PHYTOPHTHORA RESISTANT PLANTS BELONGING TO THE SOLANACEAE FAMILY

The present invention relates to a plant belonging to the Solanaceae family wherein said plant comprises a genetic trait providing Phytophthora resistance and wherein said resistance trait is encoded by a combination of at least two genes having a reduced expression, or transcription, of said genes or a reduced activity of proteins encoded by said genes as compared to said plant belonging to Solanaceae family being susceptible to Phytophthora.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a Continuation of U.S. patent application Ser. No. 16/055,697, filed Aug. 6, 2018, which is a Continuation of U.S. patent application Ser. No. 15/111,285, internationally filed Jan. 14, 2014, which is a U.S. National Phase application under 35 U.S.C. § 371 of International Application No. PCT/EP2014/050572, filed Jan. 14, 2014, each of which are incorporated herein by reference in their entirety.

SUBMISSION OF SEQUENCE LISTING ON ASCII TEXT FILE

The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: 701802011903SEQLIST.TXT, date recorded: Mar. 18, 2019, size: 27 KB).

FIELD OF THE INVENTION

The present invention relates to Phytophthora resistance plants belonging to Solanaceae family wherein said resistance is encoded by a combination of two genes. The present invention further relates to the use of these genes providing Phytophthora resistance plants belonging to Solanaceae family, the genes themselves and proteins encoded by the present genes.

BACKGROUND OF THE INVENTION

The plant pathogen Phytophthora is a genus of plant-damaging Oomycetes (water molds), whose member species are capable of causing large economic losses on crops worldwide, as well as environmental damage in natural ecosystems. The genus was first described by Heinrich Anton de Bary in 1875. Approximately 100 species have been described, although an estimate of 100 to 500 undiscovered Phytophthora species are suspected to exist.

Phytophthora pathogens are mostly pathogens of dicotyledons and generally are host-specific parasites. Many species of Phytophthora are plant pathogens of considerable economic importance. Phytophthora infestans was the infective agent of the potato blight that caused the Great Irish Famine (1845-1849), and still remains the most destructive pathogen of solanaceous crops, including tomato and potato. The soybean root and stem rot agent, Phytophthora sojae, has also caused longstanding problems for the agricultural industry. In general, plant diseases caused by this genus are difficult to control chemically, and thus the growth of resistant cultivars is the main management strategy. Other important Phytophthora diseases are: Phytophthora cactorum—causes rhododendron root rot affecting rhododendrons, azaleas and causes bleeding canker in hardwood trees; Phytophthora capsici—infects Cucurbitaceae fruits, such as cucumbers and squash; Phytophthora cinnamomi—causes cinnamon root rot affecting woody ornamentals including arborvitae, azalea; Phytophthora fragariae—causes red root rot affecting strawberries; Phytophthora kernoviae—pathogen of beech and rhododendron, also occurring on other trees and shrubs including oak, and holm oak; Phytophthora megakarya—one of the cocoa black pod disease species, is invasive and probably responsible for the greatest cocoa crop loss in Africa; Phytophthora palmivora—causes fruit rot in coconuts and betel nuts; Phytophthora ramorum; Phytophthora quercina—causes oak death; and Phytophthora sojae—causes soybean root rot.

Phytophthora is sometimes referred to as a fungal-like organism but it is classified under a different kingdom: Chromalveolata (formerly Stramenopila and previously Chromista). Phytophthora is morphologically very similar to true fungi yet its evolutionary history is quite distinct. In contrast to fungi, chromalveolatas are more closely related to plants than animals Whereas fungal cell walls are made primarily of chitin, chromalveolata cell walls are constructed mostly of cellulose. Ploidy levels are different between these two groups; Phytophthora have diploid (paired) chromosomes in the vegetative (growing, non-reproductive) stage of life, fungi are almost always haploid in this state. Biochemical pathways also differ, notably the highly conserved.

Phytophthoras may reproduce sexually or asexually. In many species, sexual structures have never been observed, or have only been observed in laboratory matings. In homothallic species, sexual structures occur in single culture. Heterothallic species have mating strains, designated as A1 and A2. When mated, antheridia introduce gametes into oogonia, either by the oogonium passing through the antheridium (amphigyny) or by the antheridium attaching to the proximal (lower) half of the oogonium (paragyny), and the union producing oospores. Like animals, but not like most true fungi, meiosis is gametic, and somatic nuclei are diploid. Asexual (mitotic) spore types are chlamydospores, and sporangia which produce zoospores. Chlamydospores are usually spherical and pigmented, and may have a thickened cell wall to aid in its role as a survival structure. Sporangia may be retained by the subtending hyphae (non-caducous) or be shed readily by wind or water tension (caducous) acting as dispersal structures. Also, sporangia may release zoospores, which have two unlike flagella which they use to swim towards a host plant.

The Solanaceae, or nightshades, are an economically important family of flowering plants. The family ranges from herbs to trees, and includes a number of important agricultural crops, medicinal plants, spices, weeds, and ornamentals. Many members of the family contain potent alkaloids, and some are highly toxic.

The family belongs to the order Solanales, in the asterid group dicotyledons (Magnoliopsida). The Solanaceae family consists of approximately 98 genera and some 2,700 species, with a great diversity of habitats, morphology and ecology.

The family has a worldwide distribution being present on all continents except Antarctica. The greatest diversity in species is found in South America and Central America. Solanaceae includes a number of commonly collected or cultivated species. Perhaps the most economically important genus of the family is Solanum, which contains the potato (Solanum tuberosum, in fact, another common name of the family is the “potato family”), the tomato (Solanum lycopersicum), and the aubergine or eggplant (Solanum melongena). Another important genus Capsicum produce both chilli peppers and bell peppers.

The genus Physalis produces the so-called groundcherries, as well as the tomatillo (Physalis philadelphica), the Cape gooseberry and the Chinese lantern. The genus Lycium contains the boxthorns and the wolfberry Lycium barbarum. Nicotiana contains, among other species, the plant that produces tobacco. Some other important members of Solanaceae include a number of ornamental plants such as Petunia, Browallia and Lycianthes, the source of psychoactive alkaloids, Datura, Mandragora (mandrake), and Atropa belladonna (deadly nightshade). Certain species are universally known for their medicinal uses, their psychotropic effects or for being poisonous.

With the exception of tobacco (Nicotianoideae) and petunia (Petunioideae), most of the economically important genera are contained in the subfamily Solanoideae. Finally, but not less importantly, the Solanaceae include many model organisms which are important in the investigation of fundamental biological questions at a cellular, molecular and genetic level, such as tobacco and the petunia.

Considering the economic importance of many plant members of the Solanaceae family and the destructive effect of the plant pathogen Phytophthora on many members of this family, it is an object, amongst other objects, of the present invention to provide Phytophthora resistant plants.

DETAILED DESCRIPTION OF THE INVENTION

The above object, amongst other objects, is met by the present invention by providing plants, uses, proteins and genes as outlined in the appended claims.

Specifically, the above object, amongst other objects, is met, according to a first aspect, by plants belonging to the Solanaceae family wherein the present plants comprise a genetic trait providing Phytophthora resistance and wherein the present resistance trait is encoded by a combination of at least two genes having a reduced expression, or reduced transcription, of the present genes or a reduced activity of proteins encoded by the present genes as compared to the plant belonging to Solanaceae family being susceptible to Phytophthora.

According to a preferred embodiment of this first aspect of the present invention, the present plants belonging to the Solanaceae family are selected from the group consisting of potato, petunia, tomato, aubergine, eggplant, tobacco and pepper, more preferably potato, petunia and tomato.

According to an especially preferred embodiment of this first aspect, the present invention relates to potato, the present Phytophthora resistance is resistance to Phytophthora infestans and the present combination of at least two genes are genes encoding proteins according to SEQ ID NO. 1 and SEQ ID NO. 2 or proteins having at least 80%, 85%, or 90% sequence identity with SEQ ID NO. 1 and SEQ ID NO. 2, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

According to another especially preferred embodiment of this first aspect, the present invention relates to petunia, the present Phytophthora resistance is resistance to Phytophthora nicotianae and the present combination of at least two genes are genes encoding proteins according to SEQ ID NO. 3 and SEQ ID NO. 4 or proteins having at least 80%, 85%, or 90% sequence identity with SEQ ID NO. 3 and SEQ ID NO. 4, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

According to another especially preferred embodiment of this first aspect, the present invention relates to tomato, the present Phytophthora resistance is resistance to Phytophthora infestans and the present combination of at least two genes are genes encoding proteins according to SEQ ID NO. 5 and SEQ ID NO. 6 or proteins having at least 80%, 85%, or 90% sequence identity with SEQ ID NO. 5 and SEQ ID NO. 6, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

According to yet another especially preferred embodiment of this first aspect, the present invention relates to a plant belonging to the Solanaceae family wherein the present plant comprises a genetic trait providing Phytophthora resistance, wherein the present resistance trait is obtainable by down regulating the activity of combination of two genes or reducing the activity of proteins encoded by the present genes in a Phytophthora susceptible plant, wherein the present two genes encode the combinations of SEQ ID NO. 1 and SEQ ID NO. 2 or SEQ ID NO. 3 and SEQ ID NO. 4 or SEQ ID NO. 5 and SEQ ID NO. 6 or proteins having at least 80%, 85%, or 90% sequence identity therewith such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

According to a further preferred embodiment, the present plant belonging to the Solanaceae family is selected from the group consisting of potato, petunia and tomato.

Given the advantageous properties of the present genes for providing Phytophthora resistance plants, the present invention relates, according to a second aspect, to the use of genes encoding the combinations of SEQ ID NO. 1 and SEQ ID NO. 2 or SEQ ID NO. 3 and SEQ ID NO. 4 or SEQ ID NO. 5 and SEQ ID NO. 6 or proteins having at least 80%, 85%, or 90% sequence identity therewith, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity, for providing Phytophthora resistance in plants belonging to the Solanaceae family.

According to a further preferred embodiment, the present use for providing Phytophthora resistance in plants belonging to the Solanaceae family comprises reduced expression, or reduced transcription, of the present genes or a reduced activity of proteins encoded by the present genes as compared to the plant belonging to Solanaceae family being susceptible to Phytophthora.

According to a further preferred embodiment of this second aspect, the present plants belonging to the Solanaceae family are selected from the group consisting of potato, petunia and tomato. More preferably, the present Phytophthora resistance is Phytophthora infestans in potato and/or tomato, or Phytophthora nicohanae in petunia.

Given the Phytophthora resistance providing properties of the present proteins and genes, the present invention relates according a third aspect to proteins and genes suitable for providing Phytophthora resistance to plants. Specifically, the present invention relates according to this third aspect to proteins selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and protein having at least 80%, 85%, or 90% sequence identity therewith, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.

According to a preferred embodiment of this third aspect, the present invention relates to coding sequences, or genes encoding cDNA sequence, selected from the group consisting of SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12 and sequences having at least 80%, 85%, or 90% sequence identity therewith such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity. Preferably the present coding sequene, or genes encoding cDNA sequence, is an isolated sequence.

BRIEF DESCRIPTION OF THE DRAWINGS

The invention is further illustrated in the examples below, with reference to the figures, wherein:

FIG. 1 shows a detached leaf assay of control potato plants after infection with Phytophthora infestans, wherein all leaves are infected by Phytophthora infestans.

FIGS. 2A and 2B show a detached leaf assay of SEQ ID NO. 7 and SEQ ID NO. 8 silenced potato plants after infection with Phytophthora infestans, wherein each leaf is from an independent plant. FIG. 2A shows leaves from plants silenced with a middle construct, silencing both SEQ ID NO. 7 and SEQ ID NO. 8. FIG. 2B shows leaves from chimeric silenced plants.

FIG. 3 shows the percentage of plants which are infected by Phytophthora infestans, wherein the first bar shows a control group (about 10% partially infected), the second bar shows plants of which only SEQ ID NO. 7 is silenced (about 10% partially infected), the third bar shows plants of which both SEQ ID NO. 7 and SEQ ID NO. 8 are silenced in the middle part of the respective sequences (about 50% clean), the fourth bar shows plants of which both SEQ ID NO. 7 and SEQ ID NO. 8 are silenced at the 5′end (about 40% clean).

FIG. 4 shows the percentages of living petunia plants after inoculation with Phytophthora nicotianae, wherein the first bar shows wild type control plants (0% living), the second bar shows SEQ ID NO. 9 mutants (20% living plants), the third bar shows SEQ ID NO. 10 mutants (20% living plants) and the fourth bar shows SEQ ID NO. 9 and SEQ ID NO. 10 double mutants (45% living plants).

FIG. 5 shows leaves of tomato plants from a Phytophthora infestans disease test.

EXAMPLES Example 1 (Potato)

RNAi constructs targeting potato SEQ ID NO. 7 and SEQ ID NO. 8

3 Different RNAi Constructs were made, Harboring/Targeting:

1. 5′ end of SEQ ID NOS 7: equivalent to coding sequence -159-200 (−159 from start means in 5′UTR).

2. Chimera of 5′ end of SEQ ID NO. 7 and SEQ ID NO. 8: equivalent to coding sequence 4-199+1-204.

3. Middle part of SEQ ID NO. 7 (highly homologous to middle of SEQ ID NO. 8): equivalent to coding sequence 334-743.

The fragments were amplified from genomic DNA and cloned into the pENTR-D-TOPO vector. For the chimeric construct, 2 fragments were coupled using primers with complementary overhangs, and subsequent extension and amplification to create the fused fragment. Fragments were transferred using a Gateway LR reaction to the RNAi vector pK7GWiWG2 (Karimi et al., 2002, Trends Plant Sci 7), creating an inverted repeat with hairpin structure. Because the pK7GWiWG2 vector requires Streptomycin for bacterial selection, and the Agrobacterium strain used for potato transformation (LBA4404) already carries a Streptomycin selection marker, the complete RNAi (hairpin) cassette was transferred to a different plant transformation vector, pGreen0029 (bacterial as well as plant selection marker=Kanamycin) (Hellens et al., 2000, Plant Mol Biol 42). The final constructs allow stable expression of a 35S-promoter driven hairpin RNA that forms a silencing-inducing dsRNA, after the hairpin-loop forming intron gets spliced out. At least six independent Ti transformants were maintained for each construct.

Phytophthora infestans Assay Details

Detached leaves were taken from T1 (first generation transgenics) plants, and placed in a tray with 100% RH with petioles in wet cotton-wool or Oasis. Phytophthora infestans (P.inf) zoospores/sporangia were harvested from P.inf cultures (rye-sucrose-agar plates), and a 10 ul drop of spore suspension containing 10e3 sporangia (10e5/ml) was placed on each side of the midvein. Trays were incubated at 18C. Leaf infection rates were scored on day 11, as 1. Completely infected/overgrown, 2. Partially infected (10-50% area), and 3. Clean (<10% area). As shown in FIGS. 1, 2A, and 2B, the double silenced (SEQ ID NO. 7 and SEQ ID NO. 8) plants of FIG. 2A show that only 50% is infected, the double silenced (chimeric) plants of FIG. 2B show that only 60% is infected, whereas the control group of FIG. 1 shows that all plants were infected.

As shown in FIGS. 3, 40 to 50% of the both SEQ ID NO. 7 and SEQ ID NO. 8 silenced plants are clean, whereas the plants having only SEQ ID NO. 7 silenced only 10% of the plants score partially infected. Accordingly, silencing of both SEQ ID NO. 7 and SEQ ID NO. 8 provides resistance to Phytophthora infestans.

Example 2 (Petunia)

Transposon insertion lines were identified from a collection/library (Vandenbussche et al., 2008, Plant Journal 54). 2 dTph1 transposon insertion alleles were found in SEQ ID NO. 9 and 3 dTph1 transposon insertion alleles in SEQ ID NO. 10. Several crosses were made to generate double mutants.

Phytophthora nicotianae Assay details

Plants were grown in standard potting soil, individually potted, at 23C. P.nicotianae spores were harvested from cultures (lima-bean-agar or V8-agar plates), and 2 ml of spore suspension containing 10e4 (assay Sept) spores was dripped onto the soil with each plant. Plant collapse was monitored regularly.

As shown in FIG. 4, double mutants, i.e. plants having mutations in both SEQ ID NO. 9 and SEQ ID NO. 10 have a percentage of living plants of 45%, whereas the percentage of living plants of single mutants (mutant in SEQ ID NO. 9 or SEQ ID NO. 10) is only 20%.

Example 3 (Tomato)

Tomato plants were transformed with two constructs, either for providing over expression of both SEQ ID NO. 11 and SEQ ID NO. 12, or for providing silencing of both SEQ ID NO. 11 and SEQ ID NO. 12.

Tomato SEQ ID NO. 11 silencing constructs were generated using Gateway cloning of a 300 bp fragment identical to the middle part of the CDS of SEQ ID NO. 11.

Sequence:

(SEQ ID NO. 15) TTGGGTGAACAAGGACAACATATGGCTATCAATTATTATCCTCCTTGTCC ACAACCAGAACTTACTTATGGGCTTCCGGCCCATACTGATCCAAATTCAC TTACAATTCTTCTTCAAGACTTGCAAGTTGCGGGTCTTCAAGTTCTTAAA GATGGCAAATGGTTAGCTGTAAAACCTCAACCTGACGCCTTTGTCATTAA TCTTGGGGATCAATTGCAGGCAGTAAGTAACGGTAAGTACAGAAGTGTAT GGCATCGAGCTATTGTGAATTCAGATCAAGCTAGGATGTCAGTGGCTTCG TTT 

Using Primers:

S. lycopersicum AttB1-F (SEQ ID NO. 13) aaaaagcaggcttcttgggtgaacaaggacaaca S. lycopersicum AttB2-R (SEQ ID NO. 14) agaaagctgggtaaaacgaagccactgacatcc

The generated ENTRY vector was Gateway cloned into the pHellsgatel2 binary vector. Following Agrobacterium transformation according standard procedure for tomato. The silencing constructs were able to silence both SEQ ID NO. 11 and SEQ ID NO. 12, due to similarities in the sequences.

Offspring from transformed tomato plants were subjected to a disease test by inoculation of Phytophthora infestans isolate US11. 7 days after inoculation the plants were visually analysed by scoring leaves on a visual scale from 1 to 9, wherein 1 means susceptible and 9 means resistant. As a control for susceptible the plants TS33, TS19 and OT9 were used. As control for resistant the known resistant wild accession LA1269 is used. Per plant 8 leaves were measured. Table below provides the average score from the 8 leaves per plant.

LA1269 RC 8.7 TS33 VC 1.3 TS19 VC 1.5 OT9 VC 2.0 551-06-01 overexpres 2.8 551-06-02 overexpres 3.3 551-06-03 overexpres 3.0 551-06-07 overexpres 1.5 551-06-08 overexpres 2.3 551-06-09 overexpres 2.3 551-06-12 overexpres 2.3 556-02-01 silencing 6.5 556-02-02 silencing 8.5 556-02-03 silencing 8.3 556-02-06 silencing 7.3 556-02-11 silencing 7.3 556-01-01 silencing 7.8 556-01-02 silencing 8.3 556-01-03 silencing 8.5 556-01-04 silencing 8.5 556-01-05 silencing 8.5 556-01-06 silencing 6.0 556-01-07 silencing 5.5 556-01-08 silencing 8.5 556-01-09 silencing 7.0 556-01-10 silencing 8.5 556-01-11 silencing 8.8 556-01-12 silencing 7.8

In the table is shown that the SEQ ID NO. 11 and SEQ ID NO. 12 overexpressing plants are susceptible for isolate US11. The silenced plant provides significant higher scores than the susceptible control LA1269. For example plant 556-01-08 has an average score of 8.5. A sample of this plant is shown in FIG. 5 in box G10, and is not infected similar to resistant control plant LA1296 as shown in box D8. Accordingly, silencing of both SEQ ID NO. 11 and SEQ ID NO. 12 provides resistance to Phytophthora infestans.

Claims

1-11. (canceled)

12. A Phytophthora nicotianae resistant petunia plant comprising reduced expression or reduced activity of a first protein and reduced expression or reduced activity of a second protein compared to the expression or activity of the first protein and the second protein in a petunia plant that is not resistant to Phytophthora nicotianae.

13. The resistant petunia plant of claim 12, wherein the resistant petunia plant has a first non-natural mutation introduced into its genome that results in reduced expression or reduced transcription of a first nucleotide sequence encoding the first protein and a second non-natural mutation introduced into its genome that results in reduced expression or reduced transcription of a second nucleotide sequence encoding the second protein.

14. The resistant petunia plant of claim 13, wherein the first non-natural mutation results in a truncated, non-functional, or knocked out first protein and the second non-natural mutation results in a truncated, non-functional, or knocked out second protein.

15. The resistant petunia plant of claim 14, wherein the first protein sequence comprises SEQ ID NO. 3 and the second protein sequence comprises SEQ ID NO. 4, and wherein the first nucleotide sequence comprises SEQ ID NO. 10 and the second nucleotide sequence comprises SEQ ID NO. 9.

16. A seed, tissue, or plant part of the petunia plant of claim 14, wherein the seed, tissue, or plant part comprises the reduced expression or reduced activity of the first protein and the reduced expression or reduced activity of the second protein, and further comprises the reduced expression or reduced transcription of the first nucleotide sequence and the reduced expression or reduced transcription of the second nucleotide sequence.

17. The resistant seed, tissue, or plant part of the petunia plant of claim 16, wherein the first protein sequence comprises SEQ ID NO. 3 and the second protein sequence comprises SEQ ID NO. 4, and wherein the first nucleotide sequence comprises SEQ ID NO. 10 and the second nucleotide sequence comprises SEQ ID NO. 9.

18. A method for obtaining a Phytophthora nicotianae resistant petunia plant comprising:

introducing a non-natural mutation into a first nucleotide sequence and introducing a non-natural mutation into a second nucleotide sequence resulting in reducing expression or activity of a first protein and reducing expression or activity of a second protein as compared to a petunia plant that is not resistant to Phytophthora nicotianae.

19. The method of claim 18, wherein the non-natural mutation introduced into the first nucleotide sequence results in reduced expression or reduced transcription of the first nucleotide sequence and the non-natural mutation introduced into the second nucleotide sequence results in reduced expression or reduced transcription of the second nucleotide sequence.

20. The method of claim 19, wherein the non-natural mutation in the first nucleotide sequence results in a truncated, non-functional, or knocked out first protein, and wherein the non-natural mutation in the second nucleotide sequence results in a truncated, non-functional, or knocked out second protein.

21. The method of claim 20, wherein the first protein sequence comprises SEQ ID NO. 3 and the second protein sequence comprises SEQ ID NO. 4, and wherein the first nucleotide sequence comprises SEQ ID NO. 10 and the second nucleotide sequence comprises SEQ ID NO. 9.

22. A Phytophthora nicotianae resistant petunia plant produced by the method of claim 18, wherein the petunia plant comprises the non-natural mutation in the first nucleotide sequence and the non-natural mutation in the second nucleotide sequence, and wherein the petunia plant has the reduced expression or activity of the first protein and the reduced expression or activity of the second protein.

23. The resistant petunia plant of claim 22, wherein the first protein sequence comprises SEQ ID NO. 3 and the second protein sequence comprises SEQ ID NO. 4, and wherein the first nucleotide sequence comprises SEQ ID NO. 10 and the second nucleotide sequence comprises SEQ ID NO. 9.

24. A seed, tissue, or plant part of the resistant petunia plant of claim 23, wherein the seed, tissue, or plant part comprises the non-natural mutation in the first nucleotide sequence and the non-natural mutation in the second nucleotide sequence, and wherein the petunia plant has the reduced expression or activity of the first protein and the reduced expression or activity of the second protein.

Patent History
Publication number: 20190309319
Type: Application
Filed: Mar 21, 2019
Publication Date: Oct 10, 2019
Applicant: Enza Zaden Beheer B.V. (Enkhuizen)
Inventors: Christianus Cornelis Nicolaas VAN SCHIE (Amsterdam), Tieme ZEILMAKER (Amersfoort)
Application Number: 16/361,089
Classifications
International Classification: C12N 15/82 (20060101); C12N 9/02 (20060101);