ARTIFICIAL FORISOME BODIES WITH SEO-F FUSION PROTEINS, PLANT OR YEAST CELLS WITH VECTORS FOR ENCODING THESE PROTEINS AND VECTORS FOR ENCODING SEO-F FUSION PROTEINS

Abstract

Artificial forisome bodies include a fusion protein of at least one SEO-F protein or an at least 50-amino acid portion of an SEO-F protein, and at least one additional protein or peptide, with the exception of GFP and the Venus protein. The additional protein or peptide has a mass of at most 30 kDa, or the forisome body further includes an unfused SEO-F protein or a form of the protein having C-terminal deletions of up to 45 amino acids and/or N-terminal deletions of up to 13 amino acids, in which the unfused SEO-F protein is a protein capable of forming homomeric forisome bodies in the absence of additional SEO-F proteins.

Description

INCORPORATION BY REFERENCE TO ANY PRIORITY APPLICATIONS

Any and all applications for which a foreign or domestic priority claim is identified in the Application Data Sheet as filed with the present application are hereby incorporated by reference under 37 CFR 1.57.

SEQUENCE LISTING IN ELECTRONIC FORMAT

The present application is being filed along with an Electronic Sequence Listing as an ASCII text file via EFS-Web. The Electronic Sequence Listing is provided as a file entitled 2019-04-02_SEQ-SWKC001001C1.txt created and last saved on Apr. 5, 2019, which is approximately 57 kilobytes in size. The information in the Electronic Sequence Listing is incorporated herein by reference in its entirety in accordance with 35 U.S.C. § 1.52(e).

BACKGROUND OF THE INVENTION

Field of the Invention

The present invention relates to artificial forisome bodies having properties useful protein-chemistry, plant cells and yeast cells with a combination of vectors that enable formation and isolation of said forisome bodies in the cell, and novel vectors encoding SEO-F fusion proteins.

Description of the Related Art

Forisomes are plant protein bodies (mechanoproteins), which are found exclusively in the phloem of plants of the Fabaceae family (legumes). They are located in the sieve plates of the phloem system. When the phloem is wounded, forisomes undergo a calcium-dependent conformational change that converts them from a condensed state to a thickened, dispersed state that allows them to plug the sieve elements and prevent the loss of valuable sugar molecules. Forisomes exist as fibrillar substructures packed into large, compact bundles. In vitro, divalent cations, pH changes, or electrical stimuli can trigger forisomes to undergo numerous ATP-independent repeatable cycles of contractions and alternating expansions.

A forisome is comprised of several million subunits. These subunits are homologous proteins that, according to their function, are named “Sieve Element Occlusion by Forisomes” (SEO-F). The thesis by Gundula Noll (2005) describes expression of several genes that code for these proteins using bacterial expression vectors. It was determined that in Medicago trunculata at least four subunits (SEO-F1 to SEO-F4) exist (G. Noll et al., Plant Mol. Biol. 65:285-294 (2007), HC Pelissier et al., Plant Cell Physiol. 49:1699-1710 (2008)). All four subunits have meanwhile been sequenced; their sequences are shown as SEQ-ID NO: 1-4 in Sequence Listing. The sequences of SEO-F1 proteins of the species Dipteryx panamensis, Lotus japonicus, Pisum sativum and Vicia faba are shown as SEQ-ID NO: 5-8 in Sequence Listing. In plants, the different SEO-F proteins assemble to forisome protein bodies. Expression of the corresponding genes in foreign organisms (tobacco plants, yeast) has meanwhile demonstrated that in Medicago trunculata each of the two sub-units, namely SEO-F1 and SEO-F4, assemble into homomeric artificial forisomes in the absence of other subunits, see G. Noll et al., Bioengineered Bugs 2:2, 1-4 (2011), 2011 Landes Bioscience. The SEO-F2 subunit, in contrast, cannot assemble into homomeric forisomes, but can co-assemble both with the SEO-F1 subunit as well as with the SEO-F4 subunit.

Some SEO-F fusion proteins have previously been generated for analytical purposes. Accordingly, G. Noll performed forisome gene-enzyme coupling in the context of her dissertation (2005) for the purpose of producing antibodies in E. coli. However, formation of forisome bodies was hereby not detectable. H. C. Pelissier et al. describe loc. cit. a fusion protein consisting of a forisome subunit and the green fluorescent protein (GFP) that allowed them to demonstrate the assembly of this subunit to a forisome body in transgenic plants in which the fusion protein was stored. In Appl. Microbiol. Biotechnol. (2010) 88:689-698 (2010) B. Müller et al. describe the preparation of four fusion protein vectors that encode one of the MtSEO1 to MtSE04 genes of Medicago truncatula and the Venus yellow fluorescent protein gene. The fusion protein was successfully expressed in epidermal cells of N. benthamiana; when the respective MtSEO gene was co-expressed with MtSEO-F1 or MtSEO-F4, protein complexes were formed that resembled a forisome body but had a different phenotypes. Using the same experimental approach, in the case of MtSEO-F2 and MtSEO-F3 protein was detectable that was localized in the cytoplasm only. In addition, MtSEO-F1/MtSEO-F1venus and MtSEO-F4/MtSEO-F4venus were coexpressed in yeast to demonstrate the possibility of producing such artificial forisome bodies in larger quantities. Furthermore, large quantities of artificial forisomes can be produced by single expression of MtSEO-F1 or MtSEO-F4.

In the past decades, great strides have been made in protein biochemistry, however the purification of recombinant proteins often still presents a substantial challenge, for example for membrane-associated or toxic proteins. In particular with enzymes, it is often observed that the quantity of the enzyme and/or its activity is not within a desirable range making the cost of the assay or the like unreasonably high because of the amount of enzyme required. The expression of recombinant proteins itself may in turn be problematic; some of these proteins may not be folded correctly in the expression organism, or deposited in an inactive form as inclusion bodies within the cell. A further requirement for production is the re-usability of enzymes, which is often accomplished by immobilization on support materials (agarose, nylon). This immobilization often results in strongly reduced enzyme activities, leading to disproportionately high costs of the subsequent assays. Purification of polyclonal antibodies in particular, which is usually performed by chromatographic methods, also remains to be improved. The inventors have therefore set themselves the task to remedy this situation by providing proteins that, on the one hand, can be produced with reasonable effort and, on the other hand, have a structure or form that facilitates the use of these proteins for the afore-mentioned purposes, and/or improves the results obtained with their use compared to results obtained with known proteins or other materials previously used for this purpose.

SUMMARY OF THE INVENTION

To solve this object, the invention proposes to provide modified forisomes. They can improve and simplify many areas of protein chemistry by the biochemically active structures that are contained in the form of fusion proteins therein. When the fusion introduces enzymatic functions to the forisomes, the forisomes can serve as carrier proteins to which the enzymes are immovably coupled, thus circumventing attachment to an external matrix. The forisome may also provide a protective function to the foreign coupled protein in the context of recombinant protein production, e.g., by simplifying their purification: The foreign protein can be easily isolated in the form of forisomes and, if needed, subsequently excised by means of appropriate protease cleavage sites and corresponding proteolytic enzymes. When antigenic structures are introduced into the forisome by fusion, these structures can be employed for purification of antibodies. In addition, by selectively varying their binding properties or by changing their conformation, the bodies according to the invention may be used for micromechanical purposes.

From the above-cited work in combination with the analysis of the SEO-F genes and proteins, it is known that a fusion protein consisting of a SEO-F1 or SEO-F4 protein, a fluorescent tag, and a corresponding native protein are capable of forming forisome bodies. However, the inventors of the present invention found that the assembly of forisomes from, or with, fusion proteins containing any SEO-F unit fused to any protein is not possible. They were nevertheless able to produce artificial forisome bodies containing foreign proteins that were suitable for the purpose of the invention. These forisome bodies can be expressed in yeast, thus allowing large production of forisomes. The authors were successful because it was shown that SEO-F proteins and/or fragments thereof may be combined with either the C-terminus or the N-terminus of a variety of proteins and, optionally, of peptides, whereby forisomes are formed, provided one of the following conditions is met.

The object of the invention is accordingly achieved by providing artificial forisome bodies comprising a fusion protein of at least one SEO-F protein or an at least 50-amino acid portion thereof, and at least one additional protein or peptide, wherein

• (a) the additional protein or peptide has a mass of at most 30 kDa, preferably of at most 25 kDa, and/or
• (b) the forisome body further comprises an unfused, often native SEO-F protein or a form of said protein having C-terminal deletions of up to approximately 50, in particular of up to 45, and preferably of up to 43 amino acids and/or N-terminal deletions of up to 13 amino acids, wherein the unfused SEO-F protein has the property of forming homomeric forisome bodies in the absence of additional SEO-F proteins, or
• (c) the additional protein or peptide is a portion of a second SEO-F protein, with the proviso that one of the two SEO-F proteins in its unfused form is capable of forming homomeric forisome bodies, and the fusion protein is comprised of an N-terminal SEO-F protein portion and a C-terminal SEO-F protein portion, wherein the fusion is within a region that is identical or approximately identical in both SEO-F proteins and is located within an identical or substantially identical region of the proteins relative to a region that is relevant for their function, so that the fusion protein represents a complete SEO-F protein, wherein however up to approximately 50 amino acids, in particular up to 45 amino acids, and preferably up to 43 amino acids of the C-terminus and/or 13 amino acids of the N-terminus may be deleted.

Of course, the present invention also encompasses forisome bodies that fulfill more than one of the conditions (a), (b) and (c).

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the schematic illustration of motif M1. Motif M1 is characteristic for proteins of the SEO family and located near their C-terminus in the SEO-CTD. Of special interest are the four highly conserved cysteines of this motif. In the forisome subunit MtSEO-F1, these cysteines are at the positions 615, 620, 633 and 634 of the amino acid sequence.

FIG. 2 shows an activity assay for the purified MtSEO-F1/MtSEO-F2-G6PDH forizymes and MtSEO-F1 control forisomes based on measuring the formation of NADPH by monitoring the absorbance at 340 nm in a G6PDH enzyme assay.

FIG. 3 shows the recombinant protein purification of MSP₁₉, using protein bodies consisting of either one or two forisome subunits.

FIG. 4 shows utilizing the interaction of the B-domain and IgG antibodies for immobilizing artificial forisomes. For visualization, the B-domain is fused to the SEO-F1 subunit of the forisome body and detected by a fluorescence-coupled IgG antibody.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

As already mentioned above, forisome bodies assembled from the combination of fusion proteins MtSEO-F1venus and MtSEO-F4venus with corresponding native proteins such as MtSEO-F1/MtSEO-F1venus and MtSEO-F4/MtSEO-F4venus are known from the prior art. These shall be excluded from the scope of the patent. They were produced for the purpose of forisome detection, while the present invention is in no way aimed at detecting forisomes, but at solving specific problems that occur in protein chemistry. Therefore, all such forisome bodies shall fall outside the scope of the patent that were generated from or with fusion proteins having a SEO-F protein or SEO-F peptide fused to a GFP protein (see SEQ ID NO:9 in Sequence Listing) or to a Venus protein (see SEQ ID NO:10 in Sequence Listing) or a portion thereof, or fused to a (artificial) variant thereof, provided the fusion protein is fluorescent, optionally by use of excitation light (such as blue or ultraviolet light). Those forisome bodies shall also not fall within the scope of the patent that are constructed to contain fusion proteins fused to other fluorescent or otherwise visually detectable peptides and proteins, e.g., chemiluminescent proteins, provided said fusion proteins are not biochemically active or activatable in the sense hereinafter defined. In the broadest sense, this may optionally apply to any forisome body assembled from or comprising fusion proteins containing protein components of non-SEO-F molecules that serve no other purpose, or are generally not intended to serve another purpose than detecting the presence of the desired fusion. The exceptions named of course extend to all products of this invention that contain the above-mentioned forisome bodies or with which said forisome bodies and/or corresponding fusion proteins can be produced.

The invention is aimed at the production of forisome fusion proteins that confer artificial biochemical activity or activatability or altered mechanical properties to the forisomes. Therefore, the additional peptide or protein is selected from the group of biochemically active or activatable proteins or peptides, and portions of a second SEO-F protein.

The term “biochemically active or activatable proteins or peptides” according to the invention includes, among others, any protein involved in metabolism such as enzymes-due to their biocatalytic effects-, any protein capable of eliciting an immune reaction, or proteins that are therapeutically beneficial such as in particular antibodies and antigens, all peptides or proteins having binding sites for foreign proteins or peptides, and other biotechnologically useful proteins and peptides. The term “biotechnologically useful” according to the invention includes for example any protein and peptide whose synthesis may be of significance for medical applications or diagnostic methods. Several proteins can be immobilized due to their affinity reaction with substrate-bound biological or biochemically-produced materials in order to enable their re-usability. Such proteins or peptides are also included in the term “biotechnologically useful.” Not covered by the term on the other hand are proteins or peptides that are (exclusively) designed to detect the fusion protein formation such as optically detectable, in particular fluorescent proteins, especially when said proteins or peptides do not possess biocatalytic activity or any other of the above-mentioned properties.

The inventors have found that forisome bodies can generally always be assembled in yeast when the fusion proteins of the invention are co-expressed with an unfused, for example native SEO-F protein, provided said SEO-F proteins has the property of forming homomeric forisome bodies in the absence of other SEO-F proteins, see condition (b). This is likely due to the fact that because of the presence of homomer-forming SEO-F molecule, the number and characteristics of the structures relevant for assembly is relatively high.

Surprisingly, however, the inventors have found that the above-defined fusion proteins assemble to forisome bodies even in the absence of said unfused SEO-F proteins in yeast when the proportion of foreign protein does not exceed a certain size. The inventors have found that this occurs when the non-SEO-F-portion has a mass of at most 30 kDa. It is more advantageous to limit the size to approximately 25 kDa (condition (a)). The forisome bodies thus obtainable are somewhat thinner and more fibrous, but can still be purified.

In regards to the definition of artificial forisomes in provision (c) it must be mentioned that in the context of the invention it was determined that SEO-F fusion products having all required properties of a SEO-F protein can be produced artificially. This requires that at least a portion of the fusion protein is derived from a SEO-F protein that is capable of forming homomeric forisomes. It is believed that in these proteins the structures that are required for assembly and thus contribute to the formation of forisomes are more pronounced. The aforementioned possibility that a certain deletion, which can be more extensive in the C-terminal region than in the N-terminal region, is, according to inventor's preliminary opinion without being absolutely bound thereto, due to the fact that the structures relevant for assembly are not located within these regions.

The inventor's discovery that according to conditions (c) artificial SEO-F proteins can be obtained that have the ability of assembling to homomeric forisomes, i.e., without additional, for example unfused protein, enables the preparation of forisomes having assembly properties that can be appropriately controlled, e.g. increased. In this way the mechanical properties of such forisomes can be adjusted to the desired applications. For example, the conditions (Ca²⁺ concentration and/or pH and/or electrical stimuli) required for conformational changes can be varied so that the forisomes can also be technically used under conditions that are not able capable of inducing conformational changes in native forisomes.

According to the invention, the fusion protein may contain the additional protein C-terminally i.e. based on the cloning vector and the DNA reading frame, “upstream”, or N-terminally, i.e. based on the cloning vector and the DNA reading frame “downstream.”

Particular advantages of using the present invention can be achieved in the following areas:

• a) Enzyme immobilization is used for industrial enzymes as it offers the advantage of re-using enzymes and minimizing contaminations in the enzyme product. However, the carrier material generally reduces the stability and activity of enzymes compared to their soluble forms. To date, enzyme immobilization is conducted mainly by adsorption, entrapment, cross-linking, or covalent binding of the enzyme to substrate materials. Disadvantages of immobilization methods include for example insufficient binding of the enzyme following adsorption and inclusion, the use of toxic chemicals for cross-linking, and blockage of essential functional amino acids groups when covalent bonds are introduced. The support materials used to date are synthetic polymers such as acrylic resins, hydrogels and silica, smart polymers such as PNIPAM, or biopolymers such as agarose, cellulose, starch, and chitosan. For example, glucose-6-phosphate dehydrogenase immobilized to agarose beads with an activity of 1000-1750 Units/gram agarose is commercially available. The purification of the enzyme, and the subsequent coupling of the enzyme to the carrier material thereby represent two separate steps, wherein the enzyme activity after immobilization is greatly reduced.
• b) Depending on the properties of the protein, expression of recombinant proteins may be problematic. For example toxic proteins affect the vitality of the expression organism and reduce the amount of recombinant protein produced. Other proteins are not properly folded or deposited as inclusion bodies in inactive forms within the cell. Other problems may occur during purification of the recombinant protein. For example, the isolation of membrane proteins is complicated by their interaction with membrane components, or proteins may be degraded during the purification process. Furthermore, the process of protein purification is usually very expensive and often requires the use of large amounts of environmentally harmful chemicals. In practice, even in industrial manufacturing process, the purification consists of multiple steps. The steps involved include precipitation, filtration, or chromatographic methods. The most important criteria of these methods are the purification efficiency, cost efficiency, and biological sustainability. For example, precipitation is very cost-effective, but delivers a low degree of purity and requires use of large amounts of chemicals, while filtration or chromatographic methods are often very expensive. For this reason, the development of new purification methods that increase the purity of the product, reduce costs, and minimize the use of chemicals are of great interest to the industry.
• c) Polyclonal antibodies are generated by injecting animals with respective antigens (proteins or peptides). Several weeks later, the polyclonal serum may be harvested from the blood of the animal. For the generation of monoclonal antibodies, plasma cells from spleen or lymph nodes of immunized animals are isolated, fused with tumor cells, and grown in sterile culture. After several rounds of selection, hybridoma cultures can be obtained that originate from a single cell and secrete the desired monoclonal antibody. In particular with polyclonal antibodies, more rarely with monoclonal antibodies, the serum contains not only the desired antibodies but also undesired antibodies (e.g., keratin antibodies) and/or substances that interfere with detection (e.g., proteins that are similar to the antigen used, or proteins that aggregate and interfere with detection methods.) These substances must be removed from the desired antibody. To date, this has been accomplished by chromatographic methods wherein the antigen is bound to a column matrix. The matrix is subsequently incubated with the “impure” antibody solution, allowing the specific antibodies to bind to the antigen, and thus to the matrix. After the matrix is washed, the antibodies are eluted from the column (e.g., by a solution with an acidic pH.) A simplification of this laborious method and increased efficiency is extremely desirable.
• d) The advantages of the invention, however, are not limited only to the manufacture and the properties of foreign proteins; they can be advantageously used in the field of forisomes itself: As mentioned above, forisomes are plant mechanoproteins that can be employed e.g., as control modules in microfluidic systems due to their calcium or pH-inducible conformational changes. These properties allowed A. Q. Shen et al. in Smart Struct. Syst. 2, 225-235 (2006) and K. Uhlig et al. in J. Microelektromech. Sys. 17, 1322-1328 (2008) to demonstrate that the flux of fluorescent particles in microchannels could be controlled using forisomes integrated therein. However, targeted, permanent attachment of forisomes can only be achieved to date manually with the help of micromanipulation techniques that require a very large amount of time and effort. Thus, Shen et al. and Uhlig et al. (loc. cit.) took advantage of forisome's natural adhesion to glass. Forisomes thereby adhere to surfaces when pressed against them. However, the adhesion does not enable permanent attachment of the forisomes in a fluid stream. In addition, the strength of the forisome reaction is reduced upon their adhesion to surfaces (G. A. Noll et al., Bioeng. Bugs 2, 111-114 (2011)).

The provision of forisomes with conformational properties that can be altered by known stimuli (e.g., upon conversion from a condensed to dispersed state and vice versa at a different pH or with a different Ca²⁺ concentration) is also desirable.

The inventors of the present invention succeeded in providing a material that has advantages in all four of the mentioned areas. It was thereby found that expression of fusion proteins is often possible when forisome proteins that can form homomers independently of the presence of other forisome subunits are co-expressed in the same cell. In contrast, the expression of the fusion protein alone yields usable product only when small foreign proteins are used, while in other cases forisome bodies are not formed and instead the protein is present in soluble form or deposited in the cell as “inclusion body.”

When a fusion protein is co-expressed with a homomeric forisome body forming SEO-F subunit and/or a when a fusion protein of a relatively small foreign protein component is expressed, stable forisome bodies can be expressed in plants and in yeast having substantially the form of native forisomes, despite the presence of a foreign protein or peptide. Thus, the invention offers the possibility of producing individually modulatable functionalized artificial forisomes. This was surprising in itself, but also in particular the finding that the assembly of the forisome bodies did not impede the functional activity of the foreign protein. Using the example of enzymes fused to SEO-F units it was shown that the forisome bodies reduced the activity of the foreign proteins to a lesser extent than commercially applied immobilization matrices; it may be assumed that this applies to all fusion proteins, despite not having being demonstrated for a number of other proteins due to lack of quantitative comparisons.

The use of MtSEO-F1 and MtSEO-F4 is particularly preferred; however, SEO-F subunits from other sources may be used equally well.

It has been found that it is not necessary for the entire amino acid chain of a respective native SEO-F subunit to be present in the fusion protein. Instead, even a relatively small amount thereof suffices, for example, a region of approximately 60 to 250 amino acids in length, as the inventors were able to determine via fusion with fluorescent proteins. This also corresponds to the finding that the presence of homomer-forming proteins such as SEO-F1 and/or SEO-F4 determines whether forisome are formed when the foreign protein exceeds a certain size.

The SEO-F component of the fusion protein can be derived from any SEO-F subunit; preferably, it is derived from the subunits SEO-F1, SEO-F2 and SEO-F4, especially from MtSEO-F1, MtSEO-F2 and MtSEO-F4.

The coexpressed, unfused SEO F protein, if present, should be substantially or at least in large part complete in order to ensure forisome formation. The inventors have found, however, that it is not required for the entire chain of respective subunits to be present. An N-terminal deletion of at least up to 13 amino acids and/or C-terminal deletions of at least up to 43 amino acids, optionally of up to 45 and possibly up to 50 amino acids are acceptable without the forisome bodies of the present invention being adversely affected.

The forisome bodies of the present invention may be comprised of any number of subunits; generally, a species of a non-fused SEO-F subunit in combination with a species of a fusion protein is sufficient, or a species of the fusion protein alone, provided the foreign protein component does not exceed the mentioned size. The forisome bodies generally consist of from approximately 10⁶-10⁷ individual protein chains, wherein optionally the ratio of the number of unfused SEO-F subunits to the number of fusion proteins is approximately between 4:1-1:1, depending on the type and size of the foreign protein.

Individual forisome bodies of the invention are generally comprised of only one type of fusion protein; however, they may also contain several different fusion proteins. A specific, particularly advantageous example thereof is illustrated below in point 1).

The origin of the native source of the respective forisome subunits is not significant for the invention. It was possible to produce forisome bodies according to the invention with SEO-F genes, for example, from the organisms Dipteryx panamensis, Pisum sativum, Vicia faba, Canavalia gladiata and Lotus japonicus. This suggests that it is possible to employ corresponding genes of any plants of the Fabacea family in the invention. In addition, genetically modified or synthetic SEO-F genes and/or forisomes subunits may be employed provided all of the conserved regions of genes of this plant family are preserved and/or present.

It has been suspected for some time that a sequence of four cysteines in the amino acid sequence of the various forisomes subunits greatly affects their structure and stability. These cysteines are located in the C-terminal portion of the amino acid sequence (following position 600) of all three forisomes subunits SEO-F1, F2, and SEO-SEO-F4, in each case within a highly conserved motif CPNPXCGRVMEVXSXXYKCC (where X denotes a variable amino acid). This motif is highly conserved in all SEO genes (i.e., also in those of other plant families). The corresponding sequence motif is shown in FIG. 1. However, the inventors have shown that the presence of this region is not essential for forisomes formation: As mentioned above, it is possible to use a SEO-F-protein in form of a coexpressed unfused SEO-F protein or a fusion protein comprising two SEO-F components, having a C-terminal deletion of up to 43, possibly even up to 45 or even 50 amino acids without the inventive feature of protein chain aggregation being lost. However, when the complete sequence of a SEO-F1 or SEO-F4 is used, or at least a sequence in which at least a part or all of the said conserved motif is present, the above cysteines obviously have a significant role: It has been shown that when the mentioned cysteines are partially or completely replaced, for example by “site-directed mutagenesis,” by amino acids which do not allow disulfide bond formation, e.g., glycine or alanine, the conformational states of the forisome bodies changes as follows: If the last two of said cysteines (cysteines C21 and C22 in the sequence motif) are mutated, the protein fibrils no longer assemble in all cases to forisome bodies, but may form a random fiber network. Without being bound by theory, it can therefore be assumed that the disulfide bonds between said cysteines of two SEO-F subunits are responsible for the ordered assembly of the protein fibrils. If, in contrast, at least one of the first two said cysteines (cysteines C3 and C8 in the sequence motif) is mutated, a typical forisome body is assembled upon its expression which, however, completely dissolves when calcium ions and NaHSO₃ are added. Calcium thereby triggers the protein fibrils to repel, while the addition of NaHSO₃ disrupts remaining disulfide bonds. It can therefore be assumed that the C3 and C8 cysteines are involved in the association of individual subunits to form fibers, which allows the protein to adopt its soluble form upon mutagenesis.

The fibrous bodies may have advantageous properties and are encompassed by the invention. The term “artificial forisome,” as used in the present invention, is therefore intended to also encompass the fiber network in at least one embodiment of the invention.

The production of soluble forisomes-bodies as described above is particularly advantageous, as it may facilitate the purification of proteins, as shown in the examples below.

As mentioned above, the preparation of forisome bodies is preferably performed in cells of plants or yeast, with the use of yeast cells being particularly beneficial because they enable the production of large amounts of artificial forisome bodies. The invention is therefore also directed to the corresponding transformed cells. Finally, the invention also comprises novel vector constructs by means of which forisome bodies according to the invention can be produced.

The invention shall be detailed with reference to several examples that demonstrate the breadth of application of the invention on the one hand and on the other specify the individual measures that enable the expert to carry out the invention. It should therefore be clear that the above examples are not meant to be limiting.

1) Forisome Bodies with Enzyme-Linked Fusion Proteins

The linking of enzymes to SEO-F proteins allows the artificial forisomes to be functionalized in such a manner that they can serve as substrates for enzymes. Enzymes may thus be immobilized. Enzyme-linked forisomes are constructed as follows: They consist of a first, optionally shortened, SEO-F subunit that is fused to an enzyme, and optionally a second SEO-F unit selected from SEO-F1 and SEO-F4, which may be deleted as described above if necessary or if desired. The enzyme may be fused to the C- or N-terminus of the fusion protein. Fusions proteins can be generated by coexpression in organisms suitable for expression such as yeast (e.g., Saccharomyces cerevisiae), bacteria (e.g., Escherichia coli) or plants (e.g., tobacco). The (co-) expression in yeast is particularly preferred. The resulting enzyme-linked forisomes are characterized by high stability. They are isolated from the expression organism (e.g., by disruption of yeast cells) and are separated from cell components, e.g., by centrifugation/density gradient centrifugation. Appropriate enzyme activity assays are used to verify the activity of the coupled enzyme. Using glucose-6-phosphate dehydrogenase as an enzyme fused to the N-terminus of a forisome subunit, a significantly higher enzymatic activity was measured in comparison to the commercially available immobilized enzyme (2700 Units/gram forisome compared to 1000-1750 U/g agarose, see SEQ ID NO:4 in Sequence Listing). The enzyme was isolated directly in an immobilized form from the production organism, thereby omitting the step of substrate coupling in the enzyme production. This not only facilitates the procedure, but obviously and surprising causes an extreme increase in activity. Fusion proteins containing hexokinase and phosphoglucoisomerase that were prepared in a similar manner yielded similar results.

When not only one, but two or even more fusion proteins are coexpressed, wherein the fusion partners are selected so that the reaction product of the first enzyme is a substrate for the second enzyme and its reaction product is optionally a substrate for a third protein, etc., reaction complexes can be generated that allow certain reaction pathways to take place.

In the fusion protein, the enzyme can also be bound to the C-terminus of the SEO-F protein.

2) Purification of Recombinant Proteins

As mentioned above, the artificial forisome bodies of the invention can also be used as purification systems for recombinant proteins. Said proteins are thereby fused to a SEO-F subunit and the fusion protein is optionally co-expressed with a second SEO-F subunit that is able to form homomers in the absence of other subunits, as described above, for example, in yeast or plant cells. The recombinant protein may be present at the C-terminus or N-terminus of the fusion protein, and optionally contain a protease restriction site that enables the foreign protein to be cleaved from the forisome body following purification. The isolation and purification of the obtained artificial forisomes is performed by cell disruption and e.g., centrifugation/density gradient centrifugation. Alternatively, the protein polymer can be converted from the solid state polymer to a soluble state, in particular following mutation of one or more of the above-described C-terminal conserved cysteines by means of high Ca²⁺ concentration (<2 mM), or by a combination of high Ca²⁺ concentration (<2 mM) and reducing conditions (>18.5 μM NaHSO₃). Thus, forisome technology presents an entirely new purification system that completely omits traditional methods such as precipitation, filtration, and chromatography, and instead is based on centrifugation and the conformational state of the protein. Based on this technology, purification of a variety of proteins can be simplified and the cost reduced. In addition, the purification system offers the advantage that toxic effects or interactions of the proteins to be purified with the membrane can be minimized or prevented by fusion to forisomes. Using this approach, the malaria antigen MSP1₁₉ for example was successfully purified by the present invention; this is extremely difficult by other means due to the strong interaction of MSP1₁₉ with the membrane. The purification is illustrated by immunological detection of the antigen, which is shown in FIG. 3.

3) Purification of Antibodies

The invention enables purification of polyclonal or monoclonal antibodies to be performed using artificial forisomes, thereby avoiding previous chromatographic separation steps. For this purpose, the antigen is cloned upstream or downstream to a forisome gene (MtSEO-F1 or MtSEO-F2 or MtSEO-F4 and/or a portion thereof, as defined above) by the methods described previously. The antigen-MtSEO-F-fusion product is subsequently expressed in yeast, optionally together with MtSEO-F1 and MtSEO-F4 having C-terminal and/or N-terminal deletions of up to 13 amino acids. This procedure yields artificial forisomes that contain the antigen in the yeast cells.

The yeast cells are grown, pelleted by centrifugation, and the cells disrupted. The artificial forisomes carrying the antigen are now free in solution and can be used to purify the polyclonal or monoclonal antibodies as follows.

The antigen-containing artificial forisomes are incubated with antibody serum, whereby the specific antibodies bind to the artificial forisomes. The forisome are pelleted by centrifugation, washed, and the antibodies subsequently eluted via a pH change. The antibody solution is then neutralized and can now be used for various applications (Western blot, immunoprecipitation, ELISA, antibody therapy, etc.).

4) Modification of Forisomes Properties

With the help of the invention, forisomes can be modified artificially to acquire new, technologically useful properties. For example, the binding of forisomes to surfaces can be improved by including SEO-F subunits fused to protein or (protein or peptide) tags in said forisomes. This approach enables their positioning and immobilization in microchannels. Examples include the fusion with the B-domain of the Staphylococcus aureus protein A, with glutathione S-transferase or with biotin, which allows selective surface functionalization of the artificial forisome produced in the organism and subsequent isolation in a manner that enables their covalent binding to surfaces coated with IgG, glutathione, or streptavidin. As before, stable forisome can be obtained when a SEO-F subunit capable of forming homomers in the absence of other subunits is coexpressed with the fusion protein, or the foreign protein component in the expression product is not too large. This circumvents problems associated with accurate positioning of forisomes employed as mechanoproteins to surfaces or to micro channels. If a fusion is performed with a further SEO-F protein instead of with a foreign protein, a mechanoprotein body is obtained having conformational change properties that can be modified by the Ca²⁺ concentration and pH.

The following examples of specific embodiments are intended to deepen the understanding of the invention.

Example 1—Enzyme Immobilization Using Artificial Forisomes (Enzyme Coupling)

I. The forisome genes MtSEO-F1 and MtSEO-F2 and MtSEO-F4 with and without translational stop codon were amplified from M. truncatula cDNA using the following oligonucleotides (the restriction sites are underlined):

MtSEO-F1 fw Ncol: 5′-AGA ACC ATG GGA TCA TTG TCC
AAT GGA ACT AAA C-3′
MtSEO-F1 rev Xhol with stop: 5′-AGA CTC GAG TCA
TAT CTT GCC ATT CTG TGG AGC-3′
MtSEO-F1 rev Xhol without stop: 5′-AGA CTC GAG
CAT ATC TTG CCA TTC TGT GGA GC-3′
MtSEO-F2 fw Ncol: 5′-AGA ACC ATG GGA TCC ACT GCA
TTG TCC TAT AAT G-3′
MtSEO-F2 rev Xhol with stop: 5′-AGA CTC GAG TCA
AAT GCA ACT ATC TGG-3′
MtSEO-F2 rev Xhol without stop: 5′-AGA CTC GAG
ATG CAG CAA CTA TCT GGA-3′
MtSEO-F4 fw Ncol: 5′-AGA ACC ATG GGA TCC CTT TCC
AAC TTA GGA AG-3′
MtSEO-F4 rev Xhol with stop: 5′-AGA CTC GAG TCA
AAC ACC AAG ATT GTT TGG-3′
MtSEO-F4 rev Xhol without stop: 5′- AGA CTC GAG
ACA CCA AGA TTG TTT GGT TC-3′

The amplicons were digested with the restriction enzymes NcoI/XhoI and cloned into the corresponding restriction sites of the pENTR4™ vector (Invitrogen, Germany). In this way, pENTR4-MtSEO-F vectors with and without stop codons were generated.

II. The genes of the enzymes hexokinase 2 (HXK2), phosphoglucoisomerase (PGI) and glucose-6-phosphate dehydrogenase (G6PDH) from Saccharomyces cerevisiae were amplified as cDNA using the following oligonucleotides (the restriction sites are underlined).

G6PDH fw Xhol: 5′-AGA CTC GAG AAT GAG TGA AGG CCC
CGT C-3′
G6PDH rev Xhol: 5′-AGA CTC GAG CTA ATT ATC CTT CGT
ATC TTC-3′
HXK2 fw Xhol: 5′-AGA CTC GAG AAT GGT TCA TTT AGG
TCC AAA-3′
HXK2 rev Xhol: 5′-AG ACT CGA GTT AAG CAC CGA TGA
TAC CA-3′
PGI Xhol fw: 5′-AGA CTC GAG AAT GTC CAA TAA CTC
ATT CAC-3′
PGI Xhol rev: 5′-AGA CTC GAG ATC ACA TCC ATT CCT
TGA ATT G-3′
Invertase Xhol fw: 5′-AGA CTC GAG AGC ATC AAT GAC
AAA CGA AAC-3′
Invertase Xhol rev: 5′-AGA CTC GAG CTA TTT TAC
TTC CCT TAC TTG G-3′

The amplicons were digested with XhoI and cloned into the corresponding restriction site of the pENTR4-MtSEO-F vectors without stop (see a) I). In this way, the following vectors were obtained: pENTR4-MtSEO-F1-G6PDH, pENTR4-MtSEO-F2-G6PDH, pENTR4-MtSEO-F4-G6PDH, pENTR4-MtSEO-F1-HXK2, pENTR4-MtSEO-F2-HXK2, pENTR4-MtSEO-F4-HXK2, pENTR4-MtSEO-F1-PGI, pENTR4-MtSEO-F2-PGI and pENTR4-MtSEO-F4-PGI.

III. The vectors pENTR4-MtSEO-F1 with stop and pENTR4-MtSEO-F4 with stop were recombined with the yeast vectors 425GPD-ccdB (Addgene, USA). The resulting expression constructs 425GPD-MtSEO-F1 and 425GPD-MtSEO-F4 were transformed into the yeast strain InvSc1 (Invitrogen, Germany). For selection, the correction of the yeast strain leucine auxotrophy was used. The resulting yeast cells produce artificial forisomes of MtSEO-F1 or MtSEO-F4 that were used as the basis for enzyme coupling.

IV. The above-mentioned pENTR4 vectors with MtSEO-F-enzyme fusions (see 1.II.) were recombined with the yeast vector 424GPD-ccdB (Addgene, USA). The resulting vectors (424GPD-MtSEO-F1-G6PDH, 424GPD-MtSEO-F2-G6PDH, 424GPD-MtSEO-F4-G6PDH, 424GPD-MtSEO-F1-HXK2, 424GPD-MtSEO-F2-HXK2, 424GPD-MtSEO-F4-HXK2, 424GPD-MtSEO-F1-PGI, 424GPD-MtSEO-F2-PGI, 424GPD-MtSEO-F4-PGI) were each transformed into yeast that already contained a plasmid (425GPD-MtSEO-F1 or 425GPD-MtSEO-F4) to generate artificial forisomes of MtSEO-F1 or MtSEO-F4 (see a) III.) The resulting double mutants (e.g., 425GPD-MtSEO-F1/424GPD-MtSEO-F2-G6PDH) are therefore corrected for their leucine as well as tryptophan auxotrophy.

V. Expression yeasts producing enzyme-coupled forisomes (see a) I.-IV.) were grown in a volume of 50 ml until the OD_{600 nm} was between 5-7 and harvested by centrifugation (1000×g, 10 min). The yeast pellet was washed with 50 ml of V-medium (10 mM Tris, 10 mM EDTA, 100 mM KCl, pH 7.4), centrifuged again (1000×g, 10 min) and frozen at −20° C. The frozen cell pellet was resuspended in 1 ml V-medium, and approximately 500 mg glass beads (425-600 μm) were added. The cells were disrupted in 1.5 ml tubes at 30 Hz in the Mixer Mill MM400 (Retsch, Germany). The artificial forisome with the insoluble cell components were subsequently pelleted by centrifugation and resuspended in 0.5 ml V-medium. The solution was loaded on a sucrose or Nycodenz density gradient in which the sucrose or Nycodenz concentration increased from 40% to 70%. The gradient was centrifuged in a Beckman ultracentrifuge at 163,000×g at 4° C. for 3 h.

The forisome-containing phase was subsequently removed from the gradient with a pipette, diluted 1:2 with V-medium and divided into 2 equal aliquots. The aliquots were centrifuged for 10 minutes at 100×g and the supernatant removed. The forisomes of the first aliquot were then taken up in 50 μl V-medium and used to determine the molecular mass and concentration of the enzyme-coupled artificial forisomes by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The second aliquot was taken up in 50 μl enzyme buffer (for G6PDH-coupled forisomes: 250 mM glycylglycine buffer, pH 7.4; HXK2-coupled forisomes: 0.05 M Tris-HCl buffer with 13.3 mM MgCl₂, pH 8; PGI-coupled forisomes: 250 mM glycylglycine buffer, pH 7.4). This aliquot was used to determine the activity of the forisomen-coupled enzymes using specific enzyme assays.

VI. The molecular mass and concentration of enzyme-coupled, artificial forisomes (see a) IV) were determined by SDS-PAGE analysis. The different forisome proteins comprising the enzyme-linked, artificial forisomes (e.g., MtSEO-F1 and MtSEO-F2 enzyme fusion protein) are thereby separated. The presence of the individual proteins was determined by comparing the mass predicted by bioinformatics (e.g., MtSEO-F2-G6PDH=124.7 kilodaltons) with the actual mass of the protein in the gel (MtSEO-F2-G6PDH=approx. 130 kDa). The protein concentration was determined using a standard series of defined protein amounts that was loaded simultaneously and/or by using the protein marker Precision Plus Protein Standards unstained (Bio-Rad). We were able to obtain a total amount of protein (single MtSEO-F protein+MtSEO-F-enzyme fusion) between 56-124 μg of artificial, enzyme-linked forisomes, depending on the selected forisome protein and enzyme fusion, from a 50 ml yeast expression culture. The proportion of MtSEO-F-enzyme fusion relative to the total protein content is between 10%-50% depending on the fusion partner. We obtained the largest quantities, both of total protein (124 μg/50 ml culture) and enzyme fusion protein (37 μg/50 ml culture) when PGI-coupled enzyme forisomes were generated (MtSEO-F1/MtSEO-F2-PGI).

The activity of the forisome-immobilized enzymes was determined by specific spectrophotometric enzyme assays. For glucose-6-phosphate dehydrogenase, the protocol recommended by Sigma-Aldrich (Germany) was used. The assay is based on the G6PDH-catalyzed conversion of glucose-6-phosphate into 6-phosphogluconolactone. In this reaction, nicotinamide adenine dinucleotide phosphate (NADP⁺) is reduced to NADPH:

The absorbance of NADPH in the wavelength range of 340 nm can be measured photometrically and used to calculate enzyme activity. For this assay, the purified enzyme forisomes from the second aliquot (see a) V.) were used. Using the determined concentration of the enzyme-linked forisomes (see a)VI.) the measured enzyme activities per gram of artificial forisome was calculated. Depending on the construct (see a) III.) activities between 2000-2700 Units per gram of artificial forisome were obtained for forisome-immobilized glucose-6-phosphate dehydrogenase. In comparison, glucose-6-phosphate dehydrogenase immobilized to agarose beads that is commercially available from Sigma-Aldrich (Germany) has only between 1000 to 1750 Units per gram of agarose. Thus, the forisome-immobilized glucose-6-phosphate dehydrogenase of the present invention exhibits a markedly higher specific enzyme activity (enzyme activity based on the amount of carrier material). FIG. 2 shows an enzyme activity assay of glucose-6-phosphate dehydrogenase that is coupled to the forisome bodies SEO-F1 and SEO-F2 of the invention.

The activity of forisome-immobilized hexokinase 2 and phosphoglucoisomerase was determined using a similar assay principle. In this case, only two successive enzyme reactions were used to measure the enzyme activity based on the increase of NADPH absorbance at 340 nm. For hexokinase 2, the protocol recommended by Worthington (Lakewood, N.J., USA) was used, which is based on the following reaction:

Glucose-6-phosphate dehydrogenase required for the second reaction was added to the assay in the form of commercially available soluble enzyme with a defined activity. Depending on the construct (see a) III.) activities between 6000-8000 Units per gram of artificial forisome were obtained for forisome-immobilized hexokinase 2. In contrast, agarose-immobilized hexokinase available from Sigma-Aldrich has an activity of only 50-75 U.

For phosphoglucoisomerase, the protocol recommended by Sigma-Aldrich (Germany) was used which is based on the following reaction:

Depending on the construct (see a) III.), activities between 6000-8000 Units per gram of artificial forisome were obtained for forisome-immobilized phosphoglucoisomerase. In contrast, agarose-immobilized phosphoglucoisomerase available from Sigma-Aldrich has an activity of only 300-600 U.

Example 2—Purification of Proteins

2.1 Purification of Recombinant Proteins Using Unmutated Forisome Genes or in Absence of Unmutated Forisome Genes

I. The coding sequence of a fragment of the malaria surface antigen MSP (MSP1₁₉) was amplified from a sequence within a vector using the following oligonucleotides (restriction sites are underlined).

MSP119 Ncol fw: 5′-AGACCATGGACCTGCGTATTTCTCAG-3′
MSP119 Ncol FaXa rev: 5′-AGACCATGGTACGACCTTCGATCC
TGCATATAGAAATGCC-3′
MSP119 Xhol FaXa fw: 5′-AGACTCGAGAATCGAAGGTCGTGAC
CTGCGTATTTCTCAG-3′
MSP119 Xbal rev: 5′-AGATCTAGATCACCTGCATATAGAAAT
G-3′

The primers MSP1₁₉ NcoI FaXa rev and MSP1₁₉ XhoI FaXa fw contain the coding sequence of the recognition site for the protease Factor Xa (shown in italics) in addition to the gene-specific sequences. The first amplicon was treated with the restriction enzyme NcoI and cloned into the NcoI site of the vectors pENTR4-MtSEO-F1 with stop codon, pENTR4-MtSEO-F2 with stop codon and pENTR4-MtSEO-F4 with stop codon (see a)I.) to generate the vectors pENTR4-MSP1₁₉-MtSEO-F1, pENTR4-MSP1₁₉-MtSEO-F2 and pENTR4-MSP1₁₉-MtSEO-F4. The second amplicon was treated with the restriction enzymes XhoI and XbaI, and cloned into the XhoI/XbaI-restriction sites of the vectors pENTR4-MtSEO-F1 without stop codon, pENTR4-MtSEO-F2 without stop codon and pENTR4-MtSEO-F4 without stop codon (see a)I.) to generate the vectors pENTR4-MtSEO-F1-MSP1₁₉, pENTR4-MtSEO-F2-MSP1₁₉ and pENTR4-MtSEO-F4-MSP1₁₉. For preparation of the expression vectors 424GPD-MSP1₁₉-MtSEO-F1, 424GPD-MSP1₁₉-MtSEO-F2, 424GPD-MSP1₁₉-MtSEO-F4, 424GPD-MtSEO-F1-MSP1₁₉, 424GPD-MtSEO-F2-MSP1₁₉ and 424GPD-MtSEO-F4-MSP1₁₉ the generated vectors were recombined with the yeast vector 424GPD-ccdB (Addgene, USA).

II. The vectors 424GPD-MSP1₁₉-MtSEO-F4 and 424GPD-MtSEO-F4-MSP₁₉ were transformed into the yeast strain InvSc1 (Invitrogen, Germany) using the correction of tryptophan auxotrophy of the yeast strain for selection. The fusion proteins comprised of MSP1₁₉ and MtSEO-F4 form forisomes without additional expression of an additional MtSEO-F protein.

The vectors 424GPD-MSP1₁₉-MtSEO-F1, 424GPD-MSP1₁₉-MtSEO-F2, 424GPD-MtSEO-F1-MSP1₁₉ and 424GPD-MtSEO-F2-MSP1₁₉ were transformed into yeast that already contained a plasmid (425GPD-MtSEO-F1) to generate artificial forisomes of MtSEO-F1 (see a) III.). The resulting yeast (e.g., 425GPD-MtSEO-F1/424GPD-MSP1₁₉-MtSEO-F1) are corrected for their leucine and tryptophane auxotrophy and provide artificial forisomes fused to the MSP1₁₉ protein.

III. The artificial forisomes fused to MSP1₁₉ were purified as described in 1.V and detected and quantified by SDS-PAGE and Western blotting. All constructs were suitable for purification. However, the inventors obtained the highest purification yield of 0.42 mg MSP1₁₉ protein per liter of cell culture with the 424GPD-MPS1₁₉-Mt.SEO-F4 construct. Future optimization by modifying culture and purification conditions will lead to higher yields of protein available for purification. Furthermore, the MSP1₁₉ protein can be cleaved from the artificial protein by incubation with Factor Xa protease. In addition, the inventors have observed that certain reducing and calcium-containing buffer conditions (4 mM CaCl₂), 200 μM NaHSO₃, 10 mM TRIS, 100 mM KCl, pH 7.2) can lead to disassembly of artificial forisomes (especially when the cysteines in position 615 and 620 of the MtSEO-F1 protein are mutated). This conversion from the insoluble form to the soluble form may also be used for protein isolation and purification. FIG. 3 shows the purification of MSP1₁₉ using forisome bodies of SEO-F1 or SEO-F4. The immunological detection of MPS1₁₉ is shown.

2.1b Purification of Recombinant Proteins Using Forisome Genes Containing Mutated Cysteines

The cysteines located at positions 3 and 8 in the sequence motif (FIG. 1) of the MtSEO-F1gene were mutated to serines using the QuikChange II Site-Directed Mutagenesis Kit from Agilent Technologies (CA, USA) according to manufacturer's instructions. The vector pENTR4-MtSEO-F1 with and without stop codons (Example 1) served as a substrate. The cysteines at position 3 and position 8 correspond to amino acids 615 and 620 of the MtSEO-F1 protein. The resulting mutated MtSEO-F1 gene is therefore hereinafter named MtSEO-F1 (C615S/C620S).

The coding sequence of a fragment of the malaria surface antigen MSP (MSP1₁₉) was cloned into the vector pENTR4™ (Invitrogen, Germany) upstream and downstream of MtSEO-F1 (C615S/C620S) as described in Example 2.1a.

By recombination of the vector pENTR4-MtSEO-F1 (C615S/C620S) with the yeast vectors 425GPD-ccdB (Addgene, USA) and recombination of the vectors pENTR4-MSP1₁₉-MtSEO-F1 (C615S/C620S) and pENTR4-MtSEO-F1 (C615S/C620S)-MSP1₁₉ with the yeast vectors 424GPD-ccdB (Addgene, USA), the expression vectors 425GPD-MtSEO-F1 (C615S/C620S), 424GPD-MSP1₁₉-MtSEO-F1 (C615S/C620S), 424GPD-MtSEO-F1 (C615S/C620S)-MSP1₁₉ [were generated].

The following combinations of yeast vectors were transformed into the yeast strain InvSc1 (Invitrogen, Germany)

425GPD-MtSEO-F1(C615S/C620S)+424GPD-MSP1₁₉-MtSEO-F1(C615S/C620S)

and

425GPD-MtSEO-F1(C615S/C620S)+424GPD-MtSEO-F1(C615S/C620S)-MSP1₁₉

The correction of the leucine and tryptophan auxotrophy of the yeast strain was used for selection. The resulting yeasts produce artificial forisomes comprised of MtSEO-F1 (C615S/C620S) that contain MSP1₁₉ protein.

Almost 100% of the resulting artificial forisomes can be converted into the soluble form with reducing buffer containing calcium ions (4 mM CaCl₂), 200 μM NaHSO₃, 10 mM TRIS, 100 mM KCl, pH 7.2), while only a small proportion of the non-mutated version converts to the soluble form.

The purification process can thereby be abbreviated. After cultivation, the yeast cells containing artificial forisomes with MSP1₁₉ protein can be disrupted, the artificial forisome and yeast components separated from soluble components by centrifugation, and the protein-forisome-fusions products then brought into solution.

2.2 Purification of Antibodies Using Artificial Forisomes

I. The coding sequence of the Small Rubber Particle Protein 3 (SRPP3) was amplified from sequences within a vector with the following oligonucleotides (restriction sites are underlined).

SRPP3 Xhol fw: 5′-AGA CTCGAG A ATGACCGACGCTGCTT
C-3′
SRPP 3 Xhol rev: 5′-AGA CTCGAG TCATGTTTCCTCCACAAT
C-3′

The amplicon was treated with the restriction enzyme XhoI and cloned into the XhoI site of the vector pENTR4-MtSEO-F1 without stop codon (see a)I.) to generate the vector pENTR4-MtSEO-F1-SRPP3. To generate the expression vector 424GPD-MtSEO-F1-SRPP3 the resulting vector was recombined with the yeast vector 424GPD-ccdB (Addgene, USA).

II. The vector 424GPD-MtSEO-F1-SRPP3 was transformed into yeast cells that already contained a plasmid (425GPD-MtSEO-F1) to produce artificial forisomes of MtSEO-F1 (see 1.III.). The resulting yeasts (e.g., 425GPD-MtSEO-F1/424GPD-MtSEO-F1-SRPP3) are corrected for their leucine and tryptophan auxotrophy and present artificial forisomes fused to the SRPP3 protein. The yeasts were grown in a volume of 50 ml to OD₆₀₀, centrifuged and resuspended in 1 ml V-medium (10 mM Tris, 10 mM EDTA, 100 mM KCl, pH 7.4), and disrupted by means of a ball mill. The artificial forisomes carrying the antigen were then free in solution and could be used in the following for purification of polyclonal or monoclonal antibodies.

III. The artificial forisomes containing antigen were incubated for 30 minutes with 500 μl of a polyclonal anti-SRPP3 serum that was produced in rabbit. The specific antibodies thereby bound to the artificial forisomes. The forisomes were pelleted by centrifugation (4000×g, 4 min), and washed three times with 1 ml PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 2 mM KH₂PO₄, pH 7.4). Then the antibodies were eluted with 450 μl 0.1 M glycine-HCl solution (pH 2.7) for 5 min. Subsequently, the antibody solution was neutralized with 50 μl 1 M Tris-HCl solution (pH 8.5). Subsequent blots demonstrated the high specificity of the purified antibody was detectable (without serum contamination). The antibodies purified by means of the forisome technology were used for various purposes (Western Blot, immunoprecipitation, ELISA, antibody therapy, etc.). The principle of this purification is shown in FIG. 3; FIG. 4 shows the use of the interaction between the B-domain and the IgG antibody for immobilization of artificial forisomes. An artificial forisome consisting of SEO-F1 subunits coupled to the B-domain binds fluorescent IgG antibodies.

Example 3 Immobilization of Artificial Forisomes to Technical Surfaces (Surface Coupling)

I. The coding sequence of glutathione-S-transferase (GST) was amplified from sequences within the pGex-3X vector (GE Healthcare, USA) using the following oligonucleotides

(restriction sites are underlined).

GST Ncol Xhol fw: 5′-AGA CCA TGG GAC TCG AGA ATG
TCC CCT ATA CTA GGT TA-3′
GST Sall rev: 5′-AGA GTC GAC TTA ACG ACC TTC GAT
CAG ATC-3′

The fragment was treated with the restriction enzymes NcoI/SalI and cloned into the NcoI/XhoI-digested pENTR4™ cloning vector, resulting in the vector pENTR4-GST. Subsequently, the amplicon containing the MtSEO-F1 gene with stop (see SEQ ID NO:1 in Sequence Listing) was cloned into the NcoI/XhoI-sites of the resulting vector to generate the vector pENTR4-GST-MtSEO-F1. To generate the expression vector 424GPD-GST-MtSEO-F1, the vector pENTR4-GST-MtSEO-F1 was recombined with the yeast vector 424GPD-ccdB (Addgene, USA). The expression vector was transformed into yeasts cells that already contained a plasmid (425GPD-MtSEO-F1) to produce artificial forisomes of MtSEO-F1 (see a) III.). The resulting yeast (425GPD-MtSEO-F1/424GPD-GST-MtSEO-F1) are corrected for their leucine and tryptophan auxotrophy and present artificial forisomes with a GST-tag. They were purified as described in a)V. and the presence of the respective proteins (MtSEO-F1 and GST-MtSEO-F1) was detectable by SDS-PAGE. It was further shown that the resulting artificial GST-coupled forisomes bound to a glutathione-coupled matrix (Glutathione Sepharose 4B, Amersham Bioscience, USA).

II. The coding sequence of the B domain of Staphylococcus aureus protein A was amplified from sequences within the vector 424GPD-ccdB-TAP (Addgene, USA) using the following oligonucleotides (restriction sites are underlined).

B domain Ncol fw: 5′-AGACCATGGCGGATAACAAATTCAAC
A-3′
B domain Ncol rev: 5′-AGACCATGGCTTTTGGTGCTTGAGCA
TC-3′
B domain Xhol fw: 5′-AGACTCGAGAGCGGATAACAAATTCAA
C-3′
B domain Xhol rev: 5′-AGACTCGAGTCATTTTGGTGCTTGAGC
ATC-3′

The first amplicon was treated with the restriction enzyme NcoI and cloned into the NcoI restriction site of pENTR4-MtSEO-F1 with stop codon and pENTR4-MtSEO-F4 with stop codon (see a) I) to generate the vectors pENTR4-B-domain-MtSEO-F1 and pENTR4-B-domain-MtSEO-F4. The second amplicon was treated with the restriction enzyme XhoI and cloned into the XhoI restriction site of the vector pENTR4-MtSEO-F1 without stop codon and pENTR4-MtSEO-F4 without stop codon (see a)I.) to generate the vectors pENTR4-MtSEO-F1-B-domain and pENTR4-MtSEO-F4-B-domain. To produce the expression vectors 424GPD-B-domain-MtSEO-F1, 424GPD-B-domain-MtSEO-F4, 424GPD-MtSEO-F1-B-domain, 424GPD-MtSEO-F4-B domain, the vectors produced were recombined with the yeast vector 424GPD-ccdB (Addgene, USA).

The vectors 424GPD-B-domain-MtSEO-F4 and 424GPD-MtSEO-F4-B-domain were transformed into the yeast strain InvSc1 (Invitrogen, Germany). For selection, the correction of tryptophan auxotrophy of the yeast strain was used. The fusion proteins of the B domain and MtSEO-F4 assembled to forisome-like structures without additional expression of another MtSEO-F protein.

The vectors 424GPD-B-domain-MtSEO-F1 and 424GPD-MtSEO-F1-B-domain were transformed into yeast that already contained a plasmid (425GPD-MtSEO-F1) to produce artificial forisomes of MtSEO-F1 (see 1.III.). The resulting yeasts (e.g., 425GPD-MtSEO-F1/424GPD-B-domain-MtSEO-F1) are corrected for their leucine and tryptoph anauxotrophy and present artificial forisomes fused to a B-domain. All of the artificial forisomes generated that contained B-domains bound to IgG-coupled Sepharose (GE Healthcare, USA).

2.3 Preparation and Purification of Artificial SEO-F Forisomes Containing Two Different SEO-F Proteins

2.3.1: Fusion of Amino Acids 1-96 of MtSEO-F4 and Amino Acids 73-648 of MtSEO-F1.

The N-terminal MtSEO-F4-fragment and the C-terminal MtSEO-F1 fragment were amplified with the oligonucleotides

MtSEO-F4 MSLSN Ncol fw 5′-AGACCATGGGATCCCTTTCCAAC
TTAGGAAGTG-3′
MtSEO-F4 LISCQ Ncol rev 5′-AGACCATGGCCTGACAAGAAAT
CAGCTT-3′
MtSEO-F1 MITTR Ncol fw 5′-AGACCATGGGAATGATAACCACC
CCTC-3′
MtSEO-F1 QNGKI Xhol rev 5′-AGACTCGAGGTCATATCTTGCC
ATTCTGTGGAG-3′

and cloned into the NcoI/XhoI-digestion pENTR4 vector. The resulting vector pENTR4-MtSEO-F4(1-288 bp)/MtSEO-F1 (219-1944 bp) was subsequently recombined with the plant expression vector pBatTL and the yeast expression vector 425GPD-ccdB. The resulting pBatTL-MtSEO-F4(1-288 bp)/MtSEO-F1 (219-1944 bp) was transformed into Agrobacterium, which was used to infiltrate N. benthamiana plants (see Müller et al., 2010). The resulting vector 425GPD-MtSEO-F4(1-288 bp)/MtSEO-F1(219-1944 bp) was transformed into the yeast strain InvSc1. In both systems, the development of artificial forisomes was observed microscopically. The purification was carried out as described above in Example 1 V.

2.3.2: Fusion of Amino Acids 1-583 of MtSEO-F1 with Amino Acids 620-670 of MtSEO-F2.

The N-terminal MtSEO-F1 fragment and the C-terminal MtSEO-F2 fragment were amplified using the oligonucleotides

MtSEO-F1 MSLNS Ncol fw 5′-AGACCATGGGATCATTGTCCAAT
GGAACTA-3′
MtSEO-F1 FKEYY Xhol rev 5′-AGACTCGAGTGATAGTATTCTT
TGAATGCAAT-3′
MtSEO-F2 DTKLS Xhol fw 5′-AGACTCGAGTGATACTAAGCTTT
CAGAGAT-3′
MtSEO-F2 DSCCI Xhol 5′-rev AAACTCGAGTCAAATGCAGCAA
CTATCTGGATCATC-3′

and cloned into the NcoI/XhoI-digested vector pENTR4. The resulting vector pENTR4-MtSEO-F1 (1-1749 bp)/MtSEO-F2(1860-2010 bp) was recombined with the plant expression vector pBatTL and the yeast expression vector 425GPD-ccdB. The generated pBatTL-MtSEO-F1 (1-1749 bp)/MtSEO-F2 (1860-2010 bp) was transformed into Agrobacterium, which was used to infiltrate N. benthamiana plants (see Müller et al., 2010). The resulting vector 425GPD-MtSEO-F1 (1-1749 bp)/MtSEO-F2(1860-2010 bp) was transformed into the yeast strain InvSc1. In both systems, the formation of artificial forisome could be observed microscopically. The purification was carried out as described in Example 1 V above.

Claims

1. An artificial forisome body comprising a fusion protein of (A) a SEO-F (Sieve Element Occlusion by Forisome) protein having an amino acid sequence of SEQ ID NO: 4, 5, 6, 7 or 8, or a fragment of the amino acid sequence of SEQ ID NO: 4, 5, 6, 7 or 8, wherein said fragment results from deleting up to 45 amino acids from the C-terminus and/or up to 13 amino acids from the N-terminus of the amino acid sequence of SEQ ID NO: 4, 5, 6, 7 or 8, and (B) at least one additional protein, wherein the at least one additional protein is not a fluorescent protein,

(a) wherein the additional protein has a mass of at most 30 kDa, and wherein the artificial forisome body does not contain an unfused SEO-F protein or an unfused SEO-F protein having C-terminal deletions of up to 45 amino acids and/or N-terminal deletions of up to 13 amino acids,

or

(b) wherein the forisome body further comprises an unfused SEO-F protein, wherein said unfused SEO-F protein is

(i) a protein having the amino acid sequence of SEQ ID NO: 4, 5, 6, 7 or 8,

or

(ii) a protein comprising a fragment of the amino acid sequence of SEQ ID NO: 4, 5, 6, 7 or 8, wherein said fragment results from deleting up to 45 amino acids from the C-terminus and/or up to 13 amino acids from the N-terminus of the amino acid sequence of SEQ ID NO: 4, 5, 6, 7 or 8,

and wherein the unfused SEO-F protein has ability to form homomeric forisome bodies in the absence of additional SEO-F proteins.

2. The artificial forisome body according to claim 1, with the exception of forisome bodies that are comprised entirely or partly of a fusion protein that contains an artificial fluorescent variant or a portion of a fluorescent portion of a green fluorescent protein (GFP) or Venus protein.

3. The artificial forisome body according to claim 1, wherein the artificial forisome body comprises a fusion protein of (A) a SEO-F (Sieve Element Occlusion by Forisome) protein having the amino acid sequence of SEQ ID NO: 4, or a fragment of the amino acid sequence of SEQ ID NO: 4, wherein said fragment results from deleting up to 45 amino acids from the C-terminus and/or up to 13 amino acids from the N-terminus of the amino acid sequence of SEQ ID NO: 4, and (B) the at least one additional protein.

4. The artificial forisome body according to claim 1, wherein the additional protein is selected from the group consisting of proteins that contribute to metabolism, proteins capable of triggering an immune response and/or proteins having a therapeutic benefit, and proteins that are useful for biotechnological applications.

5. The artificial forisome body according to claim 1, wherein the additional protein is selected from the group consisting of enzymes, antibodies, and antigens, wherein the additional protein can be immobilized on a substrate due to their affinity reaction with a substrate-bound biological or biochemically produced material.

6. The artificial forisome body according to claim 1, wherein the fusion protein contains an enzyme fused to the N-terminal end of the SEO-F protein or a portion thereof, or wherein the fusion protein comprises a protein that has a therapeutic benefit or is useful for biotechnological applications, and which is fused to the C-terminal end of the SEO-F protein or portion thereof.

7. The artificial forisome body according to claim 1, comprising at least two fusion proteins, each comprising an enzyme, such that a product of a reaction of one substrate with a first of said enzymes can serve as a substrate for a second of said enzymes.

8. A plant cell or yeast cell comprising:

a first vector encoding a fusion protein of at least one SEO-F protein or a portion thereof comprising at least 50 amino acids and at least one additional protein, with the exception of a green fluorescent protein (GFP) and Venus protein and artificial fluorescent variants or fluorescent portions of the GFP protein or the Venus protein, and optionally

a second vector encoding a SEO-F protein or a form of said protein having C-terminal deletions of up to 45 amino acids and/or N-terminal deletions of up to 13 amino acids, wherein the SEO-F protein is capable of forming forisome bodies in the absence of further homomeric SEO-F proteins, with the proviso that optionally any number of the four cysteines that are located in the native SEO-F proteins in the C-terminal region between aa 600 and aa 670, may be replaced by amino acids that are not capable for forming an SS-bond.

9. The plant cell or yeast cell according to claim 8, wherein the additional protein has a mass of at most 30 kDa.

10. The plant cell or yeast cell according to claim 8, wherein the additional protein is a portion of a second SEO-F protein, with the proviso that one of the two SEO-F proteins in unfused form is capable of forming homomeric forisome bodies and the fusion protein is comprised of an N-terminal SEO-F protein portion and a C-terminal SEO-F protein portion, wherein the portions represent an SEO-F protein that is complete or C-terminally deleted by up to approximately 50 amino acids and/or N-terminally by up to 13 amino acids.

11. The plant cell or yeast cell according to claim 8, wherein the additional protein is selected from the group consisting of proteins that contribute to metabolism, proteins capable of triggering an immune response and/or proteins having a therapeutic benefit, and proteins that are useful for biotechnological applications.

12. The plant cell or yeast cell according to claim 8, wherein the additional protein is selected from the group consisting of enzymes, antibodies, and antigens, wherein the additional protein can be immobilized on a substrate due to their affinity reaction with a substrate-bound biological or biochemically produced material.

13. The plant cell or yeast cell according to claim 8, wherein the fusion protein comprises an enzyme which is fused to the N-terminal end of the SEO-F protein or a portion thereof, or wherein the fusion protein comprises a protein that has a therapeutic benefit or is useful for biotechnological applications, and is fused to the C-terminal end of the SEO-F protein or portion thereof.

14. The plant cell or yeast cell according to claim 8, wherein the first vector encodes a fusion protein comprising an amino acid sequence of a first enzyme, characterized in that the cell contains at least one further vector encoding a fusion protein comprising the amino acid sequence of a second enzyme, wherein a reaction product of a substrate with the first enzyme is suitable as a substrate for the second enzyme.

15. A vector capable of being amplified in the yeast cell according to claim 8, comprising a region encoding a fusion protein comprised of at least one SEO-F protein or a portion thereof comprising at least 50 amino acids and at least one further protein or peptide, with the exception of the GFP and the Venus protein.

16. The vector according to claim 15, wherein the additional protein is selected from the group consisting of proteins that contribute to metabolism, proteins capable of triggering an immune response and/or proteins having a therapeutic benefit, and proteins that are useful for biotechnological applications.

17. The vector according to claim 15, wherein the additional protein or peptide is selected from the group consisting of enzymes, antibodies, and antigens, wherein the additional protein can be immobilized on a substrate due to their affinity reaction with a substrate-bound biological or biochemically produced material.

18. The vector according to claim 15, wherein the fusion protein comprises an enzyme fused to the N-terminal end of the SEO-F protein or a portion thereof, or wherein the fusion protein comprises a protein that has a therapeutic benefit or can be used for biotechnological applications, and is fused to the C-terminal end of the SEO-F protein or the portion thereof.

19. A method for producing an artificial forisome body comprising a fusion protein of at least one SEO-F (Sieve Element Occlusion by Forisome) protein or an at least 50-amino acid portion thereof, and at least one additional protein, with the exception of a green fluorescent protein (GFP) and Venus protein, wherein

(a) the additional protein or peptide has a mass of at most 30 kDa, and the artificial forisome body does not contain an unfused SEO-F protein or a form of said protein having C-terminal deletions of up to 45 amino acids and/or N-terminal deletions of up to 13 amino acids, or

(b) the forisome body further comprises an unfused SEO-F protein or a form of said protein having C-terminal deletions of up to 45 amino acids and/or N-terminal deletions of up to 13 amino acids, wherein the unfused SEO-F protein is selected from proteins having the capability of forming homomeric forisome bodies in the absence of additional SEO-F proteins, or

(c) the further protein or peptide is a portion of a second SEO-F protein, with the proviso that one of the two SEO-F proteins in its unfused form is capable of forming homomeric forisome bodies, and the fusion protein is comprised of an N-terminal SEO-F protein portion and a C-terminal SEO-F protein portion, wherein the portions represent an SEO-F protein that is complete or C-terminally deleted by up to 50 amino acids and/or N-terminally deleted by up to 13 amino acids, with the proviso that optionally any number of the four cysteines located in the C-terminal portion between aa 600 and aa 670 of the native SEO-F proteins, may be replaced by amino acids that are not capable of forming an SS-bond.

20. The method according to claim 19, wherein the fusion protein does not contain any artificial fluorescent variant and no fluorescent portion of the GFP protein or the Venus fluorescent protein.

21. The artificial forisome body according to claim 2, with the exception of forisome bodies that are composed exclusively or partly of a fluorescent fusion protein.

22. The method according to claim 20, wherein the fusion protein does not comprise fluorescent protein portions.