. Such further variants can comprise a nucleotide sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with a nucleic acid sequence disclosed in Table 1 and/or Table 2 (or a fragment thereof) and that includes a novel SNP allele disclosed in Table 1 and/or Table 2. Further, variants can comprise a nucleotide sequence that encodes a polypeptide that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with a polypeptide sequence disclosed in Table 1 (or a fragment thereof) and that includes a novel SNP allele disclosed in Table 1 and/or Table 2. Thus, an aspect of the present invention that is specifically contemplated are isolated nucleic acid molecules that have a certain degree of sequence variation compared with the sequences shown in Tables 1-2, but that contain a novel SNP allele disclosed herein. In other words, as long as an isolated nucleic acid molecule contains a novel SNP allele disclosed herein, other portions of the nucleic acid molecule that flank the novel SNP allele can vary to some degree from the specific transcript, genomic, and context sequences shown in Tables 1-2, and can encode a polypeptide that varies to some degree from the specific polypeptide sequences shown in Table 1.

To determine the percent identity of two amino acid sequences or two nucleotide sequences of two molecules that share sequence homology, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the length of a reference sequence is aligned for comparison purposes. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein, amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch algorithm (J. Mol. Biol. (48):444-453 (1970)) which has been incorporated into the GAP program in the GCG software package, using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (Devereux, J., et al., Nucleic Acids Res. 12(1):387 (1984)), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. In another embodiment, the percent identity between two amino acid or nucleotide sequences is determined using the algorithm of E. Myers and W. Miller (CABIOS, 4:11-17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.

The nucleotide and amino acid sequences of the present invention can further be used as a “query sequence” to perform a search against sequence databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (J. Mol. Biol. 215:403-10 (1990)). BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the proteins of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res. 25(17):3389-3402 (1997)). When utilizing BLAST and gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. In addition to BLAST, examples of other search and sequence comparison programs used in the art include, but are not limited to, FASTA (Pearson, Methods Mol. Biol. 25, 365-389 (1994)) and KERR (Dufresne et al., Nat Biotechnol 2002 December; 20(12):1269-71). For further information regarding bioinformatics techniques, see Current Protocols in Bioinformatics, John Wiley & Sons, Inc., N.Y.

The present invention further provides non-coding fragments of the nucleic acid molecules disclosed in Table 1 and/or Table 2. Preferred non-coding fragments include, but are not limited to, promoter sequences, enhancer sequences, intronic sequences, 5′ untranslated regions (UTRs), 3′ untranslated regions, gene modulating sequences and gene termination sequences. Such fragments are useful, for example, in controlling heterologous gene expression and in developing screens to identify gene-modulating agents.

SNP Detection Reagents

In a specific aspect of the present invention, the SNPs disclosed in Table 1 and/or Table 2, and their associated transcript sequences (provided in Table 1 as SEQ ID NOS:1-80), genomic sequences (provided in Table 2 as SEQ ID NOS:260-435), and context sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:161-259; genomic-based context sequences are provided in Table 2 as SEQ ID NOS:436-1566), can be used for the design of SNP detection reagents. As used herein, a “SNP detection reagent” is a reagent that specifically detects a specific target SNP position disclosed herein, and that is preferably specific for a particular nucleotide (allele) of the target SNP position (i.e., the detection reagent preferably can differentiate between different alternative nucleotides at a target SNP position, thereby allowing the identity of the nucleotide present at the target SNP position to be determined). Typically, such detection reagent hybridizes to a target SNP-containing nucleic acid molecule by complementary base-pairing in a sequence specific manner, and discriminates the target variant sequence from other nucleic acid sequences such as an art-known form in a test sample. An example of a detection reagent is a probe that hybridizes to a target nucleic acid containing one or more of the SNPs provided in Table 1 and/or Table 2. In a preferred embodiment, such a probe can differentiate between nucleic acids having a particular nucleotide (allele) at a target SNP position from other nucleic acids that have a different nucleotide at the same target SNP position. In addition, a detection reagent may hybridize to a specific region 5′ and/or 3′ to a SNP position, particularly a region corresponding to the context sequences provided in Table 1 and/or Table 2 (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:161-259; genomic-based context sequences are provided in Table 2 as SEQ ID NOS:436-1566). Another example of a detection reagent is a primer which acts as an initiation point of nucleotide extension along a complementary strand of a target polynucleotide. The SNP sequence information provided herein is also useful for designing primers, e.g. allele-specific primers, to amplify (e.g., using PCR) any SNP of the present invention.

In one preferred embodiment of the invention, a SNP detection reagent is an isolated or synthetic DNA or RNA polynucleotide probe or primer or PNA oligomer, or a combination of DNA, RNA and/or PNA, that hybridizes to a segment of a target nucleic acid molecule containing a SNP identified in Table 1 and/or Table 2. A detection reagent in the form of a polynucleotide may optionally contain modified base analogs, intercalators or minor groove binders. Multiple detection reagents such as probes may be, for example, affixed to a solid support (e.g., arrays or beads) or supplied in solution (e.g., probe/primer sets for enzymatic reactions such as PCR, RT-PCR, TaqMan assays, or primer-extension reactions) to form a SNP detection kit.

A probe or primer typically is a substantially purified oligonucleotide or PNA oligomer. Such oligonucleotide typically comprises a region of complementary nucleotide sequence that hybridizes under stringent conditions to at least about 8, 10, 12, 16, 18, 20, 22, 25, 30, 40, 50, 55, 60, 65, 70, 80, 90, 100, 120 (or any other number in-between) or more consecutive nucleotides in a target nucleic acid molecule. Depending on the particular assay, the consecutive nucleotides can either include the target SNP position, or be a specific region in close enough proximity 5′ and/or 3′ to the SNP position to carry out the desired assay.

Other preferred primer and probe sequences can readily be determined using the transcript sequences (SEQ ID NOS:1-80), genomic sequences (SEQ ID NOS:260-435), and SNP context sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:161-259; genomic-based context sequences are provided in Table 2 as SEQ ID NOS:436-1566) disclosed in the Sequence Listing and in Tables 1-2. It will be apparent to one of skill in the art that such primers and probes are directly useful as reagents for genotyping the SNPs of the present invention, and can be incorporated into any kit/system format.

In order to produce a probe or primer specific for a target SNP-containing sequence, the gene/transcript and/or context sequence surrounding the SNP of interest is typically examined using a computer algorithm which starts at the 5′ or at the 3′ end of the nucleotide sequence. Typical algorithms will then identify oligomers of defined length that are unique to the gene/SNP context sequence, have a GC content within a range suitable for hybridization, lack predicted secondary structure that may interfere with hybridization, and/or possess other desired characteristics or that lack other undesired characteristics.

A primer or probe of the present invention is typically at least about 8 nucleotides in length. In one embodiment of the invention, a primer or a probe is at least about 10 nucleotides in length. In a preferred embodiment, a primer or a probe is at least about 12 nucleotides in length. In a more preferred embodiment, a primer or probe is at least about 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. While the maximal length of a probe can be as long as the target sequence to be detected, depending on the type of assay in which it is employed, it is typically less than about 50, 60, 65, or 70 nucleotides in length. In the case of a primer, it is typically less than about 30 nucleotides in length. In a specific preferred embodiment of the invention, a primer or a probe is within the length of about 18 and about 28 nucleotides. However, in other embodiments, such as nucleic acid arrays and other embodiments in which probes are affixed to a substrate, the probes can be longer, such as on the order of 30-70, 75, 80, 90, 100, or more nucleotides in length (see the section below entitled “SNP Detection Kits and Systems”).

For analyzing SNPs, it may be appropriate to use oligonucleotides specific for alternative SNP alleles. Such oligonucleotides which detect single nucleotide variations in target sequences may be referred to by such terms as “allele-specific oligonucleotides”, “allele-specific probes”, or “allele-specific primers”. The design and use of allele-specific probes for analyzing polymorphisms is described in, e.g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al., Nature 324, 163-166 (1986); Dattagupta, EP235,726; and Saiki, WO 89/11548.

While the design of each allele-specific primer or probe depends on variables such as the precise composition of the nucleotide sequences flanking a SNP position in a target nucleic acid molecule, and the length of the primer or probe, another factor in the use of primers and probes is the stringency of the condition under which the hybridization between the probe or primer and the target sequence is performed. Higher stringency conditions utilize buffers with lower ionic strength and/or a higher reaction temperature, and tend to require a more perfect match between probe/primer and a target sequence in order to form a stable duplex. If the stringency is too high, however, hybridization may not occur at all. In contrast, lower stringency conditions utilize buffers with higher ionic strength and/or a lower reaction temperature, and permit the formation of stable duplexes with more mismatched bases between a probe/primer and a target sequence. By way of example and not limitation, exemplary conditions for high stringency hybridization conditions using an allele-specific probe are as follows: Prehybridization with a solution containing 5× standard saline phosphate EDTA (SSPE), 0.5% NaDodSO₄ (SDS) at 55° C., and incubating probe with target nucleic acid molecules in the same solution at the same temperature, followed by washing with a solution containing 2×SSPE, and 0.1% SDS at 55° C. or room temperature.

Moderate stringency hybridization conditions may be used for allele-specific primer extension reactions with a solution containing, e.g., about 50 mM KCl at about 46° C. Alternatively, the reaction may be carried out at an elevated temperature such as 60° C. In another embodiment, a moderately stringent hybridization condition suitable for oligonucleotide ligation assay (OLA) reactions wherein two probes are ligated if they are completely complementary to the target sequence may utilize a solution of about 100 mM KCl at a temperature of 46° C.

In a hybridization-based assay, allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms (e.g., alternative SNP alleles/nucleotides) in the respective DNA segments from the two individuals. Hybridization conditions should be sufficiently stringent that there is a significant detectable difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe hybridizes to only one of the alleles or significantly more strongly to one allele. While a probe may be designed to hybridize to a target sequence that contains a SNP site such that the SNP site aligns anywhere along the sequence of the probe, the probe is preferably designed to hybridize to a segment of the target sequence such that the SNP site aligns with a central position of the probe (e.g., a position within the probe that is at least three nucleotides from either end of the probe). This design of probe generally achieves good discrimination in hybridization between different allelic forms.

In another embodiment, a probe or primer may be designed to hybridize to a segment of target DNA such that the SNP aligns with either the 5′ most end or the 3′ most end of the probe or primer. In a specific preferred embodiment which is particularly suitable for use in a oligonucleotide ligation assay (U.S. Pat. No. 4,988,617), the 3′most nucleotide of the probe aligns with the SNP position in the target sequence.

Oligonucleotide probes and primers may be prepared by methods well known in the art. Chemical synthetic methods include, but are limited to, the phosphotriester method described by Narang et al., 1979, Methods in Enzymology 68:90; the phosphodiester method described by Brown et al., 1979, Methods in Enzymology 68:109, the diethylphosphoamidate method described by Beaucage et al., 1981, Tetrahedron Letters 22:1859; and the solid support method described in U.S. Pat. No. 4,458,066.

Allele-specific probes are often used in pairs (or, less commonly, in sets of 3 or 4, such as if a SNP position is known to have 3 or 4 alleles, respectively, or to assay both strands of a nucleic acid molecule for a target SNP allele), and such pairs may be identical except for a one nucleotide mismatch that represents the allelic variants at the SNP position. Commonly, one member of a pair perfectly matches a reference form of a target sequence that has a more common SNP allele (i.e., the allele that is more frequent in the target population) and the other member of the pair perfectly matches a form of the target sequence that has a less common SNP allele (i.e., the allele that is rarer in the target population). In the case of an array, multiple pairs of probes can be immobilized on the same support for simultaneous analysis of multiple different polymorphisms.

In one type of PCR-based assay, an allele-specific primer hybridizes to a region on a target nucleic acid molecule that overlaps a SNP position and only primes amplification of an allelic form to which the primer exhibits perfect complementarity (Gibbs, 1989, Nucleic Acid Res. 17 2427-2448). Typically, the primer's 3′-most nucleotide is aligned with and complementary to the SNP position of the target nucleic acid molecule. This primer is used in conjunction with a second primer that hybridizes at a distal site. Amplification proceeds from the two primers, producing a detectable product that indicates which allelic form is present in the test sample. A control is usually performed with a second pair of primers, one of which shows a single base mismatch at the polymorphic site and the other of which exhibits perfect complementarity to a distal site. The single-base mismatch prevents amplification or substantially reduces amplification efficiency, so that either no detectable product is formed or it is formed in lower amounts or at a slower pace. The method generally works most effectively when the mismatch is at the 3′-most position of the oligonucleotide (i.e., the 3′-most position of the oligonucleotide aligns with the target SNP position) because this position is most destabilizing to elongation from the primer (see, e.g., WO 93/22456). This PCR-based assay can be utilized as part of the TaqMan assay, described below.

In a specific embodiment of the invention, a primer of the invention contains a sequence substantially complementary to a segment of a target SNP-containing nucleic acid molecule except that the primer has a mismatched nucleotide in one of the three nucleotide positions at the 3′-most end of the primer, such that the mismatched nucleotide does not base pair with a particular allele at the SNP site. In a preferred embodiment, the mismatched nucleotide in the primer is the second from the last nucleotide at the 3′-most position of the primer. In a more preferred embodiment, the mismatched nucleotide in the primer is the last nucleotide at the 3′-most position of the primer.

In another embodiment of the invention, a SNP detection reagent of the invention is labeled with a fluorogenic reporter dye that emits a detectable signal. While the preferred reporter dye is a fluorescent dye, any reporter dye that can be attached to a detection reagent such as an oligonucleotide probe or primer is suitable for use in the invention. Such dyes include, but are not limited to, Acridine, AMCA, BODIPY, Cascade Blue, Cy2, Cy3, Cy5, Cy7, Dabcyl, Edans, Eosin, Erythrosin, Fluorescein, 6-Fam, Tet, Joe, Hex, Oregon Green, Rhodamine, Rhodol Green, Tamra, Rox, and Texas Red.

In yet another embodiment of the invention, the detection reagent may be further labeled with a quencher dye such as Tamra, especially when the reagent is used as a self-quenching probe such as a TaqMan (U.S. Pat. Nos. 5,210,015 and 5,538,848) or Molecular Beacon probe (U.S. Pat. Nos. 5,118,801 and 5,312,728), or other stemless or linear beacon probe (Livak et al., 1995, PCR Method Appl. 4:357-362; Tyagi et al., 1996, Nature Biotechnology 14: 303-308; Nazarenko et al., 1997, Nucl. Acids Res. 25:2516-2521; U.S. Pat. Nos. 5,866,336 and 6,117,635).

The detection reagents of the invention may also contain other labels, including but not limited to, biotin for streptavidin binding, hapten for antibody binding, and oligonucleotide for binding to another complementary oligonucleotide such as pairs of zipcodes.

The present invention also contemplates reagents that do not contain (or that are complementary to) a SNP nucleotide identified herein but that are used to assay one or more SNPs disclosed herein. For example, primers that flank, but do not hybridize directly to a target SNP position provided herein are useful in primer extension reactions in which the primers hybridize to a region adjacent to the target SNP position (i.e., within one or more nucleotides from the target SNP site). During the primer extension reaction, a primer is typically not able to extend past a target SNP site if a particular nucleotide (allele) is present at that target SNP site, and the primer extension product can be detected in order to determine which SNP allele is present at the target SNP site. For example, particular ddNTPs are typically used in the primer extension reaction to terminate primer extension once a ddNTP is incorporated into the extension product (a primer extension product which includes a ddNTP at the 3′-most end of the primer extension product, and in which the ddNTP is a nucleotide of a SNP disclosed herein, is a composition that is specifically contemplated by the present invention). Thus, reagents that bind to a nucleic acid molecule in a region adjacent to a SNP site and that are used for assaying the SNP site, even though the bound sequences do not necessarily include the SNP site itself, are also contemplated by the present invention.

SNP Detection Kits and Systems

A person skilled in the art will recognize that, based on the SNP and associated sequence information disclosed herein, detection reagents can be developed and used to assay any SNP of the present invention individually or in combination, and such detection reagents can be readily incorporated into one of the established kit or system formats which are well known in the art. The terms “kits” and “systems”, as used herein in the context of SNP detection reagents, are intended to refer to such things as combinations of multiple SNP detection reagents, or one or more SNP detection reagents in combination with one or more other types of elements or components (e.g., other types of biochemical reagents, containers, packages such as packaging intended for commercial sale, substrates to which SNP detection reagents are attached, electronic hardware components, etc.). Accordingly, the present invention further provides SNP detection kits and systems, including but not limited to, packaged probe and primer sets (e.g., TaqMan probe/primer sets), arrays/microarrays of nucleic acid molecules, and beads that contain one or more probes, primers, or other detection reagents for detecting one or more SNPs of the present invention. The kits/systems can optionally include various electronic hardware components; for example, arrays (“DNA chips”) and microfluidic systems (“lab-on-a-chip” systems) provided by various manufacturers typically comprise hardware components. Other kits/systems (e.g., probe/primer sets) may not include electronic hardware components, but may be comprised of, for example, one or more SNP detection reagents (along with, optionally, other biochemical reagents) packaged in one or more containers.

In some embodiments, a SNP detection kit typically contains one or more detection reagents and other components (e.g., a buffer, enzymes such as DNA polymerases or ligases, chain extension nucleotides such as deoxynucleotide triphosphates, and in the case of Sanger-type DNA sequencing reactions, chain terminating nucleotides, positive control sequences, negative control sequences, and the like) necessary to carry out an assay or reaction, such as amplification and/or detection of a SNP-containing nucleic acid molecule. A kit may further contain means for determining the amount of a target nucleic acid, and means for comparing the amount with a standard, and can comprise instructions for using the kit to detect the SNP-containing nucleic acid molecule of interest. In one embodiment of the present invention, kits are provided which contain the necessary reagents to carry out one or more assays to detect one or more SNPs disclosed herein. In a preferred embodiment of the present invention, SNP detection kits/systems are in the form of nucleic acid arrays, or compartmentalized kits, including microfluidic/lab-on-a-chip systems.

SNP detection kits/systems may contain, for example, one or more probes, or pairs of probes, that hybridize to a nucleic acid molecule at or near each target SNP position. Multiple pairs of allele-specific probes may be included in the kit/system to simultaneously assay large numbers of SNPs, at least one of which is a SNP of the present invention. In some kits/systems, the allele-specific probes are immobilized to a substrate such as an array or bead. For example, the same substrate can comprise allele-specific probes for detecting at least 1; 10; 100; 1000; 10,000; 100,000 (or any other number in-between) or substantially all of the SNPs shown in Table 1 and/or Table 2.

The terms “arrays”, “microarrays”, and “DNA chips” are used herein interchangeably to refer to an array of distinct polynucleotides affixed to a substrate, such as glass, plastic, paper, nylon or other type of membrane, filter, chip, or any other suitable solid support. The polynucleotides can be synthesized directly on the substrate, or synthesized separate from the substrate and then affixed to the substrate. In one embodiment, the microarray is prepared and used according to the methods described in U.S. Pat. No. 5,837,832, Chee et al., PCT application WO95/11995 (Chee et al.), Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619), all of which are incorporated herein in their entirety by reference. In other embodiments, such arrays are produced by the methods described by Brown et al., U.S. Pat. No. 5,807,522.

Nucleic acid arrays are reviewed in the following references: Zammatteo et al., “New chips for molecular biology and diagnostics”, Biotechnol Annu Rev. 2002; 8:85-101; Sosnowski et al., “Active microelectronic array system for DNA hybridization, genotyping and pharmacogenomic applications”, Psychiatr Genet. 2002 December; 12(4):181-92; Heller, “DNA microarray technology: devices, systems, and applications”, Annu Rev Biomed Eng. 2002; 4:129-53. Epub 2002 Mar. 22; Kolchinsky et al., “Analysis of SNPs and other genomic variations using gel-based chips”, Hum Mutat. 2002 April; 19(4):343-60; and McGall et al., “High-density genechip oligonucleotide probe arrays”, Adv Biochem Eng Biotechnol. 2002; 77:21-42.

Any number of probes, such as allele-specific probes, may be implemented in an array, and each probe or pair of probes can hybridize to a different SNP position. In the case of polynucleotide probes, they can be synthesized at designated areas (or synthesized separately and then affixed to designated areas) on a substrate using a light-directed chemical process. Each DNA chip can contain, for example, thousands to millions of individual synthetic polynucleotide probes arranged in a grid-like pattern and miniaturized (e.g., to the size of a dime). Preferably, probes are attached to a solid support in an ordered, addressable array.

A microarray can be composed of a large number of unique, single-stranded polynucleotides, usually either synthetic antisense polynucleotides or fragments of cDNAs, fixed to a solid support. Typical polynucleotides are preferably about 6-60 nucleotides in length, more preferably about 15-30 nucleotides in length, and most preferably about 18-25 nucleotides in length. For certain types of microarrays or other detection kits/systems, it may be preferable to use oligonucleotides that are only about 7-20 nucleotides in length. In other types of arrays, such as arrays used in conjunction with chemiluminescent detection technology, preferred probe lengths can be, for example, about 15-80 nucleotides in length, preferably about 50-70 nucleotides in length, more preferably about 55-65 nucleotides in length, and most preferably about 60 nucleotides in length. The microarray or detection kit can contain polynucleotides that cover the known 5′ or 3′ sequence of a gene/transcript or target SNP site, sequential polynucleotides that cover the full-length sequence of a gene/transcript; or unique polynucleotides selected from particular areas along the length of a target gene/transcript sequence, particularly areas corresponding to one or more SNPs disclosed in Table 1 and/or Table 2. Polynucleotides used in the microarray or detection kit can be specific to a SNP or SNPs of interest (e.g., specific to a particular SNP allele at a target SNP site, or specific to particular SNP alleles at multiple different SNP sites), or specific to a polymorphic gene/transcript or genes/transcripts of interest.

Hybridization assays based on polynucleotide arrays rely on the differences in hybridization stability of the probes to perfectly matched and mismatched target sequence variants. For SNP genotyping, it is generally preferable that stringency conditions used in hybridization assays are high enough such that nucleic acid molecules that differ from one another at as little as a single SNP position can be differentiated (e.g., typical SNP hybridization assays are designed so that hybridization will occur only if one particular nucleotide is present at a SNP position, but will not occur if an alternative nucleotide is present at that SNP position). Such high stringency conditions may be preferable when using, for example, nucleic acid arrays of allele-specific probes for SNP detection. Such high stringency conditions are described in the preceding section, and are well known to those skilled in the art and can be found in, for example, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.

In other embodiments, the arrays are used in conjunction with chemiluminescent detection technology. The following patents and patent applications, which are all hereby incorporated by reference, provide additional information pertaining to chemiluminescent detection: U.S. patent application Ser. Nos. 10/620,332 and 10/620,333 describe chemiluminescent approaches for microarray detection; U.S. Pat. Nos. 6,124,478, 6,107,024, 5,994,073, 5,981,768, 5,871,938, 5,843,681, 5,800,999, and 5,773,628 describe methods and compositions of dioxetane for performing chemiluminescent detection; and U.S. published application US2002/0110828 discloses methods and compositions for microarray controls.

In one embodiment of the invention, a nucleic acid array can comprise an array of probes of about 15-25 nucleotides in length. In further embodiments, a nucleic acid array can comprise any number of probes, in which at least one probe is capable of detecting one or more SNPs disclosed in Table 1 and/or Table 2, and/or at least one probe comprises a fragment of one of the sequences selected from the group consisting of those disclosed in Table 1, Table 2, the Sequence Listing, and sequences complementary thereto, said fragment comprising at least about 8 consecutive nucleotides, preferably 10, 12, 15, 16, 18, 20, more preferably 22, 25, 30, 40, 47, 50, 55, 60, 65, 70, 80, 90, 100, or more consecutive nucleotides (or any other number in-between) and containing (or being complementary to) a novel SNP allele disclosed in Table 1 and/or Table 2. In some embodiments, the nucleotide complementary to the SNP site is within 5, 4, 3, 2, or 1 nucleotide from the center of the probe, more preferably at the center of said probe.

A polynucleotide probe can be synthesized on the surface of the substrate by using a chemical coupling procedure and an ink jet application apparatus, as described in PCT application WO95/251116 (Baldeschweiler et al.) which is incorporated herein in its entirety by reference. In another aspect, a “gridded” array analogous to a dot (or slot) blot may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An array, such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536, 6144 or more polynucleotides, or any other number which lends itself to the efficient use of commercially available instrumentation.

Using such arrays or other kits/systems, the present invention provides methods of identifying the SNPs disclosed herein in a test sample. Such methods typically involve incubating a test sample of nucleic acids with an array comprising one or more probes corresponding to at least one SNP position of the present invention, and assaying for binding of a nucleic acid from the test sample with one or more of the probes. Conditions for incubating a SNP detection reagent (or a kit/system that employs one or more such SNP detection reagents) with a test sample vary. Incubation conditions depend on such factors as the format employed in the assay, the detection methods employed, and the type and nature of the detection reagents used in the assay. One skilled in the art will recognize that any one of the commonly available hybridization, amplification and array assay formats can readily be adapted to detect the SNPs disclosed herein.

A SNP detection kit/system of the present invention may include components that are used to prepare nucleic acids from a test sample for the subsequent amplification and/or detection of a SNP-containing nucleic acid molecule. Such sample preparation components can be used to produce nucleic acid extracts (including DNA and/or RNA), proteins or membrane extracts from any bodily fluids (such as blood, serum, plasma, urine, saliva, phlegm, gastric juices, semen, tears, sweat, etc.), skin, hair, cells (especially nucleated cells), biopsies, buccal cells (e.g., as obtained by buccal swabs), or tissue specimens. The test samples used in the above-described methods will vary based on such factors as the assay format, nature of the detection method, and the specific tissues, cells or extracts used as the test sample to be assayed. Methods of preparing nucleic acids, proteins, and cell extracts are well known in the art and can be readily adapted to obtain a sample that is compatible with the system utilized. Automated sample preparation systems for extracting nucleic acids from a test sample are commercially available, and examples are Qiagen's BioRobot 9600, Applied Biosystems' PRISM™ 6700 sample preparation system, and Roche Molecular Systems' COBAS AmpliPrep System.

Another form of kit contemplated by the present invention is a compartmentalized kit. A compartmentalized kit includes any kit in which reagents are contained in separate containers. Such containers include, for example, small glass containers, plastic containers, strips of plastic, glass or paper, or arraying material such as silica. Such containers allow one to efficiently transfer reagents from one compartment to another compartment such that the test samples and reagents are not cross-contaminated, or from one container to another vessel not included in the kit, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another or to another vessel. Such containers may include, for example, one or more containers which will accept the test sample, one or more containers which contain at least one probe or other SNP detection reagent for detecting one or more SNPs of the present invention, one or more containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, etc.), and one or more containers which contain the reagents used to reveal the presence of the bound probe or other SNP detection reagents. The kit can optionally further comprise compartments and/or reagents for, for example, nucleic acid amplification or other enzymatic reactions such as primer extension reactions, hybridization, ligation, electrophoresis (preferably capillary electrophoresis), mass spectrometry, and/or laser-induced fluorescent detection. The kit may also include instructions for using the kit. Exemplary compartmentalized kits include microfluidic devices known in the art (see, e.g., Weigl et al., “Lab-on-a-chip for drug development”, Adv Drug Deliv Rev. 2003 Feb. 24; 55(3):349-77). In such microfluidic devices, the containers may be referred to as, for example, microfluidic “compartments”, “chambers”, or “channels”.

Microfluidic devices, which may also be referred to as “lab-on-a-chip” systems, biomedical micro-electro-mechanical systems (bioMEMs), or multicomponent integrated systems, are exemplary kits/systems of the present invention for analyzing SNPs. Such systems miniaturize and compartmentalize processes such as probe/target hybridization, nucleic acid amplification, and capillary electrophoresis reactions in a single functional device. Such microfluidic devices typically utilize detection reagents in at least one aspect of the system, and such detection reagents may be used to detect one or more SNPs of the present invention. One example of a microfluidic system is disclosed in U.S. Pat. No. 5,589,136, which describes the integration of PCR amplification and capillary electrophoresis in chips. Exemplary microfluidic systems comprise a pattern of microchannels designed onto a glass, silicon, quartz, or plastic wafer included on a microchip. The movements of the samples may be controlled by electric, electroosmotic or hydrostatic forces applied across different areas of the microchip to create functional microscopic valves and pumps with no moving parts. Varying the voltage can be used as a means to control the liquid flow at intersections between the micro-machined channels and to change the liquid flow rate for pumping across different sections of the microchip. See, for example, U.S. Pat. No. 6,153,073, Dubrow et al., and U.S. Pat. No. 6,156,181, Parce et al.

For genotyping SNPs, an exemplary microfluidic system may integrate, for example, nucleic acid amplification, primer extension, capillary electrophoresis, and a detection method such as laser induced fluorescence detection. In a first step of an exemplary process for using such an exemplary system, nucleic acid samples are amplified, preferably by PCR. Then, the amplification products are subjected to automated primer extension reactions using ddNTPs (specific fluorescence for each ddNTP) and the appropriate oligonucleotide primers to carry out primer extension reactions which hybridize just upstream of the targeted SNP. Once the extension at the 3′ end is completed, the primers are separated from the unincorporated fluorescent ddNTPs by capillary electrophoresis. The separation medium used in capillary electrophoresis can be, for example, polyacrylamide, polyethyleneglycol or dextran. The incorporated ddNTPs in the single nucleotide primer extension products are identified by laser-induced fluorescence detection. Such an exemplary microchip can be used to process, for example, at least 96 to 384 samples, or more, in parallel.

Uses of Nucleic Acid Molecules

The nucleic acid molecules of the present invention have a variety of uses, especially in the diagnosis and treatment of stroke and related pathologies. For example, the nucleic acid molecules are useful as hybridization probes, such as for genotyping SNPs in messenger RNA, transcript, cDNA, genomic DNA, amplified DNA or other nucleic acid molecules, and for isolating full-length cDNA and genomic clones encoding the variant peptides disclosed in Table 1 as well as their orthologs.

A probe can hybridize to any nucleotide sequence along the entire length of a nucleic acid molecule provided in Table 1 and/or Table 2. Preferably, a probe of the present invention hybridizes to a region of a target sequence that encompasses a SNP position indicated in Table 1 and/or Table 2. More preferably, a probe hybridizes to a SNP-containing target sequence in a sequence-specific manner such that it distinguishes the target sequence from other nucleotide sequences which vary from the target sequence only by which nucleotide is present at the SNP site. Such a probe is particularly useful for detecting the presence of a SNP-containing nucleic acid in a test sample, or for determining which nucleotide (allele) is present at a particular SNP site (i.e., genotyping the SNP site).

A nucleic acid hybridization probe may be used for determining the presence, level, form, and/or distribution of nucleic acid expression. The nucleic acid whose level is determined can be DNA or RNA. Accordingly, probes specific for the SNPs described herein can be used to assess the presence, expression and/or gene copy number in a given cell, tissue, or organism. These uses are relevant for diagnosis of disorders involving an increase or decrease in gene expression relative to normal levels. In vitro techniques for detection of mRNA include, for example, Northern blot hybridizations and in situ hybridizations. In vitro techniques for detecting DNA include Southern blot hybridizations and in situ hybridizations (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.).

Probes can be used as part of a diagnostic test kit for identifying cells or tissues in which a variant protein is expressed, such as by measuring the level of a variant protein-encoding nucleic acid (e.g., mRNA) in a sample of cells from a subject or determining if a polynucleotide contains a SNP of interest.

Thus, the nucleic acid molecules of the invention can be used as hybridization probes to detect the SNPs disclosed herein, thereby determining whether an individual with the polymorphisms is at risk for stroke and related pathologies. Detection of a SNP associated with a disease phenotype provides a diagnostic tool for an active disease and/or genetic predisposition to the disease.

Furthermore, the nucleic acid molecules of the invention are therefore useful for detecting a gene (gene information is disclosed in Table 2, for example) which contains a SNP disclosed herein and/or products of such genes, such as expressed mRNA transcript molecules (transcript information is disclosed in Table 1, for example), and are thus useful for detecting gene expression. The nucleic acid molecules can optionally be implemented in, for example, an array or kit format for use in detecting gene expression.

The nucleic acid molecules of the invention are also useful as primers to amplify any given region of a nucleic acid molecule, particularly a region containing a SNP identified in Table 1 and/or Table 2.

The nucleic acid molecules of the invention are also useful for constructing recombinant vectors (described in greater detail below). Such vectors include expression vectors that express a portion of, or all of, any of the variant peptide sequences provided in Table 1. Vectors also include insertion vectors, used to integrate into another nucleic acid molecule sequence, such as into the cellular genome, to alter in situ expression of a gene and/or gene product. For example, an endogenous coding sequence can be replaced via homologous recombination with all or part of the coding region containing one or more specifically introduced SNPs.

The nucleic acid molecules of the invention are also useful for expressing antigenic portions of the variant proteins, particularly antigenic portions that contain a variant amino acid sequence (e.g., an amino acid substitution) caused by a SNP disclosed in Table 1 and/or Table 2.

The nucleic acid molecules of the invention are also useful for constructing vectors containing a gene regulatory region of the nucleic acid molecules of the present invention.

The nucleic acid molecules of the invention are also useful for designing ribozymes corresponding to all, or a part, of an mRNA molecule expressed from a SNP-containing nucleic acid molecule described herein.

The nucleic acid molecules of the invention are also useful for constructing host cells expressing a part, or all, of the nucleic acid molecules and variant peptides.

The nucleic acid molecules of the invention are also useful for constructing transgenic animals expressing all, or a part, of the nucleic acid molecules and variant peptides. The production of recombinant cells and transgenic animals having nucleic acid molecules which contain the SNPs disclosed in Table 1 and/or Table 2 allow, for example, effective clinical design of treatment compounds and dosage regimens.

The nucleic acid molecules of the invention are also useful in assays for drug screening to identify compounds that, for example, modulate nucleic acid expression.

The nucleic acid molecules of the invention are also useful in gene therapy in patients whose cells have aberrant gene expression. Thus, recombinant cells, which include a patient's cells that have been engineered ex vivo and returned to the patient, can be introduced into an individual where the recombinant cells produce the desired protein to treat the individual.

SNP Genotyping Methods

The process of determining which specific nucleotide (i.e., allele) is present at each of one or more SNP positions, such as a SNP position in a nucleic acid molecule disclosed in Table 1 and/or Table 2, is referred to as SNP genotyping. The present invention provides methods of SNP genotyping, such as for use in determining predisposition to stroke or related pathologies, or determining responsiveness to a form of treatment, or in genome mapping or SNP association analysis, etc.

Nucleic acid samples can be genotyped to determine which allele(s) is/are present at any given genetic region (e.g., SNP position) of interest by methods well known in the art. The neighboring sequence can be used to design SNP detection reagents such as oligonucleotide probes, which may optionally be implemented in a kit format. Exemplary SNP genotyping methods are described in Chen et al., “Single nucleotide polymorphism genotyping: biochemistry, protocol, cost and throughput”, Pharmacogenomics J. 2003; 3(2):77-96; Kwok et al., “Detection of single nucleotide polymorphisms”, Curr Issues Mol Biol. 2003 April; 5(2):43-60; Shi, “Technologies for individual genotyping: detection of genetic polymorphisms in drug targets and disease genes”, Am J Pharmacogenomics. 2002; 2(3):197-205; and Kwok, “Methods for genotyping single nucleotide polymorphisms”, Annu Rev Genomics Hum Genet 2001; 2:235-58. Exemplary techniques for high-throughput SNP genotyping are described in Marnellos, “High-throughput SNP analysis for genetic association studies”, Curr Opin Drug Discov Devel. 2003 May; 6(3):317-21. Common SNP genotyping methods include, but are not limited to, TaqMan assays, molecular beacon assays, nucleic acid arrays, allele-specific primer extension, allele-specific PCR, arrayed primer extension, homogeneous primer extension assays, primer extension with detection by mass spectrometry, pyrosequencing, multiplex primer extension sorted on genetic arrays, ligation with rolling circle amplification, homogeneous ligation, OLA (U.S. Pat. No. 4,988,167), multiplex ligation reaction sorted on genetic arrays, restriction-fragment length polymorphism, single base extension-tag assays, and the Invader assay. Such methods may be used in combination with detection mechanisms such as, for example, luminescence or chemiluminescence detection, fluorescence detection, time-resolved fluorescence detection, fluorescence resonance energy transfer, fluorescence polarization, mass spectrometry, and electrical detection.

Various methods for detecting polymorphisms include, but are not limited to, methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA duplexes (Myers et A, Science 230:1242 (1985); Cotton et al., PNAS 85:4397 (1988); and Saleeba et A, Meth. Enzymol. 217:286-295 (1992)), comparison of the electrophoretic mobility of variant and wild type nucleic acid molecules (Orita et al., PNAS 86:2766 (1989); Cotton et A, Mutat. Res. 285:125-144 (1993); and Hayashi et al., Genet. Anal. Tech. Appl. 9:73-79 (1992)), and assaying the movement of polymorphic or wild-type fragments in polyacrylamide gels containing a gradient of denaturant using denaturing gradient gel electrophoresis (DGGE) (Myers et al., Nature 313:495 (1985)). Sequence variations at specific locations can also be assessed by nuclease protection assays such as RNase and 51 protection or chemical cleavage methods.

In a preferred embodiment, SNP genotyping is performed using the TaqMan assay, which is also known as the 5′ nuclease assay (U.S. Pat. Nos. 5,210,015 and 5,538,848). The TaqMan assay detects the accumulation of a specific amplified product during PCR. The TaqMan assay utilizes an oligonucleotide probe labeled with a fluorescent reporter dye and a quencher dye. The reporter dye is excited by irradiation at an appropriate wavelength, it transfers energy to the quencher dye in the same probe via a process called fluorescence resonance energy transfer (FRET). When attached to the probe, the excited reporter dye does not emit a signal. The proximity of the quencher dye to the reporter dye in the intact probe maintains a reduced fluorescence for the reporter. The reporter dye and quencher dye may be at the 5′ most and the 3′ most ends, respectively, or vice versa. Alternatively, the reporter dye may be at the 5′ or 3′ most end while the quencher dye is attached to an internal nucleotide, or vice versa. In yet another embodiment, both the reporter and the quencher may be attached to internal nucleotides at a distance from each other such that fluorescence of the reporter is reduced.

During PCR, the 5′ nuclease activity of DNA polymerase cleaves the probe, thereby separating the reporter dye and the quencher dye and resulting in increased fluorescence of the reporter. Accumulation of PCR product is detected directly by monitoring the increase in fluorescence of the reporter dye. The DNA polymerase cleaves the probe between the reporter dye and the quencher dye only if the probe hybridizes to the target SNP-containing template which is amplified during PCR, and the probe is designed to hybridize to the target SNP site only if a particular SNP allele is present.

Preferred TaqMan primer and probe sequences can readily be determined using the SNP and associated nucleic acid sequence information provided herein. A number of computer programs, such as Primer Express (Applied Biosystems, Foster City, Calif.), can be used to rapidly obtain optimal primer/probe sets. It will be apparent to one of skill in the art that such primers and probes for detecting the SNPs of the present invention are useful in assays for determining predisposition to stroke and related pathologies, and can be readily incorporated into a kit format. The present invention also includes modifications of the Taqman assay well known in the art such as the use of Molecular Beacon probes (U.S. Pat. Nos. 5,118,801 and 5,312,728) and other variant formats (U.S. Pat. Nos. 5,866,336 and 6,117,635).

Another preferred method for genotyping the SNPs of the present invention is the use of two oligonucleotide probes in an OLA (see, e.g., U.S. Pat. No. 4,988,617). In this method, one probe hybridizes to a segment of a target nucleic acid with its 3′ most end aligned with the SNP site. A second probe hybridizes to an adjacent segment of the target nucleic acid molecule directly 3′ to the first probe. The two juxtaposed probes hybridize to the target nucleic acid molecule, and are ligated in the presence of a linking agent such as a ligase if there is perfect complementarity between the 3′ most nucleotide of the first probe with the SNP site. If there is a mismatch, ligation would not occur. After the reaction, the ligated probes are separated from the target nucleic acid molecule, and detected as indicators of the presence of a SNP.

The following patents, patent applications, and published international patent applications, which are all hereby incorporated by reference, provide additional information pertaining to techniques for carrying out various types of OLA: U.S. Pat. Nos. 6,027,889, 6,268,148, 5,494,810, 5,830,711, and 6,054,564 describe OLA strategies for performing SNP detection; WO 97/31256 and WO 00/56927 describe OLA strategies for performing SNP detection using universal arrays, wherein a zipcode sequence can be introduced into one of the hybridization probes, and the resulting product, or amplified product, hybridized to a universal zip code array; U.S. application Ser. No. 01/17,329 (and Ser. No. 09/584,905) describes OLA (or LDR) followed by PCR, wherein zipcodes are incorporated into OLA probes, and amplified PCR products are determined by electrophoretic or universal zipcode array readout; U.S. applications 60/427,818, 60/445,636, and 60/445,494 describe SNPlex methods and software for multiplexed SNP detection using OLA followed by PCR, wherein zipcodes are incorporated into OLA probes, and amplified PCR products are hybridized with a zipchute reagent, and the identity of the SNP determined from electrophoretic readout of the zipchute. In some embodiments, OLA is carried out prior to PCR (or another method of nucleic acid amplification). In other embodiments, PCR (or another method of nucleic acid amplification) is carried out prior to OLA.

Another method for SNP genotyping is based on mass spectrometry. Mass spectrometry takes advantage of the unique mass of each of the four nucleotides of DNA. SNPs can be unambiguously genotyped by mass spectrometry by measuring the differences in the mass of nucleic acids having alternative SNP alleles. MALDI-TOF (Matrix Assisted Laser Desorption Ionization—Time of Flight) mass spectrometry technology is preferred for extremely precise determinations of molecular mass, such as SNPs. Numerous approaches to SNP analysis have been developed based on mass spectrometry. Preferred mass spectrometry-based methods of SNP genotyping include primer extension assays, which can also be utilized in combination with other approaches, such as traditional gel-based formats and microarrays.

Typically, the primer extension assay involves designing and annealing a primer to a template PCR amplicon upstream (5′) from a target SNP position. A mix of dideoxynucleotide triphosphates (ddNTPs) and/or deoxynucleotide triphosphates (dNTPs) are added to a reaction mixture containing template (e.g., a SNP-containing nucleic acid molecule which has typically been amplified, such as by PCR), primer, and DNA polymerase. Extension of the primer terminates at the first position in the template where a nucleotide complementary to one of the ddNTPs in the mix occurs. The primer can be either immediately adjacent (i.e., the nucleotide at the 3′ end of the primer hybridizes to the nucleotide next to the target SNP site) or two or more nucleotides removed from the SNP position. If the primer is several nucleotides removed from the target SNP position, the only limitation is that the template sequence between the 3′ end of the primer and the SNP position cannot contain a nucleotide of the same type as the one to be detected, or this will cause premature termination of the extension primer. Alternatively, if all four ddNTPs alone, with no dNTPs, are added to the reaction mixture, the primer will always be extended by only one nucleotide, corresponding to the target SNP position. In this instance, primers are designed to bind one nucleotide upstream from the SNP position (i.e., the nucleotide at the 3′ end of the primer hybridizes to the nucleotide that is immediately adjacent to the target SNP site on the 5′ side of the target SNP site). Extension by only one nucleotide is preferable, as it minimizes the overall mass of the extended primer, thereby increasing the resolution of mass differences between alternative SNP nucleotides. Furthermore, mass-tagged ddNTPs can be employed in the primer extension reactions in place of unmodified ddNTPs. This increases the mass difference between primers extended with these ddNTPs, thereby providing increased sensitivity and accuracy, and is particularly useful for typing heterozygous base positions. Mass-tagging also alleviates the need for intensive sample-preparation procedures and decreases the necessary resolving power of the mass spectrometer.

The extended primers can then be purified and analyzed by MALDI-TOF mass spectrometry to determine the identity of the nucleotide present at the target SNP position. In one method of analysis, the products from the primer extension reaction are combined with light absorbing crystals that form a matrix. The matrix is then hit with an energy source such as a laser to ionize and desorb the nucleic acid molecules into the gas-phase. The ionized molecules are then ejected into a flight tube and accelerated down the tube towards a detector. The time between the ionization event, such as a laser pulse, and collision of the molecule with the detector is the time of flight of that molecule. The time of flight is precisely correlated with the mass-to-charge ratio (m/z) of the ionized molecule. Ions with smaller m/z travel down the tube faster than ions with larger m/z and therefore the lighter ions reach the detector before the heavier ions. The time-of-flight is then converted into a corresponding, and highly precise, m/z. In this manner, SNPs can be identified based on the slight differences in mass, and the corresponding time of flight differences, inherent in nucleic acid molecules having different nucleotides at a single base position. For further information regarding the use of primer extension assays in conjunction with MALDI-TOF mass spectrometry for SNP genotyping, see, e.g., Wise et al., “A standard protocol for single nucleotide primer extension in the human genome using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry”, Rapid Commun Mass Spectrom. 2003; 17(11):1195-202.

The following references provide further information describing mass spectrometry-based methods for SNP genotyping: Bocker, “SNP and mutation discovery using base-specific cleavage and MALDI-TOF mass spectrometry”, Bioinformatics. 2003 July; 19 Suppl 1:144-153; Storm et al., “MALDI-TOF mass spectrometry-based SNP genotyping”, Methods Mol Biol. 2003; 212:241-62; Jurinke et al., “The use of Mass ARRAY technology for high throughput genotyping”, Adv Biochem Eng Biotechnol. 2002; 77:57-74; and Jurinke et al., “Automated genotyping using the DNA MassArray technology”, Methods Mol Biol. 2002; 187:179-92.

SNPs can also be scored by direct DNA sequencing. A variety of automated sequencing procedures can be utilized ((1995) Biotechniques 19:448), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO94/16101; Cohen et al., Adv. Chromatogr. 36:127-162 (1996); and Griffin et al., Appl. Biochem. Biotechnol. 38:147-159 (1993)). The nucleic acid sequences of the present invention enable one of ordinary skill in the art to readily design sequencing primers for such automated sequencing procedures. Commercial instrumentation, such as the Applied Biosystems 377, 3100, 3700, 3730, and 3730x1 DNA Analyzers (Foster City, Calif.), is commonly used in the art for automated sequencing.

Other methods that can be used to genotype the SNPs of the present invention include single-strand conformational polymorphism (SSCP), and denaturing gradient gel electrophoresis (DGGE) (Myers et al., Nature 313:495 (1985)). SSCP identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Single-stranded PCR products can be generated by heating or otherwise denaturing double stranded PCR products. Single-stranded nucleic acids may refold or form secondary structures that are partially dependent on the base sequence. The different electrophoretic mobilities of single-stranded amplification products are related to base-sequence differences at SNP positions. DGGE differentiates SNP alleles based on the different sequence-dependent stabilities and melting properties inherent in polymorphic DNA and the corresponding differences in electrophoretic migration patterns in a denaturing gradient gel (Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, W.H. Freeman and Co, New York, 1992, Chapter 7).

Sequence-specific ribozymes (U.S. Pat. No. 5,498,531) can also be used to score SNPs based on the development or loss of a ribozyme cleavage site. Perfectly matched sequences can be distinguished from mismatched sequences by nuclease cleavage digestion assays or by differences in melting temperature. If the SNP affects a restriction enzyme cleavage site, the SNP can be identified by alterations in restriction enzyme digestion patterns, and the corresponding changes in nucleic acid fragment lengths determined by gel electrophoresis

SNP genotyping can include the steps of, for example, collecting a biological sample from a human subject (e.g., sample of tissues, cells, fluids, secretions, etc.), isolating nucleic acids (e.g., genomic DNA, mRNA or both) from the cells of the sample, contacting the nucleic acids with one or more primers which specifically hybridize to a region of the isolated nucleic acid containing a target SNP under conditions such that hybridization and amplification of the target nucleic acid region occurs, and determining the nucleotide present at the SNP position of interest, or, in some assays, detecting the presence or absence of an amplification product (assays can be designed so that hybridization and/or amplification will only occur if a particular SNP allele is present or absent). In some assays, the size of the amplification product is detected and compared to the length of a control sample; for example, deletions and insertions can be detected by a change in size of the amplified product compared to a normal genotype.

SNP genotyping is useful for numerous practical applications, as described below. Examples of such applications include, but are not limited to, SNP-disease association analysis, disease predisposition screening, disease diagnosis, disease prognosis, disease progression monitoring, determining therapeutic strategies based on an individual's genotype (“pharmacogenomics”), developing therapeutic agents based on SNP genotypes associated with a disease or likelihood of responding to a drug, stratifying a patient population for clinical trial for a treatment regimen, predicting the likelihood that an individual will experience toxic side effects from a therapeutic agent, and human identification applications such as forensics.

Analysis of Genetic Association Between SNPs and Phenotypic Traits

SNP genotyping for disease diagnosis, disease predisposition screening, disease prognosis, determining drug responsiveness (pharmacogenomics), drug toxicity screening, and other uses described herein, typically relies on initially establishing a genetic association between one or more specific SNPs and the particular phenotypic traits of interest.

Different study designs may be used for genetic association studies (Modern Epidemiology, Lippincott Williams & Wilkins (1998), 609-622). Observational studies are most frequently carried out in which the response of the patients is not interfered with. The first type of observational study identifies a sample of persons in whom the suspected cause of the disease is present and another sample of persons in whom the suspected cause is absent, and then the frequency of development of disease in the two samples is compared. These sampled populations are called cohorts, and the study is a prospective study. The other type of observational study is case-control or a retrospective study. In typical case-control studies, samples are collected from individuals with the phenotype of interest (cases) such as certain manifestations of a disease, and from individuals without the phenotype (controls) in a population (target population) that conclusions are to be drawn from. Then the possible causes of the disease are investigated retrospectively. As the time and costs of collecting samples in case-control studies are considerably less than those for prospective studies, case-control studies are the more commonly used study design in genetic association studies, at least during the exploration and discovery stage.

In both types of observational studies, there may be potential confounding factors that should be taken into consideration. Confounding factors are those that are associated with both the real cause(s) of the disease and the disease itself, and they include demographic information such as age, gender, ethnicity as well as environmental factors. When confounding factors are not matched in cases and controls in a study, and are not controlled properly, spurious association results can arise. If potential confounding factors are identified, they should be controlled for by analysis methods explained below.

In a genetic association study, the cause of interest to be tested is a certain allele or a SNP or a combination of alleles or a haplotype from several SNPs. Thus, tissue specimens (e.g., whole blood) from the sampled individuals may be collected and genomic DNA genotyped for the SNP(s) of interest. In addition to the phenotypic trait of interest, other information such as demographic (e.g., age, gender, ethnicity, etc.), clinical, and environmental information that may influence the outcome of the trait can be collected to further characterize and define the sample set. In many cases, these factors are known to be associated with diseases and/or SNP allele frequencies. There are likely gene-environment and/or gene-gene interactions as well. Analysis methods to address gene-environment and gene-gene interactions (for example, the effects of the presence of both susceptibility alleles at two different genes can be greater than the effects of the individual alleles at two genes combined) are discussed below.

After all the relevant phenotypic and genotypic information has been obtained, statistical analyses are carried out to determine if there is any significant correlation between the presence of an allele or a genotype with the phenotypic characteristics of an individual. Preferably, data inspection and cleaning are first performed before carrying out statistical tests for genetic association. Epidemiological and clinical data of the samples can be summarized by descriptive statistics with tables and graphs. Data validation is preferably performed to check for data completion, inconsistent entries, and outliers. Chi-squared tests and t-tests (Wilcoxon rank-sum tests if distributions are not normal) may then be used to check for significant differences between cases and controls for discrete and continuous variables, respectively. To ensure genotyping quality, Hardy-Weinberg disequilibrium tests can be performed on cases and controls separately. Significant deviation from Hardy-Weinberg equilibrium (HWE) in both cases and controls for individual markers can be indicative of genotyping errors. If HWE is violated in a majority of markers, it is indicative of population substructure that should be further investigated. Moreover, Hardy-Weinberg disequilibrium in cases only can indicate genetic association of the markers with the disease (Genetic Data Analysis, Weir B., Sinauer (1990)).

To test whether an allele of a single SNP is associated with the case or control status of a phenotypic trait, one skilled in the art can compare allele frequencies in cases and controls. Standard chi-squared tests and Fisher exact tests can be carried out on a 2×2 table (2 SNP alleles×2 outcomes in the categorical trait of interest). To test whether genotypes of a SNP are associated, chi-squared tests can be carried out on a 3×2 table (3 genotypes×2 outcomes). Score tests are also carried out for genotypic association to contrast the three genotypic frequencies (major homozygotes, heterozygotes and minor homozygotes) in cases and controls, and to look for trends using 3 different modes of inheritance, namely dominant (with contrast coefficients 2, −1, −1), additive (with contrast coefficients 1, 0, −1) and recessive (with contrast coefficients 1, 1, −2). Odds ratios for minor versus major alleles, and odds ratios for heterozygote and homozygote variants versus the wild type genotypes are calculated with the desired confidence limits, usually 95%.

In order to control for confounders and to test for interaction and effect modifiers, stratified analyses may be performed using stratified factors that are likely to be confounding, including demographic information such as age, ethnicity, and gender, or an interacting element or effect modifier, such as a known major gene (e.g., APOE for Alzheimer's disease or HLA genes for autoimmune diseases), or environmental factors such as smoking in lung cancer. Stratified association tests may be carried out using Cochran-Mantel-Haenszel tests that take into account the ordinal nature of genotypes with 0, 1, and 2 variant alleles. Exact tests by StatXact may also be performed when computationally possible. Another way to adjust for confounding effects and test for interactions is to perform stepwise multiple logistic regression analysis using statistical packages such as SAS or R. Logistic regression is a model-building technique in which the best fitting and most parsimonious model is built to describe the relation between the dichotomous outcome (for instance, getting a certain disease or not) and a set of independent variables (for instance, genotypes of different associated genes, and the associated demographic and environmental factors). The most common model is one in which the logit transformation of the odds ratios is expressed as a linear combination of the variables (main effects) and their cross-product terms (interactions) (Applied Logistic Regression, Hosmer and Lemeshow, Wiley (2000)). To test whether a certain variable or interaction is significantly associated with the outcome, coefficients in the model are first estimated and then tested for statistical significance of their departure from zero.

In addition to performing association tests one marker at a time, haplotype association analysis may also be performed to study a number of markers that are closely linked together. Haplotype association tests can have better power than genotypic or allelic association tests when the tested markers are not the disease-causing mutations themselves but are in linkage disequilibrium with such mutations. The test will even be more powerful if the disease is indeed caused by a combination of alleles on a haplotype (e.g., APOE is a haplotype formed by 2 SNPs that are very close to each other). In order to perform haplotype association effectively, marker-marker linkage disequilibrium measures, both D′ and R², are typically calculated for the markers within a gene to elucidate the haplotype structure. Recent studies (Daly et al, Nature Genetics, 29, 232-235, 2001) in linkage disequilibrium indicate that SNPs within a gene are organized in block pattern, and a high degree of linkage disequilibrium exists within blocks and very little linkage disequilibrium exists between blocks. Haplotype association with the disease status can be performed using such blocks once they have been elucidated.

Haplotype association tests can be carried out in a similar fashion as the allelic and genotypic association tests. Each haplotype in a gene is analogous to an allele in a multi-allelic marker. One skilled in the art can either compare the haplotype frequencies in cases and controls or test genetic association with different pairs of haplotypes. It has been proposed (Schaid et al, Am. J. Hum. Genet., 70, 425-434, 2002) that score tests can be done on haplotypes using the program “haplo.score”. In that method, haplotypes are first inferred by EM algorithm and score tests are carried out with a generalized linear model (GLM) framework that allows the adjustment of other factors.

An important decision in the performance of genetic association tests is the determination of the significance level at which significant association can be declared when the p-value of the tests reaches that level. In an exploratory analysis where positive hits will be followed up in subsequent confirmatory testing, an unadjusted p-value <0.2 (a significance level on the lenient side), for example, may be used for generating hypotheses for significant association of a SNP with certain phenotypic characteristics of a disease. It is preferred that a p-value <0.05 (a significance level traditionally used in the art) is achieved in order for a SNP to be considered to have an association with a disease. It is more preferred that a p-value <0.01 (a significance level on the stringent side) is achieved for an association to be declared. When hits are followed up in confirmatory analyses in more samples of the same source or in different samples from different sources, adjustment for multiple testing will be performed as to avoid excess number of hits while maintaining the experiment-wise error rates at 0.05. While there are different methods to adjust for multiple testing to control for different kinds of error rates, a commonly used but rather conservative method is Bonferroni correction to control the experiment-wise or family-wise error rate (Multiple comparisons and multiple tests, Westfall et al, SAS Institute (1999)). Permutation tests to control for the false discovery rates, FDR, can be more powerful (Benjamini and Hochberg, Journal of the Royal Statistical Society, Series B 57, 1289-1300, 1995, Resampling-based Multiple Testing, Westfall and Young, Wiley (1993)). Such methods to control for multiplicity would be preferred when the tests are dependent and controlling for false discovery rates is sufficient as opposed to controlling for the experiment-wise error rates.

In replication studies using samples from different populations after statistically significant markers have been identified in the exploratory stage, meta-analyses can then be performed by combining evidence of different studies (Modern Epidemiology, Lippincott Williams & Wilkins, 1998, 643-673). If available, association results known in the art for the same SNPs can be included in the meta-analyses.

Since both genotyping and disease status classification can involve errors, sensitivity analyses may be performed to see how odds ratios and p-values would change upon various estimates on genotyping and disease classification error rates.

It has been well known that subpopulation-based sampling bias between cases and controls can lead to spurious results in case-control association studies (Ewens and Spielman, Am. J. Hum. Genet. 62, 450-458, 1995) when prevalence of the disease is associated with different subpopulation groups. Such bias can also lead to a loss of statistical power in genetic association studies. To detect population stratification, Pritchard and Rosenberg (Pritchard et al. Am. J. Hum. Gen. 1999, 65:220-228) suggested typing markers that are unlinked to the disease and using results of association tests on those markers to determine whether there is any population stratification. When stratification is detected, the genomic control (GC) method as proposed by Devlin and Roeder (Devlin et al. Biometrics 1999, 55:997-1004) can be used to adjust for the inflation of test statistics due to population stratification. GC method is robust to changes in population structure levels as well as being applicable to DNA pooling designs (Devlin et al. Genet. Epidem. 20001, 21:273-284).

While Pritchard's method recommended using 15-20 unlinked microsatellite markers, it suggested using more than 30 biallelic markers to get enough power to detect population stratification. For the GC method, it has been shown (Bacanu et al. Am. J. Hum. Genet. 2000, 66:1933-1944) that about 60-70 biallelic markers are sufficient to estimate the inflation factor for the test statistics due to population stratification. Hence, 70 intergenic SNPs can be chosen in unlinked regions as indicated in a genome scan (Kehoe et al. Hum. Mol. Genet. 1999, 8:237-245).

Once individual risk factors, genetic or non-genetic, have been found for the predisposition to disease, the next step is to set up a classification/prediction scheme to predict the category (for instance, disease or no-disease) that an individual will be in depending on his genotypes of associated SNPs and other non-genetic risk factors. Logistic regression for discrete trait and linear regression for continuous trait are standard techniques for such tasks (Applied Regression Analysis, Draper and Smith, Wiley (1998)). Moreover, other techniques can also be used for setting up classification. Such techniques include, but are not limited to, MART, CART, neural network, and discriminant analyses that are suitable for use in comparing the performance of different methods (The Elements of Statistical Learning, Hastie, Tibshirani & Friedman, Springer (2002)).

Disease Diagnosis and Predisposition Screening

Information on association/correlation between genotypes and disease-related phenotypes can be exploited in several ways. For example, in the case of a highly statistically significant association between one or more SNPs with predisposition to a disease for which treatment is available, detection of such a genotype pattern in an individual may justify immediate administration of treatment, or at least the institution of regular monitoring of the individual. Detection of the susceptibility alleles associated with serious disease in a couple contemplating having children may also be valuable to the couple in their reproductive decisions. In the case of a weaker but still statistically significant association between a SNP and a human disease, immediate therapeutic intervention or monitoring may not be justified after detecting the susceptibility allele or SNP. Nevertheless, the subject can be motivated to begin simple life-style changes (e.g., diet, exercise) that can be accomplished at little or no cost to the individual but would confer potential benefits in reducing the risk of developing conditions for which that individual may have an increased risk by virtue of having the susceptibility allele(s).

The SNPs of the invention may contribute to stroke and related pathologies in an individual in different ways. Some polymorphisms occur within a protein coding sequence and contribute to disease phenotype by affecting protein structure. Other polymorphisms occur in noncoding regions but may exert phenotypic effects indirectly via influence on, for example, replication, transcription, and/or translation. A single SNP may affect more than one phenotypic trait. Likewise, a single phenotypic trait may be affected by multiple SNPs in different genes.

As used herein, the terms “diagnose”, “diagnosis”, and “diagnostics” include, but are not limited to any of the following: detection of a vascular disease that an individual may presently have, predisposition/susceptibility screening (i.e., determining an individual's risk of having a stroke, such as whether an individual has an increased or decreased risk of having a stroke in the future), determining a particular type or subclass of vascular disease or stroke in an individual who has a vascular disease or who has had a stroke, confirming or reinforcing a previously made diagnosis of stroke or vascular disease, pharmacogenomic evaluation of an individual to determine which therapeutic or preventive agent or strategy that individual is most likely to benefit from or to predict whether a patient is likely to benefit from a particular therapeutic or preventive agent or strategy, predicting whether a patient is likely to experience toxic or other undesirable side effects from a particular therapeutic or preventive agent or strategy, evaluating the future prognosis of an individual who has had a stroke or who has a vascular disease, and determining the risk that an individual who has already had a stroke will have one or more strokes again in the future (i.e., re-occurring strokes). Such diagnostic uses may be based on the SNPs individually or in combination or SNP haplotypes of the present invention.

Haplotypes are particularly useful in that, for example, fewer SNPs can be genotyped to determine if a particular genomic region harbors a locus that influences a particular phenotype, such as in linkage disequilibrium-based SNP association analysis.

Linkage disequilibrium (LD) refers to the co-inheritance of alleles (e.g., alternative nucleotides) at two or more different SNP sites at frequencies greater than would be expected from the separate frequencies of occurrence of each allele in a given population. The expected frequency of co-occurrence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-occur at expected frequencies are said to be in “linkage equilibrium”. In contrast, LD refers to any non-random genetic association between allele(s) at two or more different SNP sites, which is generally due to the physical proximity of the two loci along a chromosome. LD can occur when two or more SNPs sites are in close physical proximity to each other on a given chromosome and therefore alleles at these SNP sites will tend to remain unseparated for multiple generations with the consequence that a particular nucleotide (allele) at one SNP site will show a non-random association with a particular nucleotide (allele) at a different SNP site located nearby. Hence, genotyping one of the SNP sites will give almost the same information as genotyping the other SNP site that is in LD.

Various degrees of LD can be encountered between two or more SNPs with the result being that some SNPs are more closely associated (i.e., in stronger LD) than others. Furthermore, the physical distance over which LD extends along a chromosome differs between different regions of the genome, and therefore the degree of physical separation between two or more SNP sites necessary for LD to occur can differ between different regions of the genome.

For diagnostic purposes and similar uses, if a particular SNP site is found to be useful for determining predisposition to stroke and related pathologies (e.g., has a significant statistical association with the condition and/or is recognized as a causative polymorphism for the condition), then the skilled artisan would recognize that other SNP sites which are in LD with this SNP site would also be useful for diagnosing the condition. Thus, polymorphisms (e.g., SNPs and/or haplotypes) that are not the actual disease-causing (causative) polymorphisms, but are in LD with such causative polymorphisms, are also useful. In such instances, the genotype of the polymorphism(s) that is/are in LD with the causative polymorphism is predictive of the genotype of the causative polymorphism and, consequently, predictive of the phenotype (e.g., stroke) that is influenced by the causative SNP(s). Therefore, polymorphic markers that are in LD with causative polymorphisms are useful as diagnostic markers, and are particularly useful when the actual causative polymorphism(s) is/are unknown.

Examples of polymorphisms that can be in LD with one or more causative polymorphisms (and/or in LD with one or more polymorphisms that have a significant statistical association with a condition) and therefore useful for diagnosing the same condition that the causative/associated SNP(s) is used to diagnose, include, for example, other SNPs in the same gene, protein-coding, or mRNA transcript-coding region as the causative/associated SNP, other SNPs in the same exon or same intron as the causative/associated SNP, other SNPs in the same haplotype block as the causative/associated SNP, other SNPs in the same intergenic region as the causative/associated SNP, SNPs that are outside but near a gene (e.g., within 6 kb on either side, 5′ or 3′, of a gene boundary) that harbors a causative/associated SNP, etc. Such useful LD SNPs can be selected from among the SNPs disclosed in Table 4, for example.

Linkage disequilibrium in the human genome is reviewed in the following references: Wall et al., “Haplotype blocks and linkage disequilibrium in the human genome,”, Nat Rev Genet. 2003 August; 4(8):587-97 (August 2003); Garner et al. et al., “On selecting markers for association studies: patterns of linkage disequilibrium between two and three diallelic loci,”, Genet Epidemiol. 2003 January; 24(1):57-67 (January 2003); Ardlie et al. et al., “Patterns of linkage disequilibrium in the human genome,”, Nat Rev Genet. 2002 April; 3(4):299-309 (April 2002); (erratum in Nat Rev Genet 2002 July; 3(7):566 (July 2002); and Remm et al., “High-density genotyping and linkage disequilibrium in the human genome using chromosome 22 as a model,”; Curr Opin Chem Biol. 2002 February; 6(1):24-30 (February 2002); J. B. S. Haldane, “J B S (1919) The combination of linkage values, and the calculation of distances between the loci of linked factors,”. J Genet 8:299-309 (1919); G. Mendel, G. (1866) Versuche über Pflanzen-Hybriden. Verhandlungen des naturforschenden Vereines in Brünn [(Proceedings of the Natural History Society of Brünn)] (1866); Lewin B (1990) Genes IV, B. Lewin, ed., Oxford University Press, N.Y. New York, USA (1990); D. L. Hartl D L and A. G. Clark A G (1989) Principles of Population Genetics 2^nd ed., Sinauer Associates, Inc., Ma Sunderland, Mass., USA (1989); J. H. Gillespie J H (2004) Population Genetics: A Concise Guide. 2^nd ed., Johns Hopkins University Press. (2004) USA; R. C. Lewontin, “RC (1964) The interaction of selection and linkage. I. General considerations; heterotic models,”. Genetics 49:49-67 (1964); P. G. Hoel, P G (1954) Introduction to Mathematical Statistics 2^nd ed., John Wiley & Sons, Inc., N.Y. New York, USA (1954); R. R. Hudson, R R “(2001) Two-locus sampling distributions and their application,”. Genetics 159:1805-1817 (2001); A. P. Dempster AP, N. M. Laird, D. B. N M, Rubin, “D B (1977) Maximum likelihood from incomplete data via the EM algorithm,”. J R Stat Soc 39:1-48 (1977); L. Excoffier L, M. Slatkin, M “(1995) Maximum-likelihood estimation of molecular haplotype frequencies in a diploid population,”. Mol Biol Evol 12(5):921-927 (1995); D. A. Tregouet D A, S. Escolano S, L. Tiret L, A. Mallet A, J. L. Golmard, J L “(2004) A new algorithm for haplotype-based association analysis: the Stochastic-EM algorithm,”. Ann Hum Genet 68(Pt 2):165-177 (2004); A. D. Long AD and C. H. Langley C H, “(1999) The power of association studies to detect the contribution of candidate genetic loci to variation in complex traits,”. Genome Research 9:720-731 (1999); A. Agresti, A (1990) Categorical Data Analysis, John Wiley & Sons, Inc., N.Y. New York, USA (1990); K. Lange, K (1997) Mathematical and Statistical Methods for Genetic Analysis, Springer-Verlag New York, Inc., N.Y. New York, USA (1997); The International HapMap Consortium, “(2003) The International HapMap Project,”. Nature 426:789-796 (2003); The International HapMap Consortium, “(2005) A haplotype map of the human genome,”. Nature 437:1299-1320 (2005); G. A. Thorisson G A, A. V. Smith AV, L. Krishnan L, L. D. Stein LD (2005), “The International HapMap Project Web Site,”. Genome Research 15:1591-1593 (2005); G. McVean, C. C. A. G, Spencer CCA, R. Chaix R (2005), “Perspectives on human genetic variation from the HapMap project,”. PLoS Genetics 1(4):413-418 (2005); J. N. Hirschhorn J N, M. J. Daly, M J “(2005) Genome-wide association studies for common diseases and complex traits,”. Nat Genet 6:95-108 (2005); S. J. Schrodi, “S J (2005) A probabilistic approach to large-scale association scans: a semi-Bayesian method to detect disease-predisposing alleles,”. SAGMB 4(1):31 (2005); W. Y. S. Wang W Y S, B. J. Barratt B J, D. G. Clayton DG, J. A. Todd, “J A (2005) Genome-wide association studies: theoretical and practical concerns,”. Nat Rev Genet 6:109-118 (2005); J. K. Pritchard J K, M. Przeworski, “M (2001) Linkage disequilibrium in humans: models and data,”. Am J Hum Genet 69:1-14 (2001).

As discussed above, one aspect of the present invention is the discovery that SNPs which are in certain LD distance with the interrogated SNP can also be used as valid markers for identifying an increased or decreased risks of having or developing stroke. As used herein, the term “interrogated SNP” refers to SNPs that have been found to be associated with an increased or decreased risk of disease using genotyping results and analysis, or other appropriate experimental method as exemplified in the working examples described in this application. As used herein, the term “LD SNP” refers to a SNP that has been characterized as a SNP associating with an increased or decreased risk of diseases due to their being in LD with the “interrogated SNP” under the methods of calculation described in the application. Below, applicants describe the methods of calculation with which one of ordinary skilled in the art may determine if a particular SNP is in LD with an interrogated SNP. The parameter r² is commonly used in the genetics art to characterize the extent of linkage disequilibrium between markers (Hudson, 2001). As used herein, the term “in LD with” refers to a particular SNP that is measured at above the threshold of a parameter such as r² with an interrogated SNP.

It is now common place to directly observe genetic variants in a sample of chromosomes obtained from a population. Suppose one has genotype data at two genetic markers located on the same chromosome, for the markers A and B. Further suppose that two alleles segregate at each of these two markers such that alleles A₁ and A₂ can be found at marker A and alleles B₁ and B₂ at marker B. Also assume that these two markers are on a human autosome. If one is to examine a specific individual and find that they are heterozygous at both markers, such that their two-marker genotype is A₁A₂B₁B₂, then there are two possible configurations: the individual in question could have the alleles A₁B₁ on one chromosome and A₂B₂ on the remaining chromosome; alternatively, the individual could have alleles A₁B₂ on one chromosome and A₂B₁ on the other. The arrangement of alleles on a chromosome is called a haplotype. In this illustration, the individual could have haplotypes A₁B₁/A₂B₂ or A₁B₂/A₂B₁ (see Hartl and Clark (1989) for a more complete description). The concept of linkage equilibrium relates the frequency of haplotypes to the allele frequencies.

Assume that a sample of individuals is selected from a larger population. Considering the two markers described above, each having two alleles, there are four possible haplotypes: A₁B₁, A₁B₂, A₂B₁ and A₂B₂. Denote the frequencies of these four haplotypes with the following notation.

P₁₁=freq(A₁B₁)  (1)

P₁₂=freq(A₁B₂)  (2)

P₂₁=freq(A₂B₁)  (3)

P₂₂=freq(A₂B₂)  (4)

The allele frequencies at the two markers are then the sum of different haplotype frequencies, it is straightforward to write down a similar set of equations relating single-marker allele frequencies to two-marker haplotype frequencies:

p₁=freq(A₁)=P₁₁+P₁₂  (5)

p₂=freq(A₂)=P₂₁+P₂₂  (6)

q₁=freq(B₁)=P₁₁+P₂₁  (7)

q₂=freq(B₂)=P₁₂+P₂₂  (8)

Note that the four haplotype frequencies and the allele frequencies at each marker must sum to a frequency of 1.

P₁₁+P₁₂+P₂₁+P₂₂=1  (9)

p₁+p₂=1  (10)

q₁+q₂=1  (11)

If there is no correlation between the alleles at the two markers, one would expect that the frequency of the haplotypes would be approximately the product of the composite alleles. Therefore,

P₁₁≈p₁q₁  (12)

P₁₂≈p₁q₂  (13)

P₂₁≈p₂q₁  (14)

P₂₂≈p₂q₂  (15)

These approximating equations (12)-(15) represent the concept of linkage equilibrium where there is independent assortment between the two markers—the alleles at the two markers occur together at random. These are represented as approximations because linkage equilibrium and linkage disequilibrium are concepts typically thought of as properties of a sample of chromosomes; and as such they are susceptible to stochastic fluctuations due to the sampling process. Empirically, many pairs of genetic markers will be in linkage equilibrium, but certainly not all pairs.

Having established the concept of linkage equilibrium above, applicants can now describe the concept of linkage disequilibrium (LD), which is the deviation from linkage equilibrium. Since the frequency of the A₁B₁ haplotype is approximately the product of the allele frequencies for A₁ and B₁ under the assumption of linkage equilibrium as stated mathematically in (12), a simple measure for the amount of departure from linkage equilibrium is the difference in these two quantities, D,

D=P₁₁−p₁q₁  (16)

D=0 indicates perfect linkage equilibrium. Substantial departures from D=0 indicates LD in the sample of chromosomes examined. Many properties of D are discussed in Lewontin (1964) including the maximum and minimum values that D can take. Mathematically, using basic algebra, it can be shown that D can also be written solely in terms of haplotypes:

D=P₁₁P₂₂−P₁₂P₂₁  (17)

If one transforms D by squaring it and subsequently dividing by the product of the allele frequencies of A₁, A₂, B₁ and B₂, the resulting quantity, called r², is equivalent to the square of the Pearson's correlation coefficient commonly used in statistics (e.g. Hoel, 1954).

$\begin{array}{cc}{r}^2=\frac{D^2}{p_1p_2q_1q_2}& \left(18\right)\end{array}$

As with D, values of r² close to 0 indicate linkage equilibrium between the two markers examined in the sample set. As values of r² increase, the two markers are said to be in linkage disequilibrium. The range of values that r² can take are from 0 to 1. r²=1 when there is a perfect correlation between the alleles at the two markers.

In addition, the quantities discussed above are sample-specific. And as such, it is necessary to formulate notation specific to the samples studied. In the approach discussed here, three types of samples are of primary interest: (i) a sample of chromosomes from individuals affected by a disease-related phenotype (cases), (ii) a sample of chromosomes obtained from individuals not affected by the disease-related phenotype (controls), and (iii) a standard sample set used for the construction of haplotypes and calculation pairwise linkage disequilibrium. For the allele frequencies used in the development of the method described below, an additional subscript will be added to denote either the case or control sample sets.

p_1,cs=freq(A₁ in cases)  (19)

p_2,cs=freq(A₂ in cases)  (20)

q_1,cs=freq(B₁ in cases)  (21)

q_2,cs=freq(B₂ in cases)  (22)

Similarly,

p_1,ct=freq(A₁ in controls)  (23)

p_2,ct=freq(A₂ in controls)  (24)

q_1,ct=freq(B₁ in controls)  (25)

q_2,ct=freq(B₂ in controls)  (26)

As a well-accepted sample set is necessary for robust linkage disequilibrium calculations, data obtained from the International HapMap project (The International HapMap Consortium 2003, 2005; Thorisson et al, 2005; McVean et al, 2005) can be used for the calculation of pairwise r² values. Indeed, the samples genotyped for the International HapMap Project were selected to be representative examples from various human sub-populations with sufficient numbers of chromosomes examined to draw meaningful and robust conclusions from the patterns of genetic variation observed. The International HapMap project website (hapmap.org) contains a description of the project, methods utilized and samples examined. It is useful to examine empirical data to get a sense of the patterns present in such data.

Haplotype frequencies were explicit arguments in equation (18) above. However, knowing the 2-marker haplotype frequencies requires that phase to be determined for doubly heterozygous samples. When phase is unknown in the data examined, various algorithms can be used to infer phase from the genotype data. This issue was discussed earlier where the doubly heterozygous individual with a 2-SNP genotype of A₁A₂B₁B₂ could have one of two different sets of chromosomes: A₁B₁/A₂B₂ or A₁B₂/A₂B₁. One such algorithm to estimate haplotype frequencies is the expectation-maximization (EM) algorithm first formalized by Dempster et al. (1977). This algorithm is often used in genetics to infer haplotype frequencies from genotype data (e.g., Excoffier and Slatkin (1995); Tregouet et al., (2004)). It should be noted that for the two-SNP case explored here, EM algorithms have very little error provided that the allele frequencies and sample sizes are not too small. The impact on r² values is typically negligible.

As correlated genetic markers share information, interrogation of SNP markers in LD with a disease-associated SNP marker can also have sufficient power to detect disease association (Long and Langley (1999)). The relationship between the power to directly find disease-associated alleles and the power to indirectly detect disease-association was investigated by Pritchard and Przeworski (2001). In a straight-forward derivation, it can be shown that the power to detect disease association indirectly at a marker locus in linkage disequilibrium with a disease-association locus is approximately the same as the power to detect disease-association directly at the disease-association locus if the sample size is increased by a factor of

$\frac{1}{r^2}$

(the reciprocal of equation 18) at the marker in comparison with the disease-association locus.

Therefore, if one calculated the power to detect disease-association indirectly with an experiment having N samples, then equivalent power to directly detect disease-association (at the actual disease-susceptibility locus) would necessitate an experiment using approximately r²N samples. This elementary relationship between power, sample size and linkage disequilibrium can be used to derive an r² threshold value useful in determining whether or not genotyping markers in linkage disequilibrium with a SNP marker directly associated with disease status has enough power to indirectly detect disease-association.

To commence a derivation of the power to detect disease-associated markers through an indirect process, define the effective chromosomal sample size as

$\begin{array}{cc}n=\frac{4N_{\mathrm{cs}}N_{\mathrm{ct}}}{N_{\mathrm{cs}}+N_{\mathrm{ct}}};& \left(27\right)\end{array}$

where N_cs and N_ct are the numbers of diploid cases and controls, respectively. This is necessary to handle situations where the numbers of cases and controls are not equivalent. For equal case and control sample sizes, N_cs=N_ct=N, the value of the effective number of chromosomes is simply n=2N—as expected. Let power be calculated for a significance level α (such that traditional P-values below α will be deemed statistically significant). Define the standard Gaussian distribution function as Φ(·). Mathematically,

$\begin{array}{cc}\Phi \left(x\right)=\frac{1}{\sqrt{2\pi }}{\int }_{-\infty }^xe^{\frac{{\theta }^2}{2}}d\theta & \left(28\right)\end{array}$

Alternatively, the following error function notation (Erf) may also be used,

$\begin{array}{cc}\Phi \left(x\right)=\frac{1}{2}\left[1+\mathrm{Erf}\left(\frac{x}{\sqrt{2}}\right)\right]& \left(29\right)\end{array}$

For example, Φ(1.644854)=0.95. The value of r² may be derived to yield a pre-specified minimum amount of power to detect disease association though indirect interrogation. Noting that the LD SNP marker could be the one that is carrying the disease-association allele, therefore that this approach constitutes a lower-bound model where all indirect power results are expected to be at least as large as those interrogated.

Denote by β the error rate for not detecting truly disease-associated markers. Therefore, 1−β is the classical definition of statistical power. Substituting the Pritchard-Pzreworski result into the sample size, the power to detect disease association at a significance level of α is given by the approximation

$\begin{array}{cc}1-\beta \cong \Phi \left[\frac{q_{1,\mathrm{cs}}-q_{1,\mathrm{ct}}}{\sqrt{\frac{q_{1,\mathrm{cs}}\left(1-q_{1,\mathrm{cs}}\right)+q_{1,\mathrm{ct}}\left(1-q_{1,\mathrm{ct}}\right)}{r^2n}}}-Z_{1-\frac{\alpha }{2}}\right];& \left(30\right)\end{array}$

where Z_u is the inverse of the standard normal cumulative distribution evaluated at u (u∈(0,1)). Z_u=Φ⁻¹(u), where Φ(Φ⁻¹(u))=Φ⁻¹(Φ(u))=u. For example, setting α=0.05, and therefore 1−α/2=0.975, Z_0.975=1.95996 is obtained. Next, setting power equal to a threshold of a minimum power of T,

$\begin{array}{cc}T=\Phi \left[\frac{q_{1,\mathrm{cs}}-q_{1,\mathrm{ct}}}{\sqrt{\frac{q_{1,\mathrm{cs}}\left(1-q_{1,\mathrm{cs}}\right)+q_{1,\mathrm{ct}}\left(1-q_{1,\mathrm{ct}}\right)}{r^2n}}}-Z_{1-\frac{\alpha }{2}}\right]& \left(31\right)\end{array}$

and solving for r², the following threshold r² is obtained:

$\begin{array}{cc}{r}_T^2={\frac{\lfloor q_{1,\mathrm{cs}}\left(1-q_{1,\mathrm{cs}}\right)+q_{1,\mathrm{ct}}\left(1-q_{1,\mathrm{ct}}\right)\rfloor }{{n\left(q_{1,\mathrm{cs}}-q_{1,\mathrm{ct}}\right)}^2}\left[{\Phi }^{-1}\left(T\right)+Z_{1-\frac{\alpha }{2}}\right]}^2& \left(32\right)\end{array}$

Or,

$\begin{array}{cc}{r}_T^2=\frac{{\left(Z_T+Z_{1-\frac{\alpha }{2}}\right)}^2}{n}\left[\frac{{q_{1,\mathrm{cs}}\left(q_{1,\mathrm{cs}}\right)}^2+{q_{1,\mathrm{ct}}\left(q_{1,\mathrm{ct}}\right)}^2}{{\left(q_{1,\mathrm{cs}}-q_{1,\mathrm{ct}}\right)}^2}\right]& \left(33\right)\end{array}$

Suppose that r² is calculated between an interrogated SNP and a number of other SNPs with varying levels of LD with the interrogated SNP. The threshold value r_T² is the minimum value of linkage disequilibrium between the interrogated SNP and the potential LD SNPs such that the LD SNP still retains a power greater or equal to T for detecting disease-association. For example, suppose that SNP rs200 is genotyped in a case-control disease-association study and it is found to be associated with a disease phenotype. Further suppose that the minor allele frequency in 1,000 case chromosomes was found to be 16% in contrast with a minor allele frequency of 10% in 1,000 control chromosomes. Given those measurements one could have predicted, prior to the experiment, that the power to detect disease association at a significance level of 0.05 was quite high—approximately 98% using a test of allelic association. Applying equation (32) one can calculate a minimum value of r² to indirectly assess disease association assuming that the minor allele at SNP rs200 is truly disease-predisposing for a threshold level of power. If one sets the threshold level of power to be 80%, then r_T²=0.489 given the same significance level and chromosome numbers as above. Hence, any SNP with a pairwise r² value with rs200 greater than 0.489 is expected to have greater than 80% power to detect the disease association. Further, this is assuming the conservative model where the LD SNP is disease-associated only through linkage disequilibrium with the interrogated SNP rs200.

The contribution or association of particular SNPs and/or SNP haplotypes with disease phenotypes, such as stroke, enables the SNPs of the present invention to be used to develop superior diagnostic tests capable of identifying individuals who express a detectable trait, such as stroke, as the result of a specific genotype, or individuals whose genotype places them at an increased or decreased risk of developing a detectable trait at a subsequent time as compared to individuals who do not have that genotype. As described herein, diagnostics may be based on a single SNP or a group of SNPs. Combined detection of a plurality of SNPs (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24, 25, 30, 32, 48, 50, 64, 96, 100, or any other number in-between, or more, of the SNPs provided in Table 1 and/or Table 2) typically increases the probability of an accurate diagnosis. For example, the presence of a single SNP known to correlate with stroke might indicate a probability of 20% that an individual is at risk of having a stroke, whereas detection of five SNPs, each of which correlates with stroke, might indicate a probability of 80% that an individual is at risk of having a stroke. To further increase the accuracy of diagnosis or predisposition screening, analysis of the SNPs of the present invention can be combined with that of other polymorphisms or other risk factors of stroke, such as disease symptoms, pathological characteristics, family history, diet, environmental factors or lifestyle factors.

It will, of course, be understood by practitioners skilled in the treatment, prevention, or diagnosis of stroke that the present invention generally does not intend to provide an absolute identification of individuals who are at risk (or less at risk) of having a stroke, and/or pathologies related to stroke such as other vascular diseases, but rather to indicate a certain increased (or decreased) degree or likelihood of developing the disease (e.g., having a stroke) based on statistically significant association results. However, this information is extremely valuable as it can be used to, for example, initiate preventive treatments or to allow an individual carrying one or more significant SNPs or SNP haplotypes to foresee warning signs such as minor clinical symptoms, or to have regularly scheduled physical exams to monitor for appearance of a condition in order to identify and begin treatment of the condition at an early stage. Particularly with diseases that are extremely debilitating or fatal if not treated on time, the knowledge of a potential predisposition, even if this predisposition is not absolute, would likely contribute in a very significant manner to treatment efficacy.

The diagnostic techniques of the present invention may employ a variety of methodologies to determine whether a test subject has a SNP or a SNP pattern associated with an increased or decreased risk of developing a detectable trait or whether the individual suffers from a detectable trait as a result of a particular polymorphism/mutation, including, for example, methods which enable the analysis of individual chromosomes for haplotyping, family studies, single sperm DNA analysis, or somatic hybrids. The trait analyzed using the diagnostics of the invention may be any detectable trait that is commonly observed in pathologies and disorders related to stroke.

Another aspect of the present invention relates to a method of determining whether an individual is at risk (or less at risk) of developing one or more traits or whether an individual expresses one or more traits as a consequence of possessing a particular trait-causing or trait-influencing allele. These methods generally involve obtaining a nucleic acid sample from an individual and assaying the nucleic acid sample to determine which nucleotide(s) is/are present at one or more SNP positions, wherein the assayed nucleotide(s) is/are indicative of an increased or decreased risk of developing the trait or indicative that the individual expresses the trait as a result of possessing a particular trait-causing or trait-influencing allele.

In another embodiment, the SNP detection reagents of the present invention are used to determine whether an individual has one or more SNP allele(s) affecting the level (e.g., the concentration of mRNA or protein in a sample, etc.) or pattern (e.g., the kinetics of expression, rate of decomposition, stability profile, Km, Vmax, etc.) of gene expression (collectively, the “gene response” of a cell or bodily fluid). Such a determination can be accomplished by screening for mRNA or protein expression (e.g., by using nucleic acid arrays, RT-PCR, TaqMan assays, or mass spectrometry), identifying genes having altered expression in an individual, genotyping SNPs disclosed in Table 1 and/or Table 2 that could affect the expression of the genes having altered expression (e.g., SNPs that are in and/or around the gene(s) having altered expression, SNPs in regulatory/control regions, SNPs in and/or around other genes that are involved in pathways that could affect the expression of the gene(s) having altered expression, or all SNPs could be genotyped), and correlating SNP genotypes with altered gene expression. In this manner, specific SNP alleles at particular SNP sites can be identified that affect gene expression.

Pharmacogenomics and Therapeutics/Drug Development

The present invention provides methods for assessing the pharmacogenomics of a subject harboring particular SNP alleles or haplotypes or diplotypes to a particular therapeutic agent or pharmaceutical compound, or to a class of such compounds. Pharmacogenomics deals with the roles which clinically significant hereditary variations (e.g., SNPs) play in the response to drugs due to altered drug disposition and/or abnormal action in affected persons. See, e.g., Roses, Nature 405, 857-865 (2000); Gould Rothberg, Nature Biotechnology 19, 209-211 (2001); Eichelbaum, Clin. Exp. Pharmacol. Physiol. 23(10-11):983-985 (1996); and Linder, Clin. Chem. 43(2):254-266 (1997). The clinical outcomes of these variations can result in severe toxicity of therapeutic drugs in certain individuals or therapeutic failure of drugs in certain individuals as a result of individual variation in metabolism. Thus, the SNP genotype of an individual can determine the way a therapeutic compound acts on the body or the way the body metabolizes the compound. For example, SNPs in drug metabolizing enzymes can affect the activity of these enzymes, which in turn can affect both the intensity and duration of drug action, as well as drug metabolism and clearance.

The discovery of SNPs in drug metabolizing enzymes, drug transporters, proteins for pharmaceutical agents, and other drug targets has explained why some patients do not obtain the expected drug effects, show an exaggerated drug effect, or experience serious toxicity from standard drug dosages. SNPs can be expressed in the phenotype of the extensive metabolizer and in the phenotype of the poor metabolizer. Accordingly, SNPs may lead to allelic variants of a protein in which one or more of the protein functions in one population are different from those in another population. SNPs and the encoded variant peptides thus provide targets to ascertain a genetic predisposition that can affect treatment modality. For example, in a ligand-based treatment, SNPs may give rise to amino terminal extracellular domains and/or other ligand-binding regions of a receptor that are more or less active in ligand binding, thereby affecting subsequent protein activation. Accordingly, ligand dosage would necessarily be modified to maximize the therapeutic effect within a given population containing particular SNP alleles or haplotypes.

As an alternative to genotyping, specific variant proteins containing variant amino acid sequences encoded by alternative SNP alleles could be identified. Thus, pharmacogenomic characterization of an individual permits the selection of effective compounds and effective dosages of such compounds for prophylactic or therapeutic uses based on the individual's SNP genotype, thereby enhancing and optimizing the effectiveness of the therapy. Furthermore, the production of recombinant cells and transgenic animals containing particular SNPs/haplotypes allow effective clinical design and testing of treatment compounds and dosage regimens. For example, transgenic animals can be produced that differ only in specific SNP alleles in a gene that is orthologous to a human disease susceptibility gene.

Pharmacogenomic uses of the SNPs of the present invention provide several significant advantages for patient care, particularly in treating stroke. Pharmacogenomic characterization of an individual, based on an individual's SNP genotype, can identify those individuals unlikely to respond to treatment with a particular medication and thereby allows physicians to avoid prescribing the ineffective medication to those individuals. On the other hand, SNP genotyping of an individual may enable physicians to select the appropriate medication and dosage regimen that will be most effective based on an individual's SNP genotype. This information increases a physician's confidence in prescribing medications and motivates patients to comply with their drug regimens. Furthermore, pharmacogenomics may identify patients predisposed to toxicity and adverse reactions to particular drugs or drug dosages. Adverse drug reactions lead to more than 100,000 avoidable deaths per year in the United States alone and therefore represent a significant cause of hospitalization and death, as well as a significant economic burden on the healthcare system (Pfost et. al., Trends in Biotechnology, August 2000.). Thus, pharmacogenomics based on the SNPs disclosed herein has the potential to both save lives and reduce healthcare costs substantially.

It is also well known in the art that markers that are diagnostically useful in distinguishing patients at higher risk of developing a disease (such as stroke) from those who are at a decreased risk of developing the disease can be useful in identifying those patients who are more likely to respond to drug treatments targeting those pathways involving genes where the diagnostic SNPs reside. See references Gerdes, et al., Circulation, 2000; 101:1366-1371, Kuivenhoven, et al., N Engl J Med 1998; 338:86-93, Stolarz, et al., Hypertension 2004; 44:156-162, Chartier-Harlin, et al., Hum. Mol. Genet. 1994 April; 3(4):569-74, Roses, et al., The Pharmacogenomics Journal 2006, 1-19.

In that regard, embodiments of the present invention can be very useful in assisting clinicians to select individuals who are more likely to have a stroke and who are therefore good candidates for receiving therapy for the prevention or treatment of stroke, thus warranting administration of the above-mentioned drug treatments to such individuals. On the other hand, individuals who are deemed to have a low risk of having a stroke, using SNP markers discovered herein, can be spared the aggravation and wastefulness of the drug treatment due to the reduced benefit of such treatment in view of its cost and potential side effects.

Pharmacogenomics in general is discussed further in Rose et al., “Pharmacogenetic analysis of clinically relevant genetic polymorphisms”, Methods Mol Med. 2003; 85:225-37. Pharmacogenomics as it relates to Alzheimer's disease and other neurodegenerative disorders is discussed in Cacabelos, “Pharmacogenomics for the treatment of dementia”, Ann Med. 2002; 34(5):357-79, Maimone et al., “Pharmacogenomics of neurodegenerative diseases”, Eur J Pharmacol. 2001 Feb. 9; 413(1):11-29, and Poirier, “Apolipoprotein E: a pharmacogenetic target for the treatment of Alzheimer's disease”, Mol Diagn. 1999 December; 4(4):335-41. Pharmacogenomics as it relates to cardiovascular disorders is discussed in Siest et al., “Pharmacogenomics of drugs affecting the cardiovascular system”, Clin Chem Lab Med. 2003 April; 41(4):590-9, Mukherjee et al., “Pharmacogenomics in cardiovascular diseases”, Prog Cardiovasc Dis. 2002 May-June; 44(6):479-98, and Mooser et al., “Cardiovascular pharmacogenetics in the SNP era”, J Thromb Haemost. 2003 July; 1(7):1398-402. Pharmacogenomics as it relates to cancer is discussed in McLeod et al., “Cancer pharmacogenomics: SNPs, chips, and the individual patient”, Cancer Invest. 2003; 21(4):630-40 and Watters et al., “Cancer pharmacogenomics: current and future applications”, Biochim Biophys Acta. 2003 Mar. 17; 1603(2):99-111.

The SNPs of the present invention also can be used to identify novel therapeutic targets for stroke. For example, genes containing the disease-associated variants (“variant genes”) or their products, as well as genes or their products that are directly or indirectly regulated by or interacting with these variant genes or their products, can be targeted for the development of therapeutics that, for example, treat the disease or prevent or delay disease onset. The therapeutics may be composed of, for example, small molecules, proteins, protein fragments or peptides, antibodies, nucleic acids, or their derivatives or mimetics which modulate the functions or levels of the target genes or gene products.

The SNP-containing nucleic acid molecules disclosed herein, and their complementary nucleic acid molecules, may be used as antisense constructs to control gene expression in cells, tissues, and organisms. Antisense technology is well established in the art and extensively reviewed in Antisense Drug Technology: Principles, Strategies, and Applications, Crooke (ed.), Marcel Dekker, Inc.: New York (2001). An antisense nucleic acid molecule is generally designed to be complementary to a region of mRNA expressed by a gene so that the antisense molecule hybridizes to the mRNA and thereby blocks translation of mRNA into protein. Various classes of antisense oligonucleotides are used in the art, two of which are cleavers and blockers. Cleavers, by binding to target RNAs, activate intracellular nucleases (e.g., RNaseH or RNase L) that cleave the target RNA. Blockers, which also bind to target RNAs, inhibit protein translation through steric hindrance of ribosomes. Exemplary blockers include peptide nucleic acids, morpholinos, locked nucleic acids, and methylphosphonates (see, e.g., Thompson, Drug Discovery Today, 7 (17): 912-917 (2002)). Antisense oligonucleotides are directly useful as therapeutic agents, and are also useful for determining and validating gene function (e.g., in gene knock-out or knock-down experiments).

Antisense technology is further reviewed in: Lavery et al., “Antisense and RNAi: powerful tools in drug target discovery and validation”, Curr Opin Drug Discov Devel. 2003 July; 6(4):561-9; Stephens et al., “Antisense oligonucleotide therapy in cancer”, Curr Opin Mol Ther. 2003 April; 5(2):118-22; Kurreck, “Antisense technologies. Improvement through novel chemical modifications”, Eur J Biochem. 2003 April; 270(8):1628-44; Dias et al., “Antisense oligonucleotides: basic concepts and mechanisms”, Mol Cancer Ther. 2002 March; 1(5):347-55; Chen, “Clinical development of antisense oligonucleotides as anti-cancer therapeutics”, Methods Mol Med. 2003; 75:621-46; Wang et al., “Antisense anticancer oligonucleotide therapeutics”, Curr Cancer Drug Targets. 2001 November; 1(3):177-96; and Bennett, “Efficiency of antisense oligonucleotide drug discovery”, Antisense Nucleic Acid Drug Dev. 2002 June; 12(3):215-24.

The SNPs of the present invention are particularly useful for designing antisense reagents that are specific for particular nucleic acid variants. Based on the SNP information disclosed herein, antisense oligonucleotides can be produced that specifically target mRNA molecules that contain one or more particular SNP nucleotides. In this manner, expression of mRNA molecules that contain one or more undesired polymorphisms (e.g., SNP nucleotides that lead to a defective protein such as an amino acid substitution in a catalytic domain) can be inhibited or completely blocked. Thus, antisense oligonucleotides can be used to specifically bind a particular polymorphic form (e.g., a SNP allele that encodes a defective protein), thereby inhibiting translation of this form, but which do not bind an alternative polymorphic form (e.g., an alternative SNP nucleotide that encodes a protein having normal function).

Antisense molecules can be used to inactivate mRNA in order to inhibit gene expression and production of defective proteins. Accordingly, these molecules can be used to treat a disorder, such as stroke, characterized by abnormal or undesired gene expression or expression of certain defective proteins. This technique can involve cleavage by means of ribozymes containing nucleotide sequences complementary to one or more regions in the mRNA that attenuate the ability of the mRNA to be translated. Possible mRNA regions include, for example, protein-coding regions and particularly protein-coding regions corresponding to catalytic activities, substrate/ligand binding, or other functional activities of a protein.

The SNPs of the present invention are also useful for designing RNA interference reagents that specifically target nucleic acid molecules having particular SNP variants. RNA interference (RNAi), also referred to as gene silencing, is based on using double-stranded RNA (dsRNA) molecules to turn genes off. When introduced into a cell, dsRNAs are processed by the cell into short fragments (generally about 21, 22, or 23 nucleotides in length) known as small interfering RNAs (siRNAs) which the cell uses in a sequence-specific manner to recognize and destroy complementary RNAs (Thompson, Drug Discovery Today, 7 (17): 912-917 (2002)). Accordingly, an aspect of the present invention specifically contemplates isolated nucleic acid molecules that are about 18-26 nucleotides in length, preferably 19-25 nucleotides in length, and more preferably 20, 21, 22, or 23 nucleotides in length, and the use of these nucleic acid molecules for RNAi. Because RNAi molecules, including siRNAs, act in a sequence-specific manner, the SNPs of the present invention can be used to design RNAi reagents that recognize and destroy nucleic acid molecules having specific SNP alleles/nucleotides (such as deleterious alleles that lead to the production of defective proteins), while not affecting nucleic acid molecules having alternative SNP alleles (such as alleles that encode proteins having normal function). As with antisense reagents, RNAi reagents may be directly useful as therapeutic agents (e.g., for turning off defective, disease-causing genes), and are also useful for characterizing and validating gene function (e.g., in gene knock-out or knock-down experiments).

The following references provide a further review of RNAi: Reynolds et al., “Rational siRNA design for RNA interference”, Nat Biotechnol. 2004 March; 22(3):326-30. Epub 2004 Feb. 1; Chi et al., “Genomewide view of gene silencing by small interfering RNAs”, PNAS 100(11):6343-6346, 2003; Vickers et al., “Efficient Reduction of Target RNAs by Small Interfering RNA and RNase H-dependent Antisense Agents”, J. Biol. Chem. 278: 7108-7118, 2003; Agami, “RNAi and related mechanisms and their potential use for therapy”, Curr Opin Chem Biol. 2002 December; 6(6):829-34; Lavery et al., “Antisense and RNAi: powerful tools in drug target discovery and validation”, Curr Opin Drug Discov Devel. 2003 July; 6(4):561-9; Shi, “Mammalian RNAi for the masses”, Trends Genet 2003 January; 19(1):9-12), Shuey et al., “RNAi: gene-silencing in therapeutic intervention”, Drug Discovery Today 2002 October; 7(20):1040-1046; McManus et al., Nat Rev Genet 2002 October; 3(10):737-47; Xia et al., Nat Biotechnol 2002 October; 20(10):1006-10; Plasterk et al., Curr Opin Genet Dev 2000 October; 10(5):562-7; Bosher et al., Nat Cell Biol 2000 February; 2(2):E31-6; and Hunter, Curr Biol 1999 Jun. 17; 9(12):R440-2).

A subject suffering from a pathological condition, such as stroke, ascribed to a SNP may be treated so as to correct the genetic defect (see Kren et al., Proc. Natl. Acad. Sci. USA 96:10349-10354 (1999)). Such a subject can be identified by any method that can detect the polymorphism in a biological sample drawn from the subject. Such a genetic defect may be permanently corrected by administering to such a subject a nucleic acid fragment incorporating a repair sequence that supplies the normal/wild-type nucleotide at the position of the SNP. This site-specific repair sequence can encompass an RNA/DNA oligonucleotide that operates to promote endogenous repair of a subject's genomic DNA. The site-specific repair sequence is administered in an appropriate vehicle, such as a complex with polyethylenimine, encapsulated in anionic liposomes, a viral vector such as an adenovirus, or other pharmaceutical composition that promotes intracellular uptake of the administered nucleic acid. A genetic defect leading to an inborn pathology may then be overcome, as the chimeric oligonucleotides induce incorporation of the normal sequence into the subject's genome. Upon incorporation, the normal gene product is expressed, and the replacement is propagated, thereby engendering a permanent repair and therapeutic enhancement of the clinical condition of the subject.

In cases in which a cSNP results in a variant protein that is ascribed to be the cause of, or a contributing factor to, a pathological condition, a method of treating such a condition can include administering to a subject experiencing the pathology the wild-type/normal cognate of the variant protein. Once administered in an effective dosing regimen, the wild-type cognate provides complementation or remediation of the pathological condition.

The invention further provides a method for identifying a compound or agent that can be used to treat or prevent stroke. The SNPs disclosed herein are useful as targets for the identification and/or development of therapeutic agents. A method for identifying a therapeutic agent or compound typically includes assaying the ability of the agent or compound to modulate the activity and/or expression of a SNP-containing nucleic acid or the encoded product and thus identifying an agent or a compound that can be used to treat a disorder characterized by undesired activity or expression of the SNP-containing nucleic acid or the encoded product. The assays can be performed in cell-based and cell-free systems. Cell-based assays can include cells naturally expressing the nucleic acid molecules of interest or recombinant cells genetically engineered to express certain nucleic acid molecules.

Variant gene expression in a stroke patient can include, for example, either expression of a SNP-containing nucleic acid sequence (for instance, a gene that contains a SNP can be transcribed into an mRNA transcript molecule containing the SNP, which can in turn be translated into a variant protein) or altered expression of a normal/wild-type nucleic acid sequence due to one or more SNPs (for instance, a regulatory/control region can contain a SNP that affects the level or pattern of expression of a normal transcript).

Assays for variant gene expression can involve direct assays of nucleic acid levels (e.g., mRNA levels), expressed protein levels, or of collateral compounds involved in a signal pathway. Further, the expression of genes that are up- or down-regulated in response to the signal pathway can also be assayed. In this embodiment, the regulatory regions of these genes can be operably linked to a reporter gene such as luciferase.

Modulators of variant gene expression can be identified in a method wherein, for example, a cell is contacted with a candidate compound/agent and the expression of mRNA determined. The level of expression of mRNA in the presence of the candidate compound is compared to the level of expression of mRNA in the absence of the candidate compound. The candidate compound can then be identified as a modulator of variant gene expression based on this comparison and be used to treat a disorder such as stroke that is characterized by variant gene expression (e.g., either expression of a SNP-containing nucleic acid or altered expression of a normal/wild-type nucleic acid molecule due to one or more SNPs that affect expression of the nucleic acid molecule) due to one or more SNPs of the present invention. When expression of mRNA is statistically significantly greater in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of nucleic acid expression. When nucleic acid expression is statistically significantly less in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of nucleic acid expression.

The invention further provides methods of treatment, with the SNP or associated nucleic acid domain (e.g., catalytic domain, ligand/substrate-binding domain, regulatory/control region, etc.) or gene, or the encoded mRNA transcript, as a target, using a compound identified through drug screening as a gene modulator to modulate variant nucleic acid expression. Modulation can include either up-regulation (i.e., activation or agonization) or down-regulation (i.e., suppression or antagonization) of nucleic acid expression.

Expression of mRNA transcripts and encoded proteins, either wild type or variant, may be altered in individuals with a particular SNP allele in a regulatory/control element, such as a promoter or transcription factor binding domain, that regulates expression. In this situation, methods of treatment and compounds can be identified, as discussed herein, that regulate or overcome the variant regulatory/control element, thereby generating normal, or healthy, expression levels of either the wild type or variant protein.

The SNP-containing nucleic acid molecules of the present invention are also useful for monitoring the effectiveness of modulating compounds on the expression or activity of a variant gene, or encoded product, in clinical trials or in a treatment regimen. Thus, the gene expression pattern can serve as an indicator for the continuing effectiveness of treatment with the compound, particularly with compounds to which a patient can develop resistance, as well as an indicator for toxicities. The gene expression pattern can also serve as a marker indicative of a physiological response of the affected cells to the compound. Accordingly, such monitoring would allow either increased administration of the compound or the administration of alternative compounds to which the patient has not become resistant. Similarly, if the level of nucleic acid expression falls below a desirable level, administration of the compound could be commensurately decreased.

In another aspect of the present invention, there is provided a pharmaceutical pack comprising a therapeutic agent (e.g., a small molecule drug, antibody, peptide, antisense or RNAi nucleic acid molecule, etc.) and a set of instructions for administration of the therapeutic agent to humans diagnostically tested for one or more SNPs or SNP haplotypes provided by the present invention.

The SNPs/haplotypes of the present invention are also useful for improving many different aspects of the drug development process. For instance, an aspect of the present invention includes selecting individuals for clinical trials based on their SNP genotype. For example, individuals with SNP genotypes that indicate that they are likely to positively respond to a drug can be included in the trials, whereas those individuals whose SNP genotypes indicate that they are less likely to or would not respond to the drug, or who are at risk for suffering toxic effects or other adverse reactions, can be excluded from the clinical trials. This not only can improve the safety of clinical trials, but also can enhance the chances that the trial will demonstrate statistically significant efficacy. Furthermore, the SNPs of the present invention may explain why certain previously developed drugs performed poorly in clinical trials and may help identify a subset of the population that would benefit from a drug that had previously performed poorly in clinical trials, thereby “rescuing” previously developed drugs, and enabling the drug to be made available to a particular stroke patient population that can benefit from it.

SNPs have many important uses in drug discovery, screening, and development. A high probability exists that, for any gene/protein selected as a potential drug target, variants of that gene/protein will exist in a patient population. Thus, determining the impact of gene/protein variants on the selection and delivery of a therapeutic agent should be an integral aspect of the drug discovery and development process. (Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 March; S30-S36).

Knowledge of variants (e.g., SNPs and any corresponding amino acid polymorphisms) of a particular therapeutic target (e.g., a gene, mRNA transcript, or protein) enables parallel screening of the variants in order to identify therapeutic candidates (e.g., small molecule compounds, antibodies, antisense or RNAi nucleic acid compounds, etc.) that demonstrate efficacy across variants (Rothberg, Nat Biotechnol 2001 March; 19(3):209-11). Such therapeutic candidates would be expected to show equal efficacy across a larger segment of the patient population, thereby leading to a larger potential market for the therapeutic candidate.

Furthermore, identifying variants of a potential therapeutic target enables the most common form of the target to be used for selection of therapeutic candidates, thereby helping to ensure that the experimental activity that is observed for the selected candidates reflects the real activity expected in the largest proportion of a patient population (Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 March; S30-S36).

Additionally, screening therapeutic candidates against all known variants of a target can enable the early identification of potential toxicities and adverse reactions relating to particular variants. For example, variability in drug absorption, distribution, metabolism and excretion (ADME) caused by, for example, SNPs in therapeutic targets or drug metabolizing genes, can be identified, and this information can be utilized during the drug development process to minimize variability in drug disposition and develop therapeutic agents that are safer across a wider range of a patient population. The SNPs of the present invention, including the variant proteins and encoding polymorphic nucleic acid molecules provided in Tables 1-2, are useful in conjunction with a variety of toxicology methods established in the art, such as those set forth in Current Protocols in Toxicology, John Wiley & Sons, Inc., N.Y.

Furthermore, therapeutic agents that target any art-known proteins (or nucleic acid molecules, either RNA or DNA) may cross-react with the variant proteins (or polymorphic nucleic acid molecules) disclosed in Table 1, thereby significantly affecting the pharmacokinetic properties of the drug. Consequently, the protein variants and the SNP-containing nucleic acid molecules disclosed in Tables 1-2 are useful in developing, screening, and evaluating therapeutic agents that target corresponding art-known protein forms (or nucleic acid molecules). Additionally, as discussed above, knowledge of all polymorphic forms of a particular drug target enables the design of therapeutic agents that are effective against most or all such polymorphic forms of the drug target.

Pharmaceutical Compositions and Administration Thereof

Any of the stroke-associated proteins, and encoding nucleic acid molecules, disclosed herein can be used as therapeutic targets (or directly used themselves as therapeutic compounds) for treating or preventing stroke and related pathologies, and the present disclosure enables therapeutic compounds (e.g., small molecules, antibodies, therapeutic proteins, RNAi and antisense molecules, etc.) to be developed that target (or are comprised of) any of these therapeutic targets.

In general, a therapeutic compound will be administered in a therapeutically effective amount by any of the accepted modes of administration for agents that serve similar utilities. The actual amount of the therapeutic compound of this invention, i.e., the active ingredient, will depend upon numerous factors such as the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and form of administration, and other factors.

Therapeutically effective amounts of therapeutic compounds may range from, for example, approximately 0.01-50 mg per kilogram body weight of the recipient per day; preferably about 0.1-20 mg/kg/day. Thus, as an example, for administration to a 70 kg person, the dosage range would most preferably be about 7 mg to 1.4 g per day.

In general, therapeutic compounds will be administered as pharmaceutical compositions by any one of the following routes: oral, systemic (e.g., transdermal, intranasal, or by suppository), or parenteral (e.g., intramuscular, intravenous, or subcutaneous) administration. The preferred manner of administration is oral or parenteral using a convenient daily dosage regimen, which can be adjusted according to the degree of affliction. Oral compositions can take the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs, aerosols, or any other appropriate compositions.

The choice of formulation depends on various factors such as the mode of drug administration (e.g., for oral administration, formulations in the form of tablets, pills, or capsules are preferred) and the bioavailability of the drug substance. Recently, pharmaceutical formulations have been developed especially for drugs that show poor bioavailability based upon the principle that bioavailability can be increased by increasing the surface area, i.e., decreasing particle size. For example, U.S. Pat. No. 4,107,288 describes a pharmaceutical formulation having particles in the size range from 10 to 1,000 nm in which the active material is supported on a cross-linked matrix of macromolecules. U.S. Pat. No. 5,145,684 describes the production of a pharmaceutical formulation in which the drug substance is pulverized to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a pharmaceutical formulation that exhibits remarkably high bioavailability.

Pharmaceutical compositions are comprised of, in general, a therapeutic compound in combination with at least one pharmaceutically acceptable excipient. Acceptable excipients are non-toxic, aid administration, and do not adversely affect the therapeutic benefit of the therapeutic compound. Such excipients may be any solid, liquid, semi-solid or, in the case of an aerosol composition, gaseous excipient that is generally available to one skilled in the art.

Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk and the like. Liquid and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oils, including those of petroleum, animal, vegetable or synthetic origin, e.g., peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid carriers, particularly for injectable solutions, include water, saline, aqueous dextrose, and glycols.

Compressed gases may be used to disperse a compound of this invention in aerosol form. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc.

Other suitable pharmaceutical excipients and their formulations are described in Remington's Pharmaceutical Sciences, edited by E. W. Martin (Mack Publishing Company, 18^th ed., 1990).

The amount of the therapeutic compound in a formulation can vary within the full range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent (wt %) basis, from about 0.01-99.99 wt % of the therapeutic compound based on the total formulation, with the balance being one or more suitable pharmaceutical excipients. Preferably, the compound is present at a level of about 1-80 wt %.

Therapeutic compounds can be administered alone or in combination with other therapeutic compounds or in combination with one or more other active ingredient(s). For example, an inhibitor or stimulator of a stroke-associated protein can be administered in combination with another agent that inhibits or stimulates the activity of the same or a different stroke-associated protein to thereby counteract the affects of stroke.

For further information regarding pharmacology, see Current Protocols in Pharmacology, John Wiley & Sons, Inc., N.Y.

Human Identification Applications

In addition to their diagnostic, risk assessment, preventive, and therapeutic uses in stroke and related pathologies, the SNPs provided by the present invention are also useful as human identification markers for such applications as forensics, paternity testing, and biometrics (see, e.g., Gill, “An assessment of the utility of single nucleotide polymorphisms (SNPs) for forensic purposes”, Int J Legal Med. 2001; 114(4-5):204-10). Genetic variations in the nucleic acid sequences between individuals can be used as genetic markers to identify individuals and to associate a biological sample with an individual. Determination of which nucleotides occupy a set of SNP positions in an individual identifies a set of SNP markers that distinguishes the individual. The more SNP positions that are analyzed, the lower the probability that the set of SNPs in one individual is the same as that in an unrelated individual. Preferably, if multiple sites are analyzed, the sites are unlinked (i.e., inherited independently). Thus, preferred sets of SNPs can be selected from among the SNPs disclosed herein, which may include SNPs on different chromosomes, SNPs on different chromosome arms, and/or SNPs that are dispersed over substantial distances along the same chromosome arm.

Furthermore, among the SNPs disclosed herein, preferred SNPs for use in certain forensic/human identification applications include SNPs located at degenerate codon positions (i.e., the third position in certain codons which can be one of two or more alternative nucleotides and still encode the same amino acid), since these SNPs do not affect the encoded protein. SNPs that do not affect the encoded protein are expected to be under less selective pressure and are therefore expected to be more polymorphic in a population, which is typically an advantage for forensic/human identification applications. However, for certain forensics/human identification applications, such as predicting phenotypic characteristics (e.g., inferring ancestry or inferring one or more physical characteristics of an individual) from a DNA sample, it may be desirable to utilize SNPs that affect the encoded protein.

For many of the SNPs disclosed in Tables 1-2 (which are identified as “Applera” SNP source), Tables 1-2 provide SNP allele frequencies obtained by re-sequencing the DNA of chromosomes from 39 individuals (Tables 1-2 also provide allele frequency information for “Celera” source SNPs and, where available, public SNPs from dbEST, HGBASE, and/or HGMD). The allele frequencies provided in Tables 1-2 enable these SNPs to be readily used for human identification applications. Although any SNP disclosed in Table 1 and/or Table 2 could be used for human identification, the closer that the frequency of the minor allele at a particular SNP site is to 50%, the greater the ability of that SNP to discriminate between different individuals in a population since it becomes increasingly likely that two randomly selected individuals would have different alleles at that SNP site. Using the SNP allele frequencies provided in Tables 1-2, one of ordinary skill in the art could readily select a subset of SNPs for which the frequency of the minor allele is, for example, at least 1%, 2%, 5%, 10%, 20%, 25%, 30%, 40%, 45%, or 50%, or any other frequency in-between. Thus, since Tables 1-2 provide allele frequencies based on the re-sequencing of the chromosomes from 39 individuals, a subset of SNPs could readily be selected for human identification in which the total allele count of the minor allele at a particular SNP site is, for example, at least 1, 2, 4, 8, 10, 16, 20, 24, 30, 32, 36, 38, 39, 40, or any other number in-between.

Furthermore, Tables 1-2 also provide population group (interchangeably referred to herein as ethnic or racial groups) information coupled with the extensive allele frequency information. For example, the group of 39 individuals whose DNA was re-sequenced was made-up of 20 Caucasians and 19 African-Americans. This population group information enables further refinement of SNP selection for human identification. For example, preferred SNPs for human identification can be selected from Tables 1-2 that have similar allele frequencies in both the Caucasian and African-American populations; thus, for example, SNPs can be selected that have equally high discriminatory power in both populations. Alternatively, SNPs can be selected for which there is a statistically significant difference in allele frequencies between the Caucasian and African-American populations (as an extreme example, a particular allele may be observed only in either the Caucasian or the African-American population group but not observed in the other population group); such SNPs are useful, for example, for predicting the race/ethnicity of an unknown perpetrator from a biological sample such as a hair or blood stain recovered at a crime scene. For a discussion of using SNPs to predict ancestry from a DNA sample, including statistical methods, see Frudakis et al., “A Classifier for the SNP-Based Inference of Ancestry”, Journal of Forensic Sciences 2003; 48(4):771-782.

SNPs have numerous advantages over other types of polymorphic markers, such as short tandem repeats (STRs). For example, SNPs can be easily scored and are amenable to automation, making SNPs the markers of choice for large-scale forensic databases. SNPs are found in much greater abundance throughout the genome than repeat polymorphisms. Population frequencies of two polymorphic forms can usually be determined with greater accuracy than those of multiple polymorphic forms at multi-allelic loci. SNPs are mutationaly more stable than repeat polymorphisms. SNPs are not susceptible to artefacts such as stutter bands that can hinder analysis. Stutter bands are frequently encountered when analyzing repeat polymorphisms, and are particularly troublesome when analyzing samples such as crime scene samples that may contain mixtures of DNA from multiple sources. Another significant advantage of SNP markers over STR markers is the much shorter length of nucleic acid needed to score a SNP. For example, STR markers are generally several hundred base pairs in length. A SNP, on the other hand, comprises a single nucleotide, and generally a short conserved region on either side of the SNP position for primer and/or probe binding. This makes SNPs more amenable to typing in highly degraded or aged biological samples that are frequently encountered in forensic casework in which DNA may be fragmented into short pieces.

SNPs also are not subject to microvariant and “off-ladder” alleles frequently encountered when analyzing STR loci. Microvariants are deletions or insertions within a repeat unit that change the size of the amplified DNA product so that the amplified product does not migrate at the same rate as reference alleles with normal sized repeat units. When separated by size, such as by electrophoresis on a polyacrylamide gel, microvariants do not align with a reference allelic ladder of standard sized repeat units, but rather migrate between the reference alleles. The reference allelic ladder is used for precise sizing of alleles for allele classification; therefore alleles that do not align with the reference allelic ladder lead to substantial analysis problems. Furthermore, when analyzing multi-allelic repeat polymorphisms, occasionally an allele is found that consists of more or less repeat units than has been previously seen in the population, or more or less repeat alleles than are included in a reference allelic ladder. These alleles will migrate outside the size range of known alleles in a reference allelic ladder, and therefore are referred to as “off-ladder” alleles. In extreme cases, the allele may contain so few or so many repeats that it migrates well out of the range of the reference allelic ladder. In this situation, the allele may not even be observed, or, with multiplex analysis, it may migrate within or close to the size range for another locus, further confounding analysis.

SNP analysis avoids the problems of microvariants and off-ladder alleles encountered in STR analysis. Importantly, microvariants and off-ladder alleles may provide significant problems, and may be completely missed, when using analysis methods such as oligonucleotide hybridization arrays, which utilize oligonucleotide probes specific for certain known alleles. Furthermore, off-ladder alleles and microvariants encountered with STR analysis, even when correctly typed, may lead to improper statistical analysis, since their frequencies in the population are generally unknown or poorly characterized, and therefore the statistical significance of a matching genotype may be questionable. All these advantages of SNP analysis are considerable in light of the consequences of most DNA identification cases, which may lead to life imprisonment for an individual, or re-association of remains to the family of a deceased individual.

DNA can be isolated from biological samples such as blood, bone, hair, saliva, or semen, and compared with the DNA from a reference source at particular SNP positions. Multiple SNP markers can be assayed simultaneously in order to increase the power of discrimination and the statistical significance of a matching genotype. For example, oligonucleotide arrays can be used to genotype a large number of SNPs simultaneously. The SNPs provided by the present invention can be assayed in combination with other polymorphic genetic markers, such as other SNPs known in the art or STRs, in order to identify an individual or to associate an individual with a particular biological sample.

Furthermore, the SNPs provided by the present invention can be genotyped for inclusion in a database of DNA genotypes, for example, a criminal DNA databank such as the FBI's Combined DNA Index System (CODIS) database. A genotype obtained from a biological sample of unknown source can then be queried against the database to find a matching genotype, with the SNPs of the present invention providing nucleotide positions at which to compare the known and unknown DNA sequences for identity. Accordingly, the present invention provides a database comprising novel SNPs or SNP alleles of the present invention (e.g., the database can comprise information indicating which alleles are possessed by individual members of a population at one or more novel SNP sites of the present invention), such as for use in forensics, biometrics, or other human identification applications. Such a database typically comprises a computer-based system in which the SNPs or SNP alleles of the present invention are recorded on a computer readable medium (see the section of the present specification entitled “Computer-Related Embodiments”).

The SNPs of the present invention can also be assayed for use in paternity testing. The object of paternity testing is usually to determine whether a male is the father of a child. In most cases, the mother of the child is known and thus, the mother's contribution to the child's genotype can be traced. Paternity testing investigates whether the part of the child's genotype not attributable to the mother is consistent with that of the putative father. Paternity testing can be performed by analyzing sets of polymorphisms in the putative father and the child, with the SNPs of the present invention providing nucleotide positions at which to compare the putative father's and child's DNA sequences for identity. If the set of polymorphisms in the child attributable to the father does not match the set of polymorphisms of the putative father, it can be concluded, barring experimental error, that the putative father is not the father of the child. If the set of polymorphisms in the child attributable to the father match the set of polymorphisms of the putative father, a statistical calculation can be performed to determine the probability of coincidental match, and a conclusion drawn as to the likelihood that the putative father is the true biological father of the child.

In addition to paternity testing, SNPs are also useful for other types of kinship testing, such as for verifying familial relationships for immigration purposes, or for cases in which an individual alleges to be related to a deceased individual in order to claim an inheritance from the deceased individual, etc. For further information regarding the utility of SNPs for paternity testing and other types of kinship testing, including methods for statistical analysis, see Krawczak, “Informativity assessment for biallelic single nucleotide polymorphisms”, Electrophoresis 1999 June; 20(8):1676-81.

The use of the SNPs of the present invention for human identification further extends to various authentication systems, commonly referred to as biometric systems, which typically convert physical characteristics of humans (or other organisms) into digital data. Biometric systems include various technological devices that measure such unique anatomical or physiological characteristics as finger, thumb, or palm prints; hand geometry; vein patterning on the back of the hand; blood vessel patterning of the retina and color and texture of the iris; facial characteristics; voice patterns; signature and typing dynamics; and DNA. Such physiological measurements can be used to verify identity and, for example, restrict or allow access based on the identification. Examples of applications for biometrics include physical area security, computer and network security, aircraft passenger check-in and boarding, financial transactions, medical records access, government benefit distribution, voting, law enforcement, passports, visas and immigration, prisons, various military applications, and for restricting access to expensive or dangerous items, such as automobiles or guns (see, for example, O'Connor, Stanford Technology Law Review and U.S. Pat. No. 6,119,096).

Groups of SNPs, particularly the SNPs provided by the present invention, can be typed to uniquely identify an individual for biometric applications such as those described above. Such SNP typing can readily be accomplished using, for example, DNA chips/arrays. Preferably, a minimally invasive means for obtaining a DNA sample is utilized. For example, PCR amplification enables sufficient quantities of DNA for analysis to be obtained from buccal swabs or fingerprints, which contain DNA-containing skin cells and oils that are naturally transferred during contact. Further information regarding techniques for using SNPs in forensic/human identification applications can be found in, for example, Current Protocols in Human Genetics, John Wiley & Sons, N.Y. (2002), 14.1-14.7.

Variant Proteins, Antibodies, Vectors & Host Cells, & Uses Thereof

Variant Proteins Encoded by SNP-Containing Nucleic Acid Molecules

The present invention provides SNP-containing nucleic acid molecules, many of which encode proteins having variant amino acid sequences as compared to the art-known (i.e., wild-type) proteins. Amino acid sequences encoded by the polymorphic nucleic acid molecules of the present invention are provided as SEQ ID NOS:81-160 in Table 1 and the Sequence Listing. These variants will generally be referred to herein as variant proteins/peptides/polypeptides, or polymorphic proteins/peptides/polypeptides of the present invention. The terms “protein”, “peptide”, and “polypeptide” are used herein interchangeably.

A variant protein of the present invention may be encoded by, for example, a nonsynonymous nucleotide substitution at any one of the cSNP positions disclosed herein. In addition, variant proteins may also include proteins whose expression, structure, and/or function is altered by a SNP disclosed herein, such as a SNP that creates or destroys a stop codon, a SNP that affects splicing, and a SNP in control/regulatory elements, e.g. promoters, enhancers, or transcription factor binding domains.

As used herein, a protein or peptide is said to be “isolated” or “purified” when it is substantially free of cellular material or chemical precursors or other chemicals. The variant proteins of the present invention can be purified to homogeneity or other lower degrees of purity. The level of purification will be based on the intended use. The key feature is that the preparation allows for the desired function of the variant protein, even if in the presence of considerable amounts of other components.

As used herein, “substantially free of cellular material” includes preparations of the variant protein having less than about 30% (by dry weight) other proteins (i.e., contaminating protein), less than about 20% other proteins, less than about 10% other proteins, or less than about 5% other proteins. When the variant protein is recombinantly produced, it can also be substantially free of culture medium, i.e., culture medium represents less than about 20% of the volume of the protein preparation.

The language “substantially free of chemical precursors or other chemicals” includes preparations of the variant protein in which it is separated from chemical precursors or other chemicals that are involved in its synthesis. In one embodiment, the language “substantially free of chemical precursors or other chemicals” includes preparations of the variant protein having less than about 30% (by dry weight) chemical precursors or other chemicals, less than about 20% chemical precursors or other chemicals, less than about 10% chemical precursors or other chemicals, or less than about 5% chemical precursors or other chemicals.

An isolated variant protein may be purified from cells that naturally express it, purified from cells that have been altered to express it (recombinant host cells), or synthesized using known protein synthesis methods. For example, a nucleic acid molecule containing SNP(s) encoding the variant protein can be cloned into an expression vector, the expression vector introduced into a host cell, and the variant protein expressed in the host cell. The variant protein can then be isolated from the cells by any appropriate purification scheme using standard protein purification techniques. Examples of these techniques are described in detail below (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

The present invention provides isolated variant proteins that comprise, consist of or consist essentially of amino acid sequences that contain one or more variant amino acids encoded by one or more codons which contain a SNP of the present invention.

Accordingly, the present invention provides variant proteins that consist of amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein consists of an amino acid sequence when the amino acid sequence is the entire amino acid sequence of the protein.

The present invention further provides variant proteins that consist essentially of amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein consists essentially of an amino acid sequence when such an amino acid sequence is present with only a few additional amino acid residues in the final protein.

The present invention further provides variant proteins that comprise amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein comprises an amino acid sequence when the amino acid sequence is at least part of the final amino acid sequence of the protein. In such a fashion, the protein may contain only the variant amino acid sequence or have additional amino acid residues, such as a contiguous encoded sequence that is naturally associated with it or heterologous amino acid residues. Such a protein can have a few additional amino acid residues or can comprise many more additional amino acids. A brief description of how various types of these proteins can be made and isolated is provided below.

The variant proteins of the present invention can be attached to heterologous sequences to form chimeric or fusion proteins. Such chimeric and fusion proteins comprise a variant protein operatively linked to a heterologous protein having an amino acid sequence not substantially homologous to the variant protein. “Operatively linked” indicates that the coding sequences for the variant protein and the heterologous protein are ligated in-frame. The heterologous protein can be fused to the N-terminus or C-terminus of the variant protein. In another embodiment, the fusion protein is encoded by a fusion polynucleotide that is synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see Ausubel et al., Current Protocols in Molecular Biology, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST protein). A variant protein-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the variant protein.

In many uses, the fusion protein does not affect the activity of the variant protein. The fusion protein can include, but is not limited to, enzymatic fusion proteins, for example, beta-galactosidase fusions, yeast two-hybrid GAL fusions, poly-His fusions, MYC-tagged, HI-tagged and Ig fusions. Such fusion proteins, particularly poly-His fusions, can facilitate their purification following recombinant expression. In certain host cells (e g, mammalian host cells), expression and/or secretion of a protein can be increased by using a heterologous signal sequence. Fusion proteins are further described in, for example, Terpe, “Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems”, Appl Microbiol Biotechnol. 2003 January; 60(5):523-33. Epub 2002 Nov. 7; Graddis et al., “Designing proteins that work using recombinant technologies”, Curr Pharm Biotechnol. 2002 December; 3(4):285-97; and Nilsson et al., “Affinity fusion strategies for detection, purification, and immobilization of recombinant proteins”, Protein Expr Purif. 1997 October; 11(1):1-16.

The present invention also relates to further obvious variants of the variant polypeptides of the present invention, such as naturally-occurring mature forms (e.g., alleleic variants), non-naturally occurring recombinantly-derived variants, and orthologs and paralogs of such proteins that share sequence homology. Such variants can readily be generated using art-known techniques in the fields of recombinant nucleic acid technology and protein biochemistry. It is understood, however, that variants exclude those known in the prior art before the present invention.

Further variants of the variant polypeptides disclosed in Table 1 can comprise an amino acid sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with an amino acid sequence disclosed in Table 1 (or a fragment thereof) and that includes a novel amino acid residue (allele) disclosed in Table 1 (which is encoded by a novel SNP allele). Thus, an aspect of the present invention that is specifically contemplated are polypeptides that have a certain degree of sequence variation compared with the polypeptide sequences shown in Table 1, but that contain a novel amino acid residue (allele) encoded by a novel SNP allele disclosed herein. In other words, as long as a polypeptide contains a novel amino acid residue disclosed herein, other portions of the polypeptide that flank the novel amino acid residue can vary to some degree from the polypeptide sequences shown in Table 1.

Full-length pre-processed forms, as well as mature processed forms, of proteins that comprise one of the amino acid sequences disclosed herein can readily be identified as having complete sequence identity to one of the variant proteins of the present invention as well as being encoded by the same genetic locus as the variant proteins provided herein.

Orthologs of a variant peptide can readily be identified as having some degree of significant sequence homology/identity to at least a portion of a variant peptide as well as being encoded by a gene from another organism. Preferred orthologs will be isolated from non-human mammals, preferably primates, for the development of human therapeutic targets and agents. Such orthologs can be encoded by a nucleic acid sequence that hybridizes to a variant peptide-encoding nucleic acid molecule under moderate to stringent conditions depending on the degree of relatedness of the two organisms yielding the homologous proteins.

Variant proteins include, but are not limited to, proteins containing deletions, additions and substitutions in the amino acid sequence caused by the SNPs of the present invention. One class of substitutions is conserved amino acid substitutions in which a given amino acid in a polypeptide is substituted for another amino acid of like characteristics. Typical conservative substitutions are replacements, one for another, among the aliphatic amino acids Ala, Val, Leu, and Be; interchange of the hydroxyl residues Ser and Thr; exchange of the acidic residues Asp and Glu; substitution between the amide residues Asn and Gln; exchange of the basic residues Lys and Arg; and replacements among the aromatic residues Phe and Tyr. Guidance concerning which amino acid changes are likely to be phenotypically silent are found in, for example, Bowie et al., Science 247:1306-1310 (1990).

Variant proteins can be fully functional or can lack function in one or more activities, e.g. ability to bind another molecule, ability to catalyze a substrate, ability to mediate signaling, etc. Fully functional variants typically contain only conservative variations or variations in non-critical residues or in non-critical regions. Functional variants can also contain substitution of similar amino acids that result in no change or an insignificant change in function. Alternatively, such substitutions may positively or negatively affect function to some degree. Non-functional variants typically contain one or more non-conservative amino acid substitutions, deletions, insertions, inversions, truncations or extensions, or a substitution, insertion, inversion, or deletion of a critical residue or in a critical region.

Amino acids that are essential for function of a protein can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al., Science 244:1081-1085 (1989)), particularly using the amino acid sequence and polymorphism information provided in Table 1. The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as enzyme activity or in assays such as an in vitro proliferative activity. Sites that are critical for binding partner/substrate binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992); de Vos et al. Science 255:306-312 (1992)).

Polypeptides can contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids. Further, many amino acids, including the terminal amino acids, may be modified by natural processes, such as processing and other post-translational modifications, or by chemical modification techniques well known in the art. Accordingly, the variant proteins of the present invention also encompass derivatives or analogs in which a substituted amino acid residue is not one encoded by the genetic code, in which a substituent group is included, in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (e.g., polyethylene glycol), or in which additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence for purification of the mature polypeptide or a pro-protein sequence.

Known protein modifications include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent crosslinks, formation of cystine, formation of pyroglutamate, formylation, gamma carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.

Such protein modifications are well known to those of skill in the art and have been described in great detail in the scientific literature. Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation, for instance, are described in most basic texts, such as Proteins—Structure and Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); Wold, F., Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York 1-12 (1983); Seifter et al., Meth. Enzymol. 182: 626-646 (1990); and Rattan et al., Ann. N.Y. Acad. Sci. 663:48-62 (1992).

The present invention further provides fragments of the variant proteins in which the fragments contain one or more amino acid sequence variations (e.g., substitutions, or truncations or extensions due to creation or destruction of a stop codon) encoded by one or more SNPs disclosed herein. The fragments to which the invention pertains, however, are not to be construed as encompassing fragments that have been disclosed in the prior art before the present invention.

As used herein, a fragment may comprise at least about 4, 8, 10, 12, 14, 16, 18, 20, 25, 30, 50, 100 (or any other number in-between) or more contiguous amino acid residues from a variant protein, wherein at least one amino acid residue is affected by a SNP of the present invention, e.g., a variant amino acid residue encoded by a nonsynonymous nucleotide substitution at a cSNP position provided by the present invention. The variant amino acid encoded by a cSNP may occupy any residue position along the sequence of the fragment. Such fragments can be chosen based on the ability to retain one or more of the biological activities of the variant protein or the ability to perform a function, e.g., act as an immunogen. Particularly important fragments are biologically active fragments. Such fragments will typically comprise a domain or motif of a variant protein of the present invention, e.g., active site, transmembrane domain, or ligand/substrate binding domain. Other fragments include, but are not limited to, domain or motif-containing fragments, soluble peptide fragments, and fragments containing immunogenic structures. Predicted domains and functional sites are readily identifiable by computer programs well known to those of skill in the art (e.g., PROSITE analysis) (Current Protocols in Protein Science, John Wiley & Sons, N.Y. (2002)).

Uses of Variant Proteins

The variant proteins of the present invention can be used in a variety of ways, including but not limited to, in assays to determine the biological activity of a variant protein, such as in a panel of multiple proteins for high-throughput screening; to raise antibodies or to elicit another type of immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the variant protein (or its binding partner) in biological fluids; as a marker for cells or tissues in which it is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); as a target for screening for a therapeutic agent; and as a direct therapeutic agent to be administered into a human subject. Any of the variant proteins disclosed herein may be developed into reagent grade or kit format for commercialization as research products. Methods for performing the uses listed above are well known to those skilled in the art (see, e.g., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Sambrook and Russell, 2000, and Methods in Enzymology: Guide to Molecular Cloning Techniques, Academic Press, Berger, S. L. and A. R. Kimmel eds., 1987).

In a specific embodiment of the invention, the methods of the present invention include detection of one or more variant proteins disclosed herein. Variant proteins are disclosed in Table 1 and in the Sequence Listing as SEQ ID NOS:81-160. Detection of such proteins can be accomplished using, for example, antibodies, small molecule compounds, aptamers, ligands/substrates, other proteins or protein fragments, or other protein-binding agents. Preferably, protein detection agents are specific for a variant protein of the present invention and can therefore discriminate between a variant protein of the present invention and the wild-type protein or another variant form. This can generally be accomplished by, for example, selecting or designing detection agents that bind to the region of a protein that differs between the variant and wild-type protein, such as a region of a protein that contains one or more amino acid substitutions that is/are encoded by a non-synonymous cSNP of the present invention, or a region of a protein that follows a nonsense mutation-type SNP that creates a stop codon thereby leading to a shorter polypeptide, or a region of a protein that follows a read-through mutation-type SNP that destroys a stop codon thereby leading to a longer polypeptide in which a portion of the polypeptide is present in one version of the polypeptide but not the other.

In another specific aspect of the invention, the variant proteins of the present invention are used as targets for diagnosing stroke or for determining predisposition to stroke in a human (e.g., determining whether an individual has an increased or decreased risk of having a stroke). Accordingly, the invention provides methods for detecting the presence of, or levels of, one or more variant proteins of the present invention in a cell, tissue, or organism. Such methods typically involve contacting a test sample with an agent (e.g., an antibody, small molecule compound, or peptide) capable of interacting with the variant protein such that specific binding of the agent to the variant protein can be detected. Such an assay can be provided in a single detection format or a multi-detection format such as an array, for example, an antibody or aptamer array (arrays for protein detection may also be referred to as “protein chips”). The variant protein of interest can be isolated from a test sample and assayed for the presence of a variant amino acid sequence encoded by one or more SNPs disclosed by the present invention. The SNPs may cause changes to the protein and the corresponding protein function/activity, such as through non-synonymous substitutions in protein coding regions that can lead to amino acid substitutions, deletions, insertions, and/or rearrangements; formation or destruction of stop codons; or alteration of control elements such as promoters. SNPs may also cause inappropriate post-translational modifications.

One preferred agent for detecting a variant protein in a sample is an antibody capable of selectively binding to a variant form of the protein (antibodies are described in greater detail in the next section). Such samples include, for example, tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject.

In vitro methods for detection of the variant proteins associated with stroke that are disclosed herein and fragments thereof include, but are not limited to, enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIA), Western blots, immunoprecipitations, immunofluorescence, and protein arrays/chips (e.g., arrays of antibodies or aptamers). For further information regarding immunoassays and related protein detection methods, see Current Protocols in Immunology, John Wiley & Sons, N.Y., and Hage, “Immunoassays”, Anal Chem. 1999 Jun. 15; 71(12):294R-304R.

Additional analytic methods of detecting amino acid variants include, but are not limited to, altered electrophoretic mobility, altered tryptic peptide digest, altered protein activity in cell-based or cell-free assay, alteration in ligand or antibody-binding pattern, altered isoelectric point, and direct amino acid sequencing.

Alternatively, variant proteins can be detected in vivo in a subject by introducing into the subject a labeled antibody (or other type of detection reagent) specific for a variant protein. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

Other uses of the variant peptides of the present invention are based on the class or action of the protein. For example, proteins isolated from humans and their mammalian orthologs serve as targets for identifying agents (e.g., small molecule drugs or antibodies) for use in therapeutic applications, particularly for modulating a biological or pathological response in a cell or tissue that expresses the protein. Pharmaceutical agents can be developed that modulate protein activity.

As an alternative to modulating gene expression, therapeutic compounds can be developed that modulate protein function. For example, many SNPs disclosed herein affect the amino acid sequence of the encoded protein (e.g., non-synonymous cSNPs and nonsense mutation-type SNPs). Such alterations in the encoded amino acid sequence may affect protein function, particularly if such amino acid sequence variations occur in functional protein domains, such as catalytic domains, ATP-binding domains, or ligand/substrate binding domains. It is well established in the art that variant proteins having amino acid sequence variations in functional domains can cause or influence pathological conditions. In such instances, compounds (e.g., small molecule drugs or antibodies) can be developed that target the variant protein and modulate (e.g., up- or down-regulate) protein function/activity.

The therapeutic methods of the present invention further include methods that target one or more variant proteins of the present invention. Variant proteins can be targeted using, for example, small molecule compounds, antibodies, aptamers, ligands/substrates, other proteins, or other protein-binding agents. Additionally, the skilled artisan will recognize that the novel protein variants (and polymorphic nucleic acid molecules) disclosed in Table 1 may themselves be directly used as therapeutic agents by acting as competitive inhibitors of corresponding art-known proteins (or nucleic acid molecules such as mRNA molecules).

The variant proteins of the present invention are particularly useful in drug screening assays, in cell-based or cell-free systems. Cell-based systems can utilize cells that naturally express the protein, a biopsy specimen, or cell cultures. In one embodiment, cell-based assays involve recombinant host cells expressing the variant protein. Cell-free assays can be used to detect the ability of a compound to directly bind to a variant protein or to the corresponding SNP-containing nucleic acid fragment that encodes the variant protein.

A variant protein of the present invention, as well as appropriate fragments thereof, can be used in high-throughput screening assays to test candidate compounds for the ability to bind and/or modulate the activity of the variant protein. These candidate compounds can be further screened against a protein having normal function (e.g., a wild-type/non-variant protein) to further determine the effect of the compound on the protein activity. Furthermore, these compounds can be tested in animal or invertebrate systems to determine in vivo activity/effectiveness. Compounds can be identified that activate (agonists) or inactivate (antagonists) the variant protein, and different compounds can be identified that cause various degrees of activation or inactivation of the variant protein.

Further, the variant proteins can be used to screen a compound for the ability to stimulate or inhibit interaction between the variant protein and a target molecule that normally interacts with the protein. The target can be a ligand, a substrate or a binding partner that the protein normally interacts with (for example, epinephrine or norepinephrine). Such assays typically include the steps of combining the variant protein with a candidate compound under conditions that allow the variant protein, or fragment thereof, to interact with the target molecule, and to detect the formation of a complex between the protein and the target or to detect the biochemical consequence of the interaction with the variant protein and the target, such as any of the associated effects of signal transduction.

Candidate compounds include, for example, 1) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam et al., Nature 354:82-84 (1991); Houghten et al., Nature 354:84-86 (1991)) and combinatorial chemistry-derived molecular libraries made of D- and/or L-configuration amino acids; 2) phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songyang et al., Cell 72:767-778 (1993)); 3) antibodies (e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies as well as Fab, F(ab′)₂, Fab expression library fragments, and epitope-binding fragments of antibodies); and 4) small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries).

One candidate compound is a soluble fragment of the variant protein that competes for ligand binding. Other candidate compounds include mutant proteins or appropriate fragments containing mutations that affect variant protein function and thus compete for ligand. Accordingly, a fragment that competes for ligand, for example with a higher affinity, or a fragment that binds ligand but does not allow release, is encompassed by the invention.

The invention further includes other end point assays to identify compounds that modulate (stimulate or inhibit) variant protein activity. The assays typically involve an assay of events in the signal transduction pathway that indicate protein activity. Thus, the expression of genes that are up or down-regulated in response to the variant protein dependent signal cascade can be assayed. In one embodiment, the regulatory region of such genes can be operably linked to a marker that is easily detectable, such as luciferase. Alternatively, phosphorylation of the variant protein, or a variant protein target, could also be measured. Any of the biological or biochemical functions mediated by the variant protein can be used as an endpoint assay. These include all of the biochemical or biological events described herein, in the references cited herein, incorporated by reference for these endpoint assay targets, and other functions known to those of ordinary skill in the art.

Binding and/or activating compounds can also be screened by using chimeric variant proteins in which an amino terminal extracellular domain or parts thereof, an entire transmembrane domain or subregions, and/or the carboxyl terminal intracellular domain or parts thereof, can be replaced by heterologous domains or subregions. For example, a substrate-binding region can be used that interacts with a different substrate than that which is normally recognized by a variant protein. Accordingly, a different set of signal transduction components is available as an end-point assay for activation. This allows for assays to be performed in other than the specific host cell from which the variant protein is derived.

The variant proteins are also useful in competition binding assays in methods designed to discover compounds that interact with the variant protein. Thus, a compound can be exposed to a variant protein under conditions that allow the compound to bind or to otherwise interact with the variant protein. A binding partner, such as ligand, that normally interacts with the variant protein is also added to the mixture. If the test compound interacts with the variant protein or its binding partner, it decreases the amount of complex formed or activity from the variant protein. This type of assay is particularly useful in screening for compounds that interact with specific regions of the variant protein (Hodgson, Bio/technology, 1992, Sep. 10(9), 973-80).

To perform cell-free drug screening assays, it is sometimes desirable to immobilize either the variant protein or a fragment thereof, or its target molecule, to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Any method for immobilizing proteins on matrices can be used in drug screening assays. In one embodiment, a fusion protein containing an added domain allows the protein to be bound to a matrix. For example, glutathione-S-transferase/¹²⁵I fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the cell lysates (e.g., ³⁵S-labeled) and a candidate compound, such as a drug candidate, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads can be washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly, or in the supernatant after the complexes are dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of bound material found in the bead fraction quantitated from the gel using standard electrophoretic techniques.

Either the variant protein or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Alternatively, antibodies reactive with the variant protein but which do not interfere with binding of the variant protein to its target molecule can be derivatized to the wells of the plate, and the variant protein trapped in the wells by antibody conjugation. Preparations of the target molecule and a candidate compound are incubated in the variant protein-presenting wells and the amount of complex trapped in the well can be quantitated. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the protein target molecule, or which are reactive with variant protein and compete with the target molecule, and enzyme-linked assays that rely on detecting an enzymatic activity associated with the target molecule.

Modulators of variant protein activity identified according to these drug screening assays can be used to treat a subject with a disorder mediated by the protein pathway, such as stroke. These methods of treatment typically include the steps of administering the modulators of protein activity in a pharmaceutical composition to a subject in need of such treatment.

The variant proteins, or fragments thereof, disclosed herein can themselves be directly used to treat a disorder characterized by an absence of, inappropriate, or unwanted expression or activity of the variant protein. Accordingly, methods for treatment include the use of a variant protein disclosed herein or fragments thereof.

In yet another aspect of the invention, variant proteins can be used as “bait proteins” in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693-1696; and Brent WO94/10300) to identify other proteins that bind to or interact with the variant protein and are involved in variant protein activity. Such variant protein-binding proteins are also likely to be involved in the propagation of signals by the variant proteins or variant protein targets as, for example, elements of a protein-mediated signaling pathway. Alternatively, such variant protein-binding proteins are inhibitors of the variant protein.

The two-hybrid system is based on the modular nature of most transcription factors, which typically consist of separable DNA-binding and activation domains. Briefly, the assay typically utilizes two different DNA constructs. In one construct, the gene that codes for a variant protein is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein (“prey” or “sample”) is fused to a gene that codes for the activation domain of the known transcription factor. If the “bait” and the “prey” proteins are able to interact, in vivo, forming a variant protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) that is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene that encodes the protein that interacts with the variant protein.

Antibodies Directed to Variant Proteins

The present invention also provides antibodies that selectively bind to the variant proteins disclosed herein and fragments thereof. Such antibodies may be used to quantitatively or qualitatively detect the variant proteins of the present invention. As used herein, an antibody selectively binds a target variant protein when it binds the variant protein and does not significantly bind to non-variant proteins, i.e., the antibody does not significantly bind to normal, wild-type, or art-known proteins that do not contain a variant amino acid sequence due to one or more SNPs of the present invention (variant amino acid sequences may be due to, for example, nonsynonymous cSNPs, nonsense SNPs that create a stop codon, thereby causing a truncation of a polypeptide or SNPs that cause read-through mutations resulting in an extension of a polypeptide).

As used herein, an antibody is defined in terms consistent with that recognized in the art: they are multi-subunit proteins produced by an organism in response to an antigen challenge. The antibodies of the present invention include both monoclonal antibodies and polyclonal antibodies, as well as antigen-reactive proteolytic fragments of such antibodies, such as Fab, F(ab)′₂, and Fv fragments. In addition, an antibody of the present invention further includes any of a variety of engineered antigen-binding molecules such as a chimeric antibody (U.S. Pat. Nos. 4,816,567 and 4,816,397; Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851, 1984; Neuberger et al., Nature 312:604, 1984), a humanized antibody (U.S. Pat. Nos. 5,693,762; 5,585,089; and 5,565,332), a single-chain Fv (U.S. Pat. No. 4,946,778; Ward et al., Nature 334:544, 1989), a bispecific antibody with two binding specificities (Segal et al., J. Immunol. Methods 248:1, 2001; Carter, J. Immunol. Methods 248:7, 2001), a diabody, a triabody, and a tetrabody (Todorovska et al., J. Immunol. Methods, 248:47, 2001), as well as a Fab conjugate (dimer or trimer), and a minibody.

Many methods are known in the art for generating and/or identifying antibodies to a given target antigen (Harlow, Antibodies, Cold Spring Harbor Press, (1989)). In general, an isolated peptide (e.g., a variant protein of the present invention) is used as an immunogen and is administered to a mammalian organism, such as a rat, rabbit, hamster or mouse. Either a full-length protein, an antigenic peptide fragment (e.g., a peptide fragment containing a region that varies between a variant protein and a corresponding wild-type protein), or a fusion protein can be used. A protein used as an immunogen may be naturally-occurring, synthetic or recombinantly produced, and may be administered in combination with an adjuvant, including but not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substance such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and the like.

Monoclonal antibodies can be produced by hybridoma technology (Kohler and Milstein, Nature, 256:495, 1975), which immortalizes cells secreting a specific monoclonal antibody. The immortalized cell lines can be created in vitro by fusing two different cell types, typically lymphocytes, and tumor cells. The hybridoma cells may be cultivated in vitro or in vivo. Additionally, fully human antibodies can be generated by transgenic animals (He et al., J. Immunol., 169:595, 2002). Fd phage and Fd phagemid technologies may be used to generate and select recombinant antibodies in vitro (Hoogenboom and Chames, Immunol. Today 21:371, 2000; Liu et al., J. Mol. Biol. 315:1063, 2002). The complementarity-determining regions of an antibody can be identified, and synthetic peptides corresponding to such regions may be used to mediate antigen binding (U.S. Pat. No. 5,637,677).

Antibodies are preferably prepared against regions or discrete fragments of a variant protein containing a variant amino acid sequence as compared to the corresponding wild-type protein (e.g., a region of a variant protein that includes an amino acid encoded by a nonsynonymous cSNP, a region affected by truncation caused by a nonsense SNP that creates a stop codon, or a region resulting from the destruction of a stop codon due to read-through mutation caused by a SNP). Furthermore, preferred regions will include those involved in function/activity and/or protein/binding partner interaction. Such fragments can be selected on a physical property, such as fragments corresponding to regions that are located on the surface of the protein, e.g., hydrophilic regions, or can be selected based on sequence uniqueness, or based on the position of the variant amino acid residue(s) encoded by the SNPs provided by the present invention. An antigenic fragment will typically comprise at least about 8-10 contiguous amino acid residues in which at least one of the amino acid residues is an amino acid affected by a SNP disclosed herein. The antigenic peptide can comprise, however, at least 12, 14, 16, 20, 25, 50, 100 (or any other number in-between) or more amino acid residues, provided that at least one amino acid is affected by a SNP disclosed herein.

Detection of an antibody of the present invention can be facilitated by coupling (i.e., physically linking) the antibody or an antigen-reactive fragment thereof to a detectable substance. Detectable substances include, but are not limited to, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include ¹²⁵I, ¹³¹I, ³⁵S or ³H.

Antibodies, particularly the use of antibodies as therapeutic agents, are reviewed in: Morgan, “Antibody therapy for Alzheimer's disease”, Expert Rev Vaccines. 2003 February; 2(1):53-9; Ross et al., “Anticancer antibodies”, Am J Clin Pathol. 2003 April; 119(4):472-85; Goldenberg, “Advancing role of radiolabeled antibodies in the therapy of cancer”, Cancer Immunol Immunother. 2003 May; 52(5):281-96. Epub 2003 Mar. 11; Ross et al., “Antibody-based therapeutics in oncology”, Expert Rev Anticancer Ther. 2003 February; 3(1):107-21; Cao et al., “Bispecific antibody conjugates in therapeutics”, Adv Drug Deliv Rev. 2003 Feb. 10; 55(2):171-97; von Mehren et al., “Monoclonal antibody therapy for cancer”, Annu Rev Med. 2003; 54:343-69. Epub 2001 Dec. 3; Hudson et al., “Engineered antibodies”, Nat Med. 2003 January; 9(1):129-34; Brekke et al., “Therapeutic antibodies for human diseases at the dawn of the twenty-first century”, Nat Rev Drug Discov. 2003 January; 2(1):52-62 (Erratum in: Nat Rev Drug Discov. 2003 March; 2(3):240); Houdebine, “Antibody manufacture in transgenic animals and comparisons with other systems”, Curr Opin Biotechnol. 2002 December; 13(6):625-9; Andreakos et al., “Monoclonal antibodies in immune and inflammatory diseases”, Curr Opin Biotechnol. 2002 December; 13(6):615-20; Kellermann et al., “Antibody discovery: the use of transgenic mice to generate human monoclonal antibodies for therapeutics”, Curr Opin Biotechnol. 2002 December; 13(6):593-7; Pini et al., “Phage display and colony filter screening for high-throughput selection of antibody libraries”, Comb Chem High Throughput Screen. 2002 November; 5(7):503-10; Batra et al., “Pharmacokinetics and biodistribution of genetically engineered antibodies”, Curr Opin Biotechnol. 2002 December; 13(6):603-8; and Tangri et al., “Rationally engineered proteins or antibodies with absent or reduced immunogenicity”, Curr Med Chem. 2002 December; 9(24):2191-9.

Uses of Antibodies

Antibodies can be used to isolate the variant proteins of the present invention from a natural cell source or from recombinant host cells by standard techniques, such as affinity chromatography or immunoprecipitation. In addition, antibodies are useful for detecting the presence of a variant protein of the present invention in cells or tissues to determine the pattern of expression of the variant protein among various tissues in an organism and over the course of normal development or disease progression. Further, antibodies can be used to detect variant protein in situ, in vitro, in a bodily fluid, or in a cell lysate or supernatant in order to evaluate the amount and pattern of expression. Also, antibodies can be used to assess abnormal tissue distribution, abnormal expression during development, or expression in an abnormal condition, such as stroke. Additionally, antibody detection of circulating fragments of the full-length variant protein can be used to identify turnover.

Antibodies to the variant proteins of the present invention are also useful in pharmacogenomic analysis. Thus, antibodies against variant proteins encoded by alternative SNP alleles can be used to identify individuals that require modified treatment modalities.

Further, antibodies can be used to assess expression of the variant protein in disease states such as in active stages of the disease or in an individual with a predisposition to a disease related to the protein's function, particularly stroke. Antibodies specific for a variant protein encoded by a SNP-containing nucleic acid molecule of the present invention can be used to assay for the presence of the variant protein, such as to screen for predisposition to stroke as indicated by the presence of the variant protein.

Antibodies are also useful as diagnostic tools for evaluating the variant proteins in conjunction with analysis by electrophoretic mobility, isoelectric point, tryptic peptide digest, and other physical assays well known in the art.

Antibodies are also useful for tissue typing. Thus, where a specific variant protein has been correlated with expression in a specific tissue, antibodies that are specific for this protein can be used to identify a tissue type.

Antibodies can also be used to assess aberrant subcellular localization of a variant protein in cells in various tissues. The diagnostic uses can be applied, not only in genetic testing, but also in monitoring a treatment modality. Accordingly, where treatment is ultimately aimed at correcting the expression level or the presence of variant protein or aberrant tissue distribution or developmental expression of a variant protein, antibodies directed against the variant protein or relevant fragments can be used to monitor therapeutic efficacy.

The antibodies are also useful for inhibiting variant protein function, for example, by blocking the binding of a variant protein to a binding partner. These uses can also be applied in a therapeutic context in which treatment involves inhibiting a variant protein's function. An antibody can be used, for example, to block or competitively inhibit binding, thus modulating (agonizing or antagonizing) the activity of a variant protein. Antibodies can be prepared against specific variant protein fragments containing sites required for function or against an intact variant protein that is associated with a cell or cell membrane. For in vivo administration, an antibody may be linked with an additional therapeutic payload such as a radionuclide, an enzyme, an immunogenic epitope, or a cytotoxic agent. Suitable cytotoxic agents include, but are not limited to, bacterial toxin such as diphtheria, and plant toxin such as ricin. The in vivo half-life of an antibody or a fragment thereof may be lengthened by pegylation through conjugation to polyethylene glycol (Leong et al., Cytokine 16:106, 2001).

The invention also encompasses kits for using antibodies, such as kits for detecting the presence of a variant protein in a test sample. An exemplary kit can comprise antibodies such as a labeled or labelable antibody and a compound or agent for detecting variant proteins in a biological sample; means for determining the amount, or presence/absence of variant protein in the sample; means for comparing the amount of variant protein in the sample with a standard; and instructions for use.

Vectors and Host Cells

The present invention also provides vectors containing the SNP-containing nucleic acid molecules described herein. The term “vector” refers to a vehicle, preferably a nucleic acid molecule, which can transport a SNP-containing nucleic acid molecule. When the vector is a nucleic acid molecule, the SNP-containing nucleic acid molecule can be covalently linked to the vector nucleic acid. Such vectors include, but are not limited to, a plasmid, single or double stranded phage, a single or double stranded RNA or DNA viral vector, or artificial chromosome, such as a BAC, PAC, YAC, or MAC.

A vector can be maintained in a host cell as an extrachromosomal element where it replicates and produces additional copies of the SNP-containing nucleic acid molecules. Alternatively, the vector may integrate into the host cell genome and produce additional copies of the SNP-containing nucleic acid molecules when the host cell replicates.

The invention provides vectors for the maintenance (cloning vectors) or vectors for expression (expression vectors) of the SNP-containing nucleic acid molecules. The vectors can function in prokaryotic or eukaryotic cells or in both (shuttle vectors).

Expression vectors typically contain cis-acting regulatory regions that are operably linked in the vector to the SNP-containing nucleic acid molecules such that transcription of the SNP-containing nucleic acid molecules is allowed in a host cell. The SNP-containing nucleic acid molecules can also be introduced into the host cell with a separate nucleic acid molecule capable of affecting transcription. Thus, the second nucleic acid molecule may provide a trans-acting factor interacting with the cis-regulatory control region to allow transcription of the SNP-containing nucleic acid molecules from the vector. Alternatively, a trans-acting factor may be supplied by the host cell. Finally, a trans-acting factor can be produced from the vector itself. It is understood, however, that in some embodiments, transcription and/or translation of the nucleic acid molecules can occur in a cell-free system.

The regulatory sequences to which the SNP-containing nucleic acid molecules described herein can be operably linked include promoters for directing mRNA transcription. These include, but are not limited to, the left promoter from bacteriophage X, the lac, TRP, and TAC promoters from E. coli, the early and late promoters from SV40, the CMV immediate early promoter, the adenovirus early and late promoters, and retrovirus long-terminal repeats.

In addition to control regions that promote transcription, expression vectors may also include regions that modulate transcription, such as repressor binding sites and enhancers. Examples include the SV40 enhancer, the cytomegalovirus immediate early enhancer, polyoma enhancer, adenovirus enhancers, and retrovirus LTR enhancers.

In addition to containing sites for transcription initiation and control, expression vectors can also contain sequences necessary for transcription termination and, in the transcribed region, a ribosome-binding site for translation. Other regulatory control elements for expression include initiation and termination codons as well as polyadenylation signals. A person of ordinary skill in the art would be aware of the numerous regulatory sequences that are useful in expression vectors (see, e.g., Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

A variety of expression vectors can be used to express a SNP-containing nucleic acid molecule. Such vectors include chromosomal, episomal, and virus-derived vectors, for example, vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, including yeast artificial chromosomes, from viruses such as baculoviruses, papovaviruses such as SV40, Vaccinia viruses, adenoviruses, poxviruses, pseudorabies viruses, and retroviruses. Vectors can also be derived from combinations of these sources such as those derived from plasmid and bacteriophage genetic elements, e.g., cosmids and phagemids. Appropriate cloning and expression vectors for prokaryotic and eukaryotic hosts are described in Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

The regulatory sequence in a vector may provide constitutive expression in one or more host cells (e.g., tissue specific expression) or may provide for inducible expression in one or more cell types such as by temperature, nutrient additive, or exogenous factor, e.g., a hormone or other ligand. A variety of vectors that provide constitutive or inducible expression of a nucleic acid sequence in prokaryotic and eukaryotic host cells are well known to those of ordinary skill in the art.

A SNP-containing nucleic acid molecule can be inserted into the vector by methodology well-known in the art. Generally, the SNP-containing nucleic acid molecule that will ultimately be expressed is joined to an expression vector by cleaving the SNP-containing nucleic acid molecule and the expression vector with one or more restriction enzymes and then ligating the fragments together. Procedures for restriction enzyme digestion and ligation are well known to those of ordinary skill in the art.

The vector containing the appropriate nucleic acid molecule can be introduced into an appropriate host cell for propagation or expression using well-known techniques. Bacterial host cells include, but are not limited to, E. coli, Streptomyces, and Salmonella typhimurium. Eukaryotic host cells include, but are not limited to, yeast, insect cells such as Drosophila, animal cells such as COS and CHO cells, and plant cells.

As described herein, it may be desirable to express the variant peptide as a fusion protein. Accordingly, the invention provides fusion vectors that allow for the production of the variant peptides. Fusion vectors can, for example, increase the expression of a recombinant protein, increase the solubility of the recombinant protein, and aid in the purification of the protein by acting, for example, as a ligand for affinity purification. A proteolytic cleavage site may be introduced at the junction of the fusion moiety so that the desired variant peptide can ultimately be separated from the fusion moiety. Proteolytic enzymes suitable for such use include, but are not limited to, factor Xa, thrombin, and enterokinase. Typical fusion expression vectors include pGEX (Smith et al., Gene 67:31-40 (1988)), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al., Gene 69:301-415 (1988)) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185:60-89 (1990)).

Recombinant protein expression can be maximized in a bacterial host by providing a genetic background wherein the host cell has an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128). Alternatively, the sequence of the SNP-containing nucleic acid molecule of interest can be altered to provide preferential codon usage for a specific host cell, for example, E. coli (Wada et al., Nucleic Acids Res. 20:2111-2118 (1992)).

The SNP-containing nucleic acid molecules can also be expressed by expression vectors that are operative in yeast. Examples of vectors for expression in yeast (e.g., S. cerevisiae) include pYepSec1 (Baldari, et al., EMBO J. 6:229-234 (1987)), pMFa (Kurjan et al., Cell 30:933-943 (1982)), pJRY88 (Schultz et al., Gene 54:113-123 (1987)), and pYES2 (Invitrogen Corporation, San Diego, Calif.).

The SNP-containing nucleic acid molecules can also be expressed in insect cells using, for example, baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al., Mol. Cell Biol. 3:2156-2165 (1983)) and the pVL series (Lucklow et al., Virology 170:31-49 (1989)).

In certain embodiments of the invention, the SNP-containing nucleic acid molecules described herein are expressed in mammalian cells using mammalian expression vectors. Examples of mammalian expression vectors include pCDM8 (Seed, B. Nature 329:840 (1987)) and pMT2PC (Kaufman et al., EMBO J. 6:187-195 (1987)).

The invention also encompasses vectors in which the SNP-containing nucleic acid molecules described herein are cloned into the vector in reverse orientation, but operably linked to a regulatory sequence that permits transcription of antisense RNA. Thus, an antisense transcript can be produced to the SNP-containing nucleic acid sequences described herein, including both coding and non-coding regions. Expression of this antisense RNA is subject to each of the parameters described above in relation to expression of the sense RNA (regulatory sequences, constitutive or inducible expression, tissue-specific expression).

The invention also relates to recombinant host cells containing the vectors described herein. Host cells therefore include, for example, prokaryotic cells, lower eukaryotic cells such as yeast, other eukaryotic cells such as insect cells, and higher eukaryotic cells such as mammalian cells.

The recombinant host cells can be prepared by introducing the vector constructs described herein into the cells by techniques readily available to persons of ordinary skill in the art. These include, but are not limited to, calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, lipofection, and other techniques such as those described in Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

Host cells can contain more than one vector. Thus, different SNP-containing nucleotide sequences can be introduced in different vectors into the same cell. Similarly, the SNP-containing nucleic acid molecules can be introduced either alone or with other nucleic acid molecules that are not related to the SNP-containing nucleic acid molecules, such as those providing trans-acting factors for expression vectors. When more than one vector is introduced into a cell, the vectors can be introduced independently, co-introduced, or joined to the nucleic acid molecule vector.

In the case of bacteriophage and viral vectors, these can be introduced into cells as packaged or encapsulated virus by standard procedures for infection and transduction. Viral vectors can be replication-competent or replication-defective. In the case in which viral replication is defective, replication can occur in host cells that provide functions that complement the defects.

Vectors generally include selectable markers that enable the selection of the subpopulation of cells that contain the recombinant vector constructs. The marker can be inserted in the same vector that contains the SNP-containing nucleic acid molecules described herein or may be in a separate vector. Markers include, for example, tetracycline or ampicillin-resistance genes for prokaryotic host cells, and dihydrofolate reductase or neomycin resistance genes for eukaryotic host cells. However, any marker that provides selection for a phenotypic trait can be effective.

While the mature variant proteins can be produced in bacteria, yeast, mammalian cells, and other cells under the control of the appropriate regulatory sequences, cell-free transcription and translation systems can also be used to produce these variant proteins using RNA derived from the DNA constructs described herein.

Where secretion of the variant protein is desired, which is difficult to achieve with multi-transmembrane domain containing proteins such as G-protein-coupled receptors (GPCRs), appropriate secretion signals can be incorporated into the vector. The signal sequence can be endogenous to the peptides or heterologous to these peptides.

Where the variant protein is not secreted into the medium, the protein can be isolated from the host cell by standard disruption procedures, including freeze/thaw, sonication, mechanical disruption, use of lysing agents, and the like. The variant protein can then be recovered and purified by well-known purification methods including, for example, ammonium sulfate precipitation, acid extraction, anion or cationic exchange chromatography, phosphocellulose chromatography, hydrophobic-interaction chromatography, affinity chromatography, hydroxylapatite chromatography, lectin chromatography, or high performance liquid chromatography.

It is also understood that, depending upon the host cell in which recombinant production of the variant proteins described herein occurs, they can have various glycosylation patterns, or may be non-glycosylated, as when produced in bacteria. In addition, the variant proteins may include an initial modified methionine in some cases as a result of a host-mediated process.

For further information regarding vectors and host cells, see Current Protocols in Molecular Biology, John Wiley & Sons, N.Y.

Uses of Vectors and Host Cells, and Transgenic Animals

Recombinant host cells that express the variant proteins described herein have a variety of uses. For example, the cells are useful for producing a variant protein that can be further purified into a preparation of desired amounts of the variant protein or fragments thereof. Thus, host cells containing expression vectors are useful for variant protein production.

Host cells are also useful for conducting cell-based assays involving the variant protein or variant protein fragments, such as those described above as well as other formats known in the art. Thus, a recombinant host cell expressing a variant protein is useful for assaying compounds that stimulate or inhibit variant protein function. Such an ability of a compound to modulate variant protein function may not be apparent from assays of the compound on the native/wild-type protein, or from cell-free assays of the compound. Recombinant host cells are also useful for assaying functional alterations in the variant proteins as compared with a known function.

Genetically-engineered host cells can be further used to produce non-human transgenic animals. A transgenic animal is preferably a non-human mammal, for example, a rodent, such as a rat or mouse, in which one or more of the cells of the animal include a transgene. A transgene is exogenous DNA containing a SNP of the present invention which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal in one or more of its cell types or tissues. Such animals are useful for studying the function of a variant protein in vivo, and identifying and evaluating modulators of variant protein activity. Other examples of transgenic animals include, but are not limited to, non-human primates, sheep, dogs, cows, goats, chickens, and amphibians. Transgenic non-human mammals such as cows and goats can be used to produce variant proteins which can be secreted in the animal's milk and then recovered.

A transgenic animal can be produced by introducing a SNP-containing nucleic acid molecule into the male pronuclei of a fertilized oocyte, e.g., by microinjection or retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Any nucleic acid molecules that contain one or more SNPs of the present invention can potentially be introduced as a transgene into the genome of a non-human animal.

Any of the regulatory or other sequences useful in expression vectors can form part of the transgenic sequence. This includes intronic sequences and polyadenylation signals, if not already included. A tissue-specific regulatory sequence(s) can be operably linked to the transgene to direct expression of the variant protein in particular cells or tissues.

Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described in, for example, U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al., and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the transgene in its genome and/or expression of transgenic mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene can further be bred to other transgenic animals carrying other transgenes. A transgenic animal also includes a non-human animal in which the entire animal or tissues in the animal have been produced using the homologously recombinant host cells described herein.

In another embodiment, transgenic non-human animals can be produced which contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage P1 (Lakso et al. PNAS 89:6232-6236 (1992)). Another example of a recombinase system is the FLP recombinase system of S. cerevisiae (O'Gorman et al. Science 251:1351-1355 (1991)). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are generally needed. Such animals can be provided through the construction of “double” transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected variant protein and the other containing a transgene encoding a recombinase.

Clones of the non-human transgenic animals described herein can also be produced according to the methods described in, for example, Wilmut, I. et al. Nature 385:810-813 (1997) and PCT International Publication Nos. WO 97/07668 and WO 97/07669. In brief, a cell (e.g., a somatic cell) from the transgenic animal can be isolated and induced to exit the growth cycle and enter G_o phase. The quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The reconstructed oocyte is then cultured such that it develops to morula or blastocyst and then transferred to pseudopregnant female foster animal. The offspring born of this female foster animal will be a clone of the animal from which the cell (e.g., a somatic cell) is isolated.

Transgenic animals containing recombinant cells that express the variant proteins described herein are useful for conducting the assays described herein in an in vivo context. Accordingly, the various physiological factors that are present in vivo and that could influence ligand or substrate binding, variant protein activation, signal transduction, or other processes or interactions, may not be evident from in vitro cell-free or cell-based assays. Thus, non-human transgenic animals of the present invention may be used to assay in vivo variant protein function as well as the activities of a therapeutic agent or compound that modulates variant protein function/activity or expression. Such animals are also suitable for assessing the effects of null mutations (i.e., mutations that substantially or completely eliminate one or more variant protein functions).

For further information regarding transgenic animals, see Houdebine, “Antibody manufacture in transgenic animals and comparisons with other systems”, Curr Opin Biotechnol. 2002 December; 13(6):625-9; Petters et al., “Transgenic animals as models for human disease”, Transgenic Res. 2000; 9(4-5):347-51; discussion 345-6; Wolf et al., “Use of transgenic animals in understanding molecular mechanisms of toxicity”, J Pharm Pharmacol. 1998 June; 50(6):567-74; Echelard, “Recombinant protein production in transgenic animals”, Curr Opin Biotechnol. 1996 October; 7(5):536-40; Houdebine, “Transgenic animal bioreactors”, Transgenic Res. 2000; 9(4-5):305-20; Pirity et al., “Embryonic stem cells, creating transgenic animals”, Methods Cell Biol. 1998; 57:279-93; and Robl et al., “Artificial chromosome vectors and expression of complex proteins in transgenic animals”, Theriogenology. 2003 Jan. 1; 59 (1):107-13.

EXAMPLES

The following examples are offered to illustrate, but not to limit the claimed invention.

Example One: SNPs Associated with Stroke in the Atherosclerosis Risk in Communities (ARIC) Study

Overview

51 SNPs associated with coronary heart disease (CHD) in multiple antecedent studies (Bare et al. 2007) were analyzed to determine whether these SNPs are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. To carry out this analysis, 495 validated ischemic strokes were identified from the multi-ethnic ARIC cohort of 14,215 individuals by following the cohort for an average of 13.5 years for potential cerebrovascular events. Risk alleles for 51 SNPs were specified based on the results from at least two antecedent studies in which these SNPs were associated with CHD. As a result of this analysis, Cox proportional hazards models, adjusted for age and gender, identified three SNPs in whites/Caucasians (these terms are used herein interchangeably) and two SNPs in blacks/African Americans (these terms are used herein interchangeably) that were associated (p≤0.05) with incident stroke and had the same risk allele as specified by the antecedent studies. The rs11628722 polymorphism in SERPINA9 was associated with incident ischemic stroke in both whites and blacks. Thus, genetic variation in SERPINA9 was associated with incident stroke in both whites and blacks, even after taking into account traditional risk factors.

Subjects and Methods

The Atherosclerosis Risk in Communities (ARIC) Study

Study participants were selected from the ARIC Study, a prospective investigation of atherosclerosis and its clinical sequelae involving 15,792 individuals aged 45-64 years at recruitment (1986-1989). Subjects were selected by probability sampling from four communities: Forsyth County, N.C.; Jackson, Miss. (blacks only); Northwestern suburbs of Minneapolis, Minn.; and Washington County, Md. The initial clinical exams included a home interview to ascertain cardiovascular risk factors, socioeconomic factors and family medical history, clinical examination and blood drawing for laboratory determinations. A detailed description of the ARIC study design and methods has been published elsewhere (ARIC Investigators (1989) “The Atherosclerosis Risk in Communities (ARIC) Study: design and objectives”. American Journal of Epidemiology 129: 687-702).

Incident Ischemic Stroke

Ischemic stroke was determined by contacting participants annually to identify hospitalizations during the previous year, and by surveying discharge lists from local hospitals and death certificates from state vital statistics offices for potential cerebrovascular events (ARIC Investigators (1989) American Journal of Epidemiology 129: 687-702; Rosamond et al. (1999) Stroke 30: 736-743). Hospital records were obtained, abstracted and classified by computer algorithm and physician review. Details on quality assurance for ascertainment and classification of ischemic stroke events have been published elsewhere (Rosamond et al. (1999) Stroke 30: 736-743). Ischemic stroke events were defined as validated definite or probable hospitalized embolic or thrombotic brain infarctions. Participants were excluded from this analysis if they had a positive or unknown history of prevalent stroke; transient ischemic attack/stroke symptoms or CHD at the initial visit; ethnic background other than white or black; an ethnic background of black but were not from Jackson, Miss.; restrictions on use of their DNA; or missing data for any of the traditional cardiovascular or cerebrovascular risk factors. The remaining 14,215 participants were followed for incident ischemic stroke for a mean of 13.5 years and 495 incident ischemic stroke cases were identified.

Examination and Laboratory Measures

Cardiovascular risk factors considered in this study were measured at baseline and included age, gender, waist-to-hip ratio, diabetes, hypertension, and smoking status. The ratio of waist (umbilical level) and hip (maximum buttocks) circumference was calculated as a measure of fat distribution. Diabetes was defined by a fasting glucose level ≥126 mg/dl, a nonfasting glucose level ≥200 mg/dl, or a self-reported physician diagnosis of diabetes or use of diabetes medication. Seated blood pressure was measured three times with a random-zero sphygmomanometer and the last two measurements were averaged. An interviewer-administered questionnaire was used to assess use of antihypertensive medications. Hypertension was defined as systolic blood pressure ≥140 mmHg or diastolic blood pressure ≥90 mmHg or current use of antihypertensive medication. Cigarette smoking status was classified as current or not current. The study protocol was approved by the Institutional Review Boards of the collaborating institutions, and informed written consent was obtained from each participant.

SNP Selection and Genotype Determination

Fifty-one functional SNPs associated with CHD in multiple antecedent studies, other than the ARIC study, were considered in this study. A detailed description of the antecedent studies is presented elsewhere (Bare et al., Genetics in Medicine. 2007 October; 9(10):682-9). Briefly, risk alleles for 49 SNPs were specified based on significant association with myocardial infarction in at least two antecedent case-control studies. These studies involved myocardial infarction cases and controls recruited by either the Cleveland Clinic Foundation Heart Center, Cleveland, Ohio (CCF) or the Genomic Resource in Arteriosclerosis at the University of California, San Francisco (UCSF). All cases in these two studies had a history of myocardial infarction and the controls did not, and all subjects were self-described, non-Hispanic Caucasians. The risk alleles for two additional SNPs were specified based on an association with CHD in the placebo arms of two CHD prevention trials: the Cholesterol and Recurrent Events (CARE) study (Sacks et al. (1996) New England Journal of Medicine 335: 1001-1009) and the West of Scotland Coronary Prevention Study (WOSCOPS) (Packard et al. (2000) New England Journal of Medicine 343: 1148-1155). One of these SNPs (rs20455 in KIF6) was significantly associated with CHD after correction for multiple testing (Iakoubova et al., Journal of the American College of Cardiology. 2008; 51:435-43). The second SNP associated with CHD in CARE and WOSCOPS was rs11666735 in FCAR (Iakoubova et al. (2006) Arteriosclerosis, Thrombosis and Vascular Biology 26: 2763-2768).

Genotyping of the 51 SNPs in the ARIC study was carried out using PCR-based amplification of genomic DNA followed by an allele-specific oligonucleotide ligation assay similar to a previously described procedure (Iannone et al. (2000) Cytometry 39: 131-140).

Statistical Analyses

Agreement of genotype frequencies with Hardy-Weinberg equilibrium expectations was tested separately in whites and blacks using a χ² goodness-of-fit test in non-cases, stratified by ethnicity. Deviation from Hardy-Weinberg equilibrium was determined by a p-value less than 0.05. Cox proportional hazards models were used to model time to incident ischemic stroke. The follow-up time interval was defined as the time between the initial clinical visit and the end of follow-up, which for cases was the date of the first ischemic stroke event and for non-cases was Dec. 31, 2002, the date of death, or the date of last contact if lost to follow-up. Each model was evaluated separately in whites and blacks and included a given SNP (modeled as the additive effect of the pre-specified risk allele), age and gender. Additional risk factors evaluated as potential confounders in the Cox proportional hazards models included waist-to-hip ratio, diabetes, hypertension, and smoking status (Folsom et al., (1999) Diabetes Care 22: 1077-1083). SNPs and risk factors were assessed for statistical significance in the models by the Wald statistic. A two-sided p-value of 0.05 was used to assess statistical significance with ischemic stroke and no attempt was made to adjust for multiple comparisons within this study.

Results

Race-specific proportions, means and standard deviations for the traditional risk factors are presented in Table 5. Mean values and proportions differed significantly (p<0.03) between incident ischemic stroke cases and non-cases for all risk factors.

Three SNPs in whites (in SERPINA9, PALLD and IER2) and two SNPs in blacks (in SERPINA9 and EXOD1) were associated (p≤0.05) with ischemic stroke, after adjusting for age and gender, and had the same risk allele as specified by the antecedent studies (Table 6, Model 1). One additional SNP in EIF2AK2 was associated with ischemic stroke in whites, but the risk allele in the ARIC study differed from the risk allele identified in the antecedent CHD studies. The rs11628722 polymorphism in SERPINA9 was associated with incident ischemic stroke in both ethnicities (whites HRR=1.31, 95% CI: 1.00-1.70; blacks HRR=1.26, 95% CI: 1.03-1.53).

For the four SNPs that were associated in either ethnic group, traditional cardiovascular risk factors were included in the Cox proportional hazards models to evaluate possible confounding. The observed hazards ratios were essentially unchanged with addition of these risk factors to the prediction models (Table 6, Model 2).

Discussion

This study investigated whether 51 putative functional SNPs associated with CHD in multiple antecedent studies predict ischemic stroke among white and black individuals from the large prospective ARIC study. Three SNPs in whites and two SNPs in blacks were associated with incident ischemic stroke, even after taking into account established risk factors. The rs11628722 polymorphism in SERPINA9 was associated with ischemic stroke in both whites and blacks from the ARIC study.

It is noteworthy that the association between SERPINA9 and stroke was observed in both whites and blacks in this study. This SNP has been associated with myocardial infarction in two case-control studies and this study shows an association with stroke in both whites and blacks from the ARIC study. SERPINA9 is a member of Glade A of the large superfamily of serine peptidase inhibitors known as serpins. Serpins are protease inhibitors that use a conformational change to inhibit target enzymes, and are involved in many cellular processes, such as coagulation, fibrinolysis, complement fixation, matrix remodeling and apoptosis (Law et al. (2006) Genome Biology 7: 216). A recent study indicated that SERPINA9 was significantly upregulated in the hippocampal tissues from Alzheimer's disease transgenic mice versus age-matched controls (Jee et al (2006) Neurochemistry Research 31: 1035-1044). This study suggests that SERPINA9 may also be expressed in the human brain, consistent with the findings described herein of an association between polymorphic variation in this gene and ischemic stroke.

In addition to SERPINA9, polymorphisms in palladin (PALLD) and immediate early response 2 (IER2) were associated with ischemic stroke in whites and a polymorphism in exonuclease domain containing 1 (EXOD1) was associated in blacks. PALLD encodes a component of the cytoskeleton that controls cell shape and motility. Vascular remodeling may lead to atherosclerosis, and the shape and cytoskeletal organization of endothelial cells is an important part of this process. Mechanical stress and strain also plays a role in atherosclerotic vascular remodeling and immediate early response genes have been shown to mediate the mechanical stress-induced pathological process in the blood vessel (Liu et al. (1999) Critical Reviews in Biomedical Engineering 27: 75-148). Although little is known about EXOD1, exonucleases have been shown to play a role in both myocardial infarction and stroke. Given their functional roles, PALLD, IER2 and EXOD1 potentially play a role in the atherosclerotic pathway. Additionally, PALLD, IER2 and EXOD1 are all expressed in the heart and brain.

A strength of this study is the prospective cohort design. The large sample size allows for the assessment of exposures (e.g. genetic factors) of modest effect. All analyses for this study were performed separately in whites and blacks.

Thus, a small subset of gene variants previously associated with CHD in antecedent studies were found to also be associated with incident ischemic stroke in ARIC. In particular, SERPINA9 was associated with stroke in both whites and blacks and this association does not appear to be mediated by traditional risk factors.

Supplemental Analysis of SNPs in the ARIC Study

In a further analysis of the 51 SNPs in the ARIC participants, SNPs that predict ischemic stroke risk were identified by Cox proportional hazard analysis and included SNPs with a two-sided p-value of <0.2 after adjusting for age and sex and a hazard ratio (HRR) >1.0. These SNPs are shown in Tables 7-9 (the p-values shown in Tables 7-9 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values). SNPs that predict ischemic stroke after adjusting for age and sex (two-sided p-value <0.2 and HRR >1.0) in the white ARIC participants and separately in the black ARIC participants are shown in Table 7 (whites) and Table 8 (blacks). SNPs that predict ischemic stroke after adjusting for age and sex in both the black and the white ARIC populations with the same risk alleles are listed in Table 9.

Example Two: SNPs Associated with Stroke in the Cardiovascular Health Study (CHS)

Overview

74 SNPs, which had been associated with coronary heart disease (CHD) (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9, incorporated herein by reference in its entirety), were analyzed to determine whether these SNPs are associated with incident ischemic stroke. To carry out this analysis, the risk allele was prespecified for each of the 74 SNPs based on antecedent studies of CHD. Cox proportional hazards models were used that adjusted for traditional risk factors to estimate the associations of these SNPs with incident ischemic stroke during 14 years of follow-up in a population-based study of older adults referred to as the Cardiovascular Health Study (CHS). As a result of this analysis, the prespecified risk alleles of 7 of the 74 SNPs (in HPS1, ITGAE, ABCG2, MYH15, FSTL4, CALM1, and BAT2) were associated with increased risk of stroke in white CHS participants (1-sided P<0.05, false discovery rate (FDR)=0.42). In African American participants, the prespecified risk alleles of 5 SNPs (in KRT4, LY6G5B, EDG1, DMXL2, and ABCG2) were associated with stroke (1-sided P<0.05, FDR=0.55). The Val12Met SNP in ABCG2 was associated with stroke in both white (hazard ratio 1.46, 90% CI 1.05 to 2.03) and African American (hazard ratio 3.59, 90% CI 1.11 to 11.6) participants of CHS. Kaplan-Meier estimates of the 10 year cumulative incidence of stroke were greater among Val allele homozygotes than among Met allele carriers in both white (10% versus 6%) and African American (12% versus 3%) participants of CHS. Thus, the Val12Met SNP in ABCG2 (encoding a transporter of sterols and xenobiotics) was associated with incident ischemic stroke in white and African American participants of CHS.

Materials and Methods

Cardiovascular Health Study

CHS is a prospective population-based study of risk factors for cardiovascular disease, including CHD and stroke, in older adults. Men and women aged 65 years and older were recruited from random samples of individuals on Medicare eligibility lists in four U.S. communities (Sacramento County, Calif.; Washington County, Md.; Forsyth County, N.C.; and Pittsburgh, Allegheny County, Pennsylvania) and from age-eligible members of the same households. Potential participants were excluded if they were institutionalized, not ambulatory at home, under hospice care, receiving radiation or chemotherapy for cancer, not expected to remain in the area for at least three years, or unable to be interviewed. CHS enrolled 5201 participants in 1989-90. An additional 687 African American participants entered the cohort in 1992-93. Participants who did not donate DNA or who did not consent to the use of their DNA for studies by private companies (n=514) as well as participants for whom the amount of DNA samples were insufficient (n=130) were excluded, leaving 5244 participants available for a genetic study. The institutional review board at each site approved the study methods, and all participants gave written informed consent. Details of CHS design⁷ and recruitment⁸ have been reported.

Participants completed a baseline clinic examination that included a medical history interview, physical examination, and blood draw.⁹ Baseline self-reported myocardial infarction (MI) or stroke was confirmed by information from the clinic examination or by review of medical records or physician questionnaires.¹⁰ Cardiovascular events during follow-up were identified at semi-annual contacts, which alternated between clinic visits and telephone calls. Suspected events were adjudicated according to standard criteria by a physician review panel using information from medical records, brain imaging studies¹¹ and, in some cases, interviews with the physician, participant, or a proxy informant.¹² Medicare utilization files were searched to ascertain events that may have been missed.¹³

At baseline, 722 of the 5244 participants available for a genetic study had a history of stroke or MI. Since the risk of incident ischemic stroke might be influenced by whether a patient had had a prior stroke or MI, these 722 participants were excluded from the analysis, leaving 4522 (3849 white and 673 African American) participants in this genetic study of first incident ischemic stroke. Baseline characteristics of these 4522 participants are presented in Table 10. During follow-up, 642 participants had an incident non-procedure-related stroke, and 47 of these 642 had an MI before their stroke, leaving 595 stroke events. Of these 595 stroke events, 72 (12%) were hemorrhagic, 46 (8%) were not classified for type, and the remaining 477 stroke events were classified as ischemic stroke events: the end point for this analysis.

Covariates

Risk estimates for ischemic stroke were adjusted for the following traditional risk factors: diabetes mellitus (defined by fasting serum glucose levels of at least 126 mg/dL or the use of either insulin or oral hypoglycemic medications), impaired fasting glucose (defined as fasting glucose levels between 110 and 125 mg/dL¹⁴), hypertension (defined by systolic blood pressure of at least 140 mmHg, diastolic blood pressure of at least 90 mmHg, or a physician's diagnosis of hypertension plus the use of anti-hypertensive medications¹⁰), current smoking, LDL-cholesterol, HDL-cholesterol, and body mass index (BMI). Other covariates included atrial fibrillation, carotid intima-media thickness (IMT), and genotypes. Atrial fibrillation was identified on the basis of 12-lead resting ECGs performed at the baseline examination. Tracings were read for atrial fibrillation or flutter at the CHS Electrocardiography Reading Center.¹⁵ Ultrasonography of the common and internal carotid arteries was also performed at baseline. The IMT was defined as the mean of the maximum IMTs of the near and far walls of the left and right carotid arteries.¹⁶ Genotypes of the CHS participants were determined by a multiplex method that combines PCR, allele-specific oligonucleotide ligation assays, and hybridization to oligonucleotides coupled to Luminex®100TM xMAP microspheres (Luminex, Austin, Tex.), followed by detection of the spectrally distinct microsphere on a Luminex 100 instrument (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9).

Prespecification of Risk Alleles for 74 SNPs Investigated in CHS

For each of the 74 SNPs that were genotyped in CHS, a risk allele was prespecified based on antecedent data (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9). For 14 of the 74 SNPs, genetic associations with CHD have been previously published.^17-21 The remaining 60 SNPs were associated with MI in one or more antecedent studies of MI as described (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9).

Statistics

Since the risk estimate for gene variants can differ between whites and African Americans, the association of SNPs with incident ischemic stroke in CHS was investigated in each race separately. Analyses of time to primary end point were conducted. Follow-up began at CHS enrollment and ended on the date of incident stroke of any type, incident MI, death, loss to follow-up, or Jun. 30, 2004, whichever occurred first. The median follow-up time was 11.2 years (11.9 years for the 1989-90 cohort and 10.7 years for the African American cohort).

Cox regression models were used to estimate hazard ratios of each SNP. In Model 1, Cox models were adjusted for baseline age (continuous) and sex. In Model 2, Cox models were adjusted for baseline age (continuous), sex, body mass index (continuous), current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol (continuous), and HDL-cholesterol (continuous). Risk estimates were also further adjusted for two additional risk factors of ischemic stroke: atrial fibrillation and carotid IMT. The SNP variable in the Cox models was coded as 0 for the non-risk homozygote, 1 for those who carried 1 copy of the risk allele and 2 for those who carried 2 copies of the risk allele. Thus, the hazard ratios represent the log-additive increase in risk for each additional copy of the risk allele a subject carried, compared with the non-risk homozygotes. Because the hypotheses that the allele associated with increased risk of CHD would also be associated with increased risk of ischemic stroke was being testing, a 1-sided P-value was used to test the significance of the Cox model coefficients. Correspondingly, 90% confidence intervals were estimated for the hazard ratios (for hazard ratios greater than one, there is 95% confidence that a true risk estimate is greater than the lower bound of a 90% confidence interval). In white participants, this study had 80% or more power to detect associations between SNPs and incident ischemic stroke for SNPs that have relative risks of 1.3 and 1.5 (in an additive model) and risk allele frequencies of 0.13 and 0.05, respectively, assuming an alpha level of 0.05 and a 1-sided test. In African American participants, this study had 80% or more power to detect associations between SNPs and incident ischemic stroke for SNPs that have relative risks of 1.6 and 1.8 (in an additive model) and risk allele frequencies of 0.3 and 0.14, respectively. The cumulative incidence of stroke was estimated by the method of Kaplan and Meier. Data were analyzed using Stata Statistical Software.²² The influence of multiple testing was evaluated using the false discovery rate (FDR)²³ to estimate the expected fraction of false positives in a group of SNPs with P values below a given threshold. FDR calculations were performed with R Statistical Software.²⁴

Results

The baseline characteristics of the 3,849 white and 673 African American participants of CHS in this genetic study of ischemic stroke are presented in Table 10. There were 407 first incident ischemic stroke events in the white participants and 70 in the African American participants during follow-up (median of 11.2 years). The association between incident ischemic stroke and 74 SNPs that had previously been found to be associated with coronary heart disease (CHD) in one or more antecedent studies (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9) was investigated. Specifically, for each SNP, it was determined whether the allele that had been associated with increased risk of CHD (the risk allele) was also associated with increased risk of stroke.

In white participants of CHS, it was found that the risk alleles of 7 of these 74 SNPs were associated (P<0.05) with increased risk of stroke after adjusting for traditional risk factors (age, sex, body mass index, smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol). These 7 SNPs were in HPS1, ITGAE, ABCG2, MYH15, FSTL4, CALM1, and BAT2. The additive (per allele) hazard ratios for stroke ranged from 1.15 to 1.49 (Table 11). In African American participants of CHS, it was found that the risk alleles of 5 SNPs (in KRT4, LY6G5B, EDG1, DMXL2, and ABCG2) were associated (P<0.05) with increased risk of stroke after adjusting for traditional risk factors. The hazard ratios for these 5 SNPs ranged from 1.40 to 3.59 (Table 12). The risk estimates for the 11 SNPs that were associated with stroke in either whites or African Americans (Tables 11 and 12) were essentially unchanged when further adjusted for atrial fibrillation and internal carotid artery IMT (data not shown).

To account for multiple comparisons, the FDR²³ was estimated for the set of SNPs found to be associated with incident ischemic stroke in CHS participants. These FDRs were 0.42 for the 7 SNPs in white participants and 0.55 for the 5 SNPs in African American participants of CHS.

ABCG2 Val12Met (rs2231137) was associated with incident ischemic stroke in both white and African American participants of CHS. The risk of ischemic stroke was higher in Val allele homozygotes than in Met allele carriers. The adjusted hazard ratio for Val allele homozygotes, compared with Met allele carriers, was 1.50 (90% CI 1.06 to 2.12) in white participants and 3.62 (90% CI 1.11 to 11.9) in African American participants (Table 13). The 10-year cumulative incidence of ischemic stroke was greater in Val allele homozygotes than in Met allele carriers in both the white (10% versus 6%) and African American (12% versus 3%, FIGS. 1a-1b) participants of CHS.

Discussion

Among 74 genetic variants tested in CHS, it was found that 7 were associated with incident ischemic stroke in white participants and 5 were associated with incident ischemic stroke in African American participants. In particular, an association between the Val allele of ABCG2 Val12Met and increased risk of incident ischemic stroke was identified, and this association was consistent in both whites and African Americans.

Three of the 11 gene variants associated with incident ischemic stroke in CHS had particularly notable associations with CHD in the antecedent studies. The first of these 3 gene variants was the Val allele of ABCG2 Val12Met (rs2231137). This gene variant had previously been found to be associated with angiographically defined severe coronary artery disease (CAD) in two case-control studies.²⁰ ABCG2 encodes ATP-binding cassette, subfamily G, member 2, which is a protein that belongs to a large family of transporters. It is expressed on the cell surface of stem cells in bone marrow and skeletal muscle,²⁵ progenitor endothelial cells that are capable of vasculogenesis in adipose tissue,²⁶ and endothelial cells in blood vessels of the heart²⁷ and brain²⁸. The ABCG2 protein has been reported recently to transport sterols.^{29, 30} It is interesting to note that the related ATP-binding cassette proteins ABCA1,³¹ ABCGS, and ABCG8³² are transporters of lipids: variants of these transporters have been shown to cause lipid disorders such as Tangier disease³¹ and sitosterolemia.³² However, a well known function of the ABCG2 protein is to act as a multi-drug transporter of anticancer drugs, and the ABCG2 protein is over-expressed in drug-resistant cancer cells.³³ The Met variant of ABCG2 has been reported to confer lower drug resistance and has an altered pattern of localization when compared with the Val variant.³⁴ It is possible that the Met variant of the ABCG2 protein may function in the vascular endothelium and have an altered function as a transporter. Homozygotes of the Val allele of ABCG2 (88% of whites and 88% of African Americans) were at higher risk of stroke than carriers of the Met allele in CHS. Since there were only 16 homozygotes of the Met allele, the Met homozygotes were pooled with heterozygotes and used as the reference group. The Met allele could also be considered to be a protective allele in that the Met allele carriers had a lower risk of incident ischemic stroke than the Val allele homozygotes.

The second of the 3 gene variants with notable findings in antecedent studies is the Ala allele of MYH15 Thr1125Ala (rs3900940). In addition to being associated with MI in two antecedent association studies,⁶ it was associated with increased risk of incident CHD in the white participants of the Atherosclerosis Risk in Communities Study.²¹ MYH15 encodes myosin heavy polypeptide 15 and the Thr1125Ala SNP is located in the tail domain of the MYH15 protein.³⁵

The third gene variant with notable findings in antecedent studies is the G allele of rs3814843 in the 3′untranslated region in CALM1. This SNP was associated with angiographically defined severe CAD in two case-control studies.²⁰ CALM1 encodes calmodulin 1 which binds calcium and functions in diverse signaling pathways, including those involved in cell division,³⁶ membrane trafficking,³⁷ and platelet aggregation.³⁸

Thus, a small subset of gene variants previously associated with CHD in antecedent studies were found to also be associated with incident ischemic stroke in CHS. Notably, the Val allele of the Val12Met SNP in ABCG2 (which encodes a transporter of sterols and anticancer drugs) was associated with increased risk of incident ischemic stroke in both white and African American participants of CHS.

REFERENCES (CORRESPONDING TO EXAMPLE TWO)

• 1. Brass L M, Isaacsohn J L, Merikangas K R, Robinette C D. A study of twins and stroke. Stroke. 1992; 23:221-223
• 2. Bak S, Gaist D, Sindrup S H, Skytthe A, Christensen K. Genetic liability in stroke: a long-term follow-up study of Danish twins. Stroke. 2002; 33:769-774
• 3. Welin L, Svardsudd K, Wilhelmsen L, Larsson B, Tibblin G. Analysis of risk factors for stroke in a cohort of men born in 1913. N Engl J Med. 1987; 317:521-526
• 4. Jousilahti P, Rastenyte D, Tuomilehto J, Sarti C, Vartiainen E. Parental history of cardiovascular disease and risk of stroke. A prospective follow-up of 14371 middle-aged men and women in Finland. Stroke. 1997; 28:1361-1366
• 5. Rosamond W, Flegal K, Friday G, Furie K, Go A, Greenlund K, Haase N, Ho M, Howard V, Kissela B, Kittner S, Lloyd-Jones D, McDermott M, Meigs J, Moy C, Nichol G, O'Donnell C J, Roger V, Rumsfeld J, Sorlie P, Steinberger J, Thom T, Wasserthiel-Smoller S, Hong Y. Heart disease and stroke statistics—2007 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation. 2007; 115:e69-171
• 6. Shiffman D, O'Meara E S, Bare L A, Rowland C M, Louie J Z, Arellano A R, Lumley T, Rice K, Iakoubova O, Luke M M, Young B A, Malloy M J, Kane J P, Ellis S G, Tracy R P, Devlin J J, Psaty B M. Association of gene variants with incident myocardial infarction in the Cardiovascular Health Study. Arterioscler Thromb Vasc Biol. 2008; 28:173-179
• 7. Fried L P, Borhani N O, Enright P, Furberg C D, Gardin J M, Kronmal R A, Kuller L H, Manolio T A, Mittelmark M B, Newman A, et al. The Cardiovascular Health Study: design and rationale. Ann Epidemiol. 1991; 1:263-276
• 8. Tell G S, Fried L P, Hermanson B, Manolio T A, Newman A B, Borhani N O. Recruitment of adults 65 years and older as participants in the Cardiovascular Health Study. Ann Epidemiol. 1993; 3:358-366
• 9. Cushman M, Cornell E S, Howard P R, Bovill E G, Tracy R P. Laboratory methods and quality assurance in the Cardiovascular Health Study. Clin Chem. 1995; 41:264-270
• 10. Psaty B M, Kuller L H, Bild D, Burke G L, Kittner S J, Mittelmark M, Price T R, Rautaharju P M, Robbins J. Methods of assessing prevalent cardiovascular disease in the Cardiovascular Health Study. Ann Epidemiol. 1995; 5:270-277
• 11. Longstreth W T, Jr., Bernick C, Fitzpatrick A, Cushman M, Knepper L, Lima J, Furberg C D. Frequency and predictors of stroke death in 5,888 participants in the Cardiovascular Health Study. Neurology. 2001; 56:368-375
• 12. Price T R, Psaty B, O'Leary D, Burke G, Gardin J. Assessment of cerebrovascular disease in the Cardiovascular Health Study. Ann Epidemiol. 1993; 3:504-507
• 13. Ives D G, Fitzpatrick A L, Bild D E, Psaty B M, Kuller L H, Crowley P M, Cruise R G, Theroux S. Surveillance and ascertainment of cardiovascular events. The Cardiovascular Health Study. Ann Epidemiol. 1995; 5:278-285
• 14. American Diabetes Association. Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care. 1997; 20:1183-1197
• 15. Rautaharju P M, MacInnis P J, Warren J W, Wolf H K, Rykers P M, Calhoun H P. Methodology of ECG interpretation in the Dalhousie program; NOVACODE ECG classification procedures for clinical trials and population health surveys. Methods Inf Med. 1990; 29:362-374
• 16. O'Leary D H, Polak J F, Wolfson S K, Jr., Bond M G, Bommer W, Sheth S, Psaty B M, Sharrett A R, Manolio T A. Use of sonography to evaluate carotid atherosclerosis in the elderly. The Cardiovascular Health Study. CHS Collaborative Research Group. Stroke. 1991; 22:1155-1163
• 17. Shiffman D, Ellis S G, Rowland C M, Malloy M J, Luke M M, Iakoubova O A, Pullinger C R, Cassano J, Aouizerat B E, Fenwick R G, Reitz R E, Catanese J J, Leong D U, Zellner C, Sninsky J J, Topol E J, Devlin J J, Kane J P. Identification of four gene variants associated with myocardial infarction. Am J Hum Genet. 2005; 77:596-605
• 18. Shiffman D, Rowland C M, Louie J Z, Luke M M, Bare L A, Bolonick J I, Young B A, Catanese J J, Stiggins C F, Pullinger C R, Topol E J, Malloy M J, Kane J P, Ellis S G, Devlin J J. Gene variants of VAMP8 and HNRPUL1 are associated with early-onset myocardial infarction. Arterioscler Thromb Vasc Biol. 2006; 26:1613-1618
• 19. Iakoubova O A, Tong C H, Chokkalingam A P, Rowland C M, Kirchgessner T G, Louie J Z, Ploughman L M, Sabatine M S, Campos H, Catanese J J, Leong D U, Young B A, Lew D, Tsuchihashi Z, Luke M M, Packard C J, Zerba K E, Shaw P M, Shepherd J, Devlin J J, Sacks F M. Asp92Asn polymorphism in the myeloid IgA Fc receptor is associated with myocardial infarction in two disparate populations: CARE and WOSCOPS. Arterioscler Thromb Vasc Biol. 2006; 26:2763-2768
• 20. Luke M M, Kane J P, Liu D M, Rowland C M, Shiffman D, Cassano J, Catanese J J, Pullinger C R, Leong D U, Arellano A R, Tong C H, Movsesyan I, Naya-Vigne J, Noordhof C, Feric N T, Malloy M J, Topol E J, Koschinsky M L, Devlin J J, Ellis S G. A polymorphism in the protease-like domain of apolipoprotein(a) is associated with severe coronary artery disease. Arterioscler Thromb Vasc Biol. 2007; 27:2030-2036
• 21. Bare L A, Morrison A C, Rowland C M, Shiffman D, Luke M M, Iakoubova O A, Kane J P, Malloy M J, Ellis S G, Pankow J S, Willerson J T, Devlin J J, Boerwinkle E. Five common gene variants identify elevated genetic risk for coronary heart disease. Genet Med. 2007; 9:682-689
• 22. StataCorp. Stata Statistical Software: Release 9. 2005
• 23. Benjamini Y, Hochberg Y. Controlling the false discovery rate: A new and powerful approach to multiple testing. Journal of the Royal Statistical Society. 1995; Serials B:1289-1300
• 24. R Development Core Team. R: A language and environment for statistical computing, reference index version 2.3.0. 2005
• 25. Zhou S, Schuetz J D, Bunting K D, Colapietro A M, Sampath J, Morris J J, Lagutina I, Grosveld G C, Osawa M, Nakauchi H, Sorrentino B P. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat Med. 2001; 7:1028-1034
• 26. Miranville A, Heeschen C, Sengenes C, Curat C A, Busse R, Bouloumie A. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation. 2004; 110:349-355
• 27. Meissner K, Heydrich B, Jedlitschky G, Meyer Zu Schwabedissen H, Mosyagin I, Dazert P, Eckel L, Vogelgesang S, Warzok R W, Bohm M, Lehmann C, Wendt M, Cascorbi I, Kroemer H K. The ATP-binding cassette transporter ABCG2 (BCRP), a marker for side population stem cells, is expressed in human heart. J Histochem Cytochem. 2006; 54:215-221
• 28. Zhang W, Mojsilovic-Petrovic J, Andrade M F, Zhang H, Ball M, Stanimirovic D B. The expression and functional characterization of ABCG2 in brain endothelial cells and vessels. Faseb J. 2003; 17:2085-2087
• 29. Janvilisri T, Venter H, Shahi S, Reuter G, Balakrishnan L, van Veen H W. Sterol transport by the human breast cancer resistance protein (ABCG2) expressed in Lactococcus lactis. J Biol Chem. 2003; 278:20645-20651
• 30. Janvilisri T, Shahi S, Venter H, Balakrishnan L, van Veen H W. Arginine-482 is not essential for transport of antibiotics, primary bile acids and unconjugated sterols by the human breast cancer resistance protein (ABCG2). Biochem J. 2005; 385:419-426
• 31. Oram J F. Tangier disease and ABCA1. Biochim Biophys Acta. 2000; 1529:321-330
• 32. Schmitz G, Langmann T, Heimerl S. Role of ABCG1 and other ABCG family members in lipid metabolism. J Lipid Res. 2001; 42:1513-1520
• 33. Maliepaard M, van Gastelen M A, de Jong L A, Pluim D, van Waardenburg R C, Ruevekamp-Helmers M C, Floot B G, Schellens J H. Overexpression of the BCRP/MXR/ABCP gene in a topotecan-selected ovarian tumor cell line. Cancer Res. 1999; 59:4559-4563
• 34. Mizuarai S, Aozasa N, Kotani H. Single nucleotide polymorphisms result in impaired membrane localization and reduced atpase activity in multidrug transporter ABCG2. Int J Cancer. 2004; 109:238-246
• 35. Desjardins P R, Burkman J M, Shrager J B, Allmond L A, Stedman H H. Evolutionary implications of three novel members of the human sarcomeric myosin heavy chain gene family. Mol Biol Evol. 2002; 19:375-393
• 36. Moisoi N, Erent M, Whyte S, Martin S, Bayley P M. Calmodulin-containing substructures of the centrosomal matrix released by microtubule perturbation. J Cell Sci. 2002; 115:2367-2379
• 37. Tyteca D, van Ijzendoorn S C, Hoekstra D. Calmodulin modulates hepatic membrane polarity by protein kinase C-sensitive steps in the basolateral endocytic pathway. Exp Cell Res. 2005; 310:293-302
• 38. Oury C, Sticker E, Cornelissen H, De Vos R, Vermylen J, Hoylaerts M F. ATP augments von Willebrand factor-dependent shear-induced platelet aggregation through Ca2+-calmodulin and myosin light chain kinase activation. J Biol Chem. 2004; 279:26266-26273.
• Supplemental Analysis of SNPs in the CHS Study

In a further analysis of 77 SNPs, which include the SNPs analyzed in the CHS study described herein in Example Two along with additional SNPs found to be associated with CHD risk in a Cholesterol and Recurrent Event (CARE) trial and a WOSCOPS trial (Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-977), three additional SNPs that predict ischemic stroke risk were identified by Cox proportional hazard analysis that had one-sided p-values of <=0.05 in whites after adjusting for age and sex, and also after adjusting for all traditional risk factors including smoking, diabetes, hypertension, HDL-C, LDL-C, and BMI (similar to what was described in Shiffman et al., Arterioscler Thromb Vasc Biol. 2008 January; 28(1):173-9). These three SNPs are shown in Table 14. Also, as shown in Table 14, the hazard ratios were consistent in blacks and whites for SNPs rs2243682/hCV1624173 and rs34868416/hCV25951678.

Example Three: SNPs Associated with Noncardioembolic Stroke in the Vienna Stroke Registry

Overview

For SNPs that had been associated with coronary heart disease (CHD) in previous studies such as Atherosclerosis Risk in Communities (ARIC) (e.g., Bare, et al. (2007), Genet Med 9(10):682-9 and McPherson, et al. (2007), Science 316(5830):1488-91), carriers of the CHD risk alleles for each SNP were analyzed for increased risk of noncardioembolic stroke in the Vienna Stroke Registry (VSR). In a case-control study, 562 noncardioembolic stroke cases from VSR⁷ and 815 healthy controls from the city of Vienna⁸ were genotyped for each of the SNPs. The allele previously associated with CHD risk was pre-specified as the risk allele, and this risk allele was tested for association with noncardioembolic stroke.

It was determined that carriers of the CHD risk allele of the following four SNPs had increased risk of noncardioembolic stroke (the name of the gene or chromosome that contains each SNP is indicated in parentheses): rs3900940 (MYH15), rs20455 (KIF6), rs1010 (VAMP8), and rs10757274 (chromosome 9p21) (characteristics of these SNPs are presented in Table 16). The odds ratios (OR) for the associations of these SNPs with noncardioembolic stroke were as follows: 1.20 (90% confidence interval 0.95-1.50) for rs10757274 on chromosome 9p21, 1.24 (1.01-1.5) for rs20455 in KIF6, 1.31 (1.07-1.60) for rs3900940 in MYH15, and 1.21 (0.99-1.49) for rs1010 in VAMP8.

Subjects and Methods

Study Population

The stroke cases in VSR are consecutive Caucasian patients admitted to stroke units in Vienna within 72 hours of onset of acute ischemic stroke between October 1998 and June 2001. All patients underwent cranial CT or MRI and were documented according to a standardized protocol including stroke severity, risk factors, and medical history⁷. Only patients with noncardioembolic stroke were included as cases in this study. Controls were unrelated Caucasian participants in a health care program in Vienna, 45 years old or older, free of arterial vascular disease, and reported no arterial vascular diseases in first degree relatives⁸. Genotypes were determined as described previously⁹. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of Medical University Vienna. All subjects gave written informed consent.

Statistics

Differences in traditional risk factors between cases and controls were assessed by the Wilcoxon rank sum test (continuous variables) or by the chi-square test (discrete variables). Odds ratios estimated from logistic regression models were adjusted for traditional risk factors including age (at the index stroke event for cases, at enrollment for controls), sex, current smoker (versus not), diabetes mellitus (defined by a physician's diagnosis or the use of either insulin or oral hypoglycemic medications), hypertension (defined by systolic blood pressure >140 mmHg, diastolic blood pressure >90 mmHg, a physician's diagnosis of hypertension, or the use of anti-hypertensive medications), dyslipidemia (defined by a total cholesterol ≥240 mg/dL (6.2 mmol/L), LDL-C ≥160 mg/dL (4.1 mmol/L), HDL-C <40 mg/dL (1.0 mmol/L), or the use of lipid lowering medications), and body mass index (BMI). Since the purpose of this study was to determine if the same alleles found to be associated with increased risk of CHD in previous studies would be associated with increased risk of noncardioembolic stroke in VSR, one-sided p values and 90% confidence intervals (because there was 95% confidence that the true risk estimates were greater than the lower bounds of the 90% confidence intervals) were used. All other p values are two-sided. Effect sizes for carriers of the CHD risk alleles, compared with noncarriers, detectable with 90% power were calculated using QUANTO¹⁰ assuming a one-sided test and an alpha of 0.05. To account for multiple hypothesis testing, the false discovery rate q values were estimated by the method of Benjamini and Hochberg¹¹ using the p values for CHD risk allele carrier status from the age and sex adjusted models. The q value of a given SNP represents the expected proportion of false positives among the set of SNPs with equal or lower q values.

Structure software was used to estimate both the number of subpopulations (due to ancestry) in this study and the degree of ancestry admixture for each individual subject¹² based on genotypes of 130 SNPs whose minor allele frequencies ranged from 0.95% to 49.8%. The probable degree of admixture was included as a covariate in logistic regression models to adjust risk estimates for potential confounding due to population structure. Models that assumed one, two, three, or four subpopulations were tested, and replicate runs of the Structure program were performed for each model with a burn-in of 20,000 repetitions followed by 10,000 repetitions using the admixture model with independent allele frequencies and default values for other parameters.

Results

The clinical characteristics of the cases and controls are presented in Table 15. It was determined whether carriers of the alleles of SNPs that had previously been associated with increased risk of CHD^2,3 were also associated with increased risk of noncardioembolic stroke. The genotype distribution of these SNPs did not deviate from Hardy Weinberg equilibrium (p >0.17). To account for multiple testing, false discovery rate q values were estimated for the SNPs. Four of the SNPs were found to be associated with noncardioembolic stroke with false discovery rate q values at or below 0.15. For these four SNPs, carriers of the CHD risk allele, compared with noncarriers, had increased risk of noncardioembolic stroke after adjusting for age and sex: the odds ratios were 1.20 (90% confidence interval (CI) 0.95-1.50) for the C9p21 SNP, 1.24 (CI 1.01-1.52) for the KIF6 SNP, 1.31 (CI 1.07-1.60) for the MYH15 SNP, and 1.21 (CI 0.99-1.49) for the VAMP8 SNP (Model 1, Table 17). On examination of the homozygous and heterozygous carriers separately, it was found that for the C9p21 SNP, the homozygous carriers (OR=1.59) in particular had increased risk (OR of heterozygous carriers=1.05). These odds ratios decreased somewhat after adjustment for additional risk factors (smoking, hypertension, diabetes, dyslipidemia, and BMI) with the exception of the odds ratio for the VAMP8 SNP which increased (Model 2, Table 17). Removal of all cases with a history of myocardial infarction (n=40) from the analysis did not appreciably change the fully adjusted odds ratios for the C9p21 homozygotes (1.45, CI 1.05-1.99), MYH15 carriers (1.24, CI 0.99-1.55), and VAMP8 carriers (1.28, CI 1.01-1.61). However, removal of cases with a history of myocardial infarction reduced the odds ratio for KIF6 carriers to 1.15 (CI 0.91-1.45).

Population structure was investigated in this study using a Bayesian clustering approach¹² to evaluate models that assumed one, two, three, or four distinct subpopulations. A model assuming two subpopulations was found to result in the highest estimated log likelihood. Using the two subpopulation model, the degree of ancestry admixture was estimated for individual subjects. The fully adjusted odds ratios of the SNPs shown in Table 17 were not appreciably changed (the largest change was a decrease of 0.01 in the odds ratio for C9p21 homozygotes) when further adjusted for the ancestry of the subjects.

Discussion

It was determined that four SNPs were associated with noncardioembolic stroke after adjusting for age and sex when controlling the false discovery rate at 0.15. For these four SNPs, carriers of the CHD risk allele (G of rs10757274 on C9p21, Arg of Trp719Arg (rs20455) in KIF6, Ala of Thr1125Ala (rs3900940) in MYH15, and C of rs1010 in VAMP8) also had increased risk of noncardioembolic stroke.

MYH15 encodes myosin heavy polypeptide 15, a motor protein of the class-II sarcomeric myosin heavy chain family. The Thr1125Ala SNP is located in the coiled-coil rod domain of the MYH15 protein, and the Thr1125 residue has been shown to be phosphorylated^13,14. Since the Ala1125 residue could not be phosphorylated, this substitution could affect the function of the MYH15 protein.

VAMP8 encodes vesicle associated membrane protein 8 which functions in platelet degranulation pathways¹⁵. The rs1010 SNP is located in the 3′ untranslated region of VAMP8 in a potential microRNA binding site¹⁶.

Thus, this Example demonstrates that carriers of the CHD risk allele of SNPs rs20455 in KIF6, rs3900940 in MYH15, rs1010 in VAMP8, and rs10757274 on chromosome 9p21 had increased risk of noncardioembolic stroke in VSR.

REFERENCES (CORRESPONDING TO EXAMPLE THREE)

• 1. Rosamond W, Flegal K, Furie K, Go A, Greenlund K, Haase N, Hailpern S M, Ho M, Howard V, Kissela B, Kittner S, Lloyd-Jones D, McDermott M, Meigs J, Moy C, Nichol G, O'Donnell C, Roger V, Sorlie P, Steinberger J, Thom T, Wilson M, Hong Y: Heart disease and stroke statistics—2008 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation 2008; 117:e25-146.
• 2. Bare L A, Morrison A C, Rowland C M, Shiffman D, Luke M M, Iakoubova O A, Kane J P, Malloy M J, Ellis S G, Pankow J S, Willerson J T, Devlin J J, Boerwinkle E: Five common gene variants identify elevated genetic risk for coronary heart disease. Genet Med 2007; 9:682-689.
• 3. McPherson R, Pertsemlidis A, Kavaslar N, Stewart A, Roberts R, Cox D R, Hinds D A, Pennacchio L A, Tybjaerg-Hansen A, Folsom A R, Boerwinkle E, Hobbs H H, Cohen J C: A common allele on chromosome 9 associated with coronary heart disease. Science 2007; 316:1488-1491.
• 4. Morrison A C, Bare L A, Luke M M, Pankow J S, Mosley T H, Devlin J J, Willerson J T, Boerwinkle E: Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. Cerebrovascular Disease 2008; 26:420-424.
• 5. Zee R Y, Ridker P M: Two common gene variants on chromosome 9 and risk of atherothrombosis. Stroke 2007; 38:e111.
• 6. Luke M M, O'Meara E S, Rowland C M, Shiffman D, Bare L A, Arellano A R, Longstreth W T, Jr., Lumley T, Rice K, Tracy R P, Devlin J J, Psaty B M: Gene Variants Associated With Ischemic Stroke. The Cardiovascular Health Study. Stroke 2008.
• 7. Lang W: The Vienna Stroke Registry—objectives and methodology. The Vienna Stroke Study Group. Wien Klin Wochenschr 2001; 113:141-147.
• 8. Lalouschek W, Lang W, Mullner M: Current strategies of secondary prevention after a cerebrovascular event: the Vienna stroke registry. Stroke 2001; 32:2860-2866.
• 9. Shiffman D, Ellis S G, Rowland C M, Malloy M J, Luke M M, Iakoubova O A, Pullinger C R, Cassano J, Aouizerat B E, Fenwick R G, Reitz R E, Catanese J J, Leong D U, Zellner C, Sninsky J J, Topol E J, Devlin J J, Kane J P: Identification of four gene variants associated with myocardial infarction. Am J Hum Genet 2005; 77:596-605.
• 10. QUANTO: Release 1.1 A computer program for power and sample size calculations for genetic epidemiology studies. Gauderman WJMJ. 2006.
• 11. Benjamini Y, Hochberg Y: Controlling the false discovery rate: A new and powerful approach to multiple testing. Journal of the Royal Statistical Society 1995; Serials B:1289-1300.
• 12. Pritchard J K, Stephens M, Donnelly P: Inference of population structure using multilocus genotype data. Genetics 2000; 155:945-959.
• 13. Gnad F, Ren S, Cox J, Olsen J V, Macek B, Oroshi M, Mann M: PHOSIDA (phosphorylation site database): management, structural and evolutionary investigation, and prediction of phosphosites. Genome Biol 2007; 8:R250.
• 14. Olsen J V, Blagoev B, Gnad F, Macek B, Kumar C, Mortensen P, Mann M: Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 2006; 127:635-648.
• 15. Polgar J, Chung S H, Reed G L: Vesicle-associated membrane protein 3 (VAMP-3) and VAMP-8 are present in human platelets and are required for granule secretion. Blood 2002; 100:1081-1083.
• 16. Shiffman D, Rowland C M, Louie J Z, Luke M M, Bare L A, Bolonick J I, Young B A, Catanese J J, Stiggins C F, Pullinger C R, Topol E J, Malloy M J, Kane J P, Ellis S G, Devlin J J: Gene variants of VAMP8 and HNRPUL1 are associated with early-onset myocardial infarction. Arterioscler Thromb Vasc Biol 2006; 26:1613-1618.
• 17. Helgadottir et al.: The same sequence variant on 9p21 associates with myocardial infarction, abdominal aortic aneurysm and intracranial aneurysm. Nat Genet 2008; 40:217-224.

Supplemental Analysis of SNPs in the Vienna Stroke Registry

In a further analysis, the genotype of 19 SNPs (which were previously found to be associated with incident CHD in white or black participants of the ARIC study) were determined in the cases and controls of the Vienna Stroke Registry (“VSR”, approximately 764 ischemic stroke cases which included 562 atherothrombotic stroke cases, and 815 controls who were 45 or older from the same region).

As shown in Table 18, the risk alleles (which were associated with CHD in ARIC) for certain of these 19 SNPs were found to be associated (2-sided p-value of <0.2) with ischemic stroke (labeled “ischemic” in the “outcome” column of Table 18), atherothrombotic stroke (labeled “athero” in the “outcome” column of Table 18), and/or early-onset stroke (labeled “early-onset” in the “outcome” column of Table 18) in VSR before and/or after adjustment for traditional risk factors such as age, sex, body mass index, smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol (results after adjustment are labeled “yes” and results before adjustment are labeled “no” in the “adjust?” column of Table 18) (the p-values shown in Table 18 are two-sided p-values; thus, the one-sided p-values for these SNPs are half of these two-sided p-values).

Early-onset stroke is ischemic stroke that occurs early in life. As used herein, early-onset stroke is defined as those stroke events that happened before the median stroke age of the ischemic cases. The controls for these early-onset cases are those controls who were at ages above the median age of all controls in the study (i.e., young cases versus old controls was the study design).

Example Four: SNPs Associated with Stroke in the UCSF/CCF Study

The allele frequencies of 25,878 putative functional SNPs were determined in atherothrombotic stroke cases and healthy controls of the Vienna Stroke Registry (“VSR”, about 562 cases and 815 controls, Study ID V0031), and the allele frequencies of about 3,300 of these 25,878 SNPs were found to be associated with atherothrombotic (noncardioembolic) stroke (2-sided p value of less than or equal to 0.05). These 3,300 SNPs were then further tested in a stroke study of cases with a history of stroke and controls with no history of stroke or myocardial infarction from the UCSF and the CCF sample sets (Study ID GS41). The allele frequencies of 292 of these 3,300 SNPs were again associated with stroke risk (1-sided p<0.05) in the UCSF/CCF stroke study (approximately 570 cases and 1604 controls), and the risk alleles were the same in VSR and in UCSF/CCF studies. These stroke associations were then confirmed by individually genotyping the 292 SNPs in VSR subjects, and 101 of these SNPs were again found to be associated with stroke risk (p<0.05 in allelic, additive, dominant, or recessive mode). These 101 SNPs were then genotyped in the UCSF/CCF stroke study and it was determined that 61 of these SNPs were still associated with stroke in the UCSF/CCF study (1-sided p<0.05 or 2-sided p<0.1) and have the same risk allele as in the VSR study.

These 61 SNPs and the stroke association data in both the UCSF/CCF and the VSR studies are provided in Table 19. These SNPs were further analyzed in additional sample sets, as discussed below in Examples Five, Six, and Seven.

Example Five: SNPs Associated with Stroke in the German West Study

The identification of 61 SNPs that are associated with stroke in both of two case-control studies (Vienna Stroke Registry and the UCSF/CCF Stroke Study) is described in Example Four above. Here, Example Five describes the analysis of these 61 SNPs, plus 17 additional SNPs, in the German West Study (which may be interchangeably referred to herein as the “Muenster” Stroke Study).

The German West Study, which is a stroke case-control study, included 1,300 ischemic stroke cases and 1,000 healthy controls. The ischemic stroke cases were further classified by TOAST criteria into several stroke subtypes, allowing analyses of the association of genotypes of the tested SNPs with the following endpoints: 1) ischemic stroke (outcome: “ischemic_stk” in Tables 20-21), 2) noncardioembolic stroke (outcome: “nonce_stk” in Tables 20-21; ischemic stroke that were not cardioembolic in origin), 3) cardioembolic stroke (outcome: “CE_stk” in Tables 20-21), 4) atherothrombotic stroke (outcome: “athero_stk” in Tables 20-21), 5) Lacunar stroke (outcome: “lacunar_stk” in Tables 20-21), 6) no heart disease stroke (outcome: “nohd_stk” in Tables 20-21; ischemic stroke cases excluding those with a history of heart disease), 7) recurrent stroke (outcome: “recurrent_stk” in Tables 20-21; stroke cases that also had a prior history of stroke), and 8) early onset stroke (outcome: “EO_stk” in Tables 20-21; cases that are younger than the median age of all cases, and controls that were older than the median age of all controls).

Potential population stratification was also adjusted for (in addition to traditional risk factors) in assessing the risk estimates of the SNPs. The risk allele of each of the SNPs tested in this study was pre-specified to be the same as in antecedent studies, and a 2-sided p-value of less than 0.1 (equivalent to 1-sided p-values less than 0.05) or a 2-sided p-value less than 0.2 (equivalent to 1-sided p-values less than 0.1) were used as cutoffs for statistical significance.

SNPs that showed significant association with stroke risk in the German West Study are provided in Tables 20-21. Table 20 provides SNPs associated with stroke that have the same risk allele and 2-sided p-values that are less than 0.1 (equivalent to 1-sided p-values that are less than 0.05), and Table 21 provides SNPs associated with stroke that have the same risk allele and 2-sided p-values that are between 0.1 and 0.2 (equivalent to 1-sided p-values that are between 0.05 and 0.1).

Supplemental Analysis of SNPs in the German West Study

Overview and Results

Also in the German West Study, SNPs were identified that are associated with noncardioembolic stroke in three large study populations (the German West Study, as well as in the Vienna and UCSF/CCF Studies described above). A case-control study design was used: the Vienna Study, the UCSF/CCF Study, and the German West Study (728 noncardioembolic stroke cases, 1,041 controls). It was determined whether the alleles of those SNPs that were associated with increased risk in both the Vienna and UCSF/CCF studies were also associated with increased risk in the German West Study (thus, 1-sided tests of significance were used). Logistic regression analysis adjusting for age, sex, hypertension, and diabetes was performed.

Four SNPs were determined to be associated with noncardioembolic stroke (p<0.05) in the German West Study (before correcting for multiple testing—46 SNPs and 3 genetic models), as well as also being associated with noncardioembolic stroke in the UCSF/CCF and Vienna studies described above. These four SNPs (and the genes which they are in or near) are as follows: rs544115 in NEU3, rs1264352 near DDR1, rs10948059 in GNMT, and rs362277 in HD. An increased risk for noncardioembolic stroke was observed for carriers of the following genotypes, compared with noncarriers, for each of these four SNPs (with carrier frequency in controls, odds ratio, and 90% confidence interval indicated): CT or CC carriers of rs544115 (96.0% of controls, OR 2.39, CI 1.31-4.36), CG or CC carriers of rs1264352 (23.9% of controls, OR 1.38, CI 1.08-1.76), CT or CC carriers of rs10948059 (77% of controls, OR 1.38, CI 1.06-1.79), and CC carriers of rs362277 (80.0% of controls, OR 1.39, CI 1.05-1.84). After correcting for multiple testing, this set of 4 SNPs had a false discovery rate (FDR) of 0.67.

Subjects and Methods

Study Subjects

Subjects in all three studies (the German West Study, as well as the Vienna and UCSF/CCF Studies) were unrelated men and women of European decent and have given written informed consent. In the Vienna Study, the noncardioembolic stroke cases (defined as ischemic stroke cases that are not of cardioembolic origin, and included large vessel and small vessel stroke) were drawn from the Vienna Stroke Registry (VSR). Stroke cases in VSR were consecutive Caucasian patients admitted to stroke units in Vienna within 72 hours of onset of acute ischemic stroke between October 1998 and June 2001. All patients underwent cranial CT or MRI and were documented according to a standardized protocol including stroke severity, risk factors, and medical history. Controls were unrelated Caucasian participants in a health care program in Vienna, 45 years old or older, free of arterial vascular disease, and reported no arterial vascular diseases in first degree relatives. This study complied with the Declaration of Helsinki and was approved by the Ethics Committee of Medical University Vienna.

The UCSF/CCF study included 416 cases and 977 controls drawn from Genomic Resource at University of California San Francisco (UCSF) as well as 154 cases and 627 controls drawn from the Genebank of Cleveland Clinic Foundation (CCF). Cases in the UCSF/CCF study did not have stroke subtype information. To enrich for noncardioembolic stroke cases, patients with a history of stroke were excluded who also had a history of heart rhythm or heart valve diseases that could have lead to cardioembolic stroke. Cases from UCSF had a history of stroke and no history of abnormal heart rhythm, heart valve disease or surgery. Controls from UCSF did not have a history of stroke, atherectomy, or CHD (including coronary stenosis, myocardial infarction, or coronary revascularization procedures). Cases and controls from CCF were patients who have had coronary angiography. Cases had a history of stroke and no history of atrial fibrillation, heart valve disease, or surgery. Controls did not have a history of stroke or CHD (including myocardial infarction, coronary stenosis greater than 50%, peripheral vascular disease, or revascularization procedures).

The German West Study included 728 noncardioembolic cases (ischemic strokes that were not of cardioembolic origin) from Westphalia Stroke Registry and 1,041 controls from the same region of Germany recruited by the Dortmund Health Study for the noncardioembolic stroke analysis. For the cardioembolic stroke analysis, 462 cardioembolic stroke cases (ischemic strokes of cardioembolic origin), also enrolled in the Westphalia Stroke Registry, were compared with the same 1401 controls from the Dortmund Health Study.

Statistics

Differences in traditional risk factors between cases and controls were assessed by the Wilcoxon rank sum test (continuous variables) or by the chi-square test (discrete variables). Odds ratios for the Vienna Study or the UCSF/CCF Study were not adjusted, and odds ratios for the German West Study were estimated from logistic regression models and adjusted for traditional risk factors including age (at the index stroke event for cases, at enrollment for controls), sex, diabetes mellitus (defined by a physician's diagnosis or the use of either insulin or oral hypoglycemic medications), hypertension (defined by systolic blood pressure >140 mmHg, diastolic blood pressure >90 mmHg, a physician's diagnosis of hypertension, or the use of anti-hypertensive medications). To account for multiple hypothesis testing, the false discovery rate (FDR) q values were estimated by the method of Benjamini and Hochberg (Journal of the Royal Statistical Society 1995; Serials B:1289-1300) using the p-values for risk genotype carrier status from the model adjusted for age, sex, hypertension, and diabetes.

Example Six: SNPs Associated with Stroke or Statin Response in CARE or PROSPER Studies

The identification of 61 SNPs that are associated with stroke in both of two case-control studies (Vienna Stroke Registry and the UCSF/CCF Stroke Study) is described in Example Four above. Example Five above describes the analysis of these 61 SNPs plus 17 additional SNPs in the German West Study. Here, Example Six describes the analysis of SNPs for association with stroke risk and stroke statin response (SSR) in two pravastatin trials: CARE (“Cholesterol and Recurrent Events” study, which is comprised of individuals who have previously had an MI) and PROSPER (“Prospective Study of Pravastatin in the Elderly at Risk” study, which is comprised of elderly individuals with or without a history of cardiovascular disease (CVD)).

In CARE, SNPs were analyzed for association with stroke risk or SSR. SNPs that were significantly associated with stroke risk or SSR in CARE (which were also associated with stroke risk in the German West Study described above in Example Five) are provided in Table 22 (stroke risk) and Table 23 (SSR). Additional SNPs that were significantly associated with stroke risk or SSR in CARE are provided in Table 24 (stroke risk) and Table 25 (SSR). Further SNPs that were significantly associated with stroke risk or SSR in CARE are provided in Table 26 (stroke risk) and Table 27 (SSR).

Table 26 shows that, for example, individuals in CARE who were G/G homozygotes at the CALM1 SNP (rs3814843/hCV11474611) had an increased risk for stroke (HR=7.54 with a 2-sided p-value of 0.0441 for genotypic mode and adjusted for statin use; HR=7.43 with a 2-sided p-value of 0.0455 for recessive mode and adjusted for statin use; HR=6.64 with a 2-sided p-value of 0.0606 for genotypic mode and unadjusted; and HR=6.67 with a 2-sided p-value of 0.0599 for recessive mode and unadjusted).

Results of the analysis of the MYH15 SNP (rs3900940/hcv7425232) for association with stroke risk in CARE are provided in Table 28. Table 28 shows that, for example, individuals in CARE who were C/C homozygotes at the MYH15 SNP (rs3900940/hcv7425232) had an increased risk for stroke (HR=1.403 with a 2-sided p-value of 0.153 when adjusted for statin use; HR=1.51 with a 2-sided p-value of 0.086 when adjusted for traditional risk factors, BMI, and statin use; and HR=1.49 with a 2-sided p-value of 0.094 when adjusted for CHD, traditional risk factors, BMI, and statin use). All the p-values (including P_int values) provided in Tables 22-28 are two-sided p-values.

In PROSPER, SNPs were analyzed for association with stroke risk or SSR, in the whole study cohort (strata: “ALL”), or in the subgroup with a history of CVD (strata: “hist”) or without a CVD history (strata: “no hist”). SNPs were considered significantly associated with stroke risk if they met the p-value cutoffs and had the same risk allele as in antecedent studies (e.g., as described herein in Examples Four, Five, and Six), and these SNPs that are significantly associated with stroke risk are provided in Tables 29-30. Specifically, Table 29 lists SNPs associated with stroke risk that have P_all <0.2 (which is the p-value based on the entire study cohort), and Table 30 lists SNPs associated with stroke risk that have P_placebo <0.2 (which is the p-value based on just the placebo arm of the trial). For SSR, the results of the analyses of pravastatin-treated versus placebo-treated individuals are provided in Table 31 (which lists SNPs having P_int<0.1) and Table 32 (which lists SNPs having P_int<0.2). All the p-values (including P_int values) provided in Tables 29-32 are two-sided p-values (two-sided p-value cutoffs of 0.1 and 0.2 are equivalent to one-sided p-value cutoffs of 0.05 and 0.1, respectively).

Table 30 shows that, for example, individuals in PROSPER who were A/G heterozygotes at the chromosome 9p21 SNP (rs1075727/hCV26505812) had an increased risk for stroke (HR=1.464 with a 2-sided p-value of 0.035 based on the placebo group; see the first row for rs10757274/hCV26505812 in Table 30).

Table 30 also shows that, for example, individuals in PROSPER who were T/T homozygotes at the chromosome 4q25 SNP (rs2200733/hCV16158671) had an increased risk for stroke (HR=3.711 with a 2-sided p-value of 0.025 based on the placebo group).

Also in the CARE and PROSPER trials, the chromosome 9p21 SNP rs10757274 (hCV26505812) was analyzed further for association with SSR, including unadjusted and adjusted analysis. Adjusted analysis in CARE (Table 37) was adjusted for age, gender, smoking status, hypertension, diabetes, body mass index (BMI), and LDL and HDL levels, and adjusted analysis in PROSPER (Table 38) was adjusted for country, gender, age, LDL, HDL, smoking status (current vs. past or never), history of hypertension, and diabetes. Table 37 provides results in CARE, and Table 38 provides results in PROSPER (whether each analysis is unadjusted or adjusted is indicated in the “adjust” column in Table 37, or by “unadj” and “adj” column labels in Tables 38). All the p-values (including P_int values) provided in Tables 37-38 are two-sided p-values.

In CARE, among the three genotypes of SNP rs1075727 (homozygous carriers of each of the two alternative alleles plus heterozygous carriers), the heterozygous carriers of SNP rs10757274 (49% genotype frequency) had the greatest reduction in the number of stroke events (HR=0.61) upon pravastatin treatment after adjusting for traditional risk factors (2-sided p-value=0.034, and the genotype by treatment interaction had a 2-sided p-interaction value (“pval_intx” or P_int)=0.44; see the 13^th row under the column headings in Table 37). In PROSPER, heterozygous carriers of the G allele (risk allele) at SNP rs1075727 in the placebo arm had an increased stroke risk (for example, see the first row for rs10757274/hCV26505812 in Table 30), as indicated above. Furthermore, in PROSPER, after stratifying by rs10757274 genotype, heterozygous carriers of this SNP (51% of the population) also had the greatest reduction in the number of stroke events (unadjusted HR=0.777) in the pravastatin-treated versus the placebo-treated arms of the trial (2 sided p-value=0.066; see the 3rd row under the column headings in Table 38), whether unadjusted or adjusted for traditional risk factors.

Example Seven: SNPs Associated with Stroke in the Cardiovascular Health Study (CHS)

The identification of 61 SNPs that are associated with stroke in both of two case-control studies (Vienna Stroke Registry and the UCSF/CCF Stroke Study) is described in Example Four above. Example Five above describes the analysis of these 61 SNPs plus 17 additional SNPs in the German West Study. Here, Example Seven describes the analysis of SNPs previously found to be associated with stroke (e.g., in Examples Four, Five, and/or Six above) for association with incident stroke events in the Cardiovascular Health Study (CHS), which is a population-based study of elderly white or black participants in the United States. Association was analyzed for three related stroke end points: stroke (all subtypes) (endpoint: “stroke” in Tables 33-36), ischemic stroke (excludes hemorrhagic stroke) (endpoint: “ischem” in Tables 33-36), and atherothrombotic stroke (excludes hemorrhagic stroke and cardioembolic stroke) (endpoint: “athero” in Tables 33-36).

The results in the CHS Study are provided in Tables 33-36. Specifically, SNPs that are associated with stroke risk in white or black individuals with 2-sided p-values less than 0.1 (equivalent to 1-sided p-values less than 0.05) are provided in Table 33 (white individuals) and Table 34 (black individuals), and SNPs that are associated with stroke in white or black individuals with 2-sided p-values between 0.1 and 0.2 (equivalent to 1-sided p-values between 0.05 and 0.1) are provided in Table 35 (white individuals) and Table 36 (black individuals).

Example Eight: Additional LD SNPs Associated with Stroke

Another investigation was conducted to identify SNPs in linkage disequilibrium (LD) with certain “interrogated SNPs” which have been found to be associated with stroke, as described herein and shown in the tables. The interrogated SNPs are shown in column 1 (which indicates the hCV identification numbers of each interrogated SNP) and column 2 (which indicates the public rs identification numbers of each interrogated SNP) of Table 4. The methodology is described earlier in the instant application. To summarize briefly, the power threshold (T) was set at an appropriate level, such as 51%, for detecting disease association using LD markers. This power threshold is based on equation (31) above, which incorporates allele frequency data from previous disease association studies, the predicted error rate for not detecting truly disease-associated markers, and a significance level of 0.05. Using this power calculation and the sample size, a threshold level of LD, or r² value, was derived for each interrogated SNP (r_T², equations (32) and (33) above). The threshold value r_T² is the minimum value of linkage disequilibrium between the interrogated SNP and its LD SNPs possible such that the non-interrogated SNP still retains a power greater or equal to T for detecting disease association.

Based on the above methodology, LD SNPs were found for the interrogated SNPs. Several exemplary LD SNPs for the interrogated SNPs are listed in Table 4; each LD SNP is associated with its respective interrogated SNP. Also shown are the public SNP IDs (rs numbers) for the interrogated and LD SNPs, when available, and the threshold r² value and the power used to determine this, and the r² value of linkage disequilibrium between the interrogated SNP and its corresponding LD SNP. As an example in Table 4, the interrogated, stroke-associated SNP rs11580249 (hCV11548152) was calculated to be in LD with rs12137135 (hCV30715059) at an r² value of 0.4781, based on a 51% power calculation, thus establishing the latter SNP as a marker associated with stroke as well.

In general, the threshold r_T² value can be set such that one of ordinary skill in the art would consider that any two SNPs having an r² value greater than or equal to the threshold r_T² value would be in sufficient LD with each other such that either SNP is useful for the same utilities, such as determining an individual's risk for stroke. For example, in various embodiments, the threshold r_T² value used to classify SNPs as being in sufficient LD with an interrogated SNP (such that these LD SNPs can be used for the same utilities as the interrogated SNP, for example, such as determining stroke risk) can be set at, for example, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 0.96, 0.97, 0.98, 0.99, 1, etc. (or any other r² value in-between these values). Threshold r_T² values may be utilized with or without considering power or other calculations.

All publications and patents cited in this specification are herein incorporated by reference in their entirety. Various modifications and variations of the described compositions, methods and systems of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments and certain working examples, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described modes for carrying out the invention that are obvious to those skilled in the field of molecular biology, genetics and related fields are intended to be within the scope of the following claims.

TABLE 3
Marker	Alleles	Primer 1 (Allele-specific Primer)	Primer 2 (Allele-specific Primer)	Common Primer
hCV1022614	C/T	CTGCAGCCTCTCCTACG (SEQ ID NO: 1567)	CCTGCAGCCTCTCCTACA (SEQ ID NO: 1568)	GATTCCCCATCGGTCATAA (SEQ ID NO: 1569)
hCV1053082	C/T	TTGCAGAGAAGCGTTCC (SEQ ID NO: 1570)	CTTTGCAGAGAAGCGTTCT (SEQ ID NO: 1571)	CTGAGCTTTGTGAAGAGAAACTGA (SEQ ID
				NO: 1572)
hCV1116757	C/T	GACAAACTGAGGGACAACG (SEQ ID NO: 1573)	GACAAACTGAGGGACAACA (SEQ ID NO: 1574)	CCTCTGACAGACGCTTCTTGA (SEQ ID NO: 1575)
hCV1116793	C/T	GGAAGGTCATCCTGGG (SEQ ID NO: 1576)	GGAAGGTCATCCTGGA (SEQ ID NO: 1577)	CGAAGAGTTTCTGTGTGGTACAG (SEQ ID NO: 1578)
hCV11354788	C/T	TGAGACGGGTGGTAACC (SEQ ID NO: 1579)	TTGAGACGGGTGGTAACT (SEQ ID NO: 1580)	CAGCTTTGAAGGGCATCCATATGA (SEQ ID
				NO: 1581)
hCV11425801	C/T	TCCCACACCACCTGC (SEQ ID NO: 1582)	CTCCCACACCACCTGT (SEQ ID NO: 1583)	GCCACCACAATGTCTCTCAATAC (SEQ ID NO: 1584)
hCV11425842	C/T	CCGCTCCGCACTTAAAG (SEQ ID NO: 1585)	CCGCTCCGCACTTAAAA (SEQ ID NO: 1586)	CCTGCAGCTGGACAGACTC (SEQ ID NO: 1587)
hCV11450563	G/T	TAAAGAATGCATAAATTAGTGTGG	TTAAAGAATGCATAAATTAGTGTGT	GATCCTAATTGGATTTGAAGACTTA
		(SEQ ID NO: 1588)	(SEQ ID NO: 1589)	(SEQ ID NO: 1590)
hCV11474611	G/T	ATCGCCCATGTGCTG (SEQ ID NO: 1591)	CATCGCCCATGTGCTT (SEQ ID NO: 1592)	TCAAACCAGGAACCCTATCT (SEQ ID NO: 1593)
hCV11548152	G/T	CTGTAAACGCTGGTCTGG (SEQ ID NO: 1594)	ACTGTAAACGCTGGTCTGT (SEQ ID NO: 1595)	CCTTGTCCCTGATTGCTTCTTCA (SEQ ID NO: 1596)
hCV11738775	C/T	CCCCGCTTCAACACG (SEQ ID NO: 1597)	TCCCCGCTTCAACACA (SEQ ID NO: 1598)	AACTTCATTCGGCACTTGCTACAA
				(SEQ ID NO: 1599)
hCV11758801	C/G	AGTACCTCTTGGTCTCTCTCC	AGTACCTCTTGGTCTCTCTCG	GCATGTTGTGTTTCTGATTGTAC (SEQ ID NO: 1602)
		(SEQ ID NO: 1600)	(SEQ ID NO: 1601)
hCV11861255	A/G	AAAGGGCCGAGCTGATA (SEQ ID NO: 1603)	AGGGCCGAGCTGATG (SEQ ID NO: 1604)	GGGAGGTTTGGAGAGAGAGTAT (SEQ ID NO: 1605)
hCV12071939	G/T	GACCGTGGTCCCTTG (SEQ ID NO: 1606)	TGACCGTGGTCCCTTT (SEQ ID NO: 1607)	CGCCCGGAGACAGAA (SEQ ID NO: 1608)
hCV1209800	G/T	TAGCAACTGCTATCAATGACAG	TAGCAACTGCTATCAATGACAT	AGTGAAGGAGTTAACTGAGTGTGTA
		(SEQ ID NO: 1609)	(SEQ ID NO: 1610)	(SEQ ID NO: 1611)
hCV1262973	A/G	TGGGTCCCAAGCTCAT (SEQ ID NO: 1612)	TGGGTCCCAAGCTCAC (SEQ ID NO: 1613)	GGCTCGCCGACACTG (SEQ ID NO: 1614)
hCV1305848	A/G	ACATTTATACCATTTCCCGAGT (SEQ ID	ACATTTATACCATTTCCCGAGC	GCCTAACAACAGTACCTACTCCATAGG
		NO: 1615)	(SEQ ID NO: 1616)	(SEQ ID NO: 1617)
hCV1348610	A/G	CATTTGTCCTAAAAGTACCTCTCT	CATTTGTCCTAAAAGTACCTCTCC	CAAGGCTAAGCATGCTGAACACA (SEQ ID NO: 1620)
		(SEQ ID NO: 1618)	(SEQ ID NO: 1619)
hCV1408483	C/T	TGCTAAGGCCTGTGAAC (SEQ ID NO: 1621)	TTGCTAAGGCCTGTGAAT (SEQ ID NO: 1622)	TCTGTTTTCGCTGGAGTCTT (SEQ ID NO: 1623)
hCV1452085	A/C	ACACCCTGACACCTCTTTTACT (SEQ ID NO: 1624)	ACCCTGACACCTCTTTTACG (SEQ ID NO: 1625)	CGTTCCAGTCCATATTCACAT (SEQ ID NO: 1626)
hCV1463226	C/T	ATTTCCTCCCTCACATGATAC (SEQ ID NO: 1627)	ATTTCCTCCCTCACATGATAT	TCAAAGAATGAAGAGTGAAGACA (SEQ ID NO: 1629)
			(SEQ ID NO: 1628)
hCV15752716	C/T	ACGCTGCTGTTCCG (SEQ ID NO: 1630)	ACGCTGCTGTTCCA (SEQ ID NO: 1631)	CAGACAGACAACAATTCAGAAGAA
				(SEQ ID NO: 1632)
hCV15770510	G/T	TGAAGACTGATTGTTGTACTTGC	CTGAAGACTGATTGTTGTACTTGA	TGGTGGAGAGGGTTGTAGAA (SEQ ID NO: 1635)
		(SEQ ID NO: 1633)	(SEQ ID NO: 1634)
hCV15851766	A/G	GAGTTTTCGCCATCCACT (SEQ ID NO: 1636)	GTTTTCGCCATCCACC (SEQ ID NO: 1637)	GAATCTGCTTCATTTGAATCTCT (SEQ ID NO: 1638)
hCV15854171	C/T	TTGGTGTTTCCTTGTGACAC (SEQ ID NO: 1639)	TTGGTGTTTCCTTGTGACAT (SEQ ID NO: 1640)	CCTAGTGTTTGCAATCTCATTTATC (SEQ
				ID NO: 1641)
hCV15857769	C/T	CACTCCTAAGTGAGCAGC (SEQ ID NO: 1642)	ATCACTCCTAAGTGAGCAGT (SEQ ID NO: 1643)	CTGCTTCAGTGTTATCTCAGTCTT
				(SEQ ID NO: 1644)
hCV15879601	C/T	CCACCAGGATGTAACAGTCC (SEQ ID NO: 1645)	CCCACCAGGATGTAACAGTCT	TGTGGATGCAGCAGTGAC (SEQ ID NO: 1647)
			(SEQ ID NO: 1646)
hCV16093418	A/G	CAAGAAGTTCACAGCTGAAGA (SEQ ID NO: 1648)	AAGAAGTTCACAGCTGAAGG (SEQ ID NO: 1649)	CCTGCTGGAGAGACAGAGTG (SEQ ID NO: 1650)
hCV16134786	A/G	GGCAGGGGTGAGATTGA (SEQ ID NO: 1651)	GGCAGGGGTGAGATTGG (SEQ ID NO: 1652)	GTCGTGAGGTCAGATGCTATGAG (SEQ ID NO: 1653)
hCV16158671	C/T	CTTAAATATTACCTGTTCTAATTTTCTCTG (SEQ ID	CCTTAAATATTACCTGTTCTAATTTTCTCTA	GAAATGCTGTGGGAACATAAACTAACTAGG
		NO: 1654)	(SEQ ID NO: 1655)	(SEQ ID NO: 1656)
hCV16164743	A/C	GAGCAATAGTAAGTATACACAATGAAATAA (SEQ ID	GAGCAATAGTAAGTATACACAATGAAATAC (SEQ	GATCACGGGCCTCTAGATTGATTACA
		NO: 1657)	ID NO: 1658)	(SEQ ID NO: 1659)
hCV1619596	A/G	GAGGAGCCCGTTGCA (SEQ ID NO: 1660)	AGGAGCCCGTTGCG (SEQ ID NO: 1661)	TCACCATGCACAAGGACA (SEQ ID NO: 1662)
hCV1624173	A/G	TGGACAACAGCACCTTAT (SEQ ID NO: 1663)	TGGACAACAGCACCTTAC (SEQ ID NO: 1664)	TTCCAGAGGTTCCTTCAATC (SEQ ID NO: 1665)
hCV16336	C/T	CCCCTCAAGCACTCTGAC (SEQ ID NO: 1666)	CCCCTCAAGCACTCTGAT (SEQ ID NO: 1667)	TCTGCCCCTCGTCTTTCTCT (SEQ ID NO: 1668)
hCV1690777	A/G	GGCTTTACAGAAGGAAATGCT (SEQ ID NO: 1669)	GCTTTACAGAAGGAAATGCC (SEQ ID NO: 1670)	GCATGCGCTGAATTTTATATAG (SEQ ID NO: 1671)
hCV1723718	A/G	CAGCCGTTTCTTCATATAATCCA	AGCCGTTTCTTCATATAATCCG	CTTGCTAATTCATTCTGTGACCTCAAT
		(SEQ ID NO: 1672)	(SEQ ID NO: 1673)	(SEQ ID NO: 1674)
hCV1746715	A/G	GCGCCTTTCTGTGTAGTT (SEQ ID NO: 1675)	GCGCCTTTCTGTGTAGTC (SEQ ID NO: 1676)	CACAACAGTTGTTAAGTTGTTAGCAAACC
				(SEQ ID NO: 1677)
hCV1754669	A/G	TTCAGGCCATCTTGCAAAT (SEQ ID NO: 1678)	TCAGGCCATCTTGCAAAC (SEQ ID NO: 1679)	CTCATGGCCCGATGATTTTCAGTTA
				(SEQ ID NO: 1680)
hCV1846459	C/T	CAGGCTCGTCTTGAACTC (SEQ ID NO: 1681)	CAGGCTCGTCTTGAACTT (SEQ ID NO: 1682)	CAAGAGTGGGAACTGCAGGTTT (SEQ ID NO: 1683)
hCV1958451	G/T	GTGGGAGTCTTATGTTTGTAGATG	GTGGGAGTCTTATGTTTGTAGATT	GCTTGACAATGCGCAGTTGT (SEQ ID NO: 1686)
		(SEQ ID NO: 1684)	(SEQ ID NO: 1685)
hCV2091644	C/T	TTCTGGGGCATACAACG (SEQ ID NO: 1687)	CTTCTGGGGCATACAACA (SEQ ID NO: 1688)	AGGGACAACCCTCCATAAA (SEQ ID NO: 1689)
hCV2121658	A/G	AGTGGAGATTTAGCACCAGA (SEQ ID NO: 1690)	GTGGAGATTTAGCACCAGG (SEQ ID NO: 1691)	GTACATTTTGGATTGGGAGAGGATAT
				(SEQ ID NO: 1692)
hCV2169762	G/T	CGAGTCGGTCTGCTGC (SEQ ID NO: 1693)	CGAGTCGGTCTGCTGA (SEQ ID NO: 1694)	TGCCTACCTCATTCCATCTG (SEQ ID NO: 1695)
hCV2192261	C/T	CCTACCTTGAATTCACCTATCTG	CCTACCTTGAATTCACCTATCTA	CATTTCCAAATCAGAAACATGA (SEQ ID NO: 1698)
		(SEQ ID NO: 1696)	(SEQ ID NO: 1697)
hCV22275299	C/G	GCAACTTGTTGAATGCCAG (SEQ ID NO: 1699)	GCAACTTGTTGAATGCCAC (SEQ ID NO: 1700)	GTGCTGTCACACCCAAGAAGTAC (SEQ ID NO: 1701)
hCV2358247	A/G	GGTTGGGCGTAAGGGTT (SEQ ID NO: 1702)	GGTTGGGCGTAAGGGTC (SEQ ID NO: 1703)	CCCTAGCTTTGCATAAATCATAC (SEQ ID NO: 1704)
hCV2390937	A/C	GTGGAAATGCAAGCTCTTCA (SEQ ID NO: 1705)	TGGAAATGCAAGCTCTTCC (SEQ ID NO: 1706)	CCAGATCGCTTTGGTAAAGGATTAA
				(SEQ ID NO: 1707)
hCV2442143	C/T	ATTTAAGCATCATAGCATACCAC	ATTTAAGCATCATAGCATACCAT	TGGTACACCATAAATCTTGACTTAC
		(SEQ ID NO: 1708)	(SEQ ID NO: 1709)	(SEQ ID NO: 1710)
hCV25473186	C/T	ATCTTCACAGTGTTCCACATC (SEQ ID	ATCTTCACAGTGTTCCACATT	TTCTGACCTCCAGGTTCTTT (SEQ ID NO: 1713)
		NO: 1711)	(SEQ ID NO: 1712)
hCV25596936	C/T	GGCAGGCGAAGAGTCAC (SEQ ID NO: 1714)	GGCAGGCGAAGAGTCAT (SEQ ID NO: 1715)	GGGTCAATCCACAGTCTAGATG (SEQ ID NO: 1716)
hCV25609987	A/G	TGAGCAGGTAGCCTGTATTT (SEQ ID NO: 1717)	TGAGCAGGTAGCCTGTATTC (SEQ ID NO: 1718)	TGCTGCCTTGGTTGTGA (SEQ ID NO: 1719)
hCV25615822	C/T	CGGATCTTCTCCAGCG (SEQ ID NO: 1720)	CCGGATCTTCTCCAGCA (SEQ ID NO: 1721)	TGAAGCCACATCCTTCTTTAT (SEQ ID NO: 1722)
hCV25623804	A/G	TTTCAAGCTGTCTCCTACCAT (SEQ ID NO: 1723)	TTTCAAGCTGTCTCCTACCAC	GGAGAGAAGGGAAGGACTAAAG (SEQ ID NO: 1725)
			(SEQ ID NO: 1724)
hCV25637605	A/G	GCGGCTCTGCACAT (SEQ ID NO: 1726)	GCGGCTCTGCACAC (SEQ ID NO: 1727)	GCGGGTGGCTCCTTTAA (SEQ ID NO: 1728)
hCV25651109	C/G	GGTCCTGCTTGATGCG (SEQ ID NO: 1729)	AGGTCCTGCTTGATGCC (SEQ ID NO: 1730)	CGACCATGGACATTCACAT (SEQ ID NO: 1731)
hCV25742059	A/G	CTGCCTCTTCTGCATTAGA (SEQ ID NO: 1732)	TGCCTCTTCTGCATTAGG (SEQ ID NO: 1733)	CCTTCACTGCCTGTTTCTCT (SEQ ID NO: 1734)
hCV25924894	A/G	GGGAAGTTCTTTCTTGTATATTCAA	GGGAAGTTCTTTCTTGTATATTCAG	TGCTGTCTTTGCCTCACTAAT (SEQ ID NO: 1737)
		(SEQ ID NO: 1735)	(SEQ ID NO: 1736)
hCV25925481	A/G	AATCAGCATTTTTGTCAAAGA (SEQ ID NO: 1738)	ATCAGCATTTTTGTCAAAGG (SEQ ID NO: 1739)	GGCTTGTGACCTCATTGTTT (SEQ ID NO: 1740)
hCV25951678	A/G	AATGCAGCTGCTCAAAGA (SEQ ID NO: 1741)	ATGCAGCTGCTCAAAGG (SEQ ID NO: 1742)	GTTCCCGGGCTCACA (SEQ ID NO: 1743)
hCV25952089	A/C	CCCTGCCTCTGTCTGACTA (SEQ ID NO: 1744)	CCCTGCCTCTGTCTGACTC (SEQ ID NO: 1745)	AAGACAAGCCCAGGTTCA (SEQ ID NO: 1746)
hCV25983294	G/T	CCATCATTTACTCCTACCGC (SEQ ID NO: 1747)	CCCATCATTTACTCCTACCGT	GCCGAGCGGTCTGAG (SEQ ID NO: 1749)
			(SEQ ID NO: 1748)
hCV2637554	C/T	ACATCCCAATAAAAGAGCAGG (SEQ ID NO: 1750)	AAACATCCCAATAAAAGAGCAGA	ACTTTGTTTCTTTCAGTATTTATGGCAGTGG
			(SEQ ID NO: 1751)	(SEQ ID NO: 1752)
hCV26478797	A/G	GAAATCCTCCCACTGATGA (SEQ ID NO: 1753)	AAATCCTCCCACTGATGG (SEQ ID NO: 1754)	GCCAGATAGAATGACTTTATTGTAGA
				(SEQ ID NO: 1755)
hCV26505812	A/G	GTCAAATCTAAGCTGAGTGTTGA	TCAAATCTAAGCTGAGTGTTGG	GCTTTCCCAGATGCACTGTATTGT
		(SEQ ID NO: 1756)	(SEQ ID NO: 1757)	(SEQ ID NO: 1758)
hCV26682080	A/G	TCTCGGGTAGACCACACT (SEQ ID NO: 1759)	CTCGGGTAGACCACACC (SEQ ID NO: 1760)	GGCCCAGAGAGGTGAAGTTACT (SEQ ID NO: 1761)
hCV26881276	A/G	GAGTTGCTCACAAAAGGCA (SEQ ID NO: 1762)	AGTTGCTCACAAAAGGCG (SEQ ID NO: 1763)	GCAGGCCATGTGAATAGACATAC (SEQ ID NO: 1764)
hCV27077072	C/T	ATCCTGGTATGGCCCC (SEQ ID NO: 1765)	CATCCTGGTATGGCCCT (SEQ ID NO: 1766)	GTCACACAAGCCAAGAAGAATTAGA
				(SEQ ID NO: 1767)
hCV2741051	C/T	GCAGCCAGTTTCTCCC (SEQ ID NO: 1768)	TGCAGCCAGTTTCTCCT (SEQ ID NO: 1769)	CATGAAATGCTTCCAGGTATT (SEQ ID NO: 1770)
hCV27473671	C/T	CTGACCTCCTGAATAATCCATC (SEQ ID NO: 1771)	TCTGACCTCCTGAATAATCCATT	CAGGGCTTCCCTAGCAGATAG (SEQ ID NO: 1773)
			(SEQ ID NO: 1772)
hCV27494483	C/T	AACAGCCATTCCTTGTCC (SEQ ID NO: 1774)	GAACAGCCATTCCTTGTCT (SEQ ID NO: 1775)	CCAGAAGCAGATGAAATGAGTAC (SEQ ID NO: 1776)
hCV27504565	C/G	GCTCCCAACACTGGACAG (SEQ ID NO: 1777)	GCTCCCAACACTGGACAC (SEQ ID NO: 1778)	GGTGGCAGAGCTCTCCT (SEQ ID NO: 1779)
hCV27511436	C/T	GGCCCCCATACATTACAAC (SEQ ID NO: 1780)	GGCCCCCATACATTACAAT (SEQ ID NO: 1781)	TGGAGGAAAGTTCTGGACAGTTA (SEQ ID NO: 1782)
hCV2769503	A/G	GGATTCGAGCCGACATCT (SEQ ID NO: 1783)	GATTCGAGCCGACATCC (SEQ ID NO: 1784)	TTGAGGATTAGCCTAGAACCACACA
				(SEQ ID NO: 1785)
hCV27830265	A/G	CGACCCATGAGAGAATCAGA (SEQ ID NO: 1786)	CGACCCATGAGAGAATCAGG (SEQ ID NO: 1787)	GCAGGTCCAGCCAGTGAA (SEQ ID NO: 1788)
hCV27892569	C/T	ATGTGAAATTGCATGCACTTAG (SEQ ID	GTATGTGAAATTGCATGCACTTAA	TGTGTGTACAACACCTATACATGTGTGT
		NO: 1789)	(SEQ ID NO: 1790)	(SEQ ID NO: 1791)
hCV28036404	A/T	CATGAGACTCAACTTCTTAGGAAA	CATGAGACTCAACTTCTTAGGAAT	GCACCAGCCAAGGTTTACTTTATAG
		(SEQ ID NO: 1792)	(SEQ ID NO: 1793)	(SEQ ID NO: 1794)
hCV2851380	C/G	CTTGCTACCAATTCCATTTTCC (SEQ ID	CTTGCTACCAATTCCATTTTCG (SEQ ID NO:	GGATCTCAGGGGCAAGTCTT (SEQ ID NO: 1797)
		NO: 1795)	1796)
hCV2862873	C/T	TCAACAAATGTATTGATCAGCAAAC	CTCAACAAATGTATTGATCAGCAAAT (SEQ	CAGACAGGAGGAGTGGGATTCAT (SEQ ID NO: 1800)
		(SEQ ID NO: 1798)	ID NO: 1799)
hCV2930693	A/C	GAAGAAGTACAACCCACAT (SEQ ID NO: 1801)	GAAGAAGTACAACCCACAG (SEQ ID NO: 1802)	GACACATGTAAGTTCCACTCATATG
				(SEQ ID NO: 1803)
hCV29401764	C/T	AAGGTGAGCTTGCCAATC (SEQ ID NO: 1804)	AAGGTGAGCTTGCCAATT (SEQ ID NO: 1805)	CATGGCGAGGAAGACACATAT (SEQ ID NO: 1806)
hCV29480044	C/T	GGTGGGCCTTTTGAAATAAAC (SEQ ID NO: 1807)	TGGTGGGCCTTTTGAAATAAAT (SEQ ID	CTTGAAGTGAAGGCACCTGTCAT (SEQ ID NO: 1809)
			NO: 1808)
hCV29537898	C/T	ACCACAGCTGTCCCTC (SEQ ID NO: 1810)	TACCACAGCTGTCCCTT (SEQ ID NO: 1811)	GCCTCCCAGTGGGAATCT (SEQ ID NO: 1812)
hCV29539757	A/C	TCCAGTTAGGGATAAAGAAAGGA	CCAGTTAGGGATAAAGAAAGGC (SEQ	CCAGGCTGATCTCGAACTTCT (SEQ ID NO: 1815)
		(SEQ ID NO: 1813)	ID NO: 1814)
hCV29566897	C/T	GAAGATAGATTCTGCCAAATCATTC	GAAGATAGATTCTGCCAAATCATTT (SEQ	GGTAAACTCCTGTTGCCTCAGTA (SEQ ID NO: 1818)
		(SEQ ID NO: 1816)	ID NO: 1817)
hCV2959482	A/G	ACACCTGCGGTTAGATTGA (SEQ ID NO: 1819)	CACCTGCGGTTAGATTGG (SEQ ID NO: 1820)	CGAAGCTTCACAGATGACATC (SEQ ID NO: 1821)
hCV29881864	C/G	CTTTCTTGACATCAGTGCTTC (SEQ ID NO: 1822)	CTTTCTTGACATCAGTGCTTG (SEQ ID	CAAAGTCCTCCTTTTCCTTGACTCTG
			NO: 1823)	(SEQ ID NO: 1824)
hCV302629	A/G	AGCTGCTGCTTGCTAAATAT (SEQ ID NO: 1825)	AGCTGCTGCTTGCTAAATAC (SEQ ID NO: 1826)	CCTGGAAAGGTCATGCTACTCATACT
				(SEQ ID NO: 1827)
hCV30308202	C/G	TGGCAGGAGATGGATGTAC (SEQ ID NO: 1828)	TGGCAGGAGATGGATGTAG (SEQ ID NO: 1829)	CCAGTTACTTGACTTTTGGCGTTTCT
				(SEQ ID NO: 1830)
hCV30454150	C/T	TCTAGCAGATTTGTATCAGAACC	TAATCTAGCAGATTTGTATCAGAACT (SEQ	GCGACCCTCTCTGGTTAAACA (SEQ ID NO: 1833)
		(SEQ ID NO: 1831)	ID NO: 1832)
hCV3054550	C/T	TCCTGTCTCTGTCCCTTTC (SEQ ID NO: 1834)	ATCCTGTCTCTGTCCCTTTT (SEQ ID NO: 1835)	CGGAGTGCCCTCTTGTCT (SEQ ID NO: 1836)
hCV3054799	A/G	TGACTCCCAGCATGAAT (SEQ ID NO: 1837)	TGACTCCCAGCATGAAC (SEQ ID NO: 1838)	TGGCTTATCAAGAGACATGAGA (SEQ ID NO: 1839)
hCV3082219	A/G	AGAGATAGTGGAAGCTTTGACA (SEQ ID	GAGATAGTGGAAGCTTTGACG (SEQ ID	CCTGCAGCACACTTTGTAATCTAC
		NO: 1840)	NO: 1841)	(SEQ ID NO: 1842)
hCV31137507	C/G	CCTGGGCAACAAAGTCAC (SEQ ID NO: 1843)	CCTGGGCAACAAAGTCAG (SEQ ID NO: 1844)	CAAGAATATTGGCCTGCTTCAAACTAG
				(SEQ ID NO: 1845)
hCV31227848	C/T	CCTTGGGGTAGTCCCC (SEQ ID NO: 1846)	TCCTTGGGGTAGTCCCT (SEQ ID NO: 1847)	GCTGGAGTCCCACTGAGA (SEQ ID NO: 1848)
hCV31573621	C/T	TGTAATTGGCCCAGAACAC (SEQ ID NO: 1849)	ATGTAATTGGCCCAGAACAT (SEQ ID NO: 1850)	CCTTCCAGGCTTCTCTCTGAT (SEQ ID NO: 1851)
hCV31705214	A/T	GTTGGTGAAGAAGGATTTGTAGT	GTTGGTGAAGAAGGATTTGTAGA (SEQ	GCTGGAAGCTTGACACTTGTTGAA
		(SEQ ID NO: 1852)	ID NO: 1853)	(SEQ ID NO: 1854)
hCV32160712	A/T	TGTGCCTTCCACATCTCA (SEQ ID NO: 1855)	TGTGCCTTCCACATCTCT (SEQ ID NO: 1856)	CAGGCTTTGGTCTGGGTTAAA (SEQ ID NO: 1857)
hCV3216551	A/G	GCATACATCACATTTTCTTTACCT	GCATACATCACATTTTCTTTACCC (SEQ	GTTCATTGCAGCATTTTCCCCAATAC
		(SEQ ID NO: 1858)	ID NO: 1859)	(SEQ ID NO: 1860)
hCV323071	A/G	AAACCAGGATATCAGAACATTTTA	ACCAGGATATCAGAACATTTTG (SEQ ID	GGTCTTAGGAATTATCTGACATCTT
		(SEQ ID NO: 1861)	NO: 1862)	(SEQ ID NO: 1863)
hCV435733	C/G	CAACTACTCGGGAGACAG (SEQ ID NO: 1864)	CAACTACTCGGGAGACAC (SEQ ID NO: 1865)	CCTCTCAGCCCTCTCTCCATAAAG
				(SEQ ID NO: 1866)
hCV454333	C/T	GTATGGGCTTGAGGAAATCAC (SEQ ID NO: 1867)	GTATGGGCTTGAGGAAATCAT (SEQ ID	TGCACAGATGGCTTCTGTATGT (SEQ ID NO: 1869)
			NO: 1868)
hCV540056	C/T	AACTACTTCTGGATGGTCAGC (SEQ ID NO: 1870)	AAACTACTTCTGGATGGTCAGT (SEQ	GGGTCCTGCAAGTAGACACTAAG (SEQ ID NO: 1872)
			ID NO: 1871)
hCV7425232	C/T	TCAAAATTATTTCTTGCTACAGG	GTCAAAATTATTTCTTGCTACAGA (SEQ	TCCTCCAGCCTCTCATTC (SEQ ID NO: 1875)
		(SEQ ID NO: 1873)	ID NO: 1874)
hCV7917138	A/G	CAGTAGCAATGGTAAAGATTTGAAT	CAGTAGCAATGGTAAAGATTTGAAC (SEQ	TTCCACTGTATAGACTCTCCTGTACAGAT
		(SEQ ID NO: 1876)	ID NO: 1877)	(SEQ ID NO: 1878)
hCV8147903	A/G	GGCTCTCTCGTGAGCA (SEQ ID NO: 1879)	GGCTCTCTCGTGAGCG (SEQ ID NO: 1880)	GAAGGGGCACAGTGCCTTTTAG (SEQ ID NO: 1881)
hCV8754449	C/T	GCAGCTGAGGATTTAGCAC (SEQ ID NO: 1882)	GCAGCTGAGGATTTAGCAT (SEQ ID NO: 1883)	CAGAGCAAGACCCTGTCTCTAA (SEQ ID NO: 1884)
hCV8757333	C/T	CGTCAGCTCCTTTTGACAC (SEQ ID NO: 1885)	CGTCAGCTCCTTTTGACAT (SEQ ID NO: 1886)	CCCCAGAGGGTCCAAATTTCT (SEQ ID NO: 1887)
hCV8820007	A/T	CTTGGATAGCCTGAACCAATAA (SEQ ID	CTTGGATAGCCTGAACCAATAT (SEQ ID	CGTGAATAGGGTCCAGAGTCTA (SEQ ID NO: 1890)
		NO: 1888)	NO: 1889)
hCV8942032	G/G	TTTGGACATGGGCAAGC (SEQ ID NO: 1891)	CTTTGGACATGGGCAAGG (SEQ ID NO: 1892)	CCCTGCATGGAAAGGTAAGAAAGT
				(SEQ ID NO: 1893)
hCV9296529	A/G	CTCATCCITAATATTGTTTACTTGTGAT	CTCATCCTTAATATTGTTTACTTGTGAC	CAAGACAGCCGCCTACAAGA (SEQ ID NO: 1896)
		(SEQ ID NO: 1894	(SEQ ID NO: 1895
hCV9324316	C/T	GCAGGGGTTTCTCACC (SEQ ID NO: 1897)	TGCAGGGGTTTCTCACT (SEQ ID NO: 1898)	CCCTCCGGCTCAATGTCA (SEQ ID NO: 1899)
hCV9326822	C/T	CTCGGGACCAGTCCAG (SEQ ID NO: 1900)	CTCGGGACCAGTCCAA (SEQ ID NO: 1901)	CCGACAGCCGAGGAGA (SEQ ID NO: 1902)
hCV945276	G/T	CGCCACAAACACATACCTG (SEQ ID NO: 1903)	CGCCACAAACACATACCTT (SEQ ID NO: 1904)	CCGCTGCTTGGAACAG (SEQ ID NO: 1905)
hCV9473891	C/T	AGACTTTGATGCCAACGAG (SEQ ID NO: 1906)	CAGACTTTGATGCCAACGAA (SEQ ID NO: 1907)	CCAAGCACATTTATTGAGCACTCAA
				(SEQ ID NO: 1908)
hDV70959216	G/T	CAAACAGTGATGCAAATCAATTTC	ACAAACAGTGATGCAAATCAATTTA (SEQ	GAAGGGGGACGAAGAAGCTAGAA (SEQ ID NO: 1911)
		(SEQ ID NO: 1909)	ID NO: 1910)
hDV77718013	C/T	GGGACCCTATAGGAGCTTC (SEQ ID NO: 1912)	GGGACCCTATAGGAGCTTT (SEQ ID NO: 1913)	TCATTCTTGGGGGAGAGGCTATTC
				(SEQ ID NO: 1914)

TABLE 4
Interrogated SNP	Interrogated rs	LD SNP	LD SNP rs	Power	Threshold r2	r2
hCV11548152	rs11580249	hCV30715059	rs12137135	0.51	0.477953358	0.4781
hCV11548152	rs11580249	hCV31574252	rs12128312	0.51	0.477953358	0.6764
hCV11738775	rs6754561	hCV27153776	rs10164837	0.51	0.66106443	0.8444
hCV11738775	rs6754561	hCV3232568	rs3795880	0.51	0.66106443	0.8552
hCV11758801	rs11841997	hCV30023295	rs9591381	0.51	0.58648249	1
hCV1408483	rs17070848	hCV1408479	rs12961976	0.51	0.685992147	0.8832
hCV1408483	rs17070848	hCV1408480	rs11663275	0.51	0.685992147	0.8379
hCV1408483	rs17070848	hCV1408481	rs11152374	0.51	0.685992147	0.8946
hCV1408483	rs17070848	hCV1408515	rs12967026	0.51	0.685992147	0.7306
hCV1408483	rs17070848	hCV29202466	rs7234941	0.51	0.685992147	0.8379
hCV1408483	rs17070848	hCV31494763	rs7242542	0.51	0.685992147	0.9429
hCV1408483	rs17070848	hCV31494861	rs12970840	0.51	0.685992147	0.8379
hCV15857769	rs2924914	hCV1379455	rs2942805	0.51	0.948384617	1
hCV15857769	rs2924914	hCV1379456	rs2978341	0.51	0.948384617	1
hCV15857769	rs2924914	hCV15857755	rs2924920	0.51	0.948384617	0.9584
hCV15857769	rs2924914	hCV15857780	rs2924912	0.51	0.948384617	0.9584
hCV15857769	rs2924914	hCV15878591	rs2978339	0.51	0.948384617	0.9594
hCV15857769	rs2924914	hCV15878604	rs2978352	0.51	0.948384617	0.9594
hCV15857769	rs2924914	hCV16167752	rs2930285	0.51	0.948384617	1
hCV15857769	rs2924914	hCV27184738	rs2942808	0.51	0.948384617	1
hCV15857769	rs2924914	hCV29765690	rs9644266	0.51	0.948384617	0.9582
hCV15879601	rs2275769	hCV11396361	rs9370261	0.51	0.394289193	0.6541
hCV15879601	rs2275769	hCV15879602	rs2275770	0.51	0.394289193	1
hCV15879601	rs2275769	hCV16113165	rs2792634	0.51	0.394289193	1
hCV15879601	rs2275769	hCV2140762	rs2792638	0.51	0.394289193	1
hCV15879601	rs2275769	hCV2140766	rs1340667	0.51	0.394289193	1
hCV15879601	rs2275769	hCV2140769	rs1150875	0.51	0.394289193	1
hCV15879601	rs2275769	hCV2140770	rs2792635	0.51	0.394289193	1
hCV15879601	rs2275769	hCV2140772	rs11963558	0.51	0.394289193	1
hCV15879601	rs2275769	hCV25929027	rs6934690	0.51	0.394289193	1
hCV15879601	rs2275769	hCV25930618	rs10484648	0.51	0.394289193	1
hCV15879601	rs2275769	hCV26548331	rs2145761	0.51	0.394289193	1
hCV15879601	rs2275769	hCV26548343	rs2754795	0.51	0.394289193	1
hCV15879601	rs2275769	hCV26548347	rs2754798	0.51	0.394289193	1
hCV15879601	rs2275769	hCV29161504	rs6914051	0.51	0.394289193	0.5561
hCV15879601	rs2275769	hCV29161551	rs6924913	0.51	0.394289193	1
hCV15879601	rs2275769	hCV29649198	rs9885975	0.51	0.394289193	1
hCV15879601	rs2275769	hCV29649199	rs9474772	0.51	0.394289193	1
hCV15879601	rs2275769	hCV29667033	rs9474754	0.51	0.394289193	1
hCV15879601	rs2275769	hCV29703373	rs9474766	0.51	0.394289193	1
hCV15879601	rs2275769	hCV29703374	rs9283919	0.51	0.394289193	1
hCV15879601	rs2275769	hCV29721486	rs9370254	0.51	0.394289193	0.5549
hCV15879601	rs2275769	hCV29721492	rs9474762	0.51	0.394289193	1
hCV15879601	rs2275769	hCV29811423	rs10484647	0.51	0.394289193	1
hCV15879601	rs2275769	hCV29902056	rs9464034	0.51	0.394289193	1
hCV15879601	rs2275769	hCV30082095	rs9357788	0.51	0.394289193	0.5896
hCV15879601	rs2275769	hCV30136287	rs9367551	0.51	0.394289193	0.5567
hCV15879601	rs2275769	hCV30154225	rs10155669	0.51	0.394289193	1
hCV15879601	rs2275769	hCV30190199	rs9474748	0.51	0.394289193	0.7432
hCV15879601	rs2275769	hCV30225881	rs9370259	0.51	0.394289193	0.5567
hCV15879601	rs2275769	hCV30225882	rs9283918	0.51	0.394289193	0.5567
hCV15879601	rs2275769	hCV30298175	rs9382281	0.51	0.394289193	0.5567
hCV15879601	rs2275769	hCV30298180	rs10080252	0.51	0.394289193	1
hCV15879601	rs2275769	hCV30370722	rs9942457	0.51	0.394289193	1
hCV15879601	rs2275769	hCV30370723	rs9474771	0.51	0.394289193	1
hCV15879601	rs2275769	hCV30388486	rs9382285	0.51	0.394289193	0.6552
hCV15879601	rs2275769	hCV30424487	rs9296737	0.51	0.394289193	0.5553
hCV15879601	rs2275769	hCV30514288	rs10484649	0.51	0.394289193	1
hCV15879601	rs2275769	hCV30586618	rs4329099	0.51	0.394289193	1
hCV15879601	rs2275769	hCV31341134	rs10948793	0.51	0.394289193	0.5567
hCV15879601	rs2275769	hCV31341182	rs11969948	0.51	0.394289193	1
hCV15879601	rs2275769	hCV31341185	rs9474746	0.51	0.394289193	1
hCV15879601	rs2275769	hCV31341188	rs6905950	0.51	0.394289193	1
hCV15879601	rs2275769	hCV31341214	rs9474774	0.51	0.394289193	1
hCV15879601	rs2275769	hCV3248104	rs1340664	0.51	0.394289193	1
hCV15879601	rs2275769	hCV3248105	rs7751241	0.51	0.394289193	1
hCV15879601	rs2275769	hCV7807314	rs9382274	0.51	0.394289193	0.5564
hCV15879601	rs2275769	hCV7807316	rs9357783	0.51	0.394289193	0.5567
hCV15879601	rs2275769	hCV7807392	rs9349691	0.51	0.394289193	0.5567
hCV15879601	rs2275769	hCV7807393	rs9349692	0.51	0.394289193	0.6541
hCV15879601	rs2275769	hCV7807402	rs1325821	0.51	0.394289193	0.5567
hCV15879601	rs2275769	hCV7807421	rs9395899	0.51	0.394289193	0.7931
hCV15879601	rs2275769	hCV7807440	rs12662586	0.51	0.394289193	0.7931
hCV15879601	rs2275769	hCV8767722	rs1342831	0.51	0.394289193	1
hCV15879601	rs2275769	hCV8768817	rs1325833	0.51	0.394289193	0.5567
hCV15879601	rs2275769	hCV8768819	rs991199	0.51	0.394289193	0.5564
hCV15879601	rs2275769	hCV8768954	rs1150884	0.51	0.394289193	1
hCV15879601	rs2275769	hCV8768992	rs1299293	0.51	0.394289193	1
hCV15879601	rs2275769	hCV8769017	rs1150874	0.51	0.394289193	1
hCV15879601	rs2275769	hCV8769025	rs1340665	0.51	0.394289193	1
hCV15879601	rs2275769	hDV70700190	rs16869492	0.51	0.394289193	1
hCV15879601	rs2275769	hDV70710884	rs16884761	0.51	0.394289193	1
hCV15879601	rs2275769	hDV70711006	rs16884943	0.51	0.394289193	1
hCV15879601	rs2275769	hDV70711009	rs16884946	0.51	0.394289193	1
hCV15879601	rs2275769	hDV70711130	rs16885091	0.51	0.394289193	1
hCV15879601	rs2275769	hDV71001425	rs17755375	0.51	0.394289193	1
hCV15879601	rs2275769	hDV77036921	rs4715443	0.51	0.394289193	0.7436
hCV16134786	rs2857595	hCV15896673	rs2596430	0.51	0.570810789	0.6215
hCV16134786	rs2857595	hCV26778946	rs2734583	0.51	0.570810789	0.6706
hCV16134786	rs2857595	hCV27300892	rs2922994	0.51	0.570810789	0.6198
hCV16134786	rs2857595	hCV27300895	rs2156874	0.51	0.570810789	0.6215
hCV16134786	rs2857595	hCV27301030	rs2844531	0.51	0.570810789	0.5926
hCV16134786	rs2857595	hCV27301032	rs2596565	0.51	0.570810789	0.6215
hCV16134786	rs2857595	hCV27452303	rs3094005	0.51	0.570810789	0.6706
hCV16134786	rs2857595	hCV27455402	rs3099844	0.51	0.570810789	0.6706
hCV16134786	rs2857595	hCV27462380	rs3130614	0.51	0.570810789	0.6592
hCV16134786	rs2857595	hCV27463679	rs3132472	0.51	0.570810789	0.6706
hCV16134786	rs2857595	hCV30109416	rs4143332	0.51	0.570810789	0.6084
hCV16134786	rs2857595	hCV30127488	rs3132473	0.51	0.570810789	0.7159
hCV16134786	rs2857595	hCV30319025	rs3093988	0.51	0.570810789	0.95
hCV16134786	rs2857595	hCV30589567	rs3093975	0.51	0.570810789	0.9498
hCV16134786	rs2857595	hCV50000055	rs1800629	0.51	0.570810789	0.8562
hCV16134786	rs2857595	hDV75435585	rs3134792	0.51	0.570810789	0.6582
hCV16336	rs362277	hCV1084102	rs363141	0.51	0.668699498	0.83
hCV16336	rs362277	hCV1084108	rs363100	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV1084110	rs363101	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV1084117	rs363106	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV11764409	rs6834455	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV11764411	rs6843895	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV2229297	rs362303	0.51	0.668699498	0.6732
hCV16336	rs362277	hCV2229306	rs362310	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV2231776	rs363091	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV2231787	rs363124	0.51	0.668699498	0.8176
hCV16336	rs362277	hCV2231788	rs363125	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV2231789	rs363093	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV2231797	rs363095	0.51	0.668699498	0.8023
hCV16336	rs362277	hCV2231805	rs363097	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV2231808	rs363098	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV2231925	rs362274	0.51	0.668699498	0.8911
hCV16336	rs362277	hCV2231935	rs362276	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV2231937	rs362323	0.51	0.668699498	0.8486
hCV16336	rs362277	hCV2231938	rs362325	0.51	0.668699498	1
hCV16336	rs362277	hCV2231953	rs362338	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV2484952	rs363094	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV29284939	rs6839081	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV29284940	rs6446725	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV29284943	rs6839274	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV29726333	rs10021254	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV29816351	rs10155264	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV30627341	rs10488840	0.51	0.668699498	0.7513
hCV16336	rs362277	hCV31758114	rs7688390	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV3266236	rs7654034	0.51	0.668699498	0.8413
hCV16336	rs362277	hCV3266250	rs7665816	0.51	0.668699498	0.8413
hCV16336	rs362277	hDV70681393	rs16844026	0.51	0.668699498	0.8413
hCV16336	rs362277	hDV70681394	rs16844028	0.51	0.668699498	0.8413
hCV16336	rs362277	hDV71057631	rs7683309	0.51	0.668699498	0.8294
hCV1958451	rs2985822	hCV11288054	rs3008858	0.51	0.59989501	1
hCV1958451	rs2985822	hCV11288055	rs1886686	0.51	0.59989501	1
hCV1958451	rs2985822	hCV11728590	rs2065002	0.51	0.59989501	0.6298
hCV1958451	rs2985822	hCV11731325	rs1925411	0.51	0.59989501	1
hCV1958451	rs2985822	hCV118052	rs6673462	0.51	0.59989501	0.9559
hCV1958451	rs2985822	hCV11863077	rs12137403	0.51	0.59989501	1
hCV1958451	rs2985822	hCV11864627	rs4620509	0.51	0.59989501	1
hCV1958451	rs2985822	hCV11864638	rs4486425	0.51	0.59989501	0.6247
hCV1958451	rs2985822	hCV12102654	rs1925413	0.51	0.59989501	1
hCV1958451	rs2985822	hCV1464018	rs2985826	0.51	0.59989501	1
hCV1958451	rs2985822	hCV1464019	rs2985825	0.51	0.59989501	1
hCV1958451	rs2985822	hCV15755638	rs3008853	0.51	0.59989501	1
hCV1958451	rs2985822	hCV15755654	rs3008871	0.51	0.59989501	1
hCV1958451	rs2985822	hCV16119992	rs2815349	0.51	0.59989501	0.6298
hCV1958451	rs2985822	hCV16120003	rs2815359	0.51	0.59989501	1
hCV1958451	rs2985822	hCV16120009	rs2815361	0.51	0.59989501	1
hCV1958451	rs2985822	hCV16120017	rs2815370	0.51	0.59989501	1
hCV1958451	rs2985822	hCV16120018	rs2815371	0.51	0.59989501	1
hCV1958451	rs2985822	hCV16186149	rs2985797	0.51	0.59989501	1
hCV1958451	rs2985822	hCV16186183	rs2182143	0.51	0.59989501	1
hCV1958451	rs2985822	hCV16186204	rs2985821	0.51	0.59989501	1
hCV1958451	rs2985822	hCV16186205	rs2985824	0.51	0.59989501	1
hCV1958451	rs2985822	hCV16286251	rs2755256	0.51	0.59989501	1
hCV1958451	rs2985822	hCV1958424	rs1925408	0.51	0.59989501	1
hCV1958451	rs2985822	hCV1958425	rs1925409	0.51	0.59989501	0.6298
hCV1958451	rs2985822	hCV1958426	rs1925410	0.51	0.59989501	0.6141
hCV1958451	rs2985822	hCV1958427	rs1118392	0.51	0.59989501	0.6632
hCV1958451	rs2985822	hCV1958436	rs3008854	0.51	0.59989501	1
hCV1958451	rs2985822	hCV1958439	rs4655658	0.51	0.59989501	1
hCV1958451	rs2985822	hCV1958440	rs3736905	0.51	0.59989501	0.6247
hCV1958451	rs2985822	hCV1958441	rs3929738	0.51	0.59989501	0.6298
hCV1958451	rs2985822	hCV1958444	rs2985818	0.51	0.59989501	1
hCV1958451	rs2985822	hCV1958449	rs1570838	0.51	0.59989501	0.6298
hCV1958451	rs2985822	hCV1958456	rs10789219	0.51	0.59989501	0.6298
hCV1958451	rs2985822	hCV1958457	rs2025608	0.51	0.59989501	1
hCV1958451	rs2985822	hCV2142099	rs2065000	0.51	0.59989501	1
hCV1958451	rs2985822	hCV2142100	rs2755253	0.51	0.59989501	0.9196
hCV1958451	rs2985822	hCV2142101	rs2755254	0.51	0.59989501	0.6247
hCV1958451	rs2985822	hCV2142106	rs2755271	0.51	0.59989501	0.6182
hCV1958451	rs2985822	hCV2142112	rs2815351	0.51	0.59989501	1
hCV1958451	rs2985822	hCV2142114	rs2755242	0.51	0.59989501	0.6379
hCV1958451	rs2985822	hCV2142122	rs2755244	0.51	0.59989501	1
hCV1958451	rs2985822	hCV2142125	rs2065001	0.51	0.59989501	1
hCV1958451	rs2985822	hCV2142126	rs2755245	0.51	0.59989501	1
hCV1958451	rs2985822	hCV2142127	rs2755246	0.51	0.59989501	1
hCV1958451	rs2985822	hCV2142133	rs2815360	0.51	0.59989501	0.6273
hCV1958451	rs2985822	hCV2142134	rs2755250	0.51	0.59989501	1
hCV1958451	rs2985822	hCV2142135	rs2755251	0.51	0.59989501	0.6298
hCV1958451	rs2985822	hCV2142137	rs2815363	0.51	0.59989501	0.6467
hCV1958451	rs2985822	hCV2142138	rs1535365	0.51	0.59989501	0.6298
hCV1958451	rs2985822	hCV2142160	rs2815380	0.51	0.59989501	0.7025
hCV1958451	rs2985822	hCV2142162	rs1024229	0.51	0.59989501	0.7254
hCV1958451	rs2985822	hCV2142163	rs1024230	0.51	0.59989501	0.7254
hCV1958451	rs2985822	hCV2142165	rs2208577	0.51	0.59989501	0.6618
hCV1958451	rs2985822	hCV26465724	rs12044278	0.51	0.59989501	1
hCV1958451	rs2985822	hCV26465735	rs12131222	0.51	0.59989501	1
hCV1958451	rs2985822	hCV27868373	rs4582760	0.51	0.59989501	0.6141
hCV1958451	rs2985822	hCV27996044	rs4655662	0.51	0.59989501	0.6298
hCV1958451	rs2985822	hCV287782	rs11208979	0.51	0.59989501	1
hCV1958451	rs2985822	hCV30441499	rs4655663	0.51	0.59989501	1
hCV1958451	rs2985822	hCV3144208	rs912797	0.51	0.59989501	1
hCV1958451	rs2985822	hCV3144211	rs2985794	0.51	0.59989501	1
hCV1958451	rs2985822	hCV3144213	rs3008873	0.51	0.59989501	1
hCV1958451	rs2985822	hCV3144214	rs2985795	0.51	0.59989501	1
hCV1958451	rs2985822	hCV79872	rs12132532	0.51	0.59989501	1
hCV1958451	rs2985822	hCV92092	rs12041926	0.51	0.59989501	1
hCV1958451	rs2985822	hCV9510886	rs1137656	0.51	0.59989501	1
hCV1958451	rs2985822	hDV70961073	rs17497828	0.51	0.59989501	1
hCV2121658	rs1187332	hCV1050736	rs726433	0.51	0.493100715	0.8585
hCV2121658	rs1187332	hCV1050741	rs1001904	0.51	0.493100715	0.7897
hCV2121658	rs1187332	hCV1050742	rs1001905	0.51	0.493100715	0.7897
hCV2121658	rs1187332	hCV11868553	rs2378669	0.51	0.493100715	0.914
hCV2121658	rs1187332	hCV11930968	rs1837305	0.51	0.493100715	0.7769
hCV2121658	rs1187332	hCV16035227	rs2579375	0.51	0.493100715	0.7769
hCV2121658	rs1187332	hCV16094752	rs2378670	0.51	0.493100715	1
hCV2121658	rs1187332	hCV16094754	rs2799484	0.51	0.493100715	1
hCV2121658	rs1187332	hCV2121649	rs17087514	0.51	0.493100715	1
hCV2121658	rs1187332	hCV2121666	rs1187326	0.51	0.493100715	0.5394
hCV2121658	rs1187332	hCV26567602	rs17087497	0.51	0.493100715	1
hCV2121658	rs1187332	hCV26567643	rs1187370	0.51	0.493100715	0.5824
hCV2121658	rs1187332	hCV29169653	rs7468983	0.51	0.493100715	0.8585
hCV2121658	rs1187332	hCV29169655	rs7045967	0.51	0.493100715	1
hCV2121658	rs1187332	hCV3237574	rs1211443	0.51	0.493100715	1
hCV2121658	rs1187332	hCV3237587	rs1187333	0.51	0.493100715	1
hCV2121658	rs1187332	hCV3237592	rs1147193	0.51	0.493100715	0.5562
hCV2121658	rs1187332	hCV7423840	rs1443441	0.51	0.493100715	0.5299
hCV2121658	rs1187332	hCV7423871	rs1209068	0.51	0.493100715	0.5284
hCV2121658	rs1187332	hCV7424026	rs1307279	0.51	0.493100715	0.5562
hCV2121658	rs1187332	hCV7424033	rs1659412	0.51	0.493100715	0.7897
hCV2121658	rs1187332	hCV7424042	rs1147198	0.51	0.493100715	0.5562
hCV2121658	rs1187332	hCV7424057	rs1147195	0.51	0.493100715	0.7897
hCV2121658	rs1187332	hCV7424077	rs1201364	0.51	0.493100715	0.7897
hCV2121658	rs1187332	hCV7424082	rs1659415	0.51	0.493100715	1
hCV2121658	rs1187332	hCV7424093	rs1147190	0.51	0.493100715	1
hCV2121658	rs1187332	hCV7424099	rs1332894	0.51	0.493100715	1
hCV2121658	rs1187332	hCV7424100	rs1332893	0.51	0.493100715	0.8585
hCV2121658	rs1187332	hDV70859017	rs17087470	0.51	0.493100715	0.8585
hCV2121658	rs1187332	hDV70859019	rs17087472	0.51	0.493100715	0.8585
hCV2121658	rs1187332	hDV70859037	rs17087496	0.51	0.493100715	1
hCV2358247	rs415989	hCV26338105	rs1013561	0.51	0.799037114	1
hCV2358247	rs415989	hCV29881294	rs6073814	0.51	0.799037114	0.826
hCV2358247	rs415989	hCV30007459	rs10485460	0.51	0.799037114	1
hCV2358247	rs415989	hCV7499352	rs1516579	0.51	0.799037114	1
hCV2358247	rs415989	hDV70786842	rs16990761	0.51	0.799037114	1
hCV2358247	rs415989	hDV72026194	rs800683	0.51	0.799037114	1
hCV2390937	rs739719	hCV2390936	rs739718	0.51	0.633865259	1
hCV25473186	rs2880415	hCV11313256	rs1947069	0.51	0.877072532	1
hCV25473186	rs2880415	hCV11313258	rs1947067	0.51	0.877072532	1
hCV25473186	rs2880415	hCV16209365	rs2342652	0.51	0.877072532	1
hCV25473186	rs2880415	hCV26159412	rs2342653	0.51	0.877072532	1
hCV25473186	rs2880415	hCV29013151	rs7688639	0.51	0.877072532	1
hCV25473186	rs2880415	hCV29987400	rs4234915	0.51	0.877072532	1
hCV25473186	rs2880415	hCV30852132	rs7673498	0.51	0.877072532	1
hCV25473186	rs2880415	hCV7427258	rs1047214	0.51	0.877072532	1
hCV25473186	rs2880415	hCV7428282	rs1444792	0.51	0.877072532	1
hCV25473186	rs2880415	hCV7428284	rs1444799	0.51	0.877072532	1
hCV25596936	rs6967117	hCV25596967	rs7800937	0.51	0.9709961	1
hCV25596936	rs6967117	hCV485060	rs1804527	0.51	0.9709961	1
hCV25983294	rs3739709	hCV1316797	rs1043128	0.51	0.483483129	0.9447
hCV25983294	rs3739709	hCV1316809	rs12555590	0.51	0.483483129	0.8857
hCV25983294	rs3739709	hCV27503139	rs3936868	0.51	0.483483129	0.7051
hCV25983294	rs3739709	hCV27883057	rs4978964	0.51	0.483483129	0.5049
hCV25983294	rs3739709	hCV31956059	rs10980596	0.51	0.483483129	0.5434
hCV25983294	rs3739709	hCV31956067	rs10980602	0.51	0.483483129	0.6012
hCV25983294	rs3739709	hCV31956070	rs10980605	0.51	0.483483129	0.6847
hCV25983294	rs3739709	hCV31956071	rs10980607	0.51	0.483483129	0.898
hCV25983294	rs3739709	hCV31956076	rs10817101	0.51	0.483483129	0.6835
hCV25983294	rs3739709	hCV31959065	rs10980575	0.51	0.483483129	0.7051
hCV25983294	rs3739709	hCV613577	rs551517	0.51	0.483483129	0.6445
hCV25983294	rs3739709	hCV8780367	rs1061548	0.51	0.483483129	1
hCV2637554	rs3205421	hCV11704313	rs2041149	0.51	0.586104829	0.706
hCV2637554	rs3205421	hCV11704321	rs1811338	0.51	0.586104829	0.6624
hCV2637554	rs3205421	hCV2411030	rs741645	0.51	0.586104829	1
hCV2637554	rs3205421	hCV2637556	rs2041150	0.51	0.586104829	0.5966
hCV2637554	rs3205421	hCV2637560	rs9669539	0.51	0.586104829	1
hCV2637554	rs3205421	hCV2637565	rs10860779	0.51	0.586104829	1
hCV2637554	rs3205421	hCV2637574	rs730013	0.51	0.586104829	0.6624
hCV2637554	rs3205421	hCV2637576	rs3817305	0.51	0.586104829	1
hCV2637554	rs3205421	hCV2637583	rs4764813	0.51	0.586104829	1
hCV2637554	rs3205421	hCV2637585	rs10492085	0.51	0.586104829	0.6624
hCV2637554	rs3205421	hCV27278316	rs10778146	0.51	0.586104829	0.6395
hCV2637554	rs3205421	hCV27480555	rs3764973	0.51	0.586104829	0.7373
hCV2637554	rs3205421	hCV2905213	rs11832844	0.51	0.586104829	0.7378
hCV2637554	rs3205421	hCV29407507	rs7957655	0.51	0.586104829	0.6624
hCV2637554	rs3205421	hCV29407514	rs7960795	0.51	0.586104829	0.7391
hCV2637554	rs3205421	hCV29407573	rs7965541	0.51	0.586104829	0.7373
hCV2637554	rs3205421	hCV32176762	rs7135472	0.51	0.586104829	0.7602
hCV2637554	rs3205421	hCV32176795	rs4764814	0.51	0.586104829	0.6624
hCV2637554	rs3205421	hCV8698769	rs919214	0.51	0.586104829	0.6391
hCV26478797	rs2015018	hCV2553995	rs10057898	0.51	0.783014529	0.8829
hCV26478797	rs2015018	hCV2554001	rs6861345	0.51	0.783014529	0.8487
hCV26478797	rs2015018	hCV2554006	rs1557759	0.51	0.783014529	0.8487
hCV26478797	rs2015018	hCV2557450	rs42250	0.51	0.783014529	1
hCV26478797	rs2015018	hCV29134287	rs6878107	0.51	0.783014529	0.7886
hCV26478797	rs2015018	hCV30441646	rs6883532	0.51	0.783014529	0.8098
hCV27473671	rs3750465	hCV11265714	rs12686736	0.51	0.86047945	1
hCV27473671	rs3750465	hCV15849807	rs2900481	0.51	0.86047945	0.962
hCV27473671	rs3750465	hCV15961264	rs2271878	0.51	0.86047945	0.962
hCV27473671	rs3750465	hCV1751510	rs11789624	0.51	0.86047945	0.9259
hCV27473671	rs3750465	hCV1751522	rs11792861	0.51	0.86047945	0.9259
hCV27473671	rs3750465	hCV1751524	rs10512391	0.51	0.86047945	0.962
hCV27473671	rs3750465	hCV1751537	rs11788825	0.51	0.86047945	0.962
hCV27473671	rs3750465	hCV1751538	rs11794648	0.51	0.86047945	0.9259
hCV27473671	rs3750465	hCV1751568	rs11788904	0.51	0.86047945	0.9207
hCV27473671	rs3750465	hCV1751573	rs7870597	0.51	0.86047945	0.962
hCV27473671	rs3750465	hCV25805845	rs3750451	0.51	0.86047945	0.962
hCV27473671	rs3750465	hCV27507261	rs3829084	0.51	0.86047945	0.9259
hCV27473671	rs3750465	hCV27511474	rs3750454	0.51	0.86047945	0.922
hCV27473671	rs3750465	hCV29343287	rs7855282	0.51	0.86047945	0.962
hCV27473671	rs3750465	hCV29343294	rs7470160	0.51	0.86047945	0.962
hCV27473671	rs3750465	hCV8779898	rs1333344	0.51	0.86047945	0.962
hCV27473671	rs3750465	hDV70967853	rs17552292	0.51	0.86047945	1
hCV27473671	rs3750465	hDV70979148	rs17628095	0.51	0.86047945	1
hCV27473671	rs3750465	hDV70997039	rs17729523	0.51	0.86047945	0.9617
hCV27473671	rs3750465	hDV74776655	rs1044905	0.51	0.86047945	0.962
hCV27494483	rs3748743	hCV12084456	rs1935829	0.51	0.567281167	0.5874
hCV27494483	rs3748743	hCV12085551	rs1994830	0.51	0.567281167	1
hCV27494483	rs3748743	hCV12085641	rs699753	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV12085820	rs815124	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV15752023	rs2995522	0.51	0.567281167	1
hCV27494483	rs3748743	hCV16027831	rs2488452	0.51	0.567281167	1
hCV27494483	rs3748743	hCV16052590	rs1689088	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV16250228	rs2486081	0.51	0.567281167	1
hCV27494483	rs3748743	hCV16250229	rs2486080	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV25763709	rs2488429	0.51	0.567281167	1
hCV27494483	rs3748743	hCV26680298	rs4839049	0.51	0.567281167	0.7078
hCV27494483	rs3748743	hCV26680430	rs2488433	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV26680450	rs2488449	0.51	0.567281167	1
hCV27494483	rs3748743	hCV26681176	rs11810230	0.51	0.567281167	1
hCV27494483	rs3748743	hCV29197202	rs1775518	0.51	0.567281167	1
hCV27494483	rs3748743	hCV29723037	rs1775698	0.51	0.567281167	0.7927
hCV27494483	rs3748743	hCV31476567	rs10923675	0.51	0.567281167	0.6429
hCV27494483	rs3748743	hCV31476715	rs10923964	0.51	0.567281167	0.6807
hCV27494483	rs3748743	hCV31477547	rs10923969	0.51	0.567281167	1
hCV27494483	rs3748743	hCV31477571	rs10923965	0.51	0.567281167	1
hCV27494483	rs3748743	hCV8690513	rs1342718	0.51	0.567281167	1
hCV27494483	rs3748743	hCV8690516	rs1418656	0.51	0.567281167	0.8808
hCV27494483	rs3748743	hCV8690521	rs1767265	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8691661	rs815105	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8691672	rs815107	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8691697	rs815118	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8691711	rs1281540	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8692279	rs1466812	0.51	0.567281167	0.8673
hCV27494483	rs3748743	hCV8692280	rs815102	0.51	0.567281167	0.6071
hCV27494483	rs3748743	hCV8692287	rs864175	0.51	0.567281167	0.7078
hCV27494483	rs3748743	hCV8692304	rs1767259	0.51	0.567281167	1
hCV27494483	rs3748743	hCV8692310	rs1775519	0.51	0.567281167	0.7078
hCV27494483	rs3748743	hCV8692311	rs1767258	0.51	0.567281167	0.7078
hCV27494483	rs3748743	hCV8701061	rs1689087	0.51	0.567281167	0.7498
hCV27494483	rs3748743	hCV8701081	rs1775702	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8701111	rs1281693	0.51	0.567281167	0.642
hCV27494483	rs3748743	hCV8701127	rs1798109	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8701139	rs1798110	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8701140	rs699768	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8701141	rs1689096	0.51	0.567281167	0.8808
hCV27494483	rs3748743	hCV8701148	rs699766	0.51	0.567281167	0.7917
hCV27494483	rs3748743	hCV8701153	rs699765	0.51	0.567281167	0.8668
hCV27494483	rs3748743	hCV8701160	rs699761	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8701179	rs699755	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8701181	rs699754	0.51	0.567281167	1
hCV27494483	rs3748743	hCV8701183	rs699752	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8701197	rs699748	0.51	0.567281167	0.881
hCV27494483	rs3748743	hCV8701213	rs1342719	0.51	0.567281167	0.881
hCV27494483	rs3748743	hDV70820092	rs17034936	0.51	0.567281167	0.867
hCV27494483	rs3748743	hDV70820421	rs17035363	0.51	0.567281167	0.6589
hCV27504565	rs3219489	hCV148812	rs2153608	0.51	0.960429702	1
hCV27504565	rs3219489	hCV16138635	rs2153609	0.51	0.960429702	1
hCV27504565	rs3219489	hCV16154820	rs2185549	0.51	0.960429702	1
hCV27504565	rs3219489	hCV16188158	rs2298018	0.51	0.960429702	1
hCV27504565	rs3219489	hCV27913398	rs4660853	0.51	0.960429702	1
hCV27504565	rs3219489	hCV27967653	rs4660854	0.51	0.960429702	1
hCV27504565	rs3219489	hCV27968738	rs4660849	0.51	0.960429702	1
hCV27504565	rs3219489	hCV27989232	rs4660852	0.51	0.960429702	1
hCV27504565	rs3219489	hCV29054909	rs4520450	0.51	0.960429702	1
hCV27504565	rs3219489	hCV29482894	rs9326141	0.51	0.960429702	1
hCV27504565	rs3219489	hCV29609344	rs9429160	0.51	0.960429702	1
hCV27504565	rs3219489	hCV29681797	rs9429072	0.51	0.960429702	1
hCV27504565	rs3219489	hCV29736116	rs3219472	0.51	0.960429702	1
hCV27504565	rs3219489	hCV30258653	rs9429076	0.51	0.960429702	1
hCV27504565	rs3219489	hCV30456994	rs9429158	0.51	0.960429702	1
hCV27504565	rs3219489	hCV30874754	rs11211101	0.51	0.960429702	1
hCV27504565	rs3219489	hCV32304101	rs4660851	0.51	0.960429702	1
hCV27504565	rs3219489	hCV469305	rs7543428	0.51	0.960429702	1
hCV27504565	rs3219489	hCV519782	rs2492840	0.51	0.960429702	1
hCV27511436	rs3750145	hCV106815	rs11771236	0.51	0.469307594	0.555
hCV27511436	rs3750145	hCV188768	rs10953041	0.51	0.469307594	0.653
hCV27511436	rs3750145	hCV27170501	rs12533378	0.51	0.469307594	0.7892
hCV27511436	rs3750145	hCV2835970	rs12540728	0.51	0.469307594	0.764
hCV27511436	rs3750145	hCV2835987	rs10953044	0.51	0.469307594	0.8598
hCV27511436	rs3750145	hCV29373899	rs7781027	0.51	0.469307594	0.686
hCV27511436	rs3750145	hCV32068681	rs11761729	0.51	0.469307594	0.8598
hCV27511436	rs3750145	hCV8315224	rs1052015	0.51	0.469307594	0.8598
hCV27511436	rs3750145	hDV72086373	rs34899057	0.51	0.469307594	0.8598
hCV2769503	rs4787956	hCV2769507	rs3024685	0.51	0.516261595	0.7057
hCV2769503	rs4787956	hCV8903080	rs1029489	0.51	0.516261595	0.7456
hCV2769503	rs4787956	hCV8903085	rs8832	0.51	0.516261595	0.5477
hCV2769503	rs4787956	hCV8903086	rs1049631	0.51	0.516261595	0.5278
hCV2769503	rs4787956	hDV70776992	rs16976728	0.51	0.516261595	0.7051
hCV27892569	rs4903741	hCV27198279	rs4903749	0.51	0.955713817	1
hCV27892569	rs4903741	hDV71062438	rs8006711	0.51	0.955713817	1
hCV2851380	rs12445805	hCV11667261	rs12446178	0.51	0.45310779	1
hCV2851380	rs12445805	hCV11667266	rs12448204	0.51	0.45310779	1
hCV2851380	rs12445805	hCV1565864	rs12447158	0.51	0.45310779	0.6364
hCV2851380	rs12445805	hCV26981883	rs12447735	0.51	0.45310779	1
hCV2851380	rs12445805	hCV2851355	rs12446298	0.51	0.45310779	1
hCV2851380	rs12445805	hCV2851356	rs12449083	0.51	0.45310779	0.8182
hCV2851380	rs12445805	hCV2851359	rs12446840	0.51	0.45310779	1
hCV2851380	rs12445805	hCV2851368	rs12447812	0.51	0.45310779	1
hCV2851380	rs12445805	hCV29564089	rs9924583	0.51	0.45310779	0.5385
hCV2851380	rs12445805	hCV31815677	rs12446340	0.51	0.45310779	1
hCV2851380	rs12445805	hCV31815680	rs12448935	0.51	0.45310779	1
hCV2851380	rs12445805	hCV31815681	rs12448739	0.51	0.45310779	1
hCV2851380	rs12445805	hCV31815709	rs12927043	0.51	0.45310779	0.5898
hCV29537898	rs6073804	hCV2358247	rs415989	0.51	0.552444046	0.7016
hCV29537898	rs6073804	hCV26338105	rs1013561	0.51	0.552444046	0.7016
hCV29537898	rs6073804	hCV26534413	rs544055	0.51	0.552444046	0.6811
hCV29537898	rs6073804	hCV27947632	rs4812932	0.51	0.552444046	1
hCV29537898	rs6073804	hCV27947633	rs4812930	0.51	0.552444046	1
hCV29537898	rs6073804	hCV27947636	rs4812923	0.51	0.552444046	1
hCV29537898	rs6073804	hCV29610044	rs6073808	0.51	0.552444046	1
hCV29537898	rs6073804	hCV29827054	rs6073795	0.51	0.552444046	1
hCV29537898	rs6073804	hCV29881294	rs6073814	0.51	0.552444046	0.8494
hCV29537898	rs6073804	hCV29899344	rs4812922	0.51	0.552444046	1
hCV29537898	rs6073804	hCV29935270	rs6073796	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30007459	rs10485460	0.51	0.552444046	0.7016
hCV29537898	rs6073804	hCV30133494	rs6073819	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30169599	rs6073794	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30187505	rs6065834	0.51	0.552444046	0.6134
hCV29537898	rs6073804	hCV30241248	rs6073789	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30259333	rs10485458	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30259338	rs6073797	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30277376	rs6073810	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30349417	rs6032347	0.51	0.552444046	0.6134
hCV29537898	rs6073804	hCV30511464	rs6073791	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30529696	rs6073813	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30601833	rs6073793	0.51	0.552444046	1
hCV29537898	rs6073804	hCV30601834	rs6073792	0.51	0.552444046	1
hCV29537898	rs6073804	hCV7499352	rs1516579	0.51	0.552444046	0.7016
hCV29537898	rs6073804	hDV70786611	rs16990423	0.51	0.552444046	1
hCV29537898	rs6073804	hDV70786630	rs16990452	0.51	0.552444046	1
hCV29537898	rs6073804	hDV70786842	rs16990761	0.51	0.552444046	0.7016
hCV29537898	rs6073804	hDV72026194	rs800683	0.51	0.552444046	0.6545
hCV29539757	rs10110659	hCV16018696	rs2116465	0.51	0.486011754	0.5448
hCV29539757	rs10110659	hCV1894171	rs2469505	0.51	0.486011754	0.5448
hCV29539757	rs10110659	hCV1894196	rs9642905	0.51	0.486011754	0.5894
hCV29539757	rs10110659	hCV29774726	rs10108362	0.51	0.486011754	0.8046
hCV29539757	rs10110659	hCV29991301	rs10111409	0.51	0.486011754	0.5523
hCV29539757	rs10110659	hCV30513298	rs9297840	0.51	0.486011754	0.8063
hCV29539757	rs10110659	hCV31233524	rs10956635	0.51	0.486011754	0.6776
hCV29539757	rs10110659	hCV3218376	rs959003	0.51	0.486011754	0.5698
hCV29539757	rs10110659	hDV70983393	rs17652451	0.51	0.486011754	1
hCV302629	rs9284183	hCV11491432	rs7992229	0.51	0.476125719	0.827
hCV302629	rs9284183	hCV11697373	rs7332672	0.51	0.476125719	0.5308
hCV302629	rs9284183	hCV16091979	rs2182885	0.51	0.476125719	0.4929
hCV302629	rs9284183	hCV1619929	rs9300542	0.51	0.476125719	0.901
hCV302629	rs9284183	hCV1619953	rs9517704	0.51	0.476125719	0.9036
hCV302629	rs9284183	hCV1619954	rs912130	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV1619955	rs912131	0.51	0.476125719	0.9036
hCV302629	rs9284183	hCV1619962	rs1923895	0.51	0.476125719	0.9512
hCV302629	rs9284183	hCV2028227	rs9517637	0.51	0.476125719	0.4953
hCV302629	rs9284183	hCV2028228	rs9517638	0.51	0.476125719	0.9512
hCV302629	rs9284183	hCV2028233	rs9517642	0.51	0.476125719	0.8581
hCV302629	rs9284183	hCV2028235	rs9517644	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV2028239	rs11069357	0.51	0.476125719	0.9473
hCV302629	rs9284183	hCV2028241	rs2296860	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV2028245	rs7995524	0.51	0.476125719	0.9496
hCV302629	rs9284183	hCV26560448	rs7983491	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV26560464	rs7335403	0.51	0.476125719	0.8573
hCV302629	rs9284183	hCV2699349	rs7999348	0.51	0.476125719	0.9041
hCV302629	rs9284183	hCV28038226	rs4772201	0.51	0.476125719	0.5153
hCV302629	rs9284183	hCV29166806	rs7999077	0.51	0.476125719	0.4956
hCV302629	rs9284183	hCV2950553	rs7322572	0.51	0.476125719	0.533
hCV302629	rs9284183	hCV3042329	rs4511390	0.51	0.476125719	0.9457
hCV302629	rs9284183	hCV3042331	rs2181502	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV3042333	rs9517686	0.51	0.476125719	1
hCV302629	rs9284183	hCV3042336	rs7339230	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV3042337	rs7338726	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV3042339	rs1887704	0.51	0.476125719	0.7119
hCV302629	rs9284183	hCV31358927	rs9554573	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV31358982	rs11842736	0.51	0.476125719	0.9465
hCV302629	rs9284183	hCV3193760	rs9585021	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV3193775	rs7338177	0.51	0.476125719	0.5308
hCV302629	rs9284183	hCV3193777	rs7139964	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV3193779	rs731955	0.51	0.476125719	0.5137
hCV302629	rs9284183	hCV3193781	rs984477	0.51	0.476125719	0.509
hCV302629	rs9284183	hCV3193783	rs9513584	0.51	0.476125719	0.8558
hCV302629	rs9284183	hCV3193794	rs2296911	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV3193798	rs6491493	0.51	0.476125719	0.9514
hCV302629	rs9284183	hCV8698973	rs927989	0.51	0.476125719	0.8886
hCV302629	rs9284183	hDV70984009	rs17655647	0.51	0.476125719	0.9512
hCV30308202	rs9482985	hCV11200332	rs9492268	0.51	0.712481366	0.7376
hCV30308202	rs9482985	hCV11200405	rs6569582	0.51	0.712481366	1
hCV30308202	rs9482985	hCV11692112	rs1979404	0.51	0.712481366	1
hCV30308202	rs9482985	hCV15796613	rs2448013	0.51	0.712481366	1
hCV30308202	rs9482985	hCV15886692	rs2494937	0.51	0.712481366	1
hCV30308202	rs9482985	hCV15967216	rs2279165	0.51	0.712481366	0.955
hCV30308202	rs9482985	hCV16163318	rs2219787	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889342	rs899350	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889343	rs1478800	0.51	0.712481366	0.7698
hCV30308202	rs9482985	hCV1889344	rs9492240	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889345	rs1382515	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889346	rs2448012	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889347	rs7751112	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889348	rs17056825	0.51	0.712481366	0.8924
hCV30308202	rs9482985	hCV1889349	rs9492243	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889355	rs11751534	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889357	rs11756052	0.51	0.712481366	0.955
hCV30308202	rs9482985	hCV1889358	rs11758207	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889359	rs9492248	0.51	0.712481366	0.9525
hCV30308202	rs9482985	hCV1889367	rs2876021	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889371	rs6925197	0.51	0.712481366	1
hCV30308202	rs9482985	hCV1889378	rs9492271	0.51	0.712481366	0.7467
hCV30308202	rs9482985	hCV1889383	rs265334	0.51	0.712481366	0.7778
hCV30308202	rs9482985	hCV1889389	rs265332	0.51	0.712481366	0.7776
hCV30308202	rs9482985	hCV1889390	rs265380	0.51	0.712481366	0.7778
hCV30308202	rs9482985	hCV26000215	rs17056847	0.51	0.712481366	0.7765
hCV30308202	rs9482985	hCV27442718	rs7744609	0.51	0.712481366	1
hCV30308202	rs9482985	hCV27442721	rs10499150	0.51	0.712481366	1
hCV30308202	rs9482985	hCV27480203	rs3778132	0.51	0.712481366	0.7698
hCV30308202	rs9482985	hCV27480208	rs3778137	0.51	0.712481366	0.7391
hCV30308202	rs9482985	hCV27480211	rs3778141	0.51	0.712481366	0.955
hCV30308202	rs9482985	hCV27499807	rs3778134	0.51	0.712481366	1
hCV30308202	rs9482985	hCV27499808	rs3778135	0.51	0.712481366	1
hCV30308202	rs9482985	hCV29433849	rs6569585	0.51	0.712481366	0.955
hCV30308202	rs9482985	hCV29433859	rs7756786	0.51	0.712481366	1
hCV30308202	rs9482985	hCV29433860	rs7738316	0.51	0.712481366	1
hCV30308202	rs9482985	hCV29496377	rs6569583	0.51	0.712481366	1
hCV30308202	rs9482985	hCV29532686	rs9492262	0.51	0.712481366	0.7698
hCV30308202	rs9482985	hCV30020211	rs9492237	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30056140	rs7748051	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30092368	rs9492241	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30092369	rs6941264	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30110237	rs9492245	0.51	0.712481366	0.955
hCV30308202	rs9482985	hCV30128317	rs9492253	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30182412	rs9482989	0.51	0.712481366	0.9548
hCV30308202	rs9482985	hCV30200320	rs6569584	0.51	0.712481366	0.955
hCV30308202	rs9482985	hCV30308200	rs9492263	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30308204	rs9492238	0.51	0.712481366	0.9537
hCV30308202	rs9482985	hCV30398657	rs9492247	0.51	0.712481366	0.955
hCV30308202	rs9482985	hCV30452477	rs9492265	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30470292	rs9492234	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30506242	rs9492264	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30560754	rs9492254	0.51	0.712481366	1
hCV30308202	rs9482985	hCV30632610	rs7762236	0.51	0.712481366	1
hCV30308202	rs9482985	hCV32245443	rs12210504	0.51	0.712481366	0.7521
hCV30308202	rs9482985	hCV32245454	rs6569586	0.51	0.712481366	1
hCV30308202	rs9482985	hCV32245465	rs12179603	0.51	0.712481366	1
hCV30308202	rs9482985	hCV8922745	rs1478804	0.51	0.712481366	1
hCV30308202	rs9482985	hCV8922746	rs1478803	0.51	0.712481366	1
hCV30308202	rs9482985	hCV8922755	rs1478802	0.51	0.712481366	1
hCV30308202	rs9482985	hCV8922768	rs1478798	0.51	0.712481366	1
hCV30308202	rs9482985	hCV8922785	rs1478793	0.51	0.712481366	1
hCV30308202	rs9482985	hCV8922791	rs1478792	0.51	0.712481366	0.955
hCV30308202	rs9482985	hCV8922793	rs1478808	0.51	0.712481366	0.9509
hCV30308202	rs9482985	hCV923718	rs727183	0.51	0.712481366	1
hCV30308202	rs9482985	hCV923730	rs265361	0.51	0.712481366	0.8035
hCV30308202	rs9482985	hCV923731	rs265360	0.51	0.712481366	0.7371
hCV30308202	rs9482985	hCV923753	rs265382	0.51	0.712481366	0.7778
hCV30308202	rs9482985	hCV923754	rs265381	0.51	0.712481366	0.7778
hCV30308202	rs9482985	hCV923758	rs265388	0.51	0.712481366	0.7778
hCV30308202	rs9482985	hCV923759	rs265387	0.51	0.712481366	0.7778
hCV30308202	rs9482985	hCV923761	rs265385	0.51	0.712481366	0.7778
hCV30308202	rs9482985	hCV923762	rs265384	0.51	0.712481366	0.7778
hCV30308202	rs9482985	hDV70836483	rs17056909	0.51	0.712481366	1
hCV30308202	rs9482985	hDV71969667	rs7767990	0.51	0.712481366	0.955
hCV3054550	rs1559599	hCV11208814	rs4896640	0.51	0.580062034	0.8025
hCV3054550	rs1559599	hCV11208823	rs9403478	0.51	0.580062034	0.83
hCV3054550	rs1559599	hCV1649763	rs11155286	0.51	0.580062034	0.6394
hCV3054550	rs1559599	hCV1649764	rs11155287	0.51	0.580062034	0.6113
hCV3054550	rs1559599	hCV1649774	rs11754096	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV1649776	rs4896633	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV1649777	rs11752523	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV1649778	rs11753048	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV1649779	rs11755477	0.51	0.580062034	0.8476
hCV3054550	rs1559599	hCV1649780	rs4896636	0.51	0.580062034	0.8463
hCV3054550	rs1559599	hCV1649781	rs4896637	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV1649782	rs9496565	0.51	0.580062034	0.8025
hCV3054550	rs1559599	hCV1649784	rs11753012	0.51	0.580062034	0.8481
hCV3054550	rs1559599	hCV1649785	rs967633	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV1649786	rs9376741	0.51	0.580062034	0.8463
hCV3054550	rs1559599	hCV1649787	rs11754065	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV27888181	rs4896650	0.51	0.580062034	1
hCV3054550	rs1559599	hCV27888182	rs4896635	0.51	0.580062034	0.8476
hCV3054550	rs1559599	hCV27888183	rs4896634	0.51	0.580062034	0.8476
hCV3054550	rs1559599	hCV27888184	rs4895606	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV27937623	rs4895607	0.51	0.580062034	0.8476
hCV3054550	rs1559599	hCV28024244	rs4896653	0.51	0.580062034	0.6324
hCV3054550	rs1559599	hCV2867272	rs11758932	0.51	0.580062034	1
hCV3054550	rs1559599	hCV29604750	rs9390074	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV29930123	rs9496561	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV29947932	rs9496594	0.51	0.580062034	0.9498
hCV3054550	rs1559599	hCV30146228	rs9403485	0.51	0.580062034	0.9438
hCV3054550	rs1559599	hCV30217924	rs9399434	0.51	0.580062034	0.6673
hCV3054550	rs1559599	hCV30272167	rs9390075	0.51	0.580062034	0.8476
hCV3054550	rs1559599	hCV30344162	rs9390076	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV30398541	rs9285499	0.51	0.580062034	0.6394
hCV3054550	rs1559599	hCV30524360	rs9403486	0.51	0.580062034	0.9498
hCV3054550	rs1559599	hCV3054531	rs6937858	0.51	0.580062034	0.894
hCV3054550	rs1559599	hCV3054542	rs9399439	0.51	0.580062034	1
hCV3054550	rs1559599	hCV3054556	rs11751030	0.51	0.580062034	1
hCV3054550	rs1559599	hCV32241095	rs11757293	0.51	0.580062034	1
hCV3054550	rs1559599	hCV32241106	rs11753058	0.51	0.580062034	0.8737
hCV3054550	rs1559599	hCV32404557	rs4896632	0.51	0.580062034	0.8482
hCV3054550	rs1559599	hCV7576514	rs9908	0.51	0.580062034	0.95
hCV3054550	rs1559599	hCV9783869	rs4896639	0.51	0.580062034	0.8476
hCV3082219	rs1884833	hCV1781515	rs13218371	0.51	0.822864328	1
hCV3082219	rs1884833	hCV1802750	rs13213246	0.51	0.822864328	0.9393
hCV3082219	rs1884833	hCV1802756	rs13216434	0.51	0.822864328	1
hCV3082219	rs1884833	hCV3082214	rs17208849	0.51	0.822864328	1
hCV3082219	rs1884833	hCV3082227	rs2180621	0.51	0.822864328	1
hCV31137507	rs7660668	hCV11746020	rs1979605	0.51	0.891437139	1
hCV31137507	rs7660668	hCV11746021	rs1979604	0.51	0.891437139	1
hCV31137507	rs7660668	hCV15809632	rs2101476	0.51	0.891437139	1
hCV31137507	rs7660668	hCV16072560	rs2130040	0.51	0.891437139	1
hCV31137507	rs7660668	hCV26406027	rs4336288	0.51	0.891437139	1
hCV31137507	rs7660668	hCV27941642	rs4865012	0.51	0.891437139	1
hCV31137507	rs7660668	hCV29101714	rs6851971	0.51	0.891437139	1
hCV31137507	rs7660668	hCV29101718	rs7665846	0.51	0.891437139	1
hCV31137507	rs7660668	hCV29882171	rs9993599	0.51	0.891437139	1
hCV31137507	rs7660668	hCV30440588	rs6554291	0.51	0.891437139	1
hCV31137507	rs7660668	hCV30494157	rs10012559	0.51	0.891437139	1
hCV31137507	rs7660668	hCV31137533	rs6853506	0.51	0.891437139	1
hCV31137507	rs7660668	hCV31137546	rs11732481	0.51	0.891437139	0.9502
hCV31137507	rs7660668	hCV31137548	rs6554290	0.51	0.891437139	0.9594
hCV31137507	rs7660668	hCV31137562	rs6830728	0.51	0.891437139	1
hCV31137507	rs7660668	hCV31137564	rs6842960	0.51	0.891437139	0.9183
hCV31137507	rs7660668	hCV769774	rs550144	0.51	0.891437139	1
hCV31137507	rs7660668	hCV8746676	rs880358	0.51	0.891437139	1
hCV31137507	rs7660668	hCV8746701	rs6802	0.51	0.891437139	1
hCV31137507	rs7660668	hCV8746719	rs1801260	0.51	0.891437139	1
hCV31137507	rs7660668	hCV8746730	rs11240	0.51	0.891437139	1
hCV31137507	rs7660668	hCV8746755	rs1021307	0.51	0.891437139	1
hCV31137507	rs7660668	hCV8746756	rs1021306	0.51	0.891437139	1
hCV31137507	rs7660668	hCV8746776	rs972446	0.51	0.891437139	1
hCV31137507	rs7660668	hDV70995909	rs17722979	0.51	0.891437139	1
hCV31137507	rs7660668	hDV71005355	rs17776975	0.51	0.891437139	1
hCV31137507	rs7660668	hDV71953492	rs7698022	0.51	0.891437139	1
hCV31137507	rs7660668	hDV75174888	rs17721497	0.51	0.891437139	1
hCV31137507	rs7660668	hDV75209995	rs2070062	0.51	0.891437139	1
hCV31227848	rs11809423	hCV11874240	rs12731266	0.51	0.290800579	0.2996
hCV31227848	rs11809423	hCV15842490	rs2181276	0.51	0.290800579	0.355
hCV31227848	rs11809423	hCV1654102	rs12740722	0.51	0.290800579	0.2996
hCV31227848	rs11809423	hCV3056582	rs12757352	0.51	0.290800579	0.2996
hCV31227848	rs11809423	hDV70662612	rs17363472	0.51	0.290800579	0.2988
hCV31227848	rs11809423	hDV71039510	rs6600383	0.51	0.290800579	0.2996
hCV31705214	rs12804599	hCV107313	rs10833000	0.51	0.618581044	0.8531
hCV31705214	rs12804599	hCV11594063	rs11024880	0.51	0.618581044	0.7562
hCV31705214	rs12804599	hCV1950266	rs11024863	0.51	0.618581044	1
hCV31705214	rs12804599	hCV1950274	rs10833015	0.51	0.618581044	1
hCV31705214	rs12804599	hCV1950287	rs12787111	0.51	0.618581044	1
hCV31705214	rs12804599	hCV29267415	rs7948997	0.51	0.618581044	0.8406
hCV31705214	rs12804599	hCV31705227	rs11024850	0.51	0.618581044	1
hCV31705214	rs12804599	hCV31705248	rs7931749	0.51	0.618581044	0.8479
hCV31705214	rs12804599	hDV74880995	rs10832987	0.51	0.618581044	0.6552
hCV31705214	rs12804599	hDV74888902	rs11024797	0.51	0.618581044	0.8369
hCV31705214	rs12804599	hDV75065597	rs12275926	0.51	0.618581044	0.8191
hCV32160712	rs11079160	hCV11616144	rs11656978	0.51	0.436836227	0.6753
hCV32160712	rs11079160	hCV1388786	rs11079157	0.51	0.436836227	0.6444
hCV32160712	rs11079160	hCV1388790	rs955734	0.51	0.436836227	0.5822
hCV32160712	rs11079160	hCV1388795	rs11651545	0.51	0.436836227	0.7495
hCV32160712	rs11079160	hCV1388815	rs12453442	0.51	0.436836227	0.7267
hCV32160712	rs11079160	hCV1388823	rs9895713	0.51	0.436836227	0.8877
hCV32160712	rs11079160	hCV1388832	rs12453544	0.51	0.436836227	0.8868
hCV32160712	rs11079160	hCV27267033	rs11079158	0.51	0.436836227	0.5822
hCV32160712	rs11079160	hCV29495159	rs9903045	0.51	0.436836227	1
hCV32160712	rs11079160	hCV30379482	rs9895210	0.51	0.436836227	0.8507
hCV32160712	rs11079160	hCV32160720	rs11656169	0.51	0.436836227	0.5822
hCV32160712	rs11079160	hCV32160723	rs11654125	0.51	0.436836227	0.6208
hCV32160712	rs11079160	hCV7595955	rs1465353	0.51	0.436836227	0.7565
hCV32160712	rs11079160	hCV7595964	rs2010671	0.51	0.436836227	1
hCV32160712	rs11079160	hCV8675361	rs7223639	0.51	0.436836227	0.5555
hCV32160712	rs11079160	hDV70999843	rs17746075	0.51	0.436836227	0.942
hCV32160712	rs11079160	hDV70999855	rs17746146	0.51	0.436836227	1
hCV32160712	rs11079160	hDV71012207	rs17818816	0.51	0.436836227	1
hCV454333	rs10916581	hCV31711080	rs10916583	0.51	0.908108083	1
hCV540056	rs346802	hCV31556699	rs12165049	0.51	0.491985177	1
hCV540056	rs346802	hCV540057	rs346801	0.51	0.491985177	1
hCV540056	rs346802	hCV540061	rs346816	0.51	0.491985177	1
hCV540056	rs346802	hCV540062	rs346817	0.51	0.491985177	1
hCV540056	rs346802	hCV540063	rs453116	0.51	0.491985177	1
hCV540056	rs346802	hCV540071	rs443112	0.51	0.491985177	1
hCV540056	rs346802	hCV540074	rs369654	0.51	0.491985177	0.8251
hCV540056	rs346802	hCV7446926	rs495055	0.51	0.491985177	0.6606
hCV7917138	rs9822460	hCV11538341	rs9848078	0.51	0.404318811	0.4871
hCV7917138	rs9822460	hCV11538354	rs11708509	0.51	0.404318811	1
hCV7917138	rs9822460	hCV11556848	rs4857380	0.51	0.404318811	0.9027
hCV7917138	rs9822460	hCV130955	rs9862953	0.51	0.404318811	0.5658
hCV7917138	rs9822460	hCV159392	rs1497530	0.51	0.404318811	1
hCV7917138	rs9822460	hCV246831	rs7640341	0.51	0.404318811	0.6769
hCV7917138	rs9822460	hCV246832	rs7640257	0.51	0.404318811	0.6769
hCV7917138	rs9822460	hCV26005059	rs13093620	0.51	0.404318811	0.6769
hCV7917138	rs9822460	hCV26008835	rs9821488	0.51	0.404318811	0.4212
hCV7917138	rs9822460	hCV26158969	rs4630981	0.51	0.404318811	1
hCV7917138	rs9822460	hCV26158970	rs7616504	0.51	0.404318811	0.4212
hCV7917138	rs9822460	hCV26922520	rs9869161	0.51	0.404318811	0.5455
hCV7917138	rs9822460	hCV26922587	rs13069360	0.51	0.404318811	0.9026
hCV7917138	rs9822460	hCV26922590	rs7646920	0.51	0.404318811	0.6769
hCV7917138	rs9822460	hCV29281482	rs6439825	0.51	0.404318811	0.6202
hCV7917138	rs9822460	hCV29644396	rs9877169	0.51	0.404318811	0.4212
hCV7917138	rs9822460	hCV30212818	rs9826529	0.51	0.404318811	0.6346
hCV7917138	rs9822460	hCV30320887	rs9289589	0.51	0.404318811	0.6346
hCV7917138	rs9822460	hCV362321	rs9847827	0.51	0.404318811	0.4777
hCV7917138	rs9822460	hCV362323	rs13068323	0.51	0.404318811	0.5932
hCV7917138	rs9822460	hCV362326	rs9289587	0.51	0.404318811	0.9027
hCV7917138	rs9822460	hCV362328	rs6799469	0.51	0.404318811	0.9027
hCV7917138	rs9822460	hCV362329	rs9844815	0.51	0.404318811	0.9027
hCV7917138	rs9822460	hCV362331	rs13086478	0.51	0.404318811	0.6305
hCV7917138	rs9822460	hCV362335	rs6439823	0.51	0.404318811	0.6769
hCV7917138	rs9822460	hCV362337	rs7630351	0.51	0.404318811	0.6769
hCV7917138	rs9822460	hCV50572	rs11721164	0.51	0.404318811	0.5526
hCV7917138	rs9822460	hCV50573	rs10433345	0.51	0.404318811	0.5526
hCV7917138	rs9822460	hCV7917329	rs904143	0.51	0.404318811	0.6276
hCV7917138	rs9822460	hDV77184830	rs6796827	0.51	0.404318811	0.6769
hCV7917138	rs9822460	hDV77231044	rs7638805	0.51	0.404318811	0.6769
hCV8147903	rs680014	hCV11785233	rs2460397	0.51	0.400661237	1
hCV8147903	rs680014	hCV11788458	rs2460386	0.51	0.400661237	1
hCV8147903	rs680014	hCV11788468	rs553352	0.51	0.400661237	1
hCV8147903	rs680014	hCV11788533	rs4799084	0.51	0.400661237	0.6566
hCV8147903	rs680014	hCV12091565	rs629084	0.51	0.400661237	0.5434
hCV8147903	rs680014	hCV1731571	rs580675	0.51	0.400661237	1
hCV8147903	rs680014	hCV26871521	rs12605631	0.51	0.400661237	1
hCV8147903	rs680014	hCV2744994	rs2510276	0.51	0.400661237	1
hCV8147903	rs680014	hCV2745000	rs2680752	0.51	0.400661237	1
hCV8147903	rs680014	hCV2745001	rs1788659	0.51	0.400661237	1
hCV8147903	rs680014	hCV27516223	rs3786238	0.51	0.400661237	0.7292
hCV8147903	rs680014	hCV27877725	rs4799077	0.51	0.400661237	0.8788
hCV8147903	rs680014	hCV29779584	rs4799081	0.51	0.400661237	0.9183
hCV8147903	rs680014	hCV3068685	rs3859321	0.51	0.400661237	0.7991
hCV8147903	rs680014	hCV3068718	rs673590	0.51	0.400661237	1
hCV8147903	rs680014	hCV3068726	rs685665	0.51	0.400661237	1
hCV8147903	rs680014	hCV3068731	rs522723	0.51	0.400661237	0.9587
hCV8147903	rs680014	hCV3068735	rs517479	0.51	0.400661237	1
hCV8147903	rs680014	hCV3068736	rs485400	0.51	0.400661237	1
hCV8147903	rs680014	hCV3068738	rs503615	0.51	0.400661237	1
hCV8147903	rs680014	hCV3068739	rs603957	0.51	0.400661237	1
hCV8147903	rs680014	hCV3068757	rs3826573	0.51	0.400661237	0.4225
hCV8147903	rs680014	hCV3068760	rs585571	0.51	0.400661237	0.8509
hCV8147903	rs680014	hCV805999	rs649763	0.51	0.400661237	1
hCV8147903	rs680014	hCV806002	rs681631	0.51	0.400661237	1
hCV8147903	rs680014	hCV806008	rs655609	0.51	0.400661237	0.8402
hCV8147903	rs680014	hCV806012	rs671424	0.51	0.400661237	0.4335
hCV8147903	rs680014	hCV806021	rs618342	0.51	0.400661237	0.4335
hCV8147903	rs680014	hCV8155000	rs605183	0.51	0.400661237	1
hCV8147903	rs680014	hCV8155010	rs570029	0.51	0.400661237	1
hCV8147903	rs680014	hCV8155011	rs589394	0.51	0.400661237	1
hCV8147903	rs680014	hCV8831345	rs529195	0.51	0.400661237	1
hCV8147903	rs680014	hCV8831346	rs1239783	0.51	0.400661237	1
hCV8147903	rs680014	hCV8831352	rs500795	0.51	0.400661237	0.4335
hCV8942032	rs1264352	hCV11196362	rs3129820	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV11690723	rs886424	0.51	0.674510346	0.9461
hCV8942032	rs1264352	hCV15885725	rs2532923	0.51	0.674510346	0.8224
hCV8942032	rs1264352	hCV15947385	rs2233980	0.51	0.674510346	0.7828
hCV8942032	rs1264352	hCV16027870	rs2517578	0.51	0.674510346	0.8297
hCV8942032	rs1264352	hCV2437063	rs3131060	0.51	0.674510346	0.9468
hCV8942032	rs1264352	hCV2437065	rs3129985	0.51	0.674510346	0.9468
hCV8942032	rs1264352	hCV2437122	rs3095337	0.51	0.674510346	0.7947
hCV8942032	rs1264352	hCV2437158	rs2284174	0.51	0.674510346	0.8428
hCV8942032	rs1264352	hCV2452431	rs3132625	0.51	0.674510346	0.6845
hCV8942032	rs1264352	hCV25606044	rs7750641	0.51	0.674510346	0.6923
hCV8942032	rs1264352	hCV25606244	rs3130247	0.51	0.674510346	0.7442
hCV8942032	rs1264352	hCV25966128	rs9262135	0.51	0.674510346	0.7934
hCV8942032	rs1264352	hCV26544258	rs1634726	0.51	0.674510346	0.7745
hCV8942032	rs1264352	hCV26546104	rs8233	0.51	0.674510346	0.7955
hCV8942032	rs1264352	hCV26546345	rs2535332	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV26546351	rs2263298	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV27452306	rs3094032	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27452307	rs3094036	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27452310	rs3094057	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27452312	rs3094061	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27452313	rs3094064	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27452317	rs3094034	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27452321	rs3094031	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27452331	rs3094086	0.51	0.674510346	0.8942
hCV8942032	rs1264352	hCV27452332	rs3094035	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27452369	rs3094127	0.51	0.674510346	0.7955
hCV8942032	rs1264352	hCV27452387	rs3094222	0.51	0.674510346	0.7571
hCV8942032	rs1264352	hCV27452568	rs3094703	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27452590	rs3094717	0.51	0.674510346	0.6845
hCV8942032	rs1264352	hCV27452726	rs3095329	0.51	0.674510346	0.7945
hCV8942032	rs1264352	hCV27452728	rs3095336	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV27452739	rs3095330	0.51	0.674510346	0.8339
hCV8942032	rs1264352	hCV27452751	rs3095338	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV27452792	rs3095153	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV27452821	rs3095340	0.51	0.674510346	0.8428
hCV8942032	rs1264352	hCV27462338	rs3130353	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27462341	rs3130374	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27462390	rs3130660	0.51	0.674510346	0.7934
hCV8942032	rs1264352	hCV27462600	rs3131050	0.51	0.674510346	0.942
hCV8942032	rs1264352	hCV27462601	rs3131064	0.51	0.674510346	0.9485
hCV8942032	rs1264352	hCV27462862	rs3131788	0.51	0.674510346	0.7415
hCV8942032	rs1264352	hCV27462962	rs3129812	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27462963	rs3129815	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27462964	rs3129818	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27462981	rs3129973	0.51	0.674510346	0.8435
hCV8942032	rs1264352	hCV27462982	rs3129984	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV27462996	rs3130123	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27463014	rs3130352	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27463047	rs3130782	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV27463445	rs3131783	0.51	0.674510346	0.7423
hCV8942032	rs1264352	hCV27463454	rs3131934	0.51	0.674510346	0.7955
hCV8942032	rs1264352	hCV27463630	rs3130557	0.51	0.674510346	0.7415
hCV8942032	rs1264352	hCV27463637	rs3130641	0.51	0.674510346	0.942
hCV8942032	rs1264352	hCV27463692	rs3132580	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV27463694	rs3132610	0.51	0.674510346	0.7442
hCV8942032	rs1264352	hCV27463813	rs3131044	0.51	0.674510346	0.9447
hCV8942032	rs1264352	hCV27464298	rs3132600	0.51	0.674510346	0.7998
hCV8942032	rs1264352	hCV27464300	rs3132605	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV27464304	rs3132630	0.51	0.674510346	0.6845
hCV8942032	rs1264352	hCV27464305	rs3132631	0.51	0.674510346	0.6845
hCV8942032	rs1264352	hCV27464307	rs3132645	0.51	0.674510346	0.7345
hCV8942032	rs1264352	hCV27465359	rs3129978	0.51	0.674510346	0.8905
hCV8942032	rs1264352	hCV27465360	rs3129980	0.51	0.674510346	0.942
hCV8942032	rs1264352	hCV27465386	rs3130350	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27465389	rs3130364	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27465407	rs3130544	0.51	0.674510346	0.7218
hCV8942032	rs1264352	hCV27465417	rs3130673	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV27465853	rs3132634	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV27465855	rs3132649	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV29486333	rs3132584	0.51	0.674510346	0.7955
hCV8942032	rs1264352	hCV29504305	rs3094712	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV29522452	rs3095334	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV29540580	rs3094067	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV29558680	rs3132599	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV29594803	rs9262204	0.51	0.674510346	0.9398
hCV8942032	rs1264352	hCV29666963	rs3130363	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV29666973	rs9262130	0.51	0.674510346	0.7768
hCV8942032	rs1264352	hCV29703261	rs3095155	0.51	0.674510346	0.8696
hCV8942032	rs1264352	hCV29721426	rs3132616	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV29775548	rs3132647	0.51	0.674510346	0.6952
hCV8942032	rs1264352	hCV29847742	rs3129809	0.51	0.674510346	0.7345
hCV8942032	rs1264352	hCV29883892	rs3132581	0.51	0.674510346	0.8865
hCV8942032	rs1264352	hCV29992126	rs3094627	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV29992140	rs9262200	0.51	0.674510346	0.9468
hCV8942032	rs1264352	hCV30028026	rs3130372	0.51	0.674510346	0.6845
hCV8942032	rs1264352	hCV30045930	rs3095326	0.51	0.674510346	0.8435
hCV8942032	rs1264352	hCV30045931	rs3131055	0.51	0.674510346	0.8951
hCV8942032	rs1264352	hCV30172261	rs3130365	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV30190135	rs3094621	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV30262083	rs3094050	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV30262102	rs3130665	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV30280013	rs3094024	0.51	0.674510346	0.7442
hCV8942032	rs1264352	hCV30352101	rs3129821	0.51	0.674510346	0.6845
hCV8942032	rs1264352	hCV30424437	rs9262143	0.51	0.674510346	0.7934
hCV8942032	rs1264352	hCV30442461	rs9262141	0.51	0.674510346	0.7768
hCV8942032	rs1264352	hCV30496055	rs3130117	0.51	0.674510346	0.7442
hCV8942032	rs1264352	hCV30622443	rs3129823	0.51	0.674510346	0.6845
hCV8942032	rs1264352	hCV3273752	rs3130370	0.51	0.674510346	0.6845
hCV8942032	rs1264352	hCV7926405	rs3130126	0.51	0.674510346	0.6961
hCV8942032	rs1264352	hCV8692767	rs1264376	0.51	0.674510346	0.9468
hCV8942032	rs1264352	hCV8692768	rs1264377	0.51	0.674510346	0.8951
hCV8942032	rs1264352	hCV8692796	rs1059612	0.51	0.674510346	0.7934
hCV8942032	rs1264352	hCV8692806	rs1064627	0.51	0.674510346	0.7955
hCV8942032	rs1264352	hCV8941738	rs1634721	0.51	0.674510346	0.8435
hCV8942032	rs1264352	hCV8941879	rs1264308	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV8941918	rs1049633	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV8941930	rs886422	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV8941940	rs1264322	0.51	0.674510346	0.8905
hCV8942032	rs1264352	hCV8941988	rs2535340	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV8942006	rs1264341	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV8942015	rs1264347	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV8942025	rs1264349	0.51	0.674510346	0.8946
hCV8942032	rs1264352	hCV8942026	rs1264350	0.51	0.674510346	0.8812
hCV8942032	rs1264352	hCV8942038	rs1264353	0.51	0.674510346	0.9427
hCV8942032	rs1264352	hCV9481170	rs886423	0.51	0.674510346	1
hCV8942032	rs1264352	hDV75255684	rs2517546	0.51	0.674510346	0.6985

TABLE 5
Baseline Characteristics of ARIC Participants in Ischemic Stroke Study
	Whites (N = 10401)		Blacks(N = 3814)
	Cases	Non-cases		Cases	Non-cases
	(N = 275)	(N = 10126)		(N = 220)	(N = 3594)
Characteristics	Mean (SD)	Mean (SD)	p-value*	Mean (SD)	Mean (SD)	p-value*
Age	57.59 (5.32)	54.10 (5.69)	<0.01	55.21 (5.79)	53.25 (5.79)	<0.01
Waist-to-hip ratio	0.96 (0.07)	0.92 (0.08)	<0.01	0.94 (0.07)	0.92 (0.08)	<0.01
	N (%)	N (%)	p-value*	N (%)	N (%)	p-value*
Male	162 (59)	4569 (45)	<0.01	97 (44)	1318 (37)	0.03
Hypertensive	137 (50)	2516 (25)	<0.01	168 (77)	1903 (53)	<0.01
Diabetic	55 (20)	799 (8)	<0.01	94 (44)	596 (17)	<0.01
Smoker	90 (33)	2455 (24)	<0.01	81 (37)	1036 (29)	0.01
*p-value represents a comparison between cases and non-cases within an ethnic group

TABLE 6
SNPs Associated with Incident Ischemic Stroke in the ARIC Study
	Risk-	Risk-
	raising	lowering	Model 1†	Model 2‡
			allele	allele			p-			p-
Gene Symbol	SNP ID	Function*	(frequency)	(frequency)	HRR	95% CI	value	HRR	95% CI	value
Whites
SERPINA9	rs11628722	Nonsynonymous	G (0.84)	A (0.16)	1.31	1.00-1.70	0.05	1.32	1.02-1.72	0.03
		Ala348Val
PALLD	rs7439293	Intronic	A (0.62)	G (0.38)	1.24	1.03-1.49	0.02	1.21	1.01-1.46	0.04
IER2	rs1042164	Nonsynonymous	T (0.17)	C (0.83)	1.38	1.12-1.71	0.003	1.39	1.12-1.72	0.003
		Val133Ala
Blacks
SERPINA9	rs11628722	Nonsynonymous	G (0.45)	A (0.55)	1.26	1.03-1.53	0.02	1.27	1.04-1.54	0.02
		Ala348Val
EXOD1	rs3213646	Intronic	C (0.16)	T (0.84)	1.29	1.01-1.64	0.04	1.29	1.01-1.65	0.04
*First amino acid corresponds to risk raising allele for nonsynonymous SNPs.
†Model 1 was adjusted for age and gender.
‡Model 2 was adjusted for age, gender, waist-to-hip ratio and diabetes, hypertension and smoking status.

TABLE 7
						p-value			p-value
			Risk	White		(two-	Black		(two-
hCV number	rs number	Gene Symbol	Allele	HRR	95% CI	sided)	HRR	95% CI	sided)
hCV2091644	rs1010	VAMP8	C	1.16	0.97-1.38	0.1	0.9	0.74-1.10	0.3
hCV25925481	rs11628722	SERPINA9	G	1.31	1.00-1.70	0.05	1.26	1.03-1.53	0.02
hCV323071	rs7439293	PALLD	A	1.24	1.03-1.49	0.02	1.2	0.93-1.56	0.16
hCV7425232	rs3900940	MYH15	C	1.18	0.98-1.42	0.08	1.1	0.85-1.43	0.49
hCV9326822	rs1042164	IER2	T	1.38	1.12-1.71	0	0.54	0.27-1.09	0.08
hCV15770510	rs3027309	ALOX12B	T	1.17	0.95-1.46	0.14	1.25	0.88-1.77	0.21
hCV9626088	rs943133	LOC391102	A	1.13	0.94-1.36	0.19	1	0.69-1.45	1

TABLE 8
						p-value			p-value
		Gene	Risk	White		(two-	Black		(two-
hCV number	rs number	Symbol	Allele	HRR	95% CI	sided)	HRR	95% CI	sided)
hCV25924894	rs17090921	SERPINA9	A	1.12	0.93-1.35	0.23	1.19	0.92-1.52	0.18
hCV1690777	rs12684749	NFIB	G	0.99	0.64-1.53	0.97	1.68	0.90-3.13	0.1
hCV25925481	rs11628722	SERPINA9	G	1.31	1.00-1.70	0.05	1.26	1.03-1.53	0.02
hCV323071	rs7439293	PALLD	A	1.24	1.03-1.49	0.02	1.2	0.93-1.56	0.16
hCV25609987	rs10817479	WDR31	A	0.93	0.65-1.32	0.67	5.15	0.72-36.78	0.1
hCV2192261	rs3213646	EXOD1	C	0.98	0.82-1.17	0.82	1.29	1.01-1.64	0.04

TABLE 9
						p-value			p-value
			Risk	White		(two-	Black		(two-
hCV number	rs number	Gene Symbol	Allele	HRR	95% CI	sided)	HRR	95% CI	sided)
hCV25924894	rs17090921	SERPINA9	A	1.12	0.93-1.35	0.23	1.19	0.92-1.52	0.18
hCV25925481	rs11628722	SERPINA9	G	1.31	1.00-1.70	0.05	1.26	1.03-1.53	0.02
hCV323071	rs7439293	PALLD	A	1.24	1.03-1.49	0.02	1.2	0.93-1.56	0.16

TABLE 10
Baseline Characteristics of CHS
Participants in Ischemic Stroke Study
			African
Characteristic	Whites	Americans
Number of individuals in this analysis	3849	673
Male	1575	(41)	243	(36)
Age, mean (SD), y	72.7	(5.6)	72.9	(5.7)
BMI, mean (SD), kg/m2	26.3	(4.5)	28.5	(5.6)
Smoking,current	423	(11)	113	(17)
Diabetes	511	(13)	151	(23)
Impaired fasting glucose	522	(14)	92	(14)
Hypertension	2110	(55)	490	(73)
LDL cholesterol, mean (SD), mg/dL	130	(36)	129	(36)
HDL cholesterol, mean (SD), mg/dL	54	(16)	58	(15)
Total cholesterol, mean (SD), mg/dL	212	(39)	210	(39)
Data presented as number of participants (%) unless otherwise indicated.

TABLE 11
SNPs Associated with Incident Ischemic Stroke in
White Participants of CHS
		Prespecified	Risk Allele
Gene	dbSNP	Risk Allele	Frequency	HR (90% CI)*	P
HPS1	rs1804689	T	0.30	1.23 (1.09-1.40)	0.003
ITGAE	rs220479	C	0.82	1.26 (1.08-1.48)	0.008
ABCG2	rs2231137	C	0.95	1.46 (1.05-2.03)	0.03
MYH15	rs3900940	C	0.29	1.15 (1.02-1.31)	0.03
FSTL4	rs13183672	A	0.76	1.17 (1.01-1.35)	0.04
CALM1	rs3814843	G	0.05	1.31 (1.02-1.68)	0.04
BAT2	rs11538264	G	0.97	1.49 (1.02-2.16)	0.04
*Hazard ratios (HR) are adjusted for baseline age, sex, body mass index, current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol at baseline. Hazard ratios are per copy of the risk allele.

TABLE 12
SNPs Associated with Incident Ischemic Stroke in
African American Participants of CHS
		Pre-	Risk
		specified	Allele
		Risk	Fre-
Gene	dbSNP	Allele	quency	HR (90% CI)*	P
KRT4	rs89962	T	0.11	2.08 (1.48-2.94)	<0.001
LY6G5B	rs11758242	C	0.89	2.28 (1.20-4.33)	0.02
EDG1	rs2038366	G	0.73	1.59 (1.08-2.35)	0.02
DMXL2	rs12102203	G	0.47	1.40 (1.03-1.90)	0.04
ABCG2	rs2231137	C	0.95	3.59 (1.11-11.7)	0.04
*Hazard ratios (HR) are adjusted for baseline age, sex, body mass index, current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol at baseline. Hazard ratios are per copy of the risk allele.

TABLE 13
The Val Allele Homozygotes of ABCG2 Val12Met (rs2231137), Compared with
the Met Allele Carriers, are Associated With Increased Risk of Incident
Ischemic Stroke in Both White and African American Participants of CHS
	ABCG2	Events	Total	Model 1*	Model 2*
	Genotype	n	n	HR (90% CI)	P	HR (90% CI)	P
White	ValVal	370	3398	1.58 (1.12-2.23)	0.02	1.50 (1.06-2.12)	0.03
	ValMet + MetMet	24	335	1 (Reference)		1 (Reference)
	ValMet	23	321
	MetMet	1	14
Af. Am.	ValVal	66	592	3.80 (1.16-12.4)	0.03	3.62 (1.11-11.9)	0.04
	ValMet + MetMet	2	70	1 (Reference)		1 (Reference)
	ValMet	2	69
	MetMet	0	1
*Model 1 was adjusted for baseline age and sex. Model 2 was adjusted for baseline age, sex, body mass index, current smoking, diabetes, impaired fasting glucose, hypertension, LDL-cholesterol, and HDL-cholesterol.

TABLE 14

HR (90%

p-

HR (90%

p-

HR (90%

p-

HR (90%

p-

risk

CI) AgeSex

value

CI) Full

value

CI) AgeSex

value

CI) Full

value

gene

rs #

hCV#

allele

mode

(whites)

(whites)

(whites)

(whites)

(blacks)

(blacks)

(blacks)

(blacks)

CENPE

rs2243682

hCV1624173

A

dom

1.2 (1.02,

0.034

1.2 (1.01,

0.037

.98 (.51,

0.517

1.17 (.6,

0.352

1.42)

1.42)

1.9)

2.28)

FCRLB

rs34868416

hCV25951678

A

rec

2.01 (1.07,

0.034

2.18 (1.16,

0.021

1.52 (.84,

0.122

1.82 (.97,

0.06

3.76)

4.09)

2.74)

3.44)

FSTL4

rs3749817

hCV25637605

G

dom

2.04 (1.2,

0.013

2.04 (1.2,

0.013

3.45)

3.46)

“HR (90% CI) AgeSex” = hazard ratio (with 90% confidence intervals) adjusted for age and sex

“HR (90% CI) Full” = hazard ratio (with 90% confidence intervals) fully adjusted for all traditional risk factors including smoking, diabetes, hypertension, HDL-C, LDL-C, and BMI

TABLE 15
Characteristics of noncardioembolic stroke cases
and healthy controls in VSR
		Cases	Controls
	Characteristics	n = 562	n = 815	p
	Age (SD)	66.0	(14)	58.8	(8.5)	<0.0001
	Male	326	(58.0)	397	(48.7)	0.0007
	Smoking	172	(32.0)	147	(18.7)	<0.0001
	Hypertension	400	(71.2)	403	(49.5)	<0.0001
	Diabetes	191	(34.0)	36	(4.4)	<0.0001
	Dyslipidemia	347	(61.7)	464	(56.9)	0.07
	BMI (SD)	26.8	(4.9)	26.0	(3.8)	0.004
	Age and BMI are presented as means (standard deviation, SD) Other risk factors are presented as counts (%) having the risk factor

TABLE 16
Characteristics of six SNPs tested for association with noncardioembolic stroke in VSR.
	CHD Risk	Frequency in	Frequency in	Chrom
Gene	Allele	VSR Controls	ARIC Whites*	Loc†	SNP ID	SNP Type	SNP Source
MYH15	C	0.29	0.30	3q13.13	rs3900940	Thr1125Ala	Bare et al
KIF6	G	0.37	0.36	6p21.2	rs20455	Trp719Arg	Bare et al
VAMP8	C	0.38	0.42	2p12	rs1010	3′UTR	Bare et al
Chr9p21	G	0.46	0.49	9p21	rs10757274	Intergenic	McPherson et al

TABLE 17
Adjusted association of six SNPs with noncardioembolic stroke in VSR
Locus	Case	Control	Model 1	Model 2
Genotype	n (%)	n (%)	OR (90% CI)	p	q	OR (90% CI)	p
C9p21
GG + GA	386 (76.7)	568 (72.4)	1.20 (0.95-1.50)	0.10	0.15	1.14 (0.89-1.46)	0.20
GG	139 (27.6)	154 (19.6)	1.59 (1.20-2.11)	0.004		1.45 (1.06-1.98)	0.03
GA	247 (49.1)	414 (52.8)	1.05 (0.82-1.34)	0.38		1.02 (0.78-1.33)	0.45
AA	117 (23.3)	216 (27.6)	ref			ref
KIF6
GG + GA	327 (64.8)	475 (60.7)	1.24 (1.01-1.52)	0.05	0.12	1.23 (0.98-1.54)	0.07
GG	73 (14.5)	102 (13.0)	1.24 (0.91-1.69)	0.13		1.30 (0.93-1.83)	0.10
GA	254 (50.3)	373 (47.7)	1.24 (1.00-1.53)	0.05		1.20 (0.95-1.53)	0.10
AA	178 (35.3)	307 (39.3)	ref			ref
MYH15
CC + CT	281 (55.6)	390 (49.8)	1.31 (1.07-1.60)	0.01	0.06	1.25 (1.00-1.56)	0.05
CC	56 (11.1)	72 (9.2)	1.50 (1.06-2.11)	0.03		1.19 (0.80-1.75)	0.24
CT	225 (44.5)	318 (40.6)	1.27 (1.03-1.56)	0.03		1.26 (1.00-1.59)	0.05
TT	225 (44.5)	394 (50.3)	ref			ref
VAMP8
CC + CT	326 (64.4)	483 (61.6)	1.21 (0.99-1.49)	0.06	0.12	1.33 (1.06-1.67)	0.02
CC	77 (15.2)	112 (14.3)	1.27 (0.93-1.72)	0.10		1.37 (0.98-1.91)	0.06
CT	249 (49.2)	371 (47.3)	1.20 (0.96-1.49)	0.09		1.32 (1.04-1.68)	0.03
TT	180 (35.6)	301 (38.4)	ref			ref

TABLE 18
									p-value
							OR Lower	OR Upper	(two-
SNP	Gene	OUTCOME	ADJUST?	MODE	GENOTYPE	OR	90% CI	90% CI	sided)
hCV1116793	ZNF132	ISCHEMIC	NO	GEN	TC	0.83	0.69375216	0.992667515	0.0869
hCV1116793	ZNF132	ISCHEMIC	NO	ADD	T	0.84	0.724853655	0.974320962	0.053
hCV1116793	ZNF132	ISCHEMIC	NO	DOM	TC or TT	0.819	0.689223622	0.973935207	0.0578
hCV16093418	LOC646377	ISCHEMIC	NO	GEN	AA	1.483	0.912916828	2.408756165	0.1815
hCV16093418	LOC646377	ISCHEMIC	NO	ADD	A	1.16	0.992191149	1.356678591	0.118
hCV16093418	LOC646377	ISCHEMIC	NO	DOM	AG or AA	1.161	0.968083437	1.392968387	0.1766
hCV1754669	Chr 9	ISCHEMIC	NO	GEN	AG	0.849	0.694898144	1.0380978	0.1806
hCV1754669	Chr 9	ISCHEMIC	NO	GEN	AA	0.704	0.553438026	0.894406866	0.016
hCV1754669	Chr 9	ISCHEMIC	NO	ADD	A	0.839	0.744293003	0.946031417	0.0161
hCV1754669	Chr 9	ISCHEMIC	NO	DOM	AG or AA	0.802	0.663035663	0.970180153	0.0566
hCV1754669	Chr 9	ISCHEMIC	NO	REC	AA	0.785	0.643446754	0.957447873	0.0451
hCV25637605	FSTL4	ISCHEMIC	NO	DOM	AG or AA	1.141	0.96474641	1.349440416	0.1959
hCV26505812	Chr 9	ISCHEMIC	NO	GEN	GG	1.434	1.126756329	1.825140554	0.0139
hCV26505812	Chr 9	ISCHEMIC	NO	ADD	G	1.193	1.057688641	1.345699564	0.0159
hCV26505812	Chr 9	ISCHEMIC	NO	DOM	GA or GG	1.175	0.971230942	1.421611376	0.1636
hCV26505812	Chr 9	ISCHEMIC	NO	REC	GG	1.362	1.115126666	1.663679973	0.0111
hCV7425232	MYH15	ISCHEMIC	NO	GEN	CT	1.207	1.013056501	1.437676114	0.0772
hCV7425232	MYH15	ISCHEMIC	NO	ADD	C	1.138	1.002467038	1.290637136	0.0933
hCV7425232	MYH15	ISCHEMIC	NO	DOM	CT or CC	1.207	1.022059286	1.424442487	0.0628
hCV1116793	ZNF132	ISCHEMIC	YES	GEN	TC	0.703	0.562477582	0.877572242	0.0091
hCV1116793	ZNF132	ISCHEMIC	YES	ADD	T	0.75	0.624608329	0.899631989	0.0093
hCV1116793	ZNF132	ISCHEMIC	YES	DOM	TC or TT	0.701	0.565686919	0.867894166	0.0063
hCV16093418	LOC646377	ISCHEMIC	YES	GEN	AA	1.866	1.045328301	3.330322013	0.0766
hCV16093418	LOC646377	ISCHEMIC	YES	ADD	A	1.162	0.960599702	1.404663117	0.1948
hCV16093418	LOC646377	ISCHEMIC	YES	REC	AA	1.841	1.034539603	3.275411467	0.0815
hCV1754669	Chr 9	ISCHEMIC	YES	GEN	AA	0.76	0.568372651	1.01549685	0.1192
hCV1754669	Chr 9	ISCHEMIC	YES	ADD	A	0.87	0.752699651	1.006107576	0.1151
hCV1754669	Chr 9	ISCHEMIC	YES	DOM	AG or AA	0.805	0.638680148	1.014657888	0.1232
hCV2091644	VAMP8	ISCHEMIC	YES	GEN	CT	1.401	1.120353768	1.751995633	0.0131
hCV2091644	VAMP8	ISCHEMIC	YES	GEN	CC	1.38	1.009559907	1.885674346	0.0901
hCV2091644	VAMP8	ISCHEMIC	YES	ADD	C	1.221	1.052766014	1.416485778	0.0267
hCV2091644	VAMP8	ISCHEMIC	YES	DOM	CT or CC	1.396	1.129256555	1.725713348	0.0096
hCV26505812	Chr 9	ISCHEMIC	YES	GEN	GG	1.388	1.036839351	1.858599041	0.0645
hCV26505812	Chr 9	ISCHEMIC	YES	ADD	G	1.171	1.011727737	1.355459485	0.0756
hCV26505812	Chr 9	ISCHEMIC	YES	REC	GG	1.398	1.096801262	1.782473489	0.0232
hCV945276	KRT5	ISCHEMIC	YES	REC	TT	1.232	0.957897979	1.585681051	0.1725
hCV1116793	ZNF132	ATHERO	NO	GEN	TC	0.787	0.646590569	0.95833488	0.0454
hCV1116793	ZNF132	ATHERO	NO	ADD	T	0.819	0.696165402	0.962297139	0.0419
hCV1116793	ZNF132	ATHERO	NO	DOM	TC or TT	0.784	0.648664594	0.947280056	0.0344
hCV1754669	Chr 9	ATHERO	NO	GEN	AG	0.833	0.670269439	1.034455809	0.165
hCV1754669	Chr 9	ATHERO	NO	GEN	AA	0.676	0.520352663	0.878840811	0.014
hCV1754669	Chr 9	ATHERO	NO	ADD	A	0.823	0.72208458	0.937642062	0.0141
hCV1754669	Chr 9	ATHERO	NO	DOM	AG or AA	0.782	0.636551788	0.960683278	0.0493
hCV1754669	Chr 9	ATHERO	NO	REC	AA	0.764	0.614147286	0.950963593	0.043
hCV26505812	Chr 9	ATHERO	NO	GEN	GG	1.571	1.210420113	2.038944965	0.0044
hCV26505812	Chr 9	ATHERO	NO	ADD	G	1.251	1.097125415	1.426047313	0.005
hCV26505812	Chr 9	ATHERO	NO	DOM	GA or GG	1.218	0.987731875	1.501018684	0.1217
hCV26505812	Chr 9	ATHERO	NO	REC	GG	1.485	1.199236975	1.839906031	0.0024
hCV7425232	MYH15	ATHERO	NO	GEN	CT	1.291	1.06621554	1.562183465	0.028
hCV7425232	MYH15	ATHERO	NO	GEN	CC	1.36	0.995974126	1.856019239	0.1044
hCV7425232	MYH15	ATHERO	NO	ADD	C	1.209	1.05488262	1.385651602	0.0221
hCV7425232	MYH15	ATHERO	NO	DOM	CT or CC	1.304	1.087542975	1.562799868	0.0161
hCV945276	KRT5	ATHERO	NO	GEN	TT	1.226	0.944746161	1.589848931	0.1986
hCV1116793	ZNF132	ATHERO	YES	GEN	TC	0.639	0.501790288	0.814951237	0.0024
hCV1116793	ZNF132	ATHERO	YES	ADD	T	0.698	0.570892416	0.853128157	0.0032
hCV1116793	ZNF132	ATHERO	YES	DOM	TC or TT	0.64	0.507110931	0.808823546	0.0017
hCV16093418	LOC646377	ATHERO	YES	GEN	AA	1.762	0.928367604	3.34386559	0.1459
hCV16093418	LOC646377	ATHERO	YES	REC	AA	1.74	0.920040581	3.292138982	0.1527
hCV1754669	Chr 9	ATHERO	YES	GEN	AA	0.765	0.558483335	1.046582925	0.1596
hCV1754669	Chr 9	ATHERO	YES	ADD	A	0.874	0.746743893	1.022073084	0.1568
hCV2091644	VAMP8	ATHERO	YES	GEN	CT	1.322	1.038739023	1.682015035	0.0569
hCV2091644	VAMP8	ATHERO	YES	GEN	CC	1.366	0.976758835	1.910405456	0.126
hCV2091644	VAMP8	ATHERO	YES	ADD	C	1.2	1.023536718	1.407388698	0.0592
hCV2091644	VAMP8	ATHERO	YES	DOM	CT or CC	1.332	1.06021742	1.673849394	0.0388
hCV26505812	Chr 9	ATHERO	YES	GEN	GG	1.449	1.059805605	1.98082713	0.0512
hCV26505812	Chr 9	ATHERO	YES	ADD	G	1.201	1.025903307	1.405546929	0.056
hCV26505812	Chr 9	ATHERO	YES	REC	GG	1.431	1.106229626	1.851215592	0.022
hCV3054799	KIF6	ATHERO	YES	ADD	G	1.156	0.984174559	1.356831226	0.1385
hCV3054799	KIF6	ATHERO	YES	DOM	GA or GG	1.226	0.976764207	1.538041725	0.1403
hCV323071	PALLD	ATHERO	YES	GEN	GA	0.822	0.647104489	1.044405162	0.178
hCV7425232	MYH15	ATHERO	YES	GEN	CT	1.263	1.002774843	1.590469093	0.0961
hCV7425232	MYH15	ATHERO	YES	ADD	C	1.152	0.973983418	1.361464556	0.1655
hCV7425232	MYH15	ATHERO	YES	DOM	CT or CC	1.248	1.002130266	1.555305517	0.0966
hCV1116793	ZNF132	EARLY-ONSET	NO	GEN	TC	0.721	0.555259615	0.93717945	0.0401
hCV1116793	ZNF132	EARLY-ONSET	NO	ADD	T	0.742	0.596550429	0.9231085	0.0246
hCV1116793	ZNF132	EARLY-ONSET	NO	DOM	TC or TT	0.709	0.550475956	0.912444516	0.025
hCV16093418	LOC646377	EARLY-ONSET	NO	GEN	AA	2.279	1.165213696	4.458870577	0.0434
hCV16093418	LOC646377	EARLY-ONSET	NO	REC	AA	2.283	1.172006222	4.448126516	0.0417
hCV1754669	Chr 9	EARLY-ONSET	NO	GEN	AA	0.638	0.449570543	0.904532087	0.0342
hCV1754669	Chr 9	EARLY-ONSET	NO	ADD	A	0.805	0.677020314	0.957005634	0.0392
hCV1754669	Chr 9	EARLY-ONSET	NO	REC	AA	0.657	0.491043284	0.880225636	0.0181
hCV26505812	Chr 9	EARLY-ONSET	NO	GEN	GG	1.454	1.031679957	2.049942	0.0727
hCV26505812	Chr 9	EARLY-ONSET	NO	ADD	G	1.205	1.015074491	1.431092302	0.0737
hCV26505812	Chr 9	EARLY-ONSET	NO	DOM	GA or GG	1.257	0.954270123	1.654681429	0.1722
hCV26505812	Chr 9	EARLY-ONSET	NO	REC	GG	1.308	0.984656431	1.736831541	0.1199
hCV3054799	KIF6	EARLY-ONSET	NO	GEN	GA	1.256	0.968081501	1.629118384	0.1499
hCV3054799	KIF6	EARLY-ONSET	NO	DOM	GA or GG	1.215	0.949308931	1.553982515	0.1942
hCV7425232	MYH15	EARLY-ONSET	NO	GEN	CC	1.411	0.92477899	2.153297741	0.18
hCV7425232	MYH15	EARLY-ONSET	NO	ADD	C	1.188	0.989106766	1.42696955	0.1219
hCV7425232	MYH15	EARLY-ONSET	NO	DOM	CT or CC	1.227	0.964448349	1.560176569	0.1624
hCV1116793	ZNF132	EARLY-ONSET	YES	GEN	TC	0.569	0.383972632	0.843482605	0.0184
hCV1116793	ZNF132	EARLY-ONSET	YES	GEN	TT	0.257	0.07724157	0.857115583	0.0635
hCV1116793	ZNF132	EARLY-ONSET	YES	ADD	T	0.551	0.390357614	0.77793835	0.0045
hCV1116793	ZNF132	EARLY-ONSET	YES	DOM	TC or TT	0.536	0.36534707	0.78765705	0.0076
hCV1116793	ZNF132	EARLY-ONSET	YES	REC	TT	0.312	0.09554036	1.01979997	0.1057
hCV1754669	Chr 9	EARLY-ONSET	YES	GEN	AA	0.531	0.310682745	0.90627091	0.0515
hCV1754669	Chr 9	EARLY-ONSET	YES	ADD	A	0.754	0.582569376	0.975219212	0.071
hCV1754669	Chr 9	EARLY-ONSET	YES	REC	AA	0.471	0.300175493	0.740364979	0.0061
hCV26505812	Chr 9	EARLY-ONSET	YES	GEN	GA	1.613	1.036095685	2.50964297	0.0756
hCV26505812	Chr 9	EARLY-ONSET	YES	GEN	GG	1.607	0.955315621	2.704490393	0.1335
hCV26505812	Chr 9	EARLY-ONSET	YES	ADD	G	1.267	0.980473167	1.638072097	0.129
hCV26505812	Chr 9	EARLY-ONSET	YES	DOM	GA or GG	1.611	1.056911526	2.455300114	0.0627
hCV3054799	KIF6	EARLY-ONSET	YES	GEN	GA	1.469	0.997042382	2.16444072	0.1027
hCV3054799	KIF6	EARLY-ONSET	YES	DOM	GA or GG	1.423	0.980591812	2.063903309	0.1192
hCV323071	PALLD	EARLY-ONSET	YES	GEN	GA	0.722	0.490060464	1.064203359	0.1673
hCV323071	PALLD	EARLY-ONSET	YES	DOM	GA or GG	0.74	0.515454368	1.061949638	0.1704

TABLE 19A
				Ref				Case	Case	Control	Control						Control	Control
Study	Marker	Gene	rs	Allele	Allele	ALL cnt	ALL frq	cnt	frq	cnt	frq	Allele	ALL cnt	ALL frq	Case cnt	Case frq	cnt	frq
UCSFCCF	hCV1053082	NEU3	rs544115	C	T	884	0.2039	216	0.1898	668	0.2089	C	3452	0.796	922	0.8102	2530	0.7911
VSR	hCV1053082	NEU3	rs544115	C	T	500	0.1836	177	0.1615	323	0.1984	C	2224	0.816	919	0.8385	1305	0.8016
UCSFCCF	hCV1116757		rs3794971	T	C	844	0.1946	206	0.181	638	0.1994	T	3494	0.805	932	0.819	2562	0.8006
VSR	hCV1116757		rs3794971	T	C	454	0.1695	164	0.1513	290	0.1819	T	2224	0.831	920	0.8487	1304	0.8181
UCSFCCF	hCV11425801	PEX6	rs3805953	T	C	2068	0.4763	570	0.5009	1498	0.4675	T	2274	0.524	568	0.4991	1706	0.5325
VSR	hCV11425801	PEX6	rs3805953	T	C	1320	0.4857	554	0.5064	766	0.4717	T	1398	0.514	540	0.4936	858	0.5283
UCSFCCF	hCV11425842	GNMT	rs10948059	C	T	2048	0.4723	513	0.4516	1535	0.4797	C	2288	0.528	623	0.5484	1665	0.5203
VSR	hCV11425842	GNMT	rs10948059	C	T	1258	0.4618	485	0.4425	773	0.4748	C	1466	0.538	611	0.5575	855	0.5252
UCSFCCF	hCV11548152		rs11580249	G	T	707	0.1631	210	0.1845	497	0.1555	G	3627	0.837	928	0.8155	2699	0.8445
VSR	hCV11548152		rs11580249	G	T	413	0.1513	184	0.1673	229	0.1405	G	2317	0.849	916	0.8327	1401	0.8595
UCSFCCF	hCV11738775		rs6754561	T	C	1616	0.3725	394	0.3462	1222	0.3819	T	2722	0.628	744	0.6538	1978	0.6181
VSR	hCV11738775		rs6754561	T	C	1025	0.3766	387	0.3531	638	0.3924	T	1697	0.623	709	0.6469	988	0.6076
UCSFCCF	hCV11758801	GUCY1B2	rs11841997	C	G	131	0.0302	44	0.0387	87	0.0272	C	4207	0.97	1092	0.9613	3115	0.9728
VSR	hCV11758801	GUCY1B2	rs11841997	C	G	87	0.0319	44	0.04	43	0.0264	C	2643	0.968	1056	0.96	1587	0.9736
UCSFCCF	hCV11861255	GRIK3	rs529407	A	G	1038	0.2392	260	0.2285	778	0.243	A	3302	0.761	878	0.7715	2424	0.757
VSR	hCV11861255	GRIK3	rs529407	A	G	674	0.2506	245	0.226	429	0.2671	A	2016	0.749	839	0.774	1177	0.7329
UCSFCCF	hCV12071939		rs1950943	G	T	929	0.2142	221	0.1942	708	0.2212	G	3409	0.786	917	0.8058	2492	0.7788
VSR	hCV12071939		rs1950943	G	T	532	0.1952	193	0.1755	339	0.2085	G	2194	0.805	907	0.8245	1287	0.7915
UCSFCCF	hCV1209800	CLIC5	rs35067690	G	T	207	0.0477	38	0.0335	169	0.0527	G	4133	0.952	1098	0.9665	3035	0.9473
VSR	hCV1209800	CLIC5	rs35067690	G	T	111	0.0406	34	0.0309	77	0.0472	G	2621	0.959	1068	0.9691	1553	0.9528
UCSFCCF	hCV1262973	PLEKHG3	rs229653	G	A	382	0.088	114	0.1002	268	0.0837	G	3958	0.912	1024	0.8998	2934	0.9163
VSR	hCV1262973	PLEKHG3	rs229653	G	A	277	0.1024	127	0.118	150	0.0921	G	2427	0.898	949	0.882	1478	0.9079
UCSFCCF	hCV1348610	C9orf46	rs3739636	G	A	2013	0.4645	559	0.4921	1454	0.4547	G	2321	0.536	577	0.5079	1744	0.5453
VSR	hCV1348610	C9orf46	rs3739636	G	A	1223	0.4567	512	0.4794	711	0.4416	G	1455	0.543	556	0.5206	899	0.5584
UCSFCCF	hCV1408483	BCL2	rs17070848	C	T	719	0.1657	209	0.1837	510	0.1594	C	3619	0.834	929	0.8163	2690	0.8406
VSR	hCV1408483	BCL2	rs17070848	C	T	526	0.1931	232	0.2117	294	0.1806	C	2198	0.807	864	0.7883	1334	0.8194
UCSFCCF	hCV1452085	TRIM22	rs12223005	C	A	468	0.1078	111	0.0975	357	0.1115	C	3872	0.892	1027	0.9025	2845	0.8885
VSR	hCV1452085	TRIM22	rs12223005	C	A	279	0.1021	98	0.0889	181	0.111	C	2453	0.898	1004	0.9111	1449	0.889
UCSFCCF	hCV15851766	APC	rs2229995	G	A	87	0.0201	14	0.0123	73	0.0228	G	4245	0.98	1122	0.9877	3123	0.9772
VSR	hCV15851766	APC	rs2229995	G	A	59	0.022	15	0.0139	44	0.0274	G	2621	0.978	1061	0.9861	1560	0.9726
UCSFCCF	hCV15857769		rs2924914	C	T	1314	0.3029	368	0.3234	946	0.2956	C	3024	0.697	770	0.6766	2254	0.7044
VSR	hCV15857769		rs2924914	C	T	786	0.2883	331	0.3015	455	0.2795	C	1940	0.712	767	0.6985	1173	0.7205
UCSFCCF	hCV15879601	C6orf142	rs2275769	C	T	333	0.0767	70	0.0615	263	0.0821	C	4009	0.923	1068	0.9385	2941	0.9179
VSR	hCV15879601	C6orf142	rs2275769	C	T	171	0.0628	59	0.0537	112	0.0689	C	2553	0.937	1039	0.9463	1514	0.9311
UCSFCCF	hCV16134786		rs2857595	G	A	774	0.1785	226	0.1989	548	0.1712	G	3562	0.822	910	0.8011	2652	0.8288
VSR	hCV16134786		rs2857595	G	A	510	0.1868	227	0.2064	283	0.1736	G	2220	0.813	873	0.7936	1347	0.8264
UCSFCCF	hCV1619596	FKBP1A	rs1048621	G	A	1198	0.2764	337	0.2961	861	0.2694	G	3136	0.724	801	0.7039	2335	0.7306
VSR	hCV1619596	FKBP1A	rs1048621	G	A	675	0.2474	297	0.27	378	0.2322	G	2053	0.753	803	0.73	1250	0.7678
UCSFCCF	hCV16336	HD	rs362277	C	T	469	0.108	107	0.094	362	0.113	C	3873	0.892	1031	0.906	2842	0.887
VSR	hCV16336	HD	rs362277	C	T	294	0.1079	97	0.0885	197	0.121	C	2430	0.892	999	0.9115	1431	0.879
UCSFCCF	hCV1723718	UMODL1	rs12481805	G	A	1336	0.3081	377	0.3313	959	0.2999	G	3000	0.692	761	0.6687	2239	0.7001
VSR	hCV1723718	UMODL1	rs12481805	G	A	779	0.2858	336	0.306	443	0.2721	G	1947	0.714	762	0.694	1185	0.7279
UCSFCCF	hCV1958451	MIER1	rs2985822	G	T	1073	0.2475	256	0.225	817	0.2555	G	3263	0.753	882	0.775	2381	0.7445
VSR	hCV1958451	MIER1	rs2985822	G	T	676	0.2487	248	0.2271	428	0.2632	G	2042	0.751	844	0.7729	1198	0.7368
UCSFCCF	hCV2121658		rs1187332	G	A	534	0.1232	120	0.1058	414	0.1294	G	3800	0.877	1014	0.8942	2786	0.8706
VSR	hCV2121658		rs1187332	G	A	331	0.1226	119	0.1104	212	0.1307	G	2369	0.877	959	0.8896	1410	0.8693
UCSFCCF	hCV2358247	SPINT4	rs415989	A	G	290	0.0669	88	0.0775	202	0.0631	A	4046	0.933	1048	0.9225	2998	0.9369
VSR	hCV2358247	SPINT4	rs415989	A	G	150	0.0549	77	0.0699	73	0.0448	A	2582	0.945	1025	0.9301	1557	0.9552
UCSFCCF	hCV2390937	LOC441108	rs739719	C	A	318	0.0733	70	0.0615	248	0.0775	C	4022	0.927	1068	0.9385	2954	0.9225
VSR	hCV2390937	LOC441108	rs739719	C	A	185	0.0678	60	0.0545	125	0.0767	C	2545	0.932	1040	0.9455	1505	0.9233
UCSFCCF	hCV25473186	NPY2R	rs2880415	T	C	2044	0.4708	566	0.4974	1478	0.4613	T	2298	0.529	572	0.5026	1726	0.5387
VSR	hCV25473186	NPY2R	rs2880415	T	C	1181	0.4336	509	0.4653	672	0.4123	T	1543	0.566	585	0.5347	958	0.5877
UCSFCCF	hCV25596936	EPHA1	rs6967117	C	T	308	0.0709	92	0.0808	216	0.0674	C	4034	0.929	1046	0.9192	2988	0.9326
VSR	hCV25596936	EPHA1	rs6967117	C	T	241	0.0884	118	0.1073	123	0.0756	C	2485	0.912	982	0.8927	1503	0.9244
UCSFCCF	hCV25615822	DHODH	NONE	C	T	114	0.0263	35	0.0308	79	0.0247	C	4224	0.974	1101	0.9692	3123	0.9753
VSR	hCV25615822	DHODH	NONE	C	T	113	0.0414	56	0.0508	57	0.035	C	2617	0.959	1046	0.9492	1571	0.965
UCSFCCF	hCV25983294	EDG2	rs3739709	G	A	821	0.1892	190	0.1673	631	0.1969	G	3519	0.811	946	0.8327	2573	0.8031
VSR	hCV25983294	EDG2	rs3739709	G	A	541	0.1988	197	0.1794	344	0.2118	G	2181	0.801	901	0.8206	1280	0.7882
UCSFCCF	hCV2637554	CHPT1	rs3205421	T	C	1293	0.2985	368	0.3245	925	0.2892	T	3039	0.702	766	0.6755	2273	0.7108
VSR	hCV2637554	CHPT1	rs3205421	T	C	842	0.3109	363	0.3336	479	0.2957	T	1866	0.689	725	0.6664	1141	0.7043
UCSFCCF	hCV26478797	CHSY-2	rs2015018	G	A	1100	0.2537	266	0.2337	834	0.2608	G	3236	0.746	872	0.7663	2364	0.7392
VSR	hCV26478797	CHSY-2	rs2015018	G	A	721	0.2653	270	0.2473	451	0.2774	G	1997	0.735	822	0.7527	1175	0.7226
UCSFCCF	hCV26881276	C11orf47	rs2344829	A	G	1429	0.3297	392	0.3451	1037	0.3243	A	2905	0.67	744	0.6549	2161	0.6757
VSR	hCV26881276	C11orf47	rs2344829	A	G	963	0.3527	418	0.38	545	0.3344	A	1767	0.647	682	0.62	1085	0.6656
UCSFCCF	hCV27077072		rs8060368	C	T	1429	0.3293	353	0.3102	1076	0.336	C	2911	0.671	785	0.6898	2126	0.664
VSR	hCV27077072		rs8060368	C	T	911	0.3339	346	0.3145	565	0.3471	C	1817	0.666	754	0.6855	1063	0.6529
UCSFCCF	hCV27473671	C9orf4	rs3750465	T	C	1270	0.2925	357	0.3137	913	0.285	T	3072	0.708	781	0.6863	2291	0.715
VSR	hCV27473671	C9orf4	rs3750465	T	C	738	0.2709	324	0.2945	414	0.2549	T	1986	0.729	776	0.7055	1210	0.7451
UCSFCCF	hCV27494483	SLC22A15	rs3748743	C	T	226	0.0521	72	0.0633	154	0.0481	C	4114	0.948	1066	0.9367	3048	0.9519
VSR	hCV27494483	SLC22A15	rs3748743	C	T	127	0.0466	63	0.0573	64	0.0394	C	2599	0.953	1037	0.9427	1562	0.9606
UCSFCCF	hCV27504565	MUTYH	rs3219489	C	G	1135	0.2618	277	0.2434	858	0.2683	C	3201	0.738	861	0.7566	2340	0.7317
VSR	hCV27504565	MUTYH	rs3219489	C	G	594	0.2174	213	0.1933	381	0.2337	C	2138	0.783	889	0.8067	1249	0.7663
UCSFCCF	hCV27511436	FZD1	rs3750145	T	C	687	0.1592	157	0.1389	530	0.1665	T	3627	0.841	973	0.8611	2654	0.8335
VSR	hCV27511436	FZD1	rs3750145	T	C	474	0.1736	173	0.1573	301	0.1847	T	2256	0.826	927	0.8427	1329	0.8153
UCSFCCF	hCV2769503		rs4787956	A	G	1495	0.3445	426	0.3743	1069	0.3339	A	2845	0.656	712	0.6257	2133	0.6661
VSR	hCV2769503		rs4787956	A	G	891	0.3317	393	0.3666	498	0.3086	A	1795	0.668	679	0.6334	1116	0.6914
UCSFCCF	hCV27892569	NRXN3	rs4903741	T	C	1022	0.2364	289	0.2544	733	0.2299	T	3302	0.764	847	0.7456	2455	0.7701
VSR	hCV27892569	NRXN3	rs4903741	T	C	626	0.23	268	0.2432	358	0.221	T	2096	0.77	834	0.7568	1262	0.779
UCSFCCF	hCV28036404	RBL1	rs4812768	T	A	875	0.2017	216	0.1905	659	0.2057	T	3463	0.798	918	0.8095	2545	0.7943
VSR	hCV28036404	RBL1	rs4812768	T	A	511	0.1879	182	0.1667	329	0.2021	T	2209	0.812	910	0.8333	1299	0.7979
UCSFCCF	hCV2851380		rs12445805	G	C	450	0.1037	99	0.0871	351	0.1096	G	3890	0.896	1037	0.9129	2853	0.8904
VSR	hCV2851380		rs12445805	G	C	320	0.1173	113	0.1027	207	0.1271	G	2408	0.883	987	0.8973	1421	0.8729
UCSFCCF	hCV29401764	LOC646588	rs7793552	C	T	1402	0.3233	347	0.3049	1055	0.3299	C	2934	0.677	791	0.6951	2143	0.6701
VSR	hCV29401764	LOC646588	rs7793552	C	T	913	0.3357	337	0.3086	576	0.3538	C	1807	0.664	755	0.6914	1052	0.6462
UCSFCCF	hCV29537898		rs6073804	C	T	393	0.0907	120	0.1056	273	0.0854	C	3941	0.909	1016	0.8944	2925	0.9146
VSR	hCV29537898		rs6073804	C	T	216	0.0796	100	0.0921	116	0.0713	C	2496	0.92	986	0.9079	1510	0.9287
UCSFCCF	hCV29539757	KCNQ3	rs10110659	C	A	1311	0.3022	312	0.2746	999	0.312	C	3027	0.698	824	0.7254	2203	0.688
VSR	hCV29539757	KCNQ3	rs10110659	C	A	870	0.3191	318	0.2896	552	0.3391	C	1856	0.681	780	0.7104	1076	0.6609
UCSFCCF	hCV302629	UBAC2	rs9284183	A	G	1247	0.2876	359	0.316	888	0.2775	A	3089	0.712	777	0.684	2312	0.7225
VSR	hCV302629	UBAC2	rs9284183	A	G	763	0.2815	319	0.2932	444	0.2737	A	1947	0.719	769	0.7068	1178	0.7263
UCSFCCF	hCV30308202	LAMA2	rs9482985	G	C	917	0.2115	219	0.1924	698	0.2183	G	3419	0.789	919	0.8076	2500	0.7817
VSR	hCV30308202	LAMA2	rs9482985	G	C	549	0.2017	200	0.1828	349	0.2144	G	2173	0.798	894	0.8172	1279	0.7856
UCSFCCF	hCV3054550	AIG1	rs1559599	C	T	641	0.1476	189	0.1661	452	0.1411	C	3701	0.852	949	0.8339	2752	0.8589
VSR	hCV3054550	AIG1	rs1559599	C	T	434	0.1589	189	0.1715	245	0.1503	C	2298	0.841	913	0.8285	1385	0.8497
UCSFCCF	hCV3082219	RFXDC1	rs1884833	G	A	505	0.1164	148	0.1301	357	0.1115	G	3835	0.884	990	0.8699	2845	0.8885
VSR	hCV3082219	RFXDC1	rs1884833	G	A	344	0.127	159	0.147	185	0.1138	G	2364	0.873	923	0.853	1441	0.8862
UCSFCCF	hCV31137507	CLOCK	rs7660668	G	C	1165	0.2683	328	0.2882	837	0.2612	G	3177	0.732	810	0.7118	2367	0.7388
VSR	hCV31137507	CLOCK	rs7660668	G	C	741	0.272	317	0.2892	424	0.2604	G	1983	0.728	779	0.7108	1204	0.7396
UCSFCCF	hCV31227848	HIVEP3	rs11809423	C	T	172	0.0396	61	0.0536	111	0.0347	C	4168	0.96	1077	0.9464	3091	0.9653
VSR	hCV31227848	HIVEP3	rs11809423	C	T	120	0.044	64	0.0583	56	0.0344	C	2608	0.956	1034	0.9417	1574	0.9656
UCSFCCF	hCV31573621	SKAP1	rs11079818	T	C	1223	0.2817	295	0.2592	928	0.2896	T	3119	0.718	843	0.7408	2276	0.7104
VSR	hCV31573621	SKAP1	rs11079818	T	C	739	0.2751	276	0.2575	463	0.2869	T	1947	0.725	796	0.7425	1151	0.7131
UCSFCCF	hCV31705214	LOC645397	rs12804599	A	T	984	0.2266	283	0.2487	701	0.2188	A	3358	0.773	855	0.7513	2503	0.7812
VSR	hCV31705214	LOC645397	rs12804599	A	T	596	0.2183	266	0.2418	330	0.2025	A	2134	0.782	834	0.7582	1300	0.7975
UCSFCCF	hCV32160712		rs11079160	A	T	743	0.1713	221	0.1942	522	0.1631	A	3595	0.829	917	0.8058	2678	0.8369
VSR	hCV32160712		rs11079160	A	T	432	0.1595	191	0.1752	241	0.1489	A	2276	0.841	899	0.8248	1377	0.8511
UCSFCCF	hCV435733		rs10276935	C	G	1346	0.3103	383	0.3366	963	0.3009	C	2992	0.69	755	0.6634	2237	0.6991
VSR	hCV435733		rs10276935	C	G	819	0.3004	345	0.3142	474	0.2912	C	1907	0.7	753	0.6858	1154	0.7088
UCSFCCF	hCV454333	NVL	rs10916581	C	T	590	0.136	139	0.1224	451	0.1408	C	3748	0.864	997	0.8776	2751	0.8592
VSR	hCV454333	NVL	rs10916581	C	T	324	0.1194	110	0.0998	214	0.1328	C	2390	0.881	992	0.9002	1398	0.8672
UCSFCCF	hCV540056	SPHK1	rs346802	C	T	163	0.0376	32	0.0281	131	0.0409	C	4177	0.962	1106	0.9719	3071	0.9591
VSR	hCV540056	SPHK1	rs346802	C	T	90	0.033	26	0.0237	64	0.0394	C	2634	0.967	1072	0.9763	1562	0.9606
UCSFCCF	hCV7917138	OR5H8P	rs9822460	A	G	860	0.1984	255	0.2241	605	0.1893	A	3474	0.802	883	0.7759	2591	0.8107
VSR	hCV7917138	OR5H8P	rs9822460	A	G	538	0.1981	231	0.2115	307	0.189	A	2178	0.802	861	0.7885	1317	0.811
UCSFCCF	hCV8147903	FLJ25715	rs680014	G	A	971	0.2237	225	0.1977	746	0.233	G	3369	0.776	913	0.8023	2456	0.767
VSR	hCV8147903	FLJ25715	rs680014	G	A	577	0.2124	214	0.1963	363	0.2232	G	2139	0.788	876	0.8037	1263	0.7768
UCSFCCF	hCV8754449	TESK2	rs781226	C	T	1126	0.2596	277	0.2434	849	0.2653	C	3212	0.74	861	0.7566	2351	0.7347
VSR	hCV8754449	TESK2	rs781226	C	T	606	0.2226	218	0.1989	388	0.2386	C	2116	0.777	878	0.8011	1238	0.7614
UCSFCCF	hCV8820007		rs938390	T	A	1055	0.2432	265	0.2333	790	0.2467	T	3283	0.757	871	0.7667	2412	0.7533
VSR	hCV8820007		rs938390	T	A	651	0.2399	234	0.2135	417	0.2577	T	2063	0.76	862	0.7865	1201	0.7423
UCSFCCF	hCV8942032	DDR1	rs1264352	G	C	610	0.1406	179	0.1573	431	0.1347	G	3728	0.859	959	0.8427	2769	0.8653
VSR	hCV8942032	DDR1	rs1264352	G	C	366	0.1343	165	0.1505	201	0.1233	G	2360	0.866	931	0.8495	1429	0.8767

TABLE 19B
				ALL		Case	Case	Control	Control		ALL		Case	Case
Study	Marker	rs	Genot	cnt	ALL frq	cnt	frq	cnt	frq	Genot	cnt	ALL frq	cnt	frq
UCSFCCF	hCV1053082	rs544115	T T	98	0.0452	17	0.0299	81	0.0507	T C	688	0.3173	182	0.3199
VSR	hCV1053082	rs544115	T T	52	0.0382	16	0.0292	36	0.0442	T C	396	0.2907	145	0.2646
UCSFCCF	hCV1116757	rs3794971	C C	85	0.0392	24	0.0422	61	0.0381	C T	674	0.3107	158	0.2777
VSR	hCV1116757	rs3794971	C C	41	0.0306	13	0.024	28	0.0351	C T	372	0.2778	138	0.2546
UCSFCCF	hCV11425801	rs3805953	C C	499	0.2298	143	0.2513	356	0.2222	C T	1070	0.4929	284	0.4991
VSR	hCV11425801	rs3805953	C C	319	0.2347	140	0.2559	179	0.2204	C T	682	0.5018	274	0.5009
UCSFCCF	hCV11425842	rs10948059	T T	486	0.2242	111	0.1954	375	0.2344	T C	1076	0.4963	291	0.5123
VSR	hCV11425842	rs10948059	T T	283	0.2078	104	0.1898	179	0.2199	T C	692	0.5081	277	0.5055
UCSFCCF	hCV11548152	rs11580249	T T	52	0.024	15	0.0264	37	0.0232	T G	603	0.2783	180	0.3163
VSR	hCV11548152	rs11580249	T T	34	0.0249	17	0.0309	17	0.0209	T G	345	0.2527	150	0.2727
UCSFCCF	hCV11738775	rs6754561	C C	279	0.1286	57	0.1002	222	0.1388	C T	1058	0.4878	280	0.4921
VSR	hCV11738775	rs6754561	C C	201	0.1477	65	0.1186	136	0.1673	C T	623	0.4578	257	0.469
UCSFCCF	hCV11758801	rs11841997	G G	4	0.0018	2	0.0035	2	0.0012	G C	123	0.0567	40	0.0704
VSR	hCV11758801	rs11841997	G G	2	0.0015	2	0.0036	0	0	G C	83	0.0608	40	0.0727
UCSFCCF	hCV11861255	rs529407	G G	144	0.0664	27	0.0475	117	0.0731	G A	750	0.3456	206	0.362
VSR	hCV11861255	rs529407	G G	95	0.0706	30	0.0554	65	0.0809	G A	484	0.3599	185	0.3413
UCSFCCF	hCV12071939	rs1950943	T T	94	0.0433	15	0.0264	79	0.0494	T G	741	0.3416	191	0.3357
VSR	hCV12071939	rs1950943	T T	61	0.0448	25	0.0455	36	0.0443	T G	410	0.3008	143	0.26
UCSFCCF	hCV1209800	rs35067690	T T	4	0.0018	0	0	4	0.0025	T G	199	0.0917	38	0.0669
VSR	hCV1209800	rs35067690	T T	4	0.0029	0	0	4	0.0049	T G	103	0.0754	34	0.0617
UCSFCCF	hCV1262973	rs229653	A A	29	0.0134	11	0.0193	18	0.0112	A G	324	0.1493	92	0.1617
VSR	hCV1262973	rs229653	A A	16	0.0118	5	0.0093	11	0.0135	A G	245	0.1812	117	0.2175
UCSFCCF	hCV1348610	rs3739636	A A	474	0.2187	135	0.2377	339	0.212	A G	1065	0.4915	289	0.5088
VSR	hCV1348610	rs3739636	A A	301	0.2248	137	0.2566	164	0.2037	A G	621	0.4638	238	0.4457
UCSFCCF	hCV1408483	rs17070848	T T	56	0.0258	14	0.0246	42	0.0262	T C	607	0.2799	181	0.3181
VSR	hCV1408483	rs17070848	T T	50	0.0367	22	0.0401	28	0.0344	T C	426	0.3128	188	0.3431
UCSFCCF	hCV1452085	rs12223005	A A	28	0.0129	3	0.0053	25	0.0156	A C	412	0.1899	105	0.1845
VSR	hCV1452085	rs12223005	A A	17	0.0124	7	0.0127	10	0.0123	A C	245	0.1794	84	0.1525
UCSFCCF	hCV15851766	rs2229995	A A	0	0	0	0	0	0	A G	87	0.0402	14	0.0246
VSR	hCV15851766	rs2229995	A A	0	0	0	0	0	0	A G	59	0.044	15	0.0279
UCSFCCF	hCV15857769	rs2924914	T T	212	0.0977	65	0.1142	147	0.0919	T C	890	0.4103	238	0.4183
VSR	hCV15857769	rs2924914	T T	106	0.0778	53	0.0965	53	0.0651	T C	574	0.4211	225	0.4098
UCSFCCF	hCV15879601	rs2275769	T T	13	0.006	2	0.0035	11	0.0069	T C	307	0.1414	66	0.116
VSR	hCV15879601	rs2275769	T T	8	0.0059	0	0	8	0.0098	T C	155	0.1138	59	0.1075
UCSFCCF	hCV16134786	rs2857595	A A	72	0.0332	22	0.0387	50	0.0312	A G	630	0.2906	182	0.3204
VSR	hCV16134786	rs2857595	A A	53	0.0388	22	0.04	31	0.038	A G	404	0.296	183	0.3327
UCSFCCF	hCV1619596	rs1048621	A A	186	0.0858	54	0.0949	132	0.0826	A G	826	0.3812	229	0.4025
VSR	hCV1619596	rs1048621	A A	83	0.0609	37	0.0673	46	0.0565	A G	509	0.3732	223	0.4055
UCSFCCF	hCV16336	rs362277	T T	31	0.0143	7	0.0123	24	0.015	T C	407	0.1875	93	0.1634
VSR	hCV16336	rs362277	T T	15	0.011	2	0.0036	13	0.016	T C	264	0.1938	93	0.1697
UCSFCCF	hCV1723718	rs12481805	A A	199	0.0918	61	0.1072	138	0.0863	A G	938	0.4327	255	0.4482
VSR	hCV1723718	rs12481805	A A	123	0.0902	53	0.0965	70	0.086	A G	533	0.391	230	0.4189
UCSFCCF	hCV1958451	rs2985822	T T	135	0.0623	30	0.0527	105	0.0657	T G	803	0.3704	196	0.3445
VSR	hCV1958451	rs2985822	T T	90	0.0662	27	0.0495	63	0.0775	T G	496	0.365	194	0.3553
UCSFCCF	hCV2121658	rs1187332	A A	23	0.0106	6	0.0106	17	0.0106	A G	488	0.2252	108	0.1905
VSR	hCV2121658	rs1187332	A A	18	0.0133	3	0.0056	15	0.0185	A G	295	0.2185	113	0.2096
UCSFCCF	hCV2358247	rs415989	G G	14	0.0065	2	0.0035	12	0.0075	G A	262	0.1208	84	0.1479
VSR	hCV2358247	rs415989	G G	5	0.0037	5	0.0091	0	0	G A	140	0.1025	67	0.1216
UCSFCCF	hCV2390937	rs739719	A A	12	0.0055	2	0.0035	10	0.0062	A C	294	0.1355	66	0.116
VSR	hCV2390937	rs739719	A A	3	0.0022	1	0.0018	2	0.0025	A C	179	0.1311	58	0.1055
UCSFCCF	hCV25473186	rs2880415	C C	488	0.2248	135	0.2373	353	0.2203	C T	1068	0.4919	296	0.5202
VSR	hCV25473186	rs2880415	C C	246	0.1806	109	0.1993	137	0.1681	C T	689	0.5059	291	0.532
UCSFCCF	hCV25596936	rs6967117	T T	13	0.006	2	0.0035	11	0.0069	T C	282	0.1299	88	0.1547
VSR	hCV25596936	rs6967117	T T	15	0.011	7	0.0127	8	0.0098	T C	211	0.1548	104	0.1891
UCSFCCF	hCV25615822	NONE	T T	1	0.0005	1	0.0018	0	0	T C	112	0.0516	33	0.0581
VSR	hCV25615822	NONE	T T	2	0.0015	1	0.0018	1	0.0012	T C	109	0.0799	54	0.098
UCSFCCF	hCV25983294	rs3739709	A A	75	0.0346	19	0.0335	56	0.035	A G	671	0.3092	152	0.2676
VSR	hCV25983294	rs3739709	A A	64	0.047	23	0.0419	41	0.0505	A G	413	0.3035	151	0.275
UCSFCCF	hCV2637554	rs3205421	C C	190	0.0877	64	0.1129	126	0.0788	C T	913	0.4215	240	0.4233
VSR	hCV2637554	rs3205421	C C	139	0.1027	63	0.1158	76	0.0938	C T	564	0.4165	237	0.4357
UCSFCCF	hCV26478797	rs2015018	A A	122	0.0563	31	0.0545	91	0.0569	A G	856	0.3948	204	0.3585
VSR	hCV26478797	rs2015018	A A	95	0.0699	28	0.0513	67	0.0824	A G	531	0.3907	214	0.3919
UCSFCCF	hCV26881276	rs2344829	G G	250	0.1154	66	0.1162	184	0.1151	G A	929	0.4287	260	0.4577
VSR	hCV26881276	rs2344829	G G	183	0.1341	86	0.1564	97	0.119	G A	597	0.4374	246	0.4473
UCSFCCF	hCV27077072	rs8060368	T T	237	0.1092	60	0.1054	177	0.1106	T C	955	0.4401	233	0.4095
VSR	hCV27077072	rs8060368	T T	152	0.1114	54	0.0982	98	0.1204	T C	607	0.445	238	0.4327
UCSFCCF	hCV27473671	rs3750465	C C	183	0.0843	54	0.0949	129	0.0805	C T	904	0.4164	249	0.4376
VSR	hCV27473671	rs3750465	C C	103	0.0756	51	0.0927	52	0.064	C T	532	0.3906	222	0.4036
UCSFCCF	hCV27494483	rs3748743	T T	12	0.0055	4	0.007	8	0.005	T C	202	0.0931	64	0.1125
VSR	hCV27494483	rs3748743	T T	3	0.0022	2	0.0036	1	0.0012	T C	121	0.0888	59	0.1073
UCSFCCF	hCV27504565	rs3219489	G G	138	0.0637	39	0.0685	99	0.0619	G C	859	0.3962	199	0.3497
VSR	hCV27504565	rs3219489	G G	67	0.049	13	0.0236	54	0.0663	G C	460	0.3367	187	0.3394
UCSFCCF	hCV27511436	rs3750145	C C	55	0.0255	5	0.0088	50	0.0314	C T	577	0.2675	147	0.2602
VSR	hCV27511436	rs3750145	C C	47	0.0344	16	0.0291	31	0.038	C T	380	0.2784	141	0.2564
UCSFCCF	hCV2769503	rs4787956	G G	253	0.1166	74	0.1301	179	0.1118	G A	989	0.4558	278	0.4886
VSR	hCV2769503	rs4787956	G G	146	0.1087	65	0.1213	81	0.1004	G A	599	0.446	263	0.4907
UCSFCCF	hCV27892569	rs4903741	C C	113	0.0523	35	0.0616	78	0.0489	C T	796	0.3682	219	0.3856
VSR	hCV27892569	rs4903741	C C	88	0.0647	34	0.0617	54	0.0667	C T	450	0.3306	200	0.363
UCSFCCF	hCV28036404	rs4812768	A A	99	0.0456	17	0.03	82	0.0512	A T	677	0.3121	182	0.321
VSR	hCV28036404	rs4812768	A A	39	0.0287	13	0.0238	26	0.0319	A T	433	0.3184	156	0.2857
UCSFCCF	hCV2851380	rs12445805	C C	32	0.0147	4	0.007	28	0.0175	C G	386	0.1779	91	0.1602
VSR	hCV2851380	rs12445805	C C	21	0.0154	7	0.0127	14	0.0172	C G	278	0.2038	99	0.18
UCSFCCF	hCV29401764	rs7793552	T T	223	0.1029	62	0.109	161	0.1007	T C	956	0.441	223	0.3919
VSR	hCV29401764	rs7793552	T T	159	0.1169	58	0.1062	101	0.1241	T C	595	0.4375	221	0.4048
UCSFCCF	hCV29537898	rs6073804	T T	23	0.0106	10	0.0176	13	0.0081	T C	347	0.1601	100	0.1761
VSR	hCV29537898	rs6073804	T T	6	0.0044	5	0.0092	1	0.0012	T C	204	0.1504	90	0.1657
UCSFCCF	hCV29539757	rs10110659	A A	192	0.0885	49	0.0863	143	0.0893	A C	927	0.4274	214	0.3768
VSR	hCV29539757	rs10110659	A A	136	0.0998	46	0.0838	90	0.1106	A C	598	0.4387	226	0.4117
UCSFCCF	hCV302629	rs9284183	G G	185	0.0853	68	0.1197	117	0.0731	G A	877	0.4045	223	0.3926
VSR	hCV302629	rs9284183	G G	111	0.0819	55	0.1011	56	0.0691	G A	541	0.3993	209	0.3842
UCSFCCF	hCV30308202	rs9482985	C C	101	0.0466	17	0.0299	84	0.0525	C G	715	0.3298	185	0.3251
VSR	hCV30308202	rs9482985	C C	66	0.0485	25	0.0457	41	0.0504	C G	417	0.3064	150	0.2742
UCSFCCF	hCV3054550	rs1559599	T T	50	0.023	17	0.0299	33	0.0206	T C	541	0.2492	155	0.2724
VSR	hCV3054550	rs1559599	T T	36	0.0264	14	0.0254	22	0.027	T C	362	0.265	161	0.2922
UCSFCCF	hCV3082219	rs1884833	A A	27	0.0124	7	0.0123	20	0.0125	A G	451	0.2078	134	0.2355
VSR	hCV3082219	rs1884833	A A	21	0.0155	11	0.0203	10	0.0123	A G	302	0.223	137	0.2532
UCSFCCF	hCV31137507	rs7660668	C C	162	0.0746	47	0.0826	115	0.0718	C G	841	0.3874	234	0.4112
VSR	hCV31137507	rs7660668	C C	101	0.0742	46	0.0839	55	0.0676	C G	539	0.3957	225	0.4106
UCSFCCF	hCV31227848	rs11809423	T T	4	0.0018	1	0.0018	3	0.0019	T C	164	0.0756	59	0.1037
VSR	hCV31227848	rs11809423	T T	2	0.0015	1	0.0018	1	0.0012	T C	116	0.085	62	0.1129
UCSFCCF	hCV31573621	rs11079818	C C	164	0.0755	36	0.0633	128	0.0799	C T	895	0.4123	223	0.3919
VSR	hCV31573621	rs11079818	C C	100	0.0745	30	0.056	70	0.0867	C T	539	0.4013	216	0.403
UCSFCCF	hCV31705214	rs12804599	T T	116	0.0534	41	0.0721	75	0.0468	T A	752	0.3464	201	0.3533
VSR	hCV31705214	rs12804599	T T	71	0.052	31	0.0564	40	0.0491	T A	454	0.3326	204	0.3709
UCSFCCF	hCV32160712	rs11079160	T T	57	0.0263	17	0.0299	40	0.025	T A	629	0.29	187	0.3286
VSR	hCV32160712	rs11079160	T T	37	0.0273	20	0.0367	17	0.021	T A	358	0.2644	151	0.2771
UCSFCCF	hCV435733	rs10276935	G G	226	0.1042	65	0.1142	161	0.1006	G C	894	0.4122	253	0.4446
VSR	hCV435733	rs10276935	G G	132	0.0968	46	0.0838	86	0.1057	G C	555	0.4072	253	0.4608
UCSFCCF	hCV454333	rs10916581	T T	42	0.0194	6	0.0106	36	0.0225	T C	506	0.2333	127	0.2236
VSR	hCV454333	rs10916581	T T	25	0.0184	5	0.0091	20	0.0248	T C	274	0.2019	100	0.1815
UCSFCCF	hCV540056	rs346802	T T	2	0.0009	1	0.0018	1	0.0006	T C	159	0.0733	30	0.0527
VSR	hCV540056	rs346802	T T	0	0	0	0	0	0	T C	90	0.0661	26	0.0474
UCSFCCF	hCV7917138	rs9822460	G G	94	0.0434	29	0.051	65	0.0407	G A	672	0.3101	197	0.3462
VSR	hCV7917138	rs9822460	G G	53	0.039	29	0.0531	24	0.0296	G A	432	0.3181	173	0.3168
UCSFCCF	hCV8147903	rs680014	A A	118	0.0544	25	0.0439	93	0.0581	A G	735	0.3387	175	0.3076
VSR	hCV8147903	rs680014	A A	66	0.0486	21	0.0385	45	0.0554	A G	445	0.3277	172	0.3156
UCSFCCF	hCV8754449	rs781226	T T	137	0.0632	37	0.065	100	0.0625	T C	852	0.3928	203	0.3568
VSR	hCV8754449	rs781226	T T	73	0.0536	15	0.0274	58	0.0713	T C	460	0.338	188	0.3431
UCSFCCF	hCV8820007	rs938390	A A	143	0.0659	29	0.0511	114	0.0712	A T	769	0.3545	207	0.3644
VSR	hCV8820007	rs938390	A A	94	0.0693	28	0.0511	66	0.0816	A T	463	0.3412	178	0.3248
UCSFCCF	hCV8942032	rs1264352	C C	46	0.0212	14	0.0246	32	0.02	C G	518	0.2388	151	0.2654
VSR	hCV8942032	rs1264352	C C	34	0.0249	16	0.0292	18	0.0221	C G	298	0.2186	133	0.2427
				Control	Control		ALL	ALL	Case	Case	Control	Control
	Study	Marker	rs	cnt	frq	Genot	cnt	frq	cnt	frq	cnt	frq
	UCSFCCF	hCV1053082	rs544115	506	0.3164	C C	1382	0.6375	370	0.6503	1012	0.6329
	VSR	hCV1053082	rs544115	251	0.3084	C C	914	0.6711	387	0.7062	527	0.6474
	UCSFCCF	hCV1116757	rs3794971	516	0.3225	T T	1410	0.6501	387	0.6801	1023	0.6394
	VSR	hCV1116757	rs3794971	234	0.2936	T T	926	0.6916	391	0.7214	535	0.6713
	UCSFCCF	hCV11425801	rs3805953	786	0.4906	T T	602	0.2773	142	0.2496	460	0.2871
	VSR	hCV11425801	rs3805953	408	0.5025	T T	358	0.2634	133	0.2431	225	0.2771
	UCSFCCF	hCV11425842	rs10948059	785	0.4906	C C	606	0.2795	166	0.2923	440	0.275
	VSR	hCV11425842	rs10948059	415	0.5098	C C	387	0.2841	167	0.3047	220	0.2703
	UCSFCCF	hCV11548152	rs11580249	423	0.2647	G G	1512	0.6977	374	0.6573	1138	0.7121
	VSR	hCV11548152	rs11580249	195	0.2393	G G	986	0.7223	383	0.6964	603	0.7399
	UCSFCCF	hCV11738775	rs6754561	778	0.4862	T T	832	0.3836	232	0.4077	600	0.375
	VSR	hCV11738775	rs6754561	366	0.4502	T T	537	0.3946	226	0.4124	311	0.3825
	UCSFCCF	hCV11758801	rs11841997	83	0.0518	C C	2042	0.9414	526	0.9261	1516	0.9469
	VSR	hCV11758801	rs11841997	43	0.0528	C C	1280	0.9377	508	0.9236	772	0.9472
	UCSFCCF	hCV11861255	rs529407	544	0.3398	A A	1276	0.588	336	0.5905	940	0.5871
	VSR	hCV11861255	rs529407	299	0.3724	A A	766	0.5695	327	0.6033	439	0.5467
	UCSFCCF	hCV12071939	rs1950943	550	0.3438	G G	1334	0.615	363	0.638	971	0.6069
	VSR	hCV12071939	rs1950943	267	0.3284	G G	892	0.6544	382	0.6945	510	0.6273
	UCSFCCF	hCV1209800	rs35067690	161	0.1005	G G	1967	0.9065	530	0.9331	1437	0.897
	VSR	hCV1209800	rs35067690	69	0.0847	G G	1259	0.9217	517	0.9383	742	0.9104
	UCSFCCF	hCV1262973	rs229653	232	0.1449	G G	1817	0.8373	466	0.819	1351	0.8438
	VSR	hCV1262973	rs229653	128	0.1572	G G	1091	0.807	416	0.7732	675	0.8292
	UCSFCCF	hCV1348610	rs3739636	776	0.4853	G G	628	0.2898	144	0.2535	484	0.3027
	VSR	hCV1348610	rs3739636	383	0.4758	G G	417	0.3114	159	0.2978	258	0.3205
	UCSFCCF	hCV1408483	rs17070848	426	0.2662	C C	1506	0.6943	374	0.6573	1132	0.7075
	VSR	hCV1408483	rs17070848	238	0.2924	C C	886	0.6505	338	0.6168	548	0.6732
	UCSFCCF	hCV1452085	rs12223005	307	0.1918	C C	1730	0.7972	461	0.8102	1269	0.7926
	VSR	hCV1452085	rs12223005	161	0.1975	C C	1104	0.8082	460	0.8348	644	0.7902
	UCSFCCF	hCV15851766	rs2229995	73	0.0457	G G	2079	0.9598	554	0.9754	1525	0.9543
	VSR	hCV15851766	rs2229995	44	0.0549	G G	1281	0.956	523	0.9721	758	0.9451
	UCSFCCF	hCV15857769	rs2924914	652	0.4075	C C	1067	0.4919	266	0.4675	801	0.5006
	VSR	hCV15857769	rs2924914	349	0.4287	C C	683	0.5011	271	0.4936	412	0.5061
	UCSFCCF	hCV15879601	rs2275769	241	0.1504	C C	1851	0.8526	501	0.8805	1350	0.8427
	VSR	hCV15879601	rs2275769	96	0.1181	C C	1199	0.8803	490	0.8925	709	0.8721
	UCSFCCF	hCV16134786	rs2857595	448	0.28	G G	1466	0.6762	364	0.6408	1102	0.6888
	VSR	hCV16134786	rs2857595	221	0.2712	G G	908	0.6652	345	0.6273	563	0.6908
	UCSFCCF	hCV1619596	rs1048621	597	0.3736	G G	1155	0.533	286	0.5026	869	0.5438
	VSR	hCV1619596	rs1048621	286	0.3514	G G	772	0.566	290	0.5273	482	0.5921
	UCSFCCF	hCV16336	rs362277	314	0.196	C C	1733	0.7982	469	0.8243	1264	0.789
	VSR	hCV16336	rs362277	171	0.2101	C C	1083	0.7952	453	0.8266	630	0.774
	UCSFCCF	hCV1723718	rs12481805	683	0.4271	G G	1031	0.4756	253	0.4446	778	0.4866
	VSR	hCV1723718	rs12481805	303	0.3722	G G	707	0.5187	266	0.4845	441	0.5418
	UCSFCCF	hCV1958451	rs2985822	607	0.3796	G G	1230	0.5673	343	0.6028	887	0.5547
	VSR	hCV1958451	rs2985822	302	0.3715	G G	773	0.5688	325	0.5952	448	0.551
	UCSFCCF	hCV2121658	rs1187332	380	0.2375	G G	1656	0.7642	453	0.7989	1203	0.7519
	VSR	hCV2121658	rs1187332	182	0.2244	G G	1037	0.7681	423	0.7848	614	0.7571
	UCSFCCF	hCV2358247	rs415989	178	0.1112	A A	1892	0.8727	482	0.8486	1410	0.8812
	VSR	hCV2358247	rs415989	73	0.0896	A A	1221	0.8939	479	0.8693	742	0.9104
	UCSFCCF	hCV2390937	rs739719	228	0.1424	C C	1864	0.859	501	0.8805	1363	0.8513
	VSR	hCV2390937	rs739719	121	0.1485	C C	1183	0.8667	491	0.8927	692	0.8491
	UCSFCCF	hCV25473186	rs2880415	772	0.4819	T T	615	0.2833	138	0.2425	477	0.2978
	VSR	hCV25473186	rs2880415	398	0.4883	T T	427	0.3135	147	0.2687	280	0.3436
	UCSFCCF	hCV25596936	rs6967117	194	0.1211	C C	1876	0.8641	479	0.8418	1397	0.872
	VSR	hCV25596936	rs6967117	107	0.1316	C C	1137	0.8342	439	0.7982	698	0.8585
	UCSFCCF	hCV25615822	NONE	79	0.0493	C C	2056	0.9479	534	0.9401	1522	0.9507
	VSR	hCV25615822	NONE	55	0.0676	C C	1254	0.9187	496	0.9002	758	0.9312
	UCSFCCF	hCV25983294	rs3739709	519	0.324	G G	1424	0.6562	397	0.6989	1027	0.6411
	VSR	hCV25983294	rs3739709	262	0.3227	G G	884	0.6495	375	0.6831	509	0.6268
	UCSFCCF	hCV2637554	rs3205421	673	0.4209	T T	1063	0.4908	263	0.4638	800	0.5003
	VSR	hCV2637554	rs3205421	327	0.4037	T T	651	0.4808	244	0.4485	407	0.5025
	UCSFCCF	hCV26478797	rs2015018	652	0.4078	G G	1190	0.5489	334	0.587	856	0.5353
	VSR	hCV26478797	rs2015018	317	0.3899	G G	733	0.5394	304	0.5568	429	0.5277
	UCSFCCF	hCV26881276	rs2344829	669	0.4184	A A	988	0.4559	242	0.4261	746	0.4665
	VSR	hCV26881276	rs2344829	351	0.4307	A A	585	0.4286	218	0.3964	367	0.4503
	UCSFCCF	hCV27077072	rs8060368	722	0.451	C C	978	0.4507	276	0.4851	702	0.4385
	VSR	hCV27077072	rs8060368	369	0.4533	C C	605	0.4435	258	0.4691	347	0.4263
	UCSFCCF	hCV27473671	rs3750465	655	0.4089	T T	1084	0.4993	266	0.4675	818	0.5106
	VSR	hCV27473671	rs3750465	310	0.3818	T T	727	0.5338	277	0.5036	450	0.5542
	UCSFCCF	hCV27494483	rs3748743	138	0.0862	C C	1956	0.9014	501	0.8805	1455	0.9088
	VSR	hCV27494483	rs3748743	62	0.0763	C C	1239	0.909	489	0.8891	750	0.9225
	UCSFCCF	hCV27504565	rs3219489	660	0.4128	C C	1171	0.5401	331	0.5817	840	0.5253
	VSR	hCV27504565	rs3219489	273	0.335	C C	839	0.6142	351	0.637	488	0.5988
	UCSFCCF	hCV27511436	rs3750145	430	0.2701	T T	1525	0.707	413	0.731	1112	0.6985
	VSR	hCV27511436	rs3750145	239	0.2933	T T	938	0.6872	393	0.7145	545	0.6687
	UCSFCCF	hCV2769503	rs4787956	711	0.4441	A A	928	0.4276	217	0.3814	711	0.4441
	VSR	hCV2769503	rs4787956	336	0.4164	A A	598	0.4453	208	0.3881	390	0.4833
	UCSFCCF	hCV27892569	rs4903741	577	0.362	T T	1253	0.5796	314	0.5528	939	0.5891
	VSR	hCV27892569	rs4903741	250	0.3086	T T	823	0.6047	317	0.5753	506	0.6247
	UCSFCCF	hCV28036404	rs4812768	495	0.309	T T	1393	0.6422	368	0.649	1025	0.6398
	VSR	hCV28036404	rs4812768	277	0.3403	T T	888	0.6529	377	0.6905	511	0.6278
	UCSFCCF	hCV2851380	rs12445805	295	0.1841	G G	1752	0.8074	473	0.8327	1279	0.7984
	VSR	hCV2851380	rs12445805	179	0.2199	G G	1065	0.7808	444	0.8073	621	0.7629
	UCSFCCF	hCV29401764	rs7793552	733	0.4584	C C	989	0.4562	284	0.4991	705	0.4409
	VSR	hCV29401764	rs7793552	374	0.4595	C C	606	0.4456	267	0.489	339	0.4165
	UCSFCCF	hCV29537898	rs6073804	247	0.1545	C C	1797	0.8293	458	0.8063	1339	0.8374
	VSR	hCV29537898	rs6073804	114	0.1402	C C	1146	0.8451	448	0.825	698	0.8585
	UCSFCCF	hCV29539757	rs10110659	713	0.4453	C C	1050	0.4841	305	0.537	745	0.4653
	VSR	hCV29539757	rs10110659	372	0.457	C C	629	0.4615	277	0.5046	352	0.4324
	UCSFCCF	hCV302629	rs9284183	654	0.4088	A A	1106	0.5101	277	0.4877	829	0.5181
	VSR	hCV302629	rs9284183	332	0.4094	A A	703	0.5188	280	0.5147	423	0.5216
	UCSFCCF	hCV30308202	rs9482985	530	0.3315	G G	1352	0.6236	367	0.645	985	0.616
	VSR	hCV30308202	rs9482985	267	0.328	G G	878	0.6451	372	0.6801	506	0.6216
	UCSFCCF	hCV3054550	rs1559599	386	0.2409	C C	1580	0.7278	397	0.6977	1183	0.7385
	VSR	hCV3054550	rs1559599	201	0.2466	C C	968	0.7086	376	0.6824	592	0.7264
	UCSFCCF	hCV3082219	rs1884833	317	0.198	G G	1692	0.7797	428	0.7522	1264	0.7895
	VSR	hCV3082219	rs1884833	165	0.203	G G	1031	0.7614	393	0.7264	638	0.7847
	UCSFCCF	hCV31137507	rs7660668	607	0.3789	G G	1168	0.538	288	0.5062	880	0.5493
	VSR	hCV31137507	rs7660668	314	0.3857	G G	722	0.5301	277	0.5055	445	0.5467
	UCSFCCF	hCV31227848	rs11809423	105	0.0656	C C	2002	0.9226	509	0.8946	1493	0.9325
	VSR	hCV31227848	rs11809423	54	0.0663	C C	1246	0.9135	486	0.8852	760	0.9325
	UCSFCCF	hCV31573621	rs11079818	672	0.4195	T T	1112	0.5122	310	0.5448	802	0.5006
	VSR	hCV31573621	rs11079818	323	0.4002	T T	704	0.5242	290	0.541	414	0.513
	UCSFCCF	hCV31705214	rs12804599	551	0.3439	A A	1303	0.6002	327	0.5747	976	0.6092
	VSR	hCV31705214	rs12804599	250	0.3067	A A	840	0.6154	315	0.5727	525	0.6442
	UCSFCCF	hCV32160712	rs11079160	442	0.2762	A A	1483	0.6837	365	0.6415	1118	0.6988
	VSR	hCV32160712	rs11079160	207	0.2559	A A	959	0.7083	374	0.6862	585	0.7231
	UCSFCCF	hCV435733	rs10276935	641	0.4006	C C	1049	0.4836	251	0.4411	798	0.4988
	VSR	hCV435733	rs10276935	302	0.371	C C	676	0.496	250	0.4554	426	0.5233
	UCSFCCF	hCV454333	rs10916581	379	0.2367	C C	1621	0.7473	435	0.7658	1186	0.7408
	VSR	hCV454333	rs10916581	174	0.2159	C C	1058	0.7797	446	0.8094	612	0.7593
	UCSFCCF	hCV540056	rs346802	129	0.0806	C C	2009	0.9258	538	0.9455	1471	0.9188
	VSR	hCV540056	rs346802	64	0.0787	C C	1272	0.9339	523	0.9526	749	0.9213
	UCSFCCF	hCV7917138	rs9822460	475	0.2972	A A	1401	0.6465	343	0.6028	1058	0.6621
	VSR	hCV7917138	rs9822460	259	0.319	A A	873	0.6429	344	0.63	529	0.6515
	UCSFCCF	hCV8147903	rs680014	560	0.3498	G G	1317	0.6069	369	0.6485	948	0.5921
	VSR	hCV8147903	rs680014	273	0.3358	G G	847	0.6237	352	0.6459	495	0.6089
	UCSFCCF	hCV8754449	rs781226	649	0.4056	C C	1180	0.544	329	0.5782	851	0.5319
	VSR	hCV8754449	rs781226	272	0.3346	C C	828	0.6084	345	0.6296	483	0.5941
	UCSFCCF	hCV8820007	rs938390	562	0.351	T T	1257	0.5795	332	0.5845	925	0.5778
	VSR	hCV8820007	rs938390	285	0.3523	T T	800	0.5895	342	0.6241	458	0.5661
	UCSFCCF	hCV8942032	rs1264352	367	0.2294	G G	1605	0.74	404	0.71	1201	0.7506
	VSR	hCV8942032	rs1264352	165	0.2025	G G	1031	0.7564	399	0.7281	632	0.7755

TABLE 19C
							DomGe	DomGen	RecGe	RecGeno
			HW(Control)	allelicA	allelicAsc	allelicAsc	notAsc	otAsc	notAsc	tAsc
Study	Marker	rs	pExact	sc chi2	pAsym	pExact	chi2	pAsym	chi2	pAsym
UCSFCCF	hCV1053082	rs544115	9.57E−02	1.8813	1.70E−01	1.84E−01	0.5478	4.59E−01	4.1986	4.05E−02
VSR	hCV1053082	rs544115	3.79E−01	5.9535	1.47E−02	1.54E−02	5.1272	2.36E−02	2.0145	1.56E−01
UCSFCCF	hCV1116757	rs3794971	7.54E−01	1.8049	1.79E−01	1.91E−01	3.0663	7.99E−02	0.1832	6.69E−01
VSR	hCV1116757	rs3794971	7.21E−01	4.3026	0.0381	0.0407	3.8015	0.0512	1.3504	0.2450
UCSFCCF	hCV11425801	rs3805953	5.81E−01	3.7417	5.31E−02	5.74E−02	2.959	8.54E−02	2.008	1.56E−01
VSR	hCV11425801	rs3805953	8.33E−01	3.1552	7.57E−02	7.83E−02	1.9414	1.64E−01	2.2927	1.30E−01
UCSFCCF	hCV11425842	rs10948059	5.15E−01	2.6567	1.03E−01	1.04E−01	0.6196	4.31E−01	3.6571	5.58E−02
VSR	hCV11425842	rs10948059	5.74E−01	2.7491	9.73E−02	9.99E−02	1.9136	1.67E−01	1.8051	1.79E−01
UCSFCCF	hCV11548152	rs11580249	8.49E−01	5.1795	2.29E−02	2.49E−02	5.9849	1.44E−02	0.1844	6.68E−01
VSR	hCV11548152	rs11580249	7.72E−01	3.669	5.54E−02	5.68E−02	3.1002	7.83E−02	1.3657	2.43E−01
UCSFCCF	hCV11738775	rs6754561	2.44E−01	4.5652	3.26E−02	3.52E−02	1.902	1.68E−01	5.5721	1.82E−02
VSR	hCV11738775	rs6754561	1.22E−01	4.301	3.81E−02	3.97E−02	1.223	2.69E−01	6.1599	1.31E−02
UCSFCCF	hCV11758801	rs11841997	3.28E−01	3.8274	5.04E−02	5.52E−02	3.307	6.90E−02	1.1756	2.78E−01
VSR	hCV11758801	rs11841997	1.00E+00	3.9487	4.69E−02	5.84E−02	3.133	7.67E−02	2.968	8.49E−02
UCSFCCF	hCV11861255	rs529407	2.74E−03	0.9704	3.25E−01	3.32E−01	0.0198	8.87E−01	4.4502	3.49E−02
VSR	hCV11861255	rs529407	1.76E−01	5.8243	1.58E−02	1.62E−02	4.2314	3.97E−02	3.2296	7.23E−02
UCSFCCF	hCV12071939	rs1950943	9.42E−01	3.6497	5.61E−02	5.84E−02	1.7131	1.91E−01	5.3616	2.06E−02
VSR	hCV12071939	rs1950943	9.15E−01	4.558	3.28E−02	3.42E−02	6.5586	1.04E−02	0.0106	9.15E−01
UCSFCCF	hCV1209800	rs35067690	1.00E+00	6.8747	8.74E−03	9.31E−03	6.4426	1.11E−02	1.4208	2.33E−01
VSR	hCV1209800	rs35067690	9.86E−02	4.5292	3.33E−02	3.77E−02	3.5355	6.01E−02	2.7122	9.96E−02
UCSFCCF	hCV1262973	rs229653	3.31E−02	2.8401	9.19E−02	9.99E−02	1.9058	1.67E−01	2.0833	1.49E−01
VSR	hCV1262973	rs229653	9.20E−02	4.7235	2.98E−02	3.25E−02	6.5217	1.07E−02	0.4932	4.82E−01
UCSFCCF	hCV1348610	rs3739636	3.92E−01	4.7184	2.98E−02	3.18E−02	4.9229	2.65E−02	1.6159	2.04E−01
VSR	hCV1348610	rs3739636	3.18E−01	3.6947	5.46E−02	5.73E−02	0.7744	3.79E−01	5.1413	2.34E−02
UCSFCCF	hCV1408483	rs17070848	7.80E−01	3.5792	5.85E−02	6.33E−02	4.9851	2.56E−02	0.0452	8.31E−01
VSR	hCV1408483	rs17070848	7.23E−01	4.0633	4.38E−02	4.77E−02	4.5874	3.22E−02	0.306	5.80E−01
UCSFCCF	hCV1452085	rs12223005	2.06E−01	1.6991	1.92E−01	2.01E−01	0.8011	3.71E−01	3.5259	6.04E−02
VSR	hCV1452085	rs12223005	1.00E+00	3.5065	6.11E−02	6.21E−02	4.2302	3.97E−02	0.005	9.36E−01
UCSFCCF	hCV15851766	rs2229995	1.00E+00	4.7105	3.00E−02	3.54E−02	4.8091	2.83E−02
VSR	hCV15851766	rs2229995	1.00E+00	5.444	1.96E−02	2.19E−02	5.5693	1.83E−02
UCSFCCF	hCV15857769	rs2924914	4.01E−01	3.0613	8.02E−02	8.41E−02	1.8442	1.74E−01	2.3797	1.23E−01
VSR	hCV15857769	rs2924914	8.13E−02	1.5429	2.14E−01	2.27E−01	0.2055	6.50E−01	4.5155	3.36E−02
UCSFCCF	hCV15879601	rs2275769	8.69E−01	5.0195	2.51E−02	2.73E−02	4.7726	2.89E−02	0.7923	3.73E−01
VSR	hCV15879601	rs2275769	4.68E−02	2.5557	1.10E−01	1.26E−01	1.3012	2.54E−01	5.4341	1.97E−02
UCSFCCF	hCV16134786	rs2857595	5.97E−01	4.3847	3.63E−02	3.81E−02	4.3936	3.61E−02	0.7309	3.93E−01
VSR	hCV16134786	rs2857595	1.14E−01	4.6354	3.13E−02	3.54E−02	5.9503	1.47E−02	0.0339	8.53E−01
UCSFCCF	hCV1619596	rs1048621	4.21E−02	2.9988	8.33E−02	8.94E−02	2.857	9.10E−02	0.809	3.68E−01
VSR	hCV1619596	rs1048621	6.94E−01	5.0407	2.48E−02	2.67E−02	5.6219	1.77E−02	0.6652	4.15E−01
UCSFCCF	hCV16336	rs362277	3.82E−01	3.1329	7.67E−02	8.47E−02	3.2376	7.20E−02	0.2141	6.44E−01
VSR	hCV16336	rs362277	7.41E−01	7.1876	7.34E−03	8.10E−03	5.5815	1.82E−02	4.5646	3.26E−02
UCSFCCF	hCV1723718	rs12481805	5.13E−01	3.8839	4.88E−02	5.19E−02	2.9562	8.56E−02	2.1993	1.38E−01
VSR	hCV1723718	rs12481805	9.24E−02	3.6917	5.47E−02	5.72E−02	4.3047	3.80E−02	0.444	5.05E−01
UCSFCCF	hCV1958451	rs2985822	9.48E−01	4.1971	4.05E−02	4.14E−02	3.9539	4.68E−02	1.2038	2.73E−01
VSR	hCV1958451	rs2985822	2.40E−01	4.5604	3.27E−02	3.35E−02	2.6009	1.07E−01	4.153	4.16E−02
UCSFCCF	hCV2121658	rs1187332	3.41E−02	4.3002	3.81E−02	4.02E−02	5.1465	2.33E−02	0.0001	9.61E−01
VSR	hCV2121658	rs1187332	7.57E−01	2.4843	1.15E−01	1.20E−01	1.3947	2.38E−01	4.1148	4.25E−02
UCSFCCF	hCV2358247	rs415989	3.03E−02	2.7624	9.65E−02	9.75E−02	4.0243	4.48E−02	1.0344	3.09E−01
VSR	hCV2358247	rs415989	4.00E−01	7.9749	4.74E−03	6.00E−03	5.853	1.56E−02	7.4228	6.44E−03
UCSFCCF	hCV2390937	rs739719	8.61E−01	3.1417	7.63E−02	8.49E−02	2.9448	8.62E−02	0.5694	4.50E−01
VSR	hCV2390937	rs739719	2.18E−01	5.0969	2.40E−02	2.44E−02	5.414	2.00E−02	0.0605	8.05E−01
UCSFCCF	hCV25473186	rs2880415	2.28E−01	4.3841	3.63E−02	3.81E−02	6.3063	1.20E−02	0.6889	4.07E−01
VSR	hCV25473186	rs2880415	8.85E−01	7.4863	6.22E−03	6.51E−03	8.5136	3.52E−03	2.1489	1.43E−01
UCSFCCF	hCV25596936	rs6967117	1.59E−01	2.2975	1.30E−01	1.39E−01	3.2629	7.09E−02	0.7923	3.73E−01
VSR	hCV25596936	rs6967117	1.24E−01	8.1435	4.32E−03	4.78E−03	8.6432	3.28E−03	0.2513	6.16E−01
UCSFCCF	hCV25615822	NONE	6.23E−01	1.2345	2.67E−01	2.80E−01	0.9387	3.33E−01	2.82	9.31E−02
VSR	hCV25615822	NONE	1.00E+00	4.1369	4.20E−02	4.98E−02	4.2329	3.96E−02	0.0772	7.81E−01
UCSFCCF	hCV25983294	rs3739709	3.85E−01	4.819	2.81E−02	3.07E−02	6.2248	1.26E−02	0.0285	8.65E−01
VSR	hCV25983294	rs3739709	3.44E−01	4.3198	3.77E−02	3.98E−02	4.5466	3.30E−02	0.5404	4.62E−01
UCSFCCF	hCV2637554	rs3205421	3.62E−01	4.974	2.57E−02	2.85E−02	2.2274	1.36E−01	6.0734	1.37E−02
VSR	hCV2637554	rs3205421	3.99E−01	4.3776	3.64E−02	3.80E−02	3.793	5.15E−02	1.707	1.91E−01
UCSFCCF	hCV26478797	rs2015018	2.31E−02	3.2424	7.18E−02	7.43E−02	4.5232	3.34E−02	0.0466	8.29E−01
VSR	hCV26478797	rs2015018	4.32E−01	3.0398	8.12E−02	8.40E−02	1.1134	2.91E−01	4.8681	2.74E−02
UCSFCCF	hCV26881276	rs2344829	7.67E−02	1.6418	2.00E−01	2.12E−01	2.7694	9.61E−02	0.0052	9.35E−01
VSR	hCV26881276	rs2344829	3.46E−01	5.9931	1.44E−02	1.60E−02	3.9019	4.82E−02	3.9451	4.70E−02
UCSFCCF	hCV27077072	rs8060368	6.95E−01	2.5397	1.11E−01	1.14E−01	3.68	5.51E−02	0.1126	7.37E−01
VSR	hCV27077072	rs8060368	1.00E+00	3.1185	7.74E−02	8.22E−02	2.4362	1.19E−01	1.6353	2.01E−01
UCSFCCF	hCV27473671	rs3750465	9.51E−01	3.3546	6.70E−02	6.87E−02	3.1234	7.72E−02	1.1247	2.89E−01
VSR	hCV27473671	rs3750465	9.27E−01	5.2115	2.24E−02	2.50E−02	3.367	6.65E−02	3.8604	4.94E−02
UCSFCCF	hCV27494483	rs3748743	2.72E−02	3.9163	4.78E−02	5.21E−02	3.7863	5.17E−02	0.3155	5.74E−01
VSR	hCV27494483	rs3748743	1.00E+00	4.7395	2.95E−02	3.30E−02	4.4302	3.53E−02	0.865	3.52E−01
UCSFCCF	hCV27504565	rs3219489	4.17E−02	2.6893	1.01E−01	1.07E−01	5.3732	2.04E−02	0.3093	5.78E−01
VSR	hCV27504565	rs3219489	6.37E−02	6.3249	1.19E−02	1.22E−02	2.0298	1.54E−01	12.829	3.41E−04
UCSFCCF	hCV27511436	rs3750145	2.79E−01	4.7174	2.99E−02	2.96E−02	2.1238	1.45E−01	8.5394	3.48E−03
VSR	hCV27511436	rs3750145	4.85E−01	3.434	6.39E−02	7.13E−02	3.2092	7.32E−02	0.7905	3.74E−01
UCSFCCF	hCV2769503	rs4787956	9.55E−01	6.0949	1.36E−02	1.50E−02	6.7483	9.38E−03	1.3572	2.44E−01
VSR	hCV2769503	rs4787956	5.09E−01	9.7933	1.75E−03	1.95E−03	11.821	5.86E−04	1.4515	2.28E−01
UCSFCCF	hCV27892569	rs4903741	3.97E−01	2.7801	9.54E−02	9.57E−02	2.2605	1.33E−01	1.3606	2.43E−01
VSR	hCV27892569	rs4903741	4.12E−03	1.8263	1.77E−01	1.79E−01	3.3443	6.74E−02	0.1334	7.15E−01
UCSFCCF	hCV28036404	rs4812768	3.21E−02	1.2024	2.73E−01	2.82E−01	0.1544	6.94E−01	4.3224	3.76E−02
VSR	hCV28036404	rs4812768	1.28E−01	5.3749	2.04E−02	2.13E−02	5.6716	1.72E−02	0.7758	3.78E−01
UCSFCCF	hCV2851380	rs12445805	2.89E−02	4.529	3.33E−02	3.60E−02	3.185	7.43E−02	3.1432	7.62E−02
VSR	hCV2851380	rs12445805	7.53E−01	3.7815	5.18E−02	5.25E−02	3.776	5.20E−02	0.433	5.11E−01
UCSFCCF	hCV29401764	rs7793552	1.57E−01	2.3924	1.22E−01	1.30E−01	5.7341	1.66E−02	0.3114	5.77E−01
VSR	hCV29401764	rs7793552	9.39E−01	5.9882	1.44E−02	1.46E−02	6.9627	8.32E−03	1.0087	3.15E−01
UCSFCCF	hCV29537898	rs6073804	6.31E−01	4.1761	4.10E−02	4.70E−02	2.8557	9.10E−02	3.5835	5.84E−02
VSR	hCV29537898	rs6073804	1.14E−01	3.821	5.06E−02	5.96E−02	2.7919	9.47E−02	4.704	3.01E−02
UCSFCCF	hCV29539757	rs10110659	1.46E−01	5.5454	1.85E−02	1.97E−02	8.6151	3.33E−03	0.0484	8.25E−01
VSR	hCV29539757	rs10110659	6.39E−01	7.379	6.60E−03	7.33E−03	6.8624	8.80E−03	2.6171	1.06E−01
UCSFCCF	hCV302629	rs9284183	4.55E−01	6.072	1.37E−02	1.46E−02	1.5552	2.12E−01	11.66	6.39E−04
VSR	hCV302629	rs9284183	4.28E−01	1.2194	2.69E−01	2.76E−01	0.0616	8.04E−01	4.4477	3.49E−02
UCSFCCF	hCV30308202	rs9482985	2.71E−01	3.3551	6.70E−02	6.92E−02	1.5017	2.20E−01	4.8497	2.76E−02
VSR	hCV30308202	rs9482985	4.66E−01	4.0472	4.42E−02	4.58E−02	4.8822	2.71E−02	0.1543	6.94E−01
UCSFCCF	hCV3054550	rs1559599	8.36E−01	4.1733	4.11E−02	4.60E−02	3.5169	6.07E−02	1.6062	2.05E−01
VSR	hCV3054550	rs1559599	3.36E−01	2.2114	1.37E−01	1.50E−01	3.0804	7.92E−02	0.0322	8.57E−01
UCSFCCF	hCV3082219	rs1884833	1.00E+00	2.8129	9.35E−02	9.54E−02	3.4024	6.51E−02	0.0012	9.55E−01
VSR	hCV3082219	rs1884833	1.00E+00	6.4474	1.11E−02	1.33E−02	6.0815	1.37E−02	1.3727	2.41E−01
UCSFCCF	hCV31137507	rs7660668	4.76E−01	3.1157	7.75E−02	7.98E−02	3.147	7.61E−02	0.7113	3.99E−01
VSR	hCV31137507	rs7660668	1.00E+00	2.7419	9.77E−02	1.04E−01	2.2328	1.35E−01	1.279	2.58E−01
UCSFCCF	hCV31227848	rs11809423	4.36E−01	7.9108	4.91E−03	6.04E−03	8.4827	3.59E−03	0.0031	9.45E−01
VSR	hCV31227848	rs11809423	1.00E+00	8.9352	2.80E−03	3.13E−03	9.2748	2.32E−03	0.0792	7.78E−01
UCSFCCF	hCV31573621	rs11079818	4.66E−01	3.8384	5.01E−02	5.05E−02	3.2818	7.01E−02	1.663	1.97E−01
VSR	hCV31573621	rs11079818	5.47E−01	2.7923	9.47E−02	1.03E−01	1.0148	3.14E−01	4.4251	3.54E−02
UCSFCCF	hCV31705214	rs12804599	8.84E−01	4.2814	3.85E−02	3.94E−02	2.0882	1.48E−01	5.2885	2.15E−02
VSR	hCV31705214	rs12804599	1.58E−01	5.9636	1.46E−02	1.60E−02	7.0819	7.79E−03	0.3533	5.52E−01
UCSFCCF	hCV32160712	rs11079160	7.14E−01	5.7112	1.69E−02	1.94E−02	6.367	1.16E−02	0.3901	5.32E−01
VSR	hCV32160712	rs11079160	8.90E−01	3.3547	6.70E−02	6.90E−02	2.1431	1.43E−01	3.0135	8.26E−02
UCSFCCF	hCV435733	rs10276935	5.73E−02	4.9763	2.57E−02	2.77E−02	5.5811	1.82E−02	0.833	3.61E−01
VSR	hCV435733	rs10276935	4.96E−03	1.658	1.98E−01	2.02E−01	6.059	1.38E−02	1.7917	1.81E−01
UCSFCCF	hCV454333	rs10916581	4.08E−01	2.4396	1.18E−01	1.31E−01	1.3942	2.38E−01	3.1385	7.65E−02
VSR	hCV454333	rs10916581	9.04E−02	6.7538	9.35E−03	9.52E−03	4.7879	2.87E−02	4.4834	3.42E−02
UCSFCCF	hCV540056	rs346802	5.17E−01	3.8011	5.12E−02	5.63E−02	4.3627	3.67E−02	0.5851	4.44E−01
VSR	hCV540056	rs346802	6.30E−01	5.0445	2.47E−02	2.84E−02	5.223	2.23E−02
UCSFCCF	hCV7917138	rs9822460	2.21E−01	6.3815	1.15E−02	1.21E−02	6.4489	1.11E−02	1.0708	3.01E−01
VSR	hCV7917138	rs9822460	3.02E−01	2.0808	1.49E−01	1.55E−01	0.6537	4.19E−01	4.8306	2.80E−02
UCSFCCF	hCV8147903	rs680014	4.01E−01	6.0117	1.42E−02	1.45E−02	5.5927	1.80E−02	1.6351	2.01E−01
VSR	hCV8147903	rs680014	3.63E−01	2.8258	9.28E−02	9.42E−02	1.9048	1.68E−01	1.996	1.58E−01
UCSFCCF	hCV8754449	rs781226	1.09E−01	2.0954	1.48E−01	1.56E−01	3.6323	5.67E−02	0.0453	8.31E−01
VSR	hCV8754449	rs781226	2.62E−02	5.9675	1.46E−02	1.46E−02	1.7282	1.89E−01	12.467	4.14E−04
UCSFCCF	hCV8820007	rs938390	2.66E−02	0.8237	3.64E−01	3.76E−01	0.0782	7.79E−01	2.764	9.64E−02
VSR	hCV8820007	rs938390	2.72E−02	7.008	8.11E−03	8.99E−03	4.5349	3.32E−02	4.7099	3.00E−02
UCSFCCF	hCV8942032	rs1264352	5.20E−01	3.55	5.95E−02	6.61E−02	3.5971	5.79E−02	0.4287	5.13E−01
VSR	hCV8942032	rs1264352	7.41E−02	4.1819	4.09E−02	4.49E−02	3.9886	4.58E−02	0.6813	4.09E−01
			AddGe	AddGeno		OR.Ho	OR.Ho
			notAsc	tAsc	OR.Ho	m.95CI.	m.95CI.		OR.Het.	OR.Het.	G
Study	Marker	rs	chi2	pAsym	m	L	U	OR.Het	95CI.L	95CI.U	Statistic
UCSFCCF	hCV1053082	rs544115	1.8401	1.75E−01	0.574	0.3358	0.9814	0.9838	0.7998	1.2101	4.5688
VSR	hCV1053082	rs544115	5.7805	1.62E−02	0.6052	0.331	1.1065	0.7867	0.617	1.003	5.8263
UCSFCCF	hCV1116757	rs3794971	1.7897	1.81E−01	1.04	0.6394	1.6918	0.8094	0.654	1.0017	3.9968
VSR	hCV1116757	rs3794971	4.246	0.0393	0.6353	0.3249	1.2422	0.8069	0.63	1.0336	4.2673
UCSFCCF	hCV11425801	rs3805953	3.6971	5.45E−02	1.3012	0.993	1.7051	1.1705	0.9281	1.4761	3.7602
VSR	hCV11425801	rs3805953	3.1695	7.50E−02	1.3231	0.9724	1.8004	1.1361	0.873	1.4785	3.1782
UCSFCCF	hCV11425842	rs10948059	2.6452	1.04E−01	0.7846	0.5948	1.035	0.9826	0.7858	1.2287	3.7537
VSR	hCV11425842	rs10948059	2.8113	9.36E−02	0.7654	0.5589	1.0482	0.8793	0.6833	1.1315	2.8121
UCSFCCF	hCV11548152	rs11580249	5.2806	2.16E−02	1.2336	0.6694	2.273	1.2948	1.0496	1.5973	5.8774
VSR	hCV11548152	rs11580249	3.6121	5.74E−02	1.5744	0.7942	3.1213	1.2111	0.9447	1.5526	3.5834
UCSFCCF	hCV11738775	rs6754561	4.7722	2.89E−02	0.664	0.4783	0.9219	0.9308	0.759	1.1414	6.296
VSR	hCV11738775	rs6754561	4.1958	4.05E−02	0.6577	0.4674	0.9255	0.9663	0.7646	1.2211	6.3672
UCSFCCF	hCV11758801	rs11841997	3.7093	5.41E−02	2.8821	0.405	20.513	1.389	0.9403	2.0517	3.3582
VSR	hCV11758801	rs11841997	3.892	4.85E−02				1.4137	0.906	2.2057
UCSFCCF	hCV11861255	rs529407	0.9239	3.36E−01	0.6456	0.4172	0.9991	1.0594	0.8647	1.2979	5.0497
VSR	hCV11861255	rs529407	5.5905	1.81E−02	0.6196	0.3928	0.9773	0.8306	0.6583	1.0482	5.7533
UCSFCCF	hCV12071939	rs1950943	3.7053	5.42E−02	0.5079	0.2887	0.8937	0.9289	0.7575	1.1392	6.4
VSR	hCV12071939	rs1950943	4.3724	3.65E−02	0.9271	0.5472	1.5708	0.715	0.561	0.9113	7.4172
UCSFCCF	hCV1209800	rs35067690	6.9406	8.43E−03	0			0.6399	0.4432	0.9239
VSR	hCV1209800	rs35067690	4.3855	3.62E−02	0			0.7072	0.462	1.0826
UCSFCCF	hCV1262973	rs229653	2.6543	1.03E−01	1.7717	0.8307	3.7788	1.1497	0.8834	1.4962	2.9516
VSR	hCV1262973	rs229653	4.6556	3.10E−02	0.7375	0.2545	2.1377	1.4832	1.1222	1.9602	7.9944
UCSFCCF	hCV1348610	rs3739636	4.6621	3.08E−02	1.3385	1.019	1.7582	1.2518	0.9947	1.5753	5.2978
VSR	hCV1348610	rs3739636	3.4678	6.26E−02	1.3555	1.0033	1.8313	1.0083	0.7811	1.3017	5.0887
UCSFCCF	hCV1408483	rs17070848	3.6225	5.70E−02	1.0089	0.5449	1.8681	1.286	1.0429	1.5858	5.472
VSR	hCV1408483	rs17070848	4.0784	4.34E−02	1.2739	0.7171	2.263	1.2807	1.0131	1.619	4.5423
UCSFCCF	hCV1452085	rs12223005	1.6769	1.95E−01	0.3303	0.0993	1.0993	0.9415	0.7362	1.2039	4.3881
VSR	hCV1452085	rs12223005	3.431	6.40E−02	0.98	0.3703	2.5937	0.7304	0.5467	0.9759	4.5378
UCSFCCF	hCV15851766	rs2229995	4.8091	2.83E−02				0.5279	0.2956	0.9429
VSR	hCV15851766	rs2229995	5.5693	1.83E−02				0.4941	0.2721	0.8972
UCSFCCF	hCV15857769	rs2924914	2.9769	8.45E−02	1.3315	0.9638	1.8396	1.0992	0.8971	1.3468	3.1352
VSR	hCV15857769	rs2924914	1.5844	2.08E−01	1.5203	1.0085	2.2918	0.9801	0.781	1.23	4.4526
UCSFCCF	hCV15879601	rs2275769	5.012	2.52E−02	0.4899	0.1082	2.2181	0.7379	0.5516	0.9872	5.1115
VSR	hCV15879601	rs2275769	2.4744	1.16E−01	0			0.8893	0.6304	1.2545
UCSFCCF	hCV16134786	rs2857595	4.3449	3.71E−02	1.3321	0.7957	2.23	1.2299	0.9978	1.5159	4.4069
VSR	hCV16134786	rs2857595	4.5185	3.35E−02	1.1581	0.6598	2.0327	1.3513	1.0658	1.7133	6.1591
UCSFCCF	hCV1619596	rs1048621	2.8638	9.06E−02	1.243	0.8815	1.7527	1.1655	0.9517	1.4273	2.9745
VSR	hCV1619596	rs1048621	5.0508	2.46E−02	1.3369	0.8468	2.1107	1.2959	1.032	1.6274	5.6095
UCSFCCF	hCV16336	rs362277	3.0502	8.07E−02	0.7861	0.3365	1.8365	0.7982	0.6189	1.0296	3.2722
VSR	hCV16336	rs362277	7.2354	7.15E−03	0.214	0.048	0.9528	0.7564	0.5717	1.0007	9.0123
UCSFCCF	hCV1723718	rs12481805	3.9421	4.71E−02	1.3593	0.9742	1.8965	1.1481	0.9381	1.4051	3.9209
VSR	hCV1723718	rs12481805	3.5428	5.98E−02	1.2553	0.8516	1.8502	1.2585	1.0007	1.5826	4.2931
UCSFCCF	hCV1958451	rs2985822	4.174	4.10E−02	0.7389	0.4833	1.1295	0.835	0.6812	1.0236	4.2666
VSR	hCV1958451	rs2985822	4.4562	3.48E−02	0.5908	0.3682	0.948	0.8855	0.7035	1.1145	5.3527
UCSFCCF	hCV2121658	rs1187332	4.49	3.41E−02	0.9373	0.3672	2.3922	0.7548	0.594	0.959	5.3775
VSR	hCV2121658	rs1187332	2.5241	1.12E−01	0.2903	0.0835	1.009	0.9012	0.6911	1.1752	5.1433
UCSFCCF	hCV2358247	rs415989	2.6772	1.02E−01	0.4876	0.1087	2.1862	1.3805	1.0441	1.8253	5.9832
VSR	hCV2358247	rs415989	7.8768	5.01E−03				1.4217	1.0009	2.0194
UCSFCCF	hCV2390937	rs739719	3.1343	7.67E−02	0.5441	0.1188	2.4919	0.7875	0.5878	1.0551	3.1758
VSR	hCV2390937	rs739719	5.2977	2.14E−02	0.7047	0.0637	7.7934	0.6756	0.4839	0.9432	5.0842
UCSFCCF	hCV25473186	rs2880415	4.3289	3.75E−02	1.3219	1.0048	1.7391	1.3253	1.0508	1.6714	6.4292
VSR	hCV25473186	rs2880415	7.7174	5.47E−03	1.5155	1.0992	2.0894	1.3927	1.0842	1.789	8.9051
UCSFCCF	hCV25596936	rs6967117	2.2646	1.32E−01	0.5303	0.1171	2.401	1.3229	1.0074	1.7373	4.7012
VSR	hCV25596936	rs6967117	7.8335	5.13E−03	1.3912	0.501	3.8636	1.5454	1.1505	2.0759	8.4034
UCSFCCF	hCV25615822	NONE	1.2457	2.64E−01				1.1906	0.7838	1.8085
VSR	hCV25615822	NONE	4.1629	4.13E−02	1.5282	0.0954	24.49	1.5004	1.0137	2.2209	3.6716
UCSFCCF	hCV25983294	rs3739709	4.8577	2.75E−02	0.8777	0.515	1.4958	0.7576	0.6112	0.9391	6.5483
VSR	hCV25983294	rs3739709	4.1249	4.23E−02	0.7614	0.4492	1.2907	0.7823	0.615	0.9951	4.5596
UCSFCCF	hCV2637554	rs3205421	5.0067	2.52E−02	1.5451	1.1091	2.1524	1.0848	0.8856	1.3286	6.3881
VSR	hCV2637554	rs3205421	4.2587	3.90E−02	1.3827	0.9553	2.0013	1.2089	0.96	1.5224	4.2815
UCSFCCF	hCV26478797	rs2015018	3.3871	6.57E−02	0.8731	0.5698	1.3378	0.8019	0.6554	0.9812	4.6697
VSR	hCV26478797	rs2015018	3.047	8.09E−02	0.5897	0.3705	0.9388	0.9527	0.759	1.1958	5.2035
UCSFCCF	hCV26881276	rs2344829	1.5938	2.07E−01	1.1057	0.8058	1.5173	1.198	0.9771	1.4689	3.0209
VSR	hCV26881276	rs2344829	5.7504	1.65E−02	1.4926	1.0675	2.087	1.1799	0.9339	1.4906	5.8097
UCSFCCF	hCV27077072	rs8060368	2.5305	1.12E−01	0.8622	0.6234	1.1924	0.8208	0.67	1.0055	3.7499
VSR	hCV27077072	rs8060368	3.1197	7.74E−02	0.7411	0.5123	1.072	0.8675	0.6898	1.0909	3.1285
UCSFCCF	hCV27473671	rs3750465	3.3751	6.62E−02	1.2873	0.9103	1.8204	1.169	0.9561	1.4294	3.4061
VSR	hCV27473671	rs3750465	5.1535	2.32E−02	1.5933	1.0529	2.4111	1.1634	0.926	1.4617	5.4661
UCSFCCF	hCV27494483	rs3748743	3.7048	5.43E−02	1.4521	0.4354	4.843	1.3469	0.9846	1.8425	3.5554
VSR	hCV27494483	rs3748743	4.7363	2.95E−02	3.0675	0.2774	33.922	1.4595	1.0039	2.122	4.3507
UCSFCCF	hCV27504565	rs3219489	2.7588	9.67E−02	0.9997	0.6757	1.4792	0.7652	0.6244	0.9376	7.0162
VSR	hCV27504565	rs3219489	6.2596	1.24E−02	0.3347	0.1799	0.6227	0.9523	0.7558	1.2	14.186
UCSFCCF	hCV27511436	rs3750145	4.7125	2.99E−02	0.2692	0.1066	0.6798	0.9205	0.7397	1.1455	10.955
VSR	hCV27511436	rs3750145	3.3344	6.78E−02	0.7158	0.3861	1.3267	0.8181	0.6402	1.0455	3.3771
UCSFCCF	hCV2769503	rs4787956	6.1512	1.31E−02	1.3545	0.9929	1.8479	1.2811	1.0429	1.5738	6.9114
VSR	hCV2769503	rs4787956	9.8523	1.70E−03	1.5046	1.0422	2.1723	1.4676	1.1624	1.853	11.864
UCSFCCF	hCV27892569	rs4903741	2.8366	9.21E−02	1.3419	0.8828	2.0397	1.135	0.9281	1.3881	2.8209
VSR	hCV27892569	rs4903741	1.7125	1.91E−01	1.005	0.6399	1.5785	1.277	1.0116	1.612	4.3397
UCSFCCF	hCV28036404	rs4812768	1.1665	2.80E−01	0.5774	0.3379	0.9867	1.0241	0.8322	1.2603	4.7358
VSR	hCV28036404	rs4812768	5.6186	1.78E−02	0.6777	0.3437	1.3363	0.7634	0.6022	0.9676	5.7808
UCSFCCF	hCV2851380	rs12445805	4.3423	3.72E−02	0.3863	0.1348	1.1071	0.8341	0.6447	1.0792	5.5293
VSR	hCV2851380	rs12445805	3.7227	5.37E−02	0.6993	0.28	1.7468	0.7736	0.5881	1.0174	3.8106
UCSFCCF	hCV29401764	rs7793552	2.411	1.20E−01	0.956	0.6916	1.3214	0.7552	0.6161	0.9257	7.6343
VSR	hCV29401764	rs7793552	5.8764	1.53E−02	0.7291	0.5084	1.0456	0.7503	0.5955	0.9452	6.9627
UCSFCCF	hCV29537898	rs6073804	4.0584	4.40E−02	2.2489	0.9794	5.1638	1.1836	0.9169	1.528	4.7982
VSR	hCV29537898	rs6073804	3.9237	4.76E−02	7.7902	0.9071	66.901	1.23	0.9105	1.6616	6.3117
UCSFCCF	hCV29539757	rs10110659	5.6203	1.78E−02	0.837	0.5894	1.1886	0.7331	0.5986	0.8979	9.1106
VSR	hCV29539757	rs10110659	7.4502	6.34E−03	0.6495	0.4404	0.9579	0.772	0.6145	0.97	7.5953
UCSFCCF	hCV302629	rs9284183	5.9952	1.43E−02	1.7394	1.2525	2.4155	1.0205	0.8322	1.2514	10.938
VSR	hCV302629	rs9284183	1.2037	2.73E−01	1.4837	0.993	2.2169	0.951	0.7559	1.1966	4.5406
UCSFCCF	hCV30308202	rs9482985	3.3181	6.85E−02	0.5432	0.3182	0.9273	0.9368	0.7625	1.151	5.6664
VSR	hCV30308202	rs9482985	3.8598	4.95E−02	0.8294	0.4955	1.3882	0.7642	0.6007	0.9721	4.9764
UCSFCCF	hCV3054550	rs1559599	4.1327	4.21E−02	1.5351	0.8458	2.7861	1.1966	0.9619	1.4885	4.0552
VSR	hCV3054550	rs1559599	2.193	1.39E−01	1.0019	0.5064	1.9825	1.2611	0.9878	1.6101	3.4557
UCSFCCF	hCV3082219	rs1884833	2.8432	9.18E−02	1.0336	0.434	2.4615	1.2484	0.9921	1.5709	3.4741
VSR	hCV3082219	rs1884833	6.4841	1.09E−02	1.7858	0.7515	4.2435	1.3479	1.0403	1.7465	6.3282
UCSFCCF	hCV31137507	rs7660668	3.0745	7.95E−02	1.2488	0.8674	1.798	1.1779	0.9633	1.4403	3.228
VSR	hCV31137507	rs7660668	2.7397	9.79E−02	1.3436	0.8834	2.0436	1.1512	0.9168	1.4454	2.724
UCSFCCF	hCV31227848	rs11809423	7.8545	5.07E−03	0.9777	0.1015	9.4209	1.6482	1.1797	2.3027	7.5344
VSR	hCV31227848	rs11809423	9.0359	2.65E−03	1.5638	0.0976	25.061	1.7955	1.2252	2.6312	8.0196
UCSFCCF	hCV31573621	rs11079818	3.9118	4.79E−02	0.7276	0.4915	1.0772	0.8585	0.7027	1.0489	3.9481
VSR	hCV31573621	rs11079818	2.8097	9.37E−02	0.6118	0.3888	0.9627	0.9547	0.7597	1.1997	4.7176
UCSFCCF	hCV31705214	rs12804599	4.2313	3.97E−02	1.6316	1.0929	2.436	1.0888	0.8875	1.3357	5.6238
VSR	hCV31705214	rs12804599	5.8152	1.59E−02	1.2917	0.7918	2.1071	1.36	1.0787	1.7147	7.0676
UCSFCCF	hCV32160712	rs11079160	5.8369	1.57E−02	1.3018	0.7291	2.3242	1.2959	1.0527	1.5953	6.2375
VSR	hCV32160712	rs11079160	3.3083	6.89E−02	1.8402	0.9516	3.5585	1.141	0.8916	1.4602	4.0086
UCSFCCF	hCV435733	rs10276935	4.7987	2.85E−02	1.2836	0.9311	1.7695	1.2548	1.0241	1.5376	5.6002
VSR	hCV435733	rs10276935	1.6077	2.05E−01	0.9114	0.6167	1.347	1.4275	1.1357	1.7943	11.119
UCSFCCF	hCV454333	rs10916581	2.4218	1.20E−01	0.4544	0.1901	1.086	0.9136	0.7266	1.1488	4.1171
VSR	hCV454333	rs10916581	6.4961	1.08E−02	0.343	0.1278	0.921	0.7886	0.5993	1.0378	7.7331
UCSFCCF	hCV540056	rs346802	3.8532	4.97E−02	2.7342	0.1707	43.792	0.6359	0.4223	0.9575	4.7627
VSR	hCV540056	rs346802	5.223	2.23E−02				0.5818	0.3639	0.9302
UCSFCCF	hCV7917138	rs9822460	6.2249	1.26E−02	1.3762	0.8737	2.1676	1.2793	1.0412	1.5718	6.4455
VSR	hCV7917138	rs9822460	2.0835	1.49E−01	1.8582	1.0639	3.2454	1.0272	0.8116	1.3	4.742
UCSFCCF	hCV8147903	rs680014	5.8658	1.54E−02	0.6906	0.437	1.0914	0.8028	0.6521	0.9885	6.0203
VSR	hCV8147903	rs680014	2.7684	9.61E−02	0.6562	0.3841	1.1213	0.886	0.7007	1.1204	3.0613
UCSFCCF	hCV8754449	rs781226	2.1424	1.43E−01	0.9571	0.6428	1.425	0.8091	0.6607	0.9907	4.2677
VSR	hCV8754449	rs781226	5.8303	1.58E−02	0.3621	0.2018	0.6495	0.9676	0.7676	1.2199	13.591
UCSFCCF	hCV8820007	rs938390	0.7944	3.73E−01	0.7088	0.4627	1.0857	1.0262	0.8379	1.2569	2.9617
VSR	hCV8820007	rs938390	6.5843	1.03E−02	0.5681	0.3573	0.9033	0.8364	0.662	1.0567	7.1036
UCSFCCF	hCV8942032	rs1264352	3.5083	6.11E−02	1.3006	0.6871	2.4618	1.2231	0.9811	1.5249	3.5479
VSR	hCV8942032	rs1264352	3.947	4.70E−02	1.408	0.7097	2.7931	1.2768	0.9839	1.6567	3.9974
				G
				Statistic			OR99C	OR99C	OR95C	OR95C
	Study	Marker	rs	pAsym	OR	std.In(OR)	I.L	I.U	I.L	I.U
	UCSFCCF	hCV1053082	rs544115	1.02E−01	0.8873	0.0872	0.7088	1.1108	0.7479	1.0527
	VSR	hCV1053082	rs544115	5.43E−02	0.7782	0.103	0.5969	1.0145	0.636	0.9521
	UCSFCCF	hCV1116757	rs3794971	1.36E−01	0.8876	0.0888	0.7061	1.1157	0.7458	1.0563
	VSR	hCV1116757	rs3794971	1.18E−01	0.8016	0.1068	0.6088	1.0553	0.6502	0.9881
	UCSFCCF	hCV11425801	rs3805953	1.53E−01	1.1429	0.0691	0.9566	1.3654	0.9982	1.3085
	VSR	hCV11425801	rs3805953	2.04E−01	1.1491	0.0783	0.9393	1.4059	0.9857	1.3397
	UCSFCCF	hCV11425842	rs10948059	1.53E−01	0.8932	0.0693	0.7471	1.0678	0.7797	1.0232
	VSR	hCV11425842	rs10948059	2.45E−01	0.878	0.0785	0.7173	1.0747	0.7528	1.024
	UCSFCCF	hCV11548152	rs11580249	5.29E−02	1.2289	0.0907	0.9729	1.5522	1.0288	1.4679
	VSR	hCV11548152	rs11580249	1.67E−01	1.2289	0.1077	0.9311	1.622	0.995	1.5179
	UCSFCCF	hCV11738775	rs6754561	4.29E−02	0.8572	0.0722	0.7118	1.0323	0.7442	0.9874
	VSR	hCV11738775	rs6754561	4.14E−02	0.8453	0.0811	0.686	1.0416	0.7211	0.9909
	UCSFCCF	hCV11758801	rs11841997	1.87E−01	1.4427	0.1883	0.8882	2.3432	0.9974	2.0867
	VSR	hCV11758801	rs11841997		1.5378	0.2181	0.8769	2.6969	1.0029	2.3579
	UCSFCCF	hCV11861255	rs529407	8.01E−02	0.9226	0.0817	0.7474	1.1389	0.786	1.083
	VSR	hCV11861255	rs529407	5.63E−02	0.8012	0.0919	0.6322	1.0153	0.669	0.9594
	UCSFCCF	hCV12071939	rs1950943	4.08E−02	0.8483	0.0862	0.6794	1.0592	0.7164	1.0044
	VSR	hCV12071939	rs1950943	2.45E−02	0.8078	0.1001	0.6243	1.0453	0.664	0.9829
	UCSFCCF	hCV1209800	rs35067690		0.6215	0.183	0.388	0.9957	0.4342	0.8896
	VSR	hCV1209800	rs35067690		0.6421	0.2097	0.3741	1.102	0.4257	0.9685
	UCSFCCF	hCV1262973	rs229653	2.29E−01	1.2188	0.1176	0.9004	1.6498	0.968	1.5346
	VSR	hCV1262973	rs229653	1.84E−02	1.3186	0.1276	0.9493	1.8315	1.0269	1.6932
	UCSFCCF	hCV1348610	rs3739636	7.07E−02	1.162	0.0692	0.9724	1.3886	1.0147	1.3307
	VSR	hCV1348610	rs3739636	7.85E−02	1.1644	0.0792	0.9495	1.4278	0.997	1.3598
	UCSFCCF	hCV1408483	rs17070848	6.48E−02	1.1866	0.0905	0.9398	1.4982	0.9937	1.417
	VSR	hCV1408483	rs17070848	1.03E−01	1.2184	0.0981	0.9464	1.5685	1.0053	1.4766
	UCSFCCF	hCV1452085	rs12223005	1.11E−01	0.8613	0.1146	0.6411	1.1571	0.688	1.0783
	VSR	hCV1452085	rs12223005	1.03E−01	0.7814	0.132	0.5562	1.0978	0.6033	1.0121
	UCSFCCF	hCV15851766	rs2229995		0.5338	0.2938	0.2504	1.1379	0.3001	0.9495
	VSR	hCV15851766	rs2229995		0.5012	0.3016	0.2305	1.0901	0.2775	0.9053
	UCSFCCF	hCV15857769	rs2924914	2.09E−01	1.1387	0.0743	0.9404	1.3788	0.9845	1.3172
	VSR	hCV15857769	rs2924914	1.08E−01	1.1125	0.0859	0.8918	1.388	0.9402	1.3165
	UCSFCCF	hCV15879601	rs2275769	7.76E−02	0.7329	0.1392	0.5121	1.0489	0.558	0.9628
	VSR	hCV15879601	rs2275769		0.7676	0.1658	0.5008	1.1767	0.5546	1.0624
	UCSFCCF	hCV16134786	rs2857595	1.10E−01	1.2019	0.0879	0.9584	1.5073	1.0117	1.4278
	VSR	hCV16134786	rs2857595	4.60E−02	1.2376	0.0991	0.9587	1.5977	1.0191	1.5031
	UCSFCCF	hCV1619596	rs1048621	2.26E−01	1.141	0.0762	0.9377	1.3884	0.9827	1.3248
	VSR	hCV1619596	rs1048621	6.05E−02	1.2231	0.0898	0.9706	1.5413	1.0258	1.4584
	UCSFCCF	hCV16336	rs362277	1.95E−01	0.8148	0.1159	0.6045	1.0982	0.6492	1.0226
	VSR	hCV16336	rs362277	1.10E−02	0.7053	0.1307	0.5037	0.9876	0.5459	0.9113
	UCSFCCF	hCV1723718	rs12481805	1.41E−01	1.1566	0.0739	0.9562	1.399	1.0007	1.3368
	VSR	hCV1723718	rs12481805	1.17E−01	1.1795	0.086	0.9452	1.4719	0.9966	1.396
	UCSFCCF	hCV1958451	rs2985822	1.18E−01	0.8459	0.0818	0.6853	1.0442	0.7206	0.9929
	VSR	hCV1958451	rs2985822	6.88E−02	0.8225	0.0916	0.6496	1.0413	0.6873	0.9842
	UCSFCCF	hCV2121658	rs1187332	6.80E−02	0.7964	0.11	0.5999	1.0572	0.642	0.9879
	VSR	hCV2121658	rs1187332	7.64E−02	0.8253	0.122	0.6028	1.1299	0.6498	1.0481
	UCSFCCF	hCV2358247	rs415989	5.02E−02	1.2462	0.1327	0.8855	1.754	0.9609	1.6163
	VSR	hCV2358247	rs415989		1.6023	0.1682	1.0388	2.4713	1.1522	2.2281
	UCSFCCF	hCV2390937	rs739719	2.04E−01	0.7807	0.14	0.5444	1.1196	0.5934	1.0272
	VSR	hCV2390937	rs739719	7.87E−02	0.6946	0.1622	0.4575	1.0547	0.5055	0.9545
	UCSFCCF	hCV25473186	rs2880415	4.02E−02	1.1555	0.0691	0.9672	1.3806	1.0092	1.3231
	VSR	hCV25473186	rs2880415	1.16E−02	1.2404	0.0788	1.0126	1.5194	1.0629	1.4475
	UCSFCCF	hCV25596936	rs6967117	9.53E−02	1.2167	0.1296	0.8714	1.6988	0.9438	1.5685
	VSR	hCV25596936	rs6967117	1.50E−02	1.4683	0.1352	1.0364	2.0802	1.1264	1.914
	UCSFCCF	hCV25615822	NONE		1.2567	0.2061	0.7391	2.1366	0.8391	1.882
	VSR	hCV25615822	NONE	1.59E−01	1.4756	0.1923	0.8991	2.4217	1.0121	2.1512
	UCSFCCF	hCV25983294	rs3739709	3.78E−02	0.819	0.0911	0.6477	1.0355	0.6851	0.979
	VSR	hCV25983294	rs3739709	1.02E−01	0.8136	0.0994	0.6298	1.0509	0.6696	0.9885
	UCSFCCF	hCV2637554	rs3205421	4.10E−02	1.1805	0.0745	0.9745	1.4301	1.0202	1.366
	VSR	hCV2637554	rs3205421	1.18E−01	1.1927	0.0843	0.96	1.4817	1.0111	1.4068
	UCSFCCF	hCV26478797	rs2015018	9.68E−02	0.8647	0.0808	0.7022	1.0647	0.738	1.013
	VSR	hCV26478797	rs2015018	7.41E−02	0.8558	0.0894	0.6798	1.0773	0.7182	1.0196
	UCSFCCF	hCV26881276	rs2344829	2.21E−01	1.098	0.073	0.9099	1.325	0.9517	1.2667
	VSR	hCV26881276	rs2344829	5.48E−02	1.2202	0.0813	0.9896	1.5046	1.0404	1.4311
	UCSFCCF	hCV27077072	rs8060368	1.53E−01	0.8885	0.0742	0.7339	1.0756	0.7682	1.0276
	VSR	hCV27077072	rs8060368	2.09E−01	0.8634	0.0832	0.6968	1.0698	0.7334	1.0163
	UCSFCCF	hCV27473671	rs3750465	1.82E−01	1.147	0.0749	0.9457	1.3912	0.9904	1.3285
	VSR	hCV27473671	rs3750465	6.50E−02	1.2203	0.0873	0.9746	1.5279	1.0284	1.448
	UCSFCCF	hCV27494483	rs3748743	1.69E−01	1.3368	0.1471	0.9151	1.9528	1.0019	1.7837
	VSR	hCV27494483	rs3748743	1.14E−01	1.4827	0.1819	0.928	2.3692	1.038	2.118
	UCSFCCF	hCV27504565	rs3219489	3.00E−02	0.8774	0.0798	0.7144	1.0776	0.7504	1.0259
	VSR	hCV27504565	rs3219489	8.31E−04	0.7854	0.0962	0.6131	1.0062	0.6505	0.9483
	UCSFCCF	hCV27511436	rs3750145	4.18E−03	0.808	0.0983	0.6273	1.0408	0.6664	0.9797
	VSR	hCV27511436	rs3750145	1.85E−01	0.824	0.1046	0.6294	1.0787	0.6713	1.0114
	UCSFCCF	hCV2769503	rs4787956	3.16E−02	1.1938	0.0718	0.9922	1.4364	1.0371	1.3743
	VSR	hCV2769503	rs4787956	2.65E−03	1.2971	0.0832	1.0469	1.607	1.1019	1.5268
	UCSFCCF	hCV27892569	rs4903741	2.44E−01	1.1428	0.0801	0.9298	1.4046	0.9768	1.337
	VSR	hCV27892569	rs4903741	1.14E−01	1.1328	0.0923	0.8931	1.4367	0.9453	1.3574
	UCSFCCF	hCV28036404	rs4812768	9.37E−02	0.9087	0.0873	0.7256	1.138	0.7657	1.0784
	VSR	hCV28036404	rs4812768	5.56E−02	0.7897	0.102	0.6072	1.0269	0.6466	0.9644
	UCSFCCF	hCV2851380	rs12445805	6.30E−02	0.776	0.1194	0.5705	1.0555	0.614	0.9807
	VSR	hCV2851380	rs12445805	1.49E−01	0.7859	0.1241	0.5709	1.0819	0.6163	1.0023
	UCSFCCF	hCV29401764	rs7793552	2.20E−02	0.8911	0.0746	0.7354	1.0798	0.7699	1.0313
	VSR	hCV29401764	rs7793552	3.08E−02	0.8152	0.0835	0.6574	1.0109	0.6921	0.9603
	UCSFCCF	hCV29537898	rs6073804	9.08E−02	1.2655	0.1154	0.94	1.7036	1.0093	1.5867
	VSR	hCV29537898	rs6073804	4.26E−02	1.3202	0.1425	0.9147	1.9055	0.9986	1.7455
	UCSFCCF	hCV29539757	rs10110659	1.05E−02	0.835	0.0766	0.6854	1.0172	0.7185	0.9703
	VSR	hCV29539757	rs10110659	2.24E−02	0.7947	0.0847	0.639	0.9884	0.6732	0.9381
	UCSFCCF	hCV302629	rs9284183	4.22E−03	1.203	0.075	0.9915	1.4595	1.0384	1.3936
	VSR	hCV302629	rs9284183	1.03E−01	1.1006	0.0868	0.8801	1.3764	0.9284	1.3047
	UCSFCCF	hCV30308202	rs9482985	5.88E−02	0.8535	0.0865	0.683	1.0666	0.7204	1.0113
	VSR	hCV30308202	rs9482985	8.31E−02	0.8199	0.0988	0.6356	1.0575	0.6755	0.9951
	UCSFCCF	hCV3054550	rs1559599	1.32E−01	1.2126	0.0944	0.9507	1.5465	1.0076	1.4592
	VSR	hCV3054550	rs1559599	1.78E−01	1.1702	0.1058	0.8911	1.5368	0.9511	1.4399
	UCSFCCF	hCV3082219	rs1884833	1.76E−01	1.1914	0.1045	0.9102	1.5593	0.9707	1.4621
	VSR	hCV3082219	rs1884833	4.23E−02	1.3418	0.1161	0.995	1.8094	1.0688	1.6846
	UCSFCCF	hCV31137507	rs7660668	1.99E−01	1.1451	0.0768	0.9396	1.3957	0.9851	1.3312
	VSR	hCV31137507	rs7660668	2.56E−01	1.1555	0.0873	0.9227	1.447	0.9737	1.3713
	UCSFCCF	hCV31227848	rs11809423	2.31E−02	1.5772	0.1633	1.0357	2.4017	1.1453	2.172
	VSR	hCV31227848	rs11809423	1.81E−02	1.7397	0.1873	1.0738	2.8185	1.2051	2.5114
	UCSFCCF	hCV31573621	rs11079818	1.39E−01	0.8583	0.0781	0.7019	1.0494	0.7365	1.0001
	VSR	hCV31573621	rs11079818	9.45E−02	0.862	0.0889	0.6855	1.0839	0.7241	1.0261
	UCSFCCF	hCV31705214	rs12804599	6.01E−02	1.1819	0.0808	0.9598	1.4553	1.0087	1.3847
	VSR	hCV31705214	rs12804599	2.92E−02	1.2564	0.0936	0.9873	1.5989	1.0459	1.5094
	UCSFCCF	hCV32160712	rs11079160	4.42E−02	1.2364	0.0889	0.9833	1.5546	1.0387	1.4718
	VSR	hCV32160712	rs11079160	1.35E−01	1.2139	0.1059	0.924	1.5948	0.9863	1.4941
	UCSFCCF	hCV435733	rs10276935	6.08E−02	1.1784	0.0736	0.9748	1.4245	1.02	1.3613
	VSR	hCV435733	rs10276935	3.85E−03	1.1155	0.0849	0.8964	1.388	0.9445	1.3173
	UCSFCCF	hCV454333	rs10916581	1.28E−01	0.8504	0.1038	0.6509	1.1111	0.6938	1.0423
	VSR	hCV454333	rs10916581	2.09E−02	0.7244	0.1244	0.5257	0.9981	0.5676	0.9245
	UCSFCCF	hCV540056	rs346802	9.24E−02	0.6783	0.2003	0.4049	1.1362	0.4581	1.0044
	VSR	hCV540056	rs346802		0.5919	0.2359	0.3224	1.0869	0.3728	0.9399
	UCSFCCF	hCV7917138	rs9822460	3.98E−02	1.2368	0.0842	0.9956	1.5364	1.0486	1.4587
	VSR	hCV7917138	rs9822460	9.34E−02	1.1509	0.0975	0.8953	1.4796	0.9507	1.3933
	UCSFCCF	hCV8147903	rs680014	4.93E−02	0.8113	0.0854	0.6512	1.0109	0.6863	0.9591
	VSR	hCV8147903	rs680014	2.16E−01	0.85	0.0968	0.6625	1.0905	0.7032	1.0275
	UCSFCCF	hCV8754449	rs781226	1.18E−01	0.8909	0.0798	0.7253	1.0943	0.7618	1.0418
	VSR	hCV8754449	rs781226	1.12E−03	0.7922	0.0955	0.6195	1.013	0.6571	0.9552
	UCSFCCF	hCV8820007	rs938390	2.27E−01	0.9289	0.0813	0.7535	1.1452	0.7922	1.0893
	VSR	hCV8820007	rs938390	2.87E−02	0.7818	0.0931	0.6152	0.9937	0.6515	0.9383
	UCSFCCF	hCV8942032	rs1264352	1.70E−01	1.1992	0.0965	0.9353	1.5375	0.9925	1.4488
	VSR	hCV8942032	rs1264352	1.36E−01	1.26	0.1132	0.9414	1.6865	1.0093	1.5729

TABLE 20
								95%	95%	ProbChi
								Low-	Up-	Sq (2-
						GENO-	Odds	er	per	sided p-	PVAL-
hCV #	rs #	Gene	OUTCOME	ADJUST	MODE	TYPE	Ratio	CL	CL	value)	UE_2DF
hCV1958451	rs2985822	MIER1	EO_STK	AGE MALE	GEN	GT	1.753	0.99	3.106	0.0543	0.15583
				DIAB HTN
hCV1958451	rs2985822	MIER1	EO_STK	AGE MALE	DOM	GT or	1.676	0.974	2.884	0.0623	.
				DIAB HTN		GG
hCV1958451	rs2985822	MIER1	EO_STK		GEN	GT	1.565	0.952	2.573	0.0775	0.15311
hCV1958451	rs2985822	MIER1	EO_STK	AGE MALE	GEN	GG	1.628	0.935	2.835	0.0852	0.15583
				DIAB HTN
hCV1958451	rs2985822	MIER1	LACUNAR_STK		GEN	GT	1.932	0.987	3.781	0.0546	0.06739
hCV27494483	rs3748743	SLC22A15	CE_STK		GEN	TC	1.575	1.084	2.287	0.0171	0.05794
hCV27494483	rs3748743	SLC22A15	CE_STK		DOM	TC or	1.564	1.081	2.263	0.0176	.
						TT
hCV27494483	rs3748743	SLC22A15	CE_STK		ADD	T	1.522	1.065	2.175	0.0211	.
hCV27494483	rs3748743	SLC22A15	ISCHEMIC_STK		DOM	TC or	1.307	0.967	1.765	0.0814	.
						TT
hCV27494483	rs3748743	SLC22A15	ISCHEMIC_STK		ADD	T	1.291	0.966	1.725	0.0847	.
hCV27494483	rs3748743	SLC22A15	ISCHEMIC_STK		GEN	TC	1.306	0.963	1.771	0.0859	0.21896
hCV27504565	rs3219489	MUTYH	ATHERO_STK	AGE MALE	GEN	CG	2.619	1.242	5.524	0.0115	0.04076
				DIAB HTN
hCV27504565	rs3219489	MUTYH	ATHERO_STK	AGE MALE	DOM	CG or	2.434	1.184	5.002	0.0155	.
				DIAB HTN		CC
hCV27504565	rs3219489	MUTYH	ATHERO_STK	AGE MALE	GEN	CC	2.336	1.127	4.841	0.0225	0.04076
				DIAB HTN
hCV27504565	rs3219489	MUTYH	ATHERO_STK		GEN	CG	1.922	1.077	3.43	0.027	0.08635
hCV27504565	rs3219489	MUTYH	ATHERO_STK		DOM	CG or	1.858	1.06	3.256	0.0306	.
						CC
hCV27504565	rs3219489	MUTYH	ATHERO_STK		GEN	CC	1.821	1.032	3.212	0.0385	0.08635
hCV27504565	rs3219489	MUTYH	ISCHEMIC_STK		GEN	CG	1.416	0.957	2.095	0.0819	0.13029
hCV27504565	rs3219489	MUTYH	NOHD_STK		GEN	CG	1.527	0.985	2.369	0.0585	0.11469
hCV27504565	rs3219489	MUTYH	NOHD_STK	AGE MALE	GEN	CG	1.706	0.952	3.055	0.0725	0.18169
				DIAB HTN
hCV27504565	rs3219489	MUTYH	NONCE_STK	AGE MALE	GEN	CG	1.811	0.973	3.371	0.061	0.10231
				DIAB HTN
hCV27504565	rs3219489	MUTYH	NONCE_STK		GEN	CG	1.487	0.943	2.346	0.0877	0.12763
hCV27504565	rs3219489	MUTYH	RECURRENT_STK	AGE MALE	GEN	CG	2.79	0.968	8.046	0.0575	0.15677
				DIAB HTN
hCV27504565	rs3219489	MUTYH	RECURRENT_STK	AGE MALE	DOM	CG or	2.47	0.893	6.833	0.0817	.
				DIAB HTN		CC
hCV8754449	rs781226	TESK2	ATHERO_STK	AGE MALE	GEN	CT	2.155	1.043	4.452	0.0381	0.11587
				DIAB HTN
hCV8754449	rs781226	TESK2	ATHERO_STK	AGE MALE	DOM	CT or	2.021	1.004	4.065	0.0486	.
				DIAB HTN		CC
hCV8754449	rs781226	TESK2	ATHERO_STK		GEN	CT	1.768	1.002	3.119	0.049	0.1425
hCV8754449	rs781226	TESK2	ATHERO_STK		DOM	CT or	1.724	0.995	2.986	0.0521	.
						CC
hCV8754449	rs781226	TESK2	ATHERO_STK		GEN	CC	1.698	0.974	2.96	0.0619	0.1425
hCV8754449	rs781226	TESK2	ATHERO_STK	AGE MALE	GEN	CC	1.949	0.96	3.955	0.0647	0.11587
				DIAB HTN
hCV8754449	rs781226	TESK2	RECURRENT_STK	AGE MALE	GEN	CT	2.615	0.909	7.524	0.0747	0.20413
				DIAB HTN
hCV8754449	rs781226	TESK2	RECURRENT_STK	AGE MALE	DOM	CT or	2.421	0.876	6.693	0.0883	.
				DIAB HTN		CC
hCV2091644	rs1010	VAMP8	CE_STK		REC	CC	1.275	0.956	1.699	0.0984	.
hCV8820007	rs938390		ATHERO_STK		GEN	TA	1.597	0.953	2.678	0.0757	0.18574
hCV8820007	rs938390		ISCHEMIC_STK		GEN	TA	1.387	0.953	2.02	0.0876	0.11797
hCV8820007	rs938390		ISCHEMIC_STK	AGE MALE	GEN	TA	1.511	0.927	2.463	0.0975	0.21063
				DIAB HTN
hCV8820007	rs938390		NOHD_STK		GEN	TA	1.624	1.065	2.478	0.0243	0.01745
hCV8820007	rs938390		NOHD_STK	AGE MALE	GEN	TA	1.751	1.027	2.984	0.0396	0.07825
				DIAB HTN
hCV8820007	rs938390		NOHD_STK	AGE MALE	DOM	TA or	1.543	0.929	2.564	0.094	.
				DIAB HTN		TT
hCV8820007	rs938390		NOHD_STK		DOM	TA or	1.404	0.937	2.102	0.0998	.
						TT
hCV11354788	rs12644625	LOC729065	ATHERO_STK	AGE MALE	ADD	T	1.379	1.016	1.871	0.0394	.
				DIAB HTN
hCV11354788	rs12644625	LOC729065	ATHERO_STK	AGE MALE	DOM	TC or	1.419	1.012	1.99	0.0423	.
				DIAB HTN		TT
hCV11354788	rs12644625	LOC729065	ATHERO_STK	AGE MALE	GEN	TC	1.397	0.987	1.977	0.0592	0.11826
				DIAB HTN
hCV11354788	rs12644625	LOC729065	ATHERO_STK		DOM	TC or	1.274	0.99	1.639	0.0597	.
						TT
hCV11354788	rs12644625	LOC729065	ATHERO_STK		GEN	TC	1.275	0.984	1.653	0.066	0.16972
hCV11354788	rs12644625	LOC729065	ATHERO_STK		ADD	T	1.231	0.982	1.542	0.0711	.
hCV11354788	rs12644625	LOC729065	CE_STK		ADD	T	1.501	1.205	1.869	0.0003	.
hCV11354788	rs12644625	LOC729065	CE_STK		DOM	TC or	1.56	1.216	2.002	0.0005	.
						TT
hCV11354788	rs12644625	LOC729065	CE_STK	AGE MALE	ADD	T	1.633	1.215	2.196	0.0011	.
				DIAB HTN
hCV11354788	rs12644625	LOC729065	CE_STK	AGE MALE	DOM	TC or	1.712	1.227	2.39	0.0016	.
				DIAB HTN		TT
hCV11354788	rs12644625	LOC729065	CE_STK		GEN	TC	1.51	1.166	1.956	0.0018	0.00137
hCV11354788	rs12644625	LOC729065	CE_STK	AGE MALE	GEN	TC	1.652	1.17	2.332	0.0043	0.00498
				DIAB HTN
hCV11354788	rs12644625	LOC729065	CE_STK		GEN	TT	2.198	1.061	4.556	0.0341	0.00137
hCV11354788	rs12644625	LOC729065	CE_STK		REC	TT	1.996	0.966	4.125	0.0619	.
hCV11354788	rs12644625	LOC729065	CE_STK	AGE MALE	GEN	TT	2.533	0.921	6.962	0.0716	0.00498
				DIAB HTN
hCV11354788	rs12644625	LOC729065	EO_STK	AGE MALE	ADD	T	1.432	1.068	1.922	0.0165	.
				DIAB HTN
hCV11354788	rs12644625	LOC729065	EO_STK		DOM	TC or	1.413	1.06	1.883	0.0184	.
						TT
hCV11354788	rs12644625	LOC729065	EO_STK		ADD	T	1.365	1.053	1.768	0.0186	.
hCV11354788	rs12644625	LOC729065	EO_STK	AGE MALE	DOM	TC or	1.466	1.057	2.032	0.0217	.
				DIAB HTN		TT
hCV11354788	rs12644625	LOC729065	EO_STK		GEN	TC	1.396	1.038	1.876	0.0273	0.05898
hCV11354788	rs12644625	LOC729065	EO_STK	AGE MALE	GEN	TC	1.423	1.017	1.991	0.0396	0.0564
				DIAB HTN
hCV11354788	rs12644625	LOC729065	ISCHEMIC_STK		DOM	TC or	1.356	1.113	1.652	0.0025	.
						TT
hCV11354788	rs12644625	LOC729065	ISCHEMIC_STK		ADD	T	1.309	1.097	1.563	0.0029	.
hCV11354788	rs12644625	LOC729065	ISCHEMIC_STK		GEN	TC	1.346	1.099	1.65	0.0041	0.0099
hCV11354788	rs12644625	LOC729065	ISCHEMIC_STK	AGE MALE	ADD	T	1.367	1.077	1.735	0.0102	.
				DIAB HTN
hCV11354788	rs12644625	LOC729065	ISCHEMIC_STK	AGE MALE	DOM	TC or	1.404	1.077	1.831	0.0122	.
				DIAB HTN		TT
hCV11354788	rs12644625	LOC729065	ISCHEMIC_STK	AGE MALE	GEN	TC	1.376	1.047	1.809	0.022	0.03661
				DIAB HTN
hCV11354788	rs12644625	LOC729065	NOHD_STK		ADD	T	1.31	1.083	1.585	0.0053	.
hCV11354788	rs12644625	LOC729065	NOHD_STK		DOM	TC or	1.345	1.086	1.666	0.0065	.
						TT
hCV11354788	rs12644625	LOC729065	NOHD_STK		GEN	TC	1.321	1.059	1.647	0.0135	0.02034
hCV11354788	rs12644625	LOC729065	NOHD_STK	AGE MALE	ADD	T	1.354	1.052	1.743	0.0188	.
				DIAB HTN
hCV11354788	rs12644625	LOC729065	NOHD_STK	AGE MALE	DOM	TC or	1.375	1.036	1.825	0.0275	.
				DIAB HTN		TT
hCV11354788	rs12644625	LOC729065	NOHD_STK	AGE MALE	GEN	TC	1.332	0.995	1.784	0.0544	0.06231
				DIAB HTN
hCV11354788	rs12644625	LOC729065	NONCE_STK		GEN	TC	1.248	0.99	1.573	0.0613	0.17362
hCV11354788	rs12644625	LOC729065	NONCE_STK		DOM	TC or	1.233	0.984	1.545	0.0692	.
						TT
hCV11354788	rs12644625	LOC729065	NONCE_STK	AGE MALE	DOM	TC or	1.295	0.953	1.758	0.0982	.
				DIAB HTN		TT
hCV11354788	rs12644625	LOC729065	RECURRENT_STK	AGE MALE	GEN	TC	2.096	1.252	3.509	0.0049	0.01709
				DIAB HTN
hCV11354788	rs12644625	LOC729065	RECURRENT_STK	AGE MALE	DOM	TC or	1.962	1.187	3.243	0.0086	.
				DIAB HTN		TT
hCV11354788	rs12644625	LOC729065	RECURRENT_STK	AGE MALE	ADD	T	1.701	1.072	2.7	0.0241	.
				DIAB HTN
hCV11354788	rs12644625	LOC729065	RECURRENT_STK		DOM	TC or	1.383	0.979	1.955	0.066	.
						TT
hCV11354788	rs12644625	LOC729065	RECURRENT_STK		GEN	TC	1.382	0.968	1.973	0.075	0.1844
hCV11354788	rs12644625	LOC729065	RECURRENT_STK		ADD	T	1.321	0.972	1.796	0.0752	.
hCV16158671	rs2200733		ATHERO_STK	AGE MALE	ADD	T	1.415	1.045	1.915	0.0248	.
				DIAB HTN
hCV16158671	rs2200733		ATHERO_STK	AGE MALE	DOM	TC or	1.442	1.028	2.023	0.0339	.
				DIAB HTN		TT
hCV16158671	rs2200733		ATHERO_STK		DOM	TC or	1.304	1.013	1.679	0.039	.
						TT
hCV16158671	rs2200733		ATHERO_STK		ADD	T	1.257	1.005	1.573	0.0456	.
hCV16158671	rs2200733		ATHERO_STK		GEN	TC	1.302	1.003	1.69	0.047	0.11865
hCV16158671	rs2200733		ATHERO_STK	AGE MALE	GEN	TC	1.397	0.986	1.98	0.06	0.07966
				DIAB HTN
hCV16158671	rs2200733		CE_STK		ADD	T	1.509	1.213	1.879	0.0002	.
hCV16158671	rs2200733		CE_STK		DOM	TC or	1.585	1.235	2.035	0.0003	.
						TT
hCV16158671	rs2200733		CE_STK		GEN	TC	1.543	1.191	1.999	0.001	0.00106
hCV16158671	rs2200733		CE_STK	AGE MALE	ADD	T	1.631	1.216	2.189	0.0011	.
				DIAB HTN
hCV16158671	rs2200733		CE_STK	AGE MALE	DOM	TC or	1.733	1.241	2.42	0.0012	.
				DIAB HTN		TT
hCV16158671	rs2200733		CE_STK	AGE MALE	GEN	TC	1.684	1.192	2.381	0.0032	0.00458
				DIAB HTN
hCV16158671	rs2200733		CE_STK		GEN	TT	2.083	1.015	4.275	0.0454	0.00106
hCV16158671	rs2200733		CE_STK		REC	TT	1.883	0.92	3.853	0.0832	.
hCV16158671	rs2200733		CE_STK	AGE MALE	GEN	TT	2.319	0.869	6.191	0.093	0.00458
				DIAB HTN
hCV16158671	rs2200733		EO_STK		DOM	TC or	1.426	1.069	1.901	0.0156	.
						TT
hCV16158671	rs2200733		EO_STK		ADD	T	1.364	1.055	1.763	0.0178	.
hCV16158671	rs2200733		EO_STK	AGE MALE	ADD	T	1.409	1.052	1.887	0.0215	.
				DIAB HTN
hCV16158671	rs2200733		EO_STK		GEN	TC	1.415	1.051	1.905	0.022	0.05284
hCV16158671	rs2200733		EO_STK	AGE MALE	DOM	TC or	1.448	1.044	2.008	0.0267	.
				DIAB HTN		TT
hCV16158671	rs2200733		EO_STK	AGE MALE	GEN	TC	1.409	1.006	1.975	0.0461	0.07117
				DIAB HTN
hCV16158671	rs2200733		ISCHEMIC_STK		DOM	TC or	1.376	1.13	1.677	0.0015	.
						TT
hCV16158671	rs2200733		ISCHEMIC_STK		ADD	T	1.324	1.11	1.579	0.0018	.
hCV16158671	rs2200733		ISCHEMIC_STK		GEN	TC	1.365	1.113	1.674	0.0028	0.00631
hCV16158671	rs2200733		ISCHEMIC_STK	AGE MALE	ADD	T	1.375	1.085	1.742	0.0083	.
				DIAB HTN
hCV16158671	rs2200733		ISCHEMIC_STK	AGE MALE	DOM	TC or	1.413	1.083	1.843	0.0109	.
				DIAB HTN		TT
hCV16158671	rs2200733		ISCHEMIC_STK	AGE MALE	GEN	TC	1.378	1.047	1.813	0.0222	0.03074
				DIAB HTN
hCV16158671	rs2200733		NOHD_STK		ADD	T	1.327	1.099	1.603	0.0032	.
hCV16158671	rs2200733		NOHD_STK		DOM	TC or	1.366	1.103	1.691	0.0042	.
						TT
hCV16158671	rs2200733		NOHD_STK		GEN	TC	1.337	1.072	1.668	0.0101	0.01299
hCV16158671	rs2200733		NOHD_STK	AGE MALE	ADD	T	1.366	1.063	1.754	0.0147	.
				DIAB HTN
hCV16158671	rs2200733		NOHD_STK	AGE MALE	DOM	TC or	1.384	1.042	1.838	0.0247	.
				DIAB HTN		TT
hCV16158671	rs2200733		NOHD_STK	AGE MALE	GEN	TC	1.33	0.992	1.783	0.0569	0.04871
				DIAB HTN
hCV16158671	rs2200733		NOHD_STK	AGE MALE	GEN	TT	2.103	0.891	4.961	0.0896	0.04871
				DIAB HTN
hCV16158671	rs2200733		NONCE_STK		DOM	TC or	1.251	0.998	1.568	0.0518	.
						TT
hCV16158671	rs2200733		NONCE_STK		GEN	TC	1.259	0.998	1.588	0.0525	0.14733
hCV16158671	rs2200733		NONCE_STK		ADD	T	1.206	0.985	1.475	0.0696	.
hCV16158671	rs2200733		NONCE_STK	AGE MALE	ADD	T	1.274	0.967	1.679	0.0852	.
				DIAB HTN
hCV16158671	rs2200733		NONCE_STK	AGE MALE	DOM	TC or	1.297	0.954	1.761	0.0967	.
				DIAB HTN		TT
hCV16158671	rs2200733		RECURRENT_STK	AGE MALE	GEN	TC	2.087	1.24	3.512	0.0056	0.01904
				DIAB HTN
hCV16158671	rs2200733		RECURRENT_STK	AGE MALE	DOM	TC or	1.943	1.171	3.225	0.0102	.
				DIAB HTN		TT
hCV16158671	rs2200733		RECURRENT_STK	AGE MALE	ADD	T	1.671	1.053	2.652	0.0294	.
				DIAB HTN
hCV16158671	rs2200733		RECURRENT_STK		DOM	TC or	1.375	0.971	1.948	0.0728	.
						TT
hCV16158671	rs2200733		RECURRENT_STK		GEN	TC	1.38	0.964	1.975	0.0786	0.19939
hCV16158671	rs2200733		RECURRENT_STK		ADD	T	1.307	0.961	1.776	0.0879	.
hCV16336	rs362277	HD	ATHERO_STK		REC	CC	1.377	1.032	1.837	0.0298	.
hCV16336	rs362277	HD	ATHERO_STK		ADD	C	1.315	1.013	1.707	0.0399	.
hCV16336	rs362277	HD	ATHERO_STK	AGE MALE	REC	CC	1.39	0.96	2.013	0.0812	.
				DIAB HTN
hCV16336	rs362277	HD	CE_STK		ADD	C	1.523	1.147	2.022	0.0036	.
hCV16336	rs362277	HD	CE_STK		REC	CC	1.525	1.126	2.066	0.0065	.
hCV16336	rs362277	HD	CE_STK	AGE MALE	ADD	C	1.49	1.033	2.148	0.0328	.
				DIAB HTN
hCV16336	rs362277	HD	CE_STK	AGE MALE	REC	CC	1.52	1.028	2.247	0.036	.
				DIAB HTN
hCV16336	rs362277	HD	CE_STK		GEN	CC	3.625	0.825	15.926	0.0881	0.01511
hCV16336	rs362277	HD	EO_STK	AGE MALE	REC	CC	1.659	1.156	2.381	0.0061	.
				DIAB HTN
hCV16336	rs362277	HD	EO_STK	AGE MALE	ADD	C	1.559	1.11	2.188	0.0103	.
				DIAB HTN
hCV16336	rs362277	HD	EO_STK		REC	CC	1.389	1.014	1.904	0.0407	.
hCV16336	rs362277	HD	EO_STK		ADD	C	1.355	1.01	1.819	0.0427	.
hCV16336	rs362277	HD	ISCHEMIC_STK		ADD	C	1.379	1.127	1.686	0.0018	.
hCV16336	rs362277	HD	ISCHEMIC_STK		REC	CC	1.41	1.131	1.758	0.0023	.
hCV16336	rs362277	HD	ISCHEMIC_STK	AGE MALE	ADD	C	1.377	1.052	1.803	0.0198	.
				DIAB HTN
hCV16336	rs362277	HD	ISCHEMIC_STK	AGE MALE	REC	CC	1.417	1.056	1.901	0.0203	.
				DIAB HTN
hCV16336	rs362277	HD	NOHD_STK		ADD	C	1.227	0.99	1.521	0.0619	.
hCV16336	rs362277	HD	NOHD_STK		REC	CC	1.248	0.986	1.581	0.0658	.
hCV16336	rs362277	HD	NONCE_STK		REC	CC	1.345	1.046	1.73	0.0211	.
hCV16336	rs362277	HD	NONCE_STK		ADD	C	1.3	1.035	1.633	0.0244	.
hCV16336	rs362277	HD	NONCE_STK	AGE MALE	REC	CC	1.39	0.999	1.935	0.0508	.
				DIAB HTN
hCV16336	rs362277	HD	NONCE_STK	AGE MALE	ADD	C	1.346	0.997	1.816	0.0521	.
				DIAB HTN
hCV26478797	rs2015018	CHSY-2	CE_STK		REC	GG	1.205	0.965	1.505	0.099	.
hCV11425801	rs3805953	PEX6	ATHERO_STK	AGE MALE	GEN	CT	1.99	1.402	2.824	0.0001	0.0005
				DIAB HTN
hCV11425801	rs3805953	PEX6	ATHERO_STK	AGE MALE	DOM	CT or	1.726	1.251	2.38	0.0009	.
				DIAB HTN		CC
hCV11425801	rs3805953	PEX6	ATHERO_STK		GEN	CT	1.539	1.183	2.002	0.0013	0.00531
hCV11425801	rs3805953	PEX6	ATHERO_STK		DOM	CT or	1.481	1.159	1.892	0.0017	.
						CC
hCV11425801	rs3805953	PEX6	ATHERO_STK		ADD	C	1.179	1.019	1.363	0.0271	.
hCV11425801	rs3805953	PEX6	ATHERO_STK		GEN	CC	1.385	1.028	1.865	0.0323	0.00531
hCV11425801	rs3805953	PEX6	ATHERO_STK	AGE MALE	ADD	C	1.18	0.974	1.429	0.0913	.
				DIAB HTN
hCV11425801	rs3805953	PEX6	EO_STK		GEN	CT	1.639	1.226	2.192	0.0009	0.00345
hCV11425801	rs3805953	PEX6	EO_STK	AGE MALE	GEN	CT	1.718	1.229	2.4	0.0015	0.00399
				DIAB HTN
hCV11425801	rs3805953	PEX6	EO_STK		DOM	CT or	1.484	1.135	1.939	0.0038	.
						CC
hCV11425801	rs3805953	PEX6	EO_STK	AGE MALE	DOM	CT or	1.483	1.092	2.015	0.0116	.
				DIAB HTN		CC
hCV11425801	rs3805953	PEX6	ISCHEMIC_STK	AGE MALE	GEN	CT	1.617	1.235	2.116	0.0005	0.00176
				DIAB HTN
hCV11425801	rs3805953	PEX6	ISCHEMIC_STK	AGE MALE	DOM	CT or	1.453	1.135	1.86	0.003	.
				DIAB HTN		CC
hCV11425801	rs3805953	PEX6	ISCHEMIC_STK		GEN	CT	1.321	1.082	1.612	0.0062	0.02335
hCV11425801	rs3805953	PEX6	ISCHEMIC_STK		DOM	CT or	1.276	1.062	1.534	0.0094	.
						CC
hCV11425801	rs3805953	PEX6	ISCHEMIC_STK		ADD	C	1.104	0.985	1.236	0.0889	.
hCV11425801	rs3805953	PEX6	LACUNAR_STK	AGE MALE	GEN	CT	1.826	1.186	2.811	0.0063	0.01078
				DIAB HTN
hCV11425801	rs3805953	PEX6	LACUNAR_STK	AGE MALE	DOM	CT or	1.51	1.014	2.25	0.0427	.
				DIAB HTN		CC
hCV11425801	rs3805953	PEX6	LACUNAR_STK		GEN	CT	1.368	0.973	1.923	0.0715	0.11508
hCV11425801	rs3805953	PEX6	NOHD_STK	AGE MALE	GEN	CT	1.641	1.229	2.19	0.0008	0.00304
				DIAB HTN
hCV11425801	rs3805953	PEX6	NOHD_STK	AGE MALE	DOM	CT or	1.472	1.13	1.916	0.0041	.
				DIAB HTN		CC
hCV11425801	rs3805953	PEX6	NOHD_STK		DOM	CT or	1.276	1.043	1.559	0.0176	.
						CC
hCV11425801	rs3805953	PEX6	NOHD_STK		GEN	CT	1.295	1.041	1.61	0.0201	0.05622
hCV11425801	rs3805953	PEX6	NOHD_STK		ADD	C	1.12	0.991	1.266	0.07	.
hCV11425801	rs3805953	PEX6	NOHD_STK		GEN	CC	1.244	0.973	1.591	0.0821	0.05622
hCV11425801	rs3805953	PEX6	NONCE_STK	AGE MALE	DOM	CT or	1.689	1.268	2.251	0.0003	.
				DIAB HTN		CC
hCV11425801	rs3805953	PEX6	NONCE_STK		GEN	CT	1.48	1.176	1.862	0.0008	0.00363
hCV11425801	rs3805953	PEX6	NONCE_STK		DOM	CT or	1.393	1.125	1.725	0.0023	.
						CC
hCV11425801	rs3805953	PEX6	NONCE_STK		ADD	C	1.126	0.989	1.282	0.0732	.
hCV11425801	rs3805953	PEX6	NONCE_STK		GEN	CC	1.249	0.96	1.625	0.0971	0.00363
hCV11425801	rs3805953	PEX6	RECURRENT_STK	AGE MALE	GEN	CT	1.636	0.988	2.71	0.0556	0.12066
				DIAB HTN
hCV11425801	rs3805953	PEX6	RECURRENT_STK		GEN	CT	1.368	0.951	1.967	0.091	0.22257
hCV11425842	rs10948059	GNMT	ATHERO_STK	AGE MALE	DOM	CT or	1.483	1.042	2.111	0.0286	.
				DIAB HTN		CC
hCV11425842	rs10948059	GNMT	ATHERO_STK	AGE MALE	GEN	CT	1.508	1.036	2.195	0.032	0.08825
				DIAB HTN
hCV11425842	rs10948059	GNMT	ATHERO_STK		DOM	CT or	1.281	0.979	1.676	0.0707	.
						CC
hCV11425842	rs10948059	GNMT	ATHERO_STK	AGE MALE	GEN	CC	1.445	0.961	2.172	0.077	0.08825
				DIAB HTN
hCV11425842	rs10948059	GNMT	ATHERO_STK		GEN	CT	1.292	0.972	1.717	0.0777	0.19224
hCV11425842	rs10948059	GNMT	EO_STK		GEN	CT	1.44	1.056	1.965	0.0214	0.06697
hCV11425842	rs10948059	GNMT	EO_STK		DOM	CT or	1.4	1.047	1.871	0.0232	.
						CC
hCV11425842	rs10948059	GNMT	EO_STK	AGE MALE	GEN	CT	1.497	1.048	2.138	0.0267	0.08575
				DIAB HTN
hCV11425842	rs10948059	GNMT	EO_STK	AGE MALE	DOM	CT or	1.418	1.016	1.978	0.0399	.
				DIAB HTN		CC
hCV11425842	rs10948059	GNMT	EO_STK		GEN	CC	1.338	0.953	1.878	0.0927	0.06697
hCV11425842	rs10948059	GNMT	ISCHEMIC_STK	AGE MALE	GEN	CT	1.334	0.998	1.785	0.0518	0.1427
				DIAB HTN
hCV11425842	rs10948059	GNMT	ISCHEMIC_STK	AGE MALE	DOM	CT or	1.309	0.997	1.719	0.0525	.
				DIAB HTN		CC
hCV11425842	rs10948059	GNMT	NONCE_STK	AGE MALE	GEN	CT	1.435	1.028	2.005	0.0341	0.10566
				DIAB HTN
hCV11425842	rs10948059	GNMT	NONCE_STK	AGE MALE	DOM	CT or	1.379	1.008	1.886	0.0444	.
				DIAB HTN		CC
hCV1209800	rs35067690	CLIC5	CE_STK		REC	GG	1.54	0.995	2.384	0.0529	.
hCV1209800	rs35067690	CLIC5	CE_STK		ADD	G	1.497	0.985	2.277	0.059	.
hCV16134786	rs2857595		EO_STK		ADD	A	1.287	1.044	1.587	0.018	.
hCV16134786	rs2857595		EO_STK		GEN	AA	1.967	1.08	3.581	0.0269	0.0477
hCV16134786	rs2857595		EO_STK		REC	AA	1.845	1.02	3.336	0.0428	.
hCV16134786	rs2857595		EO_STK		DOM	AG or	1.283	0.999	1.65	0.0513	.
						AA
hCV16134786	rs2857595		LACUNAR_STK		GEN	AA	2.149	1.196	3.86	0.0105	0.0372
hCV16134786	rs2857595		LACUNAR_STK		REC	AA	2.114	1.189	3.76	0.0108	.
hCV16134786	rs2857595		LACUNAR_STK		ADD	A	1.243	0.98	1.578	0.073	.
hCV16134786	rs2857595		NONCE_STK		ADD	A	1.158	0.984	1.363	0.0777	.
hCV16134786	rs2857595		NONCE_STK		GEN	AA	1.501	0.953	2.365	0.0799	0.16516
hCV25651109	rs35690712	SLC39A7	ISCHEMIC_STK		GEN	GG	8.255	1.015	67.158	0.0484	0.13989
hCV25651109	rs35690712	SLC39A7	ISCHEMIC_STK		DOM	GC or	8.232	1.012	66.954	0.0487	.
						GG
hCV25651109	rs35690712	SLC39A7	ISCHEMIC_STK		GEN	GC	7.978	0.963	66.101	0.0542	0.13989
hCV25651109	rs35690712	SLC39A7	NOHD_STK		GEN	GC	6.169	0.743	51.25	0.0921	0.2415
hCV25651109	rs35690712	SLC39A7	NOHD_STK		DOM	GC or	5.892	0.724	47.938	0.0973	.
						GG
hCV25651109	rs35690712	SLC39A7	NOHD_STK		GEN	GG	5.866	0.721	47.736	0.0981	0.2415
hCV30308202	rs9482985	LAMA2	RECURRENT_STK		ADD	G	1.354	1.016	1.803	0.0384	.
hCV30308202	rs9482985	LAMA2	RECURRENT_STK	AGE MALE	GEN	GG	3.706	1.016	13.521	0.0473	0.12903
				DIAB HTN
hCV30308202	rs9482985	LAMA2	RECURRENT_STK	AGE MALE	DOM	GC or	3.537	0.978	12.795	0.0542	.
				DIAB HTN		GG
hCV30308202	rs9482985	LAMA2	RECURRENT_STK		REC	GG	1.349	0.975	1.868	0.0712	.
hCV30308202	rs9482985	LAMA2	RECURRENT_STK	AGE MALE	GEN	GC	3.204	0.854	12.028	0.0845	0.12903
				DIAB HTN
hCV30308202	rs9482985	LAMA2	RECURRENT_STK		GEN	GG	2.419	0.856	6.839	0.0956	0.11116
hCV3082219	rs1884833	RFXDC1	EO_STK		ADD	A	1.273	0.982	1.65	0.0681	.
hCV3082219	rs1884833	RFXDC1	LACUNAR_STK		ADD	A	1.399	1.049	1.867	0.0225	.
hCV3082219	rs1884833	RFXDC1	LACUNAR_STK		DOM	AG or	1.424	1.035	1.959	0.03	.
						AA
hCV3082219	rs1884833	RFXDC1	LACUNAR_STK		GEN	AG	1.391	1.003	1.93	0.0483	0.07365
hCV3082219	rs1884833	RFXDC1	NONCE_STK		ADD	A	1.213	0.991	1.485	0.0608	.
hCV3082219	rs1884833	RFXDC1	NONCE_STK		DOM	AG or	1.227	0.984	1.529	0.0688	.
						AA
hCV3082219	rs1884833	RFXDC1	NONCE_STK		GEN	AG	1.214	0.969	1.52	0.0917	0.17242
hCV8942032	rs1264352	DDR1	EO_STK		DOM	CG or	1.484	1.127	1.954	0.0049	.
						CC
hCV8942032	rs1264352	DDR1	EO_STK		GEN	CG	1.488	1.12	1.978	0.0062	0.01912
hCV8942032	rs1264352	DDR1	EO_STK		ADD	C	1.394	1.092	1.78	0.0077	.
hCV8942032	rs1264352	DDR1	EO_STK	AGE MALE	GEN	CG	1.513	1.09	2.101	0.0134	0.04543
				DIAB HTN
hCV8942032	rs1264352	DDR1	EO_STK	AGE MALE	DOM	CG or	1.486	1.083	2.038	0.0142	.
				DIAB HTN		CC
hCV8942032	rs1264352	DDR1	EO_STK	AGE MALE	ADD	C	1.37	1.037	1.81	0.0265	.
				DIAB HTN
hCV8942032	rs1264352	DDR1	ISCHEMIC_STK	AGE MALE	GEN	CG	1.383	1.056	1.811	0.0183	0.061
				DIAB HTN
hCV8942032	rs1264352	DDR1	ISCHEMIC_STK	AGE MALE	DOM	CG or	1.341	1.035	1.737	0.0262	.
				DIAB HTN		CC
hCV8942032	rs1264352	DDR1	ISCHEMIC_STK	AGE MALE	ADD	C	1.241	0.991	1.554	0.0604	.
				DIAB HTN
hCV8942032	rs1264352	DDR1	ISCHEMIC_STK		GEN	CG	1.208	0.988	1.476	0.0658	0.17422
hCV8942032	rs1264352	DDR1	ISCHEMIC_STK		DOM	CG or	1.178	0.972	1.428	0.0949	.
						CC
hCV8942032	rs1264352	DDR1	LACUNAR_STK	AGE MALE	DOM	CG or	1.803	1.207	2.694	0.004	.
				DIAB HTN		CC
hCV8942032	rs1264352	DDR1	LACUNAR_STK	AGE MALE	ADD	C	1.64	1.165	2.307	0.0046	.
				DIAB HTN
hCV8942032	rs1264352	DDR1	LACUNAR_STK	AGE MALE	GEN	CG	1.77	1.166	2.689	0.0074	0.01502
				DIAB HTN
hCV8942032	rs1264352	DDR1	LACUNAR_STK		DOM	CG or	1.418	1.036	1.942	0.0294	.
						CC
hCV8942032	rs1264352	DDR1	LACUNAR_STK		ADD	C	1.328	1.023	1.725	0.0333	.
hCV8942032	rs1264352	DDR1	LACUNAR_STK		GEN	CG	1.405	1.01	1.954	0.0435	0.09148
hCV8942032	rs1264352	DDR1	NOHD_STK	AGE MALE	GEN	CG	1.358	1.021	1.807	0.0355	0.09951
				DIAB HTN
hCV8942032	rs1264352	DDR1	NOHD_STK	AGE MALE	DOM	CG or	1.309	0.994	1.723	0.0554	.
				DIAB HTN		CC
hCV8942032	rs1264352	DDR1	NOHD_STK		GEN	CG	1.218	0.98	1.513	0.0749	0.10394
hCV8942032	rs1264352	DDR1	NONCE_STK	AGE MALE	GEN	CG	1.419	1.047	1.923	0.0242	0.07825
				DIAB HTN
hCV8942032	rs1264352	DDR1	NONCE_STK	AGE MALE	DOM	CG or	1.377	1.027	1.845	0.0323	.
				DIAB HTN		CC
hCV8942032	rs1264352	DDR1	NONCE_STK		GEN	CG	1.244	0.992	1.559	0.0585	0.1603
hCV8942032	rs1264352	DDR1	NONCE_STK	AGE MALE	ADD	C	1.269	0.983	1.637	0.0672	.
				DIAB HTN
hCV8942032	rs1264352	DDR1	NONCE_STK		DOM	CG or	1.211	0.975	1.504	0.0833	.
						CC
hCV8942032	rs1264352	DDR1	RECURRENT_STK	AGE MALE	DOM	CG or	1.953	1.219	3.129	0.0054	.
				DIAB HTN		CC
hCV8942032	rs1264352	DDR1	RECURRENT_STK	AGE MALE	GEN	CG	1.965	1.206	3.201	0.0067	0.02072
				DIAB HTN
hCV8942032	rs1264352	DDR1	RECURRENT_STK	AGE MALE	ADD	C	1.728	1.15	2.594	0.0084	.
				DIAB HTN
hCV8942032	rs1264352	DDR1	RECURRENT_STK		GEN	CG	1.415	1.001	2.001	0.0494	0.14433
hCV8942032	rs1264352	DDR1	RECURRENT_STK		DOM	CG or	1.384	0.992	1.931	0.0561	.
						CC
hCV8942032	rs1264352	DDR1	RECURRENT_STK		ADD	C	1.269	0.959	1.68	0.0956	.
hCV25596936	rs6967117	EPHA1	ATHERO_STK		GEN	TC	1.432	1.071	1.913	0.0153	0.03518
hCV25596936	rs6967117	EPHA1	ATHERO_STK		DOM	TC or	1.345	1.017	1.779	0.038	.
						TT
hCV25596936	rs6967117	EPHA1	ISCHEMIC_STK		GEN	TC	1.263	0.997	1.601	0.0533	0.04107
hCV25596936	rs6967117	EPHA1	LACUNAR_STK		GEN	TC	1.433	0.981	2.092	0.0627	0.15123
hCV25596936	rs6967117	EPHA1	NOHD_STK		GEN	TC	1.302	1.01	1.679	0.0419	0.06504
hCV25596936	rs6967117	EPHA1	NONCE_STK		GEN	TC	1.438	1.108	1.865	0.0063	0.01473
hCV25596936	rs6967117	EPHA1	NONCE_STK		DOM	TC or	1.352	1.052	1.736	0.0183	.
						TT
hCV25596936	rs6967117	EPHA1	NONCE_STK		ADD	T	1.224	0.981	1.526	0.0731	.
hCV27511436	rs3750145	FZD1	ATHERO_STK		GEN	TC	2.706	1.389	5.271	0.0034	0.00764
hCV27511436	rs3750145	FZD1	ATHERO_STK	AGE MALE	GEN	TC	2.877	1.272	6.508	0.0111	0.03448
				DIAB HTN
hCV27511436	rs3750145	FZD1	ATHERO_STK		DOM	TC or	2.231	1.18	4.22	0.0136	.
						TT
hCV27511436	rs3750145	FZD1	ATHERO_STK		GEN	TT	2.105	1.11	3.993	0.0227	0.00764
hCV27511436	rs3750145	FZD1	ATHERO_STK	AGE MALE	DOM	TC or	2.397	1.108	5.184	0.0263	.
				DIAB HTN		TT
hCV27511436	rs3750145	FZD1	ATHERO_STK	AGE MALE	GEN	TT	2.271	1.046	4.93	0.0381	0.03448
				DIAB HTN
hCV27511436	rs3750145	FZD1	CE_STK		GEN	TC	2.392	1.294	4.422	0.0054	0.00015
hCV27511436	rs3750145	FZD1	CE_STK	AGE MALE	GEN	TC	3.084	1.383	6.875	0.0059	0.00609
				DIAB HTN
hCV27511436	rs3750145	FZD1	CE_STK	AGE MALE	DOM	TC or	2.257	1.055	4.828	0.0359	.
				DIAB HTN		TT
hCV27511436	rs3750145	FZD1	CE_STK	AGE MALE	GEN	TT	2.025	0.943	4.352	0.0705	0.00609
				DIAB HTN
hCV27511436	rs3750145	FZD1	CE_STK		DOM	TC or	1.647	0.917	2.958	0.0946	.
						TT
hCV27511436	rs3750145	FZD1	EO_STK		GEN	TC	5.062	2.211	11.593	0.0001	0.00053
hCV27511436	rs3750145	FZD1	EO_STK		DOM	TC or	4.226	1.901	9.394	0.0004	.
						TT
hCV27511436	rs3750145	FZD1	EO_STK	AGE MALE	GEN	TC	4.83	1.964	11.882	0.0006	0.00223
				DIAB HTN
hCV27511436	rs3750145	FZD1	EO_STK		GEN	TT	3.983	1.786	8.882	0.0007	0.00053
hCV27511436	rs3750145	FZD1	EO_STK	AGE MALE	DOM	TC or	3.916	1.653	9.279	0.0019	.
				DIAB HTN		TT
hCV27511436	rs3750145	FZD1	EO_STK	AGE MALE	GEN	TT	3.668	1.542	8.725	0.0033	0.00223
				DIAB HTN
hCV27511436	rs3750145	FZD1	ISCHEMIC_STK	AGE MALE	GEN	TC	3.449	1.798	6.618	0.0002	0.00063
				DIAB HTN
hCV27511436	rs3750145	FZD1	ISCHEMIC_STK		DOM	TC or	2.217	1.397	3.521	0.0007	.
						TT
hCV27511436	rs3750145	FZD1	ISCHEMIC_STK	AGE MALE	DOM	TC or	2.78	1.498	5.158	0.0012	.
				DIAB HTN		TT
hCV27511436	rs3750145	FZD1	ISCHEMIC_STK	AGE MALE	GEN	TT	2.59	1.392	4.82	0.0027	0.00063
				DIAB HTN
hCV27511436	rs3750145	FZD1	ISCHEMIC_STK		GEN	TT	2.033	1.277	3.236	0.0028	0.00001
hCV27511436	rs3750145	FZD1	LACUNAR_STK	AGE MALE	GEN	TC	12.63	2.356	67.742	0.0031	0.00773
				DIAB HTN
hCV27511436	rs3750145	FZD1	LACUNAR_STK		GEN	TC	8.049	1.905	34.008	0.0046	0.00667
hCV27511436	rs3750145	FZD1	LACUNAR_STK	AGE MALE	DOM	TC or	9.88	1.896	51.473	0.0065	.
				DIAB HTN		TT
hCV27511436	rs3750145	FZD1	LACUNAR_STK	AGE MALE	GEN	TT	9.1	1.743	47.499	0.0088	0.00773
				DIAB HTN
hCV27511436	rs3750145	FZD1	LACUNAR_STK		DOM	TC or	6.318	1.528	26.128	0.0109	.
						TT
hCV27511436	rs3750145	FZD1	LACUNAR_STK		GEN	TT	5.858	1.413	24.288	0.0148	0.00667
hCV27511436	rs3750145	FZD1	NOHD_STK		GEN	TC	2.83	1.661	4.824	0.0001	0.00002
hCV27511436	rs3750145	FZD1	NOHD_STK	AGE MALE	GEN	TC	3.231	1.612	6.479	0.001	0.00243
				DIAB HTN
hCV27511436	rs3750145	FZD1	NOHD_STK		DOM	TC or	2.088	1.258	3.467	0.0044	.
						TT
hCV27511436	rs3750145	FZD1	NOHD_STK	AGE MALE	DOM	TC or	2.586	1.334	5.012	0.0049	.
				DIAB HTN		TT
hCV27511436	rs3750145	FZD1	NOHD_STK	AGE MALE	GEN	TT	2.4	1.235	4.665	0.0098	0.00243
				DIAB HTN
hCV27511436	rs3750145	FZD1	NOHD_STK		GEN	TT	1.891	1.135	3.149	0.0144	0.00002
hCV27511436	rs3750145	FZD1	NONCE_STK	AGE MALE	GEN	TC	3.955	1.807	8.657	0.0006	0.00244
				DIAB HTN
hCV27511436	rs3750145	FZD1	NONCE_STK		DOM	TC or	2.827	1.555	5.142	0.0007	.
						TT
hCV27511436	rs3750145	FZD1	NONCE_STK		GEN	TT	2.657	1.457	4.843	0.0014	0.00023
hCV27511436	rs3750145	FZD1	NONCE_STK	AGE MALE	DOM	TC or	3.312	1.571	6.985	0.0017	.
				DIAB HTN		TT
hCV27511436	rs3750145	FZD1	NONCE_STK	AGE MALE	GEN	TT	3.137	1.483	6.636	0.0028	0.00244
				DIAB HTN
hCV29401764	rs7793552	LOC646588	ATHERO_STK	AGE MALE	GEN	CT	1.633	0.952	2.798	0.0746	0.17293
				DIAB HTN
hCV15857769	rs2924914		ATHERO_STK		ADD	T	1.187	1.011	1.394	0.0361	.
hCV15857769	rs2924914		ATHERO_STK		DOM	TC or	1.255	1.011	1.557	0.0391	.
						TT
hCV15857769	rs2924914		ATHERO_STK		GEN	TC	1.23	0.979	1.545	0.0756	0.1026
hCV15857769	rs2924914		ATHERO_STK	AGE MALE	GEN	TT	1.532	0.946	2.48	0.0827	0.21882
				DIAB HTN
hCV15857769	rs2924914		ATHERO_STK		GEN	TT	1.36	0.947	1.952	0.096	0.1026
hCV15857769	rs2924914		CE_STK		GEN	TC	1.295	1.029	1.63	0.0275	0.0333
hCV15857769	rs2924914		CE_STK		DOM	TC or	1.209	0.97	1.507	0.0919	.
						TT
hCV15857769	rs2924914		ISCHEMIC_STK		GEN	TC	1.252	1.05	1.493	0.0124	0.04329
hCV15857769	rs2924914		ISCHEMIC_STK		DOM	TC or	1.219	1.031	1.441	0.0203	.
						TT
hCV15857769	rs2924914		ISCHEMIC_STK		ADD	T	1.117	0.983	1.27	0.0904	.
hCV15857769	rs2924914		NOHD_STK		GEN	TC	1.263	1.043	1.53	0.0167	0.05587
hCV15857769	rs2924914		NOHD_STK		DOM	TC or	1.228	1.024	1.474	0.0271	.
						TT
hCV15857769	rs2924914		NONCE_STK		DOM	TC or	1.226	1.013	1.483	0.0365	.
						TT
hCV15857769	rs2924914		NONCE_STK		GEN	TC	1.224	1.001	1.497	0.0489	0.11225
hCV15857769	rs2924914		NONCE_STK		ADD	T	1.149	0.996	1.327	0.057	.
hCV15857769	rs2924914		RECURRENT_STK		GEN	TC	1.788	1.299	2.463	0.0004	0.00102
hCV15857769	rs2924914		RECURRENT_STK		DOM	TC or	1.641	1.203	2.238	0.0018	.
						TT
hCV15857769	rs2924914		RECURRENT_STK	AGE MALE	GEN	TC	1.733	1.112	2.701	0.0151	0.04261
				DIAB HTN
hCV15857769	rs2924914		RECURRENT_STK	AGE MALE	DOM	TC or	1.596	1.042	2.443	0.0315	.
				DIAB HTN		TT
hCV15857769	rs2924914		RECURRENT_STK		ADD	T	1.259	1.003	1.58	0.0471	.
hCV29539757	rs10110659	KCNQ3	NONCE_STK		GEN	CA	1.401	0.977	2.009	0.0671	0.0978
hCV1348610	rs3739636	C9orf46	ISCHEMIC_STK	AGE MALE	GEN	AG	1.307	1.014	1.685	0.0389	0.11763
				DIAB HTN
hCV1348610	rs3739636	C9orf46	ISCHEMIC_STK	AGE MALE	DOM	AG or	1.262	0.993	1.602	0.0567	.
				DIAB HTN		AA
hCV1348610	rs3739636	C9orf46	NOHD_STK	AGE MALE	GEN	AG	1.285	0.981	1.683	0.0688	0.15881
				DIAB HTN
hCV1348610	rs3739636	C9orf46	NONCE_STK	AGE MALE	GEN	AG	1.283	0.96	1.714	0.0923	0.22581
				DIAB HTN
hCV26505812	rs10757274	C9P21	ATHERO_STK	AGE MALE	REC	GG	1.363	0.956	1.943	0.0866	.
				DIAB HTN
hCV26505812	rs10757274	C9P21	NONCE_STK	AGE MALE	REC	GG	1.32	0.959	1.818	0.0886	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	CE_STK		GEN	TG	1.479	1.172	1.866	0.001	0.00436
hCV2169762	rs1804689	HPS1	CE_STK		DOM	TG or	1.422	1.139	1.774	0.0018	.
						TT
hCV2169762	rs1804689	HPS1	CE_STK		ADD	T	1.216	1.033	1.433	0.0189	.
hCV2169762	rs1804689	HPS1	CE_STK	AGE MALE	DOM	TG or	1.401	1.046	1.876	0.0237	.
				DIAB HTN		TT
hCV2169762	rs1804689	HPS1	CE_STK	AGE MALE	GEN	TG	1.41	1.038	1.916	0.0281	0.07665
				DIAB HTN
hCV2169762	rs1804689	HPS1	CE_STK	AGE MALE	ADD	T	1.25	1.003	1.559	0.0473	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	EO_STK	AGE MALE	REC	TT	1.493	0.946	2.357	0.0852	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	ISCHEMIC_STK	AGE MALE	ADD	T	1.246	1.052	1.476	0.0108	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	ISCHEMIC_STK		DOM	TG or	1.233	1.043	1.456	0.014	.
						TT
hCV2169762	rs1804689	HPS1	ISCHEMIC_STK	AGE MALE	DOM	TG or	1.31	1.046	1.641	0.0187	.
				DIAB HTN		TT
hCV2169762	rs1804689	HPS1	ISCHEMIC_STK		GEN	TG	1.236	1.035	1.476	0.0192	0.04864
hCV2169762	rs1804689	HPS1	ISCHEMIC_STK	AGE MALE	GEN	TT	1.536	1.045	2.259	0.0291	0.03859
				DIAB HTN
hCV2169762	rs1804689	HPS1	ISCHEMIC_STK		ADD	T	1.148	1.014	1.301	0.0296	.
hCV2169762	rs1804689	HPS1	ISCHEMIC_STK	AGE MALE	GEN	TG	1.258	0.991	1.597	0.0589	0.03859
				DIAB HTN
hCV2169762	rs1804689	HPS1	ISCHEMIC_STK	AGE MALE	REC	TT	1.382	0.955	2	0.0861	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	LACUNAR_STK	AGE MALE	DOM	TG or	1.362	0.949	1.955	0.0934	.
				DIAB HTN		TT
hCV2169762	rs1804689	HPS1	NOHD_STK		DOM	TG or	1.35	1.125	1.619	0.0012	.
						TT
hCV2169762	rs1804689	HPS1	NOHD_STK		GEN	TG	1.354	1.116	1.642	0.0021	0.00545
hCV2169762	rs1804689	HPS1	NOHD_STK		ADD	T	1.218	1.064	1.395	0.0042	.
hCV2169762	rs1804689	HPS1	NOHD_STK	AGE MALE	ADD	T	1.281	1.069	1.534	0.0073	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	NOHD_STK	AGE MALE	DOM	TG or	1.386	1.089	1.763	0.0079	.
				DIAB HTN		TT
hCV2169762	rs1804689	HPS1	NOHD_STK	AGE MALE	GEN	TG	1.347	1.044	1.737	0.0221	0.02354
				DIAB HTN
hCV2169762	rs1804689	HPS1	NOHD_STK	AGE MALE	GEN	TT	1.553	1.031	2.34	0.035	0.02354
				DIAB HTN
hCV2169762	rs1804689	HPS1	NOHD_STK		GEN	TT	1.335	0.985	1.809	0.063	0.00545
hCV2169762	rs1804689	HPS1	NONCE_STK	AGE MALE	GEN	TT	1.497	0.971	2.308	0.0677	0.17878
				DIAB HTN
hCV2169762	rs1804689	HPS1	NONCE_STK	AGE MALE	ADD	T	1.188	0.981	1.438	0.0774	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	NONCE_STK	AGE MALE	REC	TT	1.422	0.939	2.153	0.0966	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	ATHERO_STK		GEN	GG	2.437	1.292	4.596	0.0059	0.01855
hCV27830265	rs12762303	ALOX5	ATHERO_STK		REC	GG	2.354	1.254	4.421	0.0077	.
hCV27830265	rs12762303	ALOX5	ATHERO_STK	AGE MALE	ADD	G	1.38	1.051	1.812	0.0204	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	ATHERO_STK		ADD	G	1.256	1.027	1.535	0.0262	.
hCV27830265	rs12762303	ALOX5	ATHERO_STK	AGE MALE	GEN	GG	2.705	1.09	6.711	0.0318	0.04449
				DIAB HTN
hCV27830265	rs12762303	ALOX5	ATHERO_STK	AGE MALE	REC	GG	2.508	1.018	6.179	0.0456	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	ATHERO_STK	AGE MALE	DOM	GA or	1.356	0.997	1.845	0.0522	.
				DIAB HTN		GG
hCV27830265	rs12762303	ALOX5	EO_STK	AGE MALE	ADD	G	1.294	0.988	1.697	0.0616	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	EO_STK	AGE MALE	DOM	GA or	1.322	0.979	1.786	0.0687	.
				DIAB HTN		GG
hCV27830265	rs12762303	ALOX5	EO_STK	AGE MALE	GEN	GA	1.302	0.956	1.772	0.0938	0.17365
				DIAB HTN
hCV27830265	rs12762303	ALOX5	ISCHEMIC_STK		GEN	GG	1.909	1.098	3.32	0.0219	0.06853
hCV27830265	rs12762303	ALOX5	ISCHEMIC_STK		REC	GG	1.88	1.084	3.26	0.0246	.
hCV27830265	rs12762303	ALOX5	ISCHEMIC_STK	AGE MALE	ADD	G	1.231	0.99	1.53	0.0618	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	ISCHEMIC_STK	AGE MALE	GEN	GG	2.011	0.94	4.304	0.0719	0.12112
				DIAB HTN
hCV27830265	rs12762303	ALOX5	ISCHEMIC_STK	AGE MALE	REC	GG	1.923	0.902	4.099	0.0903	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	ISCHEMIC_STK		ADD	G	1.146	0.977	1.344	0.0941	.
hCV27830265	rs12762303	ALOX5	LACUNAR_STK	AGE MALE	ADD	G	1.391	0.982	1.972	0.0632	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	LACUNAR_STK	AGE MALE	DOM	GA or	1.408	0.958	2.069	0.082	.
				DIAB HTN		GG
hCV27830265	rs12762303	ALOX5	NOHD_STK		GEN	GG	1.889	1.048	3.404	0.0342	0.10105
hCV27830265	rs12762303	ALOX5	NOHD_STK		REC	GG	1.859	1.035	3.339	0.0381	.
hCV27830265	rs12762303	ALOX5	NOHD_STK	AGE MALE	ADD	G	1.246	0.988	1.571	0.0637	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	NONCE_STK	AGE MALE	ADD	G	1.376	1.074	1.761	0.0114	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	NONCE_STK		GEN	GG	2.132	1.172	3.878	0.0132	0.02459
hCV27830265	rs12762303	ALOX5	NONCE_STK		ADD	G	1.248	1.042	1.493	0.0158	.
hCV27830265	rs12762303	ALOX5	NONCE_STK		REC	GG	2.037	1.124	3.693	0.019	.
hCV27830265	rs12762303	ALOX5	NONCE_STK	AGE MALE	DOM	GA or	1.386	1.051	1.83	0.021	.
				DIAB HTN		GG
hCV27830265	rs12762303	ALOX5	NONCE_STK	AGE MALE	GEN	GA	1.335	1.004	1.775	0.0472	0.03807
				DIAB HTN
hCV27830265	rs12762303	ALOX5	NONCE_STK		DOM	GA or	1.221	0.996	1.497	0.0553	.
						GG
hCV27830265	rs12762303	ALOX5	NONCE_STK	AGE MALE	GEN	GG	2.187	0.939	5.093	0.0697	0.03807
				DIAB HTN
hCV27830265	rs12762303	ALOX5	RECURRENT_STK		REC	GG	3.032	1.42	6.474	0.0042	.
hCV27830265	rs12762303	ALOX5	RECURRENT_STK		GEN	GG	2.907	1.354	6.243	0.0062	0.01156
hCV27830265	rs12762303	ALOX5	RECURRENT_STK	AGE MALE	REC	GG	4.128	1.238	13.766	0.021	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	RECURRENT_STK	AGE MALE	GEN	GG	4.048	1.205	13.592	0.0237	0.06695
				DIAB HTN
hCV1053082	rs544115	NEU3	ATHERO_STK	AGE MALE	DOM	CT or	2.424	1.101	5.338	0.028	.
				DIAB HTN		CC
hCV1053082	rs544115	NEU3	ATHERO_STK	AGE MALE	GEN	CC	2.412	1.089	5.342	0.03	0.08891
				DIAB HTN
hCV1053082	rs544115	NEU3	ATHERO_STK	AGE MALE	GEN	CT	2.452	1.079	5.571	0.0322	0.08891
				DIAB HTN
hCV1053082	rs544115	NEU3	CE_STK	AGE MALE	GEN	CC	2.519	1.057	6.004	0.0372	0.11133
				DIAB HTN
hCV1053082	rs544115	NEU3	CE_STK	AGE MALE	DOM	CT or	2.464	1.039	5.844	0.0406	.
				DIAB HTN		CC
hCV1053082	rs544115	NEU3	CE_STK		ADD	C	1.228	1.001	1.508	0.0494	.
hCV1053082	rs544115	NEU3	CE_STK	AGE MALE	GEN	CT	2.339	0.958	5.715	0.0622	0.11133
				DIAB HTN
hCV1053082	rs544115	NEU3	CE_STK		REC	CC	1.233	0.972	1.564	0.084	.
hCV1053082	rs544115	NEU3	EO_STK		DOM	CT or	2.443	1.139	5.24	0.0218	.
						CC
hCV1053082	rs544115	NEU3	EO_STK		GEN	CC	2.453	1.139	5.282	0.0219	0.07158
hCV1053082	rs544115	NEU3	EO_STK		GEN	CT	2.419	1.101	5.313	0.0278	0.07158
hCV1053082	rs544115	NEU3	EO_STK	AGE MALE	ADD	C	1.306	1.002	1.703	0.0483	.
				DIAB HTN
hCV1053082	rs544115	NEU3	EO_STK	AGE MALE	GEN	CC	2.182	0.894	5.324	0.0865	0.11774
				DIAB HTN
hCV1053082	rs544115	NEU3	EO_STK	AGE MALE	REC	CC	1.297	0.959	1.752	0.0909	.
				DIAB HTN
hCV1053082	rs544115	NEU3	ISCHEMIC_STK	AGE MALE	DOM	CT or	2.441	1.274	4.675	0.0071	.
				DIAB HTN		CC
hCV1053082	rs544115	NEU3	ISCHEMIC_STK	AGE MALE	GEN	CC	2.438	1.267	4.689	0.0076	0.02673
				DIAB HTN
hCV1053082	rs544115	NEU3	ISCHEMIC_STK	AGE MALE	GEN	CT	2.449	1.249	4.801	0.0091	0.02673
				DIAB HTN
hCV1053082	rs544115	NEU3	ISCHEMIC_STK		GEN	CC	1.695	1.052	2.732	0.0302	0.08337
hCV1053082	rs544115	NEU3	ISCHEMIC_STK		DOM	CT or	1.658	1.032	2.664	0.0365	.
						CC
hCV1053082	rs544115	NEU3	ISCHEMIC_STK		GEN	CT	1.577	0.965	2.576	0.0691	0.08337
hCV1053082	rs544115	NEU3	ISCHEMIC_STK		ADD	C	1.152	0.989	1.343	0.0698	.
hCV1053082	rs544115	NEU3	NOHD_STK	AGE MALE	DOM	CT or	2.225	1.109	4.465	0.0244	.
				DIAB HTN		CC
hCV1053082	rs544115	NEU3	NOHD_STK	AGE MALE	GEN	CT	2.282	1.109	4.692	0.025	0.07672
				DIAB HTN
hCV1053082	rs544115	NEU3	NOHD_STK	AGE MALE	GEN	CC	2.202	1.092	4.438	0.0274	0.07672
				DIAB HTN
hCV1053082	rs544115	NEU3	NOHD_STK		GEN	CC	1.715	1.006	2.924	0.0475	0.13875
hCV1053082	rs544115	NEU3	NOHD_STK		DOM	CT or	1.695	0.998	2.88	0.0509	.
						CC
hCV1053082	rs544115	NEU3	NOHD_STK		GEN	CT	1.651	0.955	2.855	0.0727	0.13875
hCV1053082	rs544115	NEU3	NONCE_STK	AGE MALE	DOM	CT or	2.388	1.164	4.897	0.0175	.
				DIAB HTN		CC
hCV1053082	rs544115	NEU3	NONCE_STK	AGE MALE	GEN	CT	2.451	1.164	5.163	0.0183	0.05761
				DIAB HTN
hCV1053082	rs544115	NEU3	NONCE_STK	AGE MALE	GEN	CC	2.36	1.145	4.866	0.02	0.05761
				DIAB HTN
hCV1053082	rs544115	NEU3	NONCE_STK		DOM	CT or	1.684	0.963	2.945	0.0673	.
						CC
hCV1053082	rs544115	NEU3	NONCE_STK		GEN	CC	1.69	0.963	2.966	0.0674	0.18668
hCV1053082	rs544115	NEU3	NONCE_STK		GEN	CT	1.672	0.939	2.977	0.0808	0.18668
hCV1452085	rs12223005	TRIM22	ISCHEMIC_STK	AGE MALE	GEN	CA	2.844	0.95	8.517	0.0617	0.07446
				DIAB HTN
hCV1452085	rs12223005	TRIM22	LACUNAR_STK	AGE MALE	GEN	CA	8.604	0.863	85.766	0.0666	0.00063
				DIAB HTN
hCV1452085	rs12223005	TRIM22	NOHD_STK	AGE MALE	GEN	CA	4.953	1.405	17.456	0.0128	0.01831
				DIAB HTN
hCV1452085	rs12223005	TRIM22	NOHD_STK	AGE MALE	DOM	CA or	3.875	1.132	13.267	0.031	.
				DIAB HTN		CC
hCV1452085	rs12223005	TRIM22	NOHD_STK	AGE MALE	GEN	CC	3.687	1.075	12.65	0.038	0.01831
				DIAB HTN
hCV1452085	rs12223005	TRIM22	NONCE_STK	AGE MALE	GEN	CA	2.892	0.881	9.491	0.0798	0.03384
				DIAB HTN
hCV1452085	rs12223005	TRIM22	RECURRENT_STK	AGE MALE	GEN	CA	12.05	0.995	145.92	0.0505	0.02942
				DIAB HTN
hCV302629	rs9284183	UBAC2	EO_STK		GEN	GA	1.268	0.982	1.638	0.0684	0.16605
hCV11474611	rs3814843	CALM1	ATHERO_STK		GEN	GT	1.408	0.962	2.061	0.0785	0.15447
hCV11474611	rs3814843	CALM1	CE_STK	AGE MALE	GEN	GG	7.206	0.691	75.167	0.0988	0.25264
				DIAB HTN
hCV11474611	rs3814843	CALM1	CE_STK	AGE MALE	REC	GG	7.176	0.688	74.834	0.0995	.
				DIAB HTN
hCV1262973	rs229653	PLEKHG3	CE_STK		GEN	AG	1.33	0.99	1.789	0.0586	0.03312
hCV27892569	rs4903741	NRXN3	CE_STK		GEN	CC	1.569	1.022	2.409	0.0394	0.11153
hCV27892569	rs4903741	NRXN3	CE_STK		REC	CC	1.514	0.996	2.303	0.0525	.
hCV27892569	rs4903741	NRXN3	CE_STK		ADD	C	1.184	0.993	1.412	0.06	.
hCV27892569	rs4903741	NRXN3	NOHD_STK		ADD	C	1.139	0.982	1.32	0.0847	.
hCV27077072	rs8060368		RECURRENT_STK		ADD	C	1.253	0.99	1.587	0.0605	.
hCV27077072	rs8060368		RECURRENT_STK		REC	CC	1.308	0.967	1.77	0.0816	.
hCV27077072	rs8060368		RECURRENT_STK	AGE MALE	GEN	CC	1.952	0.901	4.23	0.0899	0.22584
				DIAB HTN
hCV32160712	rs11079160		CE_STK		GEN	TT	1.93	1.061	3.512	0.0313	0.0843
hCV32160712	rs11079160		CE_STK		REC	TT	1.872	1.034	3.391	0.0385	.
hCV32160712	rs11079160		CE_STK		ADD	T	1.213	0.988	1.489	0.0648	.
hCV32160712	rs11079160		EO_STK	AGE MALE	REC	TT	2.382	1.026	5.532	0.0435	.
				DIAB HTN
hCV32160712	rs11079160		EO_STK	AGE MALE	GEN	TT	2.361	1.011	5.513	0.047	0.12823
				DIAB HTN
hCV32160712	rs11079160		ISCHEMIC_STK		GEN	TT	1.563	0.953	2.565	0.0772	0.1756
hCV32160712	rs11079160		ISCHEMIC_STK		REC	TT	1.529	0.935	2.502	0.0907	.
hCV1619596	rs1048621	SDCBP2	CE_STK	AGE MALE	GEN	AG	1.412	1.038	1.92	0.0281	0.08963
				DIAB HTN
hCV1619596	rs1048621	SDCBP2	CE_STK	AGE MALE	DOM	AG or	1.362	1.017	1.823	0.0382	.
				DIAB HTN		AA
hCV1619596	rs1048621	SDCBP2	CE_STK		ADD	A	1.168	0.982	1.389	0.0794	.
hCV1619596	rs1048621	SDCBP2	EO_STK		DOM	AG or	1.314	1.03	1.677	0.0281	.
						AA
hCV1619596	rs1048621	SDCBP2	EO_STK		GEN	AG	1.33	1.029	1.719	0.0292	0.08594
hCV1619596	rs1048621	SDCBP2	EO_STK		ADD	A	1.205	0.993	1.461	0.0586	.
hCV1619596	rs1048621	SDCBP2	EO_STK	AGE MALE	DOM	AG or	1.295	0.979	1.713	0.0699	.
				DIAB HTN		AA
hCV1619596	rs1048621	SDCBP2	EO_STK	AGE MALE	GEN	AG	1.298	0.967	1.741	0.0822	0.1932
				DIAB HTN
hCV1619596	rs1048621	SDCBP2	ISCHEMIC_STK	AGE MALE	GEN	AG	1.271	1.001	1.612	0.0486	0.14298
				DIAB HTN
hCV1619596	rs1048621	SDCBP2	ISCHEMIC_STK	AGE MALE	DOM	AG or	1.239	0.989	1.554	0.0629	.
				DIAB HTN		AA
hCV1619596	rs1048621	SDCBP2	ISCHEMIC_STK		ADD	A	1.125	0.985	1.284	0.0826	.
hCV2358247	rs415989	WFDC3	RECURRENT_STK		DOM	GA or	1.521	0.989	2.34	0.0561	.
						GG
hCV2358247	rs415989	WFDC3	RECURRENT_STK		GEN	GA	1.527	0.987	2.363	0.0574	0.16029
hCV2358247	rs415989	WFDC3	RECURRENT_STK		ADD	G	1.468	0.978	2.204	0.0636	.
hCV29537898	rs6073804		NOHD_STK		GEN	TC	1.303	1.011	1.679	0.0406	0.06312
hCV29537898	rs6073804		NOHD_STK		DOM	TC or	1.258	0.98	1.614	0.0712	.
						TT
hCV29537898	rs6073804		RECURRENT_STK		DOM	TC or	1.866	1.288	2.703	0.001	.
						TT
hCV29537898	rs6073804		RECURRENT_STK		ADD	T	1.749	1.25	2.448	0.0011	.
hCV29537898	rs6073804		RECURRENT_STK		GEN	TC	1.848	1.264	2.701	0.0015	0.00417
hCV1723718	rs12481805	UMODL1	EO_STK	AGE MALE	REC	AA	1.543	0.928	2.565	0.0944	.
				DIAB HTN
hCV1723718	rs12481805	UMODL1	LACUNAR_STK		REC	AA	1.773	1.119	2.809	0.0147	.
hCV1723718	rs12481805	UMODL1	LACUNAR_STK		GEN	AA	1.632	1.011	2.633	0.045	0.02572

TABLE 21
								95%	95%	ProbChi
								Low-	Up-	Sq (2-
						GENO-	Odds	er	per	sided p-	PVAL-
hCV #	rs #	Gene	OUTCOME	ADJUST	MODE	TYPE	Ratio	CL	CL	value)	UE_2DF
hCV11548152	rs11580249		EO_STK	AGE MALE	GEN	TG	1.231	0.899	1.686	0.1947	0.43131
				DIAB HTN
hCV1958451	rs2985822	MIER1	EO_STK		DOM	GT or	1.409	0.879	2.258	0.1545	.
						GG
hCV1958451	rs2985822	MIER1	ISCHEMIC_STK		GEN	GT	1.279	0.909	1.8	0.1576	0.08689
hCV1958451	rs2985822	MIER1	LACUNAR_STK		DOM	GT or	1.638	0.857	3.131	0.1351	.
						GG
hCV1958451	rs2985822	MIER1	LACUNAR_STK	AGE MALE	GEN	GT	1.734	0.753	3.995	0.196	0.39776
				DIAB HTN
hCV1958451	rs2985822	MIER1	NOHD_STK		GEN	GT	1.284	0.887	1.859	0.1849	0.03579
hCV1958451	rs2985822	MIER1	NONCE_STK		GEN	GT	1.361	0.915	2.024	0.1281	0.13834
hCV27494483	rs3748743	SLC22A15	CE_STK	AGE MALE	GEN	TC	1.433	0.867	2.366	0.1602	0.27105
				DIAB HTN
hCV27504565	rs3219489	MUTYH	ISCHEMIC_STK		DOM	CG or	1.305	0.896	1.901	0.1656	.
						CC
hCV27504565	rs3219489	MUTYH	NOHD_STK		GEN	CC	1.339	0.872	2.055	0.1821	0.11469
hCV27504565	rs3219489	MUTYH	NOHD_STK		DOM	CG or	1.407	0.922	2.146	0.1129	.
						CC
hCV27504565	rs3219489	MUTYH	NOHD_STK	AGE MALE	GEN	CC	1.519	0.859	2.683	0.1503	0.18169
				DIAB HTN
hCV27504565	rs3219489	MUTYH	NOHD_STK	AGE MALE	DOM	CG or	1.587	0.906	2.782	0.1066	.
				DIAB HTN		CC
hCV27504565	rs3219489	MUTYH	NONCE_STK		DOM	CG or	1.351	0.871	2.095	0.1786	.
						CC
hCV27504565	rs3219489	MUTYH	NONCE_STK	AGE MALE	DOM	CG or	1.593	0.877	2.895	0.1265	.
				DIAB HTN		CC
hCV27504565	rs3219489	MUTYH	RECURENT_STK	AGE MALE	GEN	CC	2.313	0.826	6.477	0.1106	0.15677
				DIAB HTN
hCV31227848	rs11809423	HIVEP3	ATHERO_STK		GEN	TC	1.404	0.927	2.128	0.1094	0.06604
hCV31227848	rs11809423	HIVEP3	NOHD_STK		GEN	TC	1.284	0.889	1.853	0.1822	0.0563
hCV31227848	rs11809423	HIVEP3	NONCE_STK		GEN	TC	1.327	0.908	1.939	0.1434	0.12332
hCV454333	rs10916581	NVL	RECURRENT_STK		GEN	CT	5.03	0.664	38.1	0.1179	0.09083
hCV454333	rs10916581	NVL	RECURRENT_STK		GEN	CC	3.778	0.504	28.32	0.1959	0.09083
hCV454333	rs10916581	NVL	RECURRENT_STK		DOM	CT or	4.101	0.548	30.66	0.1692	.
						CC
hCV8754449	rs781226	TESK2	NOHD_STK		GEN	CT	1.375	0.894	2.114	0.1474	0.25013
hCV8754449	rs781226	TESK2	NOHD_STK	AGE MALE	GEN	CT	1.508	0.856	2.656	0.1552	0.34108
				DIAB HTN
hCV8754449	rs781226	TESK2	NONCE_STK	AGE MALE	GEN	CT	1.536	0.841	2.803	0.1625	0.25117
				DIAB HTN
hCV8754449	rs781226	TESK2	RECURRENT_STK	AGE MALE	GEN	CC	2.321	0.83	6.495	0.1087	0.20413
				DIAB HTN
hCV2091644	rs1010	VAMP8	CE_STK		GEN	CC	1.287	0.933	1.776	0.1236	0.25285
hCV2091644	rs1010	VAMP8	CE_STK		ADD	C	1.114	0.952	1.305	0.1788	.
hCV2091644	rs1010	VAMP8	EO_STK	AGE MALE	GEN	CT	1.238	0.912	1.682	0.1714	0.34826
				DIAB HTN
hCV2091644	rs1010	VAMP8	ISCHEMIC_STK		GEN	CC	1.189	0.927	1.524	0.1731	0.28614
hCV2091644	rs1010	VAMP8	ISCHEMIC_STK		REC	CC	1.198	0.957	1.499	0.115	.
hCV2091644	rs1010	VAMP8	RECURRENT_STK	AGE MALE	GEN	CT	1.385	0.865	2.216	0.1753	0.3581
				DIAB HTN
hCV7425232	rs3900940	MYH15	EO_STK	AGE MALE	DOM	CT or	1.208	0.913	1.596	0.1853	.
				DIAB HTN		CC
hCV8820007	rs938390		ATHERO_STK		GEN	TT	1.428	0.865	2.359	0.1639	0.18574
hCV8820007	rs938390		ATHERO_STK		DOM	TA or	1.486	0.906	2.437	0.1171	.
						TT
hCV8820007	rs938390		ATHERO_STK	AGE MALE	GEN	TA	1.603	0.846	3.038	0.1475	0.28036
				DIAB HTN
hCV8820007	rs938390		CE_STK		GEN	TA	1.389	0.846	2.282	0.194	0.14033
hCV8820007	rs938390		EO_STK		GEN	TA	1.523	0.889	2.609	0.1254	0.30388
hCV8820007	rs938390		EO_STK		DOM	TA or	1.432	0.862	2.379	0.1661	.
						TT
hCV8820007	rs938390		EO_STK	AGE MALE	GEN	TA	1.659	0.904	3.046	0.1025	0.25362
				DIAB HTN
hCV8820007	rs938390		EO_STK	AGE MALE	GEN	TT	1.463	0.818	2.616	0.1998	0.25362
				DIAB HTN
hCV8820007	rs938390		EO_STK	AGE MALE	DOM	TA or	1.525	0.861	2.704	0.1482	.
				DIAB HTN		TT
hCV8820007	rs938390		ISCHEMIC_STK	AGE MALE	DOM	TA or	1.382	0.871	2.194	0.1698	.
				DIAB HTN		TT
hCV8820007	rs938390		NOHD_STK	AGE MALE	GEN	TT	1.434	0.856	2.403	0.1711	0.07825
				DIAB HTN
hCV8820007	rs938390		NONCE_STK		GEN	TA	1.386	0.897	2.142	0.1412	0.28065
hCV8820007	rs938390		NONCE_STK	AGE MALE	GEN	TA	1.555	0.891	2.713	0.1203	0.27256
				DIAB HTN
hCV8820007	rs938390		NONCE_STK	AGE MALE	DOM	TA or	1.431	0.845	2.423	0.1829	.
				DIAB HTN		TT
hCV8820007	rs938390		RECURRENT_STK		GEN	TA	1.702	0.812	3.567	0.1592	0.19862
hCV11354788	rs12644625	LOC729065	CE_STK	AGE MALE	REC	TT	2.249	0.823	6.145	0.1141	.
				DIAB HTN
hCV11354788	rs12644625	LOC729065	EO_STK	AGE MALE	GEN	TT	2.129	0.727	6.236	0.1683	0.0564
				DIAB HTN
hCV11354788	rs12644625	LOC729065	ISCHEMIC_STK	AGE MALE	GEN	TT	1.8	0.759	4.269	0.1821	0.03661
				DIAB HTN
hCV11354788	rs12644625	LOC729065	NOHD_STK		GEN	TT	1.651	0.849	3.213	0.1397	0.02034
hCV11354788	rs12644625	LOC729065	NOHD_STK		REC	TT	1.552	0.799	3.015	0.1942	.
hCV11354788	rs12644625	LOC729065	NOHD_STK	AGE MALE	GEN	TT	1.985	0.81	4.86	0.1337	0.06231
				DIAB HTN
hCV11354788	rs12644625	LOC729065	NOHD_STK	AGE MALE	REC	TT	1.86	0.761	4.543	0.1733	.
				DIAB HTN
hCV11354788	rs12644625	LOC729065	NONCE_STK		ADD	T	1.186	0.967	1.454	0.1013	.
hCV11354788	rs12644625	LOC729065	NONCE_STK	AGE MALE	GEN	TC	1.288	0.941	1.763	0.1139	0.25236
				DIAB HTN
hCV11354788	rs12644625	LOC729065	NONCE_STK	AGE MALE	ADD	T	1.261	0.955	1.666	0.102	.
				DIAB HTN
hCV15854171	rs2231137	ABCG2	CE_STK		ADD	C	1.357	0.865	2.129	0.184	.
hCV16158671	rs2200733		ATHERO_STK	AGE MALE	GEN	TT	2.133	0.724	6.287	0.1696	0.07966
				DIAB HTN
hCV16158671	rs2200733		CE_STK	AGE MALE	REC	TT	2.054	0.774	5.452	0.1483	.
				DIAB HTN
hCV16158671	rs2200733		EO_STK	AGE MALE	GEN	TT	1.982	0.7	5.614	0.1976	0.07117
				DIAB HTN
hCV16158671	rs2200733		ISCHEMIC_STK		GEN	TT	1.506	0.815	2.783	0.1916	0.00631
hCV16158671	rs2200733		ISCHEMIC_STK	AGE MALE	GEN	TT	1.874	0.819	4.292	0.1372	0.03074
				DIAB HTN
hCV16158671	rs2200733		ISCHEMIC_STK	AGE MALE	REC	TT	1.743	0.763	3.982	0.1873	.
				DIAB HTN
hCV16158671	rs2200733		NOHD_STK		GEN	TT	1.705	0.898	3.238	0.1031	0.01299
hCV16158671	rs2200733		NOHD_STK		REC	TT	1.599	0.844	3.032	0.1501	.
hCV16158671	rs2200733		NOHD_STK	AGE MALE	REC	TT	1.973	0.839	4.643	0.1195	.
				DIAB HTN
hCV16158671	rs2200733		NONCE_STK	AGE MALE	GEN	TC	1.275	0.93	1.747	0.1316	0.22725
				DIAB HTN
hCV16336	rs362277	HD	ATHERO_STK	AGE MALE	ADD	C	1.321	0.946	1.844	0.102	.
				DIAB HTN
hCV16336	rs362277	HD	CE_STK		DOM	CT or	3.411	0.777	14.97	0.104	.
						CC
hCV16336	rs362277	HD	ISCHEMIC_STK		GEN	CC	1.847	0.825	4.133	0.1354	0.00758
hCV16336	rs362277	HD	ISCHEMIC_STK		DOM	CT or	1.751	0.783	3.914	0.1725	.
						CC
hCV16336	rs362277	HD	LACUNAR_STK	AGE MALE	ADD	C	1.368	0.892	2.097	0.1507	.
				DIAB HTN
hCV16336	rs362277	HD	LACUNAR_STK	AGE MALE	REC	CC	1.389	0.873	2.211	0.1656	.
				DIAB HTN
hCV31137507	rs7660668	CLOCK	LACUNAR_STK		GEN	CG	1.274	0.945	1.716	0.112	0.22027
hCV31137507	rs7660668	CLOCK	LACUNAR_STK		DOM	CG or	1.21	0.909	1.612	0.1921	.
						CC
hCV26478797	rs2015018	CHSY-2	CE_STK		ADD	G	1.134	0.951	1.352	0.1602	.
hCV26478797	rs2015018	CHSY-2	CE_STK	AGE MALE	REC	GG	1.233	0.921	1.649	0.1593	.
				DIAB HTN
hCV26478797	rs2015018	CHSY-2	NOHD_STK		REC	GG	1.132	0.944	1.358	0.1816	.
hCV26478797	rs2015018	CHSY-2	RECURRENT_STK		GEN	GA	1.613	0.804	3.238	0.1787	0.30867
hCV26478797	rs2015018	CHSY-2	RECURRENT_STK		GEN	GG	1.712	0.86	3.407	0.1255	0.30867
hCV26478797	rs2015018	CHSY-2	RECURRENT_STK		DOM	GA or	1.668	0.85	3.272	0.137	.
						GG
hCV11425801	rs3805953	PEX6	ATHERO_STK	AGE MALE	GEN	CC	1.372	0.929	2.025	0.1116	0.0005
				DIAB HTN
hCV11425801	rs3805953	PEX6	CE_STK	AGE MALE	GEN	CT	1.287	0.913	1.812	0.1493	0.35182
				DIAB HTN
hCV11425801	rs3805953	PEX6	EO_STK		GEN	CC	1.254	0.903	1.739	0.1764	0.00345
hCV11425801	rs3805953	PEX6	EO_STK		ADD	C	1.133	0.961	1.335	0.1372	.
hCV11425801	rs3805953	PEX6	ISCHEMIC_STK		GEN	CC	1.202	0.958	1.508	0.1123	0.02335
hCV11425801	rs3805953	PEX6	ISCHEMIC_STK	AGE MALE	ADD	C	1.116	0.959	1.3	0.1556	.
				DIAB HTN
hCV11425801	rs3805953	PEX6	LACUNAR_STK		DOM	CT or	1.235	0.897	1.7	0.1959	.
						CC
hCV11425801	rs3805953	PEX6	NOHD_STK	AGE MALE	GEN	CC	1.236	0.896	1.706	0.1968	0.00304
				DIAB HTN
hCV11425801	rs3805953	PEX6	NOHD_STK	AGE MALE	ADD	C	1.124	0.958	1.32	0.1525	.
				DIAB HTN
hCV11425801	rs3805953	PEX6	NONCE_STK	AGE MALE	GEN	CC	1.276	0.898	1.813	0.1732	0.00005
				DIAB HTN
hCV11425801	rs3805953	PEX6	NONCE_STK	AGE MALE	ADD	C	1.147	0.963	1.365	0.1237	.
				DIAB HTN
hCV11425801	rs3805953	PEX6	RECURRENT_STK		DOM	CT or	1.28	0.912	1.798	0.1535	.
						CC
hCV11425801	rs3805953	PEX6	RECURRENT_STK	AGE MALE	DOM	CT or	1.403	0.885	2.225	0.1498	.
				DIAB HTN		CC
hCV11425842	rs10948059	GNMT	ATHERO_STK		GEN	CC	1.263	0.927	1.722	0.1392	0.19224
hCV11425842	rs10948059	GNMT	ATHERO_STK		ADD	C	1.109	0.953	1.29	0.1815	.
hCV11425842	rs10948059	GNMT	ATHERO_STK	AGE MALE	ADD	C	1.178	0.964	1.439	0.1101	.
				DIAB HTN
hCV11425842	rs10948059	GNMT	CE_STK	AGE MALE	DOM	CT or	1.272	0.898	1.8	0.1751	.
				DIAB HTN		CC
hCV11425842	rs10948059	GNMT	EO_STK		ADD	C	1.141	0.964	1.352	0.126	.
hCV11425842	rs10948059	GNMT	EO_STK	AGE MALE	GEN	CC	1.302	0.883	1.92	0.1827	0.08575
				DIAB HTN
hCV11425842	rs10948059	GNMT	ISCHEMIC_STK	AGE MALE	GEN	CC	1.27	0.925	1.743	0.1389	0.1427
				DIAB HTN
hCV11425842	rs10948059	GNMT	ISCHEMIC_STK	AGE MALE	ADD	C	1.113	0.951	1.303	0.1836	.
				DIAB HTN
hCV11425842	rs10948059	GNMT	NOHD_STK	AGE MALE	GEN	CT	1.279	0.938	1.745	0.1197	0.26094
				DIAB HTN
hCV11425842	rs10948059	GNMT	NOHD_STK	AGE MALE	GEN	CC	1.266	0.905	1.772	0.1686	0.26094
				DIAB HTN
hCV11425842	rs10948059	GNMT	NOHD_STK	AGE MALE	DOM	CT or	1.274	0.953	1.703	0.1015	.
				DIAB HTN		CC
hCV11425842	rs10948059	GNMT	NONCE_STK		GEN	CT	1.195	0.932	1.531	0.1595	0.35697
hCV11425842	rs10948059	GNMT	NONCE_STK		DOM	CT or	1.184	0.938	1.495	0.1556	.
						CC
hCV11425842	rs10948059	GNMT	NONCE_STK	AGE MALE	GEN	CC	1.294	0.9	1.861	0.1646	0.10566
				DIAB HTN
hCV16134786	rs2857595		EO_STK		GEN	AG	1.207	0.929	1.568	0.1593	0.0477
hCV16134786	rs2857595		EO_STK	AGE MALE	ADD	A	1.185	0.934	1.504	0.1629	.
				DIAB HTN
hCV16134786	rs2857595		ISCHEMIC_STK		GEN	AA	1.406	0.933	2.119	0.103	0.26366
hCV16134786	rs2857595		ISCHEMIC_STK		REC	AA	1.392	0.928	2.088	0.1098	.
hCV16134786	rs2857595		ISCHEMIC_STK	AGE MALE	ADD	A	1.154	0.949	1.402	0.1516	.
				DIAB HTN
hCV16134786	rs2857595		LACUNAR_STK	AGE MALE	GEN	AA	1.77	0.809	3.873	0.153	0.27205
				DIAB HTN
hCV16134786	rs2857595		LACUNAR_STK	AGE MALE	ADD	A	1.272	0.943	1.717	0.1157	.
				DIAB HTN
hCV16134786	rs2857595		LACUNAR_STK	AGE MALE	DOM	AG or	1.287	0.889	1.863	0.182	.
				DIAB HTN		AA
hCV16134786	rs2857595		NONCE_STK		DOM	AG or	1.151	0.947	1.399	0.1584	.
						AA
hCV16134786	rs2857595		NONCE_STK		REC	AA	1.448	0.924	2.268	0.1062	.
hCV25651109	rs35690712	SLC39A7	EO_STK		GEN	GC	5.189	0.556	48.4	0.1484	0.34485
hCV25651109	rs35690712	SLC39A7	EO_STK		GEN	GG	4.668	0.52	41.92	0.1689	0.34485
hCV25651109	rs35690712	SLC39A7	EO_STK		DOM	GC or	4.709	0.525	42.28	0.1664	.
						GG
hCV25651109	rs35690712	SLC39A7	ISCHEMIC_STK	AGE MALE	GEN	GC	4.69	0.505	43.57	0.1742	0.39506
				DIAB HTN
hCV25651109	rs35690712	SLC39A7	ISCHEMIC_STK	AGE MALE	GEN	GG	4.372	0.486	39.35	0.1882	0.39506
				DIAB HTN
hCV25651109	rs35690712	SLC39A7	ISCHEMIC_STK	AGE MALE	DOM	GC or	4.398	0.489	39.56	0.1864	.
				DIAB HTN		GG
hCV25651109	rs35690712	SLC39A7	NONCE_STK		GEN	GC	4.525	0.542	37.77	0.1632	0.26183
hCV25651109	rs35690712	SLC39A7	NONCE_STK		GEN	GG	5.073	0.623	41.3	0.129	0.26183
hCV25651109	rs35690712	SLC39A7	NONCE_STK		ADD	G	1.239	0.895	1.713	0.1962	.
hCV25651109	rs35690712	SLC39A7	NONCE_STK		DOM	GC or	5.026	0.618	40.91	0.1312	.
						GG
hCV30308202	rs9482985	LAMA2	CE_STK		ADD	G	1.168	0.958	1.423	0.1237	.
hCV30308202	rs9482985	LAMA2	CE_STK		REC	GG	1.179	0.936	1.484	0.1621	.
hCV30308202	rs9482985	LAMA2	CE_STK	AGE MALE	GEN	GC	1.724	0.779	3.815	0.1792	0.26508
				DIAB HTN
hCV30308202	rs9482985	LAMA2	CE_STK	AGE MALE	GEN	GG	1.878	0.867	4.07	0.1103	0.26508
				DIAB HTN
hCV30308202	rs9482985	LAMA2	CE_STK	AGE MALE	ADD	G	1.19	0.92	1.54	0.1851	.
				DIAB HTN
hCV30308202	rs9482985	LAMA2	CE_STK	AGE MALE	DOM	GC or	1.825	0.848	3.929	0.124	.
				DIAB HTN		GG
hCV30308202	rs9482985	LAMA2	RECURRENT_STK		DOM	GC or	2.236	0.795	6.289	0.1272	.
						GG
hCV30308202	rs9482985	LAMA2	RECURRENT_STK	AGE MALE	ADD	G	1.379	0.94	2.022	0.1002	.
				DIAB HTN
hCV3082219	rs1884833	RFXDC1	EO_STK		GEN	AG	1.217	0.909	1.628	0.1874	0.16147
hCV3082219	rs1884833	RFXDC1	EO_STK		GEN	AA	2.194	0.766	6.286	0.1434	0.16147
hCV3082219	rs1884833	RFXDC1	EO_STK		DOM	AG or	1.262	0.949	1.677	0.1091	.
						AA
hCV3082219	rs1884833	RFXDC1	EO_STK		REC	AA	2.096	0.733	5.993	0.1672	.
hCV3082219	rs1884833	RFXDC1	LACUNAR_STK		GEN	AA	2.024	0.703	5.824	0.1911	0.07365
hCV3082219	rs1884833	RFXDC1	LACUNAR_STK	AGE MALE	GEN	AA	2.876	0.735	11.26	0.1292	0.25425
				DIAB HTN
hCV3082219	rs1884833	RFXDC1	LACUNAR_STK	AGE MALE	ADD	A	1.288	0.89	1.865	0.18	.
				DIAB HTN
hCV3082219	rs1884833	RFXDC1	LACUNAR_STK	AGE MALE	REC	AA	2.755	0.706	10.75	0.1444	.
				DIAB HTN
hCV3082219	rs1884833	RFXDC1	NOHD_STK		GEN	AA	1.762	0.835	3.717	0.137	0.20951
hCV3082219	rs1884833	RFXDC1	NOHD_STK		ADD	A	1.171	0.965	1.421	0.11	.
hCV3082219	rs1884833	RFXDC1	NOHD_STK		DOM	AG or	1.158	0.935	1.432	0.1783	.
						AA
hCV3082219	rs1884833	RFXDC1	NOHD_STK		REC	AA	1.715	0.814	3.612	0.1557	.
hCV3082219	rs1884833	RFXDC1	NOHD_STK	AGE MALE	GEN	AA	1.98	0.711	5.513	0.1912	0.41847
				DIAB HTN
hCV3082219	rs1884833	RFXDC1	NOHD_STK	AGE MALE	REC	AA	1.961	0.706	5.45	0.1964	.
				DIAB HTN
hCV8942032	rs1264352	DDR1	ATHERO_STK	AGE MALE	GEN	CG	1.315	0.937	1.846	0.1128	0.23534
				DIAB HTN
hCV8942032	rs1264352	DDR1	ATHERO_STK	AGE MALE	DOM	CG or	1.257	0.906	1.744	0.1707	.
				DIAB HTN		CC
hCV8942032	rs1264352	DDR1	CE_STK	AGE MALE	GEN	CG	1.299	0.916	1.842	0.1424	0.29178
				DIAB HTN
hCV8942032	rs1264352	DDR1	CE_STK	AGE MALE	ADD	C	1.251	0.938	1.669	0.1269	.
				DIAB HTN
hCV8942032	rs1264352	DDR1	CE_STK	AGE MALE	DOM	CG or	1.307	0.935	1.826	0.1175	.
				DIAB HTN		CC
hCV8942032	rs1264352	DDR1	ISCHEMIC_STK		ADD	C	1.119	0.948	1.321	0.1832	.
hCV8942032	rs1264352	DDR1	LACUNAR_STK	AGE MALE	GEN	CC	2.104	0.743	5.961	0.1614	0.01502
				DIAB HTN
hCV8942032	rs1264352	DDR1	NOHD_STK		DOM	CG or	1.16	0.942	1.43	0.163	.
						CC
hCV8942032	rs1264352	DDR1	NOHD_STK	AGE MALE	ADD	C	1.211	0.951	1.541	0.1206	.
				DIAB HTN
hCV8942032	rs1264352	DDR1	NONCE_STK		ADD	C	1.142	0.948	1.375	0.1628	.
hCV25596936	rs6967117	EPHA1	ATHERO_STK		ADD	T	1.215	0.95	1.552	0.1207	.
hCV25596936	rs6967117	EPHA1	ISCHEMIC_STK		DOM	TC or	1.181	0.941	1.482	0.1522	.
						TT
hCV25596936	rs6967117	EPHA1	LACUNAR_STK		DOM	TC or	1.352	0.937	1.951	0.1065	.
						TT
hCV25596936	rs6967117	EPHA1	NOHD_STK		DOM	TC or	1.226	0.961	1.566	0.1014	.
						TT
hCV29401764	rs7793552	LOC646588	ATHERO_STK	AGE MALE	DOM	CT or	1.501	0.896	2.513	0.123	.
				DIAB HTN		CC
hCV15857769	rs2924914		ATHERO_STK	AGE MALE	ADD	T	1.193	0.963	1.479	0.1061	.
				DIAB HTN
hCV15857769	rs2924914		ATHERO_STK	AGE MALE	REC	TT	1.456	0.92	2.305	0.1089	.
				DIAB HTN
hCV15857769	rs2924914		NOHD_STK		ADD	T	1.12	0.975	1.287	0.1103	.
hCV15857769	rs2924914		RECURRENT_STK	AGE MALE	ADD	T	1.255	0.909	1.731	0.167	.
				DIAB HTN
hCV29539757	rs10110659	KCNQ3	ATHERO_STK		GEN	CA	1.362	0.902	2.058	0.1417	0.31708
hCV29539757	rs10110659	KCNQ3	ATHERO_STK		DOM	CA or	1.297	0.875	1.925	0.1957	.
						CC
hCV29539757	rs10110659	KCNQ3	LACUNAR_STK		GEN	CA	1.453	0.843	2.504	0.1789	0.08401
hCV29539757	rs10110659	KCNQ3	NONCE_STK		DOM	CA or	1.283	0.909	1.81	0.1572	.
						CC
hCV1348610	rs3739636	C9orf46	ATHERO_STK	AGE MALE	GEN	AG	1.304	0.945	1.799	0.1062	0.25491
				DIAB HTN
hCV1348610	rs3739636	C9orf46	ATHERO_STK	AGE MALE	DOM	AG or	1.242	0.918	1.682	0.1605	.
				DIAB HTN		AA
hCV1348610	rs3739636	C9orf46	CE_STK	AGE MALE	GEN	AG	1.24	0.895	1.719	0.1962	0.39368
				DIAB HTN
hCV1348610	rs3739636	C9orf46	CE_STK	AGE MALE	DOM	AG or	1.238	0.911	1.682	0.1722	.
				DIAB HTN		AA
hCV1348610	rs3739636	C9orf46	NOHD_STK	AGE MALE	DOM	AG or	1.217	0.944	1.569	0.1306	.
				DIAB HTN		AA
hCV1348610	rs3739636	C9orf46	NONCE_STK	AGE MALE	DOM	AG or	1.226	0.933	1.61	0.144	.
				DIAB HTN		AA
hCV1754669	rs2383206	C9P21	ATHERO_STK	AGE MALE	REC	GG	1.277	0.913	1.784	0.1528	.
				DIAB HTN
hCV1754669	rs2383206	C9P21	NONCE_STK	AGE MALE	REC	GG	1.227	0.906	1.662	0.187	.
				DIAB HTN
hCV26505812	rs10757274	C9P21	ISCHEMIC_STK	AGE MALE	REC	GG	1.207	0.912	1.599	0.1887	.
				DIAB HTN
hCV26505812	rs10757274	C9P21	NOHD_STK	AGE MALE	REC	GG	1.238	0.918	1.669	0.1611	.
				DIAB HTN
hCV26505812	rs10757274	C9P21	NONCE_STK	AGE MALE	GEN	GG	1.297	0.893	1.884	0.1714	0.23096
				DIAB HTN
hCV15752716	rs2296436	HPS1	CE_STK		ADD	T	1.242	0.914	1.686	0.1656	.
hCV15752716	rs2296436	HPS1	CE_STK		REC	TT	1.284	0.928	1.778	0.1311	.
hCV2169762	rs1804689	HPS1	ATHERO_STK		GEN	TT	1.293	0.914	1.829	0.1461	0.33606
hCV2169762	rs1804689	HPS1	ATHERO_STK		REC	TT	1.282	0.92	1.787	0.1422	.
hCV2169762	rs1804689	HPS1	ATHERO_STK	AGE MALE	GEN	TT	1.446	0.902	2.316	0.1255	0.27749
				DIAB HTN
hCV2169762	rs1804689	HPS1	ATHERO_STK	AGE MALE	REC	TT	1.447	0.92	2.276	0.1093	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	EO_STK	AGE MALE	GEN	TT	1.49	0.926	2.397	0.1003	0.2272
				DIAB HTN
hCV2169762	rs1804689	HPS1	ISCHEMIC_STK		GEN	TT	1.22	0.921	1.617	0.1658	0.04864
hCV2169762	rs1804689	HPS1	LACUNAR_STK		GEN	TG	1.273	0.941	1.721	0.1172	0.29125
hCV2169762	rs1804689	HPS1	LACUNAR_STK		DOM	TG or	1.235	0.927	1.644	0.1491	.
						TT
hCV2169762	rs1804689	HPS1	LACUNAR_STK	AGE MALE	GEN	TG	1.345	0.919	1.97	0.1275	0.23974
				DIAB HTN
hCV2169762	rs1804689	HPS1	LACUNAR_STK	AGE MALE	ADD	T	1.246	0.953	1.63	0.1085	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	NOHD_STK	AGE MALE	REC	TT	1.351	0.914	1.999	0.1317	.
				DIAB HTN
hCV2169762	rs1804689	HPS1	NONCE_STK		GEN	TT	1.229	0.897	1.683	0.1999	0.37015
hCV2169762	rs1804689	HPS1	NONCE_STK		ADD	T	1.106	0.961	1.272	0.1591	.
hCV2169762	rs1804689	HPS1	NONCE_STK	AGE MALE	DOM	TG or	1.193	0.923	1.541	0.1783	.
				DIAB HTN		TT
hCV27830265	rs12762303	ALOX5	ATHERO_STK		DOM	GA or	1.204	0.956	1.515	0.1143	.
						GG
hCV27830265	rs12762303	ALOX5	ATHERO_STK	AGE MALE	GEN	GA	1.275	0.928	1.752	0.1331	0.04449
				DIAB HTN
hCV27830265	rs12762303	ALOX5	CE_STK		GEN	GG	1.591	0.788	3.212	0.1954	0.27948
hCV27830265	rs12762303	ALOX5	CE_STK		REC	GG	1.637	0.813	3.293	0.1673	.
hCV27830265	rs12762303	ALOX5	CE_STK	AGE MALE	REC	GG	1.967	0.73	5.302	0.1811	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	EO_STK		GEN	GG	1.724	0.758	3.92	0.1937	0.27237
hCV27830265	rs12762303	ALOX5	EO_STK		ADD	G	1.201	0.951	1.517	0.1236	.
hCV27830265	rs12762303	ALOX5	EO_STK		DOM	GA or	1.194	0.919	1.551	0.1835	.
						GG
hCV27830265	rs12762303	ALOX5	ISCHEMIC_STK	AGE MALE	DOM	GA or	1.211	0.948	1.547	0.1246	.
				DIAB HTN		GG
hCV27830265	rs12762303	ALOX5	LACUNAR_STK		GEN	GA	1.242	0.911	1.692	0.1704	0.30411
hCV27830265	rs12762303	ALOX5	LACUNAR_STK		ADD	G	1.237	0.944	1.621	0.1228	.
hCV27830265	rs12762303	ALOX5	LACUNAR_STK		DOM	GA or	1.258	0.93	1.701	0.1365	.
						GG
hCV27830265	rs12762303	ALOX5	LACUNAR_STK	AGE MALE	GEN	GA	1.371	0.924	2.032	0.1169	0.17426
				DIAB HTN
hCV27830265	rs12762303	ALOX5	NOHD_STK		ADD	G	1.146	0.963	1.364	0.1236	.
hCV27830265	rs12762303	ALOX5	NOHD_STK	AGE MALE	GEN	GA	1.204	0.92	1.575	0.1757	0.16102
				DIAB HTN
hCV27830265	rs12762303	ALOX5	NOHD_STK	AGE MALE	GEN	GG	1.82	0.823	4.024	0.1389	0.16102
				DIAB HTN
hCV27830265	rs12762303	ALOX5	NOHD_STK	AGE MALE	DOM	GA or	1.244	0.958	1.615	0.1015	.
				DIAB HTN		GG
hCV27830265	rs12762303	ALOX5	NOHD_STK	AGE MALE	REC	GG	1.722	0.783	3.787	0.1768	.
				DIAB HTN
hCV27830265	rs12762303	ALOX5	NONCE_STK		GEN	GA	1.16	0.94	1.432	0.166	0.02459
hCV27830265	rs12762303	ALOX5	NONCE_STK	AGE MALE	REC	GG	1.999	0.864	4.627	0.1056	.
				DIAB HTN
hCV1053082	rs544115	NEU3	ATHERO_STK		GEN	CC	1.629	0.864	3.07	0.1313	0.29853
hCV1053082	rs544115	NEU3	ATHERO_STK		ADD	C	1.139	0.935	1.387	0.1971	.
hCV1053082	rs544115	NEU3	ATHERO_STK		DOM	CT or	1.597	0.851	2.997	0.1454	.
						CC
hCV1053082	rs544115	NEU3	CE_STK		GEN	CC	1.702	0.885	3.27	0.1107	0.13598
hCV1053082	rs544115	NEU3	CE_STK		DOM	CT or	1.618	0.845	3.097	0.1466	.
						CC
hCV1053082	rs544115	NEU3	CE_STK	AGE MALE	ADD	C	1.237	0.945	1.619	0.1224	.
				DIAB HTN
hCV1053082	rs544115	NEU3	EO_STK		ADD	C	1.172	0.933	1.471	0.172	.
hCV1053082	rs544115	NEU3	EO_STK	AGE MALE	DOM	CT or	2.054	0.846	4.982	0.1115	.
				DIAB HTN		CC
hCV1053082	rs544115	NEU3	ISCHEMIC_STK		REC	CC	1.125	0.942	1.344	0.1924	.
hCV1053082	rs544115	NEU3	ISCHEMIC_STK	AGE MALE	ADD	C	1.164	0.943	1.436	0.1567	.
				DIAB HTN
hCV1053082	rs544115	NEU3	LACUNAR_STK		GEN	CT	2.025	0.775	5.292	0.1499	0.33773
hCV1053082	rs544115	NEU3	LACUNAR_STK		DOM	CT or	1.895	0.742	4.839	0.1815	.
						CC
hCV1053082	rs544115	NEU3	LACUNAR_STK	AGE MALE	GEN	CT	2.148	0.723	6.38	0.1685	0.38668
				DIAB HTN
hCV1053082	rs544115	NEU3	LACUNAR_STK	AGE MALE	DOM	CT or	2.036	0.708	5.851	0.1868	.
				DIAB HTN		CC
hCV1053082	rs544115	NEU3	NOHD_STK		ADD	C	1.128	0.954	1.333	0.1577	.
hCV1452085	rs12223005	TRIM22	CE_STK		GEN	CA	3.193	0.705	14.47	0.1321	0.27397
hCV1452085	rs12223005	TRIM22	CE_STK		GEN	CC	2.843	0.638	12.66	0.1703	0.27397
hCV1452085	rs12223005	TRIM22	CE_STK		DOM	CA or	2.902	0.652	12.91	0.1619	.
						CC
hCV1452085	rs12223005	TRIM22	CE_STK	AGE MALE	GEN	CA	4.133	0.74	23.07	0.1058	0.25417
				DIAB HTN
hCV1452085	rs12223005	TRIM22	CE_STK	AGE MALE	GEN	CC	3.631	0.67	19.68	0.1347	0.25417
				DIAB HTN
hCV1452085	rs12223005	TRIM22	CE_STK	AGE MALE	DOM	CA or	3.711	0.686	20.07	0.1279	.
				DIAB HTN		CC
hCV1452085	rs12223005	TRIM22	EO_STK		GEN	CA	2.362	0.762	7.322	0.1364	0.26957
hCV1452085	rs12223005	TRIM22	EO_STK		DOM	CA or	2.075	0.691	6.232	0.1935	.
						CC
hCV1452085	rs12223005	TRIM22	ISCHEMIC_STK		GEN	CA	1.97	0.824	4.714	0.1275	0.08218
hCV1452085	rs12223005	TRIM22	ISCHEMIC_STK	AGE MALE	GEN	CC	2.207	0.757	6.44	0.1472	0.07446
				DIAB HTN
hCV1452085	rs12223005	TRIM22	ISCHEMIC_STK	AGE MALE	DOM	CA or	2.31	0.793	6.727	0.1247	.
				DIAB HTN		CC
hCV1452085	rs12223005	TRIM22	LACUNAR_STK		GEN	CA	4.431	0.568	34.58	0.1556	0.00441
hCV1452085	rs12223005	TRIM22	LACUNAR_STK	AGE MALE	DOM	CA or	4.519	0.471	43.37	0.1911	.
				DIAB HTN		CC
hCV1452085	rs12223005	TRIM22	NOHD_STK		GEN	CA	2.418	0.843	6.932	0.1004	0.16487
hCV1452085	rs12223005	TRIM22	NOHD_STK		GEN	CC	2.082	0.739	5.866	0.1655	0.16487
hCV1452085	rs12223005	TRIM22	NOHD_STK		DOM	CA or	2.138	0.759	6.02	0.1502	.
						CC
hCV1452085	rs12223005	TRIM22	RECURRENT_STK	AGE MALE	GEN	CC	6.513	0.564	75.15	0.1332	0.02942
				DIAB HTN
hCV1452085	rs12223005	TRIM22	RECURRENT_STK	AGE MALE	DOM	CA or	7.075	0.618	80.97	0.1157	.
				DIAB HTN		CC
hCV302629	rs9284183	UBAC2	EO_STK		DOM	GA or	1.217	0.954	1.553	0.1137	.
						GG
hCV302629	rs9284183	UBAC2	EO_STK	AGE MALE	GEN	GA	1.219	0.91	1.633	0.1853	0.37831
				DIAB HTN
hCV302629	rs9284183	UBAC2	EO_STK	AGE MALE	ADD	G	1.156	0.927	1.442	0.1987	.
				DIAB HTN
hCV302629	rs9284183	UBAC2	EO_STK	AGE MALE	DOM	GA or	1.219	0.923	1.611	0.1632	.
				DIAB HTN		GG
hCV11474611	rs3814843	CALM1	ATHERO_STK		DOM	GT or	1.345	0.925	1.956	0.1207	.
						GG
hCV11474611	rs3814843	CALM1	ISCHEMIC_STK		GEN	GT	1.282	0.939	1.748	0.1173	0.13174
hCV11474611	rs3814843	CALM1	ISCHEMIC_STK		DOM	GT or	1.222	0.902	1.656	0.1959	.
						GG
hCV11474611	rs3814843	CALM1	NOHD_STK		GEN	GT	1.32	0.946	1.842	0.1021	0.1136
hCV11474611	rs3814843	CALM1	NOHD_STK		DOM	GT or	1.251	0.902	1.735	0.1789	.
						GG
hCV11474611	rs3814843	CALM1	NONCE_STK		GEN	GT	1.328	0.939	1.877	0.1082	0.1417
hCV11474611	rs3814843	CALM1	NONCE_STK		DOM	GT or	1.261	0.898	1.772	0.1806	.
						GG
hCV11474611	rs3814843	CALM1	RECURRENT_STK		GEN	GT	1.526	0.916	2.544	0.1047	0.2681
hCV11474611	rs3814843	CALM1	RECURRENT_STK		DOM	GT or	1.429	0.86	2.374	0.168	.
						GG
hCV1262973	rs229653	PLEKHG3	ISCHEMIC_STK		GEN	AG	1.186	0.939	1.499	0.1523	0.00405
hCV1262973	rs229653	PLEKHG3	RECURRENT_STK		GEN	AG	1.33	0.893	1.982	0.1605	0.3735
hCV27892569	rs4903741	NRXN3	CE_STK		DOM	CT or	1.171	0.936	1.466	0.1674	.
						CC
hCV27892569	rs4903741	NRXN3	LACUNAR_STK		GEN	CT	1.273	0.943	1.719	0.1153	0.28645
hCV27892569	rs4903741	NRXN3	LACUNAR_STK		DOM	CT or	1.241	0.93	1.656	0.143	.
						CC
hCV27892569	rs4903741	NRXN3	NOHD_STK		GEN	CC	1.333	0.917	1.939	0.1323	0.22016
hCV27892569	rs4903741	NRXN3	NOHD_STK		DOM	CT or	1.153	0.958	1.388	0.1327	.
						CC
hCV27892569	rs4903741	NRXN3	NOHD_STK		REC	CC	1.278	0.885	1.845	0.191	.
hCV27077072	rs8060368		RECURRENT_STK		GEN	CC	1.564	0.889	2.75	0.1205	0.17139
hCV27077072	rs8060368		RECURRENT_STK	AGE MALE	ADD	C	1.308	0.947	1.806	0.1032	.
				DIAB HTN
hCV27077072	rs8060368		RECURRENT_STK	AGE MALE	DOM	CT or	1.798	0.854	3.786	0.1226	.
				DIAB HTN		CC
hCV2769503	rs4787956		CE_STK		GEN	GA	1.171	0.924	1.484	0.1909	0.3088
hCV2769503	rs4787956		CE_STK		ADD	G	1.131	0.961	1.331	0.1373	.
hCV2769503	rs4787956		CE_STK		DOM	GA or	1.187	0.948	1.485	0.1354	.
						GG
hCV2769503	rs4787956		RECURRENT_STK		GEN	GA	1.27	0.919	1.753	0.1471	0.27579
hCV31573621	rs11079818	SKAP1	ATHERO_STK		REC	TT	1.165	0.939	1.445	0.1653	.
hCV31573621	rs11079818	SKAP1	LACUNAR_STK	AGE MALE	GEN	TC	1.614	0.78	3.341	0.1973	0.13048
				DIAB HTN
hCV32160712	rs11079160		CE_STK		DOM	TA or	1.181	0.928	1.501	0.1761	.
						TT
hCV32160712	rs11079160		CE_STK	AGE MALE	GEN	TT	1.93	0.872	4.27	0.1047	0.26509
				DIAB HTN
hCV32160712	rs11079160		CE_STK	AGE MALE	REC	TT	1.896	0.862	4.17	0.1116	.
				DIAB HTN
hCV32160712	rs11079160		EO_STK		GEN	TT	1.734	0.829	3.629	0.144	0.19059
hCV32160712	rs11079160		EO_STK		REC	TT	1.8	0.864	3.751	0.1167	.
hCV32160712	rs11079160		ISCHEMIC_STK		ADD	T	1.137	0.972	1.33	0.1085	.
hCV32160712	rs11079160		ISCHEMIC_STK	AGE MALE	GEN	TT	1.675	0.848	3.308	0.1373	0.31696
				DIAB HTN
hCV32160712	rs11079160		ISCHEMIC_STK	AGE MALE	REC	TT	1.646	0.837	3.237	0.1488	.
				DIAB HTN
hCV32160712	rs11079160		NOHD_STK		GEN	TT	1.509	0.886	2.57	0.1303	0.30893
hCV32160712	rs11079160		NOHD_STK		REC	TT	1.49	0.878	2.531	0.1396	.
hCV32160712	rs11079160		RECURRENT_STK		GEN	TT	1.887	0.865	4.117	0.1107	0.28017
hCV32160712	rs11079160		RECURRENT_STK		REC	TT	1.87	0.863	4.056	0.1128	.
hCV32160712	rs11079160		RECURRENT_STK	AGE MALE	GEN	TT	2.044	0.706	5.92	0.1878	0.41924
				DIAB HTN
hCV32160712	rs11079160		RECURRENT_STK	AGE MALE	REC	TT	2.029	0.706	5.827	0.1887	.
				DIAB HTN
hCV1408483	rs17070848	BCL2	ATHERO_STK		GEN	TT	1.514	0.894	2.564	0.1231	0.29337
hCV1408483	rs17070848	BCL2	ATHERO_STK		REC	TT	1.487	0.882	2.505	0.1364	.
hCV1619596	rs1048621	SDCBP2	CE_STK		GEN	AG	1.176	0.932	1.483	0.1731	0.21433
hCV1619596	rs1048621	SDCBP2	CE_STK		GEN	AA	1.35	0.888	2.055	0.1607	0.21433
hCV1619596	rs1048621	SDCBP2	CE_STK		DOM	AG or	1.203	0.964	1.501	0.1025	.
						AA
hCV1619596	rs1048621	SDCBP2	CE_STK	AGE MALE	ADD	A	1.204	0.959	1.51	0.109	.
				DIAB HTN
hCV1619596	rs1048621	SDCBP2	EO_STK	AGE MALE	ADD	A	1.202	0.965	1.497	0.101	.
				DIAB HTN
hCV1619596	rs1048621	SDCBP2	ISCHEMIC_STK		GEN	AG	1.127	0.945	1.344	0.1838	0.22154
hCV1619596	rs1048621	SDCBP2	ISCHEMIC_STK		GEN	AA	1.261	0.909	1.748	0.1644	0.22154
hCV1619596	rs1048621	SDCBP2	ISCHEMIC_STK		DOM	AG or	1.148	0.97	1.357	0.1079	.
						AA
hCV1619596	rs1048621	SDCBP2	ISCHEMIC_STK	AGE MALE	ADD	A	1.139	0.954	1.36	0.1508	.
				DIAB HTN
hCV1619596	rs1048621	SDCBP2	NOHD_STK		GEN	AA	1.267	0.89	1.804	0.1884	0.27789
hCV1619596	rs1048621	SDCBP2	NOHD_STK		ADD	A	1.125	0.974	1.299	0.1095	.
hCV1619596	rs1048621	SDCBP2	NOHD_STK		DOM	AG or	1.146	0.955	1.375	0.1442	.
						AA
hCV1619596	rs1048621	SDCBP2	NOHD_STK	AGE MALE	GEN	AG	1.217	0.944	1.569	0.1302	0.29766
				DIAB HTN
hCV1619596	rs1048621	SDCBP2	NOHD_STK	AGE MALE	ADD	A	1.14	0.944	1.376	0.1722	.
				DIAB HTN
hCV1619596	rs1048621	SDCBP2	NOHD_STK	AGE MALE	DOM	AG or	1.21	0.951	1.541	0.1208	.
				DIAB HTN		AA
hCV1619596	rs1048621	SDCBP2	RECURRENT_STK		GEN	AG	1.23	0.896	1.689	0.1998	0.42372
hCV1619596	rs1048621	SDCBP2	RECURRENT_STK		DOM	AG or	1.224	0.904	1.658	0.1917	.
						AA
hCV1619596	rs1048621	SDCBP2	RECURRENT_STK	AGE MALE	GEN	AG	1.334	0.86	2.07	0.1987	0.41241
				DIAB HTN
hCV29537898	rs6073804		NOHD_STK		ADD	T	1.194	0.943	1.511	0.1415	.
hCV29537898	rs6073804		RECURRENT_STK	AGE MALE	GEN	TT	5.809	0.6	56.26	0.1288	0.23964
				DIAB HTN
hCV29537898	rs6073804		RECURRENT_STK	AGE MALE	REC	TT	5.608	0.578	54.4	0.1369	.
				DIAB HTN
hCV1723718	rs12481805	UMODL1	EO_STK		REC	AA	1.45	0.917	2.293	0.1118	.
hCV1723718	rs12481805	UMODL1	ISCHEMIC_STK		REC	AA	1.254	0.922	1.706	0.1498	.
hCV1723718	rs12481805	UMODL1	LACUNAR_STK	AGE MALE	REC	AA	1.545	0.838	2.848	0.1633	.
				DIAB HTN
hCV1723718	rs12481805	UMODL1	NOHD_STK		REC	AA	1.316	0.947	1.829	0.1019	.
hCV1723718	rs12481805	UMODL1	NONCE_STK		REC	AA	1.33	0.945	1.872	0.1017	.
hCV1723718	rs12481805	UMODL1	RECURRENT_STK	AGE MALE	GEN	AG	1.349	0.867	2.098	0.185	0.37072
				DIAB HTN
hCV1723718	rs12481805	UMODL1	RECURRENT_STK	AGE MALE	ADD	A	1.239	0.897	1.711	0.1934	.
				DIAB HTN
hCV1723718	rs12481805	UMODL1	RECURRENT_STK	AGE MALE	DOM	AG or	1.352	0.889	2.056	0.159	.
				DIAB HTN		AA

TABLE 22
		Gene					GENO-
hCV #	rs #	Symbol	ENDPT	MODE	STRATA	ADJUST	TYPE
hCV16336	rs362277	HD	ENDPT4F1	GEN	ALL	STATIN	TC
hCV16336	rs362277	HD	ENDPT4F1	DOM	ALL	STATIN	TC + TT
hCV16336	rs362277	HD	ENDPT4F1	ADD	ALL	STATIN	T
hCV32160712	rs11079160		ENDPT4F1	GEN	ALL	STATIN	TT
hCV32160712	rs11079160		ENDPT4F1	REC	ALL	STATIN	TT
hCV32160712	rs11079160		ENDPT4F1	ADD	ALL	STATIN	T
hCV16134786	rs2857595		ENDPT4F1	REC	ALL		AA
hCV1619596	rs1048621	SDCBP2	ENDPT4F1	GEN	ALL		AA
hCV1619596	rs1048621	SDCBP2	ENDPT4F1	REC	ALL		AA
hCV32160712	rs11079160		ENDPT4F1	GEN	ALL		TT
hCV32160712	rs11079160		ENDPT4F1	DOM	ALL		TA + TT
hCV32160712	rs11079160		ENDPT4F1	REC	ALL		TT
hCV32160712	rs11079160		ENDPT4F1	ADD	ALL		T
						95%	95%
						Lower	Upper
		Risk				CL for	CL for	P-	2DF P-
	hCV #	Genotype	EVENTS	TOTAL	HR	HR	HR	VALUE	VALUE
	hCV16336	CC	21	491	0.7	0.444	1.115	0.1341	0.3256
	hCV16336	CC	23	526	0.72	0.462	1.12	0.1447	.
	hCV16336	CC	.	.	0.76	0.507	1.14	0.1848	.
	hCV32160712	TT	8	83	1.88	0.914	3.853	0.0866	0.221
	hCV32160712	TT	8	83	1.82	0.895	3.714	0.0981	.
	hCV32160712	TT	.	.	1.21	0.918	1.604	0.1746	.
	hCV16134786	AA	5	45	1.92	0.778	4.735	0.1569	.
	hCV1619596	AG or	12	115	1.69	0.894	3.195	0.1065	0.1552
		AA
	hCV1619596	AG or	12	115	1.78	0.97	3.274	0.0627	.
		AA
	hCV32160712	TT	6	37	3.09	1.33	7.19	0.0088	0.0281
	hCV32160712	TT	34	428	1.41	0.917	2.164	0.1172	.
	hCV32160712	TT	6	37	2.87	1.253	6.585	0.0126	.
	hCV32160712	TT	.	.	1.48	1.037	2.12	0.0308	.

TABLE 23

Risk

Gene

GENO-

Risk

Geno-

95% Lower

95% Upper

P-

hCV #

rs #

Symbol

ENDPT

TIMEVAR

MODE

TYPE

Allele

type

STATIN

EVENTS

TOTAL

HR

CL for HR

CL for HR

VALUE

PVAL_INTX

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

GG

G

GA or

Pravastatin

0

23

0

0

.

0.9967

0.15026

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

GG

G

GA or

Placebo

2

42

ref

.

.

.

0.15026

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

GA

G

GA or

Pravastatin

13

376

0.47

0.239

0.906

0.0243

0.15026

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

GA

G

GA or

Placebo

26

351

ref

.

.

.

0.15026

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

AA

G

GA or

Pravastatin

54

1005

0.84

0.584

1.212

0.3548

0.15026

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

AA

G

GA or

Placebo

62

980

ref

.

.

.

0.15026

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

DOM

GA + GG

G

GA or

Pravastatin

13

399

0.46

0.236

0.88

0.0192

0.10233

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

DOM

GA + GG

G

GA or

Placebo

28

393

ref

.

.

.

0.10233

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

REC

GA + AA

G

GA or

Pravastatin

67

1381

0.73

0.531

1.002

0.0514

0.24445

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

REC

GA + AA

G

GA or

Placebo

88

1331

ref

.

.

.

0.24445

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

GG

G

GA or

Pravastatin

0

23

0

0

.

0.9967

0.15067

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

GG

G

GA or

Placebo

2

42

ref

.

.

.

0.15067

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

GA

G

GA or

Pravastatin

13

375

0.47

0.24

0.911

0.0254

0.15067

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

GA

G

GA or

Placebo

26

352

ref

.

.

.

0.15067

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

AA

G

GA or

Pravastatin

54

1002

0.85

0.587

1.218

0.3671

0.15067

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

GEN

AA

G

GA or

Placebo

62

981

ref

.

.

.

0.15067

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

DOM

GA + GG

G

GA or

Pravastatin

13

398

0.46

0.237

0.884

0.02

0.10281

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

DOM

GA + GG

G

GA or

Placebo

28

394

ref

.

.

.

0.10281

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

REC

GA + AA

G

GA or

Pravastatin

67

1377

0.73

0.533

1.007

0.0549

0.24354

GG

hCV27830265

rs12762303

ALOX5

ENDPT4F1

TIMETO_EP4F1

REC

GA + AA

G

GA or

Placebo

88

1333

ref

.

.

.

0.24354

GG

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

GEN

CC

C

CG or

Pravastatin

1

36

0.86

0.054

13.71

0.9134

0.18029

CC

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

GEN

CC

C

CG or

Placebo

1

31

ref

.

.

.

0.18029

CC

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

GEN

CG

C

CG or

Pravastatin

9

356

0.39

0.179

0.844

0.0169

0.18029

CC

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

GEN

CG

C

CG or

Placebo

22

347

ref

.

.

.

0.18029

CC

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

GEN

GG

C

CG or

Pravastatin

57

1011

0.84

0.592

1.201

0.3442

0.18029

CC

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

GEN

GG

C

CG or

Placebo

67

997

ref

.

.

.

0.18029

CC

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

DOM

CG + CC

C

CG or

Pravastatin

10

392

0.41

0.195

0.859

0.0182

0.07391

CC

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

DOM

CG + CC

C

CG or

Placebo

23

378

ref

.

.

.

0.07391

CC

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

REC

CG + GG

C

CG or

Pravastatin

66

1367

0.73

0.527

0.997

0.0479

0.92551

CC

hCV8942032

rs1264352

DDR1

ENDPT4F1

TIMETO_EP4F1

REC

CG + GG

C

CG or

Placebo

89

1344

ref

.

.

.

0.92551

CC

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AA

AA

Pravastatin

2

71

0.23

0.044

1.189

0.0794

0.27061

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AA

AA

Placebo

5

45

ref

.

.

.

0.27061

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AG

AA

Pravastatin

14

403

0.67

0.342

1.293

0.2295

0.27061

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AG

AA

Placebo

23

442

ref

.

.

.

0.27061

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

GG

AA

Pravastatin

51

928

0.8

0.553

1.164

0.2463

0.27061

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

GG

AA

Placebo

61

887

ref

.

.

.

0.27061

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

DOM

ALL

AG + AA

AA

Pravastatin

16

474

0.58

0.313

1.068

0.0803

0.35911

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

DOM

ALL

AG + AA

AA

Placebo

28

487

ref

.

.

.

0.35911

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

REC

ALL

AG + GG

AA

Pravastatin

65

1331

0.77

0.559

1.068

0.1182

0.12065

hCV16134786

rs2857595

ENDPT4F1

TIMETO_EP4F1

REC

ALL

AG + GG

AA

Placebo

84

1329

ref

.

.

.

0.12065

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AA

AG or

Pravastatin

2

108

0.16

0.037

0.734

0.018

0.05456

AA

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AA

AG or

Placebo

12

115

ref

.

.

.

0.05456

AA

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AG

AG or

Pravastatin

29

572

0.89

0.538

1.471

0.6494

0.05456

AA

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AG

AG or

Placebo

32

559

ref

.

.

.

0.05456

AA

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

GG

AG or

Pravastatin

36

719

0.77

0.498

1.197

0.2473

0.05456

AA

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

GG

AG or

Placebo

45

696

ref

.

.

.

0.05456

AA

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

DOM

ALL

AG + AA

AG or

Pravastatin

31

680

0.69

0.438

1.098

0.1188

0.74301

AA

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

DOM

ALL

AG + AA

AG or

Placebo

44

674

ref

.

.

.

0.74301

AA

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

REC

ALL

AG + GG

AG or

Pravastatin

65

1291

0.82

0.59

1.142

0.2405

0.01754

AA

hCV1619596

rs1048621

SDCBP2

ENDPT4F1

TIMETO_EP4F1

REC

ALL

AG + GG

AG or

Placebo

77

1255

ref

.

.

.

0.01754

AA

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

TT

TT

Pravastatin

2

46

0.24

0.048

1.193

0.0812

0.22268

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

TT

TT

Placebo

6

37

ref

.

.

.

0.22268

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

TA

TT

Pravastatin

17

382

0.62

0.339

1.132

0.1194

0.22268

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

TA

TT

Placebo

28

391

ref

.

.

.

0.22268

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AA

TT

Pravastatin

48

972

0.86

0.582

1.267

0.4421

0.22268

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

GEN

ALL

AA

TT

Placebo

54

942

ref

.

.

.

0.22268

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

DOM

ALL

TA + TT

TT

Pravastatin

19

428

0.55

0.315

0.967

0.0379

0.20087

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

DOM

ALL

TA + TT

TT

Placebo

34

428

ref

.

.

.

0.20087

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

REC

ALL

TA + AA

TT

Pravastatin

65

1354

0.78

0.562

1.077

0.1301

0.13978

hCV32160712

rs11079160

ENDPT4F1

TIMETO_EP4F1

REC

ALL

TA + AA

TT

Placebo

82

1333

ref

.

.

.

0.13978

TABLE 24
hCV #	rs #	Gene/Chrom	ENDPT	MODE	ADJUST	GENOTYPE	EVENTS
hCV1305848	rs6016200		ENDPT4F1	GEN	STATIN	AA	0
hCV1305848	rs6016200		ENDPT4F1	GEN	STATIN	AG	41
hCV1305848	rs6016200		ENDPT4F1	GEN	STATIN	GG	115
hCV1305848	rs6016200		ENDPT4F1	DOM	STATIN	AG + AA	41
hCV1305848	rs6016200		ENDPT4F1	DOM	STATIN	GG	115
hCV1305848	rs6016200		ENDPT4F1	REC	STATIN	AA	0
hCV1305848	rs6016200		ENDPT4F1	REC	STATIN	AG + GG	156
hCV1305848	rs6016200		ENDPT4F1	ADD	STATIN	A	.
hCV1746715	rs4750628	C10orf38	ENDPT4F1	GEN	STATIN	AA	39
hCV1746715	rs4750628	C10orf38	ENDPT4F1	GEN	STATIN	AG	89
hCV1746715	rs4750628	C10orf38	ENDPT4F1	GEN	STATIN	GG	28
hCV1746715	rs4750628	C10orf38	ENDPT4F1	DOM	STATIN	AG + AA	128
hCV1746715	rs4750628	C10orf38	ENDPT4F1	DOM	STATIN	GG	28
hCV1746715	rs4750628	C10orf38	ENDPT4F1	REC	STATIN	AA	39
hCV1746715	rs4750628	C10orf38	ENDPT4F1	REC	STATIN	AG + GG	117
hCV1746715	rs4750628	C10orf38	ENDPT4F1	ADD	STATIN	A	.
hCV29881864	rs10514542		ENDPT4F1	GEN	STATIN	CC	20
hCV29881864	rs10514542		ENDPT4F1	GEN	STATIN	CG	61
hCV29881864	rs10514542		ENDPT4F1	GEN	STATIN	GG	75
hCV29881864	rs10514542		ENDPT4F1	DOM	STATIN	CG + CC	81
hCV29881864	rs10514542		ENDPT4F1	DOM	STATIN	GG	75
hCV29881864	rs10514542		ENDPT4F1	REC	STATIN	CC	20
hCV29881864	rs10514542		ENDPT4F1	REC	STATIN	CG + GG	136
hCV29881864	rs10514542		ENDPT4F1	ADD	STATIN	C	.
hDV70959216	rs17482753		ENDPT4F1	GEN	STATIN	TT	0
hDV70959216	rs17482753		ENDPT4F1	GEN	STATIN	TG	20
hDV70959216	rs17482753		ENDPT4F1	GEN	STATIN	GG	136
hDV70959216	rs17482753		ENDPT4F1	DOM	STATIN	TG + TT	20
hDV70959216	rs17482753		ENDPT4F1	DOM	STATIN	GG	136
hDV70959216	rs17482753		ENDPT4F1	REC	STATIN	TT	0
hDV70959216	rs17482753		ENDPT4F1	REC	STATIN	TG + GG	156
hDV70959216	rs17482753		ENDPT4F1	ADD	STATIN	T	.
hCV1305848	rs6016200		ENDPT4F1	GEN		AA	0
hCV1305848	rs6016200		ENDPT4F1	GEN		AG	22
hCV1305848	rs6016200		ENDPT4F1	GEN		GG	67
hCV1305848	rs6016200		ENDPT4F1	DOM		AG + AA	22
hCV1305848	rs6016200		ENDPT4F1	DOM		GG	67
hCV1305848	rs6016200		ENDPT4F1	REC		AA	0
hCV1305848	rs6016200		ENDPT4F1	REC		AG + GG	89
hCV1305848	rs6016200		ENDPT4F1	ADD		A	.
hCV1746715	rs4750628	C10orf38	ENDPT4F1	GEN		AA	21
hCV1746715	rs4750628	C10orf38	ENDPT4F1	GEN		AG	52
hCV1746715	rs4750628	C10orf38	ENDPT4F1	GEN		GG	16
hCV1746715	rs4750628	C10orf38	ENDPT4F1	DOM		AG + AA	73
hCV1746715	rs4750628	C10orf38	ENDPT4F1	DOM		GG	16
hCV1746715	rs4750628	C10orf38	ENDPT4F1	REC		AA	21
hCV1746715	rs4750628	C10orf38	ENDPT4F1	REC		AG + GG	68
hCV1746715	rs4750628	C10orf38	ENDPT4F1	ADD		A	.
hCV29881864	rs10514542		ENDPT4F1	GEN		CC	14
hCV29881864	rs10514542		ENDPT4F1	GEN		CG	35
hCV29881864	rs10514542		ENDPT4F1	GEN		GG	40
hCV29881864	rs10514542		ENDPT4F1	DOM		CG + CC	49
hCV29881864	rs10514542		ENDPT4F1	DOM		GG	40
hCV29881864	rs10514542		ENDPT4F1	REC		CC	14
hCV29881864	rs10514542		ENDPT4F1	REC		CG + GG	75
hCV29881864	rs10514542		ENDPT4F1	ADD		C	.
				95% Lower	95% Upper	P-	2DF P-
	hCV #	TOTAL	HR	CL for HR	CL for HR	VALUE	VALUE
	hCV1305848	86	0	0	1.63E+248	0.9648	0.2079
	hCV1305848	875	0.72	0.507	1.035	0.0764	0.2079
	hCV1305848	1806	ref	.	.	.	0.2079
	hCV1305848	961	0.66	0.46	0.938	0.0209	.
	hCV1305848	1806	ref	.	.	.	.
	hCV1305848	86	0	0	9.16E+246	0.9649	.
	hCV1305848	2681	ref	.	.	.	.
	hCV1305848	.	0.63	0.451	0.876	0.0061	.
	hCV1746715	701	1.47	0.906	2.392	0.1187	0.0324
	hCV1746715	1340	1.76	1.151	2.691	0.0091	0.0324
	hCV1746715	726	ref	.	.	.	0.0324
	hCV1746715	2041	1.66	1.103	2.5	0.015	.
	hCV1746715	726	ref	.	.	.	.
	hCV1746715	701	0.99	0.688	1.42	0.9495	.
	hCV1746715	2066	ref	.	.	.	.
	hCV1746715	.	1.18	0.947	1.465	0.1424	.
	hCV29881864	224	1.76	1.072	2.875	0.0253	0.0767
	hCV29881864	1102	1.06	0.756	1.486	0.7354	0.0767
	hCV29881864	1450	ref	.	.	.	0.0767
	hCV29881864	1326	1.18	0.858	1.609	0.3138	.
	hCV29881864	1450	ref	.	.	.	.
	hCV29881864	224	1.71	1.07	2.736	0.0249	.
	hCV29881864	2552	ref	.	.	.	.
	hCV29881864	.	1.24	0.975	1.564	0.08	.
	hDV70959216	21	0	0	.	0.974	0.2331
	hDV70959216	495	0.66	0.416	1.063	0.088	0.2331
	hDV70959216	2252	ref	.	.	.	0.2331
	hDV70959216	516	0.64	0.399	1.019	0.0599	.
	hDV70959216	2252	ref	.	.	.	.
	hDV70959216	21	0	0	.	0.974	.
	hDV70959216	2747	ref	.	.	.	.
	hDV70959216	.	0.63	0.398	0.991	0.0458	.
	hCV1305848	44	0	0	.	0.9823	0.3016
	hCV1305848	426	0.68	0.422	1.107	0.1216	0.3016
	hCV1305848	898	ref	.	.	.	0.3016
	hCV1305848	470	0.62	0.381	0.997	0.0487	.
	hCV1305848	898	ref	.	.	.	.
	hCV1305848	44	0	0	.	0.9823	.
	hCV1305848	1324	ref	.	.	.	.
	hCV1305848	.	0.59	0.379	0.929	0.0226	.
	hCV1746715	349	1.34	0.699	2.568	0.3775	0.1054
	hCV1746715	665	1.79	1.021	3.132	0.0421	0.1054
	hCV1746715	355	ref	.	.	.	0.1054
	hCV1746715	1014	1.63	0.95	2.802	0.0763	.
	hCV1746715	355	ref	.	.	.	.
	hCV1746715	349	0.89	0.545	1.449	0.6359	.
	hCV1746715	1020	ref	.	.	.	.
	hCV1746715	.	1.13	0.844	1.501	0.4216	.
	hCV29881864	115	2.28	1.238	4.187	0.0081	0.0236
	hCV29881864	565	1.06	0.675	1.673	0.7927	0.0236
	hCV29881864	694	ref	.	.	.	0.0236
	hCV29881864	680	1.25	0.826	1.903	0.2888	.
	hCV29881864	694	ref	.	.	.	.
	hCV29881864	115	2.21	1.25	3.921	0.0064	.
	hCV29881864	1259	ref	.	.	.	.
	hCV29881864	.	1.38	1.009	1.878	0.0438	.

TABLE 25
		Gene					Risk					95% Lower	95% Upper	P-
hCV #	rs #	Symbol	ENDPT	TIMEVAR	MODE	GENOTYPE	Allele	STATIN	EVENTS	TOTAL	HR	CL for HR	CL for HR	VALUE	PVAL_INTX
hDV77718013			ENDPT4F1	TIMETO_EP4F1	REC	TC + CC		Pravastatin	66	1359	0.74	0.539	1.022	0.0673	0.0556
hCV3216551	rs562338		ENDPT4F1	TIMETO_EP4F1	GEN	GG		Pravastatin	40	932	0.59	0.401	0.877	0.0089	0.04137
hCV2862873	rs780094	GCKR	ENDPT4F1	TIMETO_EP4F1	DOM	TC + TT		Pravastatin	41	887	0.6	0.403	0.881	0.0095	0.09031
hCV9296529	rs4358307		ENDPT4F1	TIMETO_EP4F1	GEN	GA		Pravastatin	25	624	0.5	0.307	0.807	0.0047	0.08098
hCV29480044	rs10516433	TSPAN5	ENDPT4F1	TIMETO_EP4F1	GEN	TC		Pravastatin	16	454	0.46	0.255	0.832	0.0101	0.03925
hCV29480044	rs10516433	TSPAN5	ENDPT4F1	TIMETO_EP4F1	REC	TC + CC		Pravastatin	61	1309	0.67	0.487	0.934	0.0178	0.04698
hCV30454150	rs10516434	TSPAN5	ENDPT4F1	TIMETO_EP4F1	GEN	TC		Pravastatin	16	451	0.46	0.255	0.832	0.0102	0.04149
hCV30454150	rs10516434	TSPAN5	ENDPT4F1	TIMETO_EP4F1	REC	TC + CC		Pravastatin	61	1310	0.67	0.486	0.931	0.017	0.04884
hCV8942032	rs1264352	DDR1	ENDPT4F1	TIMETO_EP4F1	DOM	CG + CC	C	Pravastatin	10	392	0.41	0.195	0.859	0.0182	0.07391
hCV9473891	rs1555173		ENDPT4F1	TIMETO_EP4F1	REC	CT + TT		Pravastatin	67	1363	0.75	0.547	1.035	0.0801	0.07415
hCV2442143	rs12544854	ASAH1	ENDPT4F1	TIMETO_EP4F1	GEN	TC		Pravastatin	29	713	0.55	0.35	0.877	0.0118	0.02918
hCV2442143	rs12544854	ASAH1	ENDPT4F1	TIMETO_EP4F1	DOM	TC + TT		Pravastatin	43	1070	0.57	0.391	0.836	0.004	0.00824
hCV2442143	rs12544854	ASAH1	ENDPT4F1	TIMETO_EP4F1	GEN	TC		Pravastatin	29	704	0.57	0.36	0.905	0.0172	0.04882
hCV2442143	rs12544854	ASAH1	ENDPT4F1	TIMETO_EP4F1	DOM	TC + TT		Pravastatin	42	1059	0.56	0.384	0.825	0.0033	0.01402
hCV1463226	rs10890	FXN	ENDPT4F1	TIMETO_EP4F1	GEN	TT		Pravastatin	9	303	0.41	0.188	0.885	0.0233	0.02602
hCV1463226	rs10890	FXN	ENDPT4F1	TIMETO_EP4F1	GEN	CC		Pravastatin	16	416	0.48	0.266	0.874	0.0162	0.02602
hCV2741051	rs2230806	ABCA1	ENDPT4F1	TIMETO_EP4F1	GEN	TC		Pravastatin	16	597	0.47	0.258	0.856	0.0136	0.09085
hCV2741051	rs2230806	ABCA1	ENDPT4F1	TIMETO_EP4F1	DOM	TC + TT		Pravastatin	20	709	0.47	0.272	0.801	0.0056	0.03067
hCV2741051	rs2230806	ABCA1	ENDPT4F1	TIMETO_EP4F1	GEN	TC		Pravastatin	17	603	0.5	0.275	0.892	0.0192	0.06908
hCV2741051	rs2230806	ABCA1	ENDPT4F1	TIMETO_EP4F1	DOM	TC + TT		Pravastatin	20	711	0.47	0.273	0.802	0.0057	0.02439
hCV2959482	rs3890182	ABCA1	ENDPT4F1	TIMETO_EP4F1	GEN	AG		Pravastatin	8	302	0.34	0.152	0.767	0.0093	0.06769
hCV2959482	rs3890182	ABCA1	ENDPT4F1	TIMETO_EP4F1	DOM	AG + AA		Pravastatin	8	320	0.34	0.151	0.753	0.0081	0.02862
hCV22275299	rs28927680	BUD13	ENDPT4F1	TIMETO_EP4F1	GEN	GC		Pravastatin	2	175	0.2	0.042	0.908	0.0372	0.0983
hCV29566897	rs10507755		ENDPT4F1	TIMETO_EP4F1	REC	CT + TT		Pravastatin	67	1350	0.76	0.552	1.049	0.0957	0.02347
hCV8757333	rs1800588	LIPC	ENDPT4F1	TIMETO_EP4F1	DOM	TC + TT		Pravastatin	21	567	0.49	0.286	0.824	0.0074	0.05012
hCV16164743	rs2928932		ENDPT4F1	TIMETO_EP4F1	GEN	CC		Pravastatin	6	190	0.31	0.124	0.797	0.0148	0.03514
hCV16164743	rs2928932		ENDPT4F1	TIMETO_EP4F1	GEN	AA		Pravastatin	23	555	0.6	0.355	1.004	0.052	0.03514
hCV9324316	rs9305020		ENDPT4F1	TIMETO_EP4F1	GEN	TT		Pravastatin	48	963	0.7	0.482	1.016	0.0604	0.05765
hCV9324316	rs9305020		ENDPT4F1	TIMETO_EP4F1	REC	CT + TT		Pravastatin	67	1352	0.76	0.554	1.05	0.0968	0.02527
hCV1846459	rs4803759		ENDPT4F1	TIMETO_EP4F1	GEN	TC		Pravastatin	25	565	0.62	0.378	1.023	0.0613	0.05544
hCV1846459	rs4803759		ENDPT4F1	TIMETO_EP4F1	GEN	CC		Pravastatin	31	707	0.66	0.415	1.036	0.0707	0.05544
hCV1846459	rs4803759		ENDPT4F1	TIMETO_EP4F1	REC	TC + CC		Pravastatin	56	1272	0.64	0.457	0.895	0.0092	0.01624
hCV26682080	rs4420638		ENDPT4F1	TIMETO_EP4F1	GEN	GG		Pravastatin	2	58	0.25	0.05	1.217	0.0855	0.07632
hCV26682080	rs4420638		ENDPT4F1	TIMETO_EP4F1	GEN	GA		Pravastatin	15	383	0.5	0.268	0.919	0.0259	0.07632
hCV26682080	rs4420638		ENDPT4F1	TIMETO_EP4F1	DOM	GA + GG		Pravastatin	17	441	0.45	0.255	0.804	0.0068	0.04158

TABLE 26
										95%	95%
										Lower	Upper
										CL for	CL for	P-
hCV #	rs #	Gene	MODE	STRATA	ADJUST	GENOTYPE	EVENTS	TOTAL	HR	HR	HR	VALUE
hCV11474611	rs3814843	CALM1	GEN	ALL	STATIN	GG	1	3	7.54	1.055	53.886	0.0441
hCV11474611	rs3814843	CALM1	GEN	ALL	STATIN	GT	14	224	1.17	0.676	2.038	0.5698
hCV11474611	rs3814843	CALM1	GEN	ALL	STATIN	TT	128	2392	ref	.	.	.
hCV11474611	rs3814843	CALM1	REC	ALL	STATIN	GG	1	3	7.43	1.041	53.062	0.0455
hCV11474611	rs3814843	CALM1	REC	ALL	STATIN	GT + TT	142	2616	ref	.	.	.
hCV11474611	rs3814843	CALM1	GEN	ALL		GG	1	3	6.64	0.919	47.944	0.0606
hCV11474611	rs3814843	CALM1	GEN	ALL		GT	6	104	0.95	0.413	2.188	0.9051
hCV11474611	rs3814843	CALM1	GEN	ALL		TT	70	1183	ref	.	.	.
hCV11474611	rs3814843	CALM1	REC	ALL		GG	1	3	6.67	0.924	48.09	0.0599
hCV11474611	rs3814843	CALM1	REC	ALL		GT + TT	76	1287	ref	.	.	.
hCV2930693	rs13183672	FSTL4	REC	ALL	STATIN	AA	96	1498	1.51	1.07	2.14	0.0191
hCV2930693	rs13183672	FSTL4	REC	ALL	STATIN	AC + CC	48	1122	ref	.	.	.
hCV2930693	rs13183672	FSTL4	ADD	ALL	STATIN	A	.	.	1.29	0.965	1.719	0.0859
hCV2930693	rs13183672	FSTL4	REC	ALL		AA	52	729	1.61	0.998	2.59	0.0512
hCV2930693	rs13183672	FSTL4	REC	ALL		AC + CC	25	560	ref	.	.	.
hCV2930693	rs13183672	FSTL4	ADD	ALL		A	.	.	1.48	0.982	2.24	0.0609

TABLE 27
									95%	95%
									Lower	Upper
									CL for	CL for	P-
hCV #	rs	Gene	MODE	GENOTYPE	STATIN	EVENTS	TOTAL	HR	HR	HR	VALUE	PVAL_INTX
hCV1022614	rs220479	ITGAE	GEN	CC	Pravastatin	52	973	0.89	0.609	1.295	0.5366	0.22592
hCV1022614	rs220479	ITGAE	GEN	CC	Placebo	56	927	ref	.	.	.	0.22592
hCV1022614	rs220479	ITGAE	GEN	CT	Pravastatin	15	408	0.48	0.257	0.887	0.0192	0.22592
hCV1022614	rs220479	ITGAE	GEN	CT	Placebo	30	400	ref	.	.	.	0.22592
hCV1022614	rs220479	ITGAE	GEN	TT	Pravastatin	3	46	0.91	0.203	4.047	0.8969	0.22592
hCV1022614	rs220479	ITGAE	GEN	TT	Placebo	4	56	ref	.	.	.	0.22592
hCV1022614	rs220479	ITGAE	DOM	CT + CC	Pravastatin	67	1381	0.74	0.541	1.024	0.0696	0.79081
hCV1022614	rs220479	ITGAE	DOM	CT + CC	Placebo	86	1327	ref	.	.	.	0.79081
hCV1022614	rs220479	ITGAE	REC	CT + TT	Pravastatin	18	454	0.52	0.294	0.921	0.0248	0.11998
hCV1022614	rs220479	ITGAE	REC	CT + TT	Placebo	34	456	ref	.	.	.	0.11998
hCV11450563	rs2038366		GEN	GG	Pravastatin	29	539	1.15	0.669	1.975	0.6132	0.17234
hCV11450563	rs2038366		GEN	GG	Placebo	24	522	ref	.	.	.	0.17234
hCV11450563	rs2038366		GEN	GT	Pravastatin	28	638	0.61	0.381	0.986	0.0436	0.17234
hCV11450563	rs2038366		GEN	GT	Placebo	43	602	ref	.	.	.	0.17234
hCV11450563	rs2038366		GEN	TT	Pravastatin	10	151	1.13	0.472	2.724	0.7789	0.17234
hCV11450563	rs2038366		GEN	TT	Placebo	10	167	ref	.	.	.	0.17234
hCV11450563	rs2038366		DOM	GT + GG	Pravastatin	57	1177	0.81	0.567	1.148	0.2334	0.47195
hCV11450563	rs2038366		DOM	GT + GG	Placebo	67	1124	ref	.	.	.	0.47195
hCV11450563	rs2038366		REC	GT + TT	Pravastatin	38	789	0.7	0.463	1.064	0.0954	0.15155
hCV11450563	rs2038366		REC	GT + TT	Placebo	53	769	ref	.	.	.	0.15155
hCV2091644	rs1010	VAMP8	GEN	CC	Pravastatin	12	271	1.18	0.51	2.73	0.6997	0.48071
hCV2091644	rs1010	VAMP8	GEN	CC	Placebo	10	258	ref	.	.	.	0.48071
hCV2091644	rs1010	VAMP8	GEN	CT	Pravastatin	31	686	0.66	0.418	1.045	0.0763	0.48071
hCV2091644	rs1010	VAMP8	GEN	CT	Placebo	45	666	ref	.	.	.	0.48071
hCV2091644	rs1010	VAMP8	GEN	TT	Pravastatin	26	455	0.71	0.43	1.186	0.1928	0.48071
hCV2091644	rs1010	VAMP8	GEN	TT	Placebo	35	448	ref	.	.	.	0.48071
hCV2091644	rs1010	VAMP8	DOM	CT + CC	Pravastatin	43	957	0.76	0.507	1.126	0.1678	0.87535
hCV2091644	rs1010	VAMP8	DOM	CT + CC	Placebo	55	924	ref	.	.	.	0.87535
hCV2091644	rs1010	VAMP8	REC	CT + TT	Pravastatin	57	1141	0.68	0.487	0.961	0.0284	0.23503
hCV2091644	rs1010	VAMP8	REC	CT + TT	Placebo	80	1114	ref	.	.	.	0.23503
hCV2169762	rs1804689	HPS1	GEN	TT	Pravastatin	4	107	0.99	0.266	3.694	0.9903	0.34901
hCV2169762	rs1804689	HPS1	GEN	TT	Placebo	5	131	ref	.	.	.	0.34901
hCV2169762	rs1804689	HPS1	GEN	TG	Pravastatin	36	652	0.92	0.583	1.468	0.7398	0.34901
hCV2169762	rs1804689	HPS1	GEN	TG	Placebo	36	600	ref	.	.	.	0.34901
hCV2169762	rs1804689	HPS1	GEN	GG	Pravastatin	30	668	0.59	0.372	0.924	0.0214	0.34901
hCV2169762	rs1804689	HPS1	GEN	GG	Placebo	49	651	ref	.	.	.	0.34901
hCV2169762	rs1804689	HPS1	DOM	TG + TT	Pravastatin	40	759	0.95	0.612	1.461	0.8004	0.13433
hCV2169762	rs1804689	HPS1	DOM	TG + TT	Placebo	41	731	ref	.	.	.	0.13433
hCV2169762	rs1804689	HPS1	REC	TG + GG	Pravastatin	66	1320	0.73	0.529	1.006	0.0547	0.65359
hCV2169762	rs1804689	HPS1	REC	TG + GG	Placebo	85	1251	ref	.	.	.	0.65359
hCV2192261	rs3213646	EXOD1	GEN	CC	Pravastatin	27	417	1.05	0.613	1.799	0.8592	0.20384
hCV2192261	rs3213646	EXOD1	GEN	CC	Placebo	26	416	ref	.	.	.	0.20384
hCV2192261	rs3213646	EXOD1	GEN	CT	Pravastatin	24	691	0.54	0.328	0.898	0.0175	0.20384
hCV2192261	rs3213646	EXOD1	GEN	CT	Placebo	41	646	ref	.	.	.	0.20384
hCV2192261	rs3213646	EXOD1	GEN	TT	Pravastatin	13	245	0.64	0.316	1.278	0.2036	0.20384
hCV2192261	rs3213646	EXOD1	GEN	TT	Placebo	20	243	ref	.	.	.	0.20384
hCV2192261	rs3213646	EXOD1	DOM	CT + CC	Pravastatin	51	1108	0.73	0.506	1.048	0.0882	0.72432
hCV2192261	rs3213646	EXOD1	DOM	CT + CC	Placebo	67	1062	ref	.	.	.	0.72432
hCV2192261	rs3213646	EXOD1	REC	CT + TT	Pravastatin	37	936	0.57	0.379	0.857	0.007	0.07855
hCV2192261	rs3213646	EXOD1	REC	CT + TT	Placebo	61	889	ref	.	.	.	0.07855
hCV7425232	rs3900940	MYH15	GEN	CC	Pravastatin	13	160	1.03	0.461	2.296	0.9448	0.57268
hCV7425232	rs3900940	MYH15	GEN	CC	Placebo	11	142	ref	.	.	.	0.57268
hCV7425232	rs3900940	MYH15	GEN	CT	Pravastatin	23	561	0.61	0.365	1.022	0.0604	0.57268
hCV7425232	rs3900940	MYH15	GEN	CT	Placebo	39	583	ref	.	.	.	0.57268
hCV7425232	rs3900940	MYH15	GEN	TT	Pravastatin	30	620	0.71	0.442	1.146	0.1618	0.57268
hCV7425232	rs3900940	MYH15	GEN	TT	Placebo	39	573	ref	.	.	.	0.57268
hCV7425232	rs3900940	MYH15	DOM	CT + CC	Pravastatin	36	721	0.72	0.468	1.102	0.1293	0.97544
hCV7425232	rs3900940	MYH15	DOM	CT + CC	Placebo	50	725	ref	.	.	.	0.97544
hCV7425232	rs3900940	MYH15	REC	CT + TT	Pravastatin	53	1181	0.66	0.467	0.939	0.0207	0.33623
hCV7425232	rs3900940	MYH15	REC	CT + TT	Placebo	78	1156	ref	.	.	.	0.33623
hCV945276	rs89962	KRT4	GEN	TT	Pravastatin	9	238	0.96	0.392	2.375	0.9381	0.71864
hCV945276	rs89962	KRT4	GEN	TT	Placebo	10	255	ref	.	.	.	0.71864
hCV945276	rs89962	KRT4	GEN	TG	Pravastatin	37	674	0.64	0.423	0.979	0.0397	0.71864
hCV945276	rs89962	KRT4	GEN	TG	Placebo	53	628	ref	.	.	.	0.71864
hCV945276	rs89962	KRT4	GEN	GG	Pravastatin	17	443	0.65	0.349	1.196	0.1641	0.71864
hCV945276	rs89962	KRT4	GEN	GG	Placebo	25	426	ref	.	.	.	0.71864
hCV945276	rs89962	KRT4	DOM	TG + TT	Pravastatin	46	912	0.7	0.48	1.027	0.0683	0.83505
hCV945276	rs89962	KRT4	DOM	TG + TT	Placebo	63	883	ref	.	.	.	0.83505
hCV945276	rs89962	KRT4	REC	TG + GG	Pravastatin	54	1117	0.65	0.458	0.916	0.0141	0.42005
hCV945276	rs89962	KRT4	REC	TG + GG	Placebo	78	1054	ref	.	.	.	0.42005

TABLE 28
Association of MYH15 (rs3900940/hCV7425232) with stroke endpoint in CARE
Study population:
CARE study (n = 2913)
Endpoint:
stroke or TIA (offical CARE endpoint) (“endpt4f1”)
Statistical method:
Cox model
Association of MYH15 SNP (rs3900940/hCV7425232) with stroke endpoint in CARE combined treatment arms
	Adjusted1	Adjusted2	Adjusted3
Genotype	HR	95% CI	2-sided p-value	HR	95% CI	2-sided p-value	HR	95% CI	2-sided p-value
Hom_CC	1.403	0.88-2.23	0.153	1.51	0.94-2.40	0.086	1.49	0.93-2.37	0.094
Het_CT	0.925	0.66-1.30	0.6565	0.89	0.63-1.25	0.49	0.881	0.62-1.24	0.4715
Maj_TT	1			1			1
Rec_CC	1.46	0.94-2.25	0.09	1.6	1.03-2.47	0.0358	1.58	1.02-2.45	0.039
Maj + het	1			1			1
“Adjusted1” = Adjusted for statin use
“Adjusted2” = Adjusted for traditional risk factors (TRF), body mass index (BMI), and statin use
“Adjusted3” = Adjusted for TRF, BMI, statin use, and CHD (CARE primary endpoint)
Conclusions:
1) The MYH15 SNP (rs3900940/hCV7425232) was associated with stroke in CARE.
2) The MYH15 SNP (rs3900940/hCV7425232) was associated with stroke in CARE even after adjusting for CHD. (CHD defined in accordance with CARE original endpoint - fatal CHD/definite non-fatal MI, “endpt1”)

TABLE 29
hCV #	rs #	Gene symbol	Risk Allele	MODE	STRATA	GENO_PLACEBO	EVENTS_PLACEBO	TOTAL_PLACEBO
hCV2091644	rs1010	VAMP8	C	GEN	ALL	CC	49	521
hCV2091644	rs1010	VAMP8	C	GEN	hist	CC	28	235
hCV2091644	rs1010	VAMP8	C	GEN	hist	CT	58	633
hCV2442143	rs12544854	ASAH1	T	GEN	no hist	CT	48	808
hCV8942032	rs1264352	DDR1	C	GEN	ALL	CC	8	110
hCV2169762	rs1804689	HPS1	T	GEN	no hist	GT	38	670
hCV16158671	rs2200733	C4	T	GEN	ALL	CT	37	489
hCV16158671	rs2200733	C4	T	GEN	no hist	CT	19	285
hCV16158671	rs2200733	C4	T	GEN	hist	TT	3	10
hCV27504565	rs3219489	MUTYH	C	GEN	hist	CG	35	465
hCV27511436	rs3750145	FZD1	T	GEN	ALL	CC	4	77
hCV27511436	rs3750145	FZD1	T	GEN	hist	CC	1	31
hCV7425232	rs3900940	MYH15	C	GEN	hist	CT	55	528
		LOW-				no
hCV #	HR_PLACEBO	ER_PLACEBO	UPPER_PLACEBO	P_PLACEBO	EVENTS_ALL	event	HR_ALL	P_ALL
hCV2091644	1.50982	1.030611	2.211844	0.0344528	88	951	1.340598	0.051104903
hCV2091644	1.503	0.897908	2.515874	0.1210805	54	428	1.633661	0.014183695
hCV2091644	1.13938	0.733208	1.770572	0.5617921	118	1136	1.344979	0.076364852
hCV2442143	1.31132	0.778332	2.209298	0.3085018	101	1535	1.326084	0.166536479
hCV8942032	1.01239	0.495766	2.067369	0.9730365	22	214	1.368996	0.190221586
hCV2169762	0.99636	0.64971	1.527967	0.9866678	85	1236	1.35397	0.062193717
hCV16158671	1.07497	0.753308	1.533975	0.6902781	80	900	1.197273	0.172251195
hCV16158671	1.2283	0.742471	2.032018	0.4233603	38	517	1.282126	0.189409128
hCV16158671	3.71145	1.175206	11.72124	0.0254095	4	18	2.311594	0.124212946
hCV27504565	0.70803	0.473602	1.0585	0.092402	69	853	0.726379	0.040276813
hCV27511436	0.65977	0.244625	1.779435	0.4113489	6	149	0.503156	0.113669409
hCV27511436	0.32028	0.044599	2.300102	0.2576826	2	64	0.307292	0.120384642
hCV7425232	1.21122	0.833465	1.760195	0.3149935	107	956	1.224954	0.171949776

TABLE 30
		Gene/
		Chrom	Risk
hCV #	rs #	symbol	Allele	MODE	STRATA	GENO_PLACEBO	EVENTS_PLACEBO	TOTAL_PLACEBO
hCV2091644	rs1010	VAMP8	C	GEN	ALL	CC	49	521
hCV2091644	rs1010	VAMP8	C	DOM	ALL	CC + CT	153	1968
hCV2091644	rs1010	VAMP8	C	GEN	no hist	CC	21	286
hCV2091644	rs1010	VAMP8	C	GEN	hist	CC	28	235
hCV26505812	rs10757274	C9p21	G	GEN	ALL	AG	121	1455
hCV26505812	rs10757274	C9p21	G	DOM	ALL	GG + AG	169	2156
hCV26505812	rs10757274	C9p21	G	GEN	no hist	GG	23	364
hCV26505812	rs10757274	C9p21	G	GEN	no hist	AG	52	826
hCV26505812	rs10757274	C9p21	G	DOM	no hist	GG + AG	75	1190
hCV26505812	rs10757274	C9p21	G	GEN	hist	AG	69	629
hCV2442143	rs12544854	ASAH1	T	GEN	no hist	TT	26	393
hCV8942032	rs1264352	DDR1	C	GEN	no hist	CG	37	550
hCV8942032	rs1264352	DDR1	C	DOM	no hist	CC + CG	41	616
hCV16158671	rs2200733	C4	T	GEN	hist	TT	3	10
hCV27504565	rs3219489	MUTYH	C	GEN	hist	CG	35	465
hCV27504565	rs3219489	MUTYH	C	DOM	hist	GG + CG	41	523
hCV27511436	rs3750145	FZD1	T	DOM	ALL	CC + CT	50	804
hCV27511436	rs3750145	FZD1	T	GEN	no hist	CT	16	414
hCV27511436	rs3750145	FZD1	T	DOM	no hist	CC + CT	19	460
		LOW-				no
hCV #	HR_PLACEBO	ER_PLACEBO	UPPER_PLACEBO	P_PLACEBO	EVENTS_ALL	event	HR_ALL	P_ALL
hCV2091644	1.509818	1.030611	2.211844	0.0344528	88	951	1.340598	0.0511049
hCV2091644	1.242162	0.916407	1.683713	0.1622853
hCV2091644	1.452091	0.820968	2.568392	0.1998539	34	523	1.033962	0.91230651
hCV2091644	1.503005	0.897908	2.515874	0.1210805	54	428	1.633661	0.0141837
hCV26505812	1.464442	1.027673	2.086842	0.0347703	215	2683	1.118574	0.41790129
hCV26505812	1.381146	0.981881	1.942766	0.0636069
hCV26505812	1.507129	0.820845	2.767193	0.1857813	47	674	1.215134	0.39336777
hCV26505812	1.482778	0.876794	2.50758	0.1417039	87	1528	0.992161	1
hCV26505812	1.489002	0.900117	2.463154	0.1210931
hCV26505812	1.372228	0.849193	2.217411	0.196237	128	1155	1.185801	0.35086569
hCV2442143	1.479057	0.825673	2.649487	0.1881955	41	704	1.173733	0.49295851
hCV8942032	1.324522	0.870367	2.015654	0.1895578	61	972	1.10852	0.55960326
hCV8942032	1.305687	0.868558	1.962816	0.1996948
hCV16158671	3.711451	1.175206	11.72124	0.0254095	4	18	2.311594	0.12421295
hCV27504565	0.708031	0.473602	1.0585	0.092402	69	853	0.726379	0.04027681
hCV27504565	0.741641	0.506363	1.08624	0.1247589
hCV27511436	0.80098	0.583058	1.100353	0.1707752
hCV27511436	0.603398	0.351722	1.035162	0.066584	42	805	0.824734	0.33847297
hCV27511436	0.646002	0.390525	1.068608	0.0888378

TABLE 31
		Gene/
		Chrom	Risk
hCV #	rs #	symbol	Allele	MODE	STRATA	GENO_RESP	STATIN	EVENTS_RESP
hCV2091644	rs1010	VAMP8	C	DOM	no hist	CC + CT	pravastatin	50
hCV2091644	rs1010	VAMP8	C	DOM	no hist	CC + CT	placebo	67
hCV29539757	rs10110659	KCNQ3	C	REC	hist	CC + AC	pravastatin	106
hCV29539757	rs10110659	KCNQ3	C	REC	hist	CC + AC	placebo	100
hCV26505812	rs10757274	C9p21	G	GEN	ALL	GG	pravastatin	51
hCV26505812	rs10757274	C9p21	G	GEN	ALL	GG	placebo	48
hCV26505812	rs10757274	C9p21	G	GEN	ALL	AG	pravastatin	94
hCV26505812	rs10757274	C9p21	G	GEN	ALL	AG	placebo	121
hCV26505812	rs10757274	C9p21	G	GEN	ALL	AA	pravastatin	56
hCV26505812	rs10757274	C9p21	G	GEN	ALL	AA	placebo	41
hCV26505812	rs10757274	C9p21	G	DOM	ALL	GG + AG	pravastatin	145
hCV26505812	rs10757274	C9p21	G	DOM	ALL	GG + AG	placebo	169
hCV26505812	rs10757274	C9p21	G	GEN	no hist	GG	pravastatin	24
hCV26505812	rs10757274	C9p21	G	GEN	no hist	GG	placebo	23
hCV26505812	rs10757274	C9p21	G	GEN	no hist	AG	pravastatin	35
hCV26505812	rs10757274	C9p21	G	GEN	no hist	AG	placebo	52
hCV26505812	rs10757274	C9p21	G	GEN	no hist	AA	pravastatin	28
hCV26505812	rs10757274	C9p21	G	GEN	no hist	AA	placebo	19
hCV26505812	rs10757274	C9p21	G	DOM	no hist	GG + AG	pravastatin	59
hCV26505812	rs10757274	C9p21	G	DOM	no hist	GG + AG	placebo	75
hCV2169762	rs1804689	HPS1	T	DOM	no hist	TT + GT	pravastatin	57
hCV2169762	rs1804689	HPS1	T	DOM	no hist	TT + GT	placebo	47
hCV2169762	rs1804689	HPS1	T	REC	hist	GG + GT	pravastatin	109
hCV2169762	rs1804689	HPS1	T	REC	hist	GG + GT	placebo	102
		no	TO-		LOW-
	hCV #	event	TAL_RESP	HR_RESP	ER_RESP	UPPER_RESP	P_RESP	P_INT_RESP
	hCV2091644	994	1044	0.7860368	0.54496	1.13377	0.19768	0.0837336
	hCV2091644	1033	1100					0.0837336
	hCV29539757	1087	1193	1.0088023	0.76761	1.32578	0.94987	0.0530448
	hCV29539757	1040	1140					0.0530448
	hCV26505812	638	689	1.0816406	0.7293	1.60421	0.69635	0.0696553
	hCV26505812	653	701					0.0696553
	hCV26505812	1349	1443	0.7768621	0.59335	1.01713	0.06629	0.0696553
	hCV26505812	1334	1455					0.0696553
	hCV26505812	674	730	1.3304985	0.88923	1.99075	0.16486	0.0696553
	hCV26505812	680	721					0.0696553
	hCV26505812	1987	2132	0.8638087	0.69193	1.07838	0.1959	0.0630809
	hCV26505812	1987	2156					0.0630809
	hCV26505812	333	357	1.0681052	0.6028	1.89259	0.82141	0.0828923
	hCV26505812	341	364					0.0828923
	hCV26505812	754	789	0.6977172	0.45454	1.071	0.09971	0.0828923
	hCV26505812	774	826					0.0828923
	hCV26505812	395	423	1.5704654	0.87695	2.81243	0.12894	0.0828923
	hCV26505812	424	443					0.0828923
	hCV26505812	1087	1146	0.8131888	0.57817	1.14374	0.23474	0.0573322
	hCV26505812	1115	1190					0.0573322
	hCV2169762	731	788	1.2655756	0.86016	1.86208	0.23193	0.033
	hCV2169762	777	824					0.033
	hCV2169762	1063	1172	1.0276801	0.7845	1.34624	0.84289	0.0507564
	hCV2169762	1035	1137					0.0507564

TABLE 32
		Gene/
		Chrom	Risk						no	TO-		LOW-
hCV #	rs #	symbol	Allele	MODE	STRATA	GENO_RESP	STATIN	EVENTS_RESP	event	TAL_RESP	HR_RESP	ER_RESP	UPPER_RESP	P_RESP	P_INT_RESP
hCV2091644	rs1010	VAMP8	C	GEN	no hist	CC	pravastatin	13	258	271	0.635895	0.31841	1.26996	0.199563	0.1798335
hCV2091644	rs1010	VAMP8	C	GEN	no hist	CC	placebo	21	265	286					0.1798335
hCV2091644	rs1010	VAMP8	C	GEN	no hist	CT	pravastatin	37	736	773	0.850356	0.5516	1.31092	0.462931	0.1798335
hCV2091644	rs1010	VAMP8	C	GEN	no hist	CT	placebo	46	768	814					0.1798335
hCV2091644	rs1010	VAMP8	C	GEN	no hist	TT	pravastatin	36	492	528	1.358113	0.82457	2.2369	0.22925	0.1798335
hCV2091644	rs1010	VAMP8	C	GEN	no hist	TT	placebo	27	510	537					0.1798335
hCV2091644	rs1010	VAMP8	C	DOM	no hist	CC + CT	pravastatin	50	994	1044	0.786037	0.54496	1.13377	0.197677	0.0837336
hCV2091644	rs1010	VAMP8	C	DOM	no hist	CC + CT	placebo	67	1033	1100					0.0837336
hCV29539757	rs10110659	KCNQ3	C	GEN	hist	AA	pravastatin	7	96	103	0.411487	0.16926	1.00034	0.050088	0.1548877
hCV29539757	rs10110659	KCNQ3	C	GEN	hist	AA	placebo	16	92	108					0.1548877
hCV29539757	rs10110659	KCNQ3	C	GEN	hist	AC	pravastatin	44	493	537	0.994615	0.6549	1.51055	0.979793	0.1548877
hCV29539757	rs10110659	KCNQ3	C	GEN	hist	AC	placebo	44	481	525					0.1548877
hCV29539757	rs10110659	KCNQ3	C	GEN	hist	CC	pravastatin	62	594	656	1.015618	0.70762	1.45767	0.93301	0.1548877
hCV29539757	rs10110659	KCNQ3	C	GEN	hist	CC	placebo	56	559	615					0.1548877
hCV29539757	rs10110659	KCNQ3	C	REC	hist	CC + AC	pravastatin	106	1087	1193	1.008802	0.76761	1.32578	0.949874	0.0530448
hCV29539757	rs10110659	KCNQ3	C	REC	hist	CC + AC	placebo	100	1040	1140					0.0530448
hCV26505812	rs10757274	C9p21	G	GEN	ALL	GG	pravastatin	51	638	689	1.081641	0.7293	1.60421	0.696354	0.0696553
hCV26505812	rs10757274	C9p21	G	GEN	ALL	GG	placebo	48	653	701					0.0696553
hCV26505812	rs10757274	C9p21	G	GEN	ALL	AG	pravastatin	94	1349	1443	0.776862	0.59335	1.01713	0.066291	0.0696553
hCV26505812	rs10757274	C9p21	G	GEN	ALL	AG	placebo	121	1334	1455					0.0696553
hCV26505812	rs10757274	C9p21	G	GEN	ALL	AA	pravastatin	56	674	730	1.330498	0.88923	1.99075	0.164856	0.0696553
hCV26505812	rs10757274	C9p21	G	GEN	ALL	AA	placebo	41	680	721					0.0696553
hCV26505812	rs10757274	C9p21	G	DOM	ALL	GG + AG	pravastatin	145	1987	2132	0.863809	0.69193	1.07838	0.195899	0.0630809
hCV26505812	rs10757274	C9p21	G	DOM	ALL	GG + AG	placebo	169	1987	2156					0.0630809
hCV26505812	rs10757274	C9p21	G	GEN	no hist	GG	pravastatin	24	333	357	1.068105	0.6028	1.89259	0.821407	0.0828923
hCV26505812	rs10757274	C9p21	G	GEN	no hist	GG	placebo	23	341	364					0.0828923
hCV26505812	rs10757274	C9p21	G	GEN	no hist	AG	pravastatin	35	754	789	0.697717	0.45454	1.071	0.099711	0.0828923
hCV26505812	rs10757274	C9p21	G	GEN	no hist	AG	placebo	52	774	826					0.0828923
hCV26505812	rs10757274	C9p21	G	GEN	no hist	AA	pravastatin	28	395	423	1.570465	0.87695	2.81243	0.128942	0.0828923
hCV26505812	rs10757274	C9p21	G	GEN	no hist	AA	placebo	19	424	443					0.0828923
hCV26505812	rs10757274	C9p21	G	DOM	no hist	GG + AG	pravastatin	59	1087	1146	0.813189	0.57817	1.14374	0.234739	0.0573322
hCV26505812	rs10757274	C9p21	G	DOM	no hist	GG + AG	placebo	75	1115	1190					0.0573322
hCV2442143	rs12544854	ASAH1	T	REC	no hist	CC + CT	pravastatin	72	1146	1218	1.087339	0.78059	1.51463	0.620489	0.1385034
hCV2442143	rs12544854	ASAH1	T	REC	no hist	CC + CT	placebo	68	1175	1243					0.1385034
hCV2442143	rs12544854	ASAH1	T	DOM	hist	TT + CT	pravastatin	88	865	953	1.043307	0.77225	1.4095	0.78239	0.1787787
hCV2442143	rs12544854	ASAH1	T	DOM	hist	TT + CT	placebo	82	850	932					0.1787787
hCV27830265	rs12762303	ALOX5	G	DOM	no hist	GG + AG	pravastatin	25	474	499	1.479294	0.78982	2.77065	0.22133	0.1332561
hCV27830265	rs12762303	ALOX5	G	DOM	no hist	GG + AG	placebo	16	445	461					0.1332561
hCV2169762	rs1804689	HPS1	T	GEN	no hist	TT	pravastatin	10	127	137	1.27501	0.51771	3.14008	0.597269	0.102835
hCV2169762	rs1804689	HPS1	T	GEN	no hist	TT	placebo	9	145	154					0.102835
hCV2169762	rs1804689	HPS1	T	GEN	no hist	GT	pravastatin	47	604	651	1.268286	0.82701	1.94501	0.27599	0.102835
hCV2169762	rs1804689	HPS1	T	GEN	no hist	GT	placebo	38	632	670					0.102835
hCV2169762	rs1804689	HPS1	T	GEN	no hist	GG	pravastatin	30	753	783	0.65902	0.41685	1.04187	0.074354	0.102835
hCV2169762	rs1804689	HPS1	T	GEN	no hist	GG	placebo	47	763	810					0.102835
hCV2169762	rs1804689	HPS1	T	DOM	no hist	TT + GT	pravastatin	57	731	788	1.265576	0.86016	1.86208	0.231932	0.033
hCV2169762	rs1804689	HPS1	T	DOM	no hist	TT + GT	placebo	47	777	824					0.033
hCV2169762	rs1804689	HPS1	T	GEN	hist	TT	pravastatin	5	119	124	0.336546	0.11847	0.95606	0.040922	0.1254774
hCV2169762	rs1804689	HPS1	T	GEN	hist	TT	placebo	12	99	111					0.1254774
hCV2169762	rs1804689	HPS1	T	GEN	hist	GT	pravastatin	47	511	558	0.94255	0.62771	1.4153	0.775439	0.1254774
hCV2169762	rs1804689	HPS1	T	GEN	hist	GT	placebo	46	480	526					0.1254774
hCV2169762	rs1804689	HPS1	T	GEN	hist	GG	pravastatin	62	552	614	1.104484	0.76954	1.58521	0.589855	0.1254774
hCV2169762	rs1804689	HPS1	T	GEN	hist	GG	placebo	56	555	611					0.1254774
hCV2169762	rs1804689	HPS1	T	REC	hist	GG + GT	pravastatin	109	1063	1172	1.02768	0.7845	1.34624	0.842894	0.0507564
hCV2169762	rs1804689	HPS1	T	REC	hist	GG + GT	placebo	102	1035	1137					0.0507564
hCV1348610	rs3739636	C9orf46	A	GEN	hist	AA	pravastatin	24	226	250	0.986092	0.54	1.80071	0.963642	0.1842815
hCV1348610	rs3739636	C9orf46	A	GEN	hist	AA	placebo	19	186	205					0.1842815
hCV1348610	rs3739636	C9orf46	A	GEN	hist	AG	pravastatin	47	566	613	0.740596	0.50624	1.08345	0.121846	0.1842815
hCV1348610	rs3739636	C9orf46	A	GEN	hist	AG	placebo	61	545	606					0.1842815
hCV1348610	rs3739636	C9orf46	A	GEN	hist	GG	pravastatin	43	378	421	1.276897	0.81723	1.99511	0.283036	0.1842815
hCV1348610	rs3739636	C9orf46	A	GEN	hist	GG	placebo	35	392	427					0.1842815
hCV1348610	rs3739636	C9orf46	A	DOM	hist	AA + AG	pravastatin	71	792	863	0.806434	0.58581	1.11014	0.187096	0.1002517
hCV1348610	rs3739636	C9orf46	A	DOM	hist	AA + AG	placebo	80	731	811					0.1002517
hCV27511436	rs3750145	FZD1	T	GEN	no hist	CC	pravastatin	1	42	43	0.349207	0.03631	3.35808	0.362284	0.1652143
hCV27511436	rs3750145	FZD1	T	GEN	no hist	CC	placebo	3	43	46					0.1652143
hCV27511436	rs3750145	FZD1	T	GEN	no hist	CT	pravastatin	26	407	433	1.575251	0.84504	2.93645	0.152693	0.1652143
hCV27511436	rs3750145	FZD1	T	GEN	no hist	CT	placebo	16	398	414					0.1652143
hCV27511436	rs3750145	FZD1	T	GEN	no hist	TT	pravastatin	60	1035	1095	0.85237	0.60701	1.19691	0.356417	0.1652143
hCV27511436	rs3750145	FZD1	T	GEN	no hist	TT	placebo	75	1099	1174					0.1652143
hCV27511436	rs3750145	FZD1	T	DOM	no hist	CC + CT	pravastatin	27	449	476	1.387947	0.77175	2.49613	0.273626	0.1600111
hCV27511436	rs3750145	FZD1	T	DOM	no hist	CC + CT	placebo	19	441	460					0.1600111

TABLE 33
		gene/chrom					GENO-
hCV #	rs #	symbol	ENDPT	MODE	STRATA	ADJUST	TYPE
hCV1348610	rs3739636	C9orf46	ATHERO	GEN	WHITE	AGEBL GEND01	AG
hCV15857769	rs2924914		ATHERO	GEN	WHITE	AGEBL GEND01	TT
hCV15857769	rs2924914		ATHERO	REC	WHITE	AGEBL GEND01	TT
hCV15857769	rs2924914		ATHERO	ADD	WHITE	AGEBL GEND01	T
hCV15857769	rs2924914		ATHERO	GEN	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV15857769	rs2924914		ATHERO	REC	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV15857769	rs2924914		ISCHEM	GEN	WHITE	AGEBL GEND01	TT
hCV15857769	rs2924914		ISCHEM	REC	WHITE	AGEBL GEND01	TT
hCV15857769	rs2924914		ISCHEM	ADD	WHITE	AGEBL GEND01	T
hCV15857769	rs2924914		ISCHEM	GEN	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV15857769	rs2924914		ISCHEM	ADD	WHITE	AGEBL GEND01	T
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV15857769	rs2924914		STROKE	GEN	WHITE	AGEBL GEND01	TT
hCV16336	rs362277	HD	STROKE	ADD	WHITE	AGEBL GEND01	C
hCV30308202	rs9482985	LAMA2	ISCHEM	REC	WHITE	AGEBL GEND01	GG
hCV30308202	rs9482985	LAMA2	ISCHEM	REC	WHITE	AGEBL GEND01	GG
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
				95% Lower	95% Upper	P-VALUE
hCV #	EVENTS	TOTAL	HR	CL for HR	CL for HR	(2-sided)	2DF P-VALUE
hCV1348610	147	1809	1.28	0.97	1.70	0.087	0.232
hCV15857769	31	310	1.52	1.03	2.26	0.036	0.111
hCV15857769	31	310	1.47	1.01	2.13	0.046	.
hCV15857769	.	.	1.19	0.99	1.43	0.066	.
hCV15857769	30	300	1.46	0.98	2.17	0.067	0.186
hCV15857769	30	300	1.4	0.96	2.06	0.083	.
hCV15857769	41	310	1.42	1.01	1.99	0.044	0.127
hCV15857769	41	310	1.36	0.98	1.88	0.064	.
hCV15857769	.	.	1.16	0.99	1.35	0.060	.
hCV15857769	40	300	1.36	0.97	1.93	0.078	0.202
hCV15857769	.	.	1.14	0.98	1.34	0.093	.
hCV15857769	48	310	1.32	0.96	1.80	0.084	0.220
hCV16336	.	.	1.2	0.97	1.49	0.093	.
hCV30308202	280	2509	1.21	0.98	1.50	0.080	.
hCV30308202	275	2458	1.21	0.98	1.51	0.080	.

TABLE 34
		gene/chrom					GENO-
hCV #	rs #	symbol	ENDPT	MODE	STRATA	ADJUST	TYPE
hCV1348610	rs3739636	C9orf46	ATHERO	GEN	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	ATHERO	ADD	BLACK	AGEBL GEND01	A
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	ISCHEM	GEN	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	ISCHEM	ADD	BLACK	AGEBL GEND01	A
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	STROKE	GEN	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	STROKE	REC	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	STROKE	ADD	BLACK	AGEBL GEND01	A
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1619596	rs1048621	SDCBP2	ISCHEM	GEN	BLACK	AGEBL GEND01	AA
hCV1619596	rs1048621	SDCBP2	ISCHEM	REC	BLACK	AGEBL GEND01	AA
hCV1619596	rs1048621	SDCBP2	ISCHEM	GEN	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1619596	rs1048621	SDCBP2	ISCHEM	REC	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1619596	rs1048621	SDCBP2	STROKE	GEN	BLACK	AGEBL GEND01	AA
hCV1619596	rs1048621	SDCBP2	STROKE	REC	BLACK	AGEBL GEND01	AA
hCV1619596	rs1048621	SDCBP2	STROKE	GEN	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1619596	rs1048621	SDCBP2	STROKE	REC	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV16336	rs362277	HD	ISCHEM	GEN	BLACK	AGEBL GEND01	CT
hCV16336	rs362277	HD	ISCHEM	GEN	BLACK	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1723718	rs12481805	UMODL1	ATHERO	GEN	BLACK	AGEBL GEND01	AA
hCV1723718	rs12481805	UMODL1	ATHERO	REC	BLACK	AGEBL GEND01	AA
hCV1723718	rs12481805	UMODL1	ATHERO	GEN	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1723718	rs12481805	UMODL1	ATHERO	REC	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1723718	rs12481805	UMODL1	ISCHEM	GEN	BLACK	AGEBL GEND01	AA
hCV1723718	rs12481805	UMODL1	ISCHEM	REC	BLACK	AGEBL GEND01	AA
hCV1723718	rs12481805	UMODL1	ISCHEM	GEN	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1723718	rs12481805	UMODL1	ISCHEM	REC	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV25596936	rs6967117	EPHA1	STROKE	GEN	BLACK	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV25596936	rs6967117	EPHA1	STROKE	REC	BLACK	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV27077072	rs8060368		ATHERO	REC	BLACK	AGEBL GEND01	CC
hCV27077072	rs8060368		ATHERO	ADD	BLACK	AGEBL GEND01	C
hCV27077072	rs8060368		ATHERO	ADD	BLACK	AGEBL GEND01	C
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV27077072	rs8060368		ISCHEM	ADD	BLACK	AGEBL GEND01	C
hCV8754449	rs781226	TESK2	ATHERO	GEN	BLACK	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV8754449	rs781226	TESK2	ISCHEM	GEN	BLACK	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
					95% Lower	95% Upper	P-VALUE
	hCV #	EVENTS	TOTAL	HR	CL for HR	CL for HR	(2-sided)	2DF P-VALUE
	hCV1348610	17	151	2.03	0.93	4.40	0.074	0.203
	hCV1348610	.	.	1.41	0.97	2.06	0.073	.
	hCV1348610	20	151	1.83	0.91	3.67	0.089	0.214
	hCV1348610	.	.	1.36	0.96	1.93	0.085	.
	hCV1348610	25	151	1.75	0.94	3.23	0.076	0.173
	hCV1348610	25	151	1.56	0.96	2.54	0.075	.
	hCV1348610	.	.	1.33	0.98	1.82	0.072	.
	hCV1619596	6	22	2.36	1.00	5.60	0.051	0.150
	hCV1619596	6	22	2.28	0.98	5.32	0.055	.
	hCV1619596	5	20	2.66	1.02	6.90	0.045	0.133
	hCV1619596	5	20	2.54	1.00	6.46	0.050	.
	hCV1619596	7	22	2.15	0.97	4.75	0.059	0.165
	hCV1619596	7	22	2.12	0.97	4.61	0.059	.
	hCV1619596	6	20	2.24	0.95	5.31	0.067	0.185
	hCV1619596	6	20	2.2	0.95	5.14	0.068	.
	hCV16336	43	326	1.68	0.92	3.07	0.094	0.083
	hCV16336	41	309	1.95	1.02	3.71	0.043	0.033
	hCV1723718	3	8	3.95	1.21	12.91	0.023	0.046
	hCV1723718	3	8	4.15	1.28	13.49	0.018	.
	hCV1723718	3	8	3.4	1.00	11.56	0.051	0.085
	hCV1723718	3	8	3.61	1.07	12.22	0.039	.
	hCV1723718	3	8	3.26	1.01	10.59	0.049	0.073
	hCV1723718	3	8	3.46	1.07	11.17	0.038	.
	hCV1723718	3	8	3.08	0.92	10.32	0.068	0.096
	hCV1723718	3	8	3.29	0.99	10.95	0.052	.
	hCV25596936	1	4	7	0.80	61.25	0.079	0.170
	hCV25596936	1	4	6.66	0.77	58.06	0.086	.
	hCV27077072	48	444	1.78	0.96	3.29	0.066	.
	hCV27077072	.	.	1.82	1.03	3.24	0.041	.
	hCV27077072	.	.	1.64	0.91	2.95	0.097	.
	hCV27077072	.	.	1.56	0.94	2.59	0.087	.
	hCV8754449	35	297	1.86	0.99	3.46	0.052	0.081
	hCV8754449	39	297	1.8	1.01	3.24	0.048	0.085

TABLE 35
		gene/chrom					GENO-
hCV #	rs #	symbol	ENDPT	MODE	STRATA	ADJUST	TYPE
hCV11425801	rs3805953	PEX6	ISCHEM	GEN	WHITE	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV11425801	rs3805953	PEX6	STROKE	GEN	WHITE	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	ATHERO	DOM	WHITE	AGEBL GEND01	AG + AA
hCV1348610	rs3739636	C9orf46	ATHERO	GEN	WHITE	AGEBL GEND01	AG
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	ATHERO	DOM	WHITE	AGEBL GEND01	AG + AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV15857769	rs2924914		ATHERO	ADD	WHITE	AGEBL GEND01	T
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV15857769	rs2924914		ISCHEM	DOM	WHITE	AGEBL GEND01	TC + TT
hCV15857769	rs2924914		ISCHEM	REC	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV15857769	rs2924914		STROKE	REC	WHITE	AGEBL GEND01	TT
hCV15857769	rs2924914		STROKE	ADD	WHITE	AGEBL GEND01	T
hCV15857769	rs2924914		STROKE	GEN	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV15857769	rs2924914		STROKE	REC	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV15857769	rs2924914		STROKE	ADD	WHITE	AGEBL GEND01	T
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV16158671	rs2200733		STROKE	GEN	WHITE	AGEBL GEND01	TT
hCV16158671	rs2200733		STROKE	REC	WHITE	AGEBL GEND01	TT
hCV16158671	rs2200733		STROKE	GEN	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV16158671	rs2200733		STROKE	REC	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV16336	rs362277	HD	STROKE	GEN	WHITE	AGEBL GEND01	CC
hCV16336	rs362277	HD	STROKE	DOM	WHITE	AGEBL GEND01	CT + CC
hCV16336	rs362277	HD	STROKE	REC	WHITE	AGEBL GEND01	CC
hCV16336	rs362277	HD	STROKE	ADD	WHITE	AGEBL GEND01	C
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV29401764	rs7793552	LOC646588	ISCHEM	REC	WHITE	AGEBL GEND01	CC
hCV30308202	rs9482985	LAMA2	ISCHEM	ADD	WHITE	AGEBL GEND01	G
hCV30308202	rs9482985	LAMA2	ISCHEM	ADD	WHITE	AGEBL GEND01	G
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV30308202	rs9482985	LAMA2	STROKE	REC	WHITE	AGEBL GEND01	GG
hCV32160712	rs11079160		ATHERO	GEN	WHITE	AGEBL GEND01	TT
hCV32160712	rs11079160		ATHERO	REC	WHITE	AGEBL GEND01	TT
hCV32160712	rs11079160		ATHERO	GEN	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV32160712	rs11079160		ATHERO	REC	WHITE	AGEBL GEND01	TT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
					95% Lower	95% Upper	P- VALUE
	hCV #	EVENTS	TOTAL	HR	CL for HR	CL for HR	(2-sided)	2DF P-VALUE
	hCV11425801	206	1814	1.17	0.928	1.48	0.1834	0.1314
	hCV11425801	254	1814	1.15	0.933	1.418	0.1894	0.1374
	hCV1348610	205	2556	1.25	0.953	1.631	0.108	.
	hCV1348610	143	1763	1.25	0.938	1.658	0.1286	0.3147
	hCV1348610	201	2499	1.22	0.933	1.605	0.1444	.
	hCV15857769	.	.	1.17	0.969	1.403	0.1033	.
	hCV15857769	187	1704	1.16	0.942	1.422	0.165	.
	hCV15857769	40	300	1.31	0.942	1.821	0.1092	.
	hCV15857769	48	310	1.28	0.947	1.723	0.1093	.
	hCV15857769	.	.	1.12	0.974	1.288	0.1112	.
	hCV15857769	47	300	1.29	0.939	1.766	0.1172	0.2918
	hCV15857769	47	300	1.26	0.928	1.702	0.1394	.
	hCV15857769	.	.	1.11	0.96	1.274	0.1632	.
	hCV16158671	16	90	1.41	0.853	2.323	0.1811	0.4076
	hCV16158671	16	90	1.4	0.85	2.306	0.1856	.
	hCV16158671	16	88	1.48	0.895	2.443	0.1272	0.3047
	hCV16158671	16	88	1.46	0.889	2.415	0.1345	.
	hCV16336	408	3030	2.2	0.707	6.862	0.1734	0.2057
	hCV16336	495	3764	2.14	0.689	6.677	0.188	.
	hCV16336	408	3030	1.19	0.944	1.49	0.1428	.
	hCV16336	.	.	1.16	0.937	1.44	0.1709	.
	hCV29401764	199	1792	1.15	0.941	1.395	0.1757	.
	hCV30308202	.	.	1.14	0.946	1.368	0.1694	.
	hCV30308202	.	.	1.14	0.949	1.374	0.1586	.
	hCV30308202	342	2509	1.14	0.942	1.376	0.1802	.
	hCV32160712	13	119	1.47	0.835	2.572	0.183	0.3099
	hCV32160712	13	119	1.5	0.858	2.617	0.1551	.
	hCV32160712	13	117	1.49	0.851	2.626	0.1621	0.2277
	hCV32160712	13	117	1.54	0.883	2.698	0.1277	.

TABLE 36
		gene/chrom					GENO-
hCV #	rs #	symbol	ENDPT	MODE	STRATA	ADJUST	TYPE
hCV11425801	rs3805953	PEX6	ISCHEM	GEN	BLACK	AGEBL GEND01	CT
hCV11425801	rs3805953	PEX6	ISCHEM	GEN	BLACK	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV11425801	rs3805953	PEX6	STROKE	GEN	BLACK	AGEBL GEND01	CT
hCV11425801	rs3805953	PEX6	STROKE	GEN	BLACK	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV11425842	rs10948059	GNMT	ATHERO	GEN	BLACK	AGEBL GEND01	CC
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV11425842	rs10948059	GNMT	ATHERO	REC	BLACK	AGEBL GEND01	CC
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV11425842	rs10948059	GNMT	ATHERO	ADD	BLACK	AGEBL GEND01	C
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV11425842	rs10948059	GNMT	STROKE	GEN	BLACK	AGEBL GEND01	CC
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV11425842	rs10948059	GNMT	STROKE	ADD	BLACK	AGEBL GEND01	C
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	ATHERO	GEN	BLACK	AGEBL GEND01	AA
hCV1348610	rs3739636	C9orf46	ATHERO	DOM	BLACK	AGEBL GEND01	AG + AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	ATHERO	REC	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1348610	rs3739636	C9orf46	ISCHEM	REC	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1619596	rs1048621	SDCBP2	ISCHEM	ADD	BLACK	AGEBL GEND01	A
hCV1619596	rs1048621	SDCBP2	ISCHEM	ADD	BLACK	AGEBL GEND01	A
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV16336	rs362277	HD	ATHERO	GEN	BLACK	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV16336	rs362277	HD	ISCHEM	DOM	BLACK	AGEBL GEND01	CT + CC
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV16336	rs362277	HD	STROKE	GEN	BLACK	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1723718	rs12481805	UMODL1	STROKE	GEN	BLACK	AGEBL GEND01	AA
hCV1723718	rs12481805	UMODL1	STROKE	REC	BLACK	AGEBL GEND01	AA
hCV1723718	rs12481805	UMODL1	STROKE	GEN	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV1723718	rs12481805	UMODL1	STROKE	REC	BLACK	AGEBL GEND01	AA
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV25596936	rs6967117	EPHA1	STROKE	GEN	BLACK	AGEBL GEND01	TT
hCV25596936	rs6967117	EPHA1	STROKE	REC	BLACK	AGEBL GEND01	TT
hCV27077072	rs8060368		ATHERO	REC	BLACK	AGEBL GEND01	CC
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV27077072	rs8060368		ISCHEM	REC	BLACK	AGEBL GEND01	CC
hCV27077072	rs8060368		ISCHEM	ADD	BLACK	AGEBL GEND01	C
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV29401764	rs7793552	LOC646588	STROKE	GEN	BLACK	AGEBL GEND01	CC
hCV29401764	rs7793552	LOC646588	STROKE	REC	BLACK	AGEBL GEND01	CC
hCV29401764	rs7793552	LOC646588	STROKE	GEN	BLACK	AGEBL GEND01	CC
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV29401764	rs7793552	LOC646588	STROKE	REC	BLACK	AGEBL GEND01	CC
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV8754449	rs781226	TESK2	ATHERO	GEN	BLACK	AGEBL GEND01	CT
hCV8754449	rs781226	TESK2	ATHERO	DOM	BLACK	AGEBL GEND01	CT + CC
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV8754449	rs781226	TESK2	ISCHEM	DOM	BLACK	AGEBL GEND01	CT + CC
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV8754449	rs781226	TESK2	STROKE	GEN	BLACK	AGEBL GEND01	CT
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
hCV8942032	rs1264352	DDR1	STROKE	GEN	BLACK	AGEBL GEND01	CG
hCV8942032	rs1264352	DDR1	STROKE	GEN	BLACK	AGEBL GEND01	CG
						BMI PRESSM
						DIABADA HTN
						LDLADJBL
						HDL44BL
					95% Lower	95% Upper	P-VALUE
	hCV #	EVENTS	TOTAL	HR	CL for HR	CL for HR	(2-sided)	2DF P-VALUE
	hCV11425801	25	184	1.4	0.853	2.286	0.1849	0.4151
	hCV11425801	24	177	1.47	0.882	2.446	0.1399	0.3364
	hCV11425801	30	184	1.35	0.865	2.119	0.1854	0.1546
	hCV11425801	29	177	1.39	0.88	2.209	0.1574	0.145
	hCV11425842	19	158	1.63	0.789	3.384	0.1864	0.3447
	hCV11425842	19	158	1.5	0.857	2.628	0.1557	.
	hCV11425842	.	.	1.29	0.894	1.872	0.1716	.
	hCV11425842	25	158	1.51	0.822	2.78	0.1837	0.4087
	hCV11425842	.	.	1.23	0.908	1.664	0.181	.
	hCV1348610	17	157	1.64	0.769	3.515	0.1995	0.4376
	hCV1348610	39	427	1.72	0.865	3.421	0.1223	.
	hCV1348610	17	151	1.54	0.855	2.786	0.1497	.
	hCV1348610	20	151	1.57	0.91	2.713	0.1048	.
	hCV1619596	.	.	1.33	0.902	1.954	0.1502	.
	hCV1619596	.	.	1.37	0.904	2.084	0.1373	.
	hCV16336	34	309	1.61	0.832	3.118	0.1574	0.1458
	hCV16336	53	469	1.6	0.853	3	0.1434	.
	hCV16336	48	309	1.44	0.846	2.456	0.1788	0.1231
	hCV1723718	3	8	2.45	0.763	7.88	0.1323	0.1146
	hCV1723718	3	8	2.62	0.816	8.39	0.1057	.
	hCV1723718	3	8	2.28	0.692	7.493	0.1755	0.1501
	hCV1723718	3	8	2.44	0.746	8.015	0.1401	.
	hCV25596936	1	4	4.13	0.551	31.03	0.1676	0.3443
	hCV25596936	1	4	4.04	0.539	30.26	0.1741	.
	hCV27077072	44	423	1.59	0.852	2.96	0.1453	.
	hCV27077072	53	444	1.48	0.859	2.566	0.1567	.
	hCV27077072	.	.	1.51	0.891	2.567	0.125	.
	hCV29401764	13	61	1.62	0.855	3.084	0.1382	0.3119
	hCV29401764	13	61	1.58	0.873	2.848	0.1313	.
	hCV29401764	12	57	1.62	0.836	3.15	0.1529	0.3156
	hCV29401764	12	57	1.61	0.87	2.981	0.1291	.
	hCV8754449	36	310	1.49	0.836	2.657	0.1758	0.1929
	hCV8754449	43	414	1.61	0.879	2.966	0.1228	.
	hCV8754449	49	414	1.59	0.899	2.806	0.1107	.
	hCV8754449	46	297	1.39	0.847	2.289	0.192	0.1777
	hCV8942032	38	244	1.34	0.867	2.058	0.1894	0.1396
	hCV8942032	36	229	1.43	0.915	2.25	0.1155	0.0872

TABLE 37
hCV # (C9p21	rs # (C9p21			GENO-
SNP)	SNP)	ADJUST	MODE	TYPE	STATIN	EVENTS
hCV26505812	rs10757274	unadjusted	GEN	AA	Pravastatin	17
hCV26505812	rs10757274	unadjusted	GEN	AA	Placebo	17
hCV26505812	rs10757274	unadjusted	GEN	AG	Pravastatin	27
hCV26505812	rs10757274	unadjusted	GEN	AG	Placebo	48
hCV26505812	rs10757274	unadjusted	GEN	GG	Pravastatin	23
hCV26505812	rs10757274	unadjusted	GEN	GG	Placebo	25
hCV26505812	rs10757274	unadjusted	DOM	AG + AA	Pravastatin	44
hCV26505812	rs10757274	unadjusted	DOM	AG + AA	Placebo	65
hCV26505812	rs10757274	unadjusted	REC	AG + GG	Pravastatin	50
hCV26505812	rs10757274	unadjusted	REC	AG + GG	Placebo	73
hCV26505812	rs10757274	AGE MALE CURRSMK	GEN	AA	Pravastatin	18
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
hCV26505812	rs10757274	AGE MALE CURRSMK	GEN	AA	Placebo	17
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
hCV26505812	rs10757274	AGE MALE CURRSMK	GEN	GA	Pravastatin	29
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
hCV26505812	rs10757274	AGE MALE CURRSMK	GEN	GA	Placebo	50
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
hCV26505812	rs10757274	AGE MALE CURRSMK	GEN	GG	Pravastatin	25
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
hCV26505812	rs10757274	AGE MALE CURRSMK	GEN	GG	Placebo	26
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
hCV26505812	rs10757274	AGE MALE CURRSMK	REC	GA + AA	Pravastatin	47
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
hCV26505812	rs10757274	AGE MALE CURRSMK	REC	GA + AA	Placebo	67
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
hCV26505812	rs10757274	AGE MALE CURRSMK	DOM	GA + GG	Pravastatin	54
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
hCV26505812	rs10757274	AGE MALE CURRSMK	DOM	GA + GG	Placebo	76
		HYPERTEN_1 DIABETES_1
		BMI BASE_LDL BASE_HDL
				95% Lower	95% Upper
				Confidence	Confidence
	hCV # (C9p21			Limit for	Limit for
	SNP)	TOTAL	HR	Hazard Ratio	Hazard Ratio	P-VALUE	PVAL_INTX
	hCV26505812	315	0.85	0.433	1.667	0.6359	0.44429
	hCV26505812	262	ref	.	.	.	0.44429
	hCV26505812	666	0.58	0.361	0.927	0.0229	0.44429
	hCV26505812	689	ref	.	.	.	0.44429
	hCV26505812	414	0.91	0.515	1.599	0.7377	0.44429
	hCV26505812	412	ref	.	.	.	0.44429
	hCV26505812	981	0.65	0.446	0.96	0.03	0.34883
	hCV26505812	951	ref	.	.	.	0.34883
	hCV26505812	1080	0.69	0.484	0.994	0.0463	0.65126
	hCV26505812	1101	ref	.	.	.	0.65126
	hCV26505812	328	0.92	0.469	1.802	0.8064	0.43653
	hCV26505812	272	ref	.	.	.	0.43653
	hCV26505812	690	0.61	0.384	0.963	0.0339	0.43653
	hCV26505812	727	ref	.	.	.	0.43653
	hCV26505812	441	1	0.574	1.732	0.9924	0.43653
	hCV26505812	425	ref	.	.	.	0.43653
	hCV26505812	1018	0.69	0.476	1.005	0.0533	0.3725
	hCV26505812	999	ref	.	.	.	0.3725
	hCV26505812	1131	0.73	0.512	1.03	0.0728	0.60059
	hCV26505812	1152	ref	.	.	.	0.60059

TABLE 38
for chromosome 9p21 SNP (rs10757274/hCV26505812):
	Risk						no
ENDPT	Allele	MODE	STRATA	GENO_RESP	STATIN	EVENTS_RESP	event	TOTAL_RESP	HR_RESP_unadj
stroke	G	GEN	ALL	GG	pravastatin	51	638	689	1.082
stroke	G	GEN	ALL	GG	placebo	48	653	701
stroke	G	GEN	ALL	AG	pravastatin	94	1349	1443	0.777
stroke	G	GEN	ALL	AG	placebo	121	1334	1455
stroke	G	GEN	ALL	AA	pravastatin	56	674	730	1.330
stroke	G	GEN	ALL	AA	placebo	41	680	721
stroke	G	DOM	ALL	GG + AG	pravastatin	145	1987	2132	0.864
stroke	G	DOM	ALL	GG + AG	placebo	169	1987	2156
stroke	G	REC	ALL	AA + AG	pravastatin	150	2023	2173	0.919
stroke	G	REC	ALL	AA + AG	placebo	162	2014	2176
stroke	G	GEN	no hist	GG	pravastatin	24	333	357	1.068
stroke	G	GEN	no hist	GG	placebo	23	341	364
stroke	G	GEN	no hist	AG	pravastatin	35	754	789	0.698
stroke	G	GEN	no hist	AG	placebo	52	774	826
stroke	G	GEN	no hist	AA	pravastatin	28	395	423	1.570
stroke	G	GEN	no hist	AA	placebo	19	424	443
stroke	G	DOM	no hist	GG + AG	pravastatin	59	1087	1146	0.813
stroke	G	DOM	no hist	GG + AG	placebo	75	1115	1190
stroke	G	REC	no hist	AA + AG	pravastatin	63	1149	1212	0.927
stroke	G	REC	no hist	AA + AG	placebo	71	1198	1269
stroke	G	GEN	hist	GG	pravastatin	27	305	332	1.098
stroke	G	GEN	hist	GG	placebo	25	312	337
stroke	G	GEN	hist	AG	pravastatin	59	595	654	0.816
stroke	G	GEN	hist	AG	placebo	69	560	629
stroke	G	GEN	hist	AA	pravastatin	28	279	307	1.093
stroke	G	GEN	hist	AA	placebo	22	256	278
stroke	G	DOM	hist	GG + AG	pravastatin	86	900	986	0.892
stroke	G	DOM	hist	GG + AG	placebo	94	872	966
stroke	G	REC	hist	AA + AG	pravastatin	87	874	961	0.885
stroke	G	REC	hist	AA + AG	placebo	91	816	907
ENDPT	LOWER_RESP_unadj	UPPER_RESP_unadj	P_RESP_unadj	P_INT_RESP_unadj	P_RESP_adj
stroke	0.729	1.604	0.696	0.070	0.602
stroke				0.070
stroke	0.593	1.017	0.066	0.070	0.053
stroke				0.070
stroke	0.889	1.991	0.165	0.070	0.158
stroke				0.070
stroke	0.692	1.078	0.196	0.063	0.175
stroke				0.063
stroke	0.736	1.147	0.455	0.472	0.432
stroke				0.472
stroke	0.603	1.893	0.821	0.083	0.824
stroke				0.083
stroke	0.455	1.071	0.100	0.083	0.077
stroke				0.083
stroke	0.877	2.812	0.129	0.083	0.108
stroke				0.083
stroke	0.578	1.144	0.235	0.057	0.191
stroke				0.057
stroke	0.660	1.302	0.662	0.669	0.636
stroke				0.669
stroke	0.637	1.892	0.736	0.535	0.650
stroke				0.535
stroke	0.576	1.155	0.251	0.535	0.323
stroke				0.535
stroke	0.625	1.911	0.755	0.535	0.978
stroke				0.535
stroke	0.666	1.195	0.444	0.508	0.552
stroke				0.508
stroke	0.660	1.187	0.415	0.500	0.420
stroke				0.500
ENDPT	P_INT_RESP_adj	GENO_PLACEBO	EVENTS_PLACEBO	TOTAL_PLACEBO
stroke	0.050	GG	48	701
stroke	0.050
stroke	0.050	AG	121	1455
stroke	0.050
stroke	0.050	AA	41	721
stroke	0.050
stroke	0.055	GG + AG	169	2156
stroke	0.055
stroke	0.398	AA + AG
stroke	0.398
stroke	0.065	GG	23	364
stroke	0.065
stroke	0.065	AG	52	826
stroke	0.065
stroke	0.065	AA	19	443
stroke	0.065
stroke	0.049	GG + AG	75	1190
stroke	0.049
stroke	0.624	AA + AG
stroke	0.624
stroke	0.576	GG	25	337
stroke	0.576
stroke	0.576	AG	69	629
stroke	0.576
stroke	0.576	AA	22	278
stroke	0.576
stroke	0.576	GG + AG	94	966
stroke	0.576
stroke	0.450	AA + AG
stroke	0.450
	ENDPT	HR_PLACEBO	LOWER_PLACEBO	UPPER_PLACEBO	P_PLACEBO
	stroke	1.20631	0.79513	1.8301	0.37779
	stroke
	stroke	1.46444	1.02767	2.0868	0.03477
	stroke
	stroke	ref	0	0	0
	stroke
	stroke	1.38115	0.98188	1.9428	0.06361
	stroke
	stroke
	stroke
	stroke	1.50713	0.82085	2.7672	0.18578
	stroke
	stroke	1.48278	0.87679	2.5076	0.1417
	stroke
	stroke	ref	0	0	0
	stroke
	stroke	1.489	0.90012	2.4632	0.12109
	stroke
	stroke
	stroke
	stroke	0.91337	0.51499	1.6199	0.75659
	stroke
	stroke	1.37223	0.84919	2.2174	0.19624
	stroke
	stroke	ref	0	0	0
	stroke
	stroke	1.21007	0.76069	1.9249	0.42078
	stroke
	stroke
	stroke

Claims

1. A method of determining whether a human has an altered risk for stroke, comprising testing nucleic acid from said human for the presence or absence of a polymorphism selected from the group consisting of the polymorphisms represented by position 101 of any one of the nucleotide sequences of SEQ ID NOS:436-1566 or its complement, wherein the polymorphism indicates an altered risk for stroke.

2-3. (canceled)

4. The method of claim 1, wherein the altered risk is an increased risk.

5. The method of claim 1, wherein the altered risk is a decreased risk.

6. The method of claim 1, wherein said nucleic acid is a nucleic acid extract from a biological sample from said human.

7. The method of claim 6, wherein said biological sample is blood, saliva, or buccal cells.

8. The method of claim 6, further comprising preparing said nucleic acid extract from said biological sample prior to said testing step.

9. The method of claim 8, further comprising obtaining said biological sample from said human prior to said preparing step.

10. The method of claim 1, wherein said testing step comprises nucleic acid amplification.

11. The method of claim 10, wherein said nucleic acid amplification is carried out by polymerase chain reaction.

12. The method of claim 1, further comprising correlating the presence or absence of the polymorphism with an altered risk for stroke.

13. The method of claim 12, wherein said correlating step is performed by computer software.

14. The method of claim 1, wherein said testing is performed using sequencing, 5′ nuclease digestion, molecular beacon assay, oligonucleotide ligation assay, size analysis, single-stranded conformation polymorphism analysis, or denaturing gradient gel electrophoresis (DGGE).

15. The method of any one of claim 1, wherein said testing is performed using an allele-specific method.

16. The method of claim 15, wherein said allele-specific method is allele-specific probe hybridization, allele-specific primer extension, or allele-specific amplification.

17. The method of claim 16, wherein the method is performed using an allele-specific primer provided in Table 3.

18. (canceled)

19. The method of claim 1, further comprising correlating the presence of the polymorphism with a reduction of risk for stroke by an HMG-CoA reductase inhibitor.

20. The method of claim 19, wherein said correlating step is performed by computer software.

21. The method of claim 19, wherein said HMG-CoA reductase inhibitor is a hydrophilic statin.

22. The method of claim 19, wherein said HMG-CoA reductase inhibitor is a hydrophobic statin.

23. The method of claim 19, wherein said HMG-CoA reductase inhibitor is selected from the group consisting of pravastatin, atorvastatin, simvastatin, cerevastatin, lovastatin, storvastatin, rosuvastatin, and fluvastatin, or a combination thereof.

24-41. (canceled)