OLIGONUCLEOTIDE COMPOSITIONS AND METHODS THEREOF

Among other things, the present disclosure relates to chirally controlled oligonucleotides of select designs, chirally controlled oligonucleotide compositions, and methods of making and using the same. In some embodiments, a provided chirally controlled oligonucleotide composition provides different cleavage patterns of a nucleic acid polymer than a reference oligonucleotide composition. In some embodiments, a provided chirally controlled oligonucleotide composition provides single site cleavage within a complementary sequence of a nucleic acid polymer. In some embodiments, a chirally controlled oligonucleotide composition has any sequence of bases, and/or pattern or base modifications, sugar modifications, backbone modifications and/or stereochemistry, or combination of these elements, described herein.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a divisional application of U.S. application Ser. No. 15/746,220, filed Jan. 19, 2018, issued as U.S. Pat. No. 10,479,995, which is a U.S. National Stage Application of International PCT Application Number PCT/US2016/043542, filed Jul. 22, 2016, which claims priority to United States Provisional Application Nos. 62/195,779, filed Jul. 22, 2015, 62/236,847, filed Oct. 2, 2015, and 62/331,960, filed May 4, 2016, the entirety of each of which is incorporated herein by reference.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Nov. 25, 2019, is named SL.txt and is 420,949 bytes in size.

BACKGROUND

Oligonucleotides are useful in therapeutic, diagnostic, research and nanomaterials applications. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) for therapeutics can be limited, for example, because of their instability against extra- and intracellular nucleases and/or their poor cell penetration and distribution. There is a need for new and improved oligonucleotides and oligonucleotide compositions, such as, e.g., new antisense and siRNA oligonucleotides and oligonucleotide compositions.

SUMMARY

Among other things, the present disclosure encompasses the recognition that structural elements of oligonucleotides, such as base sequence, chemical modifications (e.g., modifications of sugar, base, and/or internucleotidic linkages, and patterns thereof), and/or stereochemistry (e.g., stereochemistry of backbone chiral centers (chiral internucleotidic linkages), and/or patterns thereof), can have significant impact on properties, e.g., activities, of oligonucleotides. In some embodiments, the present disclosure demonstrates that oligonucleotide compositions comprising oligonucleotides with controlled structural elements, e.g., controlled chemical modification and/or controlled backbone stereochemistry patterns, provide unexpected properties, including but not limited to those described herein. In some embodiments, the present disclosure demonstrates that combinations of chemical modifications and stereochemistry can provide unexpected, greatly improved properties (e.g., bioactivity, selectivity, etc.). In some embodiments, the present disclosure provides an oligonucleotide composition having a particular sequence of bases, and/or pattern of sugar modifications (e.g., 2′-OMe, 2′-F, 2′-MOE, etc.), and/or pattern or base modifications (e.g., 5-methylcytosine), and/or pattern of backbone modifications (phosphate or phosphorothioate), and/or pattern of stereochemistry of backbone modifications (e.g., each phosphorothioate is Sp or Rp).

In some embodiments, modifications of internucleotidic linkages can convert phosphorus atoms in modified linkages into chiral centers. For example, in a phosphorothioate (PS) modification, one of the non-bridging oxygen (O) atoms bonded to a phosphorus (P) atom is replaced with a sulfur (S) atom. A consequence of using PS modification in oligonucleotide synthesis is that it creates a chiral center at phosphorus, which can have either an “Sp” or “Rp” configuration. For instance, a conventional stereorandom PS-modified oligonucleotide composition having 19 PS linkages [e.g., having 20 nucleotides in length, 19 PS modifications, each with two possible stereochemistries (Sp or Rp) at each PS modification] is a random mixture of over 500,000 (219) stereoisomers, each having the same nucleotide sequence (e.g., sequence of bases) but differing in the stereochemistry along their backbones; such a composition is a “stereorandom” oligonucleotide composition. In some embodiments, in contrast to stereorandom compositions, a chirally controlled oligonucleotide composition is a substantially pure preparation of a single oligonucleotide in that a predetermined level of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, some oligonucleotide compositions are stereopure (i.e., a chirally controlled oligonucleotide composition), wherein the stereochemistry at each PS is defined (Sp or Rp). In some embodiments, in a stereorandom compositions of oligonucleotides, the various oligonucleotides can have the same base sequence, same pattern of sugar modifications (e.g., 2′-OMe, 2′-F, 2′-OME, etc.), same pattern of base modifications (e.g., 5-methylcytosine), and same pattern of backbone modifications (phosphate or PS), but different patterns of backbone chiral centers, and their levels are random from non-stereocontrolled synthesis (not pre-determined as through stereocontrolled synthesis as certain methods exemplified herein using chiral auxilier). A chirally controlled oligonucleotide composition can be selected to have greater desired biological activity (e.g., greater activities, efficiency in RNA interference or RNAse H-mediated pathways, etc.) and decreased undesired activity (e.g., undesired immunogenicity, toxicity, etc.) than a stereorandom preparation of oligonucleotides of the same base sequence. In some embodiments, a chirally controlled oligonucleotide composition is better able to differentiate between a mutant (mu) and a wild-type (wt) HTT sequence (with a single nt difference).

Among other things, the present disclosure encompasses the recognition that stereorandom oligonucleotide preparations contain a plurality of distinct chemical entities that differ from one another, e.g., in the stereochemical structure of individual backbone chiral centers within the oligonucleotide chain. Without control of stereochemistry of backbone chiral centers, stereorandom oligonucleotide preparations provide uncontrolled compositions comprising undetermined levels of oligonucleotide stereoisomers. Even though these stereoisomers may have the same base sequence, they are different chemical entities at least due to their different backbone stereochemistry, and they can have, as demonstrated herein, different properties, e.g., bioactivities. Among other things, the present disclosure provides new compositions that are or contain particular stereoisomers of oligonucleotides of interest. In some embodiments, a particular stereoisomer may be defined, for example, by its base sequence, its length, its pattern of backbone linkages, and its pattern of backbone chiral centers. As is understood in the art, in some embodiments, base sequence may refer to the identity and/or modification status of nucleoside residues (e.g., of sugar and/or base components, relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil) in an oligonucleotide and/or to the hybridization character (i.e., the ability to hybridize with particular complementary residues) of such residues.

The present disclosure demonstrates, among other things, that individual stereoisomers of a particular oligonucleotide can show different stability and/or activity (e.g., functional and/or toxicity properties) from each other. Moreover, the present disclosure demonstrates that stability and/or activity improvements achieved through inclusion and/or location of particular chiral structures within an oligonucleotide can be comparable to, or even better than those achieved through use of particular backbone linkages, residue modifications, etc. (e.g., through use of certain types of modified phosphates [e.g., phosphorothioate, substituted phosphorothioate, etc.], sugar modifications [e.g., 2′-modifications, etc.], and/or base modifications [e.g., methylation, etc.]).

Among other things, the present disclosure recognizes that, in some embodiments, properties (e.g., stability and/or activities) of an oligonucleotide can be adjusted by optimizing its pattern of backbone chiral centers, optionally in combination with adjustment/optimization of one or more other features (e.g., linkage pattern, nucleoside modification pattern, etc.) of the oligonucleotide.

In some embodiments, the present disclosure provides compositions of oligonucleotides, wherein the oligonucleotides have a common pattern of backbone chiral centers which, unexpectedly, greatly enhances the stability and/or biological activity of the oligonucleotides. In some embodiments, a pattern of backbone chiral centers provides increased stability. In some embodiments, a pattern of backbone chiral centers provides surprisingly increased activity. In some embodiments, a pattern of backbone chiral centers provides increased stability and activity. In some embodiments, when an oligonucleotide is utilized to cleave a nucleic acid polymer, a pattern of backbone chiral centers, surprisingly by itself, changes the cleavage pattern of a target nucleic acid polymer. In some embodiments, a pattern of backbone chiral centers effectively prevents cleavage at secondary sites. In some embodiments, a pattern of backbone chiral centers creates new cleavage sites. In some embodiments, a pattern of backbone chiral centers minimizes the number of cleavage sites. In some embodiments, a pattern of backbone chiral centers minimizes the number of cleavage sites so that a target nucleic acid polymer is cleaved at only one site within the sequence of the target nucleic acid polymer that is complementary to the oligonucleotide. In some embodiments, a pattern of backbone chiral centers enhances cleavage efficiency at a cleavage site. In some embodiments, a pattern of backbone chiral centers of the oligonucleotide improves cleavage of a target nucleic acid polymer. In some embodiments, a pattern of backbone chiral centers increases selectivity. In some embodiments, a pattern of backbone chiral centers minimizes off-target effect. In some embodiments, a pattern of backbone chiral centers increase selectivity, e.g., cleavage selectivity between two target sequences differing only by a single nucleotide polymorphism (SNP). In some embodiments, a pattern of backbone chiral centers comprises, comprises one or more repeats of, or is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m. In some embodiments described herein, m is 1-50; and n is 1-10; and t is 1-50. In some embodiments, a pattern of backbone chiral centers comprises or is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m. In some embodiments, a pattern of backbone chiral centers comprises or is (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein m>2. In some embodiments, a pattern of backbone chiral centers is a sequence comprising at least 5, 6, 7, 8, 9, or 10 or more consecutive (Sp) positions. In some embodiments, a pattern of backbone chiral centers is a sequence comprising at least 5 consecutive (Sp) positions. In some embodiments, a pattern of backbone chiral centers is a sequence comprising at least 8 consecutive (Sp) positions. In some embodiments, a pattern of backbone chiral centers is a sequence comprising at least 10 consecutive (Sp) positions. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp). In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp) at or adjacent to the position of a SNP. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp), wherein the molecule has a wing-core-wing format. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp), wherein the molecule has a wing-core-wing format, wherein the wing on the 5′ end is 1-9 nt long, the core is 1-15 nt long, and the wing on the 3′ end is 1-9 nt long. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp), wherein the molecule has a wing-core-wing format, wherein the wing on the 5′ end is 5 nt long, the core is 1-15 nt long, and the wing on the 3′ end is 5 nt long. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp), wherein the molecule has a wing-core-wing format, wherein the wing on the 5′ end is 1-9 nt long, the core is 10 nt long, and the wing on the 3′ end is 1-9 nt long. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp), wherein the molecule has a wing-core-wing format, wherein the wing on the 5′ end is 5 nt long, the core is 10 nt long, and the wing on the 3′ end is 5 nt long. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp), wherein the molecule has a wing-core-wing format, wherein the wing on the 5′ end is 5 nt long, the core is 10 nt long, and the wing on the 3′ end is 5 nt long, and at least one wing comprises a nucleotide with a 2′-OMe modification. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp), wherein the molecule has a wing-core-wing format, wherein each wing comprises at least one nucleotide with a 2′-OMe modification. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp), wherein the molecule has a wing-core-wing format, wherein each nucleotide in both wings has a 2′-OMe modification. In some embodiments, a pattern of backbone chiral centers is a sequence consisting of all (Sp) with a single (Rp), wherein the molecule has a wing-core-wing format, wherein the wing on the 5′ end is 5 nt long, the core is 10 nt long, and the wing on the 3′ end is 5 nt long, and each nucleotide in each wing has a 2′-OMe modification. In some embodiments, the oligonucleotide is single-stranded and has a wing-core-wing format, wherein the wing on the 5′ end of the molecule comprises 4 to 8 nt, each of which has a 2′-OMe modification and wherein the nt at the 5′ end of the molecule has a phosphorothioate in the Sp conformation; the core comprises 8 to 12 nt, each of which is DNA (2′-H), wherein each has a phosphorothioate in the Sp position except one nt which has the phosphorothioate in the Rp position; and wherein the wing on the 3′ end of the molecule comprises 4 to 8 nt, each of which has a 2′-OMe modification, and wherein the nt at the 3′ end of the molecule comprises a phosphorothioate in the Sp conformation. In some embodiments, the oligonucleotide is single-stranded and has a wing-core-wing format, wherein the wing on the 5′ end of the molecule comprises 6 nt, each of which has a 2′-OMe modification and wherein the nt at the 5′ end of the molecule has a phosphorothioate in the Sp conformation; the core comprises 10 nt, each of which is DNA (2′-H), wherein each has a phosphorothioate in the Sp position except one nt which has the phosphorothioate in the Rp position; and wherein the wing on the 3′ end of the molecule comprises 6 nt, each of which has a 2′-OMe modification, and wherein the nt at the 3′ end of the molecule comprises a phosphorothioate in the Sp conformation.

In some embodiments, the present disclosure recognizes that chemical modifications, such as modifications of nucleosides and internucleotidic linkages, can provide enhanced properties. In some embodiments, the present disclosure demonstrates that combinations of chemical modifications and stereochemistry can provide unexpected, greatly improved properties (e.g., bioactivity, selectivity, etc.). In some embodiments, chemical combinations, such as modifications of sugars, bases, and/or internucleotidic linkages, are combined with stereochemistry patterns, e.g., (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, to provide oligonucleotides and compositions thereof with surprisingly enhanced properties. In some embodiments, a provided oligonucleotide composition is chirally controlled, and comprises a combination of 2′-modification of one or more sugar moieties, one or more natural phosphate linkages, one or more phosphorothioate linkages, and a stereochemistry pattern of (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein m>2.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising oligonucleotides defined by having:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that a predetermined level of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that at least about 10% of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.

Among other things, the present disclosure recognizes that combinations of oligonucleotide structural elements (e.g., patterns of chemical modifications, backbone linkages, backbone chiral centers, and/or backbone phosphorus modifications) can provide surprisingly improved properties such as bioactivities. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a predetermined level of oligonucleotides which comprise one or more wing regions and a common core region, wherein:

each wing region independently has a length of two or more bases, and independently and optionally comprises one or more chiral internucleotidic linkages;

the core region independently has a length of two or more bases, and independently comprises one or more chiral internucleotidic linkages, and the common core region has:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers.

In some embodiments, in an oligonucleotide comprising a wing-core-wing format, a “wing” is a portion of the oligonucleotide on the 5′ or 3′ end of the core, with the “core” (alternatively designated a “gap”) between the two wings. In some embodiments, an oligonucleotide can have a single wing and a single core; in such cases, the wing is on the 5′ or the 3′ end of the oligonucleotide. A wing and core can be defined by any of several structural elements (e.g., modifications or patterns of modifications of sugar, base, backbone or backbone stereochemistry, etc.). In some embodiments, a wing and core is defined by nucleoside modifications, wherein a wing comprises a nucleoside modification that the core region does not have. In some embodiments, oligonucleotides in provided compositions have a wing-core structure of nucleoside modification. In some embodiments, oligonucleotides in provided compositions have a core-wing structure of nucleoside modification. In some embodiments, oligonucleotides in provided compositions have a wing-core-wing structure of nucleoside modification. In some embodiments, a wing and core is defined by modifications of the sugar moieties. In some embodiments, a wing and core is defined by modifications of the base moieties. In some embodiments, each sugar moiety in the wing region has the same 2′-modification which is not found in the core region. In some embodiments, each sugar moiety in the wing region has the same 2′-modification which is different than any sugar modifications in the core region. In some embodiments, each sugar moiety in the wing region has the same 2′-modification, and the core region has no 2′-modifications. In some embodiments, when two or more wings are present, each sugar moiety in a wing region has the same 2′-modification, yet the common 2′-modification in a first wing region can either be the same as or different from the common 2′-modification in a second wing region.

In some embodiments, each wing comprises at least one chiral internucleotidic linkage and at least one natural phosphate linkage. In some embodiments, each wing comprises at least one modified sugar moiety. In some embodiments, each wing sugar moiety is modified. In some embodiments, a wing sugar moiety is modified by a modification that is absent from the core region. In some embodiments, a wing region only has modified internucleotidic linkages at one or both of its ends. In some embodiments, a wing region only has a modified internucleotidic linkage at its 5′-end. In some embodiments, a wing region only has a modified internucleotidic linkage at its 3′-end. In some embodiments, a wing region only has modified internucleotidic linkages at its 5′- and 3′-ends. In some embodiments, a wing is to the 5′-end of a core, and the wing only has a modified internucleotidic linkage at its 5′-end. In some embodiments, a wing is to the 5′-end of a core, and the wing only has a modified internucleotidic linkage at its 3′-end. In some embodiments, a wing is to the 5′-end of a core, and the wing only has modified internucleotidic linkages at both its 5′- and 3′-ends. In some embodiments, a wing is to the 3′-end of a core, and the wing only has a modified internucleotidic linkage at its 5′-end. In some embodiments, a wing is to the 3′-end of a core, and the wing only has a modified internucleotidic linkage at its 3′-end. In some embodiments, a wing is to the 3′-end of a core, and the wing only has modified internucleotidic linkages at both its 5′- and 3′-ends. In some embodiments, the modification(s) to the sugar moiety or internucleotidic linkage or other modifications in one wing can differ from those in another wing.

In some embodiments, each internucleotidic linkage within a core region is modified. In some embodiments, each internucleotidic linkage within a core region is chiral. In some embodiments, a core region has a pattern of backbone chiral centers of (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m. In some embodiments, a core region has a pattern of backbone chiral centers of (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein m>2. Among other things, the present disclosure demonstrates that, in some embodiments, such patterns can provide or enhance controlled cleavage of a target sequence, e.g., an RNA sequence.

In some embodiments, oligonucleotides in provided compositions have a common pattern of backbone phosphorus modifications. In some embodiments, a provided composition is an oligonucleotide composition that is chirally controlled in that the composition contains a predetermined level of oligonucleotides of an individual oligonucleotide type, wherein an oligonucleotide type is defined by:

1) base sequence;

2) pattern of backbone linkages;

3) pattern of backbone chiral centers; and

4) pattern of backbone phosphorus modifications.

As noted above and understood in the art, in some embodiments, the base sequence of an oligonucleotide may refer to the identity and/or modification status of nucleoside residues (e.g., of sugar and/or base components, relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil) in the oligonucleotide and/or to the hybridization character (i.e., the ability to hybridize with particular complementary residues) of such residues.

In some embodiments, a particular oligonucleotide type may be defined by

1A) base identity;

1B) pattern of base modification;

1C) pattern of sugar modification;

2) pattern of backbone linkages;

3) pattern of backbone chiral centers; and

4) pattern of backbone phosphorus modifications.

Thus, in some embodiments, oligonucleotides of a particular type may share identical bases but differ in their pattern of base modifications and/or sugar modifications. In some embodiments, oligonucleotides of a particular type may share identical bases and pattern of base modifications (including, e.g., absence of base modification), but differ in pattern of sugar modifications.

In some embodiments, oligonucleotides of a particular type are chemically identical in that they have the same base sequence (including length), the same pattern of chemical modifications to sugar and base moieties, the same pattern of backbone linkages (e.g., pattern of natural phosphate linkages, phosphorothioate linkages, phosphorothioate triester linkages, and combinations thereof), the same pattern of backbone chiral centers (e.g., pattern of stereochemistry (Rp/Sp) of chiral internucleotidic linkages), and the same pattern of backbone phosphorus modifications (e.g., pattern of modifications on the internucleotidic phosphorus atom, such as —S−, and -L-R1 of formula I).

In some embodiments, the sequence of the oligonucleotide comprises or consists of the sequence of any oligonucleotide disclosed herein. In some embodiments, the sequence of the oligonucleotide comprises or consists of the sequence of any oligonucleotide selected from Tables N1, N2, N3, N4 and 8. In some embodiments, the sequence of the oligonucleotide comprises or consists of the sequence of any oligonucleotide selected from Tables N1A, N2A, N3A, N4A and 8. In some embodiments, the sequence of the oligonucleotide in a stereopure (chirally controlled) oligonucleotide composition comprises or consists of the sequence of WV-1092, WVE120101, WV-2603 or WV-2595. In some embodiments, a sequence of an oligonucleotide includes any one or more of: base sequence (including length); pattern of chemical modifications to sugar and base moieties; pattern of backbone linkages; pattern of natural phosphate linkages, phosphorothioate linkages, phosphorothioate triester linkages, and combinations thereof; pattern of backbone chiral centers; pattern of stereochemistry (Rp/Sp) of chiral internucleotidic linkages; pattern of backbone phosphorus modifications; pattern of modifications on the internucleotidic phosphorus atom, such as —S−, and -L-R1 of formula I.

Among other things, the present disclosure recognizes the challenge of stereoselective (rather than stereorandom or racemic) preparation of oligonucleotides. Among other things, the present disclosure provides methods and reagents for stereoselective preparation of oligonucleotides comprising multiple (e.g., more than 5, 6, 7, 8, 9, or 10) internucleotidic linkages, and particularly for oligonucleotides comprising multiple (e.g., more than 5, 6, 7, 8, 9, or 10) chiral internucleotidic linkages. In some embodiments, in a stereorandom or racemic preparation of oligonucleotides, at least one chiral internucleotidic linkage is formed with less than 90:10, 95:5, 96:4, 97:3, or 98:2 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 90:10, 95:5, 96:4, 97:3, or 98:2 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 95:5 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 96:4 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 97:3 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 98:2 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 99:1 diastereoselectivity. In some embodiments, diastereoselectivity of a chiral internucleotidic linkage in an oligonucleotide may be measured through a model reaction, e.g. formation of a dimer under essentially the same or comparable conditions wherein the dimer has the same internucleotidic linkage as the chiral internucleotidic linkage, the 5′-nucleoside of the dimer is the same as the nucleoside to the 5′-end of the chiral internucleotidic linkage, and the 3′-nucleoside of the dimer is the same as the nucleoside to the 3′-end of the chiral internucleotidic linkage.

Among other things, it is surprisingly found that certain provided oligonucleotide compositions achieve unprecedented control of cleavage of target sequences, e.g., cleavage of target RNA by RNase H. In some embodiments, the present disclosure demonstrates that precise control of chemical and stereochemical attributes of oligonucleotides achieves improved activity of oligonucleotide preparations as compared with otherwise comparable preparations for which stereochemical attributes are not controlled. Among other things, the present disclosure specifically demonstrates improved rate, degree, and or specificity of cleavage of nucleic acid targets to which provided oligonucleotides hybridize.

In some embodiments, the present disclosure provides various uses of oligonucleotide compositions. Among other things, the present disclosure demonstrates that by controlling structural elements of oligonucleotides, such as base sequence, chemical modifications, stereochemistry, etc., properties of oligonucleotides can be greatly improved. For example, in some embodiments, the present disclosure provides methods for highly selective suppression of transcripts of a target nucleic acid sequence. In some embodiments, the present disclosure provides methods for treating a subject by suppressing transcripts from a disease-causing copy (e.g., a disease-causing allele). In some embodiments, the present disclosure provides methods for designing and preparing oligonucleotide compositions with surprisingly enhanced activity and/or selectivity when suppressing a transcript of a target sequence. In some embodiments, the present disclosure provides methods for designing and/or preparing oligonucleotide compositions which provide allele-specific suppression of a transcript from a target nucleic acid sequence.

In some embodiments, the present disclosure provides a method for controlled cleavage of a nucleic acid polymer, the method comprising steps of:

contacting a nucleic acid polymer whose nucleotide sequence comprises a target sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to a target sequence found in the nucleic acid polymer;
    • 2) a common pattern of backbone linkages; and
    • 3) a common pattern of backbone chiral centers;
      which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of the particular oligonucleotide type.

In some embodiments, the present disclosure provides a method for altering a cleavage pattern observed when a nucleic acid polymer whose nucleotide sequence includes a target sequence is contacted with a reference oligonucleotide composition that comprises oligonucleotides having a particular base sequence and length, which particular base sequence is or comprises a sequence that is complementary to the target sequence, the method comprising:

contacting the nucleic acid polymer with a chirally controlled oligonucleotide composition of oligonucleotides having the particular base sequence and length, which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of a single oligonucleotide type characterized by:

1) the particular base sequence and length;

2) a particular pattern of backbone linkages; and

3) a particular pattern of backbone chiral centers.

In some embodiments, the present disclosure provides a method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines the target nucleic acid sequence, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target nucleic acid sequence and a similar nucleic acid sequences, transcripts of the target nucleic acid sequence are suppressed at a greater level than a level of suppression observed for a similar nucleic acid sequence.

In some embodiments, the present disclosure provides a method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines the target nucleic acid sequence, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target nucleic acid sequence and a similar nucleic acid sequences, transcripts of the target nucleic acid sequence are suppressed at a greater level than a level of suppression observed for a similar nucleic acid sequence.

In some embodiments, transcripts of the target nucleic acid sequence are suppressed at a greater level than a level of suppression observed for any one of the similar nucleic acid sequence.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, transcripts of the particular allele are suppressed at a greater level than a level of suppression observed for another allele of the same nucleic acid sequence.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;

wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, transcripts of the particular allele are suppressed at a greater level than a level of suppression observed for another allele of the same nucleic acid sequence.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;

wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for another allele of the same nucleic acid sequence; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;

wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for another allele of the same nucleic acid sequence; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;

wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with an oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, a nucleotide characteristic sequence comprises a mutation that defines the target sequence relative to other similar sequences. In some embodiments, a nucleotide characteristic sequence comprises a point mutation that defines the target sequence relative to other similar sequences. In some embodiments, a nucleotide characteristic sequence comprises a SNP that defines the target sequence relative to other similar sequences.

In some embodiments, the present disclosure provides a method for preparing an oligonucleotide composition comprising oligonucleotides of a particular sequence, which composition provides selective suppression of a transcript of a target sequence, comprising providing a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence which is the same as the particular sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which pattern comprises (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein:

m is 1-50;

n is 1-10;

t is 1-50; and

each Np is independent Rp or Sp.

In general, activities of oligonucleotide compositions as described herein can be assessed using any appropriate assay. Relative activities for different compositions (e.g., stereocontrolled vs non-stereocontrolled, and/or different stereocontrolled compositions) are typically desirably determined in the same assay, in some embodiments substantially simultaneously and in some embodiments with reference to historical results.

Those of skill in the art will be aware of and/or will readily be able to develop appropriate assays for particular oligonucleotide compositions. The present disclosure provides descriptions of certain particular assays, for example that may be useful in assessing one or more features of oligonucleotide composition behavior with respect to RNAse H cleavage of a target sequence.

For example, certain assays that may be useful in the assessment of one or more features (e.g., rate, extent, and/or selectivity of cleavage) of RNase H cleavage may include an assay as described in any assay described and/or exemplified herein (e.g., in one or more of Examples 4, 9-10, 12, 14, 17-20, etc.).

In some embodiments, the present disclosure recognizes that a base sequence can impact properties of oligonucleotides. The present disclosure demonstrates that chemical and stereochemical modifications, combined with designed base sequences, can provide oligonucleotide compositions with unexpectedly improved properties (e.g., surprisingly higher activity, and/or selectivity, etc.). In some embodiments, oligonucleotides having a common base sequence complementary to a characteristic sequence element of a target nucleic acid sequence provide better activity compared to another common base sequence complementary to the characteristic sequence element of a target nucleic acid sequence. In some embodiments, oligonucleotides having a common base sequence complementary to a characteristic sequence element of a target nucleic acid sequence provide better selectivity compared to another common base sequence complementary to the characteristic sequence element of a target nucleic acid sequence.

In some embodiments, a composition of oligonucleotides having a common base sequence complementary to a characteristic sequence element of a target nucleic acid sequence, when compared to another composition of oligonucleotides having another common base sequence complementary to the characteristic sequence element of the target nucleic acid sequence, provides higher cleavage rate of a transcript from the target nucleic acid sequence, and/or a cleavage pattern which has only one major cleavage site, and the major cleavage site is within or close to the nucleotide characteristic sequence. In some embodiments, a composition of oligonucleotides having a complementary common base sequence, when compared to another composition of oligonucleotides having another complementary common base sequence, provide higher cleavage rate of a transcript from the target nucleic acid sequence, and a cleavage pattern which has only one major cleavage site, and the major cleavage site is within or close to a nucleotide characteristic sequence. In some embodiments, greater than 50%, 60%, 70%, 80% or 90% of cleavage occurs at the one major cleavage site, for example, when measured by a suitable method, e.g., an RNase H assay. In some embodiments, a composition of oligonucleotides having a complementary common base sequence, when compared to another composition of oligonucleotides having another complementary common base sequence, provides higher cleavage rate of a transcript from the target nucleic acid sequence, and a cleavage pattern which has only one major cleavage site, and the major cleavage site is within or close to a mutation or a SNP that defines the target sequence relative to other similar sequences. In some embodiments, a mutation is a point mutation. In some embodiments, a major cleavage site is next to a mutation or a SNP that defines the target sequence relative to other similar sequences. In some embodiments, each common base sequence is 100% complementary to the characteristic sequence element of the target nucleic acid sequence. In some embodiments, a major cleavage site is within less than 5, 4, 3, or 1 internucleotidic linkage from a mutation or a SNP that defines the target sequence relative to other similar sequences. In some embodiments, a major cleavage site is within less than 5, 4, 3, or 1 internucleotidic linkage from a mutation or a SNP that defines the target sequence relative to other similar sequences, and is within less than 5, 4, 3, or 1 internucleotidic linkage from a cleavage site when a stereorandom composition of oligonucleotides having the same common sequence, and/or a composition of DNA oligonucleotides having the same common sequence, is used. In some embodiments, a major cleavage site is a cleavage site when a stereorandom composition of oligonucleotides having the same common sequence is used. In some embodiments, a major cleavage site is a major cleavage site when a stereorandom composition of oligonucleotides having the same common sequence is used. In some embodiments, a major cleavage site is a cleavage site when a composition of DNA oligonucleotides having the same common sequence is used. In some embodiments, a major cleavage site is a major cleavage site when a composition of DNA oligonucleotides having the same common sequence is used.

In some embodiments, when comparing effects of a first and a second common base sequences, a stereorandom composition of oligonucleotides having a first common base sequence may be compared to a stereorandom composition of oligonucleotides having a second common base sequence. In some embodiments, a stereorandom composition is a composition of oligonucleotides having a common base sequence, a common pattern of nucleoside modifications, and a common pattern of backbone linkages. In some embodiments, a stereorandom composition is a composition of oligonucleotides having a common base sequence, a common pattern of nucleoside modifications, wherein each internucleotidic linkage is phosphorothioate. In some embodiments, when comparing effects of a first and a second common base sequences, a chirally controlled oligonucleotide composition of oligonucleotides having a first common base sequence may be compared to a chirally controlled oligonucleotide composition of oligonucleotides having a second common base sequence. In some embodiments, oligonucleotides in a chirally controlled oligonucleotide composition have a common base sequence, a common pattern of nucleoside modifications, a common pattern of backbone linkages, a common pattern of backbone chiral centers, and a common pattern of backbone phosphorus modifications. In some embodiments, each internucleotidic linkage is phosphorothioate.

In some embodiments, oligonucleotide compositions and technologies described herein are particularly useful in the treatment of Huntington's disease. For example, in some embodiments, the present disclosure defines stereochemically controlled oligonucleotide compositions that direct cleavage (e.g., RNase H-mediated cleavage) of nucleic acids associated with Huntington's disease. In some embodiments, such compositions direct preferential cleavage of a Huntington's disease-associated allele of a particular target sequence, relative to one or more (e.g., all non-Huntington's disease-associated) other alleles of the sequence.

Huntington's disease is an inherited disease that can cause progressive degeneration of nerve cells in the brain and affect a subject's motor and cognitive abilities. In some embodiments, Huntington's disease is an autosomal dominant disorder. In some embodiments, it is caused by mutations in the Huntingtin gene. Normal HTT gene contains 10 to 35 CAG tri-nucleotide repeats (SEQ ID NO: 1). People with 40 or more repeats often develop the disorder. In some embodiments, the expanded CAG segment on the first exon of HTT gene leads to the production of an abnormally long version of the Huntingtin protein (expanded polyglutamine tract) which is cut into smaller, toxic fragments that bind together and accumulate in neurons, disrupting the normal functions of these cells. Warby et al. (Am J Hum Genet. 2009, 84(3), 351-366) reported many SNPs that are associated with disease chromosomes and have stronger linkage associations with CAG expansion than those reported before. Many SNPs highly associated with CAG expansion do not segregate independently and are in Linkage Disequilibrium with each other. Among other things, the present disclosure recognizes that strong association between specific SNPs and CAG expanded chromosomes provides an attractive therapeutic opportunity for the treatment of Huntington Disease, e.g., through antisense therapy. Furthermore, the association of specific SNPs combined with high rates of heterozygosity in HD patients provides suitable targets for allele-specific knockdown of the mutant gene product. For example references, see Liu et al. Journal of Huntington's Disease 2, 2013, 491-500; Aronin, Neil and Pfister, Edith WO 2010/118263 A1; Pfister et al. Current Biology 2009, 19, 774-778.

In some embodiments, a targeted SNP of the present disclosure has high frequency of heterozygosity in HD and has a particular variant associated with the mutant HTT allele. In some embodiments, a SNP is rs362307. In some embodiments, a SNP is rs7685686. In some embodiments, a SNP may not be linked but may have a high heterozygous frequency. In some embodiments, a SNP is rs362268 (3′-UTR region). In some embodiments, a SNP is rs362306 (3′-UTR region). In some embodiments, a SNP is rs2530595. In some embodiments, a SNP is rs362331.

In some embodiments, a provided method for treating or preventing Huntington's disease in a subject, comprising administering to the subject a provided oligonucleotide compositions. In some embodiments, a provided method for treating or preventing Huntington's disease in a subject, comprising administering to the subject a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type.

In some embodiments, a provided method ameliorates a symptom of Huntington's disease. In some embodiments, a provided method slows onset of Huntington's disease. In some embodiments, a provided method slows progression of Huntington's disease.

In some embodiments, the present disclosure provides methods for identifying patients for a given oligonucleotide composition. In some embodiments, the present disclosure provides methods for patient stratification. In some embodiments, a provided method comprises identifying a mutation and/or SNP associated with a disease-causing allele. For example, in some embodiments, a provided method comprises identifying in a subject a SNP associated with expanded CAG repeats that are associated with or causing Huntington's disease.

In some embodiments, a subject has a SNP in the subject's Huntingtin gene. In some embodiments, a subject has a SNP, wherein one allele is mutant Huntingtin associated with expanded CAG repeats. In some embodiments, a subject has a SNP selected from rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In some embodiments, oligonucleotides of a provided composition have a sequence complementary to a sequence comprising a SNP from the disease-causing allele (mutant), and the composition selectively suppresses expression from the diseasing-causing allele.

In some embodiments, the sequence of oligonucleotides in provided technologies (compounds, compositions, methods, etc.) comprises, consists of, or is the sequence of any oligonucleotide described herein. In some embodiments, a sequence is selected from Tables N1A, N2A, N3A, N4A or 8; or WV-1092, WVE120101, WV-2603 or WV-2595. In some embodiments, a sequence is selected from the sequence of WV-1092, WVE120101, WV-2603 or WV-2595. In some embodiments, provided oligonucleotides are of the type defined by WV-1092, WVE120101, WV-2603 or WV-2595. In some embodiments, provided oligonucleotides are of the type defined by WV-1092. In some embodiments, provided oligonucleotides are of the type defined by WVE120101. In some embodiments, provided oligonucleotides are of the type defined by WV-2603. In some embodiments, provided oligonucleotides are of the type defined by WV-2595.

In some embodiments, provided oligonucleotide compositions comprises a lipid and an oligonucleotide. In some embodiments, a lipid is conjugated to an oligonucleotide.

In some embodiments, a composition comprises an oligonucleotide and a lipid selected from the list of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl. In some embodiments, a composition comprises an oligonucleotide and a lipid selected from the list of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl.

In some embodiments, a composition comprises an oligonucleotide and a lipid selected from:

In some embodiments, a composition comprises an oligonucleotide and a lipid, wherein the lipid comprises a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic group.

In some embodiments, an oligonucleotide composition comprises a plurality of oligonucleotides, which share:

1) a common base sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone phosphorus modifications;

wherein one or more oligonucleotides of the plurality are individually conjugated to a lipid.

In some embodiments, a chirally controlled oligonucleotide composition comprises a plurality of oligonucleotides, which share:

1) a common base sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone phosphorus modifications;

wherein:

the composition is chirally controlled in that the plurality of oligonucleotides share the same stereochemistry at one or more chiral internucleotidic linkages;

one or more oligonucleotides of the plurality are individually conjugated to a lipid; and one or more oligonucleotides of the plurality are optionally and individually conjugated to a targeting compound or moiety.

In some embodiments, a method of delivering an oligonucleotide to a cell or tissue in a human subject, comprises:

(a) Providing a composition of any one of the embodiments described herein; and

(b) Administering the composition to the human subject such that the oligonucleotide is delivered to a cell or tissue in the subject.

In some embodiments, a method for delivering an oligonucleotide to a cell or tissue comprises preparing a composition according to any one of the embodiments described herein and contacting the cell or tissue with the composition.

In some embodiments, a method of modulating the level of a transcript or gene product of a gene in a cell, the method comprises the step of contacting the cell with a composition according to any one of the embodiments described herein, wherein the oligonucleotide is capable of modulating the level of the transcript or gene product.

In some embodiments, a method for inhibiting expression of a gene in a cell or tissue comprises preparing a composition according to any one of the embodiments described herein and treating the cell or tissue with the composition.

In some embodiments, a method for inhibiting expression of a gene in a cell or tissue in a mammal comprises preparing a composition according to any one of the embodiments described herein and administering the composition to the mammal.

In some embodiments, a method of treating a disease that is caused by the over-expression of one or several proteins in a cell or tissue in a subject, said method comprises the administration of a composition according to any one of the embodiments described herein to the subject.

In some embodiments, a method of treating a disease that is caused by a reduced, suppressed or missing expression of one or several proteins in a subject, said method comprises the administration of a composition according to any one of the embodiments described herein to the subject.

In some embodiments, a method for generating an immune response in a subject, said method comprises the administration of a composition according to any one of the embodiments described herein to the subject, wherein the biologically active compound is an immunomodulating nucleic acid.

In some embodiments, a method for treating a sign and/or symptom of Huntington's Disease by providing a composition of any one of the embodiments described herein and administering the composition to the subject.

In some embodiments, a method of modulating the amount of RNaseH-mediated cleavage in a cell, the method comprises the step of contacting the cell with a composition according to any one of the embodiments described herein, wherein the oligonucleotide is capable of modulating the amount of RNaseH-mediated cleavage.

In some embodiments, a method of administering an oligonucleotide to a subject in need thereof, comprises steps of providing a composition comprises the agent a lipid, and administering the composition to the subject, wherein the agent is any agent disclosed herein, and wherein the lipid is any lipid disclosed herein.

In some embodiments, a method of treating a disease in a subject, the method comprises steps of providing a composition comprises the agent a lipid, and administering a therapeutically effective amount of the composition to the subject, wherein the agent is any agent disclosed herein, and wherein the lipid is any lipid disclosed herein, and wherein the disease is any disease disclosed herein.

In some embodiments, a lipid comprises an optionally substituted C10-C40 saturated or partially unsaturated aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic group.

In some embodiments, a lipid comprises an unsubstituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises no more than one optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises two or more optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises no tricyclic or polycyclic moiety.

In some embodiments, a lipid has the structure of R1—COOH, wherein R1 is an optionally substituted C10-C40 saturated or partially unsaturated aliphatic chain.

The composition or method of any one of claim 16, wherein the lipid is conjugated through its carboxyl group.

The composition or method according to any one of the embodiments described herein, wherein the lipid is selected from:

In some embodiments, a lipid is conjugated to the oligonucleotide.

In some embodiments, a lipid is directly conjugated to the oligonucleotide.

In some embodiments, a lipid is conjugated to the oligonucleotide via a linker.

In some embodiments, a linker is selected from: an uncharged linker; a charged linker; a linker comprises an alkyl; a linker comprises a phosphate; a branched linker; an unbranched linker; a linker comprises at least one cleavage group; a linker comprises at least one redox cleavage group; a linker comprises at least one phosphate-based cleavage group; a linker comprises at least one acid-cleavage group; a linker comprises at least one ester-based cleavage group; and a linker comprises at least one peptide-based cleavage group.

In some embodiments, each oligonucleotide of the plurality is individually conjugated to the same lipid at the same location.

In some embodiments, a lipid is conjugated to an oligonucleotide through a linker.

In some embodiments, one or more oligonucleotides of the plurality are independently conjugated to a targeting compound or moiety.

In some embodiments, one or more oligonucleotides of the plurality are independently conjugated to a lipid and a targeting compound or moiety.

In some embodiments, one or more oligonucleotides of the plurality are independently conjugated to a lipid at one end and a targeting compound or moiety at the other.

In some embodiments, oligonucleotides of the plurality share the same chemical modification patterns.

In some embodiments, oligonucleotides of the plurality share the same chemical modification patterns comprises one or more base modifications.

In some embodiments, oligonucleotides of the plurality share the same chemical modification patterns comprises one or more sugar modifications.

In some embodiments, a common base sequence is capable of hybridizing with a transcript in a cell, which transcript contains a mutation that is linked to Huntington's Disease, or whose level, activity and/or distribution is linked to Huntington's Disease.

In some embodiments, an oligonucleotide is a nucleic acid.

In some embodiments, an oligonucleotide is an oligonucleotide.

In some embodiments, an oligonucleotide is an oligonucleotide which participates in RNaseH-mediated cleavage of a mutant Huntingtin gene mRNA.

In some embodiments, a disease or disorder is Huntington's Disease.

In some embodiments, a lipid comprises an optionally substituted, C10-C80 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein each variable is independently as defined and described herein.

In some embodiments, a lipid comprises an optionally substituted C10-C80 saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted C10-C80 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted C10-C60 saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted C10-C40 saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted, C10-C60 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein each variable is independently as defined and described herein.

In some embodiments, a lipid comprises an optionally substituted C10-C80 saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted, C10-C40 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein each variable is independently as defined and described herein.

In some embodiments, a lipid comprises an optionally substituted C10-C40 saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a composition further comprises one or more additional components selected from: a polynucleotide, carbonic anhydrase inhibitor, a dye, an intercalating agent, an acridine, a cross-linker, psoralene, mitomycin C, a porphyrin, TPPC4, texaphyrin, Sapphyrin, a polycyclic aromatic hydrocarbon phenazine, dihydrophenazine, an artificial endonuclease, a chelating agent, EDTA, an alkylating agent, a phosphate, an amino, a mercapto, a PEG, PEG-40K, MPEG, [MPEG]2, a polyamino, an alkyl, a substituted alkyl, a radiolabeled marker, an enzyme, a hapten biotin, a transport/absorption facilitator, aspirin, vitamin E, folic acid, a synthetic ribonuclease, a protein, a glycoprotein, a peptide, a molecule having a specific affinity for a co-ligand, an antibody, a hormone, a hormone receptor, a non-peptidic species, a lipid, a lectin, a carbohydrate, a vitamin, a cofactor, selectivity agent, or a drug. In some embodiments, a composition further comprises one or more additional components selected from: a polynucleotide, carbonic anhydrase inhibitor, a dye, an intercalating agent, an acridine, a cross-linker, psoralene, mitomycin C, a porphyrin, TPPC4, texaphyrin, Sapphyrin, a polycyclic aromatic hydrocarbon phenazine, dihydrophenazine, an artificial endonuclease, a chelating agent, EDTA, an alkylating agent, a phosphate, an amino, a mercapto, a PEG, PEG-40K, MPEG, [MPEG]2, a polyamino, an alkyl, a substituted alkyl, a radiolabeled marker, an enzyme, a hapten biotin, a transport/absorption facilitator, aspirin, vitamin E, folic acid, a synthetic ribonuclease, a protein, a glycoprotein, a peptide, a molecule having a specific affinity for a co-ligand, an antibody, a hormone, a hormone receptor, a non-peptidic species, a lipid, a lectin, a carbohydrate, a vitamin, a cofactor, or a drug.

In some embodiments, the present disclosure provides an oligonucleotide conjugated to a selectivity agent. In some embodiments, the present disclosure provides a composition comprising an oligonucleotide or oligonucleotide type comprising a selectivity agent. In some embodiments, a selectivity agent binds specifically to one or more neurotransmitter transporters selected from the group consisting of a dopamine transporter (DAT), a serotonin transporter (SERT), and a norepinephrine transporter (NET). In some embodiments, a selectivity agent is selected from the group consisting of a dopamine reuptake inhibitor (DRI), a selective serotonin reuptake inhibitor (SSRI), a noradrenaline reuptake inhibitor (NRI), a norepinephrine-dopamine reuptake inhibitor (NDRI), and a serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI). In some embodiments, a selectivity agent is selected from the group consisting of a triple reuptake inhibitor, a noradrenaline dopamine double reuptake inhibitor, a serotonin single reuptake inhibitor, a noradrenaline single reuptake inhibitor, and a dopamine single reuptake inhibitor. In some embodiments, a selectivity agent is selected from the group consisting of a dopamine reuptake inhibitor (DRI), a Norepinephrine-Dopamine Reuptake Inhibitor (NDRI) and a serotonin-Norepinephrine-Dopamine Reuptake Inhibitor (SNDRI). In some embodiments, a selectivity agent is selected from the selectivity agents which are described in U.S. Pat. Nos. 9,084,825; and 9,193,969; and WO2011131693, WO2014064258.

In some embodiments, a lipid comprises a C10-C80 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a composition further comprises a linker linking the oligonucleotide and the lipid, wherein the linker is selected from: an uncharged linker; a charged linker; a linker comprises an alkyl; a linker comprises a phosphate; a branched linker; an unbranched linker; a linker comprises at least one cleavage group; a linker comprises at least one redox cleavage group; a linker comprises at least one phosphate-based cleavage group; a linker comprises at least one acid-cleavage group; a linker comprises at least one ester-based cleavage group; a linker comprises at least one peptide-based cleavage group.

In some embodiments, an oligonucleotide comprises or consists of or is an oligonucleotide or oligonucleotide composition or chirally controlled oligonucleotide composition.

In some embodiments, an oligonucleotide comprises or consists of or is an oligonucleotide composition or chirally controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises or consists of the sequence of any oligonucleotide described herein.

In some embodiments, an oligonucleotide comprises or consists of or is an oligonucleotide composition or chirally controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises or consists of the sequence of any oligonucleotide listed in Table 4.

In some embodiments, an oligonucleotide comprises or consists of or is an oligonucleotide composition or chirally controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises or consists of the sequence of a splice-switching oligonucleotide.

The composition or method of any of the embodiments described herein, wherein the oligonucleotide is a chirally controlled oligonucleotide composition.

The composition or method of any of the embodiments described herein, wherein the disease or disorder is Huntington's Disease.

The composition or method of any of the embodiments described herein, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a mutant Huntingtin gene mRNA.

The composition or method of any of the embodiments described herein, wherein the oligonucleotide comprises, consists of or is the sequence of any oligonucleotide disclosed herein.

The composition or method of any of the embodiments described herein, wherein the oligonucleotide is capable of differentiating between a wild-type and a mutant Huntingtin allele.

The composition or method of any of the embodiments described herein, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a mutant Huntingtin gene mRNA.

The composition or method of any of the embodiments described herein, wherein the oligonucleotide comprises, consists of or is the sequence of any oligonucleotide disclosed in Table 4.

In some embodiments, an oligonucleotide comprises or consists of or is an oligonucleotide or oligonucleotide composition or chirally controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises or consists of the sequence of any of: WV-1092, WV-2595, or WV-2603.

In some embodiments, a sequence of an oligonucleotide includes any one or more of: base sequence (including length); pattern of chemical modifications to sugar and base moieties; pattern of backbone linkages; pattern of natural phosphate linkages, phosphorothioate linkages, phosphorothioate triester linkages, and combinations thereof; pattern of backbone chiral centers; pattern of stereochemistry (Rp/Sp) of chiral internucleotidic linkages; pattern of backbone phosphorus modifications; pattern of modifications on the internucleotidic phosphorus atom, such as —S−, and -L-R1 of formula I.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type, wherein the oligonucleotides target a mutant Huntingtin gene, and the length is from about 10 to about 50 nucleotides, wherein the backbone linkages comprise at least one phosphorothioate, and wherein the pattern of backbone chiral centers comprises at least one chiral center in a Rp conformation and at least one chiral center in a Sp conformation.

In some embodiments, the present disclosure provides a method for cleavage of a nucleic acid having a base sequence comprising a target sequence, the method comprising steps of:

(a) contacting a nucleic acid having a base sequence comprising a target sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to the target sequence in the nucleic acid;
    • 2) a common pattern of backbone linkages; and
    • 3) a common pattern of backbone chiral centers;
      which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of the particular oligonucleotide type, wherein the oligonucleotide targets a mutant Huntingtin gene, and the length is from about 10 to about 50 nucleotides, wherein the backbone linkages comprise at least one phosphorothioate, and wherein the pattern of backbone chiral centers comprises at least one chiral center in a Rp conformation and at least one chiral center in a Sp conformation.

In some embodiments, the present disclosure provides a method for cleavage of a nucleic acid having a base sequence comprising a target sequence, the method comprising steps of:

(a) contacting a nucleic acid having a base sequence comprising a target sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to the target sequence in the nucleic acid;
    • 2) a common pattern of backbone linkages; and
    • 3) a common pattern of backbone chiral centers;
      which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of the particular oligonucleotide type, wherein the oligonucleotide targets a mutant Huntingtin gene, and the length is from about 10 to about 50 nucleotides, wherein the backbone linkages comprise at least one phosphorothioate, and wherein the pattern of backbone chiral centers comprises at least one chiral center in a Rp conformation and at least one chiral center in a Sp conformation; and

(b) cleavage of the nucleic acid mediated by a RNAseH or RNA interference mechanism.

In some embodiments, a provided composition further comprises a selectivity agent selected from: the group of compounds which binds specifically to one or more neurotransmitter transporters selected from the group consisting of a dopamine transporter (DAT), a serotonin transporter (SERT), and a norepinephrine transporter (NET); the group consisting of a dopamine reuptake inhibitor (DRI), a selective serotonin reuptake inhibitor (SSRI), a noradrenaline reuptake inhibitor (NRI), a norepinephrine-dopamine reuptake inhibitor (NDRI), and a serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI); the group consisting of a triple reuptake inhibitor, a noradrenaline dopamine double reuptake inhibitor, a serotonin single reuptake inhibitor, a noradrenaline single reuptake inhibitor, and a dopamine single reuptake inhibitor; and the group consisting of a dopamine reuptake inhibitor (DRI), a Norepinephrine-Dopamine Reuptake Inhibitor (NDRI) and a serotonin-Norepinephrine-Dopamine Reuptake Inhibitor (SNDRI).

In some embodiments, a provided composition comprises oligonucleotides wherein the base sequence, pattern of backbone linkages and/or pattern of backbone chiral centers of the oligonucleotides comprises or consists of the base sequence, pattern of backbone linkages and/or pattern of backbone chiral centers of any of any oligonucleotide selected from Tables N1A, N2A, N3A, N4A and 8; and WV-1092, WV-2595, and WV-2603.

In some embodiments, a provided composition comprises oligonucleotides wherein the base sequence, pattern of backbone linkages and/or pattern of backbone chiral centers of the oligonucleotides comprises or consists of the base sequence, and pattern of backbone linkages, and/or pattern of backbone chiral centers of any of any oligonucleotide selected from Tables N1A, N2A, N3A, N4A and 8; and WV-1092, WV-2595, and WV-2603.

In some embodiments, a provided composition comprises oligonucleotides wherein the base sequence, pattern of backbone linkages and/or pattern of backbone chiral centers of the oligonucleotides comprises or consists of the base sequence, and pattern of backbone linkages, and pattern of backbone chiral centers of any of any oligonucleotide selected from Tables N1A, N2A, N3A, N4A and 8; and WV-1092, WV-2595, and WV-2603.

Definitions

Aliphatic: The term “aliphatic” or “aliphatic group”, as used herein, means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic or polycyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “carbocycle” “cycloaliphatic” or “cycloalkyl”), that has a single point of attachment to the rest of the molecule. In some embodiments, aliphatic groups contain 1-50 aliphatic carbon atoms. Unless otherwise specified, aliphatic groups contain 1-10 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms. In some embodiments, “cycloaliphatic” (or “carbocycle” or “cycloalkyl”) refers to a monocyclic or bicyclic C3-C10 hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. In some embodiments, “cycloaliphatic” (or “carbocycle” or “cycloalkyl”) refers to a monocyclic C3-C6 hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.

Alkylene: The term “alkylene” refers to a bivalent alkyl group. An “alkylene chain” is a polymethylene group, i.e., —(CH2)n—, wherein n is a positive integer, preferably from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group.

Alkenylene: The term “alkenylene” refers to a bivalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group.

Animal: As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and/or worms. In some embodiments, an animal may be a transgenic animal, a genetically-engineered animal, and/or a clone.

Approximately: As used herein, the terms “approximately” or “about” in reference to a number are generally taken to include numbers that fall within a range of 5%, 10%, 15%, or 20% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value). In some embodiments, use of the term “about” in reference to dosages means±5 mg/kg/day.

Aryl: The term “aryl” used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or “aryloxyalkyl,” refers to monocyclic and bicyclic ring systems having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic and wherein each ring in the system contains three to seven ring members. The term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of the present disclosure, “aryl” refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.

Characteristic portion: As used herein, the phrase a “characteristic portion” of a protein or polypeptide is one that contains a continuous stretch of amino acids, or a collection of continuous stretches of amino acids, that together are characteristic of a protein or polypeptide. Each such continuous stretch generally will contain at least two amino acids. Furthermore, those of ordinary skill in the art will appreciate that typically at least 5, 10, 15, 20 or more amino acids are required to be characteristic of a protein. In general, a characteristic portion is one that, in addition to the sequence identity specified above, shares at least one functional characteristic with the relevant intact protein.

Characteristic sequence: A “characteristic sequence” is a sequence that is found in all members of a family of polypeptides or nucleic acids, and therefore can be used by those of ordinary skill in the art to define members of the family.

Characteristic structural element: The term “characteristic structural element” refers to a distinctive structural element (e.g., core structure, collection of pendant moieties, sequence element, etc) that is found in all members of a family of polypeptides, small molecules, or nucleic acids, and therefore can be used by those of ordinary skill in the art to define members of the family.

Comparable: The term “comparable” is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit comparison of results obtained or phenomena observed. In some embodiments, comparable sets of conditions or circumstances are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will appreciate that sets of conditions are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under the different sets of conditions or circumstances are caused by or indicative of the variation in those features that are varied.

Dosing regimen: As used herein, a “dosing regimen” or “therapeutic regimen” refers to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regime comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount.

Equivalent agents: Those of ordinary skill in the art, reading the present disclosure, will appreciate that the scope of useful agents in the context of the present disclosure is not limited to those specifically mentioned or exemplified herein. In particular, those skilled in the art will recognize that active agents typically have a structure that consists of a core and attached pendant moieties, and furthermore will appreciate that simple variations of such core and/or pendant moieties may not significantly alter activity of the agent. For example, in some embodiments, substitution of one or more pendant moieties with groups of comparable three-dimensional structure and/or chemical reactivity characteristics may generate a substituted compound or portion equivalent to a parent reference compound or portion. In some embodiments, addition or removal of one or more pendant moieties may generate a substituted compound equivalent to a parent reference compound. In some embodiments, alteration of core structure, for example by addition or removal of a small number of bonds (typically not more than 5, 4, 3, 2, or 1 bonds, and often only a single bond) may generate a substituted compound equivalent to a parent reference compound. In many embodiments, equivalent compounds may be prepared by methods illustrated in general reaction schemes as, for example, described below, or by modifications thereof, using readily available starting materials, reagents and conventional or provided synthesis procedures. In these reactions, it is also possible to make use of variants, which are in themselves known, but are not mentioned here.

Equivalent Dosage: The term “equivalent dosage” is used herein to compare dosages of different pharmaceutically active agents that effect the same biological result. Dosages of two different agents are considered to be “equivalent” to one another in accordance with the present disclosure if they achieve a comparable level or extent of the biological result. In some embodiments, equivalent dosages of different pharmaceutical agents for use in accordance with the present disclosure are determined using in vitro and/or in vivo assays as described herein. In some embodiments, one or more lysosomal activating agents for use in accordance with the present disclosure is utilized at a dose equivalent to a dose of a reference lysosomal activating agent; in some such embodiments, the reference lysosomal activating agent for such purpose is selected from the group consisting of small molecule allosteric activators (e.g., pyrazolpyrimidines), imminosugars (e.g., isofagomine), antioxidants (e.g., n-acetyl-cysteine), and regulators of cellular trafficking (e.g., Rab1a polypeptide).

Heteroaliphatic: The term “heteroaliphatic” refers to an aliphatic group wherein one or more units selected from C, CH, CH2, or CH3 are independently replaced by a heteroatom. In some embodiments, a heteroaliphatic group is heteroalkyl. In some embodiments, a heteroaliphatic group is heteroalkenyl.

Heteroaryl: The terms “heteroaryl” and “heteroar-,” used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to groups having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14π electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms. The term “heteroatom” refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. The terms “heteroaryl” and “heteroar-,” as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Nonlimiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. A heteroaryl group may be mono- or bicyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl, wherein the alkyl and heteroaryl portions independently are optionally substituted.

Heteroatom: The term “heteroatom” means one or more of oxygen, sulfur, nitrogen, phosphorus, boron, selenium, or silicon (including, any oxidized form of nitrogen, boron, selenium, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring, for example N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or NR+ (as in N-substituted pyrrolidinyl)).

Heterocycle: As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring” are used interchangeably and refer to a stable 3- to 7-membered monocyclic or 7-10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term “nitrogen” includes a substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or +NR (as in N-substituted pyrrolidinyl).

A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothiophenyl pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl, where the radical or point of attachment is on the heterocyclyl ring. A heterocyclyl group may be mono- or bicyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.

Intraperitoneal: The phrases “intraperitoneal administration” and “administered intraperitonealy” as used herein have their art-understood meaning referring to administration of a compound or composition into the peritoneum of a subject.

In vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant, and/or microbe).

In vivo: As used herein, the term “in vivo” refers to events that occur within an organism (e.g., animal, plant, and/or microbe).

Lower alkyl: The term “lower alkyl” refers to a C1-4 straight or branched alkyl group. Example lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

Lower haloalkyl: The term “lower haloalkyl” refers to a C1-4 straight or branched alkyl group that is substituted with one or more halogen atoms.

Optionally substituted: As described herein, compounds of the disclosure may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. Combinations of substituents envisioned by this disclosure are preferably those that result in the formation of stable or chemically feasible compounds. The term “stable,” as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.

Suitable monovalent substituents on a substitutable carbon atom of an “optionally substituted” group are independently halogen; —(CH2)0-4R◯; —(CH2)0-4OR◯; —O(CH2)0-4R◯, —O—(CH2)0-4C(O)OR◯; —(CH2)0-4CH(OR◯)2; —(CH2)0-4SR◯; —(CH2)0-4Ph, which may be substituted with R◯; —(CH2)0-4O(CH2)0-1Ph which may be substituted with R◯; —CH═CHPh, which may be substituted with R◯; —(CH2)0-4O(CH2)0-1-pyridyl which may be substituted with R◯; —NO2; —CN; —N3; —(CH2)0-4N(R◯)2; —(CH2)0-4N(R◯)C(O)R◯; —N(R◯)C(S)R◯; —(CH2)0-4N(R◯)C(O)NR◯2; —N(R◯)C(S)NR◯2; —(CH2)0-4N(R◯)C(O)OR◯; —N(R◯)N(R◯)C(O)R◯; —N(R◯)N(R◯)C(O)NR◯2; —N(R◯)N(R◯)C(O)OR◯; —(CH2)0-4C(O)R◯; —C(S)R◯; —(CH2)0-4C(O)OR◯; —(CH2)0-4C(O)SR◯; —(CH2)0-4C(O)OSiR◯3; —(CH2)0-4OC(O)R◯; —OC(O)(CH2)0-4SR, —SC(S)SR◯; —(CH2)0-4SC(O)R◯; —(CH2)0-4C(O)NR◯2; —C(S)NR◯2; —C(S)SR◯; —SC(S)SR◯, —(CH2)0-4OC(O)NR◯2; —C(O)N(OR◯)R◯; —C(O)C(O)R◯; —C(O)CH2C(O)R◯; —C(NOR◯)R◯; —(CH2)0-4SSR◯; —(CH2)0-4S(O)2R◯; —(CH2)0-4S(O)2OR◯; —(CH2)0-4OS(O)2R◯; —S(O)2NR◯2; —(CH2)0-4 S(O)R◯; —N(R◯)S(O)2NR◯2; —N(R◯)S(O)2R◯; —N(OR◯)R◯; —C(NH)NR◯2; —P(O)2R◯; —P(O)R◯2; —OP(O)R◯2; —OP(O)(OR◯)2; —SiR◯3; —(C1-4 straight or branched alkylene)O—N(R◯)2; or —(C1-4 straight or branched alkylene)C(O)O—N(R◯)2, wherein each R◯ may be substituted as defined below and is independently hydrogen, C1-6 aliphatic, —CH2Ph, —O(CH2)0-1Ph, —CH2-(5-6 membered heteroaryl ring), or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R◯, taken together with their intervening atom(s), form a 3-12 membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below.

Suitable monovalent substituents on R◯ (or the ring formed by taking two independent occurrences of R◯ together with their intervening atoms), are independently halogen, —(CH2)0-2R●, -(haloR●), —(CH2)0-2OH, —(CH2)0-2OR●, —(CH2)0-2CH(OR●)2; —O(haloR●), —CN, —N3, —(CH2)0-2C(O)R●, —(CH2)0-2C(O)OH, —(CH2)0-2C(O)OR●, —(CH2)0-2SR●, —(CH2)0-2SH, —(CH2)0-2NH2, —(CH2)0-2NHR●, —(CH2)0-2NR●2, —NO2, —SiR●3, —OSiR●3, —C(O)SR●, —(C1-4 straight or branched alkylene)C(O)OR●, or —SSR● wherein each R● is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently selected from C1-4 aliphatic, —CH2Ph, —O(CH2)0-1Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R° include ═O and ═S.

Suitable divalent substituents on a saturated carbon atom of an “optionally substituted” group include the following: ═O, ═S, ═NNR*2, ═NNHC(O)R*, ═NNHC(O)OR*, ═NNHS(O)2R*, ═NR*, ═NOR*, —O(C(R*2))2-3O—, or —S(C(R*2))2-3S—, wherein each independent occurrence of R* is selected from hydrogen, C1-6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: —O(CR*2)2-3O—, wherein each independent occurrence of R* is selected from hydrogen, C1-6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

Suitable substituents on the aliphatic group of R* include halogen, —R●, -(haloR●), —OH, —OR●, —O(haloR●), —CN, —C(O)OH, —C(O)OR●, —NH2, —NHR●, —NR●2, or —NO2, wherein each R● is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1-4 aliphatic, —CH2Ph, —O(CH2)0-1Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

Suitable substituents on a substitutable nitrogen of an “optionally substituted” group include —R†, —NR†2, —C(O)R†, —C(O)OR†, —C(O)C(O)R†, —C(O)CH2C(O)R†, —S(O)2R†, —S(O)2NR†2, —C(S)NR†2, —C(NH)NR†2, or —N(R)S(O)2R†; wherein each R† is independently hydrogen, C1-6 aliphatic which may be substituted as defined below, unsubstituted —OPh, or an unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R†, taken together with their intervening atom(s) form an unsubstituted 3-12 membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

Suitable substituents on the aliphatic group of R† are independently halogen, —R●, -(haloR●), —OH, —OR●, —O(haloR●), —CN, —C(O)OH, —C(O)OR●, —NH2, —NHR●, —NR●2, or —NO2, wherein each R● is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1-4 aliphatic, —CH2Ph, —O(CH2)0-1Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

Oral: The phrases “oral administration” and “administered orally” as used herein have their art-understood meaning referring to administration by mouth of a compound or composition.

Parenteral: The phrases “parenteral administration” and “administered parenterally” as used herein have their art-understood meaning referring to modes of administration other than enteral and topical administration, usually by injection, and include, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

Partially unsaturated: As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined.

Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.

Pharmaceutically acceptable: As used herein, the phrase “pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and/or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.

Pharmaceutically acceptable salt: The term “pharmaceutically acceptable salt”, as used herein, refers to salts of such compounds that are appropriate for use in pharmaceutical contexts, i.e., salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salt include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate.

Prodrug: A general, a “prodrug,” as that term is used herein and as is understood in the art, is an entity that, when administered to an organism, is metabolized in the body to deliver an active (e.g., therapeutic or diagnostic) agent of interest. Typically, such metabolism involves removal of at least one “prodrug moiety” so that the active agent is formed. Various forms of “prodrugs” are known in the art. For examples of such prodrug moieties, see:

  • a) Design of Prodrugs, edited by H. Bundgaard, (Elsevier, 1985) and Methods in Enzymology, 42:309-396, edited by K. Widder, et al. (Academic Press, 1985);
  • b) Prodrugs and Targeted Delivery, edited by J. Rautio (Wiley, 2011);
  • c) Prodrugs and Targeted Delivery, edited by J. Rautio (Wiley, 2011);
  • d) A Textbook of Drug Design and Development, edited by Krogsgaard-Larsen;
  • e) Bundgaard, Chapter 5 “Design and Application of Prodrugs”, by H. Bundgaard, p. 113-191 (1991);
  • f) Bundgaard, Advanced Drug Delivery Reviews, 8:1-38 (1992);
  • g) Bundgaard, et al., Journal of Pharmaceutical Sciences, 77:285 (1988); and
  • h) Kakeya, et al., Chem. Pharm. Bull., 32:692 (1984).

As with other compounds described herein, prodrugs may be provided in any of a variety of forms, e.g., crystal forms, salt forms etc. In some embodiments, prodrugs are provided as pharmaceutically acceptable salts thereof.

Protecting group: The term “protecting group,” as used herein, is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3rd edition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference. Also included are those protecting groups specially adapted for nucleoside and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06/2012, the entirety of Chapter 2 is incorporated herein by reference. Suitable amino-protecting groups include methyl carbamate, ethyl carbamante, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluoroenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2′- and 4′-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithio carbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitrobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methyl sulfonylethyl carbamate, 2-(p-toluenesulfonyl)ethyl carbamate, [2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acyloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivative, N′-p-toluenesulfonylaminocarbonyl derivative, N′-phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzyl thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decyloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate, 1,1-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p′-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-methyl-1-(p-phenylazophenyl)ethyl carbamate, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N′-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyroolin-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N′-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, N-p-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N—(N′,N′-dimethylaminomethylene)amine, N,N′-isopropylidenediamine, N-p-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivative, N-diphenylborinic acid derivative, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethyl silylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4′,8′-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

Suitably protected carboxylic acids further include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.

Suitable hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethyl silylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxido, diphenylmethyl, p,p′-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4′-bromophenacyloxyphenyl)diphenylmethyl, 4,4′,4″-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4′,4″-tris(levulinoyloxyphenyl)methyl, 4,4′,4″-tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4′,4″-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1′-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxido, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkyl methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec), 2-(triphenylphosphonio) ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-napththyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, alkyl N,N,N′,N′-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). For protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene ortho ester, 1-methoxyethylidene ortho ester, 1-ethoxyethylidine ortho ester, 1,2-dimethoxyethylidene ortho ester, α-methoxybenzylidene ortho ester, 1-(N,N-dimethylamino)ethylidene derivative, α-(N,N′-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene ortho ester, di-t-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanylidene) derivative (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl boronate, and phenyl boronate.

In some embodiments, a hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethyl silylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4′-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4′-dimethoxytrityl, (DMTr) and 4,4′,4″-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenyl sulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4′,4″-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl) or 9-(p-methoxyphenyl)xanthine-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is, independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and 4,4′-dimethoxytrityl. In some embodiments, the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl and 4,4′-dimethoxytrityl group.

In some embodiments, a phosphorus protecting group is a group attached to the internucleotide phosphorus linkage throughout oligonucleotide synthesis. In some embodiments, the phosphorus protecting group is attached to the sulfur atom of the internucleotide phosphorothioate linkage. In some embodiments, the phosphorus protecting group is attached to the oxygen atom of the internucleotide phosphorothioate linkage. In some embodiments, the phosphorus protecting group is attached to the oxygen atom of the internucleotide phosphate linkage. In some embodiments the phosphorus protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

Protein: As used herein, the term “protein” refers to a polypeptide (i.e., a string of at least two amino acids linked to one another by peptide bonds). In some embodiments, proteins include only naturally-occurring amino acids. In some embodiments, proteins include one or more non-naturally-occurring amino acids (e.g., moieties that form one or more peptide bonds with adjacent amino acids). In some embodiments, one or more residues in a protein chain contain a non-amino-acid moiety (e.g., a glycan, etc). In some embodiments, a protein includes more than one polypeptide chain, for example linked by one or more disulfide bonds or associated by other means. In some embodiments, proteins contain L-amino acids, D-amino acids, or both; in some embodiments, proteins contain one or more amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. The term “peptide” is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, proteins are antibodies, antibody fragments, biologically active portions thereof, and/or characteristic portions thereof.

Sample: A “sample” as used herein is a specific organism or material obtained therefrom. In some embodiments, a sample is a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, a source of interest comprises an organism, such as an animal or human. In some embodiments, a biological sample comprises biological tissue or fluid. In some embodiments, a biological sample is or comprises any one or more of: bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; washings or lavages such as a ductal lavages or broncheoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids, secretions, and/or excretions; and/or cells therefrom, etc. In some embodiments, a biological sample is or comprises cells obtained from an individual. In some embodiments, a sample is a “primary sample” obtained directly from a source of interest by any appropriate means. For example, in some embodiments, a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces etc.), etc. In some embodiments, as will be clear from context, the term “sample” refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane. Such a “processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc. In some embodiments, a sample is an organism. In some embodiments, a sample is a plant. In some embodiments, a sample is an animal. In some embodiments, a sample is a human. In some embodiments, a sample is an organism other than a human.

Stereochemically isomeric forms: The phrase “stereochemically isomeric forms,” as used herein, refers to different compounds made up of the same atoms bonded by the same sequence of bonds but having different three-dimensional structures which are not interchangeable. In some embodiments of the disclosure, provided chemical compositions may be or include pure preparations of individual stereochemically isomeric forms of a compound; in some embodiments, provided chemical compositions may be or include mixtures of two or more stereochemically isomeric forms of the compound. In certain embodiments, such mixtures contain equal amounts of different stereochemically isomeric forms; in certain embodiments, such mixtures contain different amounts of at least two different stereochemically isomeric forms. In some embodiments, a chemical composition may contain all diastereomers and/or enantiomers of the compound. In some embodiments, a chemical composition may contain less than all diastereomers and/or enantiomers of a compound. In some embodiments, if a particular enantiomer of a compound of the present disclosure is desired, it may be prepared, for example, by asymmetric synthesis, or by derivation with a chiral auxiliary, where the resulting diastereomeric mixture is separated and the auxiliary group cleaved to provide the pure desired enantiomers. Alternatively, where the molecule contains a basic functional group, such as amino, diastereomeric salts are formed with an appropriate optically-active acid, and resolved, for example, by fractional crystallization.

Subject: As used herein, the term “subject” or “test subject” refers to any organism to which a provided compound or composition is administered in accordance with the present disclosure e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject may be suffering from, and/or susceptible to a disease, disorder, and/or condition.

Substantially: As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and/or chemical phenomena.

Suffering from: An individual who is “suffering from” a disease, disorder, and/or condition has been diagnosed with and/or displays one or more symptoms of a disease, disorder, and/or condition.

Susceptible to: An individual who is “susceptible to” a disease, disorder, and/or condition is one who has a higher risk of developing the disease, disorder, and/or condition than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder and/or condition may not have been diagnosed with the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition may exhibit symptoms of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition may not exhibit symptoms of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.

Systemic: The phrases “systemic administration,” “administered systemically,” “peripheral administration,” and “administered peripherally” as used herein have their art-understood meaning referring to administration of a compound or composition such that it enters the recipient's system.

Tautomeric forms: The phrase “tautomeric forms,” as used herein, is used to describe different isomeric forms of organic compounds that are capable of facile interconversion. Tautomers may be characterized by the formal migration of a hydrogen atom or proton, accompanied by a switch of a single bond and adjacent double bond. In some embodiments, tautomers may result from prototropic tautomerism (i.e., the relocation of a proton). In some embodiments, tautomers may result from valence tautomerism (i.e., the rapid reorganization of bonding electrons). All such tautomeric forms are intended to be included within the scope of the present disclosure. In some embodiments, tautomeric forms of a compound exist in mobile equilibrium with each other, so that attempts to prepare the separate substances results in the formation of a mixture. In some embodiments, tautomeric forms of a compound are separable and isolatable compounds. In some embodiments of the disclosure, chemical compositions may be provided that are or include pure preparations of a single tautomeric form of a compound. In some embodiments of the disclosure, chemical compositions may be provided as mixtures of two or more tautomeric forms of a compound. In certain embodiments, such mixtures contain equal amounts of different tautomeric forms; in certain embodiments, such mixtures contain different amounts of at least two different tautomeric forms of a compound. In some embodiments of the disclosure, chemical compositions may contain all tautomeric forms of a compound. In some embodiments of the disclosure, chemical compositions may contain less than all tautomeric forms of a compound. In some embodiments of the disclosure, chemical compositions may contain one or more tautomeric forms of a compound in amounts that vary over time as a result of interconversion. In some embodiments of the disclosure, the tautomerism is keto-enol tautomerism. One of skill in the chemical arts would recognize that a keto-enol tautomer can be “trapped” (i.e., chemically modified such that it remains in the “enol” form) using any suitable reagent known in the chemical arts in to provide an enol derivative that may subsequently be isolated using one or more suitable techniques known in the art. Unless otherwise indicated, the present disclosure encompasses all tautomeric forms of relevant compounds, whether in pure form or in admixture with one another.

Therapeutic agent: As used herein, the phrase “therapeutic agent” refers to any agent that, when administered to a subject, has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect. In some embodiments, a therapeutic agent is any substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition.

Therapeutically effective amount: As used herein, the term “therapeutically effective amount” means an amount of a substance (e.g., a therapeutic agent, composition, and/or formulation) that elicits a desired biological response when administered as part of a therapeutic regimen. In some embodiments, a therapeutically effective amount of a substance is an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, diagnose, prevent, and/or delay the onset of the disease, disorder, and/or condition. As will be appreciated by those of ordinary skill in this art, the effective amount of a substance may vary depending on such factors as the desired biological endpoint, the substance to be delivered, the target cell or tissue, etc. For example, the effective amount of compound in a formulation to treat a disease, disorder, and/or condition is the amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of and/or reduces incidence of one or more symptoms or features of the disease, disorder, and/or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

Treat: As used herein, the term “treat,” “treatment,” or “treating” refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition. In some embodiments, treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and/or condition, for example for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.

Unsaturated: The term “unsaturated,” as used herein, means that a moiety has one or more units of unsaturation.

Unit dose: The expression “unit dose” as used herein refers to an amount administered as a single dose and/or in a physically discrete unit of a pharmaceutical composition. In many embodiments, a unit dose contains a predetermined quantity of an active agent. In some embodiments, a unit dose contains an entire single dose of the agent. In some embodiments, more than one unit dose is administered to achieve a total single dose. In some embodiments, administration of multiple unit doses is required, or expected to be required, in order to achieve an intended effect. A unit dose may be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined quantity of one or more therapeutic agents, a predetermined amount of one or more therapeutic agents in solid form, a sustained release formulation or drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It will be appreciated that a unit dose may be present in a formulation that includes any of a variety of components in addition to the therapeutic agent(s). For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, etc., may be included as described infra. It will be appreciated by those skilled in the art, in many embodiments, a total appropriate daily dosage of a particular therapeutic agent may comprise a portion, or a plurality, of unit doses, and may be decided, for example, by the attending physician within the scope of sound medical judgment. In some embodiments, the specific effective dose level for any particular subject or organism may depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of specific active compound employed; specific composition employed; age, body weight, general health, sex and diet of the subject; time of administration, and rate of excretion of the specific active compound employed; duration of the treatment; drugs and/or additional therapies used in combination or coincidental with specific compound(s) employed, and like factors well known in the medical arts.

Wild-type: As used herein, the term “wild-type” has its art-understood meaning that refers to an entity having a structure and/or activity as found in nature in a “normal” (as contrasted with mutant, diseased, altered, etc) state or context. Those of ordinary skill in the art will appreciate that wild type genes and polypeptides often exist in multiple different forms (e.g., alleles).

Nucleic acid: The term “nucleic acid” includes any nucleotides, modified variants thereof, analogs thereof, and polymers thereof. The term “polynucleotide” as used herein refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) or modified variants or analogs thereof. These terms refer to the primary structure of the molecules and, thus, include double- and single-stranded DNA, and double- and single-stranded RNA. These terms include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs and modified polynucleotides such as, though not limited to, methylated, protected and/or capped nucleotides or polynucleotides. The terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and/or modified nucleobases; nucleic acids derived from sugars and/or modified sugars; and nucleic acids derived from phosphate bridges and/or modified phosphorus-atom bridges (also referred to herein as “internucleotide linkages”). The term encompasses nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified phosphorus atom bridges. Examples include, and are not limited to, nucleic acids containing ribose moieties, the nucleic acids containing deoxy-ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. The prefix poly-refers to a nucleic acid containing 2 to about 10,000 nucleotide monomer units and wherein the prefix oligo-refers to a nucleic acid containing 2 to about 200 nucleotide monomer units.

Nucleotide: The term “nucleotide” as used herein refers to a monomeric unit of a polynucleotide that consists of a heterocyclic base, a sugar, and one or more phosphate groups or phosphorus-containing internucleotidic linkages. The naturally occurring bases, (guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U)) are derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogs are also included. The naturally occurring sugar is the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), though it should be understood that naturally and non-naturally occurring sugar analogs are also included. Nucleotides are linked via internucleotidic linkages to form nucleic acids, or polynucleotides. Many internucleotidic linkages are known in the art (such as, though not limited to, phosphate, phosphorothioates, boranophosphates and the like). Artificial nucleic acids include PNAs (peptide nucleic acids), phosphotriesters, phosphorothionates, H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates and other variants of the phosphate backbone of native nucleic acids, such as those described herein. Other analogs (e.g., artificial nucleic acids or components which can be incorporated into a nucleic acid or artificial nucleic acid) include: boranophosphate RNA, FANA, locked nucleic acids (LNA), Morpholinos, peptidic nucleic acids (PNA), threose nucleic acid (TNA), and glycol nucleic acid (GNA). These skilled in the art are aware of a variety of modified nucleotides or nucleotide analogs, including, for example, those described in any of: Gryaznov, S; Chen, J.-K. J. Am. Chem. Soc. 1994, 116, 3143; Hendrix et al. 1997 Chem. Eur. J. 3: 110; Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Jepsen et al. 2004 Oligo. 14: 130-146; Jones et al. J. Org. Chem. 1993, 58, 2983; Koizumi et al. 2003 Nuc. Acids Res. 12: 3267-3273; Koshkin et al. 1998 Tetrahedron 54: 3607-3630; Kumar et al. 1998 Bioo. Med. Chem. Let. 8: 2219-2222; Lauritsen et al. 2002 Chem. Comm. 5: 530-531; Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; Mesmaeker et al. Angew. Chem., Int. Ed. Engl. 1994, 33, 226; Morita et al. 2001 Nucl. Acids Res. Supp. 1: 241-242; Morita et al. 2002 Bioo. Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem. Lett. 2211-2226; Nielsen et al. 1997 Chem. Soc. Rev. 73; Nielsen et al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Obika et al. 1997 Tetrahedron Lett. 38 (50): 8735-8; Obika et al. 1998 Tetrahedron Lett. 39: 5401-5404; Pallan et al. 2012 Chem. Comm. 48: 8195-8197; Petersen et al. 2003 TRENDS Biotech. 21: 74-81; Rajwanshi et al. 1999 Chem. Commun. 1395-1396; Schultz et al. 1996 Nucleic Acids Res. 24: 2966; Seth et al. 2009 J. Med. Chem. 52: 10-13; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al. 2010 J. Org. Chem. 75: 1569-1581; Seth et al. 2012 Bioo. Med. Chem. Lett. 22: 296-299; Seth et al. 2012 Mol. Ther-Nuc. Acids. 1, e47; Seth, Punit P; Siwkowski, Andrew; Allerson, Charles R; Vasquez, Guillermo; Lee, Sam; Prakash, Thazha P; Kinberger, Garth; Migawa, Michael T; Gaus, Hans; Bhat, Balkrishen; et al. From Nucleic Acids Symposium Series (2008), 52(1), 553-554; Singh et al. 1998 Chem. Comm. 1247-1248; Singh et al. 1998 J. Org. Chem. 63: 10035-39; Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Sorensen 2003 Chem. Comm. 2130-2131; Ts'o et al. Ann. N. Y. Acad. Sci. 1988, 507, 220; Van Aerschot et al. 1995 Angew. Chem. Int. Ed. Engl. 34: 1338; Vasseur et al. J. Am. Chem. Soc. 1992, 114, 4006; WO 20070900071; WO 20070900071; or WO 2016/079181.

Nucleoside: The term “nucleoside” refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or modified sugar.

Sugar: The term “sugar” refers to a monosaccharide in closed and/or open form. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term also encompasses structural analogs used in lieu of conventional sugar molecules, such as glycol, polymer of which forms the backbone of the nucleic acid analog, glycol nucleic acid (“GNA”).

Modified sugar: The term “modified sugar” refers to a moiety that can replace a sugar. The modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical property of a sugar.

Nucleobase: The term “nucleobase” refers to the parts of nucleic acids that are involved in the hydrogen-bonding that binds one nucleic acid strand to another complementary strand in a sequence specific manner. The most common naturally-occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally-occurring nucleobases are modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally-occurring nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a nucleobase is a “modified nucleobase,” e.g., a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of the nucleobase and retains the property of hydrogen-bonding that binds one nucleic acid strand to another in a sequence specific manner. In some embodiments, a modified nucleobase can pair with all of the five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes or activity of the oligonucleotide duplex.

Chiral ligand: The term “chiral ligand” or “chiral auxiliary” refers to a moiety that is chiral and can be incorporated into a reaction so that the reaction can be carried out with certain stereoselectivity.

Condensing reagent: In a condensation reaction, the term “condensing reagent” refers to a reagent that activates a less reactive site and renders it more susceptible to attack by another reagent. In some embodiments, such another reagent is a nucleophile.

Blocking group: The term “blocking group” refers to a group that masks the reactivity of a functional group. The functional group can be subsequently unmasked by removal of the blocking group. In some embodiments, a blocking group is a protecting group.

Moiety: The term “moiety” refers to a specific segment or functional group of a molecule. Chemical moieties are often recognized chemical entities embedded in or appended to a molecule.

Solid support: The term “solid support” refers to any support which enables synthesis of nucleic acids. In some embodiments, the term refers to a glass or a polymer, that is insoluble in the media employed in the reaction steps performed to synthesize nucleic acids, and is derivatized to comprise reactive groups. In some embodiments, the solid support is Highly Cross-linked Polystyrene (HCP) or Controlled Pore Glass (CPG). In some embodiments, the solid support is Controlled Pore Glass (CPG). In some embodiments, the solid support is hybrid support of Controlled Pore Glass (CPG) and Highly Cross-linked Polystyrene (HCP).

Linking moiety: The term “linking moiety” refers to any moiety optionally positioned between the terminal nucleoside and the solid support or between the terminal nucleoside and another nucleoside, nucleotide, or nucleic acid.

DNA molecule: A “DNA molecule” refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form or a double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences can be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).

Coding sequence: A DNA “coding sequence” or “coding region” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate expression control sequences. The boundaries of the coding sequence (the “open reading frame” or “ORF”) are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. A polyadenylation signal and transcription termination sequence is, usually, be located 3′ to the coding sequence. The term “non-coding sequence” or “non-coding region” refers to regions of a polynucleotide sequence that are not translated into amino acids (e.g. 5′ and 3′ un-translated regions).

Reading frame: The term “reading frame” refers to one of the six possible reading frames, three in each direction, of the double stranded DNA molecule. The reading frame that is used determines which codons are used to encode amino acids within the coding sequence of a DNA molecule.

Antisense: As used herein, an “antisense” nucleic acid molecule comprises a nucleotide sequence which is complementary to a “sense” nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule, complementary to an mRNA sequence or complementary to the coding strand of a gene. Accordingly, an antisense nucleic acid molecule can associate via hydrogen bonds to a sense nucleic acid molecule. In some embodiments, an antisense oligonucleotide is an oligonucleotide which participates in RNaseH-mediated cleavage; for example, an antisense oligonucleotide hybridizes in a sequence-specific manner to a portion of a target mRNA, thus targeting the mRNA for cleavage by RNaseH. In some embodiments, an antisense oligonucleotide is able to differentiate between a wild-type and a mutant allele of a target. In some embodiments, an antisense oligonucleotide significantly participates in RNaseH-mediated cleavage of a mutant allele but participates in RNaseH-mediated cleavage of a wild-type allele to a much less degree (e.g., does not significantly participate in RNaseH-mediated cleavage of the wild-type allele of the target).

Wobble position: As used herein, a “wobble position” refers to the third position of a codon. Mutations in a DNA molecule within the wobble position of a codon, in some embodiments, result in silent or conservative mutations at the amino acid level. For example, there are four codons that encode Glycine, i.e., GGU, GGC, GGA and GGG, thus mutation of any wobble position nucleotide, to any other nucleotide selected from A, U, C and G, does not result in a change at the amino acid level of the encoded protein and, therefore, is a silent substitution.

Silent substitution: a “silent substitution” or “silent mutation” is one in which a nucleotide within a codon is modified, but does not result in a change in the amino acid residue encoded by the codon. Examples include mutations in the third position of a codon, as well in the first position of certain codons such as in the codon “CGG” which, when mutated to AGG, still encodes Arg.

Gene: The terms “gene,” “recombinant gene” and “gene construct” as used herein, refer to a DNA molecule, or portion of a DNA molecule, that encodes a protein or a portion thereof. The DNA molecule can contain an open reading frame encoding the protein (as exon sequences) and can further include intron sequences. The term “intron” as used herein, refers to a DNA sequence present in a given gene which is not translated into protein and is found in some, but not all cases, between exons. It can be desirable for the gene to be operably linked to, (or it can comprise), one or more promoters, enhancers, repressors and/or other regulatory sequences to modulate the activity or expression of the gene, as is well known in the art.

Complementary DNA: As used herein, a “complementary DNA” or “cDNA” includes recombinant polynucleotides synthesized by reverse transcription of mRNA and from which intervening sequences (introns) have been removed.

Homology: “Homology” or “identity” or “similarity” refers to sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing a position in each sequence which can be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base, then the molecules are identical at that position; when the equivalent site occupied by the same or a similar nucleic acid residue (e.g., similar in steric and/or electronic nature), then the molecules can be referred to as homologous (similar) at that position. Expression as a percentage of homology/similarity or identity refers to a function of the number of identical or similar nucleic acids at positions shared by the compared sequences. A sequence which is “unrelated” or “non-homologous” shares less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with a sequence described herein. In comparing two sequences, the absence of residues (amino acids or nucleic acids) or presence of extra residues also decreases the identity and homology/similarity.

In some embodiments, the term “homology” describes a mathematically based comparison of sequence similarities which is used to identify genes with similar functions or motifs. The nucleic acid sequences described herein can be used as a “query sequence” to perform a search against public databases, for example, to identify other family members, related sequences or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In some embodiments, BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleic acid molecules of the disclosure. In some embodiments, to obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and BLAST) can be used (See www.ncbi.nlm.nih.gov).

Identity: As used herein, “identity” means the percentage of identical nucleotide residues at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Methods to determine identity are designed to give the largest match between the sequences tested. Moreover, methods to determine identity are codified in publicly available computer programs. Computer program methods to determine identity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids Res. 25: 3389-3402 (1997)). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990). The well-known Smith Waterman algorithm can also be used to determine identity.

Heterologous: A “heterologous” region of a DNA sequence is an identifiable segment of DNA within a larger DNA sequence that is not found in association with the larger sequence in nature. Thus, when the heterologous region encodes a mammalian gene, the gene can usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a sequence where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns or synthetic sequences having codons or motifs different than the unmodified gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

Transition mutation: The term “transition mutations” refers to base changes in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T) is replaced by another pyrimidine, or a purine (adenosine (A) or guanosine (G) is replaced by another purine.

Transversion mutation: The term “transversion mutations” refers to base changes in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T) is replaced by a purine (adenosine (A) or guanosine (G), or a purine is replaced by a pyrimidine.

Oligonucleotide: the term “oligonucleotide” refers to a polymer or oligomer of nucleotide monomers, containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges (also referred to herein as “internucleotidic linkage”, defined further herein).

Oligonucleotides can be single-stranded or double-stranded. As used herein, the term “oligonucleotide strand” encompasses a single-stranded oligonucleotide. A single-stranded oligonucleotide can have double-stranded regions and a double-stranded oligonucleotide can have single-stranded regions. Example oligonucleotides include, but are not limited to structural genes, genes including control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNAs and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, Ul adaptors, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immuno-stimulatory oligonucleotides, and decoy oligonucleotides.

Double-stranded and single-stranded oligonucleotides that are effective in inducing RNA interference are also referred to as siRNA, RNAi agent, or iRNA agent, herein. In some embodiments, these RNA interference inducing oligonucleotides associate with a cytoplasmic multi-protein complex known as RNAi-induced silencing complex (RISC). In many embodiments, single-stranded and double-stranded RNAi agents are sufficiently long that they can be cleaved by an endogenous molecule, e.g., by Dicer, to produce smaller oligonucleotides that can enter the RISC machinery and participate in RISC mediated cleavage of a target sequence, e.g. a target mRNA.

Oligonucleotides of the present disclosure can be of various lengths. In particular embodiments, oligonucleotides can range from about 2 to about 200 nucleotides in length. In various related embodiments, oligonucleotides, single-stranded, double-stranded, and triple-stranded, can range in length from about 4 to about 10 nucleotides, from about 10 to about 50 nucleotides, from about 20 to about 50 nucleotides, from about 15 to about 30 nucleotides, from about 20 to about 30 nucleotides in length. In some embodiments, the oligonucleotide is from about 9 to about 39 nucleotides in length. In some embodiments, the oligonucleotide is at least 4 nucleotides in length. In some embodiments, the oligonucleotide is at least 5 nucleotides in length. In some embodiments, the oligonucleotide is at least 6 nucleotides in length. In some embodiments, the oligonucleotide is at least 7 nucleotides in length. In some embodiments, the oligonucleotide is at least 8 nucleotides in length. In some embodiments, the oligonucleotide is at least 9 nucleotides in length. In some embodiments, the oligonucleotide is at least 10 nucleotides in length. In some embodiments, the oligonucleotide is at least 11 nucleotides in length. In some embodiments, the oligonucleotide is at least 12 nucleotides in length. In some embodiments, the oligonucleotide is at least 15 nucleotides in length. In some embodiments, the oligonucleotide is at least 20 nucleotides in length. In some embodiments, the oligonucleotide is at least 25 nucleotides in length. In some embodiments, the oligonucleotide is at least 30 nucleotides in length. In some embodiments, the oligonucleotide is a duplex of complementary strands of at least 18 nucleotides in length. In some embodiments, the oligonucleotide is a duplex of complementary strands of at least 21 nucleotides in length.

Internucleotidic linkage. As used herein, the phrase “internucleotidic linkage” refers generally to the phosphorus-containing linkage between nucleotide units of an oligonucleotide, and is interchangeable with “inter-sugar linkage” and “phosphorus atom bridge,” as used above and herein. In some embodiments, an internucleotidic linkage is a phosphodiester linkage, as found in naturally occurring DNA and RNA molecules. In some embodiments, an internucleotidic linkage is a “modified internucleotidic linkage” wherein each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, such an organic or inorganic moiety is selected from but not limited to ═S, ═Se, ═NR′, —SR′, —SeR′, —N(R′)2, B(R′)3, —S—, —Se—, and —N(R′)—, wherein each R′ is independently as defined and described below. In some embodiments, an internucleotidic linkage is a phosphotriester linkage, phosphorothioate diester linkage

or modified phosphorothioate triester linkage. It is understood by a person of ordinary skill in the art that the internucleotidic linkage may exist as an anion or cation at a given pH due to the existence of acid or base moieties in the linkage.

Unless otherwise specified, when used with an oligonucleotide sequence, each of s, s1, s2, s3, s4, s5, s6 and s7 independently represents the following modified internucleotidic linkage as illustrated in Table 1, below.

TABLE 1 Example Modified Internucleotidic Linkage. Symbol Modified Internucleotidic Linkage s s1 s2 s3 s4 s5 s6 s7 s8 s9 s10 s11 s12 s13 s14 s15 s16 s17 s18

For instance, (Rp, Sp)-ATsCs1GA has 1) a phosphorothioate internucleotidic linkage

between T and C; and 2) a phosphorothioate triester internucleotidic linkage having the structure of

between C and G. Unless otherwise specified, the Rp/Sp designations preceding an oligonucleotide sequence describe the configurations of chiral linkage phosphorus atoms in the internucleotidic linkages sequentially from 5′ to 3′ of the oligonucleotide sequence. For instance, in (Rp, Sp)-ATsCs1GA, the phosphorus in the “s” linkage between T and C has Rp configuration and the phosphorus in “s1” linkage between C and G has Sp configuration. In some embodiments, “All-(Rp)” or “All-(Sp)” is used to indicate that all chiral linkage phosphorus atoms in oligonucleotide have the same Rp or Sp configuration, respectively. For instance, All-(Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 2) indicates that all the chiral linkage phosphorus atoms in the oligonucleotide have Rp configuration; All-(Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 3) indicates that all the chiral linkage phosphorus atoms in the oligonucleotide have Sp configuration.

Oligonucleotide type: As used herein, the phrase “oligonucleotide type” is used to define an oligonucleotide that has a particular base sequence, pattern of backbone linkages (i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, etc), pattern of backbone chiral centers (i.e. pattern of linkage phosphorus stereochemistry (Rp/Sp)), and pattern of backbone phosphorus modifications (e.g., pattern of “—XLR1” groups in formula I). Oligonucleotides of a common designated “type” are structurally identical to one another.

One of skill in the art will appreciate that synthetic methods of the present disclosure provide for a degree of control during the synthesis of an oligonucleotide strand such that each nucleotide unit of the oligonucleotide strand can be designed and/or selected in advance to have a particular stereochemistry at the linkage phosphorus and/or a particular modification at the linkage phosphorus, and/or a particular base, and/or a particular sugar. In some embodiments, an oligonucleotide strand is designed and/or selected in advance to have a particular combination of stereocenters at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and/or determined to have a particular combination of modifications at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and/or selected to have a particular combination of bases. In some embodiments, an oligonucleotide strand is designed and/or selected to have a particular combination of one or more of the above structural characteristics. The present disclosure provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., chirally controlled oligonucleotide compositions). In some embodiments, all such molecules are of the same type (i.e., are structurally identical to one another). In many embodiments, however, provided compositions comprise a plurality of oligonucleotides of different types, typically in pre-determined relative amounts.

Chiral control: As used herein, “chiral control” refers to an ability to control the stereochemical designation of every chiral linkage phosphorus within an oligonucleotide strand. The phrase “chirally controlled oligonucleotide” refers to an oligonucleotide which exists in a single diastereomeric form with respect to the chiral linkage phosphorus. Chirally controlled oligonucleotides are prepared from chirally controlled oligonucleotide synthesis.

Chirally controlled oligonucleotide composition: As used herein, the phrase “chirally controlled oligonucleotide composition” refers to an oligonucleotide composition that contains predetermined levels of individual oligonucleotide types. For instance, in some embodiments a chirally controlled oligonucleotide composition comprises one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises a mixture of multiple oligonucleotide types. Example chirally controlled oligonucleotide compositions are described further herein.

Chirally pure: as used herein, the phrase “chirally pure” is used to describe a chirally controlled oligonucleotide composition in which all of the oligonucleotides exist in a single diastereomeric form with respect to the linkage phosphorus.

Chirally uniform: as used herein, the phrase “chirally uniform” is used to describe an oligonucleotide molecule or type in which all nucleotide units have the same stereochemistry at the linkage phosphorus. For instance, an oligonucleotide whose nucleotide units all have Rp stereochemistry at the linkage phosphorus is chirally uniform. Likewise, an oligonucleotide whose nucleotide units all have Sp stereochemistry at the linkage phosphorus is chirally uniform.

Predetermined: By predetermined is meant deliberately selected, for example as opposed to randomly occurring or achieved. Those of ordinary skill in the art, reading the present specification, will appreciate that the present disclosure provides new and surprising technologies that permit selection of particular oligonucleotide types for preparation and/or inclusion in provided compositions, and further permits controlled preparation of precisely the selected particular types, optionally in selected particular relative amounts, so that provided compositions are prepared. Such provided compositions are “predetermined” as described herein. Compositions that may contain certain individual oligonucleotide types because they happen to have been generated through a process that cannot be controlled to intentionally generate the particular oligonucleotide types is not a “predetermined” composition. In some embodiments, a predetermined composition is one that can be intentionally reproduced (e.g., through repetition of a controlled process).

Linkage phosphorus: as defined herein, the phrase “linkage phosphorus” is used to indicate that the particular phosphorus atom being referred to is the phosphorus atom present in the internucleotidic linkage, which phosphorus atom corresponds to the phosphorus atom of a phosphodiester of an internucleotidic linkage as occurs in naturally occurring DNA and RNA. In some embodiments, a linkage phosphorus atom is in a modified internucleotidic linkage, wherein each oxygen atom of a phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, a linkage phosphorus atom is P* of formula I. In some embodiments, a linkage phosphorus atom is chiral. In some embodiments, a chiral linkage phosphorus atom is P* of formula I.

P-modification: as used herein, the term “P-modification” refers to any modification at the linkage phosphorus other than a stereochemical modification. In some embodiments, a P-modification comprises addition, substitution, or removal of a pendant moiety covalently attached to a linkage phosphorus. In some embodiments, the “P-modification” is —X-L-R1 wherein each of X, L and R1 is independently as defined and described herein and below.

Blockmer: the term “blockmer,” as used herein, refers to an oligonucleotide strand whose pattern of structural features characterizing each individual nucleotide unit is characterized by the presence of at least two consecutive nucleotide units sharing a common structural feature at the internucleotidic phosphorus linkage. By common structural feature is meant common stereochemistry at the linkage phosphorus or a common modification at the linkage phosphorus. In some embodiments, the at least two consecutive nucleotide units sharing a common structure feature at the internucleotidic phosphours linkage are referred to as a “block”.

In some embodiments, a blockmer is a “stereoblockmer,” e.g., at least two consecutive nucleotide units have the same stereochemistry at the linkage phosphorus. Such at least two consecutive nucleotide units form a “stereoblock.” For instance, (Sp, Sp)-ATsCs1GA is a stereoblockmer because at least two consecutive nucleotide units, the Ts and the Cs1, have the same stereochemistry at the linkage phosphorus (both Sp). In the same oligonucleotide (Sp, Sp)-ATsCs1GA, TsCs1 forms a block, and it is a stereoblock.

In some embodiments, a blockmer is a “P-modification blockmer,” e.g., at least two consecutive nucleotide units have the same modification at the linkage phosphorus. Such at least two consecutive nucleotide units form a “P-modification block”. For instance, (Rp, Sp)-ATsCsGA is a P-modification blockmer because at least two consecutive nucleotide units, the Ts and the Cs, have the same P-modification (i.e., both are a phosphorothioate diester). In the same oligonucleotide of (Rp, Sp)-ATsCsGA, TsCs forms a block, and it is a P-modification block.

In some embodiments, a blockmer is a “linkage blockmer,” e.g., at least two consecutive nucleotide units have identical stereochemistry and identical modifications at the linkage phosphorus. At least two consecutive nucleotide units form a “linkage block”. For instance, (Rp, Rp)-ATsCsGA is a linkage blockmer because at least two consecutive nucleotide units, the Ts and the Cs, have the same stereochemistry (both Rp) and P-modification (both phosphorothioate). In the same oligonucleotide of (Rp, Rp)-ATsCsGA, TsCs forms a block, and it is a linkage block.

In some embodiments, a blockmer comprises one or more blocks independently selected from a stereoblock, a P-modification block and a linkage block. In some embodiments, a blockmer is a stereoblockmer with respect to one block, and/or a P-modification blockmer with respect to another block, and/or a linkage blockmer with respect to yet another block. For instance, (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp)-AAsTsCsGsAs1Ts1Cs1Gs1ATCG (SEQ ID NO: 4) is a stereoblockmer with respect to the stereoblock AsTsCsGsAs1 (all Rp at linkage phosphorus) or Ts1Cs1Gs1 (all Sp at linkage phosphorus), a P-modification blockmer with respect to the P-modification block AsTsCsGs (all s linkage) or As1Ts1Cs1Gs1 (all s1 linkage), or a linkage blockmer with respect to the linkage block AsTsCsGs (all Rp at linkage phosphorus and all s linkage) or Ts1Cs1Gs1 (all Sp at linkage phosphorus and all s1 linkage).

Altmer: the term “altmer,” as used herein, refers to an oligonucleotide strand whose pattern of structural features characterizing each individual nucleotide unit is characterized in that no two consecutive nucleotide units of the oligonucleotide strand share a particular structural feature at the internucleotidic phosphorus linkage. In some embodiments, an altmer is designed such that it comprises a repeating pattern. In some embodiments, an altmer is designed such that it does not comprise a repeating pattern.

In some embodiments, an altmer is a “stereoaltmer,” e.g., no two consecutive nucleotide units have the same stereochemistry at the linkage phosphorus. For instance, (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 5).

In some embodiments, an altmer is a “P-modification altmer” e.g., no two consecutive nucleotide units have the same modification at the linkage phosphorus. For instance, All-(Sp)-CAs1GsT, in which each linkage phosphorus has a different P-modification than the others.

In some embodiments, an altmer is a “linkage altmer,” e.g., no two consecutive nucleotide units have identical stereochemistry or identical modifications at the linkage phosphorus. For instance, (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp)-GsCs1CsTs1CsAs1GsTs1CsTs1GsCs1TsTs2CsGs3CsAs4CsC (SEQ ID NO: 6).

Unimer: the term “unimer,” as used herein, refers to an oligonucleotide strand whose pattern of structural features characterizing each individual nucleotide unit is such that all nucleotide units within the strand share at least one common structural feature at the internucleotidic phosphorus linkage. By common structural feature is meant common stereochemistry at the linkage phosphorus or a common modification at the linkage phosphorus.

In some embodiments, a unimer is a “stereounimer,” e.g., all nucleotide units have the same stereochemistry at the linkage phosphorus. For instance, All-(Sp)-CsAs1GsT, in which all the linkages have Sp phosphorus.

In some embodiments, a unimer is a “P-modification unimer”, e.g., all nucleotide units have the same modification at the linkage phosphorus. For instance, (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 7), in which all the internucleotidic linkages are phosphorothioate diester.

In some embodiments, a unimer is a “linkage unimer,” e.g., all nucleotide units have the same stereochemistry and the same modifications at the linkage phosphorus. For instance, All-(Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 8), in which all the internucleotidic linkages are phosphorothioate diester having Sp linkage phosphorus.

Gapmer: as used herein, the term “gapmer” refers to an oligonucleotide strand characterized in that at least one internucleotidic phosphorus linkage of the oligonucleotide strand is a phosphate diester linkage, for example such as those found in naturally occurring DNA or RNA. In some embodiments, more than one internucleotidic phosphorus linkage of the oligonucleotide strand is a phosphate diester linkage such as those found in naturally occurring DNA or RNA. For instance, All-(Sp)-CAs1GsT, in which the internucleotidic linkage between C and A is a phosphate diester linkage.

Skipmer: as used herein, the term “skipmer” refers to a type of gapmer in which every other internucleotidic phosphorus linkage of the oligonucleotide strand is a phosphate diester linkage, for example such as those found in naturally occurring DNA or RNA, and every other internucleotidic phosphorus linkage of the oligonucleotide strand is a modified internucleotidic linkage. For instance, All-(Sp)-AsTCs1GAs2TCs3G.

For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 67th Ed., 1986-87, inside cover.

The methods and structures described herein relating to compounds and compositions of the disclosure also apply to the pharmaceutically acceptable acid or base addition salts and all stereoisomeric forms of these compounds and compositions.

BRIEF DESCRIPTION OF THE DRAWING

FIG. 1. Reverse phase HPLCs after incubation with rat liver homogenate. Total amounts of oligonucleotides remaining when incubated with rat whole liver homogenate at 37° C. at different days were measured. The in-vitro metabolic stability of ONT-154 was found to be similar to ONT-87, which has 2′-MOE wings, while both have much better stability than 2′-MOE gapmer which is stereorandom (ONT-41, Mipomersen). The amount of full length oligomer remaining was measured by reverse phase HPLC where peak area of the peak of interest was normalized with internal standard.

FIG. 2. Degradation of various chirally pure analogues of Mipomersen (ONT-41) in rat whole liver homogenate. Total amounts of oligonucleotide remaining when incubated with rat whole liver homogenate at 37° C. at different days were measured. The in-vitro metabolic stability of chirally pure diastereomers of human ApoB sequence ONT-41 (Mipomersen) was found to increase with increased Sp internucleotidic linkages. The amount of full length oligomer remaining was measured by reverse phase HPLC where peak area of the peak of interest was normalized with internal standard. Compositions used include: ONT-41, ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88 and ONT-89.

FIG. 3. Degradation of various chirally pure analogues of mouse ApoB sequence (ISIS 147764, ONT-83) in rat whole liver homogenate. Total amounts of oligonucleotide remaining when incubated with rat whole liver homogenate at 37° C. at different days were measured. The in-vitro metabolic stability of chirally pure diastereomers of murine ApoB sequence (ONT-83, 2′-MOE gapmer, stereorandom phosphorothioate) was found to increase with increased Sp internucleotidic linkages. The amount of full length oligomer remaining was measured by reverse phase HPLC where peak area of the peak of interest was normalized with internal standard. Compositions used include: ONT-82 to ONT-86.

FIG. 4. Degradation of Mipomersen analogue ONT-75 in rat whole liver homogenate over a period of 24 hrs. This figure illustrates stability of ONT-75 in rate whole liver homogenate.

FIG. 5. Degradation of Mipomersen analogue ONT-81 in rat whole liver homogenate over a period of 24 hrs. This figure illustrates stability of ONT-81 in rate whole liver homogenate.

FIG. 6. Durations of knockdown for ONT-87, ONT-88, and ONT-89. Stereoisomers can exhibit substantially different durations of knockdown. ONT-87 results in substantially more durable suppression than other stereoisomers. Increased duration of action of ONT-87 in multiple in vivo studies was observed. ONT-88 showed similar efficacy and recovery profile as ONT-41 (Mipomersen) in certain in-vivo studies. Hu ApoB transgenic mice, n=4, were dosed with 10 mpk IP bolus, 2×/week for three weeks. The mice were randomized to study groups, and dosed intraperitoneally (IP) at 10 mg/kg on Days 1, 4, 8, 11, 15, 18, and 22, based on individual mouse body weight measured prior to dosing on each dosing day. Blood was collected on days 0, 17, 24, 31, 38, 45 and 52 by submandibular (cheek) bleed and at sacrifice on Day 52 by cardiac puncture and then processed to serum. ApoB was measured by ELISA. Highlighted: 72% vs. 35% knock-down maintained at 3 weeks postdose.

FIG. 7. HPLC profiles exhibiting the difference in metabolic stability determined in Human Serum for siRNA duplexes having several Rp, Sp or stereorandom phosphorothioate linkages. Compositions used include: ONT-114, ONT-116, ONT-109, ONT-107, ONT-108 and ONT-106.

FIG. 8. Effect of stereochemistry on RNase H activity. Oligonucleotides were hybridized with RNA and then incubated with RNase H at 37° C. in the presence of 1×RNase H buffer. From top to bottom at 120 min: ONT-89, ONT-77, ONT-81, ONT-80, ONT-75, ONT-41, ONT-88, ONT-154, ONT-87, with ONT-77/154 very close to each other.

FIG. 9. Analysis of human RNase H1 cleavage of a 20-mer RNA when hybridized with different preparations of stereoisomers of phosphorothioate oligonucleotides targeting the same region of human ApoB mRNA. Specific sites of cleavage are strongly influenced by the distinct stereochemistries. Arrows represent position of cleavage (cleavage sites). Products were analyzed by UPLC/MS. The length of the arrow signifies the amount of products present in the reaction mixture which was determined from the ratio of UV peak area to theoretical extinction coefficient of that fragment (the larger the arrow, the more the detected cleavage products). (A): Legend for cleavage maps. (B) and (C): cleavage maps of oligonucleotides. In the figures: (τ) indicates that both RNase H1 cleavage fragments (5′-phosphate species as well as 5′-OH 3′-OH species) were identified in reaction mixtures. (┌) indicates that only 5′-phosphate species was detected and (┐) indicates that 5′-OH 3′-OH component was detected in mass spectrometry analysis. Compositions used include: ONT-41, ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, ONT-89 and ONT-154 (SEQ ID NOS 397-401 and 758-761, respectively). Figure also discloses SEQ ID NO: 1559.

FIG. 10. Cleavage maps of different oligonucleotide compositions ((A)-(C)). These three sequences target different regions in FOXO1 mRNA. Each sequence was studied with five different chemistries. Cleavage maps are derived from reaction mixtures obtained after 30 minutes of incubation of respective duplexes with RNase H1C in the presence of 1×PBS buffer at 37° C. Arrows indicate sites of cleavage. The length of the arrow signifies the amount of products present in the reaction mixture which was determined from the ratio of UV peak area to theoretical extinction coefficient of that fragment (the larger the arrow, the more the detectable cleavage products). Only in the cases where 5′-OH 3′-OH was not detected in the reaction mixture, 5′-phosphate species peak was used for quantification. Cleavage rates were determined by measuring amount of full length RNA remaining in the reaction mixtures by reverse phase HPLC. Reactions were quenched at fixed time points by 30 mM Na2EDTA. Compositions used include: ONT-316, ONT-355, ONT-361, ONT-367, ONT-373, ONT-302, ONT-352, ONT-358, ONT-364, ONT-370, ONT-315, ONT-354, ONT-360, ONT-366, and ONT-372 (SEQ ID NOS 670-674, 676-680 and 682-686, respectively). Figure also discloses SEQ ID NO: 1560 in panel A and SEQ ID NO: 1561 in panels B and C.

FIG. 11. Cleavage maps of oligonucleotide compositions having different common base sequences and lengths ((A)-(B)). The maps show a comparison of stereorandom DNA compositions (top panel) with three distinct and stereochemically pure oligonucleotide compositions. Data compare results of chirally controlled oligonucleotide compositions with two stereorandom phosphorothioate oligonucleotide compositions (ONT-366 and ONT-367) targeting different regions in FOXO1 mRNA. Each panel shows a comparison of stereorandom DNA (top panel) with three distinct and stereochemically pure oligonucleotide preparations. Cleavage maps were derived from reaction mixtures obtained after 30 minutes of incubation of respective duplexes with RNase H1C in the presence of 1×PBS buffer at 37° C. Arrows indicate sites of cleavage. The length of the arrow signifies the amount of metabolite present in the reaction mixture which was determined from the ratio of UV peak area to theoretical extinction coefficient of that fragment (the larger the arrow, the more the detectable cleavage products). Only in the cases where 5′-OH 3′-OH was not detected in the reaction mixture, 5′-phosphate species peak was used for quantification. Compositions used include: ONT-366, ONT-389, ONT-390, ONT-391, ONT-367, ONT-392, ONT-393, and ONT-394 (SEQ ID NOS 660-663 and 665-668, respectively). Figure also discloses SEQ ID NO: 1562 in panel A and SEQ ID NO: 1560 in panel B.

FIG. 12. Effect of stereochemistry on RNase H activity. In two independent experiments, antisense oligonucleotides targeting an identical region of FOXO1 mRNA were hybridized with RNA and then incubated with RNase H at 37° C. in the presence of 1×RNase H buffer. Disappearance of full length RNA was measured from its peak area at 254 nm using RP-HPLC. (A): from top to bottom at 60 min: ONT-355, ONT-316, ONT-367, ONT-392, ONT-393 and ONT-394 (ONT-393 and ONT-394 about the same at 60 min; ONT-393 had higher % RNA substrate remaining at 5 min). (B): from top to bottom at 60 min: ONT-315, ONT-354, ONT-366, ONT-391, ONT-389 and ONT-390. Cleavage rates were determined by measuring amount of full length RNA remaining in the reaction mixtures by reverse phase HPLC. Reactions were quenched at fixed time points by 30 mM Na2EDTA.

FIG. 13. Turnover of antisense oligonucleotides. The duplexes were made with each DNA strand concentration equal to 6 μM and RNA being 100 μM. These duplexes were incubated with 0.02 μM RNase H enzyme and disappearance of full length RNA was measured from its peak area at 254 nm using RP-HPLC. Cleavage rates were determined by measuring amount of full length RNA remaining in the reaction mixtures by reverse phase HPLC. Reactions were quenched at fixed time points by 30 mM Na2EDTA. From top to bottom at 40 min: ONT-316, ONT-367 and ONT-392.

FIG. 14. Cleavage map comparing a stereorandom phosphorothioate oligonucleotide with six distinct and stereochemically pure oligonucleotide preparations targeting the same FOXO1 mRNA region. Compositions used include: ONT-367, ONT-392, ONT-393, ONT-394, ONT-400, ONT-401, and ONT-406 (SEQ ID NOS 665-668, 729-730 and 735, respectively). Figure also discloses SEQ ID NO: 1560.

FIG. 15. Effect of stereochemistry on RNase H activity. Antisense oligonucleotides were hybridized with RNA and then incubated with RNase H at 37° C. in the presence of 1×RNase H buffer. Dependence of stereochemistry upon RNase H activity was observed. Also evident in comparing ONT-367 (stereorandom DNA) and ONT-316 (5-10-5 2′-MOE Gapmer) is the strong dependence of compositional chemistry upon RNase H activity. From top to bottom at 40 min: ONT-316, ONT-421, ONT-367, ONT-392, ONT-394, ONT-415, and ONT-422 (ONT-394/415/422 have similar levels at 40 min; at 5 min, ONT-422>ONT-394>ONT-415 in % RNA remaining in DNA/RNA duplex).

FIG. 16. Effect of stereochemistry on RNase H activity. Antisense oligonucleotides targeting an identical region of FOXO1 mRNA were hybridized with RNA and then incubated with RNase H at 37° C. in the presence of 1×RNase H buffer. Dependence of stereochemistry upon RNase H activity was observed. Form top to bottom at 40 min: ONT-396, ONT-409, ONT-414, ONT-408 (ONT-396/409/414/408 have similar levels at 40 min), ONT-404, ONT-410, ONT-402 (ONT-404/410/408 have similar levels at 40 min), ONT-403, ONT-407, ONT-405, ONT-401, ONT-406 and ONT-400 (ONT-401/405/406/400 have similar levels at 40 min).

FIG. 17. Effect of stereochemistry on RNase H activity. Antisense oligonucleotides targeting an identical region of FOXO1 mRNA were hybridized with RNA and then incubated with RNase H at 37° C. in the presence of 1×RNase H buffer. Dependence of stereochemistry upon RNase H activity was observed. ONT-406 was observed to elicit cleavage of duplexed RNA at a rate in slight excess of that of the phosphodiester oligonucleotide ONT-415. From top to bottom at 40 min: ONT-396, ONT-421, ONT-392, ONT-394, ONT-415 ONT-406, and ONT-422 (ONT-394/415/406 have similar levels at 40 min; at 5 min, ONT-394>ONT-415>ONT-406 in % RNA remaining in DNA/RNA duplex).

FIG. 18. Example UV chromatograms of RNA cleavage products obtained when RNA (ONT-388) was duplexed with stereorandom DNA, ONT-367 (top) and stereopure DNA with repeat triplet motif-3′-SSR-5′, ONT-394 (bottom). ). 2.35 min: 7mer; 3.16 min: 8mer and p-6mer; 4.48 min: P-7mer; 5.83 min: P-8mer; 6.88 min: 12mer; 9.32 min: 13mer; 10.13 min: P-11mer; 11.0 min: P-12mer and 14mer; 11.93 min: P-13mer; 13.13 min: P-14mer. ONT-394 (on the bottom) peak assignment: 4.55 min: p-7mer; 4.97 min: 10mer; 9.53 min: 13mer.

FIG. 19. Electrospray Ionization Spectrum of RNA cleavage products. RNA fragments obtained from the duplex ONT-387, RNA/ONT-354, (7-6-7, DNA-2′-OMe-DNA) on the top and ONT-387, RNA/ONT-315, (5-10-5,2′-MOE Gapmer) at the bottom when these duplexes were incubated with RNase H for 30 min in the presence of 1×RNase H buffer.

FIG. 20. UV Chromatogram and TIC of ONT-406 and ONT-388 duplex after 30 minutes of incubation with RNase H.

FIG. 21. An example proposed cleavage. Provided chirally controlled oligonucleotide compositions are capable of cleaving targets as depicted.

FIG. 22. Example allele specific cleavage targeting mutant Huntingtin mRNA. (A) and (B): example oligonucleotides. (C)-(E): cleavage maps. (F)-(H): RNA cleavage. Stereorandom and chirally controlled oligonucleotide compositions were prepared to target single nucleotide polymorphisms for allele selective suppression of mutant Huntingtin. ONT-450 (stereorandom) targeting ONT-453 (muHTT) and ONT-454 (wtHTT) showed marginal differentiation in RNA cleavage and their cleavage maps. Chirally controlled ONT-451 with selective placement of 3′-SSR-5′ motif in RNase H recognition site targeting ONT-453 (muHTT) and ONT-454 (wtHTT) showed large differentiation in RNA cleavage rate. From the cleavage map, it is notable that 3′-SSR-5′ motif is placed to direct the cleavage between positions 8 and 9 which is after the mismatch if read from 5′-end of RNA. ONT-452 with selective placement of 3′-SSR-5′ motif in RNase H recognition site targeting ONT-453 (muHTT) and ONT-454 (wtHTT) showed moderate differentiation in RNA cleavage rate. 3′-SSR-5′ motif was placed to direct the cleavage at positions 7 and 8 which is before the mismatch if read from 5′-end of RNA. Example data illustrate significance of position in placement of 3′-SSR-5′ motif to achieve enhanced discrimination for allele specific cleavage. All cleavage maps are derived from the reaction mixtures obtained after 5 minutes of incubation of respective duplexes with RNase H1C in the presence of 1×PBS buffer at 37° C. Arrows indicate sites of cleavage. The length of the arrow signifies the amount of metabolite present in the reaction mixture which was determined from the ratio of UV peak area to theoretical extinction coefficient of that fragment. Only in the cases where 5′-OH 3′-OH was not detected in the reaction mixture, 5′-phosphate species peak was used for quantification. Compositions used include: ONT-450 to ONT-454 (SEQ ID NOS 380, 267, 268, 799 and 718, respectively). Figure also discloses SEQ ID NOS 1563-1565 in panels C-E, respectively, in order of appearance.

FIG. 23. (A)-(C): example allele specific cleavage targeting FOXO1 mRNA (SEQ ID NOS 669, 731, 715, 731, 699, 729, 715, 729, 699, 735, 716 and 735, respectively, in order of appearance).

FIG. 24. In vitro dose response silencing of ApoB mRNA after treatment with ApoB oligonucleotides. Stereochemically pure diastereomers with and without 2′-MOE wings show similar efficacy as ONT-41 (Mipomersen). Compositions used include: ONT-87, ONT-41, and ONT-154.

FIG. 25. Comparison of RNase H cleavage maps (A) and RNA cleavage rates (B) for stereorandom composition (ONT-367 (SEQ ID NO: 769)) and chirally controlled oligonucleotide compositions (ONT-421 (SEQ ID NO: 772), all Sp and ONT-455 (SEQ ID NO: 767), all Rp) and DNA (ONT-415 (SEQ ID NO: 770)). These sequences target the same region in FOXO1 mRNA. Cleavage maps were derived from the reaction mixtures obtained after 5 minutes of incubation of respective duplexes with RNase H1C in the presence of 1×PBS buffer at 37° C. Arrows indicate sites of cleavage. The length of the arrow signifies the amount of metabolite present in the reaction mixture which was determined from the ratio of UV peak area to theoretical extinction coefficient of that fragment. Only in the cases where 5′-OH 3′-OH was not detected in the reaction mixture, 5′-phosphate species peak was used for quantification. Cleavage rates were determined by measuring amount of full length RNA remaining in the reaction mixtures by reverse phase HPLC. Reactions are quenched at fixed time points by 30 mM Na2EDTA. Figure also discloses SEQ ID NO: 1560.

FIG. 26. Comparison of cleavage maps of sequences containing one Rp with change of position starting from 3′-end of DNA. Compositions used include: ONT-396 to ONT-414 (SEQ ID NOS 725-743, respectively). These sequences target the same region in FOXO1 mRNA. Cleavage maps are derived from the reaction mixtures obtained after 5 minutes of incubation of respective duplexes with RNase H1C in the presence of 1×RNase H buffer at 37° C. Arrows indicate sites of cleavage. The length of the arrow signifies the amount of metabolite present in the reaction mixture which was determined from the ratio of UV peak area to theoretical extinction coefficient of that fragment. Only in the cases where 5′-OH 3′-OH was not detected in the reaction mixture, 5′-phosphate species peak was used for quantification. Figure also discloses SEQ ID NO: 1560 in panels A-D.

FIG. 27. (A) Comparison of RNase H cleavage rates for stereopure oligonucleotides (ONT-406), (ONT-401), (ONT-404) and (ONT-408). All four sequences are stereopure phosphorothioates with one Rp linkage. These sequences target the same region in FOXO1 mRNA. All duplexes were incubation with RNase H1C in the presence of 1×RNase H buffer at 37° C. Reactions were quenched at fixed time points by 30 mM Na2EDTA. Cleavage rates were determined by measuring amount of full length RNA remaining in the reaction mixtures by reverse phase HPLC. ONT-406 and ONT-401 were found to have superior cleavage rates. (B) Correlation between % RNA cleaved in RNase H assay (10 μM oligonucleotide) and % mRNA knockdown in in vitro assay (20 nM oligonucleotide). All sequences target the same region of mRNA in the FOXO1 target. The quantity of RNA remaining is determined by UV peak area for RNA when normalized to DNA in the same reaction mixture. All of the above maps are derived from the reaction mixture obtained after 5 minutes of incubation of respective duplexes with RNase H1C in the presence of 1×PBS buffer at 37° C. All sequences from ONT-396 to ONT-414 have one Rp phosphorothioate and they vary in the position of Rp. ONT-421 (All Sp) phosphorothioate was inactive in-vitro assay. It relates poor cleavage rate of RNA in RNase H assay when ONT-421 is duplexed with complementary RNA.

FIG. 28. Serum stability assay of single Rp walk PS DNA (ONT-396-ONT-414), stereorandom PS DNA(ONT-367), all-Sp PS DNA (ONT-421) and all-Rp PS DNA (ONT-455) in rat serum for 2 days. Note ONT-396 and ONT-455 decomposed at tested time point. Compositions used include: ONT-396 to ONT-414, ONT-367, ONT-421, and ONT-455.

FIG. 29. Example oligonucleotides including hemimers. (A): cleavage maps. (B): RNA cleavage assay. (C): FOXO1 mRNA knockdown. ONT-440 (SEQ ID NO: 765), ONT-441 (SEQ ID NO: 766), and ONT-367 (SEQ ID NO: 769) are used. In some embodiments, introduction of 2′-modifications on 5′-end of the sequences increases stability for binding to target RNA while maintaining RNase H activity. ONT-367 (stereorandom phosphorothioate DNA) and ONT-440 (5-15, 2′-F-DNA) have similar cleavage maps and similar rate of RNA cleavage in RNase H assay (10 LM oligonucleotide). In some embodiments, ONT-440 (5-11, 2′-F-DNA) sequence can have better cell penetration properties. In some embodiments, asymmetric 2′-modifications provide Tm advantage while maintaining RNase H activity. Introduction of RSS motifs can further enhance RNase H efficiency in the hemimers. Cleavage maps are derived from the reaction mixtures obtained after 5 minutes of incubation of respective duplexes with RNase H1C in the presence of 1×RNase H buffer at 37° C. Arrows indicate sites of cleavage. (τ) indicates that both fragments, 5′-phosphate species as well as 5′-OH 3′-OH species were identified in reaction mixtures. (┌) indicates that only 5′-phosphate species was detected and (┐) indicates that 5′-OH 3′-OH component was detected in mass spectrometry analysis. The length of the arrow signifies the amount of metabolite present in the reaction mixture which was determined from the ratio of UV peak area to theoretical extinction coefficient of that fragment. Only in the cases where 5′-OH 3′-OH was not detected in the reaction mixture, 5′-phosphate species peak was used for quantification. Figure also discloses SEQ ID NO: 1560 in panel A.

FIG. 30. Example mass spectrometry data of cleavage assay. Top: data for ONT-367: 2.35 min: 7 mer; 3.16 min: 8 mer and P-6 mer; 4.58 min: P-7 mer; 5.91 min: P-8 mer; 7.19 min: 12 mer; 9.55 min: 13 mer; 10.13 min: P-11 mer; 11.14 min: P-12 mer and 14 mer; 12.11 min: P-13 mer; 13.29 min: P-14 mer; 14.80 min: full length RNA (ONT-388) and 18.33 min: stereorandom DNA (ONT-367). Bottom: data for ONT-406: 4.72 min: p-rArUrGrGrCrUrA, 5′-phosphorylated 7 mer RNA; 9.46 min: 5′-rGrUrGrArGrCrArGrCrUrGrCrA (SEQ ID NO: 9), 5′-OH 3′-OH 13 mer RNA; 16.45 min: full length RNA (ONT-388); 19.48 and 19.49 min: stereopure DNA (ONT-406).

FIG. 31. Example RNA cleavage rates. Duplexes were incubated with RNase H1C in the presence of 1×RNase H buffer at 37° C. Reactions were quenched at fixed time points by addition of 30 mM Na2EDTA. Cleavage rates were determined by measuring amount of full length RNA remaining in the reaction mixtures. Compositions used include: WV-944 (SEQ ID NO: 791), WV-945 (SEQ ID NO: 792), WV-936 (SEQ ID NO: 162), WV-904 (SEQ ID NO: 130), WV-937 (SEQ ID NO: 163), WV-905 (SEQ ID NO: 131), WV-938 (SEQ ID NO: 164), WV-906 (SEQ ID NO: 132), WV-939 (SEQ ID NO: 165), WV-907 (SEQ ID NO: 133), WV-940 (SEQ ID NO: 166), WV-908 (SEQ ID NO: 34), WV-941 (SEQ ID NO: 167), and WV-909 (SEQ ID NO: 135).

FIG. 32. A-N: RNA cleavage rates in RNase H assay for certain compositions targeting rs362307. Some of these compositions are stereorandom and some chirally controlled. Compositions used include: WV-1085, WV-1086, WV-1087, WV-1088, WV-1089, WV-1090, WV-1091, WV-1092, WV-905, WV-944, WV-945, WV-911, WV-917, WV-931, WV-937, and WV-1497.

FIG. 33. A: Example cleavage maps. Cleavage maps were derived from reaction mixtures obtained after 5 minutes of incubation of respective duplexes with RNase H1C in the presence of 1×RNaseH buffer at 37° C. B: Legend. Arrows indicate sites of cleavage. (τ) indicates that both fragments, 5′-phosphate species as well as 3′-OH species were identified. (┌) indicates that only 5′-OH 3′-OH species was detected and (┐) indicates that 5′-Phosphate component was detected. Length of an arrow signifies the amount of fragment present in the reaction mixture which was determined from the ratio of UV peak area to theoretical extinction coefficient of that fragment. Only in the cases where 5′-OH 3′-OH fragments were not detected in the reaction mixture, the 5′-phosphate species peak was used for quantification. Compositions used include: WV-944 (SEQ ID NO: 791), WV-945 (SEQ ID NO: 792), WV-904 (SEQ ID NO: 130), WV-905 (SEQ ID NO: 131), WV-906 (SEQ ID NO: 132), WV-907 (SEQ ID NO: 133), WV-908 (SEQ ID NO: 134), and WV-909 (SEQ ID NO: 135).

FIG. 34. Example cleavage maps. Example cleavage maps. Cleavage maps were derived from reaction mixtures obtained after 30 minutes of incubation of respective duplexes with RNase H1C in the presence of 1×RNase H buffer at 37° C. For legend, see FIG. 33. Compositions used include: WV-944 (SEQ ID NO: 791), WV-945 (SEQ ID NO: 792), WV-936 (SEQ ID NO: 162), WV-937 (SEQ ID NO: 163), WV-938 (SEQ ID NO: 164), WV-939 (SEQ ID NO: 165), WV-940 (SEQ ID NO: 166), WV-941 (SEQ ID NO: 167), WV-1085 (SEQ ID NO: 168), WV-1086 (SEQ ID NO: 169), WV-1087 (SEQ ID NO: 170), WV-1088 (SEQ ID NO: 171), WV-1089 (SEQ ID NO: 172), WV-1090 (SEQ ID NO: 173), WV-1091 (SEQ ID NO: 174), and WV-1092 (SEQ ID NO: 175).

FIG. 35. Example cleavage maps. For legend, see FIG. 33. Compositions used include: WV-944 (SEQ ID NO: 791), WV-945 (SEQ ID NO: 792), WV-905 (SEQ ID NO: 131), WV-911 (SEQ ID NO: 137), WV-917 (SEQ ID NO: 143), WV-931 (SEQ ID NO: 157), and WV-937 (SEQ ID NO: 163).

FIG. 36. Total ion chromatogram of RNase H cleavage reaction for WV-937 when duplexed with WT HTT RNA (WV-944, upper panel) or mu HTT RNA (WV-945, lower panel). Following quenching of the enzymatic reaction with disodium EDTA after 30 minutes, the RNase H cleavage products were chromatographically resolved and analyzed using an Agilent 1290 UPLC coupled with an Agilent 6230 MS-TOF mass spectrometer. The high mass accuracy high resolution MS spectra for each identified peak was extracted and deconvoluted. Identification of the metabolites which led to determination of position of cleavage was done by comparing the deconvoluted average masses to masses of predicted RNA metabolites.

FIG. 37. Illustration of the Luciferase Reporter-based screening.

FIGS. 38A-38I. FIGS. 38A-38I and 39A-39G show the activity of various HTT oligonucleotides. Dose-response curves for HTT silencing in reporter-based assay in COS7 cells after transfection of ASOs targeting rs362331_T or rs2530595_T SNPs. ASO specificity is increased with no significant loss of potency by addition of stereopure design (calculated IC50s specified). Data are representative of 2 independent experiments. Lines indicate fit curves, error bars indicate standard deviations. In the figures, the location of the SNP is indicated. Compositions tested in FIG. 38 include: WV-2067, WV-2416, WV-2069, WV-2417, WV-2072, WV-2418, WV-2076, WV-2419, WV-2605, WV-2589, WV-2606, WV-2590, WV-2607, WV-2591, WV-2608, WV-2592, WV-2609, WV-2593, WV-2610, WV-2594, WV-2611, WV-2595, WV-2612, WV-2596, WV-2611, WV-2595, WV-2671, WV-2672, WV-2673, WV-2675, WV-2674, WV-2613, WV-2597, WV-2614, WV-2598, WV-2615, WV-2599, WV-2616, WV-2600, WV-2617, WV-2601, WV-2618, WV-2602, WV-2619, WV-2603, WV-2620, and WV-2604. FIG. 38F discloses SEQ ID NOS 1475, 1459 and 1487-1491, respectively, in order of appearance.

FIGS. 39A-39G. Dose-response curves for HTT silencing in reporter-based assay in COS7 cells after transfection of ASOs. Compositions tested include: WVE120101, WV-1092, WV-1497, WV-2619, WV-2603, WV-2611, and WV-2595. IC50 data is also shown. FIG. 39A discloses SEQ ID NOS 1483 and 1467, respectively, in order of appearance. FIG. 39B discloses SEQ ID NOS 1483 and 1467, respectively, in order of appearance. FIG. 39C discloses SEQ ID NOS 1483 and 1467, respectively, in order of appearance. FIG. 39E discloses SEQ ID NOS 1483 and 1467, respectively, in order of appearance. FIG. 39F discloses SEQ ID NOS 1475 and 1459, respectively, in order of appearance. FIG. 39G discloses SEQ ID NOS 1483 and 1467, respectively, in order of appearance.

FIGS. 40A-40D. FIGS. 40A-40D shows liquid chromatograph and mass spectra data for oligonucleotides: WV1092.22 (WV-1092), WV2595.01 (WV-2595) and WV2603.01 (WV-2603). The suffices (01), (02), 0.01, 0.02, 0.22, etc., as used herein, indicate batch numbers.

FIG. 41. FIG. 41 shows liquid chromatograph and mass spectra data for oligonucleotides: WV-1510, WV-2378 and WV-2380.

FIG. 42. Example tested sequences (SEQ ID NOS 775-782, respectively, in order of appearance).

 DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

Synthetic oligonucleotides provide useful molecular tools in a wide variety of applications. For example, oligonucleotides are useful in therapeutic, diagnostic, research, and new nanomaterials applications. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited, for example, by their susceptibility to endo- and exo-nucleases. As such, various synthetic counterparts have been developed to circumvent these shortcomings. These include synthetic oligonucleotides that contain backbone modifications, which render these molecules less susceptible to degradation. From a structural point of view, such modifications to internucleotide phosphate linkages introduce chirality. It has become clear that certain properties of oligonucleotides may be affected by the configurations of the phosphorus atoms that form the backbone of the oligonucleotides. For example, in vitro studies have shown that the properties of antisense nucleotides such as binding affinity, sequence specific binding to the complementary RNA, stability to nucleases are affected by, inter alia, chirality of the backbone (e.g., the configurations of the phosphorus atoms).

Among other things, the present disclosure encompasses the recognition that structural elements of oligonucleotides, such as base sequence, chemical modifications (e.g., modifications of sugar, base, and/or internucleotidic linkages, and patterns thereof), and/or stereochemistry (e.g., stereochemistry of backbone chiral centers (chiral internucleotidic linkages), and/or patterns thereof), can have significant impact on properties, e.g., activities, of oligonucleotides. In some embodiments, the present disclosure demonstrates that oligonucleotide compositions comprising oligonucleotides with controlled structural elements, e.g., controlled chemical modification and/or controlled backbone stereochemistry patterns, provide unexpected properties, including but not limited to those described herein. In some embodiments, the present disclosure provide an oligonucleotide composition comprises a predetermined level of oligonucleotides of an individual oligonucleotide type which are chemically identical, e.g., they have the same base sequence, the same pattern of nucleoside modifications (modifications to sugar and base moieties, if any), the same pattern of backbone chiral centers, and the same pattern of backbone phosphorus modifications.

Among other things, the present disclosure encompasses the recognition that stereorandom oligonucleotide preparations contain a plurality of distinct chemical entities that differ from one another, e.g., in the stereochemical structure of individual backbone chiral centers within the oligonucleotide chain. Without control of stereochemistry of backbone chiral centers, stereorandom oligonucleotide preparations provide uncontrolled compositions comprising undetermined levels of oligonucleotide stereoisomers. Even though these stereoisomers may have the same base sequence, they are different chemical entities at least due to their different backbone stereochemistry, and they can have, as demonstrated herein, different properties, e.g., bioactivities. A stereopure (or “chirally controlled”) oligonucleotide composition or preparation can have improved bioactivity compared to a stereorandom oligonucleotide preparation which is otherwise identical (e.g., both the stereopure and stereorandom versions have the same base sequence, pattern of base and sugar modifications, etc.). For example, stereorandom oligonucleotide WV-1497 composition and a stereopure oligonucleotide WV-1092 composition both have the same sequence of bases and identical patterns of sugar modifications and backbone linkages, differing only in stereochemistry. However, at higher concentrations, there was a marked difference in the ability of the stereopure WV-1092 composition and the stereorandom WV-1497 composition to differentiate between wt and mutant HTT (which differ in only one nt). At the high concentration, both knocked down the mutant HTT to a great degree, which is desirable; but stereopure WV-1092 showed only a small knock down of wildtype HTT, while WV-1497 showed significantly more knock down of wt HTT, which is less desirable in some instances.

Chirally controlled oligonucleotide compositions of both WVE120101 and WV-1092 were able to differentiate between wt and mutant versions of SNP rs362307, which differ by one nt; both WVE120101 and WV-1092 significantly knocked down the mutant allele but not the wt, while the stereorandom version, WV-1497, was not able to significantly differentiate between the wt and mutant alleles (see FIG. 39D). The modified sequences of WVE120101 and WV-1092 are identical.

A chirally controlled oligonucleotide composition of WV-2595 was able to differentiate between the C and T alleles at SNP rs2530595, which also differ at only the one nt. Stereopure WV-2595 significantly knocked down the T allele but not the C allele, unlike the stereorandom oligonucleotide composition of WV-2611, which was not able to significantly differentiate the alleles (see FIG. 39F). The sequence of WV-2595 is 5′-mG*mGmGmUmCC*T*C*C*C*C*A*C*A*G*mAmGmGmG*mA-3′ (SEQ ID NO: 10) or 5′-mG* SmGmGmUmC*SC*ST*SC* SC*SC*SC*SA*SC*RA* SG*SmAmGmGmG* SmA-3′ (SEQ ID NO: 11) with certain stereochemistry information.

A stereopure oligonucleotide composition of WV-2603 was able to differentiate between the C and T alleles of SNP rs362331, which also differ at only the one nt. Stereopure WV-2603 significantly knocked down the T allele but not the C allele, unlike the stereorandom oligonucleotide composition of WV-2619, which was not able to significantly differentiate between the alleles (see FIGS. 39A, 39B, 39C and 39E). The sequence of WV-2603 is 5′-mG*mUmGmCmA*C*A*C*A*G*T*A*G*A*T*mGmAmGmG*mG-3′ (SEQ ID NO: 12) or 5′-mG* SmUmGmCmA*SC*SA*SC* SA*SG*ST*SA*SG*RA* ST*SmGmAmGmG* SmG-3′ (SEQ ID NO: 13) with certain stereochemistry information.

In some embodiments, the sequence of the oligonucleotide in a stereopure (chirally controlled) oligonucleotide composition comprises or consists of the sequence of any oligonucleotide disclosed herein. In some embodiments, the sequence of the oligonucleotide in a stereopure (chirally controlled) oligonucleotide composition comprises or consists of the sequence of any oligonucleotide selected from Tables N1, N2, N3, N4 and 8. In some embodiments, the sequence of the oligonucleotide in a stereopure (chirally controlled) oligonucleotide composition comprises or consists of the sequence of any oligonucleotide selected from Tables N1A, N2A, N3A, N4A and 8. In some embodiments, the sequence of the oligonucleotide in a stereopure (chirally controlled) oligonucleotide composition comprises or consists of the sequence of WV-1092, WVE120101, WV-2603 or WV-2595.

Each oligonucleotide described herein comprising a HTT sequence represents an HTT oligonucleotide which was designed, constructed and tested in various assays, in some embodiments, one or more in vitro assays. Each HTT oligonucleotide listed in any of Tables N1A, N2A, N3A, N4A and 8, or described elsewhere herein, was designed, constructed and tested in various assays, in some embodiments, one or more in vitro assays. For example, HTT oligonucleotides described herein were tested in a dual luciferase reporter assay. In some embodiments, HTT oligonucleotides were tested in one or more other assays described in this disclosure and/or in the art in accordance with the present disclosure. In some embodiments, HTT oligonucleotides which were found to be particularly efficacious in the dual luciferase assay were tested in further in vitro and in vivo assays in accordance with the present disclosure.

In some embodiments, a sequence of an oligonucleotide in a stereopure (chirally controlled) oligonucleotide composition includes any one or more of: base sequence (including length); pattern of chemical modifications to sugar and base moieties; pattern of backbone linkages; pattern of natural phosphate linkages, phosphorothioate linkages, phosphorothioate triester linkages, and combinations thereof, pattern of backbone chiral centers; pattern of stereochemistry (Rp/Sp) of chiral internucleotidic linkages; pattern of backbone phosphorus modifications; pattern of modifications on the internucleotidic phosphorus atom, such as —S−, and -L-R1 of formula I.

Among other things, the present disclosure provides new compositions that are or contain particular stereoisomers of oligonucleotides of interest. In some embodiments, a particular stereoisomer may be defined, for example, by its base sequence, its length, its pattern of backbone linkages, and its pattern of backbone chiral centers. As is understood in the art, in some embodiments, base sequence may refer to the identity and/or modification status of nucleoside residues (e.g., of sugar and/or base components, relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil) in an oligonucleotide and/or to the hybridization character (i.e., the ability to hybridize with particular complementary residues) of such residues. In some embodiments, oligonucleotides in provided compositions comprise sugar modifications, e.g., 2′-modifications, at e.g., a wing region. In some embodiments, oligonucleotides in provided compositions comprise a region in the middle, e.g., a core region, that has no sugar modifications.

The present disclosure demonstrates, among other things, that individual stereoisomers of a particular oligonucleotide can show different stability and/or activity (e.g., functional and/or toxicity properties) from each other. Moreover, the present disclosure demonstrates that stability and/or activity improvements achieved through inclusion and/or location of particular chiral structures within an oligonucleotide can be comparable to, or even better than those achieved through use of particular backbone linkages, residue modifications, etc. (e.g., through use of certain types of modified phosphates [e.g., phosphorothioate, substituted phosphorothioate, etc.], sugar modifications [e.g., 2′-modifications, etc.], and/or base modifications [e.g., methylation, etc.]).

Among other things, the present disclosure recognizes that, in some embodiments, properties (e.g., stability and/or activities) of an oligonucleotide can be adjusted by optimizing its pattern of backbone chiral centers, optionally in combination with adjustment/optimization of one or more other features (e.g., linkage pattern, nucleoside modification pattern, etc.) of the oligonucleotide. In some embodiments, the present disclosure provides oligonucleotide compositions wherein the oligonucleotides comprise nucleoside modifications, chiral internucleotidic linkages and natural phosphate linkages. For example, WV-1092 comprises 2′-OMe modifications, phosphate linkages in its 5′- and 3′-wing regions, and phosphorothioate linkages in its core regions.

In some embodiments, the present disclosure demonstrates that stability improvements achieved through inclusion and/or location of particular chiral structures within an oligonucleotide can be comparable to, or even better than those achieved through use of modified backbone linkages, bases, and/or sugars (e.g., through use of certain types of modified phosphates, 2′-modifications, base modifications, etc.). The present disclosure, in some embodiments, also demonstrates that activity improvements achieved through inclusion and/or location of particular chiral structures within an oligonucleotide can be comparable to, or even better than those achieved through use of modified backbone linkages, bases, and/or sugars (e.g., through use of certain types of modified phosphates, 2′-modifications, base modifications, etc.).

In some embodiments, inclusion and/or location of particular chiral linkages within an oligonucleotide can surprisingly change the cleavage pattern of a nucleic acid polymer when such an oligonucleotide is utilized for cleaving said nucleic acid polymer. For example, in some embodiments, a pattern of backbone chiral centers provides unexpectedly high cleavage efficiency of a target nucleic acid polymer. In some embodiments, a pattern of backbone chiral centers provides new cleavage sites. In some embodiments, a pattern of backbone chiral centers provides fewer cleavage sites, for example, by blocking certain existing cleavage sites. Even more unexpectedly, in some embodiments, a pattern of backbone chiral centers provides cleavage at only one site of a target nucleic acid polymer within the sequence that is complementary to an oligonucleotide utilized for cleavage. In some embodiments, higher cleavage efficiency is achieved by selecting a pattern of backbone chiral centers to minimize the number of cleavage sites.

In some embodiments, the present disclosure provides compositions of oligonucleotides, wherein the oligonucleotides have a common pattern of backbone chiral centers which, unexpectedly, greatly enhances the stability and/or biological activity of the oligonucleotides. In some embodiments, a pattern of backbone chiral centers provides increased stability. In some embodiments, a pattern of backbone chiral centers provides surprisingly increased activity. In some embodiments, a pattern of backbone chiral centers provides increased stability and activity. In some embodiments, when an oligonucleotide is utilized to cleave a nucleic acid polymer, a pattern of backbone chiral centers, surprisingly by itself, changes the cleavage pattern of a target nucleic acid polymer. In some embodiments, a pattern of backbone chiral centers effectively prevents cleavage at secondary sites. In some embodiments, a pattern of backbone chiral centers creates new cleavage sites. In some embodiments, a pattern of backbone chiral centers minimizes the number of cleavage sites. In some embodiments, a pattern of backbone chiral centers minimizes the number of cleavage sites so that a target nucleic acid polymer is cleaved at only one site within the sequence of the target nucleic acid polymer that is complementary to the oligonucleotide (e.g., cleavage at other sites cannot be readily detected by a certain method; in some embodiments, greater than 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% cleavage occurs at such a site). In some embodiments, a pattern of backbone chiral centers enhances cleavage efficiency at a cleavage site. In some embodiments, a pattern of backbone chiral centers of the oligonucleotide improves cleavage of a target nucleic acid polymer. In some embodiments, a pattern of backbone chiral centers increases selectivity. In some embodiments, a pattern of backbone chiral centers minimizes off-target effect. In some embodiments, a pattern of backbone chiral centers increase selectivity, e.g., cleavage selectivity between two target sequences differing only by a single nucleotide polymorphism (SNP). In some embodiments, a pattern of backbone chiral centers increase cleavage at a cleavage site of a stereorandom or DNA oligonucleotide composition. In some embodiments, a pattern of backbone chiral centers increase cleavage at a major cleavage site of a stereorandom or DNA oligonucleotide composition. In some embodiments, such a site is a major cleavage site of oligonucleotides having the pattern of backbone chiral centers. In some embodiments, a site is considered a major site if it is a site having the most, or the second, third, fourth or fifth most cleavage, or a site where greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of cleavage occurs. In some embodiments, a pattern of backbone chiral centers comprises or is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m. In some embodiments, a pattern of backbone chiral centers comprises or is (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein m>2. In some embodiments, a pattern of backbone chiral centers comprises or is (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein n is 1, t>1, and m>2. In some embodiments, m>3. In some embodiments, m>4.

In some embodiments, the present disclosure recognizes that chemical modifications, such as modifications of nucleosides and internucleotidic linkages, can provide enhanced properties. In some embodiments, the present disclosure demonstrates that combinations of chemical modifications and stereochemistry can provide unexpected, greatly improved properties (e.g., bioactivity, selectivity, etc.). In some embodiments, chemical combinations, such as modifications of sugars, bases, and/or internucleotidic linkages, are combined with stereochemistry patterns, e.g., (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, to provide oligonucleotides and compositions thereof with surprisingly enhanced properties. In some embodiments, a provided oligonucleotide composition is chirally controlled, and comprises a combination of 2′-modification of one or more sugar moieties, one or more natural phosphate linkages, one or more phosphorothioate linkages, and a stereochemistry pattern of (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein m>2. In some embodiments, n is 1, t>1, and m>2. In some embodiments, m>3. In some embodiments, m>4.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising oligonucleotides defined by having:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that a predetermined level of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.

In some embodiments, a common base sequence and length may be referred to as a common base sequence. In some embodiments, oligonucleotides having a common base sequence may have the same pattern of nucleoside modifications, e.g., sugar modifications, base modifications, etc. In some embodiments, a pattern of nucleoside modifications may be represented by a combination of locations and modifications. For example, for WV-1092, the pattern of nucleoside modifications is 5×2′-OMe (2′-OMe modification on sugar moieties)-DNA (no 2′-modifications on the sugar moiety)-5×2′-OMe from the 5′-end to the 3′-end. In some embodiments, a pattern of backbone linkages comprises locations and types (e.g., phosphate, phosphorothioate, substituted phosphorothioate, etc.) of each internucleotidic linkages. In some embodiments, an oligonucleotide can have a specified pattern of backbone linkages. In some embodiments, an oligonucleotide has a pattern of backbone linkages of nPS-nPO-nPS-nPO-nPS, wherein PO is phosphate (phosphorodiester), PS is phosphorothioate, and n is 1-15, and each occurrence of n can be the same or different. In some embodiments, at least one n is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, at least one n for PS is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, the n for the PS between the two PO is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, n is greater than 5. In some embodiments, n is greater than 6. In some embodiments, n is greater than 7. In some embodiments, n is greater than 8. In some embodiments, n is greater than 9. In some embodiments, n is greater than 10. In some embodiments, n is greater than 11. In some embodiments, n is greater than 12. In some embodiments, n is greater than 13. In some embodiments, n is greater than 14. In some embodiments, n is greater than 15. In some embodiments, an oligonucleotide has a pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7 PO-1-5PS (meaning 1 to 5 phosphorothioates, 1 to 7 phosphates, 5 to 15 phosphorothioates, 1 to 7 phosphates, and 1 to 5 phosphorothioates). In some embodiments, the oligonucleotide has a pattern of backbone linkages, from 5′ to 3′, of 1PS-3PO-11PS-3PO-1PS (meaning 1 phosphorothioate, 3 phosphates, 11 phosphorothioates, 3 phosphates, and 1 phosphorothioate, and which can alternatively be represented as PS1PO3PS11PO3PS1). For example, for WV-1092, the pattern of backbone linkages is 1PS-3PO-11PS-3PO-1PS from the 5′-end to the 3′-end. In some embodiments, an oligonucleotide has a pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7PO-1-5PS, wherein each PS is Sp except for one Rp. In some embodiments, the oligonucleotide has a pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7PO-1-5PS, wherein each PS is Sp except one PS at any position from the 5th to 15th PS is Rp. In some embodiments, the oligonucleotide has a pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7PO-1-5PS, wherein each PS is Sp except that the 10th PS counting from the 5′ end is Rp. In some embodiments, the oligonucleotide has a pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7PO-1-5PS, wherein each PS is Sp except that the 9th counting from the 5′ end PS is Rp. In some embodiments, the oligonucleotide has a pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7PO-1-5PS, wherein each PS is Sp except that the 11th PS counting from the 5′ end is Rp. A pattern of backbone chiral centers of an oligonucleotide can be designated by a combination of linkage phosphorus stereochemistry (Rp/Sp) from 5′ to 3′. For example, WV-1092 has a pattern of 1S-3PO (phosphate)-8S-1R-2S-3PO-1S, and WV-937 has a pattern of 12S-1R-6S. In some embodiments, all non-chiral linkages (e.g., PO) may be omitted when describing a pattern of backbone chiral centers. As exemplified above, locations of non-chiral linkages may be obtained, for example, from pattern of backbone linkages. Any sequence disclosed herein can be combined with any patterns of backbone linkages and/or any patterns of backbone chiral centers disclosed herein. Base sequences, patterns of backbone linkages, patterns of stereochemistry (e.g., Rp or Sp), patterns of base modifications, patterns of backbone chiral centers, etc. are presented in 5′ to 3′ direction unless otherwise indicated.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type.

An example substantially racemic preparation of oligonucleotides is the preparation of phosphorothioate oligonucleotides through sulfurizing phosphite triesters from commonly used phosphoramidite oligonucleotide synthesis with either tetraethylthiuram disulfide or (TETD) or 3H-1, 2-bensodithiol-3-one 1, 1-dioxide (BDTD), a well-known process in the art. In some embodiments, substantially racemic preparation of oligonucleotides provides substantially racemic oligonucleotide compositions (or chirally uncontrolled oligonucleotide compositions).

As understood by a person having ordinary skill in the art, a stereorandom or racemic preparation of oligonucleotides is prepared by non-stereoselective and/or low-stereoselective coupling of nucleotide monomers, typically without using any chiral auxiliaries, chiral modification reagents, and/or chiral catalysts. In some embodiments, in a substantially racemic (or chirally uncontrolled) preparation of oligonucleotides, all or most coupling steps are not chirally controlled in that the coupling steps are not specifically conducted to provide enhanced stereoselectivity. An example substantially racemic preparation of oligonucleotides is the preparation of phosphorothioate oligonucleotides through sulfurizing phosphite triesters from commonly used phosphoramidite oligonucleotide synthesis with either tetraethylthiuram disulfide or (TETD) or 3H-1, 2-bensodithiol-3-one 1, 1-dioxide (BDTD), a well-known process in the art. In some embodiments, substantially racemic preparation of oligonucleotides provides substantially racemic oligonucleotide compositions (or chirally uncontrolled oligonucleotide compositions). In some embodiments, at least one coupling of a nucleotide monomer has a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at least two couplings of a nucleotide monomer have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at least three couplings of a nucleotide monomer have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at least four couplings of a nucleotide monomer have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at least five couplings of a nucleotide monomer have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, in a stereorandom or racemic preparations, at least one internucleotidic linkage has a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at least two internucleotidic linkages have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at least three internucleotidic linkages have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at least four internucleotidic linkages have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at least five internucleotidic linkages have a diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, a diastereoselectivity is lower than about 60:40. In some embodiments, a diastereoselectivity is lower than about 70:30. In some embodiments, a diastereoselectivity is lower than about 80:20. In some embodiments, a diastereoselectivity is lower than about 90:10. In some embodiments, a diastereoselectivity is lower than about 91:9. In some embodiments, a diastereoselectivity is lower than about 92:8. In some embodiments, a diastereoselectivity is lower than about 93:7. In some embodiments, a diastereoselectivity is lower than about 94:6. In some embodiments, a diastereoselectivity is lower than about 95:5. In some embodiments, a diastereoselectivity is lower than about 96:4. In some embodiments, a diastereoselectivity is lower than about 97:3. In some embodiments, a diastereoselectivity is lower than about 98:2. In some embodiments, a diastereoselectivity is lower than about 99:1. In some embodiments, at least one coupling has a diastereoselectivity lower than about 90:10. In some embodiments, at least two couplings have a diastereoselectivity lower than about 90:10. In some embodiments, at least three couplings have a diastereoselectivity lower than about 90:10. In some embodiments, at least four couplings have a diastereoselectivity lower than about 90:10. In some embodiments, at least five couplings have a diastereoselectivity lower than about 90:10. In some embodiments, at least one internucleotidic linkage has a diastereoselectivity lower than about 90:10. In some embodiments, at least two internucleotidic linkages have a diastereoselectivity lower than about 90:10. In some embodiments, at least three internucleotidic linkages have a diastereoselectivity lower than about 90:10. In some embodiments, at least four internucleotidic linkages have a diastereoselectivity lower than about 90:10. In some embodiments, at least five internucleotidic linkages have a diastereoselectivity lower than about 90:10.

As understood by a person having ordinary skill in the art, in some embodiments, diastereoselectivity of a coupling or a linkage can be assessed through the diastereoselectivity of a dimer formation under the same or comparable conditions, wherein the dimer has the same 5′- and 3′-nucleosides and internucleotidic linkage. For example, diastereoselectivity of the underlined coupling or linkage in WV-1092 mG*SmGmCmAmC*SA*SA*SG*SG*S G*SC*SA*SC*RA*SG*SmAmCmUmU*SmC (SEQ ID NO: 14) can be assessed from coupling two G moieties under the same or comparable conditions, e.g., monomers, chiral auxiliaries, solvents, activators, temperatures, etc.

In some embodiments, the present disclosure provides chirally controlled (and/or stereochemically pure) oligonucleotide compositions comprising oligonucleotides defined by having:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that at least about 10% of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.

In some embodiments, the present disclosure provides chirally controlled oligonucleotide composition of oligonucleotides in that the composition is enriched, relative to a substantially racemic preparation of the same oligonucleotides, for oligonucleotides of a single oligonucleotide type. In some embodiments, the present disclosure provides chirally controlled oligonucleotide composition of oligonucleotides in that the composition is enriched, relative to a substantially racemic preparation of the same oligonucleotides, for oligonucleotides of a single oligonucleotide type that share:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type.

In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of base modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have identical structures.

In some embodiments, oligonucleotides of an oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of sugar modifications. In some embodiments, oligonucleotides of an oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of base modifications. In some embodiments, oligonucleotides of an oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, oligonucleotides of an oligonucleotide type are identical.

In some embodiments, a chirally controlled oligonucleotide composition is a substantially pure preparation of an oligonucleotide type in that oligonucleotides in the composition that are not of the oligonucleotide type are impurities form the preparation process of said oligonucleotide type, in some case, after certain purification procedures.

In some embodiments, at least about 20% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 25% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 30% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 35% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 40% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 45% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 50% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 55% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 60% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 65% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 70% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 75% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 80% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 85% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 90% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 92% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 94% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 95% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, greater than about 99% of the oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, purity of a chirally controlled oligonucleotide composition of an oligonucleotide can be expressed as the percentage of oligonucleotides in the composition that have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.

In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of sugar modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of base modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, oligonucleotides having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers are identical.

In some embodiments, oligonucleotides in provided compositions have a common pattern of backbone phosphorus modifications. In some embodiments, a common base sequence is a base sequence of an oligonucleotide type. In some embodiments, a provided composition is an oligonucleotide composition that is chirally controlled in that the composition contains a predetermined level of oligonucleotides of an individual oligonucleotide type, wherein an oligonucleotide type is defined by:

1) base sequence;

2) pattern of backbone linkages;

3) pattern of backbone chiral centers; and

4) pattern of backbone phosphorus modifications.

As noted above and understood in the art, in some embodiments, base sequence of an oligonucleotide may refer to the identity and/or modification status of nucleoside residues (e.g., of sugar and/or base components, relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil) in the oligonucleotide and/or to the hybridization character (i.e., the ability to hybridize with particular complementary residues) of such residues.

In some embodiments, a particular oligonucleotide type may be defined by

1A) base identity;

1B) pattern of base modification;

1C) pattern of sugar modification;

2) pattern of backbone linkages;

3) pattern of backbone chiral centers; and

4) pattern of backbone phosphorus modifications.

Thus, in some embodiments, oligonucleotides of a particular type may share identical bases but differ in their pattern of base modifications and/or sugar modifications. In some embodiments, oligonucleotides of a particular type may share identical bases and pattern of base modifications (including, e.g., absence of base modification), but differ in pattern of sugar modifications.

In some embodiments, oligonucleotides of a particular type are identical in that they have the same base sequence (including length), the same pattern of chemical modifications to sugar and base moieties, the same pattern of backbone linkages (e.g., pattern of natural phosphate linkages, phosphorothioate linkages, phosphorothioate triester linkages, and combinations thereof), the same pattern of backbone chiral centers (e.g., pattern of stereochemistry (Rp/Sp) of chiral internucleotidic linkages), and the same pattern of backbone phosphorus modifications (e.g., pattern of modifications on the internucleotidic phosphorus atom, such as —S−, and -L-R1 of formula I).

In some embodiments, purity of a chirally controlled oligonucleotide composition of an oligonucleotide type is expressed as the percentage of oligonucleotides in the composition that are of the oligonucleotide type. In some embodiments, at least about 10% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 20% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 30% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 40% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 50% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 60% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 70% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 80% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 90% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 92% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 94% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 95% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 96% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 97% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 98% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type. In some embodiments, at least about 99% of the oligonucleotides in a chirally controlled oligonucleotide composition are of the same oligonucleotide type.

In some embodiments, purity of a chirally controlled oligonucleotide composition can be controlled by stereoselectivity of each coupling step in its preparation process. In some embodiments, a coupling step has a stereoselectivity (e.g., diastereoselectivity) of 60% (60% of the new internucleotidic linkage formed from the coupling step has the intended stereochemistry). After such a coupling step, the new internucleotidic linkage formed may be referred to have a 60% purity. In some embodiments, each coupling step has a stereoselectivity of at least 60%. In some embodiments, each coupling step has a stereoselectivity of at least 70%. In some embodiments, each coupling step has a stereoselectivity of at least 80%. In some embodiments, each coupling step has a stereoselectivity of at least 85%. In some embodiments, each coupling step has a stereoselectivity of at least 90%. In some embodiments, each coupling step has a stereoselectivity of at least 91%. In some embodiments, each coupling step has a stereoselectivity of at least 92%. In some embodiments, each coupling step has a stereoselectivity of at least 93%. In some embodiments, each coupling step has a stereoselectivity of at least 94%. In some embodiments, each coupling step has a stereoselectivity of at least 95%. In some embodiments, each coupling step has a stereoselectivity of at least 96%. In some embodiments, each coupling step has a stereoselectivity of at least 97%. In some embodiments, each coupling step has a stereoselectivity of at least 98%. In some embodiments, each coupling step has a stereoselectivity of at least 99%. In some embodiments, each coupling step has a stereoselectivity of at least 99.5%. In some embodiments, each coupling step has a stereoselectivity of virtually 100%. In some embodiments, a coupling step has a stereoselectivity of virtually 100% in that all detectable product from the coupling step by an analytical method (e.g., NMR, HPLC, etc) has the intended stereoselectivity.

Among other things, the present disclosure recognizes that combinations of oligonucleotide structural elements (e.g., patterns of chemical modifications, backbone linkages, backbone chiral centers, and/or backbone phosphorus modifications) can provide surprisingly improved properties such as bioactivities.

In some embodiments, the present disclosure provides an oligonucleotide composition comprising a predetermined level of oligonucleotides which comprise one or more wing regions and a common core region, wherein:

each wing region independently has a length of two or more bases, and independently and optionally comprises one or more chiral internucleotidic linkages;

the core region independently has a length of two or more bases, and independently comprises one or more chiral internucleotidic linkages, and the common core region has:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers.

In some embodiments, a wing region comprises a structural feature that is not in a core region. In some embodiments, a wing and core can be defined by any structural elements, e.g., base modifications (e.g., methylated/non-methylated, methylation at position 1/methylation at position 2, etc.), sugar modifications (e.g., modified/non-modified, 2′-modification/another type of modification, one type of 2′-modification/another type of 2′-modification, etc.), backbone linkage types (e.g., phosphate/phosphorothioate, phosphorothioate/substituted phosphorothioate, etc.), backbone chiral center stereochemistry (e.g., all Sp/all Rp, (SpRp) repeats/all Rp, etc.), backbone phosphorus modification types (e.g., s1/s2, s1/s3, etc.), etc.

In some embodiments, a wing and core is defined by nucleoside modifications, wherein a wing comprises a nucleoside modification that the core region does not have. In some embodiments, a wing and core is defined by sugar modifications, wherein a wing comprises a sugar modification that the core region does not have. In some embodiments, a sugar modification is a 2′-modification. In some embodiments, a sugar modification is 2′-OR1. In some embodiments, a sugar modification is 2′-MOE. In some embodiments, a sugar modification is 2′-OMe. Additionally example sugar modifications are described in the present disclosure.

In some embodiments, oligonucleotides in provided compositions have a wing-core structure (hemimer). In some embodiments, oligonucleotides in provided compositions have a wing-core structure of nucleoside modifications. In some embodiments, oligonucleotides in provided compositions have a core-wing structure (another type of hemimer). In some embodiments, oligonucleotides in provided compositions have a core-wing structure of nucleoside modifications. In some embodiments, oligonucleotides in provided compositions have a wing-core-wing structure (gapmer). In some embodiments, oligonucleotides in provided compositions have a wing-core-wing structure of nucleoside modifications. In some embodiments, a wing and core is defined by modifications of the sugar moieties. In some embodiments, a wing and core is defined by modifications of the base moieties. In some embodiments, each sugar moiety in the wing region has the same 2′-modification which is not found in the core region. In some embodiments, each sugar moiety in the wing region has the same 2′-modification which is different than any sugar modifications in the core region. In some embodiments, a core region has no sugar modification. In some embodiments, each sugar moiety in the wing region has the same 2′-modification, and the core region has no 2′-modifications. In some embodiments, when two or more wings are present, each wing is defined by its own modifications. In some embodiments, each wing has its own characteristic sugar modification. In some embodiments, each wing has the same characteristic sugar modification differentiating it from a core. In some embodiments, each wing sugar moiety has the same modification. In some embodiments, each wing sugar moiety has the same 2′-modification. In some embodiments, each sugar moiety in a wing region has the same 2′-modification, yet the common 2′-modification in a first wing region can either be the same as or different from the common 2′-modification in a second wing region. In some embodiments, each sugar moiety in a wing region has the same 2′-modification, and the common 2′-modification in a first wing region is the same as the common 2′-modification in a second wing region. In some embodiments, each sugar moiety in a wing region has the same 2′-modification, and the common 2′-modification in a first wing region is different from the common 2′-modification in a second wing region.

In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are antisense oligonucleotides (e.g., chiromersen). In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are siRNA oligonucleotides. In some embodiments, a provided chirally controlled oligonucleotide composition is of oligonucleotides that can be antisense oligonucleotide, antagomir, microRNA, pre-microRNs, antimir, supermir, ribozyme, Ul adaptor, RNA activator, RNAi agent, decoy oligonucleotide, triplex forming oligonucleotide, aptamer or adjuvant. In some embodiments, a chirally controlled oligonucleotide composition is of antisense oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of antagomir oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of microRNA oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of pre-microRNA oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of antimir oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of supermir oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of ribozyme oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of Ul adaptor oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of RNA activator oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of RNAi agent oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of decoy oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of triplex forming oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of aptamer oligonucleotides. In some embodiments, a chirally controlled oligonucleotide composition is of adjuvant oligonucleotides.

In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides that include one or more modified backbone linkages, bases, and/or sugars.

In some embodiments, a provided oligonucleotide comprises one or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide comprises two or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide comprises three or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide comprises four or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide comprises five or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 5 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 6 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 7 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 8 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 9 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 10 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 11 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 12 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 13 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 14 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 15 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 16 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 17 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 18 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 19 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 20 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 21 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 22 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 23 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 24 or more chiral, modified phosphate linkages. In some embodiments, a provided oligonucleotide type comprises 25 or more chiral, modified phosphate linkages.

In some embodiments, a provided oligonucleotide comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% chiral, modified phosphate linkages. Example such chiral, modified phosphate linkages are described above and herein. In some embodiments, a provided oligonucleotide comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% chiral, modified phosphate linkages in the Sp configuration.

In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 80%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 85%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 90%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 91%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 92%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 93%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 94%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 95%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 96%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 97%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 98%. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than about 99%.

In some embodiments, a chiral, modified phosphate linkage is a chiral phosphorothioate linkage, i.e., phosphorothioate internucleotidic linkage. In some embodiments, a provided oligonucleotide comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% chiral phosphorothioate internucleotidic linkages. In some embodiments, all chiral, modified phosphate linkages are chiral phosphorothioate internucleotidic linkages. In some embodiments, at least about 10, 20, 30, 40, 50, 60, 70, 80, or 90% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 10% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 20% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 30% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 40% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 50% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 60% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 70% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 80% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 90% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 95% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Sp conformation. In some embodiments, at least about 10, 20, 30, 40, 50, 60, 70, 80, or 90% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 10% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 20% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 30% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 40% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 50% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 60% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 70% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 80% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 90% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, at least about 95% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 10, 20, 30, 40, 50, 60, 70, 80, or 90% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 10% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 20% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 30% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 40% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 50% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 60% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 70% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 80% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 90% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, less than about 95% chiral phosphorothioate internucleotidic linkages of a provided oligonucleotide are of the Rp conformation. In some embodiments, a provided oligonucleotide has only one Rp chiral phosphorothioate internucleotidic linkages. In some embodiments, a provided oligonucleotide has only one Rp chiral phosphorothioate internucleotidic linkages, wherein all internucleotide linkages are chiral phosphorothioate internucleotidic linkages. In some embodiments, a chiral phosphorothioate internucleotidic linkage is a chiral phosphorothioate diester linkage. In some embodiments, each chiral phosphorothioate internucleotidic linkage is independently a chiral phosphorothioate diester linkage. In some embodiments, each internucleotidic linkage is independently a chiral phosphorothioate diester linkage. In some embodiments, each internucleotidic linkage is independently a chiral phosphorothioate diester linkage, and only one is Rp.

In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides that contain one or more modified bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides that contain no modified bases. Example such modified bases are described above and herein.

In some embodiments, oligonucleotides of provided compositions comprise at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least one natural phosphate linkage. In some embodiments, oligonucleotides of provided compositions comprise at least two natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least three natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least four natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least five natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least six natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least seven natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least eight natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least nine natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least ten natural phosphate linkages.

In some embodiments, oligonucleotides of provided compositions comprise 2, 3, 4, 5, 6, 7, 8, 9 or 10 natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise one natural phosphate linkage. In some embodiments, oligonucleotides of provided compositions comprise two natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise three natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise four natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise five natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise six natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise seven natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise eight natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise nine natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise ten natural phosphate linkages.

In some embodiments, oligonucleotides of provided compositions comprise at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least two consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least three consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least four consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least five consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least six consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least seven consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least eight consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least nine consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise at least ten consecutive natural phosphate linkages.

In some embodiments, oligonucleotides of provided compositions comprise 2, 3, 4, 5, 6, 7, 8, 9 or 10 consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise two consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise three consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise four consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise five consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise six consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise seven consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise eight consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise nine consecutive natural phosphate linkages. In some embodiments, oligonucleotides of provided compositions comprise ten consecutive natural phosphate linkages.

In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 8 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 9 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 10 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 11 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 12 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 13 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 14 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 15 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 16 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 17 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 18 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 19 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 20 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 21 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 22 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 23 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 24 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 25 bases. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are of oligonucleotides having a common base sequence of at least 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 bases.

In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations comprise oligonucleotides containing one or more residues which are modified at the sugar moiety. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations comprise oligonucleotides containing one or more residues which are modified at the 2′ position of the sugar moiety (referred to herein as a “2′-modification”). Examples of such modifications are described above and herein and include, but are not limited to, 2′-OMe, 2′-MOE, 2′-LNA, 2′-F, FRNA, FANA, S-cEt, etc. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations comprise oligonucleotides containing one or more residues which are 2′-modified. For example, in some embodiments, provided oligonucleotides contain one or more residues which are 2′-O-methoxyethyl (2′-MOE)-modified residues. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations comprise oligonucleotides which do not contain any 2′-modifications. In some embodiments, provided chirally controlled (and/or stereochemically pure) preparations are oligonucleotides which do not contain any 2′-MOE residues. That is, in some embodiments, provided oligonucleotides are not MOE-modified. Additional example sugar modifications are described in the present disclosure.

In some embodiments, provided oligonucleotides are of a general motif of wing-core or core-wing (hemimer, also represented herein generally as X—Y or Y—X, respectively). In some embodiments, provided oligonucleotides are of a general motif of wing-core-wing (gapmer, also represented herein generically as X—Y—X). In some embodiments, each wing independently contains one or more residues having a particular modification, which modification is absent from the core “Y” portion. In some embodiments, each wing independently contains one or more residues having a particular nucleoside modification, which modification is absent from the core “Y” portion. In some embodiments, each wing independently contains one or more residues having a particular base modification, which modification is absent from the core “Y” portion. In some embodiments, each wing independently contains one or more residues having a particular sugar modification, which modification is absent from the core “Y” portion. Example sugar modifications are widely known in the art. In some embodiments, a sugar modification is a modification selected from those modifications described in U.S. Pat. No. 9,006,198, which sugar modifications are incorporated herein by references. Additional example sugar modifications are described in the present disclosure. In some embodiment, each wing contains one or more residues having a 2′ modification that is not present in the core portion. In some embodiments, a 2′-modification is 2′-OR1, wherein R1 is as defined and described in the present disclosure.

In some embodiments, provided oligonucleotides have a wing-core motif represented as X—Y, or a core-wing motif represented as Y—X, wherein the residues at the “X” portion are sugar modified residues of a particular type and the residues in the core “Y” portion are not sugar modified residues of the same particular type. In some embodiments, provided oligonucleotides have a wing-core-wing motif represented as X—Y—X, wherein the residues at each “X” portion are sugar modified residues of a particular type and the residues in the core “Y” portion are not sugar modified residues of the same particular type. In some embodiments, provided oligonucleotides have a wing-core motif represented as X—Y, or a core-wing motif represented as Y—X, wherein the residues at the “X” portion are 2′-modified residues of a particular type and the residues in the core “Y” portion are not 2′-modified residues of the same particular type. In some embodiments, provided oligonucleotides have a wing-core motif represented as X—Y, wherein the residues at the “X” portion are 2′-modified residues of a particular type and the residues in the core “Y” portion are not 2′-modified residues of the same particular type. In some embodiments, provided oligonucleotides have a core-wing motif represented as Y—X, wherein the residues at the “X” portion are 2′-modified residues of a particular type and the residues in the core “Y” portion are not 2′-modified residues of the same particular type. In some embodiments, provided oligonucleotides have a wing-core-wing motif represented as X—Y—X, wherein the residues at each “X” portion are 2′-modified residues of a particular type and the residues in the core “Y” portion are not 2′-modified residues of the same particular type. In some embodiments, provided oligonucleotides have a wing-core motif represented as X—Y, wherein the residues at the “X” portion are 2′-modified residues of a particular type and the residues in the core “Y” portion are 2′-deoxyribonucleoside. In some embodiments, provided oligonucleotides have a core-wing motif represented as Y—X, wherein the residues at the “X” portion are 2′-modified residues of a particular type and the residues in the core “Y” portion are 2′-deoxyribonucleoside. In some embodiments, provided oligonucleotides have a wing-core-wing motif represented as X—Y—X, wherein the residues at each “X” portion are 2′-modified residues of a particular type and the residues in the core “Y” portion are 2′-deoxyribonucleoside. In some embodiments, provided oligonucleotides have a wing-core-wing motif represented as X—Y—X, wherein the residues at each “X” portion are 2′-modified residues of a particular type and the residues in the core “Y” portion are 2′-deoxyribonucleoside. For instance, in some embodiments, provided oligonucleotides have a wing-core-wing motif represented as X—Y—X, wherein the residues at each “X” portion are 2′-MOE-modified residues and the residues in the core “Y” portion are not 2′-MOE-modified residues. In some embodiments, provided oligonucleotides have a wing-core-wing motif represented as X—Y—X, wherein the residues at each “X” portion are 2′-MOE-modified residues and the residues in the core “Y” portion are 2′-deoxyribonucleoside. One of skill in the relevant arts will recognize that all such 2′-modifications described above and herein are contemplated in the context of such X—Y, Y—X and/or X—Y—X motifs.

In some embodiments, a wing has a length of one or more bases. In some embodiments, a wing has a length of two or more bases. In some embodiments, a wing has a length of three or more bases. In some embodiments, a wing has a length of four or more bases. In some embodiments, a wing has a length of five or more bases. In some embodiments, a wing has a length of six or more bases. In some embodiments, a wing has a length of seven or more bases. In some embodiments, a wing has a length of eight or more bases. In some embodiments, a wing has a length of nine or more bases. In some embodiments, a wing has a length of ten or more bases. In some embodiments, a wing has a length of 11 or more bases. In some embodiments, a wing has a length of 12 or more bases. In some embodiments, a wing has a length of 13 or more bases. In some embodiments, a wing has a length of 14 or more bases. In some embodiments, a wing has a length of 15 or more bases. In some embodiments, a wing has a length of 16 or more bases. In some embodiments, a wing has a length of 17 or more bases. In some embodiments, a wing has a length of 18 or more bases. In some embodiments, a wing has a length of 19 or more bases. In some embodiments, a wing has a length often or more bases.

In some embodiments, a wing has a length of one base. In some embodiments, a wing has a length of two bases. In some embodiments, a wing has a length of three bases. In some embodiments, a wing has a length of four bases. In some embodiments, a wing has a length of five bases. In some embodiments, a wing has a length of six bases. In some embodiments, a wing has a length of seven bases. In some embodiments, a wing has a length of eight bases. In some embodiments, a wing has a length of nine bases. In some embodiments, a wing has a length of ten bases. In some embodiments, a wing has a length of 11 bases. In some embodiments, a wing has a length of 12 bases. In some embodiments, a wing has a length of 13 bases. In some embodiments, a wing has a length of 14 bases. In some embodiments, a wing has a length of 15 bases. In some embodiments, a wing has a length of 16 bases. In some embodiments, a wing has a length of 17 bases. In some embodiments, a wing has a length of 18 bases. In some embodiments, a wing has a length of 19 bases. In some embodiments, a wing has a length of ten bases.

In some embodiments, a wing comprises one or more chiral internucleotidic linkages. In some embodiments, a wing comprises one or more natural phosphate linkages. In some embodiments, a wing comprises one or more chiral internucleotidic linkages and one or more natural phosphate linkages. In some embodiments, a wing comprises one or more chiral internucleotidic linkages and two or more natural phosphate linkages. In some embodiments, a wing comprises one or more chiral internucleotidic linkages and two or more natural phosphate linkages, wherein two or more natural phosphate linkages are consecutive. In some embodiments, a wing comprises no chiral internucleotidic linkages. In some embodiments, each wing linkage is a natural phosphate linkage. In some embodiments, a wing comprises no phosphate linkages. In some embodiments, each wing is independently a chiral internucleotidic linkage.

In some embodiments, each wing independently comprises one or more chiral internucleotidic linkages. In some embodiments, each wing independently comprises one or more natural phosphate linkages. In some embodiments, each wing independently comprises one or more chiral internucleotidic linkages and one or more natural phosphate linkages. In some embodiments, each wing independently comprises one or more chiral internucleotidic linkages and two or more natural phosphate linkages. In some embodiments, each wing independently comprises one or more chiral internucleotidic linkages and two or more natural phosphate linkages, wherein two or more natural phosphate linkages are consecutive.

In some embodiments, each wing independently comprises at least one chiral internucleotidic linkage. In some embodiments, each wing independently comprises at least two chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least three chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least four chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least five chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least six chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least seven chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least eight chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least nine chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least ten chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 11 chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 12 chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 13 chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 14 chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 15 chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 16 chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 17 chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 18 chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 19 chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 20 chiral internucleotidic linkages.

In some embodiments, each wing independently comprises one chiral internucleotidic linkage. In some embodiments, each wing independently comprises two chiral internucleotidic linkages. In some embodiments, each wing independently comprises three chiral internucleotidic linkages. In some embodiments, each wing independently comprises four chiral internucleotidic linkages. In some embodiments, each wing independently comprises five chiral internucleotidic linkages. In some embodiments, each wing independently comprises six chiral internucleotidic linkages. In some embodiments, each wing independently comprises seven chiral internucleotidic linkages. In some embodiments, each wing independently comprises eight chiral internucleotidic linkages. In some embodiments, each wing independently comprises nine chiral internucleotidic linkages. In some embodiments, each wing independently comprises ten chiral internucleotidic linkages. In some embodiments, each wing independently comprises 11 chiral internucleotidic linkages. In some embodiments, each wing independently comprises 12 chiral internucleotidic linkages. In some embodiments, each wing independently comprises 13 chiral internucleotidic linkages. In some embodiments, each wing independently comprises 14 chiral internucleotidic linkages. In some embodiments, each wing independently comprises 15 chiral internucleotidic linkages. In some embodiments, each wing independently comprises 16 chiral internucleotidic linkages. In some embodiments, each wing independently comprises 17 chiral internucleotidic linkages. In some embodiments, each wing independently comprises 18 chiral internucleotidic linkages. In some embodiments, each wing independently comprises 19 chiral internucleotidic linkages. In some embodiments, each wing independently comprises 20 chiral internucleotidic linkages.

In some embodiments, each wing independently comprises at least one consecutive natural phosphate linkage. In some embodiments, each wing independently comprises at least two consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least three consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least four consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least five consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least six consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least seven consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least eight consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least nine consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least ten consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 11 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 12 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 13 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 14 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 15 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 16 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 17 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 18 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 19 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises at least 20 consecutive chiral internucleotidic linkages.

In some embodiments, each wing independently comprises one consecutive natural phosphate linkage. In some embodiments, each wing independently comprises two consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises three consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises four consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises five consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises six consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises seven consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises eight consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises nine consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises ten consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 11 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 12 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 13 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 14 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 15 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 16 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 17 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 18 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 19 consecutive chiral internucleotidic linkages. In some embodiments, each wing independently comprises 20 consecutive chiral internucleotidic linkages.

In some embodiments, each wing independently comprises at least one natural phosphate linkage. In some embodiments, each wing independently comprises at least two natural phosphate linkages. In some embodiments, each wing independently comprises at least three natural phosphate linkages. In some embodiments, each wing independently comprises at least four natural phosphate linkages. In some embodiments, each wing independently comprises at least five natural phosphate linkages. In some embodiments, each wing independently comprises at least six natural phosphate linkages. In some embodiments, each wing independently comprises at least seven natural phosphate linkages. In some embodiments, each wing independently comprises at least eight natural phosphate linkages. In some embodiments, each wing independently comprises at least nine natural phosphate linkages. In some embodiments, each wing independently comprises at least ten natural phosphate linkages. In some embodiments, each wing independently comprises at least 11 natural phosphate linkages. In some embodiments, each wing independently comprises at least 12 natural phosphate linkages. In some embodiments, each wing independently comprises at least 13 natural phosphate linkages. In some embodiments, each wing independently comprises at least 14 natural phosphate linkages. In some embodiments, each wing independently comprises at least 15 natural phosphate linkages. In some embodiments, each wing independently comprises at least 16 natural phosphate linkages. In some embodiments, each wing independently comprises at least 17 natural phosphate linkages. In some embodiments, each wing independently comprises at least 18 natural phosphate linkages. In some embodiments, each wing independently comprises at least 19 natural phosphate linkages. In some embodiments, each wing independently comprises at least 20 natural phosphate linkages.

In some embodiments, each wing independently comprises one natural phosphate linkage. In some embodiments, each wing independently comprises two natural phosphate linkages. In some embodiments, each wing independently comprises three natural phosphate linkages. In some embodiments, each wing independently comprises four natural phosphate linkages. In some embodiments, each wing independently comprises five natural phosphate linkages. In some embodiments, each wing independently comprises six natural phosphate linkages. In some embodiments, each wing independently comprises seven natural phosphate linkages. In some embodiments, each wing independently comprises eight natural phosphate linkages. In some embodiments, each wing independently comprises nine natural phosphate linkages. In some embodiments, each wing independently comprises ten natural phosphate linkages. In some embodiments, each wing independently comprises 11 natural phosphate linkages. In some embodiments, each wing independently comprises 12 natural phosphate linkages. In some embodiments, each wing independently comprises 13 natural phosphate linkages. In some embodiments, each wing independently comprises 14 natural phosphate linkages. In some embodiments, each wing independently comprises 15 natural phosphate linkages. In some embodiments, each wing independently comprises 16 natural phosphate linkages. In some embodiments, each wing independently comprises 17 natural phosphate linkages. In some embodiments, each wing independently comprises 18 natural phosphate linkages. In some embodiments, each wing independently comprises 19 natural phosphate linkages. In some embodiments, each wing independently comprises 20 natural phosphate linkages.

In some embodiments, each wing independently comprises at least one consecutive natural phosphate linkage. In some embodiments, each wing independently comprises at least two consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least three consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least four consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least five consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least six consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least seven consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least eight consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least nine consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least ten consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 11 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 12 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 13 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 14 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 15 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 16 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 17 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 18 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 19 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises at least 20 consecutive natural phosphate linkages.

In some embodiments, each wing independently comprises one consecutive natural phosphate linkage. In some embodiments, each wing independently comprises two consecutive natural phosphate linkages. In some embodiments, each wing independently comprises three consecutive natural phosphate linkages. In some embodiments, each wing independently comprises four consecutive natural phosphate linkages. In some embodiments, each wing independently comprises five consecutive natural phosphate linkages. In some embodiments, each wing independently comprises six consecutive natural phosphate linkages. In some embodiments, each wing independently comprises seven consecutive natural phosphate linkages. In some embodiments, each wing independently comprises eight consecutive natural phosphate linkages. In some embodiments, each wing independently comprises nine consecutive natural phosphate linkages. In some embodiments, each wing independently comprises ten consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 11 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 12 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 13 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 14 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 15 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 16 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 17 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 18 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 19 consecutive natural phosphate linkages. In some embodiments, each wing independently comprises 20 consecutive natural phosphate linkages.

In some embodiments, a wing comprises only one chiral internucleotidic linkage. In some embodiments, a 5′-end wing comprises only one chiral internucleotidic linkage. In some embodiments, a 5′-end wing comprises only one chiral internucleotidic linkage at the 5′-end of the wing. In some embodiments, a 5′-end wing comprises only one chiral internucleotidic linkage at the 5′-end of the wing, and the chiral internucleotidic linkage is Rp. In some embodiments, a 5′-end wing comprises only one chiral internucleotidic linkage at the 5′-end of the wing, and the chiral internucleotidic linkage is Sp. In some embodiments, a 3′-end wing comprises only one chiral internucleotidic linkage at the 3′-end of the wing. In some embodiments, a 3′-end wing comprises only one chiral internucleotidic linkage at the 3′-end of the wing, and the chiral internucleotidic linkage is Rp. In some embodiments, a 3′-end wing comprises only one chiral internucleotidic linkage at the 3′-end of the wing, and the chiral internucleotidic linkage is Sp.

In some embodiments, a wing comprises two or more natural phosphate linkages. In some embodiments, all phosphate linkages within a wing are consecutive, and there are no non-phosphate linkages between any two phosphate linkages within a wing.

In some embodiments, a linkage connecting a wing and a core is considered part of the core when describing linkages, e.g., linkage chemistry, linkage stereochemistry, etc. For example, in WV-1092, mG* SmGmCmAmC*SA* SA*SG*SG*SG*SC S A*SC*RA*SG*SmAmCmUmU*SmC (SEQ ID NO: 15), the underlined linkages may be considered as part of the core (bold), its 5′-wing (having 2′-OMe on sugar moieties) has one single Sp phosphorothioate linkages at its 5′-end, its 3′-wing (having 2′-OMe on sugar moieties) has one Sp phosphorothioate linkage at its 3′-end, and its core has no 2′-modifications on sugar).

In some embodiments, a 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a modified linkage. In some embodiments, a 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a linkage having the structure of formula I. In some embodiments, a 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is phosphorothioate linkage. In some embodiments, a 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a substituted phosphorothioate linkage. In some embodiments, a 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a phosphorothioate triester linkage. In some embodiments, each 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a modified linkage. In some embodiments, each 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a linkage having the structure of formula I. In some embodiments, each 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is phosphorothioate linkage. In some embodiments, each 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a substituted phosphorothioate linkage. In some embodiments, each 5′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a phosphorothioate triester linkage.

In some embodiments, a 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a modified linkage. In some embodiments, a 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a linkage having the structure of formula I. In some embodiments, a 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is phosphorothioate linkage. In some embodiments, a 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a substituted phosphorothioate linkage. In some embodiments, a 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a phosphorothioate triester linkage. In some embodiments, each 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a modified linkage. In some embodiments, each 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a linkage having the structure of formula I. In some embodiments, each 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is phosphorothioate linkage. In some embodiments, each 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a substituted phosphorothioate linkage. In some embodiments, each 3′-internucleotidic linkage connected to a sugar moiety without a 2′-modification is a phosphorothioate triester linkage.

In some embodiments, both internucleotidic linkages connected to a sugar moiety without a 2′-modification are modified linkages. In some embodiments, both internucleotidic linkages connected to a sugar moiety without a 2′-modification are linkage having the structure of formula I. In some embodiments, both internucleotidic linkages connected to a sugar moiety without a 2′-modification are phosphorothioate linkages. In some embodiments, both internucleotidic linkages connected to a sugar moiety without a 2′-modification are substituted phosphorothioate linkages. In some embodiments, both internucleotidic linkages connected to a sugar moiety without a 2′-modification are phosphorothioate triester linkages. In some embodiments, each internucleotidic linkage connected to a sugar moiety without a 2′-modification is a modified linkage. In some embodiments, each internucleotidic linkage connected to a sugar moiety without a 2′-modification is a linkage having the structure of formula I. In some embodiments, each internucleotidic linkage connected to a sugar moiety without a 2′-modification is phosphorothioate linkage. In some embodiments, each internucleotidic linkage connected to a sugar moiety without a 2′-modification is a substituted phosphorothioate linkage. In some embodiments, each internucleotidic linkage connected to a sugar moiety without a 2′-modification is a phosphorothioate triester linkage.

In some embodiments, a sugar moiety without a 2′-modification is a sugar moiety found in a natural DNA nucleoside.

In some embodiments, for a wing-core-wing structure, the 5′-end wing comprises only one chiral internucleotidic linkage. In some embodiments, for a wing-core-wing structure, the 5′-end wing comprises only one chiral internucleotidic linkage at the 5′-end of the wing. In some embodiments, for a wing-core-wing structure, the 3′-end wing comprises only one chiral internucleotidic linkage. In some embodiments, for a wing-core-wing structure, the 3′-end wing comprises only one chiral internucleotidic linkage at the 3′-end of the wing. In some embodiments, for a wing-core-wing structure, each wing comprises only one chiral internucleotidic linkage. In some embodiments, for a wing-core-wing structure, each wing comprises only one chiral internucleotidic linkage, wherein the 5′-end wing comprises only one chiral internucleotidic linkage at its 5′-end; and the 3′-end wing comprises only one chiral internucleotidic linkage at its 3′-end. In some embodiments, the only chiral internucleotidic linkage in the 5′-wing is Rp. In some embodiments, the only chiral internucleotidic linkage in the 5′-wing is Sp. In some embodiments, the only chiral internucleotidic linkage in the 3′-wing is Rp. In some embodiments, the only chiral internucleotidic linkage in the 3′-wing is Sp. In some embodiments, the only chiral internucleotidic linkage in both the 5′- and the 3′-wings are Sp. In some embodiments, the only chiral internucleotidic linkage in both the 5′- and the 3′-wings are Rp. In some embodiments, the only chiral internucleotidic linkage in the 5′-wing is Sp, and the only chiral internucleotidic linkage in the 3′-wing is Rp. In some embodiments, the only chiral internucleotidic linkage in the 5′-wing is Rp, and the only chiral internucleotidic linkage in the 3′-wing is Sp.

In some embodiments, a wing comprises two chiral internucleotidic linkages. In some embodiments, a wing comprises only two chiral internucleotidic linkages, and one or more natural phosphate linkages. In some embodiments, a wing comprises only two chiral internucleotidic linkages, and two or more natural phosphate linkages. In some embodiments, a wing comprises only two chiral internucleotidic linkages, and two or more consecutive natural phosphate linkages. In some embodiments, a wing comprises only two chiral internucleotidic linkages, and two consecutive natural phosphate linkages. In some embodiments, a wing comprises only two chiral internucleotidic linkages, and three consecutive natural phosphate linkages. In some embodiments, a 5′-wing (to a core) comprises only two chiral internucleotidic linkages, one at its 5′-end and the other at its 3′-end, with one or more natural phosphate linkages in between. In some embodiments, a 5′-wing (to a core) comprises only two chiral internucleotidic linkages, one at its 5′-end and the other at its 3′-end, with two or more natural phosphate linkages in between. In some embodiments, a 3′-wing (to a core) comprises only two chiral internucleotidic linkages, one at its 3′-end and the other at its 3′-end, with one or more natural phosphate linkages in between. In some embodiments, a 3′-wing (to a core) comprises only two chiral internucleotidic linkages, one at its 3′-end and the other at its 3′-end, with two or more natural phosphate linkages in between.

In some embodiments, a 5′-wing comprises only two chiral internucleotidic linkages, one at its 5′-end and the other at its 3′-end, with one or more natural phosphate linkages in between, and the 3′-wing comprise only one internucleotidic linkage at its 3′-end. In some embodiments, a 5′-wing (to a core) comprises only two chiral internucleotidic linkages, one at its 5′-end and the other at its 3′-end, with two or more natural phosphate linkages in between, and the 3′-wing comprise only one internucleotidic linkage at its 3′-end. In some embodiments, each chiral internucleotidic linkage independently has its own stereochemistry. In some embodiments, both chiral internucleotidic linkages in the 5′-wing have the same stereochemistry. In some embodiments, both chiral internucleotidic linkages in the 5′-wing have different stereochemistry. In some embodiments, both chiral internucleotidic linkages in the 5′-wing are Rp. In some embodiments, both chiral internucleotidic linkages in the 5′-wing are Sp. In some embodiments, chiral internucleotidic linkages in the 5′- and 3′-wings have the same stereochemistry. In some embodiments, chiral internucleotidic linkages in the 5′- and 3′-wings are Rp. In some embodiments, chiral internucleotidic linkages in the 5′- and 3′-wings are Sp. In some embodiments, chiral internucleotidic linkages in the 5′- and 3′-wings have different stereochemistry.

In some embodiments, a core region has a length of one or more bases. In some embodiments, a core region has a length of two or more bases. In some embodiments, a core region has a length of three or more bases. In some embodiments, a core region has a length of four or more bases. In some embodiments, a core region has a length of five or more bases. In some embodiments, a core region has a length of six or more bases. In some embodiments, a core region has a length of seven or more bases. In some embodiments, a core region has a length of eight or more bases. In some embodiments, a core region has a length of nine or more bases. In some embodiments, a core region has a length of ten or more bases. In some embodiments, a core region has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or more bases. In certain embodiments, a core region has a length of 11 or more bases. In certain embodiments, a core region has a length of 12 or more bases. In certain embodiments, a core region has a length of 13 or more bases. In certain embodiments, a core region has a length of 14 or more bases. In certain embodiments, a core region has a length of 15 or more bases. In certain embodiments, a core region has a length of 16 or more bases. In certain embodiments, a core region has a length of 17 or more bases. In certain embodiments, a core region has a length of 18 or more bases. In certain embodiments, a core region has a length of 19 or more bases. In certain embodiments, a core region has a length of 20 or more bases. In certain embodiments, a core region has a length of more than 20 bases. In certain embodiments, a core region has a length of 2 bases. In certain embodiments, a core region has a length of 3 bases. In certain embodiments, a core region has a length of 4 bases. In certain embodiments, a core region has a length of 5 bases. In certain embodiments, a core region has a length of 6 bases. In certain embodiments, a core region has a length of 7 bases. In certain embodiments, a core region has a length of 8 bases. In certain embodiments, a core region has a length of 9 bases. In certain embodiments, a core region has a length of 10 bases. In certain embodiments, a core region has a length of 11 bases. In certain embodiments, a core region has a length of 12 bases. In certain embodiments, a core region has a length of 13 bases. In certain embodiments, a core region has a length of 14 bases. In certain embodiments, a core region has a length of 15 bases. In certain embodiments, a core region has a length of 16 bases. In certain embodiments, a core region has a length of 17 bases. In certain embodiments, a core region has a length of 18 bases. In certain embodiments, a core region has a length of 19 bases. In certain embodiments, a core region has a length of 20 bases.

In some embodiments, a core comprises one or more chiral internucleotidic linkages. In some embodiments, a core comprises one or more natural phosphate linkages. In some embodiments, a core independently comprises one or more chiral internucleotidic linkages and one or more natural phosphate linkages. In some embodiments, a core comprises no phosphate linkages. In some embodiments, each core linkage is a chiral internucleotidic linkage.

In some embodiments, a core comprises at least one natural phosphate linkage. In some embodiments, a core comprises at least two chiral internucleotidic linkages. In some embodiments, a core comprises at least three chiral internucleotidic linkages. In some embodiments, a core comprises at least four chiral internucleotidic linkages. In some embodiments, a core comprises at least five chiral internucleotidic linkages. In some embodiments, a core comprises at least six chiral internucleotidic linkages. In some embodiments, a core comprises at least seven chiral internucleotidic linkages. In some embodiments, a core comprises at least eight chiral internucleotidic linkages. In some embodiments, a core comprises at least nine chiral internucleotidic linkages. In some embodiments, a core comprises at least ten chiral internucleotidic linkages. In some embodiments, a core comprises at least 11 chiral internucleotidic linkages. In some embodiments, a core comprises at least 12 chiral internucleotidic linkages. In some embodiments, a core comprises at least 13 chiral internucleotidic linkages. In some embodiments, a core comprises at least 14 chiral internucleotidic linkages. In some embodiments, a core comprises at least 15 chiral internucleotidic linkages. In some embodiments, a core comprises at least 16 chiral internucleotidic linkages. In some embodiments, a core comprises at least 17 chiral internucleotidic linkages. In some embodiments, a core comprises at least 18 chiral internucleotidic linkages. In some embodiments, a core comprises at least 19 chiral internucleotidic linkages. In some embodiments, a core comprises at least 20 chiral internucleotidic linkages.

In some embodiments, a core comprises one natural phosphate linkage. In some embodiments, a core comprises two chiral internucleotidic linkages. In some embodiments, a core comprises three chiral internucleotidic linkages. In some embodiments, a core comprises four chiral internucleotidic linkages. In some embodiments, a core comprises five chiral internucleotidic linkages. In some embodiments, a core comprises six chiral internucleotidic linkages. In some embodiments, a core comprises seven chiral internucleotidic linkages. In some embodiments, a core comprises eight chiral internucleotidic linkages. In some embodiments, a core comprises nine chiral internucleotidic linkages. In some embodiments, a core comprises ten chiral internucleotidic linkages. In some embodiments, a core comprises 11 chiral internucleotidic linkages. In some embodiments, a core comprises 12 chiral internucleotidic linkages. In some embodiments, a core comprises 13 chiral internucleotidic linkages. In some embodiments, a core comprises 14 chiral internucleotidic linkages. In some embodiments, a core comprises 15 chiral internucleotidic linkages. In some embodiments, a core comprises 16 chiral internucleotidic linkages. In some embodiments, a core comprises 17 chiral internucleotidic linkages. In some embodiments, a core comprises 18 chiral internucleotidic linkages. In some embodiments, a core comprises 19 chiral internucleotidic linkages. In some embodiments, a core comprises 20 chiral internucleotidic linkages.

In some embodiments, a core region has a pattern of backbone chiral centers comprising (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein each of m, n, t and Np is independently as defined and described in the present disclosure. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Sp)m(Rp)n. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Sp)m(Rp)n, wherein m>2 and n is 1. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Rp)n(Sp)m. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Rp)n(Sp)m, wherein m>2 and n is 1. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Np)t(Rp)n(Sp)m. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Np)t(Rp)n(Sp)m, wherein m>2 and n is 1. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Np)t(Rp)n(Sp)m, wherein t>2, m>2 and n is 1. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Sp)t(Rp)n(Sp)m. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Sp)t(Rp)n(Sp)m, wherein m>2 and n is 1. In some embodiments, a core region has a pattern of backbone chiral centers comprising (Sp)t(Rp)n(Sp)m, wherein t>2, m>2 and n is 1. Among other things, the present disclosure demonstrates that, in some embodiments, such patterns can provide and/or enhance controlled cleavage, improved cleavage rate, selectivity, etc., of a target sequence, e.g., an RNA sequence. Example patterns of backbone chiral centers are described in the present disclosure.

In some embodiments, at least 60% of the chiral internucleotidic linkages in the core region are Sp. In some embodiments, at least 65% of the chiral internucleotidic linkages in the core region are Sp. In some embodiments, at least 66% of the chiral internucleotidic linkages in the core region are Sp. In some embodiments, at least 67% of the chiral internucleotidic linkages in the core region are Sp. In some embodiments, at least 70% of the chiral internucleotidic linkages in the core region are Sp. In some embodiments, at least 75% of the chiral internucleotidic linkages in the core region are Sp. In some embodiments, at least 80% of the chiral internucleotidic linkages in the core region are Sp. In some embodiments, at least 85% of the chiral internucleotidic linkages in the core region are Sp. In some embodiments, at least 90% of the chiral internucleotidic linkages in the core region are Sp. In some embodiments, at least 95% of the chiral internucleotidic linkages in the core region are Sp.

In some embodiments, a wing-core-wing (i.e., X—Y—X) motif is represented numerically as, e.g., 5-10-4, meaning the wing to the 5′-end of the core is 5 bases in length, the core region is 10 bases in length, and the wing region to the 3′-end of the core is 4-bases in length. In some embodiments, a wing-core-wing motif is any of, e.g. 2-16-2, 3-14-3, 4-12-4, 5-10-5, 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-3, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5- 7-5, 5-8-6, 8-7-5, 7-7-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, and 6-9-2, etc. In certain embodiments, a wing-core-wing motif is 5-10-5. In certain embodiments, a wing-core-wing motif is 7-7-6. In certain embodiments, a wing-core-wing motif is 8-7-5.

In some embodiments, a wing-core motif is 5-15, 6-14, 7-13, 8-12, 9-12, etc. In some embodiments, a core-wing motif is 5-15, 6-14, 7-13, 8-12, 9-12, etc.

In some embodiments, the internucleosidic linkages of provided oligonucleotides of such wing-core-wing (i.e., X—Y—X) motifs are all chiral, modified phosphate linkages. In some embodiments, the internucleosidic linkages of provided oligonucleotides of such wing-core-wing (i.e., X—Y—X) motifs are all chiral phosphorothioate internucleotidic linkages. In some embodiments, chiral internucleotidic linkages of provided oligonucleotides of such wing-core-wing motifs are at least about 10, 20, 30, 40, 50, 50, 70, 80, or 90% chiral, modified phosphate internucleotidic linkages. In some embodiments, chiral internucleotidic linkages of provided oligonucleotides of such wing-core-wing motifs are at least about 10, 20, 30, 40, 50, 60, 70, 80, or 90% chiral phosphorothioate internucleotidic linkages. In some embodiments, chiral internucleotidic linkages of provided oligonucleotides of such wing-core-wing motifs are at least about 10, 20, 30, 40, 50, 50, 70, 80, or 90% chiral phosphorothioate internucleotidic linkages of the Sp conformation.

In some embodiments, each wing region of a wing-core-wing motif optionally contains chiral, modified phosphate internucleotidic linkages. In some embodiments, each wing region of a wing-core-wing motif optionally contains chiral phosphorothioate internucleotidic linkages. In some embodiments, each wing region of a wing-core-wing motif contains chiral phosphorothioate internucleotidic linkages. In some embodiments, the two wing regions of a wing-core-wing motif have the same internucleotidic linkage stereochemistry. In some embodiments, the two wing regions have different internucleotidic linkage stereochemistry. In some embodiments, each internucleotidic linkage in the wings is independently a chiral internucleotidic linkage.

In some embodiments, the core region of a wing-core-wing motif optionally contains chiral, modified phosphate internucleotidic linkages. In some embodiments, the core region of a wing-core-wing motif optionally contains chiral phosphorothioate internucleotidic linkages. In some embodiments, the core region of a wing-core-wing motif comprises a repeating pattern of internucleotidic linkage stereochemistry. In some embodiments, the core region of a wing-core-wing motif has a repeating pattern of internucleotidic linkage stereochemistry. In some embodiments, the core region of a wing-core-wing motif comprises repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is (Sp)mRp or Rp(Sp)m, wherein m is 1-50. In some embodiments, the core region of a wing-core-wing motif comprises repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is (Sp)mRp or Rp(Sp)m, wherein m is 1-50. In some embodiments, the core region of a wing-core-wing motif comprises repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is (Sp)mRp, wherein m is 1-50. In some embodiments, the core region of a wing-core-wing motif comprises repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is Rp(Sp)m, wherein m is 1-50. In some embodiments, the core region of a wing-core-wing motif has repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is (Sp)mRp or Rp(Sp)m, wherein m is 1-50. In some embodiments, the core region of a wing-core-wing motif has repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is (Sp)mRp, wherein m is 1-50. In some embodiments, the core region of a wing-core-wing motif has repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is Rp(Sp)m, wherein m is 1-50. In some embodiments, the core region of a wing-core-wing motif has repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is a motif comprising at least 33% of internucleotidic linkage in the S conformation. In some embodiments, the core region of a wing-core-wing motif has repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is a motif comprising at least 50% of internucleotidic linkage in the S conformation. In some embodiments, the core region of a wing-core-wing motif has repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is a motif comprising at least 66% of internucleotidic linkage in the S conformation. In some embodiments, the core region of a wing-core-wing motif has repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is a repeating triplet motif selected from RpRpSp and SpSpRp. In some embodiments, the core region of a wing-core-wing motif has repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is a repeating RpRpSp. In some embodiments, the core region of a wing-core-wing motif has repeating pattern of internucleotidic linkage stereochemistry, wherein the repeating pattern is a repeating SpSpRp.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Sp)mRp or Rp(Sp)m. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises Rp(Sp)m. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Sp)mRp. In some embodiments, m is 2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises Rp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Sp)2Rp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Rp)2Rp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises RpSpRp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises SpRpRp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Sp)2Rp.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)mRp or Rp(Sp)m. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises Rp(Sp)m. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)mRp. In some embodiments, m is 2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises Rp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)2Rp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Rp)2Rp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises RpSpRp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises SpRpRp(Sp)2. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)2Rp.

As defined herein, m is 1-50. In some embodiments, m is 1. In some embodiments, m is 2-50. In some embodiments, m is 2, 3, 4, 5, 6, 7 or 8. In some embodiments, m is 3, 4, 5, 6, 7 or 8. In some embodiments, m is 4, 5, 6, 7 or 8. In some embodiments, m is 5, 6, 7 or 8. In some embodiments, m is 6, 7 or 8. In some embodiments, m is 7 or 8. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5. In some embodiments, m is 6. In some embodiments, m is 7. In some embodiments, m is 8. In some embodiments, m is 9. In some embodiments, m is 10. In some embodiments, m is 11. In some embodiments, m is 12. In some embodiments, m is 13. In some embodiments, m is 14. In some embodiments, m is 15. In some embodiments, m is 16. In some embodiments, m is 17. In some embodiments, m is 18. In some embodiments, m is 19. In some embodiments, m is 20. In some embodiments, m is 21. In some embodiments, m is 22. In some embodiments, m is 23. In some embodiments, m is 24. In some embodiments, m is 25. In some embodiments, m is greater than 25.

In some embodiments, a repeating pattern is (Sp)m(Rp)n, wherein n is 1-10, and m is independently as defined above and described herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)m(Rp)n. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Sp)m(Rp)n. In some embodiments, a repeating pattern is (Rp)n(Sp)m, wherein n is 1-10, and m is independently as defined above and described herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Rp)n(Sp)m. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Rp)n(Sp)m. In some embodiments, (Rp)n(Sp)m is (Rp)(Sp)2. In some embodiments, (Sp)n(Rp)m is (Sp)2(Rp).

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)m(Rp)n(Sp)t. In some embodiments, a repeating pattern is (Sp)m(Rp)n(Sp)t, wherein n is 1-10, t is 1-50, and m is as defined above and described herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Sp)m(Rp)n(Sp)t. In some embodiments, a repeating pattern is (Sp)t(Rp)n(Sp)m, wherein n is 1-10, t is 1-50, and m is as defined above and described herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Sp)t(Rp)n(Sp)m. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Sp)t(Rp)n(Sp)m.

In some embodiments, a repeating pattern is (Np)t(Rp)n(Sp)m, wherein n is 1-10, t is 1-50, Np is independently Rp or Sp, and m is as defined above and described herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Np)t(Rp)n(Sp)m. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Np)t(Rp)n(Sp)m. In some embodiments, a repeating pattern is (Np)m(Rp)n(Sp)t, wherein n is 1-10, t is 1-50, Np is independently Rp or Sp, and m is as defined above and described herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers comprises (Np)m(Rp)n(Sp)t. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide type whose pattern of backbone chiral centers in the core region comprises (Np)m(Rp)n(Sp)t. In some embodiments, Np is Rp. In some embodiments, Np is Sp. In some embodiments, all Np are the same. In some embodiments, all Np are Sp. In some embodiments, at least one Np is different from the other Np. In some embodiments, t is 2.

As defined herein, n is 1-10. In some embodiments, n is 1, 2, 3, 4, 5, 6, 7 or 8. In some embodiments, n is 1. In some embodiments, n is 2, 3, 4, 5, 6, 7 or 8. In some embodiments, n is 3, 4, 5, 6, 7 or 8. In some embodiments, n is 4, 5, 6, 7 or 8. In some embodiments, n is 5, 6, 7 or 8. In some embodiments, n is 6, 7 or 8. In some embodiments, n is 7 or 8. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6. In some embodiments, n is 7. In some embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10.

As defined herein, t is 1-50. In some embodiments, t is 1. In some embodiments, t is 2-50. In some embodiments, t is 2, 3, 4, 5, 6, 7 or 8. In some embodiments, t is 3, 4, 5, 6, 7 or 8. In some embodiments, t is 4, 5, 6, 7 or 8. In some embodiments, t is 5, 6, 7 or 8. In some embodiments, t is 6, 7 or 8. In some embodiments, t is 7 or 8. In some embodiments, t is 2. In some embodiments, t is 3. In some embodiments, t is 4. In some embodiments, t is 5. In some embodiments, t is 6. In some embodiments, t is 7. In some embodiments, t is 8. In some embodiments, t is 9. In some embodiments, t is 10. In some embodiments, t is 11. In some embodiments, t is 12. In some embodiments, t is 13. In some embodiments, t is 14. In some embodiments, t is 15. In some embodiments, t is 16. In some embodiments, t is 17. In some embodiments, t is 18. In some embodiments, t is 19. In some embodiments, t is 20. In some embodiments, t is 21. In some embodiments, t is 22. In some embodiments, t is 23. In some embodiments, t is 24. In some embodiments, t is 25. In some embodiments, t is greater than 25.

In some embodiments, at least one of m and t is greater than 2. In some embodiments, at least one of m and t is greater than 3. In some embodiments, at least one of m and t is greater than 4. In some embodiments, at least one of m and t is greater than 5. In some embodiments, at least one of m and t is greater than 6. In some embodiments, at least one of m and t is greater than 7. In some embodiments, at least one of m and t is greater than 8. In some embodiments, at least one of m and t is greater than 9. In some embodiments, at least one of m and t is greater than 10. In some embodiments, at least one of m and t is greater than 11. In some embodiments, at least one of m and t is greater than 12. In some embodiments, at least one of m and t is greater than 13. In some embodiments, at least one of m and t is greater than 14. In some embodiments, at least one of m and t is greater than 15. In some embodiments, at least one of m and t is greater than 16. In some embodiments, at least one of m and t is greater than 17. In some embodiments, at least one of m and t is greater than 18. In some embodiments, at least one of m and t is greater than 19. In some embodiments, at least one of m and t is greater than 20. In some embodiments, at least one of m and t is greater than 21. In some embodiments, at least one of m and t is greater than 22. In some embodiments, at least one of m and t is greater than 23. In some embodiments, at least one of m and t is greater than 24. In some embodiments, at least one of m and t is greater than 25.

In some embodiments, each one of m and t is greater than 2. In some embodiments, each one of m and t is greater than 3. In some embodiments, each one of m and t is greater than 4. In some embodiments, each one of m and t is greater than 5. In some embodiments, each one of m and t is greater than 6. In some embodiments, each one of m and t is greater than 7. In some embodiments, each one of m and t is greater than 8. In some embodiments, each one of m and t is greater than 9. In some embodiments, each one of m and t is greater than 10. In some embodiments, each one of m and t is greater than 11. In some embodiments, each one of m and t is greater than 12. In some embodiments, each one of m and t is greater than 13. In some embodiments, each one of m and t is greater than 14. In some embodiments, each one of m and t is greater than 15. In some embodiments, each one of m and t is greater than 16. In some embodiments, each one of m and t is greater than 17. In some embodiments, each one of m and t is greater than 18. In some embodiments, each one of m and t is greater than 19. In some embodiments, each one of m and t is greater than 20.

In some embodiments, the sum of m and t is greater than 3. In some embodiments, the sum of m and t is greater than 4. In some embodiments, the sum of m and t is greater than 5. In some embodiments, the sum of m and t is greater than 6. In some embodiments, the sum of m and t is greater than 7. In some embodiments, the sum of m and t is greater than 8. In some embodiments, the sum of m and t is greater than 9. In some embodiments, the sum of m and t is greater than 10. In some embodiments, the sum of m and t is greater than 11. In some embodiments, the sum of m and t is greater than 12. In some embodiments, the sum of m and t is greater than 13. In some embodiments, the sum of m and t is greater than 14. In some embodiments, the sum of m and t is greater than 15. In some embodiments, the sum of m and t is greater than 16. In some embodiments, the sum of m and t is greater than 17. In some embodiments, the sum of m and t is greater than 18. In some embodiments, the sum of m and t is greater than 19. In some embodiments, the sum of m and t is greater than 20. In some embodiments, the sum of m and t is greater than 21. In some embodiments, the sum of m and t is greater than 22. In some embodiments, the sum of m and t is greater than 23. In some embodiments, the sum of m and t is greater than 24. In some embodiments, the sum of m and t is greater than 25.

In some embodiments, n is 1, and at least one of m and t is greater than 1. In some embodiments, n is 1 and each of m and t is independently greater than 1. In some embodiments, m>n and t>n. In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp)2Rp(Sp)2. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)2Rp(Sp)2. In some embodiments, (Sp)t(Rp)n(Sp)m is SpRp(Sp)2. In some embodiments, (Np)t(Rp)n(Sp)m is (Np)tRp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is (Np)2Rp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is (Rp)2Rp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is (Sp)2Rp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is RpSpRp(Sp)m. In some embodiments, (Np)t(Rp)n(Sp)m is SpRpRp(Sp)m.

In some embodiments, (Sp)t(Rp)n(Sp)m is SpRpSpSp. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)2Rp(Sp)2. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)3Rp(Sp)3. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)4Rp(Sp)4. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)tRp(Sp)5. In some embodiments, (Sp)t(Rp)n(Sp)m is SpRp(Sp)5. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)2Rp(Sp)5. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)3Rp(Sp)5. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)4Rp(Sp)5. In some embodiments, (Sp)t(Rp)n(Sp)m is (Sp)5Rp(Sp)5.

In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp)2Rp(Sp)2. In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp)3Rp(Sp)3. In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp)4Rp(Sp)4. In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp)mRp(Sp)5. In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp)2Rp(Sp)5. In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp)3Rp(Sp)5. In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp)4Rp(Sp)5. In some embodiments, (Sp)m(Rp)n(Sp)t is (Sp)5Rp(Sp)5.

In some embodiments, the core region comprises at least one Rp internucleotidic linkage. In some embodiments, the core region of a wing-core-wing motif comprises at least one Rp internucleotidic linkage. In some embodiments, a core region comprises at least one Rp phosphorothioate internucleotidic linkage. In some embodiments, the core region of a wing-core-wing motif comprises at least one Rp phosphorothioate internucleotidic linkage. In some embodiments, the core region of a wing-core-wing motif comprises only one Rp phosphorothioate internucleotidic linkage. In some embodiments, a core region motif comprises at least two Rp internucleotidic linkages. In some embodiments, the core region of a wing-core-wing motif comprises at least two Rp internucleotidic linkages. In some embodiments, the core region of a wing-core-wing motif comprises at least two Rp phosphorothioate internucleotidic linkages. In some embodiments, a core region comprises at least three Rp internucleotidic linkages. In some embodiments, the core region of a wing-core-wing motif comprises at least three Rp internucleotidic linkages. In some embodiments, the core region comprises at least three Rp phosphorothioate internucleotidic linkages. In some embodiments, the core region of a wing-core-wing motif comprises at least three Rp phosphorothioate internucleotidic linkages. In some embodiments, a core region comprises at least 4, 5, 6, 7, 8, 9, or 10 Rp internucleotidic linkages. In some embodiments, the core region of a wing-core-wing motif comprises at least 4, 5, 6, 7, 8, 9, or 10 Rp internucleotidic linkages. In some embodiments, a core region comprises at least 4, 5, 6, 7, 8, 9, or 10 Rp phosphorothioate internucleotidic linkages. In some embodiments, the core region of a wing-core-wing motif comprises at least 4, 5, 6, 7, 8, 9, or 10 Rp phosphorothioate internucleotidic linkages.

In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each wing region are 2′-modified residues. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each wing region are 2′-OR-modified residues. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each wing region are 2′-MOE-modified residues. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each wing region are 2′-OMe-modified residues. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues in the core region are 2′-deoxyribonucleoside residues. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif, wherein all internucleotidic linkages are phosphorothioate linkages. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif, wherein all internucleotidic linkages are chiral phosphorothioate linkages. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each wing region are 2′-modified residues, the residues in the core region are 2′-deoxyribonucleoside residues, and all internucleotidic linkages in the core region are chiral phosphorothioate linkages. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each wing region are 2′-OR-modified residues, the residues in the core region are 2′-deoxyribonucleoside residues, and all internucleotidic linkages in the core region are chiral phosphorothioate linkages. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each wing region are 2′-MOE-modified residues, the residues in the core region are 2′-deoxyribonucleoside residues, and all internucleotidic linkages in the core region are chiral phosphorothioate linkages. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each wing region are 2′-OMe-modified residues, the residues in the core region are 2′-deoxyribonucleoside residues, and all internucleotidic linkages in the core region are chiral phosphorothioate linkages.

In some embodiments, residues at the “X” wing region are not 2′-MOE-modified residues. In certain embodiments, a wing-core motif is a motif wherein the residues at the “X” wing region are not 2′-MOE-modified residues. In certain embodiments, a core-wing motif is a motif wherein the residues at the “X” wing region are not 2′-MOE-modified residues. In certain embodiments, a wing-core-wing motif is a motif wherein the residues at each “X” wing region are not 2′-MOE-modified residues. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each “X” wing region are not 2′-MOE-modified residues. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues in the core “Y” region are 2′-deoxyribonucleoside residues. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif, wherein all internucleotidic linkages are phosphorothioate internucleotidic linkages. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif, wherein all internucleotidic linkages are chiral phosphorothioate internucleotidic linkages. In certain embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the residues at each “X” wing region are not 2′-MOE-modified residues, the residues in the core “Y” region are 2′-deoxyribonucleoside, and all internucleotidic linkages are chiral phosphorothioate internucleotidic linkages.

As understood by a person having ordinary skill in the art, provided oligonucleotides and compositions, among other things, can target a great number of nucleic acid polymers. For instance, in some embodiments, provided oligonucleotides and compositions may target a transcript of a nucleic acid sequence, wherein a common base sequence of oligonucleotides (e.g., a base sequence of an oligonucleotide type) comprises or is a sequence complementary to a sequence of the transcript. In some embodiments, a common base sequence comprises a sequence complimentary to a sequence of a target. In some embodiments, a common base sequence is a sequence complimentary to a sequence of a target. In some embodiments, a common base sequence comprises or is a sequence 100% complimentary to a sequence of a target. In some embodiments, a common base sequence comprises a sequence 100% complimentary to a sequence of a target. In some embodiments, a common base sequence is a sequence 100% complimentary to a sequence of a target. In some embodiments, a common base sequence in a core comprises or is a sequence complimentary to a sequence of a target. In some embodiments, a common base sequence in a core comprises a sequence complimentary to a sequence of a target. In some embodiments, a common base sequence in a core is a sequence % complimentary to a sequence of a target. In some embodiments, a common base sequence in a core comprises or is a sequence 100% complimentary to a sequence of a target. In some embodiments, a common base sequence in a core comprises a sequence 100% complimentary to a sequence of a target. In some embodiments, a common base sequence in a core is a sequence 100% complimentary to a sequence of a target.

In some embodiments, as described in this disclosure, provided oligonucleotides and compositions may provide new cleavage patterns, higher cleavage rate, higher cleavage degree, higher cleavage selectivity, etc. In some embodiments, provided compositions can selectively suppress (e.g., cleave) a transcript from a target nucleic acid sequence which has one or more similar sequences exist within a subject or a population, each of the target and its similar sequences contains a specific nucleotidic characteristic sequence element that defines the target sequence relative to the similar sequences. In some embodiments, for example, a target sequence is a wild-type allele or copy of a gene, and a similar sequence is a sequence has very similar base sequence, e.g., a sequence having SNP, mutations, etc.; In some embodiments, a characteristic sequence element defines that target sequence relative to the similar sequence: for example, when a target sequence is a Huntington's disease-associated allele with T at rs362307 (U in the corresponding RNA; C for the non-disease-associated allele), a characteristic sequence comprises this SNP.

In some embodiments, a similar sequence has greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology with a target sequence. In some embodiments, a target sequence is a disease-causing copy of a nucleic acid sequence comprising one or more mutations and/or SNPs, and a similar sequence is a copy not causing the disease (wild type). In some embodiments, a target sequence comprises a mutation, wherein a similar sequence is the corresponding wild-type sequence. In some embodiments, a target sequence is a mutant allele, while a similar sequence is a wild-type allele. In some embodiments, a target sequence comprises a SNP that is associated with a disease-causing allele, while a similar sequence comprises the same SNP that is not associated with the disease-causing allele. In some embodiments, the region of a target sequence that is complementary to a common base sequence of a provided oligonucleotide composition has greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology with the corresponding region of a similar sequence. In some embodiments, the region of a target sequence that is complementary to a common base sequence of a provided oligonucleotide composition differs from the corresponding region of a similar sequence at less than 5, less than 4, less than 3, less than 2, or only 1 base pairs. In some embodiments, the region of a target sequence that is complementary to a common base sequence of a provided oligonucleotide composition differs from the corresponding region of a similar sequence only at a mutation site or SNP site. In some embodiments, the region of a target sequence that is complementary to a common base sequence of a provided oligonucleotide composition differs from the corresponding region of a similar sequence only at a mutation site. In some embodiments, the region of a target sequence that is complementary to a common base sequence of a provided oligonucleotide composition differs from the corresponding region of a similar sequence only at a SNP site.

In some embodiments, a common base sequence comprises or is a sequence complementary to a characteristic sequence element. In some embodiments, a common base sequence comprises a sequence complementary to a characteristic sequence element. In some embodiments, a common base sequence is a sequence complementary to a characteristic sequence element. In some embodiments, a common base sequence comprises or is a sequence 100% complementary to a characteristic sequence element. In some embodiments, a common base sequence comprises a sequence 100% complementary to a characteristic sequence element. In some embodiments, a common base sequence is a sequence 100% complementary to a characteristic sequence element. In some embodiments, a common base sequence in a core comprises or is a sequence complementary to a characteristic sequence element. In some embodiments, a common base sequence in a core comprises a sequence complementary to a characteristic sequence element. In some embodiments, a common base sequence in a core is a sequence complementary to a characteristic sequence element. In some embodiments, a common base sequence in a core comprises or is a sequence 100% complementary to a characteristic sequence element. In some embodiments, a common base sequence in a core comprises a sequence 100% complementary to a characteristic sequence element. In some embodiments, a common base sequence in a core is a sequence 100% complementary to a characteristic sequence element.

In some embodiments, a characteristic sequence element comprises or is a mutation. In some embodiments, a characteristic sequence element comprises a mutation. In some embodiments, a characteristic sequence element is a mutation. In some embodiments, a characteristic sequence element comprises or is a point mutation. In some embodiments, a characteristic sequence element comprises a point mutation. In some embodiments, a characteristic sequence element is a point mutation. In some embodiments, a characteristic sequence element comprises or is a SNP. In some embodiments, a characteristic sequence element comprises a SNP. In some embodiments, a characteristic sequence element is a SNP.

In some embodiments, a common base sequence 100% matches a target sequence, which it does not 100% match a similar sequence of the target sequence. For example, in some embodiments, a common base sequence matches a mutation in the disease-causing copy or allele of a target nucleic acid sequence, but does not match a non-disease-causing copy or allele at the mutation site; in some other embodiments, a common base sequence matches a SNP in the disease-causing allele of a target nucleic acid sequence, but does not match a non-disease-causing allele at the corresponding site. In some embodiments, a common base sequence in a core 100% matches a target sequence, which it does not 100% match a similar sequence of the target sequence. For example, in WV-1092, its common base sequence (and its common base sequence in its core) matches the disease-associated U, but not the non-disease-associated (wild-type) C at rs362307.

Among other things, the present disclosure recognizes that a base sequence may have impact on oligonucleotide properties. In some embodiments, a base sequence may have impact on cleavage pattern of a target when oligonucleotides having the base sequence are utilized for suppressing a target, e.g., through a pathway involving RNase H: for example, FIG. 33 demonstrates that structurally similar (all phosphorothioate linkages, all stereorandom) oligonucleotides have different sequences may have different cleavage patterns. In some embodiments, a common base sequence of a non-stereorandom oligonucleotide compositions (e.g., certain oligonucleotide compositions provided in the present disclosure) is a base sequence that when applied to a DNA oligonucleotide composition (e.g., ONT-415) or a stereorandom all-phosphorothioate oligonucleotide composition (e.g., WV-905), cleavage pattern of the DNA (DNA cleavage pattern) and/or the stereorandom all-phosphorothioate (stereorandom cleavage pattern) composition has a cleavage site within or in the vicinity of a characteristic sequence element. In some embodiments, a cleavage site within or in the vicinity is within a sequence complementary to a core region of a common sequence. In some embodiments, a cleavage site within or in the vicinity is within a sequence 100% complementary to a core region of a common sequence.

In some embodiments, a common base sequence is a base sequence that has a cleavage site within or in the vicinity of a characteristic sequence element in its DNA cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site within a characteristic sequence element in its DNA cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a characteristic sequence element in its DNA cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a mutation or SNP of a characteristic sequence element in its DNA cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a mutation in its DNA cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a SNP in its DNA cleavage pattern.

In some embodiments, a common base sequence is a base sequence that has a cleavage site within or in the vicinity of a characteristic sequence element in its stereorandom cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site within a characteristic sequence element in its stereorandom cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a characteristic sequence element in its stereorandom cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a mutation or SNP of a characteristic sequence element in its stereorandom cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a mutation in its stereorandom cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a SNP in its stereorandom cleavage pattern.

In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a mutation of a characteristic sequence element in its DNA and/or stereorandom cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a mutation in its DNA and/or stereorandom cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a mutation in its DNA cleavage pattern. In some embodiments, a cleavage site in the vicinity of a mutation is at a mutation, i.e., a cleavage site is at the internucleotidic linkage of a mutated nucleotide (e.g., if a mutation is at A in the target sequence of GGGACGTCTT (SEQ ID NO: 16), the cleavage is between A and C). In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 internucleotidic linkages away from a mutation, where 0 means cleavage at the mutation site (e.g., if a mutation is at A in the target sequence of GGGACGTCTT (SEQ ID NO: 16), the cleavage is between A and C for 0 internucleotidic linkage away; a cleavage site 1 internucleotidic linkage away from the mutation is between G and A to the 5′ from the mutation or between C and G to the 3′ from the mutation). In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, or 3 internucleotidic linkages away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, or 3 internucleotidic linkages away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, or 3 internucleotidic linkages away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, or 2 internucleotidic linkages away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, or 2 internucleotidic linkages away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, or 2 internucleotidic linkages away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0 or 1 internucleotidic linkage away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0 or 1 internucleotidic linkage away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0 or 1 internucleotidic linkage away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site 0 internucleotidic linkage away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site one internucleotidic linkage away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site one internucleotidic linkage away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site one internucleotidic linkage away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site two internucleotidic linkages away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site two internucleotidic linkages away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site two internucleotidic linkages away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site three internucleotidic linkages away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site three internucleotidic linkages away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site three internucleotidic linkages away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site four internucleotidic linkages away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site four internucleotidic linkages away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site four internucleotidic linkages away to the 3′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site five internucleotidic linkages away from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site five internucleotidic linkages away to the 5′ from a mutation. In some embodiments, a cleavage site in the vicinity is a cleavage site five internucleotidic linkages away to the 3′ from a mutation.

In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a SNP of a characteristic sequence element in its DNA and/or stereorandom cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a SNP in its DNA and/or stereorandom cleavage pattern. In some embodiments, a common base sequence is a base sequence that has a cleavage site in the vicinity of a SNP in its DNA cleavage pattern. In some embodiments, a cleavage site in the vicinity of a SNP is at a SNP, i.e., a cleavage site is at the internucleotidic linkage of a nucleotide at a SNP (e.g., for the target of WV-905, G*G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C (SEQ ID NO: 17), which comprises rUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID NO: 18) (rs362307 bolded), the cleavage is between the bolded rU and the underlined rG immediately after it). In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 internucleotidic linkages away from a SNP, where 0 means cleavage at a SNP (e.g., for the target of WV-905, G*G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C (SEQ ID NO: 17), which comprises rUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID NO: 18) (rs362307 bolded), the cleavage is between the bolded rU and the underlined rG immediately after it for 0 internucleotidic linkage away; a cleavage site 1 internucleotidic linkage away from a SNP is between the rG and rU to the 5′ from the SNP (underlined: rUrUrUrGrGrArArGrUrCrUrGrUrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID NO: 18)), or between rG and rC to the 3′-end of the SNP (underlined: rUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID NO: 18))). In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, or 3 internucleotidic linkages away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, or 3 internucleotidic linkages away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, or 3 internucleotidic linkages away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, or 2 internucleotidic linkages away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, or 2 internucleotidic linkages away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, or 2 internucleotidic linkages away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0 or 1 internucleotidic linkage away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0 or 1 internucleotidic linkage away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0 or 1 internucleotidic linkage away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site 0 internucleotidic linkage away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site one internucleotidic linkage away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site one internucleotidic linkage away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site one internucleotidic linkage away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site two internucleotidic linkages away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site two internucleotidic linkages away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site two internucleotidic linkages away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site three internucleotidic linkages away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site three internucleotidic linkages away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site three internucleotidic linkages away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site four internucleotidic linkages away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site four internucleotidic linkages away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site four internucleotidic linkages away to the 3′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site five internucleotidic linkages away from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site five internucleotidic linkages away to the 5′ from a SNP. In some embodiments, a cleavage site in the vicinity is a cleavage site five internucleotidic linkages away to the 3′ from a SNP. For example, FIG. 33 demonstrates that stereorandom cleavage pattern of the WV-905 sequence has cleavage sites at the SNP (between CUGU and GCCC), two internucleotidic linkages away (between GUCU and GUGC, and between GUGC and CCUU), three internucleotidic linkages away (between UGCC and CUUG); four internucleotidic linkages away (between GCCC and UUGU, and AAGU and CUGU), and five internucleotidic linkages away (between CCCU and UGUG).

In some embodiments, a cleavage site within or in the vicinity of a characteristic sequence element, e.g., in the vicinity of a mutation, a SNP, etc., is a major cleavage site of a DNA and/or stereorandom cleavage pattern. In some embodiments, a cleavage site within or in the vicinity of a characteristic sequence element is a major cleavage site of a DNA cleavage pattern. In some embodiments, a cleavage site within or in the vicinity of a characteristic sequence element is a major cleavage site of a stereorandom cleavage pattern. In some embodiments, a cleavage site in the vicinity of a mutation is a major cleavage site of a DNA cleavage pattern. In some embodiments, a cleavage site in the vicinity of a mutation is a major cleavage site of a stereorandom cleavage pattern. In some embodiments, a cleavage site in the vicinity of a SNP is a major cleavage site of a DNA cleavage pattern. In some embodiments, a cleavage site in the vicinity of a SNP is a major cleavage site of a stereorandom cleavage pattern. In some embodiments, a major cleavage site is within a sequence complementary to a core region of a common sequence. In some embodiments, a major cleavage site is within a sequence 100% complementary to a core region of a common sequence.

In some embodiments, a major cleavage site is a site having the most, or the second, third, fourth or fifth most cleavage. In some embodiments, a major cleavage site is a site having the most, or the second, third, or fourth most cleavage. In some embodiments, a major cleavage site is a site having the most, or the second, or third most cleavage. In some embodiments, a major cleavage site is a site having the most or the second most cleavage. In some embodiments, a major cleavage site is a site having the most cleavage. In some embodiments, a major cleavage site is a site having the second most cleavage. In some embodiments, a major cleavage site is a site having the third most cleavage. In some embodiments, a major cleavage site is a site having the fourth most cleavage. In some embodiments, a major cleavage site is a site having the fifth most cleavage.

In some embodiments, a major cleavage site is a site wherein greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 5% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 10% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 15% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 20% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 25% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 30% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 35% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 40% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 45% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 50% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 55% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 60% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 65% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 70% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 75% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 80% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 85% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 90% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 91% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 92% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 93% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 94% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 95% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 96% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 97% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 98% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein greater than 99% of cleavage occurs. In some embodiments, a major cleavage site is a site wherein 100% of cleavage occurs.

In some embodiments, a major cleavage site is a site wherein greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 5% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 10% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 15% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 20% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 25% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 30% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 35% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 40% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 45% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 50% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 55% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 60% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 65% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 70% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 75% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 80% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 85% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 90% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 91% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 92% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 93% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 94% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 95% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 96% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 97% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 98% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein greater than 99% of a target is cleaved. In some embodiments, a major cleavage site is a site wherein 100% of a target is cleaved. In some embodiments, a cleavage pattern may not have a major cleavage site as no site reaches an absolute cleavage threshold level.

As a person having ordinary skill in the art understands, various methods may be useful for generating cleavage patterns and/or identify cleavage sites, including major cleavage site. In some embodiments, an example of such an assay is an RNase cleavage assay as described herein; for example results, see FIG. 33, FIG. 34, etc.

In some embodiments, the present disclosure recognizes location effects of a sequence motif complementary to a characteristic sequence element. In some embodiments, the present disclosure recognizes location effects of a sequence motif complementary to a mutation. In some embodiments, the present disclosure recognizes location effects of a sequence motif complementary to a SNP.

In some embodiments, position 11, 12 or 13 of a sequence as counted from its 5′-terminus aligns with a characteristic sequence element. In some embodiments, position 11 of a sequence as counted from its 5′-terminus aligns with a characteristic sequence element. In some embodiments, position 12 of a sequence as counted from its 5′-terminus aligns with a characteristic sequence element. In some embodiments, position 13 of a sequence as counted from its 5′-terminus aligns with a characteristic sequence element. In some embodiments, position 8, 9 or 10 of a sequence as counted from its 3′-terminus aligns with a characteristic sequence element. In some embodiments, position 8 of a sequence as counted from its 3′-terminus aligns with a characteristic sequence element. In some embodiments, position 9 of a sequence as counted from its 3′-terminus aligns with a characteristic sequence element. In some embodiments, position 10 of a sequence as counted from its 3′-terminus aligns with a characteristic sequence element. In some embodiments, position 6, 7, or 8 of a core region as counted from the 5′-terminus of the core region aligns with a characteristic sequence element. In some embodiments, position 6 of a core region as counted from the 5′-terminus of the core region aligns with a characteristic sequence element. In some embodiments, position 7 of a core region as counted from the 5′-terminus of the core region aligns with a characteristic sequence element. In some embodiments, position 8 of a core region as counted from the 5′-terminus of the core region aligns with a characteristic sequence element. In some embodiments, position 3, 4, or 5 of a core region as counted from the 3′-terminus of the core region aligns with a characteristic sequence element. In some embodiments, position 3 of a core region as counted from the 3′-terminus of the core region aligns with a characteristic sequence element. In some embodiments, position 4 of a core region as counted from the 3′-terminus of the core region aligns with a characteristic sequence element. In some embodiments, position 5 of a core region as counted from the 3′-terminus of the core region aligns with a characteristic sequence element.

In some embodiments, position 11, 12 or 13 of a sequence as counted from its 5′-terminus aligns with a mutation. In some embodiments, position 11 of a sequence as counted from its 5′-terminus aligns with a mutation. In some embodiments, position 12 of a sequence as counted from its 5′-terminus aligns with a mutation. In some embodiments, position 13 of a sequence as counted from its 5′-terminus aligns with a mutation. In some embodiments, position 8, 9 or 10 of a sequence as counted from its 3′-terminus aligns with a mutation. In some embodiments, position 8 of a sequence as counted from its 3′-terminus aligns with a mutation. In some embodiments, position 9 of a sequence as counted from its 3′-terminus aligns with a mutation. In some embodiments, position 10 of a sequence as counted from its 3′-terminus aligns with a mutation. In some embodiments, position 6, 7, or 8 of a core region as counted from the 5′-terminus of the core region aligns with a mutation. In some embodiments, position 6 of a core region as counted from the 5′-terminus of the core region aligns with a mutation. In some embodiments, position 7 of a core region as counted from the 5′-terminus of the core region aligns with a mutation. In some embodiments, position 8 of a core region as counted from the 5′-terminus of the core region aligns with a mutation. In some embodiments, position 3, 4, or 5 of a core region as counted from the 3′-terminus of the core region aligns with a mutation. In some embodiments, position 3 of a core region as counted from the 3′-terminus of the core region aligns with a mutation. In some embodiments, position 4 of a core region as counted from the 3′-terminus of the core region aligns with a mutation. In some embodiments, position 5 of a core region as counted from the 3′-terminus of the core region aligns with a mutation.

In some embodiments, position 11, 12 or 13 of a sequence as counted from its 5′-terminus aligns with a SNP. In some embodiments, position 11 of a sequence as counted from its 5′-terminus aligns with a SNP. In some embodiments, position 12 of a sequence as counted from its 5′-terminus aligns with a SNP. In some embodiments, position 13 of a sequence as counted from its 5′-terminus aligns with a SNP. In some embodiments, position 8, 9 or 10 of a sequence as counted from its 3′-terminus aligns with a SNP. In some embodiments, position 8 of a sequence as counted from its 3′-terminus aligns with a SNP. In some embodiments, position 9 of a sequence as counted from its 3′-terminus aligns with a SNP. In some embodiments, position 10 of a sequence as counted from its 3′-terminus aligns with a SNP. In some embodiments, position 6, 7, or 8 of a core region as counted from the 5′-terminus of the core region aligns with a SNP. In some embodiments, position 6 of a core region as counted from the 5′-terminus of the core region aligns with a SNP. In some embodiments, position 7 of a core region as counted from the 5′-terminus of the core region aligns with a SNP. In some embodiments, position 8 of a core region as counted from the 5′-terminus of the core region aligns with a SNP. In some embodiments, position 3, 4, or 5 of a core region as counted from the 3′-terminus of the core region aligns with a SNP. In some embodiments, position 3 of a core region as counted from the 3′-terminus of the core region aligns with a SNP. In some embodiments, position 4 of a core region as counted from the 3′-terminus of the core region aligns with a SNP. In some embodiments, position 5 of a core region as counted from the 3′-terminus of the core region aligns with a SNP.

In some embodiments, a common base sequence comprises or is a sequence complementary to a nucleic acid sequence. In some embodiments, a common base sequence comprises or is a sequence 100% complementary to a nucleic acid sequence. In some embodiments, a common base sequence comprises or is a sequence complementary to a disease-causing nucleic acid sequence. In some embodiments, a common base sequence comprises or is a sequence 100% complementary to a disease-causing nucleic acid sequence. In some embodiments, a common base sequence comprises or is a sequence complementary to a characteristic sequence element of disease-causing nucleic acid sequence, which characteristic sequences differentiate a disease-causing nucleic acid sequence from a non-diseasing-causing nucleic acid sequence. In some embodiments, a common base sequence comprises or is a sequence 100% complementary to a characteristic sequence element of disease-causing nucleic acid sequence, which characteristic sequences differentiate a disease-causing nucleic acid sequence from a non-diseasing-causing nucleic acid sequence. In some embodiments, a common base sequence comprises or is a sequence complementary to a disease-associated nucleic acid sequence. In some embodiments, a common base sequence comprises or is a sequence 100% complementary to a disease-associated nucleic acid sequence. In some embodiments, a common base sequence comprises or is a sequence complementary to a characteristic sequence element of disease-associated nucleic acid sequence, which characteristic sequences differentiate a disease-associated nucleic acid sequence from a non-diseasing-associated nucleic acid sequence. In some embodiments, a common base sequence comprises or is a sequence 100% complementary to a characteristic sequence element of disease-associated nucleic acid sequence, which characteristic sequences differentiate a disease-associated nucleic acid sequence from a non-diseasing-associated nucleic acid sequence.

In some embodiments, a common base sequence comprises or is a sequence complementary to a gene. In some embodiments, a common base sequence comprises or is a sequence 100% complementary to a gene. In some embodiments, a common base sequence comprises or is a sequence complementary to a characteristic sequence element of a gene, which characteristic sequences differentiate the gene from a similar sequence sharing homology with the gene. In some embodiments, a common base sequence comprises or is a sequence 100% complementary to a characteristic sequence element of a gene, which characteristic sequences differentiate the gene from a similar sequence sharing homology with the gene. In some embodiments, a common base sequence comprises or is a sequence complementary to characteristic sequence element of a target gene, which characteristic sequences comprises a mutation that is not found in other copies of the gene, e.g., the wild-type copy of the gene, another mutant copy the gene, etc. In some embodiments, a common base sequence comprises or is a sequence 100% complementary to characteristic sequence element of a target gene, which characteristic sequences comprises a mutation that is not found in other copies of the gene, e.g., the wild-type copy of the gene, another mutant copy the gene, etc.

In some embodiments, a common base sequence comprises or is a sequence complementary to a sequence comprising a SNP. In some embodiments, a common base sequence comprises or is a sequence complementary to a sequence comprising a SNP, and the common base sequence is 100% complementary to the SNP that is associated with a disease. For example, in some embodiments, a common base sequence is 100% complementary to a SNP associated with a Huntington's disease-associated (or -causing) allele. In some embodiments, a common base sequence is that of WV-1092, which is 100% complementary to the disease-associated allele in many Huntington's disease patients at rs362307. In some embodiments, a SNP is rs362307. In some embodiments, a SNP is rs7685686. In some embodiments, a SNP is rs362268. In some embodiments, a SNP is rs362306. In some embodiments, a SNP is rs362331. In some embodiments, a SNP is rs2530595. In some embodiments, other example SNP site may be any of the Huntingtin site disclosed in the present disclosure.

In some embodiments, a common base sequence comprises a sequence found in GCCTCAGTCTGCTTCGCACC (SEQ ID NO: 19). In some embodiments, a common base sequence comprises a sequence found in GCCTCAGTCTGCTTCGCACC (SEQ ID NO: 19), wherein the sequence found in GCCTCAGTCTGCTTCGCACC (SEQ ID NO: 19) comprises at least 15 nucleotides. In some embodiments, a common base sequence is GCCTCAGTCTGCTTCGCACC (SEQ ID NO: 19).

In some embodiments, a common base sequence comprises a sequence found in GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20). In some embodiments, a common base sequence comprises a sequence found in GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20), wherein the sequence found in GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20) comprises at least 15 nucleotides. In some embodiments, a common base sequence is GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20). In some embodiments, a common base sequence is GGGCACAAGGGCACAGACTT (SEQ ID NO: 21). In some embodiments, a common base sequence is GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20). In some embodiments, a common base sequence is GCACAAGGGCACAGACTTCC (SEQ ID NO: 22). In some embodiments, a common base sequence is CACAAGGGCACAGACTTCCA (SEQ ID NO: 23). In some embodiments, a common base sequence is ACAAGGGCACAGACTTCCAA (SEQ ID NO: 24). In some embodiments, a common base sequence is CAAGGGCACAGACTTCCAAA (SEQ ID NO: 25). In some embodiments, a common base sequence comprises a sequence found in GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20). In some embodiments, a common base sequence comprises a sequence found in GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20), wherein the sequence found in GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20) comprises at least 15 nucleotides. In some embodiments, a common base sequence is GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20). In some embodiments, a common base sequence is GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20). In some embodiments, a common base sequence is AGCAGCTGCAACCTGGCAAC (SEQ ID NO: 26). In some embodiments, a common base sequence is GCAGCTGCAACCTGGCAACA (SEQ ID NO: 27). In some embodiments, a common base sequence is CAGCTGCAACCTGGCAACAA (SEQ ID NO: 28). In some embodiments, a common base sequence is AGCTGCAACCTGGCAACAAC (SEQ ID NO: 29). In some embodiments, a common base sequence is GCTGCAACCTGGCAACAACC (SEQ ID NO: 30). In some embodiments, a common base sequence comprises a sequence found in GGGCCAACAGCCAGCCTGCA (SEQ ID NO: 31). In some embodiments, a common base sequence comprises a sequence found in GGGCCAACAGCCAGCCTGCA (SEQ ID NO: 31), wherein the sequence found in GGGCCAACAGCCAGCCTGCA (SEQ ID NO: 31) comprises at least 15 nucleotides. In some embodiments, a common base sequence is GGGCCAACAGCCAGCCTGCA (SEQ ID NO: 31). In some embodiments, a common base sequence is GGGCCAACAGCCAGCCTGCA (SEQ ID NO: 31). In some embodiments, a common base sequence is GGCCAACAGCCAGCCTGCAG (SEQ ID NO: 32). In some embodiments, a common base sequence is GCCAACAGCCAGCCTGCAGG (SEQ ID NO: 33). In some embodiments, a common base sequence is CCAACAGCCAGCCTGCAGGA (SEQ ID NO: 34). In some embodiments, a common base sequence is CAACAGCCAGCCTGCAGGAG (SEQ ID NO: 35). In some embodiments, a common base sequence is AACAGCCAGCCTGCAGGAGG (SEQ ID NO: 36). In some embodiments, a common base sequence comprises a sequence found in ATTAATAAATTGTCATCACC (SEQ ID NO: 37). In some embodiments, a common base sequence comprises a sequence found in ATTAATAAATTGTCATCACC (SEQ ID NO: 37), wherein the sequence found in ATTAATAAATTGTCATCACC (SEQ ID NO: 37) comprises at least 15 nucleotides. In some embodiments, a common base sequence is ATTAATAAATTGTCATCACC (SEQ ID NO: 37). In some embodiments, a common base sequence is ATTAATAAATTGTCATCACC (SEQ ID NO: 37).

In some embodiments, the present disclosure provides stereochemical design parameters for oligonucleotides. That is, among other things, the present disclosure demonstrates impact of stereochemical structure at different positions along an oligonucleotide chain, for example on stability and/or activity of the oligonucleotide, including on interaction of the oligonucleotide with a cognate ligand and/or with a processing enzyme. The present disclosure specifically provides oligonucleotides whose structure incorporates or reflects the design parameters. Such oligonucleotides are new chemical entities relative to stereorandom preparations having the same base sequence and length.

In some embodiments, the present disclosure provides stereochemical design parameters for antisense oligonucleotides. In some embodiments, the present disclosure specifically provides design parameter for oligonucleotides that may be bound and/or cleaved by RNaseH. In one embodiments, the present disclosure provides stereochemical design parameters for siRNA oligonucleotides. In some embodiments, the present disclosure specifically provides design parameters for oligonucleotides that may be bound and/or cleaved by, e.g., DICER, Argonaute proteins (e.g., Argonaute-1 and Argonaute-2), etc.

In some embodiments, a single oligonucleotide of a provided composition comprises a region in which at least one of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages is chiral. In some embodiments, at least two of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least three of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least four of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least five of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least six of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least seven of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least eight of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least nine of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, one of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages is chiral. In some embodiments, two of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, three of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, four of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, five of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, six of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, seven of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, eight of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, nine of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, ten of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral.

In some embodiments, a single oligonucleotide of a provided composition comprises a region in which at least one of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages is chiral. In some embodiments, at least two of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least three of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least four of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least five of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least six of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, at least seven of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, one of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages is chiral. In some embodiments, two of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, three of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, four of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, five of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, six of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, seven of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral. In some embodiments, eight of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral.

In some embodiments, a single oligonucleotide of a provided composition comprises a region in which at least one of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages is chiral, and at least one internucleotidic linkage is achiral. In some embodiments, a single oligonucleotide of a provided composition comprises a region in which at least one of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages is chiral, and at least one internucleotidic linkage is achiral. In some embodiments, at least two internucleotidic linkages are achiral. In some embodiments, at least three internucleotidic linkages are achiral. In some embodiments, at least four internucleotidic linkages are achiral. In some embodiments, at least five internucleotidic linkages are achiral. In some embodiments, at least six internucleotidic linkages are achiral. In some embodiments, at least seven internucleotidic linkages are achiral. In some embodiments, at least eight internucleotidic linkages are achiral. In some embodiments, at least nine internucleotidic linkages are achiral. In some embodiments, at least 10 internucleotidic linkages are achiral. In some embodiments, at least 11 internucleotidic linkages are achiral. In some embodiments, at least 12 internucleotidic linkages are achiral. In some embodiments, at least 13 internucleotidic linkages are achiral. In some embodiments, at least 14 internucleotidic linkages are achiral. In some embodiments, at least 15 internucleotidic linkages are achiral. In some embodiments, at least 16 internucleotidic linkages are achiral. In some embodiments, at least 17 internucleotidic linkages are achiral. In some embodiments, at least 18 internucleotidic linkages are achiral. In some embodiments, at least 19 internucleotidic linkages are achiral. In some embodiments, at least 20 internucleotidic linkages are achiral. In some embodiments, one internucleotidic linkage is achiral. In some embodiments, two internucleotidic linkages are achiral. In some embodiments, three internucleotidic linkages are achiral. In some embodiments, four internucleotidic linkages are achiral. In some embodiments, five internucleotidic linkages are achiral. In some embodiments, six internucleotidic linkages are achiral. In some embodiments, seven internucleotidic linkages are achiral. In some embodiments, eight internucleotidic linkages are achiral. In some embodiments, nine internucleotidic linkages are achiral. In some embodiments, 10 internucleotidic linkages are achiral. In some embodiments, 11 internucleotidic linkages are achiral. In some embodiments, 12 internucleotidic linkages are achiral. In some embodiments, 13 internucleotidic linkages are achiral. In some embodiments, 14 internucleotidic linkages are achiral. In some embodiments, 15 internucleotidic linkages are achiral. In some embodiments, 16 internucleotidic linkages are achiral. In some embodiments, 17 internucleotidic linkages are achiral. In some embodiments, 18 internucleotidic linkages are achiral. In some embodiments, 19 internucleotidic linkages are achiral. In some embodiments, 20 internucleotidic linkages are achiral. In some embodiments, a single oligonucleotide of a provided composition comprises a region in which all internucleotidic linkages, except the at least one of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages which is chiral, are achiral.

In some embodiments, a single oligonucleotide of a provided composition comprises a region in which at least one of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages is chiral, and at least one internucleotidic linkage is phosphate. In some embodiments, a single oligonucleotide of a provided composition comprises a region in which at least one of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages is chiral, and at least one internucleotidic linkage is phosphate. In some embodiments, at least two internucleotidic linkages are phosphate. In some embodiments, at least three internucleotidic linkages are phosphate. In some embodiments, at least four internucleotidic linkages are phosphate. In some embodiments, at least five internucleotidic linkages are phosphate. In some embodiments, at least six internucleotidic linkages are phosphate. In some embodiments, at least seven internucleotidic linkages are phosphate. In some embodiments, at least eight internucleotidic linkages are phosphate. In some embodiments, at least nine internucleotidic linkages are phosphate. In some embodiments, at least 10 internucleotidic linkages are phosphate. In some embodiments, at least 11 internucleotidic linkages are phosphate. In some embodiments, at least 12 internucleotidic linkages are phosphate. In some embodiments, at least 13 internucleotidic linkages are phosphate. In some embodiments, at least 14 internucleotidic linkages are phosphate. In some embodiments, at least 15 internucleotidic linkages are phosphate. In some embodiments, at least 16 internucleotidic linkages are phosphate. In some embodiments, at least 17 internucleotidic linkages are phosphate. In some embodiments, at least 18 internucleotidic linkages are phosphate. In some embodiments, at least 19 internucleotidic linkages are phosphate. In some embodiments, at least 20 internucleotidic linkages are phosphate. In some embodiments, one internucleotidic linkage is phosphate. In some embodiments, two internucleotidic linkages are phosphate. In some embodiments, three internucleotidic linkages are phosphate. In some embodiments, four internucleotidic linkages are phosphate. In some embodiments, five internucleotidic linkages are phosphate. In some embodiments, six internucleotidic linkages are phosphate. In some embodiments, seven internucleotidic linkages are phosphate. In some embodiments, eight internucleotidic linkages are phosphate. In some embodiments, nine internucleotidic linkages are phosphate. In some embodiments, 10 internucleotidic linkages are phosphate. In some embodiments, 11 internucleotidic linkages are phosphate. In some embodiments, 12 internucleotidic linkages are phosphate. In some embodiments, 13 internucleotidic linkages are phosphate. In some embodiments, 14 internucleotidic linkages are phosphate. In some embodiments, 15 internucleotidic linkages are phosphate. In some embodiments, 16 internucleotidic linkages are phosphate. In some embodiments, 17 internucleotidic linkages are phosphate. In some embodiments, 18 internucleotidic linkages are phosphate. In some embodiments, 19 internucleotidic linkages are phosphate. In some embodiments, 20 internucleotidic linkages are phosphate. In some embodiments, a single oligonucleotide of a provided composition comprises a region in which all internucleotidic linkages, except the at least one of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages which is chiral, are phosphate.

In some embodiments, a single oligonucleotide of a provided composition comprises a region in which at least one of the first, second, third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth internucleotidic linkages are chiral, and at least 10% of all the internucleotidic linkages in the region is achiral. In some embodiments, a single oligonucleotide of a provided composition comprises a region in which at least one of the first, second, third, fifth, seventh, eighteenth, nineteenth and twentieth internucleotidic linkages is chiral, and at least 10% of all the internucleotidic linkages in the region are achiral. In some embodiments, at least 20% of all the internucleotidic linkages in the region are achiral. In some embodiments, at least 30% of all the internucleotidic linkages in the region are achiral. In some embodiments, at least 40% of all the internucleotidic linkages in the region are achiral. In some embodiments, at least 50% of all the internucleotidic linkages in the region are achiral. In some embodiments, at least 60% of all the internucleotidic linkages in the region are achiral. In some embodiments, at least 70% of all the internucleotidic linkages in the region are achiral. In some embodiments, at least 80% of all the internucleotidic linkages in the region are achiral. In some embodiments, at least 90% of all the internucleotidic linkages in the region are achiral. In some embodiments, at least 50% of all the internucleotidic linkages in the region are achiral. In some embodiments, an achiral internucleotidic linkage is a phosphate linkage. In some embodiments, each achiral internucleotidic linkage in a phosphate linkage.

In some embodiments, the first internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the first internucleotidic linkage of the region is an Rp modified internucleotidic linkage. In some embodiments, the second internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the second internucleotidic linkage of the region is an Rp modified internucleotidic linkage. In some embodiments, the third internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the third internucleotidic linkage of the region is an Rp modified internucleotidic linkage. In some embodiments, the fifth internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the fifth internucleotidic linkage of the region is an Rp modified internucleotidic linkage. In some embodiments, the seventh internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the seventh internucleotidic linkage of the region is an Rp modified internucleotidic linkage. In some embodiments, the eighth internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the eighth internucleotidic linkage of the region is an Rp modified internucleotidic linkage. In some embodiments, the ninth internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the ninth internucleotidic linkage of the region is an Rp modified internucleotidic linkage. In some embodiments, the eighteenth internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the eighteenth internucleotidic linkage of the region is an Rp modified internucleotidic linkage. In some embodiments, the nineteenth internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the nineteenth internucleotidic linkage of the region is an Rp modified internucleotidic linkage. In some embodiments, the twentieth internucleotidic linkage of the region is an Sp modified internucleotidic linkage. In some embodiments, the twentieth internucleotidic linkage of the region is an Rp modified internucleotidic linkage.

In some embodiments, the region has a length of at least 21 bases. In some embodiments, the region has a length of 21 bases. In some embodiments, a single oligonucleotide in a provided composition has a length of at least 21 bases. In some embodiments, a single oligonucleotide in a provided composition has a length of 21 bases.

In some embodiments, a chiral internucleotidic linkage has the structure of formula I. In some embodiments, a chiral internucleotidic linkage is phosphorothioate. In some embodiments, each chiral internucleotidic linkage in a single oligonucleotide of a provided composition independently has the structure of formula I. In some embodiments, each chiral internucleotidic linkage in a single oligonucleotide of a provided composition is a phosphorothioate.

In some embodiments, oligonucleotides of the present disclosure comprise one or more modified sugar moieties. In some embodiments, oligonucleotides of the present disclosure comprise one or more modified base moieties. As known by a person of ordinary skill in the art and described in the disclosure, various modifications can be introduced to a sugar and/or moiety. For example, in some embodiments, a modification is a modification described in U.S. Pat. No. 9,006,198 and WO2014/012081, the sugar and base modifications of each of which are incorporated herein by reference.

In some embodiments, a sugar modification is a 2′-modification. Commonly used 2′-modifications include but are not limited to 2′-OR1, wherein R1 is not hydrogen. In some embodiments, a modification is 2′-OR, wherein R is optionally substituted aliphatic. In some embodiments, a modification is 2′-OMe. In some embodiments, a modification is 2′-MOE. In some embodiments, the present disclosure demonstrates that inclusion and/or location of particular chirally pure internucleotidic linkages can provide stability improvements comparable to or better than those achieved through use of modified backbone linkages, bases, and/or sugars. In some embodiments, a provided single oligonucleotide of a provided composition has no modifications on the sugars. In some embodiments, a provided single oligonucleotide of a provided composition has no modifications on 2′-positions of the sugars (i.e., the two groups at the 2′-position are either —H/—H or —H/—OH). In some embodiments, a provided single oligonucleotide of a provided composition does not have any 2′-MOE modifications.

In some embodiments, a 2′-modification is —O-L- or -L- which connects the 2′-carbon of a sugar moiety to another carbon of a sugar moiety. In some embodiments, a 2′-modification is —O-L- or -L- which connects the 2′-carbon of a sugar moiety to the 4′-carbon of a sugar moiety. In some embodiments, a 2′-modification is S-cEt. In some embodiments, a modified sugar moiety is an LNA moiety.

In some embodiments, a 2′-modification is —F. In some embodiments, a 2′-modification is FANA. In some embodiments, a 2′-modification is FRNA.

In some embodiments, a sugar modification is a 5′-modification, e.g., R-5′-Me, S-5′-Me, etc.

In some embodiments, a sugar modification changes the size of the sugar ring. In some embodiments, a sugar modification is the sugar moiety in FHNA.

In some embodiments, a single oligonucleotide in a provided composition is a better substrate for Argonaute proteins (e.g., hAgo-1 and hAgo-2) compared to stereorandom oligonucleotide compositions. Selection and/or location of chirally pure linkages as described in the present closure are useful design parameters for oligonucleotides that interacting with such proteins, such as siRNA.

In some embodiments, a single oligonucleotide in a provided composition has at least about 25% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 30% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 35% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 40% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 45% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 50% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 55% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 60% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 65% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 70% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 75% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 80% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 85% of its internucleotidic linkages in Sp configuration. In some embodiments, a single oligonucleotide in a provided composition has at least about 90% of its internucleotidic linkages in Sp configuration.

In some embodiments, oligonucleotides in a provided composition is not an oligonucleotide selected from: TkTkmCkAGTmCATGAmCTkTmCkmCk (SEQ ID NO: 38), wherein each nucleoside followed by a subscript ‘k’ indicates a (S)-cEt modification, R is Rp phosphorothioate linkage, S is Sp phosphorothioate linkage, each mC is a 5-methylcytosine modified nucleoside, and all internucleoside linkages are phosphorothioates (PS) with stereochemistry patterns selected from RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.

In some embodiments, a single oligonucleotide in a provided composition is not an oligonucleotide selected from: TkTkmCkAGTmCATGAmCTTkmCkmCk (SEQ ID NO: 39), wherein each nucleoside followed by a subscript ‘k’ indicates a (S)-cEt modification, R is Rp phosphorothioate linkage, S is Sp phosphorothioate linkage, each mC is a 5-methylcytosine modified nucleoside and all core internucleoside linkages are phosphorothioates (PS) with stereochemistry patterns selected from: RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.

Chirally Controlled Oligonucleotides and Chirally Controlled Oligonucleotide Compositions

The present disclosure provides chirally controlled oligonucleotides, and chirally controlled oligonucleotide compositions which are of high crude purity and of high diastereomeric purity. In some embodiments, the present disclosure provides chirally controlled oligonucleotides, and chirally controlled oligonucleotide compositions which are of high crude purity. In some embodiments, the present disclosure provides chirally controlled oligonucleotides, and chirally controlled oligonucleotide compositions which are of high diastereomeric purity.

In some embodiments, a chirally controlled oligonucleotide composition is a substantially pure preparation of an oligonucleotide type in that oligonucleotides in the composition that are not of the oligonucleotide type are impurities form the preparation process of said oligonucleotide type, in some case, after certain purification procedures.

In some embodiments, the present disclosure provides oligonucleotides comprising one or more diastereomerically pure internucleotidic linkages with respect to the chiral linkage phosphorus. In some embodiments, the present disclosure provides oligonucleotides comprising one or more diastereomerically pure internucleotidic linkages having the structure of formula I. In some embodiments, the present disclosure provides oligonucleotides comprising one or more diastereomerically pure internucleotidic linkages with respect to the chiral linkage phosphorus, and one or more phosphate diester linkages. In some embodiments, the present disclosure provides oligonucleotides comprising one or more diastereomerically pure internucleotidic linkages having the structure of formula I, and one or more phosphate diester linkages. In some embodiments, the present disclosure provides oligonucleotides comprising one or more diastereomerically pure internucleotidic linkages having the structure of formula I-c, and one or more phosphate diester linkages. In some embodiments, such oligonucleotides are prepared by using stereoselective oligonucleotide synthesis, as described in this application, to form pre-designed diastereomerically pure internucleotidic linkages with respect to the chiral linkage phosphorus. For instance, in one example oligonucleotide of (Rp/Sp, Rp/Sp, Rp/Sp, Rp, Rp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGs1Cs1As1CsC] (SEQ ID NO: 40), the first three internucleotidic linkages are constructed using traditional oligonucleotide synthesis method, and the diastereomerically pure internucleotidic linkages are constructed with stereochemical control as described in this application. Example internucleotidic linkages, including those having structures of formula I, are further described below.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two of the individual internucleotidic linkages within the oligonucleotide have different stereochemistry and/or different P-modifications relative to one another. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two individual internucleotidic linkages within the oligonucleotide have different P-modifications relative to one another. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two of the individual internucleotidic linkages within the oligonucleotide have different P-modifications relative to one another, and wherein the chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two of the individual internucleotidic linkages within the oligonucleotide have different P-modifications relative to one another, and wherein the chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least one phosphorothioate diester internucleotidic linkage. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two of the individual internucleotidic linkages within the oligonucleotide have different P-modifications relative to one another, and wherein the chirally controlled oligonucleotide comprises at least one phosphorothioate triester internucleotidic linkage. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two of the individual internucleotidic linkages within the oligonucleotide have different P-modifications relative to one another, and wherein the chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least one phosphorothioate triester internucleotidic linkage.

In certain embodiments, a modified internucleotidic linkages has the structure of formula I:

wherein each variable is as defined and described below. In some embodiments, a linkage of formula I is chiral. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising one or more modified internucleotidic linkages of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising one or more modified internucleotidic linkages of formula I, and wherein individual internucleotidic linkages of formula I within the oligonucleotide have different P-modifications relative to one another. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising one or more modified internucleotidic linkages of formula I, and wherein individual internucleotidic linkages of formula I within the oligonucleotide have different —X-L-R1 relative to one another. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising one or more modified internucleotidic linkages of formula I, and wherein individual internucleotidic linkages of formula I within the oligonucleotide have different X relative to one another. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising one or more modified internucleotidic linkages of formula I, and wherein individual internucleotidic linkages of formula I within the oligonucleotide have different -L-R1 relative to one another. In some embodiments, a chirally controlled oligonucleotide is an oligonucleotide in a provided composition that is of the particular oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide is an oligonucleotide in a provided composition that has the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two of the individual internucleotidic linkages within the oligonucleotide have different stereochemistry and/or different P-modifications relative to one another. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two of the individual internucleotidic linkages within the oligonucleotide have different stereochemistry relative to one another, and wherein at least a portion of the structure of the chirally controlled oligonucleotide is characterized by a repeating pattern of alternating stereochemistry.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two of the individual internucleotidic linkages within the oligonucleotide have different P-modifications relative to one another, in that they have different X atoms in their —XLR1 moieties, and/or in that they have different L groups in their —XLR moieties, and/or that they have different R1 atoms in their —XLR1 moieties.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide, wherein at least two of the individual internucleotidic linkages within the oligonucleotide have different stereochemistry and/or different P-modifications relative to one another and the oligonucleotide has a structure represented by the following formula:


[SBn1RBn2SBn3RBn4 . . . SBnxRBny]

wherein:
each RB independently represents a block of nucleotide units having the R configuration at the linkage phosphorus;
each SB independently represents a block of nucleotide units having the S configuration at the linkage phosphorus;
each of n1-ny is zero or an integer, with the requirement that at least one odd n and at least one even n must be non-zero so that the oligonucleotide includes at least two individual internucleotidic linkages with different stereochemistry relative to one another; and
wherein the sum of n1-ny is between 2 and 200, and in some embodiments is between a lower limit selected from the group consisting of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more and an upper limit selected from the group consisting of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, and 200, the upper limit being larger than the lower limit.

In some such embodiments, each n has the same value; in some embodiments, each even n has the same value as each other even n; in some embodiments, each odd n has the same value each other odd n; in some embodiments, at least two even ns have different values from one another; in some embodiments, at least two odd ns have different values from one another.

In some embodiments, at least two adjacent ns are equal to one another, so that a provided oligonucleotide includes adjacent blocks of S stereochemistry linkages and R stereochemistry linkages of equal lengths. In some embodiments, provided oligonucleotides include repeating blocks of S and R stereochemistry linkages of equal lengths. In some embodiments, provided oligonucleotides include repeating blocks of S and R stereochemistry linkages, where at least two such blocks are of different lengths from one another; in some such embodiments each S stereochemistry block is of the same length, and is of a different length from each R stereochemistry length, which may optionally be of the same length as one another.

In some embodiments, at least two skip-adjacent ns are equal to one another, so that a provided oligonucleotide includes at least two blocks of linkages of a first stereochemistry that are equal in length to one another and are separated by a block of linkages of the other stereochemistry, which separating block may be of the same length or a different length from the blocks of first stereochemistry.

In some embodiments, ns associated with linkage blocks at the ends of a provided oligonucleotide are of the same length. In some embodiments, provided oligonucleotides have terminal blocks of the same linkage stereochemistry. In some such embodiments, the terminal blocks are separated from one another by a middle block of the other linkage stereochemistry.

In some embodiments, a provided oligonucleotide of formula [SBn1RBn2SBn3RBn4 . . . SBnxRBny] is a stereoblockmer. In some embodiments, a provided oligonucleotide of formula [SBn1RBn2SBn3RBn4 . . . SBnxRBny] is a stereoskipmer. In some embodiments, a provided oligonucleotide of formula [SBn1RBn2SBn3RBn4 . . . SBnxRBny] is a stereoaltmer. In some embodiments, a provided oligonucleotide of formula [SBn1RBn2SBn3RBn4 . . . SBnxRBny] is a gapmer.

In some embodiments, a provided oligonucleotide of formula [SBn1RBn2SBn3RBn4 . . . SBnxRBny] is of any of the above described patterns and further comprises patterns of P-modifications. For instance, in some embodiments, a provided oligonucleotide of formula [SBn1RBn2SBn3RBn4 . . . SBnxRBny] and is a stereoskipmer and P-modification skipmer. In some embodiments, a provided oligonucleotide of formula [SBn1RBn2SBn3RBn4 . . . SBnxRBny] and is a stereoblockmer and P-modification altmer. In some embodiments, a provided oligonucleotide of formula [SBn1RBn2SBn3RBn4 . . . SBnxRBny] and is a stereoaltmer and P-modification blockmer.

In some embodiments, a provided oligonucleotide of formula [SBn1RBn2SBn3RBn4 . . . SBnxRBny] is a chirally controlled oligonucleotide comprising one or more modified internuceotidic linkages independently having the structure of formula I:

wherein:

  • P* is an asymmetric phosphorus atom and is either Rp or Sp;
  • W is O, S or Se;
  • each of X, Y and Z is independently —O—, —S—, —N(-L-R1)—, or L;
  • L is a covalent bond or an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—;
  • R1 is halogen, R, or an optionally substituted C1-C50 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—
  • each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or:
    • two R′ are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
  • -Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, and heterocyclylene;
  • each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl; and
  • each

  •  independently represents a connection to a nucleoside.

In some embodiments, L is a covalent bond or an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—;

  • R1 is halogen, R, or an optionally substituted C1-C50 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—; each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or:
    • two R′ on the same nitrogen are taken together with their intervening atoms to form an optionally substituted heterocyclic or heteroaryl ring, or
    • two R′ on the same carbon are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
  • -Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene;
  • each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and
  • each

  •  independently represents a connection to a nucleoside.

In some embodiments, a chirally controlled oligonucleotide comprises one or more modified internucleotidic phosphorus linkages. In some embodiments, a chirally controlled oligonucleotide comprises, e.g., a phosphorothioate or a phosphorothioate triester linkage. In some embodiments, a chirally controlled oligonucleotide comprises a phosphorothioate triester linkage. In some embodiments, a chirally controlled oligonucleotide comprises at least two phosphorothioate triester linkages. In some embodiments, a chirally controlled oligonucleotide comprises at least three phosphorothioate triester linkages. In some embodiments, a chirally controlled oligonucleotide comprises at least four phosphorothioate triester linkages. In some embodiments, a chirally controlled oligonucleotide comprises at least five phosphorothioate triester linkages. Examples of such modified internucleotidic phosphorus linkages are described further herein.

In some embodiments, a chirally controlled oligonucleotide comprises different internucleotidic phosphorus linkages. In some embodiments, a chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least one modified internucleotidic linkage. In some embodiments, a chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least one phosphorothioate triester linkage. In some embodiments, a chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least two phosphorothioate triester linkages. In some embodiments, a chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least three phosphorothioate triester linkages. In some embodiments, a chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least four phosphorothioate triester linkages. In some embodiments, a chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least five phosphorothioate triester linkages. Examples of such modified internucleotidic phosphorus linkages are described further herein.

In some embodiments, a phosphorothioate triester linkage comprises a chiral auxiliary, which, for example, is used to control the stereoselectivity of a reaction. In some embodiments, a phosphorothioate triester linkage does not comprise a chiral auxiliary. In some embodiments, a phosphorothioate triester linkage is intentionally maintained until and/or during the administration to a subject.

In some embodiments, a chirally controlled oligonucleotide is linked to a solid support. In some embodiments, a chirally controlled oligonucleotide is cleaved from a solid support.

In some embodiments, a chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least two consecutive modified internucleotidic linkages. In some embodiments, a chirally controlled oligonucleotide comprises at least one phosphate diester internucleotidic linkage and at least two consecutive phosphorothioate triester internucleotidic linkages.

In some embodiments, a chirally controlled oligonucleotide is a blockmer. In some embodiments, a chirally controlled oligonucleotide is a stereoblockmer. In some embodiments, a chirally controlled oligonucleotide is a P-modification blockmer. In some embodiments, a chirally controlled oligonucleotide is a linkage blockmer.

In some embodiments, a chirally controlled oligonucleotide is an altmer. In some embodiments, a chirally controlled oligonucleotide is a stereoaltmer. In some embodiments, a chirally controlled oligonucleotide is a P-modification altmer. In some embodiments, a chirally controlled oligonucleotide is a linkage altmer.

In some embodiments, a chirally controlled oligonucleotide is a unimer. In some embodiments, a chirally controlled oligonucleotide is a stereounimer. In some embodiments, a chirally controlled oligonucleotide is a P-modification unimer. In some embodiments, a chirally controlled oligonucleotide is a linkage unimer.

In some embodiments, a chirally controlled oligonucleotide is a gapmer.

In some embodiments, a chirally controlled oligonucleotide is a skipmer.

In some embodiments, the present disclosure provides oligonucleotides comprising one or more modified internucleotidic linkages independently having the structure of formula I:

wherein:

  • P* is an asymmetric phosphorus atom and is either Rp or Sp;
  • W is O, S or Se;
  • each of X, Y and Z is independently —O—, —S—, —N(-L-R1)—, or L;
  • L is a covalent bond or an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—;
  • R1 is halogen, R, or an optionally substituted C1-C50 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—
  • each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or:
    • two R′ are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
  • -Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, and heterocyclylene;
  • each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl; and
  • each

  •  independently represents a connection to a nucleoside.

In some embodiments, L is a covalent bond or an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—;

  • R1 is halogen, R, or an optionally substituted C1-C50 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—;
  • each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or:
    • two R′ on the same nitrogen are taken together with their intervening atoms to form an optionally substituted heterocyclic or heteroaryl ring, or
    • two R′ on the same carbon are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
  • -Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene;
  • each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and
  • each

  •  independently represents a connection to a nucleoside.

In some embodiments, P* is an asymmetric phosphorus atom and is either Rp or Sp. In some embodiments, P* is Rp. In other embodiments, P* is Sp. In some embodiments, an oligonucleotide comprises one or more internucleotidic linkages of formula I wherein each P* is independently Rp or Sp. In some embodiments, an oligonucleotide comprises one or more internucleotidic linkages of formula I wherein each P* is Rp. In some embodiments, an oligonucleotide comprises one or more internucleotidic linkages of formula I wherein each P* is Sp. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein P* is Rp. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein P* is Sp. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein P* is Rp, and at least one internucleotidic linkage of formula I wherein P* is Sp.

In some embodiments, W is O, S, or Se. In some embodiments, W is O. In some embodiments, W is S. In some embodiments, W is Se. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein W is O. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein W is S. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein W is Se.

In some embodiments, each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl.

In some embodiments, R is hydrogen. In some embodiments, R is an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl.

In some embodiments, R is an optionally substituted C1-C6 aliphatic. In some embodiments, R is an optionally substituted C1-C6 alkyl. In some embodiments, R is optionally substituted, linear or branched hexyl. In some embodiments, R is optionally substituted, linear or branched pentyl. In some embodiments, R is optionally substituted, linear or branched butyl. In some embodiments, R is optionally substituted, linear or branched propyl. In some embodiments, R is optionally substituted ethyl. In some embodiments, R is optionally substituted methyl.

In some embodiments, R is optionally substituted phenyl. In some embodiments, R is substituted phenyl. In some embodiments, R is phenyl.

In some embodiments, R is optionally substituted carbocyclyl. In some embodiments, R is optionally substituted C3-C10 carbocyclyl. In some embodiments, R is optionally substituted monocyclic carbocyclyl. In some embodiments, R is optionally substituted cycloheptyl. In some embodiments, R is optionally substituted cyclohexyl. In some embodiments, R is optionally substituted cyclopentyl. In some embodiments, R is optionally substituted cyclobutyl. In some embodiments, R is an optionally substituted cyclopropyl. In some embodiments, R is optionally substituted bicyclic carbocyclyl.

In some embodiments, R is an optionally substituted aryl. In some embodiments, R is an optionally substituted bicyclic aryl ring.

In some embodiments, R is an optionally substituted heteroaryl. In some embodiments, R is an optionally substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen. In some embodiments, R is a substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an unsubstituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen.

In some embodiments, R is an optionally substituted 5 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen or sulfur. In some embodiments, R is an optionally substituted 6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, R is an optionally substituted 5-membered monocyclic heteroaryl ring having 1 heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, R is selected from pyrrolyl, furanyl, or thienyl.

In some embodiments, R is an optionally substituted 5-membered heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is an optionally substituted 5-membered heteroaryl ring having 1 nitrogen atom, and an additional heteroatom selected from sulfur or oxygen. Example R groups include optionally substituted pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl or isoxazolyl.

In some embodiments, R is a 6-membered heteroaryl ring having 1-3 nitrogen atoms. In other embodiments, R is an optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms. In some embodiments, R is an optionally substituted 6-membered heteroaryl ring having 2 nitrogen atoms. In certain embodiments, R is an optionally substituted 6-membered heteroaryl ring having 1 nitrogen. Example R groups include optionally substituted pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, or tetrazinyl.

In certain embodiments, R is an optionally substituted 8-10 membered bicyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1 heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted indolyl. In some embodiments, R is an optionally substituted azabicyclo[3.2.1]octanyl. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted azaindolyl. In some embodiments, R is an optionally substituted benzimidazolyl. In some embodiments, R is an optionally substituted benzothiazolyl. In some embodiments, R is an optionally substituted benzoxazolyl. In some embodiments, R is an optionally substituted indazolyl. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In certain embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 1 heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted quinolinyl. In some embodiments, R is an optionally substituted isoquinolinyl. According to one aspect, R is an optionally substituted 6,6-fused heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is a quinazoline or a quinoxaline.

In some embodiments, R is an optionally substituted heterocyclyl. In some embodiments, R is an optionally substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is a substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an unsubstituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, R is an optionally substituted heterocyclyl. In some embodiments, R is an optionally substituted 6 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 6 membered partially unsaturated heterocyclic ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 6 membered partially unsaturated heterocyclic ring having 2 oxygen atom.

In certain embodiments, R is a 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, oxepaneyl, aziridineyl, azetidineyl, pyrrolidinyl, piperidinyl, azepanyl, thiiranyl, thietanyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, thiepanyl, dioxolanyl, oxathiolanyl, oxazolidinyl, imidazolidinyl, thiazolidinyl, dithiolanyl, dioxanyl, morpholinyl, oxathianyl, piperazinyl, thiomorpholinyl, dithianyl, dioxepanyl, oxazepanyl, oxathiepanyl, dithiepanyl, diazepanyl, dihydrofuranonyl, tetrahydropyranonyl, oxepanonyl, pyrolidinonyl, piperidinonyl, azepanonyl, dihydrothiophenonyl, tetrahydrothiopyranonyl, thiepanonyl, oxazolidinonyl, oxazinanonyl, oxazepanonyl, dioxolanonyl, dioxanonyl, dioxepanonyl, oxathiolinonyl, oxathianonyl, oxathiepanonyl, thiazolidinonyl, thiazinanonyl, thiazepanonyl, imidazolidinonyl, tetrahydropyrimidinonyl, diazepanonyl, imidazolidinedionyl, oxazolidinedionyl, thiazolidinedionyl, dioxolanedionyl, oxathiolanedionyl, piperazinedionyl, morpholinedionyl, thiomorpholinedionyl, tetrahydropyranyl, tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl, piperazinyl, pyrrolidinyl, tetrahydrothiophenyl, or tetrahydrothiopyranyl. In some embodiments, R is an optionally substituted 5 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In certain embodiments, R is an optionally substituted 5-6 membered partially unsaturated monocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is an optionally substituted tetrahydropyridinyl, dihydrothiazolyl, dihydrooxazolyl, or oxazolinyl group.

In some embodiments, R is an optionally substituted 8-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted indolinyl. In some embodiments, R is an optionally substituted isoindolinyl. In some embodiments, R is an optionally substituted 1, 2, 3, 4-tetrahydroquinoline. In some embodiments, R is an optionally substituted 1, 2, 3, 4-tetrahydroisoquinoline.

In some embodiments, each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or:

    • two R′ on the same nitrogen are taken together with their intervening atoms to form an optionally substituted heterocyclic or heteroaryl ring, or
    • two R′ on the same carbon are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring.

In some embodiments, R′ is —R, —C(O)R, —CO2R, or —SO2R, wherein R is as defined above and described herein.

In some embodiments, R′ is —R, wherein R is as defined and described above and herein. In some embodiments, R′ is hydrogen.

In some embodiments, R′ is —C(O)R, wherein R is as defined above and described herein. In some embodiments, R′ is —CO2R, wherein R is as defined above and described herein. In some embodiments, R′ is —SO2R, wherein R is as defined above and described herein.

In some embodiments, two R′ on the same nitrogen are taken together with their intervening atoms to form an optionally substituted heterocyclic or heteroaryl ring. In some embodiments, two R′ on the same carbon are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring.

In some embodiments, -Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene.

In some embodiments, -Cy- is optionally substituted phenylene. In some embodiments, -Cy- is optionally substituted carbocyclylene. In some embodiments, -Cy- is optionally substituted arylene. In some embodiments, -Cy- is optionally substituted heteroarylene. In some embodiments, -Cy- is optionally substituted heterocyclylene.

In some embodiments, each of X, Y and Z is independently —O—, —S—, —N(-L-R1)—, or L, wherein each of L and R1 is independently as defined above and described below.

In some embodiments, X is —O—. In some embodiments, X is —S—. In some embodiments, X is —O— or —S—. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein X is —O—. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein X is —S—. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein X is —O—, and at least one internucleotidic linkage of formula I wherein X is —S—. In some embodiments, an oligonucleotide comprises at least one internucleotidic linkage of formula I wherein X is —O—, and at least one internucleotidic linkage of formula I wherein X is —S—, and at least one internucleotidic linkage of formula I wherein L is an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—.

In some embodiments, X is —N(-L-R1)—. In some embodiments, X is —N(R1)—. In some embodiments, X is —N(R′)—. In some embodiments, X is —N(R)—. In some embodiments, X is —NH—.

In some embodiments, X is L. In some embodiments, X is a covalent bond. In some embodiments, X is or an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—. In some embodiments, X is an optionally substituted C1-C10 alkylene or C1-C10 alkenylene. In some embodiments, X is methylene.

In some embodiments, Y is —O—. In some embodiments, Y is —S—.

In some embodiments, Y is —N(-L-R1)—. In some embodiments, Y is —N(R1)—. In some embodiments, Y is —N(R′)—. In some embodiments, Y is —N(R)—. In some embodiments, Y is —NH—.

In some embodiments, Y is L. In some embodiments, Y is a covalent bond. In some embodiments, Y is or an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—. In some embodiments, Y is an optionally substituted C1-C10 alkylene or C1-C10 alkenylene. In some embodiments, Y is methylene.

In some embodiments, Z is —O—. In some embodiments, Z is —S—.

In some embodiments, Z is —N(-L-R1)—. In some embodiments, Z is —N(R1)—. In some embodiments, Z is —N(R′)—. In some embodiments, Z is —N(R)—. In some embodiments, Z is —NH—.

In some embodiments, Z is L. In some embodiments, Z is a covalent bond. In some embodiments, Z is or an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—. In some embodiments, Z is an optionally substituted C1-C10 alkylene or C1-C10 alkenylene. In some embodiments, Z is methylene.

In some embodiments, L is a covalent bond or an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—.

In some embodiments, L is a covalent bond. In some embodiments, L is an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—.

In some embodiments, L has the structure of -L1-V—, wherein: L1 is an optionally substituted group selected from

C1-C6 alkylene, C1-C6 alkenylene, carbocyclylene, arylene, C1-C6 heteroalkylene, heterocyclylene, and heteroarylene;
V is selected from —O—, —S—, —NR′—, C(R′)2, —S—S—, —B—S—S—C—,

or an optionally substituted group selected from C1-C6 alkylene, arylene, C1-C6 heteroalkylene, heterocyclylene, and heteroarylene;

A is ═O, ═S, ═NR′, or ═C(R′)2;

each of B and C is independently —O—, —S—, —NR′—, —C(R′)2—, or an optionally substituted group selected from C1-C6 alkylene, carbocyclylene, arylene, heterocyclylene, or heteroarylene; and each R′ is independently as defined above and described herein.

In some embodiments, L1 is

In some embodiments, L1 is

wherein Ring Cy′ is an optionally substituted arylene, carbocyclylene, heteroarylene, or heterocyclylene. In some embodiments, L1 is optionally substituted

In some embodiments, L1 is

In some embodiments, L1 is connected to X. In some embodiments, L1 is an optionally substituted group selected from

and the sulfur atom is connect to V. In some embodiments, L1 is an optionally substituted group selected from

and the carbon atom is connect to X.

In some embodiments, L has the structure of:

wherein:

  • E is —O—, —S—, —NR′— or —C(R′)2—;
  • is a single or double bond;
    the two RL1 are taken together with the two carbon atoms to which they are bound to form an optionally substituted aryl, carbocyclic, heteroaryl or heterocyclic ring; and each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • is a single or double bond; and
    the two RL1 are taken together with the two carbon atoms to which they are bound to form an optionally substituted aryl, C3-C10 carbocyclic, heteroaryl or heterocyclic ring.

In some embodiments, L has the structure of:

  • wherein:
  • E is —O—, —S—, —NR′— or —C(R′)2—;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—.

In some embodiments, L has the structure of:

wherein:

  • E is —O—, —S—, —NR′— or —C(R′)2—;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—.

In some embodiments, L has the structure of:

wherein:

  • E is —O—, —S—, —NR′— or —C(R′)2—;
  • is a single or double bond;
    the two RL1 are taken together with the two carbon atoms to which they are bound to form an optionally substituted aryl, C3-C10 carbocyclic, heteroaryl or heterocyclic ring; and each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • is a single or double bond;
    the two RL1 are taken together with the two carbon atoms to which they are bound to form an optionally substituted aryl, C3-C10 carbocyclic, heteroaryl or heterocyclic ring; and each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • E is —O—, —S—, —NR′— or —C(R′)2—;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • E is —O—, —S—, —NR′— or —C(R′)2—;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • E is —O—, —S—, —NR′— or —C(R′)2—;
  • is a single or double bond;
    the two RL1 are taken together with the two carbon atoms to which they are bound to form an optionally substituted aryl, C3-C10 carbocyclic, heteroaryl or heterocyclic ring; and each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • is a single or double bond;
    the two RL1 are taken together with the two carbon atoms to which they are bound to form an optionally substituted aryl, C3-C10 carbocyclic, heteroaryl or heterocyclic ring; and each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • E is —O—, —S—, —NR′— or —C(R′)2—;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • R′ is as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • E is —O—, —S—, —NR′— or —C(R′)2—;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • each R′ is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • D is ═N—, ═C(F)—, ═C(Cl)—, ═C(Br)—, ═C(I)—, ═C(CN)—, ═C(NO2)—, ═C(CO2—(C1-C6 aliphatic))-, or ═C(CF3)—; and
  • R′ is as defined above and described herein.

In some embodiments, L has the structure of:

wherein the phenyl ring is optionally substituted. In some embodiments, the phenyl ring is not substituted. In some embodiments, the phenyl ring is substituted.

In some embodiments, L has the structure of:

wherein the phenyl ring is optionally substituted. In some embodiments, the phenyl ring is not substituted. In some embodiments, the phenyl ring is substituted.

In some embodiments, L has the structure of:

wherein:

  • is a single or double bond; and
  • the two RL1 are taken together with the two carbon atoms to which they are bound to form an optionally substituted aryl, C3-C10 carbocyclic, heteroaryl or heterocyclic ring.

In some embodiments, L has the structure of:

wherein:

  • G is —O—, —S—, or —NR′;
  • is a single or double bond; and
  • the two RL1 are taken together with the two carbon atoms to which they are bound to form an optionally substituted aryl, C3-C10 carbocyclic, heteroaryl or heterocyclic ring.

In some embodiments, E is —O—, —S—, —NR′— or —C(R′)2—, wherein each R′ independently as defined above and described herein. In some embodiments, E is —O—, —S—, or —NR′—. In some embodiments, E is —O—, —S—, or —NH—. In some embodiments, E is —O—. In some embodiments, E is —S—. In some embodiments, E is —NH—.

In some embodiments, G is —O—, —S—, or —NR′, wherein each R′ independently as defined above and described herein. In some embodiments, G is —O—, —S—, or —NH—. In some embodiments, G is —O—. In some embodiments, G is —S—. In some embodiments, G is —NH—.

In some embodiments, L is -L3-G-, wherein:

  • L3 is an optionally substituted C1-C5 alkylene or alkenylene, wherein one or more methylene units are optionally and independently replaced by —O—, —S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —S(O)—, —S(O)2—, or

  •  and
    wherein each of G, R′ and Ring Cy′ is independently as defined above and described herein.

In some embodiments, L is -L3-S—, wherein L3 is as defined above and described herein. In some embodiments, L is -L3-O—, wherein L3 is as defined above and described herein. In some embodiments, L is -L3-N(R′)—, wherein each of L3 and R′ is independently as defined above and described herein. In some embodiments, L is -L3-NH—, wherein each of L3 and R′ is independently as defined above and described herein.

In some embodiments, L3 is an optionally substituted Cs alkylene or alkenylene, wherein one or more methylene units are optionally and independently replaced by —O—, —S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —S(O)—, —S(O)2—, or

and each of R′ and Ring Cy′ is independently as defined above and described herein. In some embodiments, L3 is an optionally substituted C5 alkylene. In some embodiments, -L3-G- is

In some embodiments, L3 is an optionally substituted C4 alkylene or alkenylene, wherein one or more methylene units are optionally and independently replaced by —O—, —S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —S(O)—, —S(O)2—, or

and each of R′ and Cy′ is independently as defined above and described herein.

In some embodiments, -L3-G- is

In some embodiments, L3 is an optionally substituted C3 alkylene or alkenylene, wherein one or more methylene units are optionally and independently replaced by —O—, —S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —S(O)—, —S(O)2—, or

and each of R′ and Cy′ is independently as defined above and described herein.

In some embodiments, -L3-G- is

In some embodiments, L is

In some embodiments, L is

In some embodiments, L is

In some embodiments, L3 is an optionally substituted C2 alkylene or alkenylene, wherein one or more methylene units are optionally and independently replaced by —O—, —S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —S(O)—, —S(O)2—, or

and each of R′ and Cy′ is independently as defined above and described herein.

In some embodiments, -L3-G- is

wherein each of G and Cy′ is independently as defined above and described herein. In some embodiments, L is

In some embodiments, L is -L4-G-, wherein L4 is an optionally substituted C1-C2 alkylene; and G is as defined above and described herein. In some embodiments, L is -L4-G-, wherein L4 is an optionally substituted C1-C2 alkylene; G is as defined above and described herein; and G is connected to R1. In some embodiments, L is -L4-G-, wherein L4 is an optionally substituted methylene; G is as defined above and described herein; and G is connected to R1. In some embodiments, L is -L4-G-, wherein L4 is methylene; G is as defined above and described herein; and G is connected to R1. In some embodiments, L is -L4-G-, wherein L4 is an optionally substituted —(CH2)2—; G is as defined above and described herein; and G is connected to R1. In some embodiments, L is -L4-G-, wherein L4 is —(CH2)2—; G is as defined above and described herein; and G is connected to R1.

In some embodiments, L is

wherein G is as defined above and described herein, and G is connected to R1. In some embodiments, L is

wherein G is as defined above and described herein, and G is connected to R1. In some embodiments, L is

wherein G is as defined above and described herein, and G is connected to R1. In some embodiments, L is

wherein the sulfur atom is connected to R1. In some embodiments, L is

wherein the oxygen atom is connected to R1.

In some embodiments, L is

wherein G is as defined above and described herein.

In some embodiments, L is —S—RL3— or —S—C(O)—RL3—, wherein RL3 is an optionally substituted, linear or branched, C1-C9 alkylene, wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, wherein each of R′ and -Cy- is independently as defined above and described herein. In some embodiments, L is —S—RL3— or —S—C(O)—RL3—, wherein RL3 is an optionally substituted C1-C6 alkylene. In some embodiments, L is —S—RL3— or —S—C(O)—RL3—, wherein RL3 is an optionally substituted C1-C6 alkenylene. In some embodiments, L is —S—RL3— or —S—C(O)—RL3—, wherein RL3 is an optionally substituted C1-C6 alkylene wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkenylene, arylene, or heteroarylene. In some embodiments, In some embodiments, RL3 is an optionally substituted —S—(C1-C6 alkenylene)-, —S—(C1-C6 alkylene)-, —S—(C1-C6 alkylene)-arylene-(C1-C6 alkylene)-, —S—CO-arylene-(C1-C6 alkylene)-, or —S—CO—(C1-C6 alkylene)-arylene-(C1-C6 alkylene)-.

In some embodiments, L is

In some embodiments, L is

In some embodiments, L is

In some embodiments,

In some embodiments, the sulfur atom in the L embodiments described above and herein is connected to X. In some embodiments, the sulfur atom in the L embodiments described above and herein is connected to R1.

In some embodiments, R1 is halogen, R, or an optionally substituted C1-C50 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, wherein each variable is independently as defined above and described herein. In some embodiments, R1 is halogen, R, or an optionally substituted C1-C10 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, wherein each variable is independently as defined above and described herein.

In some embodiments, R1 is hydrogen. In some embodiments, R1 is halogen. In some embodiments, R1 is —F. In some embodiments, R1 is —Cl. In some embodiments, R1 is —Br. In some embodiments, R1 is —I.

In some embodiments, R1 is R wherein R is as defined above and described herein.

In some embodiments, R1 is hydrogen. In some embodiments, R1 is an optionally substituted group selected from C1-C50 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl.

In some embodiments, R1 is an optionally substituted C1-C50 aliphatic. In some embodiments, R1 is an optionally substituted C1-C10 aliphatic. In some embodiments, R1 is an optionally substituted C1-C6 aliphatic. In some embodiments, R1 is an optionally substituted C1-C6 alkyl. In some embodiments, R1 is optionally substituted, linear or branched hexyl. In some embodiments, R1 is optionally substituted, linear or branched pentyl. In some embodiments, R1 is optionally substituted, linear or branched butyl. In some embodiments, R1 is optionally substituted, linear or branched propyl. In some embodiments, R1 is optionally substituted ethyl. In some embodiments, R1 is optionally substituted methyl.

In some embodiments, R1 is optionally substituted phenyl. In some embodiments, R1 is substituted phenyl. In some embodiments, R1 is phenyl.

In some embodiments, R1 is optionally substituted carbocyclyl. In some embodiments, R1 is optionally substituted C3-C10 carbocyclyl. In some embodiments, R1 is optionally substituted monocyclic carbocyclyl. In some embodiments, R1 is optionally substituted cycloheptyl. In some embodiments, R1 is optionally substituted cyclohexyl. In some embodiments, R1 is optionally substituted cyclopentyl. In some embodiments, R1 is optionally substituted cyclobutyl. In some embodiments, R1 is an optionally substituted cyclopropyl. In some embodiments, R1 is optionally substituted bicyclic carbocyclyl.

In some embodiments, R1 is an optionally substituted C1-C50 polycyclic hydrocarbon. In some embodiments, R1 is an optionally substituted C1-C50 polycyclic hydrocarbon wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, wherein each variable is independently as defined above and described herein. In some embodiments, R1 is optionally substituted

In some embodiments, R1 is

In some embodiments, R1 is optionally substituted

In some embodiments, R1 is an optionally substituted C1-C50 aliphatic comprising one or more optionally substituted polycyclic hydrocarbon moieties. In some embodiments, R1 is an optionally substituted C1-C50 aliphatic comprising one or more optionally substituted polycyclic hydrocarbon moieties, wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, wherein each variable is independently as defined above and described herein. In some embodiments, R1 is an optionally substituted C1-C50 aliphatic comprising one or more optionally substituted

In some embodiments, R1 is

In some embodiments, R1 is

In some embodiments, R1 is

In some embodiments, R1 is

In some embodiments, R1 is

In some embodiments, R1 is an optionally substituted aryl. In some embodiments, R1 is an optionally substituted bicyclic aryl ring.

In some embodiments, R1 is an optionally substituted heteroaryl. In some embodiments, R1 is an optionally substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen. In some embodiments, R1 is a substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an unsubstituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen.

In some embodiments, R1 is an optionally substituted 5 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen or sulfur. In some embodiments, R1 is an optionally substituted 6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, R1 is an optionally substituted 5-membered monocyclic heteroaryl ring having 1 heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is selected from pyrrolyl, furanyl, or thienyl.

In some embodiments, R1 is an optionally substituted 5-membered heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R1 is an optionally substituted 5-membered heteroaryl ring having 1 nitrogen atom, and an additional heteroatom selected from sulfur or oxygen. Example R1 groups include optionally substituted pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl or isoxazolyl.

In some embodiments, R1 is a 6-membered heteroaryl ring having 1-3 nitrogen atoms. In other embodiments, R1 is an optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms. In some embodiments, R1 is an optionally substituted 6-membered heteroaryl ring having 2 nitrogen atoms. In certain embodiments, R1 is an optionally substituted 6-membered heteroaryl ring having 1 nitrogen. Example R1 groups include optionally substituted pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, or tetrazinyl.

In certain embodiments, R1 is an optionally substituted 8-10 membered bicyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted 5,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R1 is an optionally substituted 5,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R1 is an optionally substituted 5,6-fused heteroaryl ring having 1 heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted indolyl. In some embodiments, R1 is an optionally substituted azabicyclo[3.2.1]octanyl. In certain embodiments, R1 is an optionally substituted 5,6-fused heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted azaindolyl. In some embodiments, R1 is an optionally substituted benzimidazolyl. In some embodiments, R1 is an optionally substituted benzothiazolyl. In some embodiments, R1 is an optionally substituted benzoxazolyl. In some embodiments, R1 is an optionally substituted indazolyl. In certain embodiments, R1 is an optionally substituted 5,6-fused heteroaryl ring having 3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In certain embodiments, R1 is an optionally substituted 6,6-fused heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted 6,6-fused heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R1 is an optionally substituted 6,6-fused heteroaryl ring having 1 heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted quinolinyl. In some embodiments, R1 is an optionally substituted isoquinolinyl. According to one aspect, R1 is an optionally substituted 6,6-fused heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is a quinazoline or a quinoxaline.

In some embodiments, R1 is an optionally substituted heterocyclyl. In some embodiments, R1 is an optionally substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is a substituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an unsubstituted 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In some embodiments, R1 is an optionally substituted heterocyclyl. In some embodiments, R1 is an optionally substituted 6 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted 6 membered partially unsaturated heterocyclic ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted 6 membered partially unsaturated heterocyclic ring having 2 oxygen atoms.

In certain embodiments, R1 is a 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R1 is oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, oxepaneyl, aziridineyl, azetidineyl, pyrrolidinyl, piperidinyl, azepanyl, thiiranyl, thietanyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, thiepanyl, dioxolanyl, oxathiolanyl, oxazolidinyl, imidazolidinyl, thiazolidinyl, dithiolanyl, dioxanyl, morpholinyl, oxathianyl, piperazinyl, thiomorpholinyl, dithianyl, dioxepanyl, oxazepanyl, oxathiepanyl, dithiepanyl, diazepanyl, dihydrofuranonyl, tetrahydropyranonyl, oxepanonyl, pyrolidinonyl, piperidinonyl, azepanonyl, dihydrothiophenonyl, tetrahydrothiopyranonyl, thiepanonyl, oxazolidinonyl, oxazinanonyl, oxazepanonyl, dioxolanonyl, dioxanonyl, dioxepanonyl, oxathiolinonyl, oxathianonyl, oxathiepanonyl, thiazolidinonyl, thiazinanonyl, thiazepanonyl, imidazolidinonyl, tetrahydropyrimidinonyl, diazepanonyl, imidazolidinedionyl, oxazolidinedionyl, thiazolidinedionyl, dioxolanedionyl, oxathiolanedionyl, piperazinedionyl, morpholinedionyl, thiomorpholinedionyl, tetrahydropyranyl, tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl, piperazinyl, pyrrolidinyl, tetrahydrothiophenyl, or tetrahydrothiopyranyl. In some embodiments, R1 is an optionally substituted 5 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

In certain embodiments, R1 is an optionally substituted 5-6 membered partially unsaturated monocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R1 is an optionally substituted tetrahydropyridinyl, dihydrothiazolyl, dihydrooxazolyl, or oxazolinyl group.

In some embodiments, R1 is an optionally substituted 8-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R1 is an optionally substituted indolinyl. In some embodiments, R1 is an optionally substituted isoindolinyl. In some embodiments, R1 is an optionally substituted 1, 2, 3, 4-tetrahydroquinoline. In some embodiments, R1 is an optionally substituted 1, 2, 3, 4-tetrahydroisoquinoline.

In some embodiments, R1 is an optionally substituted C1-C10 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, wherein each variable is independently as defined above and described herein. In some embodiments, R1 is an optionally substituted C1-C10 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally-Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —OC(O)—, or —C(O)O—, wherein each R′ is independently as defined above and described herein. In some embodiments, R1 is an optionally substituted C1-C10 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally-Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —OC(O)—, or —C(O)O—, wherein each R′ is independently as defined above and described herein.

In some embodiments, R1 is

In some embodiments, R1 is CH3—,

In some embodiments, R1 comprises a terminal optionally substituted —(CH2)2— moiety which is connected to L. Examples of such R1 groups are depicted below:

In some embodiments, R1 comprises a terminal optionally substituted —(CH2)— moiety which is connected to L. Example such R1 groups are depicted below:

In some embodiments, R1 is —S—RL2, wherein RL2 is an optionally substituted C1-C9 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, and each of R′ and -Cy- is independently as defined above and described herein. In some embodiments, R1 is —S—RL2, wherein the sulfur atom is connected with the sulfur atom in L group.

In some embodiments, R1 is —C(O)—RL2, wherein RL2 is an optionally substituted C1-C9 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, and each of R′ and -Cy- is independently as defined above and described herein. In some embodiments, R1 is —C(O)—RL2, wherein the carbonyl group is connected with G in L group. In some embodiments, R1 is —C(O)—RL2, wherein the carbonyl group is connected with the sulfur atom in L group.

In some embodiments, RL2 is optionally substituted C1-C9 aliphatic. In some embodiments, RL2 is optionally substituted C1-C9 alkyl. In some embodiments, RL2 is optionally substituted C1-C9 alkenyl. In some embodiments, RL2 is optionally substituted C1-C9 alkynyl. In some embodiments, RL2 is an optionally substituted C1-C9 aliphatic wherein one or more methylene units are optionally and independently replaced by -Cy- or —C(O)—. In some embodiments, RL2 is an optionally substituted C1-C9 aliphatic wherein one or more methylene units are optionally and independently replaced by -Cy-. In some embodiments, RL2 is an optionally substituted C1-C9 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted heterocycylene. In some embodiments, RL2 is an optionally substituted C1-C9 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted arylene. In some embodiments, RL2 is an optionally substituted C1-C9 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted heteroarylene. In some embodiments, RL2 is an optionally substituted C1-C9 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C3-C10 carbocyclylene. In some embodiments, RL2 is an optionally substituted C1-C9 aliphatic wherein two methylene units are optionally and independently replaced by -Cy- or —C(O)—. In some embodiments, RL2 is an optionally substituted C1-C9 aliphatic wherein two methylene units are optionally and independently replaced by -Cy- or —C(O)—. Example RL2 groups are depicted below:

In some embodiments, R1 is hydrogen, or an optionally substituted group selected from

—S—(C1-C10 aliphatic), C1-C10 aliphatic, aryl, C1-C6 heteroalkyl, heteroaryl and heterocyclyl. In some embodiments, R1 is

or —S—(C1-C10 aliphatic). In some embodiments, R1 is

In some embodiments, R1 is an optionally substituted group selected from —S—(C1-C6 aliphatic), C1-C10 aliphatic, C1-C6 heteroaliphatic, aryl, heterocyclyl and heteroaryl.

In some embodiments, R1 is

In some embodiments, the sulfur atom in the R1 embodiments described above and herein is connected with the sulfur atom, G, E, or —C(O)— moiety in the L embodiments described above and herein. In some embodiments, the —C(O)— moiety in the R1 embodiments described above and herein is connected with the sulfur atom, G, E, or —C(O)— moiety in the L embodiments described above and herein.

In some embodiments, -L-R1 is any combination of the L embodiments and R1 embodiments described above and herein.

In some embodiments, -L-R1 is -L3-G-R1 wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 is -L4-G-R1 wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 is -L3-G-S—RL2, wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 is -L3-G-C(O)—RL2, wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 is

wherein RL2 is an optionally substituted C1-C9 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, and each G is independently as defined above and described herein.

In some embodiments, -L-R1 is —RL3—S—S—RL2, wherein each variable is independently as defined above and described herein. In some embodiments, -L-R1 is —RL3—C(O)—S—S—RL2, wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, -L-R1 has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, L has the structure of:

wherein each variable is independently as defined above and described herein.

In some embodiments, —X-L-R1 has the structure of:

wherein:
the phenyl ring is optionally substituted, and
each of R1 and X is independently as defined above and described herein.

In some embodiments, -L-R1 is

In some embodiments, -L-R1 is:

In some embodiments, -L-R1 is CH3—,

In some embodiments, -L-R1 is

In some embodiments, -L-R1 comprises a terminal optionally substituted —(CH2)2— moiety which is connected to X. In some embodiments, -L-R1 comprises a terminal —(CH2)2— moiety which is connected to X. Examples of such -L-R1 moieties are depicted below:

In some embodiments, -L-R1 comprises a terminal optionally substituted —(CH2)— moiety which is connected to X. In some embodiments, -L-R1 comprises a terminal —(CH2)— moiety which is connected to X. Examples of such -L-R1 moieties are depicted below:

In some embodiments, -L-R1 is

In some embodiments, -L-R1 is CH3—,

and X is —S—.

In some embodiments, -L-R1 is CH3—,

X is —S—, W is O, Y is —O—, and Z is —O—.

In some embodiments, R1 is

or —S—(C1-C10 aliphatic).

In some embodiments, R1 is

In some embodiments, X is —O— or —S—, and R1 is

or —S—(C1-C10 aliphatic).

In some embodiments, X is —O— or —S—, and R1 is

—S—(C1-C10 aliphatic) or —S—(C1-C50 aliphatic).

In some embodiments, L is a covalent bond and -L-R1 is R1.

In some embodiments, -L-R1 is not hydrogen.

In some embodiments, —X-L-R1 is R1 is

—S—(C1-C10 aliphatic) or —S—(C1-C50 aliphatic).

In some embodiments, —X-L-R1 has the structure of

wherein the

moiety is optionally substituted. In some embodiments, —X-L-R1 is

In some embodiments, —X-L-R1 is

In some embodiments, —X-L-R1 is

In some embodiments, —X-L-R1 has the structure of

wherein X′ is O or S, Y′ is —O—, —S— or —NR′—, and the

moiety is optionally substituted. In some embodiments, Y′ is —O—, —S— or —NH—. In some embodiments,

In some embodiments,

In some embodiments,

In some embodiments, —X-L-R1 has the structure of

wherein X′ is O or S, and the

moiety is optionally substituted. In some embodiments,

In some embodiments, —X-L-R1 is

wherein the

is optionally substituted. In some embodiments, —X-L-R1 is

wherein the

is substituted. In some embodiments, —X-L-R1 is

wherein the

is unsubstituted.

In some embodiments, —X-L-R1 is R1—C(O)—S-Lx-S—, wherein Lx is an optionally substituted group selected from

In some embodiments, Lx is

In some embodiments, —X-L-R1 is (CH3)3C—S—S-Lx-S—. In some embodiments, —X-L-R1 is R′—C(═X′)—Y′—C(R)2—S-Lx-S—. In some embodiments, —X-L-R1 is R—C(═X′)—Y′—CH2—S-Lx-S—. In some embodiments, —X-L-R1 is

As will be appreciated by a person skilled in the art, many of the —X-L-R1 groups described herein are cleavable and can be converted to —X− after administration to a subject. In some embodiments, —X-L-R1 is cleavable. In some embodiments, —X-L-R1 is —S-L-R1, and is converted to —S− after administration to a subject. In some embodiments, the conversion is promoted by an enzyme of a subject. As appreciated by a person skilled in the art, methods of determining whether the —S-L-R1 group is converted to —S− after administration is widely known and practiced in the art, including those used for studying drug metabolism and pharmacokinetics.

In some embodiments, the internucleotidic linkage having the structure of formula I is

In some embodiments, the internucleotidic linkage of formula I has the structure of formula I-a:

wherein each variable is independently as defined above and described herein.

In some embodiments, the internucleotidic linkage of formula I has the structure of formula I-b:

wherein each variable is independently as defined above and described herein.

In some embodiments, the internucleotidic linkage of formula I is an phosphorothioate triester linkage having the structure of formula I-c:

wherein:

  • P* is an asymmetric phosphorus atom and is either Rp or Sp;
  • L is a covalent bond or an optionally substituted, linear or branched C1-C10 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—;
  • R1 is halogen, R, or an optionally substituted C1-C50 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—;
  • each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or:
    • two R′ on the same nitrogen are taken together with their intervening atoms to form an optionally substituted heterocyclic or heteroaryl ring, or
    • two R′ on the same carbon are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
  • -Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene;
  • each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl;
  • each

  •  independently represents a connection to a nucleoside; and
  • R1 is not —H when L is a covalent bond.

In some embodiments, the internucleotidic linkage having the structure of formula I is

In some embodiments, the internucleotidic linkage having the structure of formula I-c is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising one or more phosphate diester linkages, and one or more modified internucleotide linkages having the formula of I-a, I-b, or I-c.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising at least one phosphate diester internucleotidic linkage and at least one phosphorothioate triester linkage having the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising at least one phosphate diester internucleotidic linkage and at least two phosphorothioate triester linkages having the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising at least one phosphate diester internucleotidic linkage and at least three phosphorothioate triester linkages having the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising at least one phosphate diester internucleotidic linkage and at least four phosphorothioate triester linkages having the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising at least one phosphate diester internucleotidic linkage and at least five phosphorothioate triester linkages having the structure of formula I-c.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the said sequence has over 50% identity with GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the said sequence has over 60% identity with GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the said sequence has over 70% identity with GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the said sequence has over 80% identity with GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the said sequence has over 90% identity with GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the said sequence has over 95% identity with GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41).

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage has a chiral linkage phosphorus. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage is

In some embodiments the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage has a chiral linkage phosphorus. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage has a chiral linkage phosphorus. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one linkage phosphorus is Rp. It is understood by a person of ordinary skill in the art that in certain embodiments wherein the chirally controlled oligonucleotide comprises an RNA sequence, each T is independently and optionally replaced with U. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each linkage phosphorus is Rp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one linkage phosphorus is Sp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each linkage phosphorus is Sp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a blockmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a stereoblockmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a P-modification blockmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a linkage blockmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is an altmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a stereoaltmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a P-modification altmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a linkage altmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a unimer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a stereounimer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a P-modification unimer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a linkage unimer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a gapmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide is a skipmer.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each cytosine is optionally and independently replaced by 5-methylcytosine. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one cytosine is optionally and independently replaced by 5-methylcytosine. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each cytosine is optionally and independently replaced by 5-methylcytosine.

In some embodiments, a chirally controlled oligonucleotide is designed such that one or more nucleotides comprise a phosphorus modification prone to “autorelease” under certain conditions. That is, under certain conditions, a particular phosphorus modification is designed such that it self-cleaves from the oligonucleotide to provide, e.g., a phosphate diester such as those found in naturally occurring DNA and RNA. In some embodiments, such a phosphorus modification has a structure of —O-L-R1, wherein each of L and R1 is independently as defined above and described herein. In some embodiments, an autorelease group comprises a morpholino group. In some embodiments, an autorelease group is characterized by the ability to deliver an agent to the internucleotidic phosphorus linker, which agent facilitates further modification of the phosphorus atom such as, e.g., desulfurization. In some embodiments, the agent is water and the further modification is hydrolysis to form a phosphate diester as is found in naturally occurring DNA and RNA.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein (including, as non-limiting examples, any sequence disclosed in any Table). In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence having over 50% identity with any sequence disclosed herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence having over 60% identity with any sequence disclosed herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence having over 70% identity with any sequence disclosed herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence having over 80% identity with any sequence disclosed herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence having over 90% identity with any sequence disclosed herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising a sequence having over 95% identity with any sequence disclosed herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage has a chiral linkage phosphorus. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein each internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein each internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage has a chiral linkage phosphorus. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein each internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein each internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide comprising any sequence disclosed herein, wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein at least one internucleotidic linkage has a chiral linkage phosphorus. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein at least one internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein each internucleotidic linkage has the structure of formula I. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein at least one internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein each internucleotidic linkage has the structure of formula I-c. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein at least one internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein each internucleotidic linkage is

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein at least one linkage phosphorus is Rp. It is understood by a person of ordinary skill in the art that in certain embodiments wherein the chirally controlled oligonucleotide comprises an RNA sequence, each T is independently and optionally replaced with U. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein each linkage phosphorus is Rp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein at least one linkage phosphorus is Sp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein each linkage phosphorus is Sp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a blockmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a stereoblockmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a P-modification blockmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a linkage blockmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is an altmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a stereoaltmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a P-modification altmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a linkage altmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a unimer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a stereounimer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a P-modification unimer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a linkage unimer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a gapmer. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein the oligonucleotide is a skipmer.

In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein each cytosine is optionally and independently replaced by 5-methylcytosine. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein at least one cytosine is optionally and independently replaced by 5-methylcytosine. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having any sequence disclosed herein, wherein each cytosine is optionally and independently replaced by 5-methylcytosine.

In various embodiments, any sequence disclosed herein can be combined with one or more of the following as disclosed herein or known in the art: pattern of backbone linkages; pattern of backbone chiral centers; and pattern of backbone P-modifications; pattern of base modification; pattern of sugar modification; pattern of backbone linkages; pattern of backbone chiral centers; and pattern of backbone P-modifications.

In some embodiments, a chirally controlled oligonucleotide is designed such that the resulting pharmaceutical properties are improved through one or more particular modifications at phosphorus. It is well documented in the art that certain oligonucleotides are rapidly degraded by nucleases and exhibit poor cellular uptake through the cytoplasmic cell membrane [Poijarvi-Virta et al., Curr. Med. Chem. (2006), 13(28); 3441-65; Wagner et al., Med. Res. Rev. (2000), 20(6):417-51; Peyrottes et al., Mini Rev. Med. Chem. (2004), 4(4):395-408; Gosselin et al., (1996), 43(1):196-208; Bologna et al., (2002), Antisense & Nucleic Acid Drug Development 12:33-41]. For instance, Vives et al., Nucleic Acids Research (1999), 27(20):4071-76, found that tert-butyl SATE pro-oligonucleotides displayed markedly increased cellular penetration compared to the parent oligonucleotide.

In some embodiments, a modification at a linkage phosphorus is characterized by its ability to be transformed to a phosphate diester, such as those present in naturally occurring DNA and RNA, by one or more esterases, nucleases, and/or cytochrome P450 enzymes, including but not limited to, those listed in Table 1A, below.

TABLE 1A Example enzymes. Family Gene CYP1 CYP1A1, CYP1A2, CYP1B1 CYP2 CYP2A6, CYP2A7, CYP2A13, CYP2B6, CYP2C8, CYP2C9, CYP2C18, CYP2C19, CYP2D6, CYP2E1, CYP2F1, CYP2J2, CYP2R1, CYP2S1, CYP2U1, CYP2W1 CYP3 CYP3A4, CYP3A5, CYP3A7, CYP3A43 CYP4 CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4V2, CYP4X1, CYP4Z1 CYP5 CYP5A1 CYP7 CYP7A1, CYP7B1 CYP8 CYP8A1 (prostacyclin synthase), CYP8B1 (bile acid biosynthesis) CYP11 CYP11A1, CYP11B1, CYP11B2 CYP17 CYP17A1 CYP19 CYP19A1 CYP20 CYP20A1 CYP21 CYP21A2 CYP24 CYP24A1 CYP26 CYP26A1, CYP26B1, CYP26C1 CYP27 CYP27A1 (bile acid biosynthesis), CYP27B1 (vitamin D3 1-alpha hydroxylase, activates vitamin D3), CYP27C1 (unknown function) CYP39 CYP39A1 CYP46 CYP46A1 CYP51 CYP51A1 (lanosterol 14-alpha demethylase)

In some embodiments, a modification at phosphorus results in a P-modification moiety characterized in that it acts as a pro-drug, e.g., the P-modification moiety facilitates delivery of an oligonucleotide to a desired location prior to removal. For instance, in some embodiments, a P-modification moiety results from PEGylation at the linkage phosphorus. One of skill in the relevant arts will appreciate that various PEG chain lengths are useful and that the selection of chain length will be determined in part by the result that is sought to be achieved by PEGylation. For instance, in some embodiments, PEGylation is effected in order to reduce RES uptake and extend in vivo circulation lifetime of an oligonucleotide.

In some embodiments, a PEGylation reagent for use in accordance with the present disclosure is of a molecular weight of about 300 g/mol to about 100,000 g/mol. In some embodiments, a PEGylation reagent is of a molecular weight of about 300 g/mol to about 10,000 g/mol. In some embodiments, a PEGylation reagent is of a molecular weight of about 300 g/mol to about 5,000 g/mol. In some embodiments, a PEGylation reagent is of a molecular weight of about 500 g/mol. In some embodiments, a PEGylation reagent of a molecular weight of about 1000 g/mol. In some embodiments, a PEGylation reagent is of a molecular weight of about 3000 g/mol. In some embodiments, a PEGylation reagent is of a molecular weight of about 5000 g/mol.

In certain embodiments, a PEGylation reagent is PEG500. In certain embodiments, a PEGylation reagent is PEG1000. In certain embodiments, a PEGylation reagent is PEG3000. In certain embodiments, a PEGylation reagent is PEG5000.

In some embodiments, a P-modification moiety is characterized in that it acts as a PK enhancer, e.g., lipids, PEGylated lipids, etc.

In some embodiments, a P-modification moiety is characterized in that it acts as an agent which promotes cell entry and/or endosomal escape, such as a membrane-disruptive lipid or peptide.

In some embodiments, a P-modification moiety is characterized in that it acts as a targeting agent. In some embodiments, a P-modification moiety is or comprises a targeting agent. The phrase “targeting agent,” as used herein, is an entity that is associates with a payload of interest (e.g., with an oligonucleotide or oligonucleotide composition) and also interacts with a target site of interest so that the payload of interest is targeted to the target site of interest when associated with the targeting agent to a materially greater extent than is observed under otherwise comparable conditions when the payload of interest is not associated with the targeting agent. A targeting agent may be, or comprise, any of a variety of chemical moieties, including, for example, small molecule moieties, nucleic acids, polypeptides, carbohydrates, etc. Targeting agents are described further by Adarsh et al., “Organelle Specific Targeted Drug Delivery—A Review,” International Journal of Research in Pharmaceutical and Biomedical Sciences, 2011, p. 895.

Examples of such targeting agents include, but are not limited to, proteins (e.g. Transferrin), oligopeptides (e.g., cyclic and acrylic RGD-containing oligopeptides), antibodies (monoclonal and polyclonal antibodies, e.g. IgG, IgA, IgM, IgD, IgE antibodies), sugars/carbohydrates (e.g., monosaccharides and/or oligosaccharides (mannose, mannose-6-phosphate, galactose, and the like)), vitamins (e.g., folate), or other small biomolecules. In some embodiments, a targeting moiety is a steroid molecule (e.g., bile acids including cholic acid, deoxycholic acid, dehydrocholic acid; cortisone; digoxigenin; testosterone; cholesterol; cationic steroids such as cortisone having a trimethylaminomethyl hydrazide group attached via a double bond at the 3-position of the cortisone ring, etc.). In some embodiments, a targeting moiety is a lipophilic molecule (e.g., alicyclic hydrocarbons, saturated and unsaturated fatty acids, waxes, terpenes, and polyalicyclic hydrocarbons such as adamantine and buckminsterfullerenes). In some embodiments, a lipophilic molecule is a terpenoid such as vitamin A, retinoic acid, retinal, or dehydroretinal. In some embodiments, a targeting moiety is a peptide.

In some embodiments, a P-modification moiety is a targeting agent of formula —X-L-R1 wherein each of X, L, and R1 are as defined in Formula I above.

In some embodiments, a P-modification moiety is characterized in that it facilitates cell specific delivery.

In some embodiments, a P-modification moiety is characterized in that it falls into one or more of the above-described categories. For instance, in some embodiments, a P-modification moiety acts as a PK enhancer and a targeting ligand. In some embodiments, a P-modification moiety acts as a pro-drug and an endosomal escape agent. One of skill in the relevant arts would recognize that numerous other such combinations are possible and are contemplated by the present disclosure.

Nucleobases

In some embodiments, a nucleobase present in a provided oligonucleotide is a natural nucleobase or a modified nucleobase derived from a natural nucleobase. Examples include, but are not limited to, uracil, thymine, adenine, cytosine, and guanine having their respective amino groups protected by acyl protecting groups, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs such as pseudoisocytosine and pseudouracil and other modified nucleobases such as 8-substituted purines, xanthine, or hypoxanthine (the latter two being the natural degradation products). Example modified nucleobases are disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22, 2183-2196 and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313.

Compounds represented by the following general formulae are also contemplated as modified nucleobases:

wherein R8 is an optionally substituted, linear or branched group selected from aliphatic, aryl, aralkyl, aryloxylalkyl, carbocyclyl, heterocyclyl or heteroaryl group having 1 to 15 carbon atoms, including, by way of example only, a methyl, isopropyl, phenyl, benzyl, or phenoxymethyl group; and each of R9 and R10 is independently an optionally substituted group selected from linear or branched aliphatic, carbocyclyl, aryl, heterocyclyl and heteroaryl.

Modified nucleobases also include expanded-size nucleobases in which one or more aryl rings, such as phenyl rings, have been added. Nucleic base replacements described in the Glen Research catalog (www.glenresearch.com); Krueger A T et al, Acc. Chem. Res., 2007, 40, 141-150; Kool, E T, Acc. Chem. Res., 2002, 35, 936-943; Benner S. A., et al., Nat. Rev. Genet., 2005, 6, 553-543; Romesberg, F. E., et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733; Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627, are contemplated as useful for the synthesis of the nucleic acids described herein. Some examples of these expanded-size nucleobases are shown below:

Herein, modified nucleobases also encompass structures that are not considered nucleobases but are other moieties such as, but not limited to, corrin- or porphyrin-derived rings. Porphyrin-derived base replacements have been described in Morales-Rojas, H and Kool, E T, Org. Lett., 2002, 4, 4377-4380. Shown below is an example of a porphyrin-derived ring which can be used as a base replacement:

In some embodiments, modified nucleobases are of any one of the following structures, optionally substituted:

In some embodiments, a modified nucleobase is fluorescent. Examples of such fluorescent modified nucleobases include phenanthrene, pyrene, stillbene, isoxanthine, isozanthopterin, terphenyl, terthiophene, benzoterthiophene, coumarin, lumazine, tethered stillbene, benzo-uracil, and naphtho-uracil, as shown below:

In some embodiments, a modified nucleobase is unsubstituted. In some embodiments, a modified nucleobase is substituted. In some embodiments, a modified nucleobase is substituted such that it contains, e.g., heteroatoms, alkyl groups, or linking moieties connected to fluorescent moieties, biotin or avidin moieties, or other protein or peptides. In some embodiments, a modified nucleobase is a “universal base” that is not a nucleobase in the most classical sense, but that functions similarly to a nucleobase. One representative example of such a universal base is 3-nitropyrrole.

In some embodiments, other nucleosides can also be used in the process disclosed herein and include nucleosides that incorporate modified nucleobases, or nucleobases covalently bound to modified sugars. Some examples of nucleosides that incorporate modified nucleobases include 4-acetylcytidine; 5-(carboxyhydroxylmethyl)uridine; 2′-O-methylcytidine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyluridine; dihydrouridine; 2′-O-methylpseudouridine; beta,D-galactosylqueosine; 2′-O-methylguanosine; N6-isopentenyladenosine; 1-methyladenosine; 1-methylpseudouridine; 1-methylguanosine; 1-methylinosine; 2,2-dimethylguanosine; 2-methyladenosine; 2-methylguanosine; N7-methylguanosine; 3-methyl-cytidine; 5-methylcytidine; 5-hydroxymethylcytidine; 5-formylcytosine; 5-carboxylcytosine; N6-methyladenosine; 7-methylguanosine; 5-methylaminoethyluridine; 5-methoxyaminomethyl-2-thiouridine; beta,D-mannosylqueosine; 5-methoxycarbonylmethyluridine; 5-methoxyuridine; 2-methylthio-N6-isopentenyladenosine; N-((9-beta,D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine; N-((9-beta,D-ribofuranosylpurine-6-yl)-N-methylcarbamoyl)threonine; uridine-5-oxyacetic acid methylester; uridine-5-oxyacetic acid (v); pseudouridine; queosine; 2-thiocytidine; 5-methyl-2-thiouridine; 2-thiouridine; 4-thiouridine; 5-methyluridine; 2′-O-methyl-5-methyluridine; and 2′-O-methyluridine.

In some embodiments, nucleosides include 6′-modified bicyclic nucleoside analogs that have either (R) or (S)-chirality at the 6′-position and include the analogs described in U.S. Pat. No. 7,399,845. In other embodiments, nucleosides include 5′-modified bicyclic nucleoside analogs that have either (R) or (S)-chirality at the 5′-position and include the analogs described in US Patent Application Publication No. 20070287831.

In some embodiments, a nucleobase or modified nucleobase comprises one or more biomolecule binding moieties such as e.g., antibodies, antibody fragments, biotin, avidin, streptavidin, receptor ligands, or chelating moieties. In other embodiments, a nucleobase or modified nucleobase is 5-bromouracil, 5-iodouracil, or 2,6-diaminopurine. In some embodiments, a nucleobase or modified nucleobase is modified by substitution with a fluorescent or biomolecule binding moiety. In some embodiments, the substituent on a nucleobase or modified nucleobase is a fluorescent moiety. In some embodiments, the substituent on a nucleobase or modified nucleobase is biotin or avidin.

Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,457,191; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, each of which is herein incorporated by reference in its entirety.

In some embodiments, a base is optionally substituted A, T, C, G or U, wherein one or more —NH2 are independently and optionally replaced with —C(-L-R1)3, one or more —NH— are independently and optionally replaced with —C(-L-R1)2—, one or more ═N— are independently and optionally replaced with —C(-L-R1)—, one or more ═CH— are independently and optionally replaced with ═N—, and one or more ═O are independently and optionally replaced with ═S, ═N(-L-R1), or ═C(-L-R1)2, wherein two or more -L-R1 are optionally taken together with their intervening atoms to form a 3-30 membered bicyclic or polycyclic ring having 0-10 heteroatom ring atoms. In some embodiments, a modified base is optionally substituted A, T, C, G or U, wherein one or more —NH2 are independently and optionally replaced with —C(-L-R1)3, one or more —NH— are independently and optionally replaced with —C(-L-R1)2—, one or more ═N— are independently and optionally replaced with —C(-L-R1)—, one or more ═CH— are independently and optionally replaced with ═N—, and one or more ═O are independently and optionally replaced with ═S, ═N(-L-R1), or ═C(-L-R1)2, wherein two or more -L-R1 are optionally taken together with their intervening atoms to form a 3-30 membered bicyclic or polycyclic ring having 0-10 heteroatom ring atoms, wherein the modified base is different than the natural A, T, C, G and U. In some embodiments, a base is optionally substituted A, T, C, G or U. In some embodiments, a modified base is substituted A, T, C, G or U, wherein the modified base is different than the natural A, T, C, G and U.

In some embodiments, a modified nucleotide or nucleotide analog is any modified nucleotide or nucleotide analog described in any of: Gryaznov, S; Chen, J.-K. J. Am. Chem. Soc. 1994, 116, 3143; Hendrix et al. 1997 Chem. Eur. J. 3: 110; Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Jepsen et al. 2004 Oligo. 14: 130-146; Jones et al. J. Org. Chem. 1993, 58, 2983; Koizumi et al. 2003 Nuc. Acids Res. 12: 3267-3273; Koshkin et al. 1998 Tetrahedron 54: 3607-3630; Kumar et al. 1998 Bioo. Med. Chem. Let. 8: 2219-2222; Lauritsen et al. 2002 Chem. Comm. 5: 530-531; Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; Mesmaeker et al. Angew. Chem., Int. Ed. Engl. 1994, 33, 226; Morita et al. 2001 Nucl. Acids Res. Supp. 1: 241-242; Morita et al. 2002 Bioo. Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem. Lett. 2211-2226; Nielsen et al. 1997 Chem. Soc. Rev. 73; Nielsen et al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Obika et al. 1997 Tetrahedron Lett. 38 (50): 8735-8; Obika et al. 1998 Tetrahedron Lett. 39: 5401-5404; Pallan et al. 2012 Chem. Comm. 48: 8195-8197; Petersen et al. 2003 TRENDS Biotech. 21: 74-81; Rajwanshi et al. 1999 Chem. Commun. 1395-1396; Schultz et al. 1996 Nucleic Acids Res. 24: 2966; Seth et al. 2009 J. Med. Chem. 52: 10-13; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al. 2010 J. Org. Chem. 75: 1569-1581; Seth et al. 2012 Bioo. Med. Chem. Lett. 22: 296-299; Seth et al. 2012 Mol. Ther-Nuc. Acids. 1, e47; Seth, Punit P; Siwkowski, Andrew; Allerson, Charles R; Vasquez, Guillermo; Lee, Sam; Prakash, Thazha P; Kinberger, Garth; Migawa, Michael T; Gaus, Hans; Bhat, Balkrishen; et al. From Nucleic Acids Symposium Series (2008), 52(1), 553-554; Singh et al. 1998 Chem. Comm. 1247-1248; Singh et al. 1998 J. Org. Chem. 63: 10035-39; Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Sorensen 2003 Chem. Comm. 2130-2131; Ts'o et al. Ann. N. Y. Acad. Sci. 1988, 507, 220; Van Aerschot et al. 1995 Angew. Chem. Int. Ed. Engl. 34: 1338; Vasseur et al. J. Am. Chem. Soc. 1992, 114, 4006; WO 20070900071; WO 20070900071; or WO 2016/079181.

Sugars

In some embodiments, provided oligonucleotides comprise one or more modified sugar moieties beside the natural sugar moieties.

The most common naturally occurring nucleotides are comprised of ribose sugars linked to the nucleobases adenosine (A), cytosine (C), guanine (G), and thymine (T) or uracil (U). Also contemplated are modified nucleotides wherein a phosphate group or linkage phosphorus in the nucleotides can be linked to various positions of a sugar or modified sugar. As non-limiting examples, the phosphate group or linkage phosphorus can be linked to the 2′, 3′, 4′ or 5′ hydroxyl moiety of a sugar or modified sugar. Nucleotides that incorporate modified nucleobases as described herein are also contemplated in this context. In some embodiments, nucleotides or modified nucleotides comprising an unprotected —OH moiety are used in accordance with methods of the present disclosure.

Other modified sugars can also be incorporated within a provided oligonucleotide. In some embodiments, a modified sugar contains one or more substituents at the 2′ position including one of the following: —F; —CF3, —CN, —N3, —NO, —NO2, —OR′, —SR′, or —N(R′)2, wherein each R′ is independently as defined above and described herein; —O—(C1-C10 alkyl), —S—(C1-C10 alkyl), —NH—(C1-C10 alkyl), or —N(C1-C10 alkyl)2; —O—(C2-C10 alkenyl), —S—(C2-C10 alkenyl), —NH—(C2-C10 alkenyl), or —N(C2-C10 alkenyl)2; —O—(C2-C10 alkynyl), —S—(C2-C10 alkynyl), —NH—(C2-C10 alkynyl), or —N(C2-C10 alkynyl)2; or —O—(C1-C10 alkylene)-O—(C1-C10 alkyl), —O—(C1-C10 alkylene)-NH—(C1-C10 alkyl) or —O—(C1-C10 alkylene)-NH(C1-C10 alkyl)2, —NH—(C1-C10 alkylene)-O—(C1-C10 alkyl), or —N(C1-C10 alkyl)-(C1-C10 alkylene)-O—(C1-C10 alkyl), wherein the alkyl, alkylene, alkenyl and alkynyl may be substituted or unsubstituted. Examples of substituents include, and are not limited to, —O(CH2)nOCH3, and —O(CH2)nNH2, wherein n is from 1 to about 10, MOE, DMAOE, DMAEOE. Also contemplated herein are modified sugars described in WO 2001/088198; and Martin et al., Helv. Chim. Acta, 1995, 78, 486-504. In some embodiments, a modified sugar comprises one or more groups selected from a substituted silyl group, an RNA cleaving group, a reporter group, a fluorescent label, an intercalator, a group for improving the pharmacokinetic properties of a nucleic acid, a group for improving the pharmacodynamic properties of a nucleic acid, or other substituents having similar properties. In some embodiments, modifications are made at one or more of the the 2′, 3′, 4′, 5′, or 6′ positions of the sugar or modified sugar, including the 3′ position of the sugar on the 3′-terminal nucleotide or in the 5′ position of the 5′-terminal nucleotide.

In some embodiments, the 2′-OH of a ribose is replaced with a substituent including one of the following: —H, —F; —CF3, —CN, —N3, —NO, —NO2, —OR′, —SR′, or —N(R′)2, wherein each R′ is independently as defined above and described herein; —O—(C1-C10 alkyl), —S—(C1-C10 alkyl), —NH—(C1-C10 alkyl), or —N(C1-C10 alkyl)2; —O—(C2-C10 alkenyl), —S—(C2-C10 alkenyl), —NH—(C2-C10 alkenyl), or —N(C2-C10 alkenyl)2; —O—(C2-C10 alkynyl), —S—(C2-C10 alkynyl), —NH—(C2-C10 alkynyl), or —N(C2-C10 alkynyl)2; or —O—(C1-C10 alkylene)-O—(C1-C10 alkyl), —O—(C1-C10 alkylene)-NH—(C1-C10 alkyl) or —O—(C1-C10 alkylene)-NH(C1-C10 alkyl)2, —NH—(C1-C10 alkylene)-O—(C1-C10 alkyl), or —N(C1-C10 alkyl)-(C1-C10 alkylene)-O—(C1-C10 alkyl), wherein the alkyl, alkylene, alkenyl and alkynyl may be substituted or unsubstituted. In some embodiments, the 2′-OH is replaced with —H (deoxyribose). In some embodiments, the 2′-OH is replaced with —F. In some embodiments, the 2′-OH is replaced with —OR′. In some embodiments, the 2′-OH is replaced with —OMe. In some embodiments, the 2′-OH is replaced with —OCH2CH2OMe.

Modified sugars also include locked nucleic acids (LNAs). In some embodiments, two substituents on sugar carbon atoms are taken together to form a bivalent moiety. In some embodiments, two substituents are on two different sugar carbon atoms. In some embodiments, a formed bivalent moiety has the structure of -L- as defined herein. In some embodiments, -L- is —O—CH2—, wherein —CH2— is optionally substituted. In some embodiments, -L- is —O—CH2—. In some embodiments, -L- is —O—CH(Et)-. In some embodiments, -L- is between C2 and C4 of a sugar moiety. In some embodiments, a locked nucleic acid has the structure indicated below. A locked nucleic acid of the structure below is indicated, wherein Ba represents a nucleobase or modified nucleobase as described herein, and wherein R2s is —OCH2C4′-.

In some embodiments, a modified sugar is an ENA such as those described in, e.g., Seth et al., J Am Chem Soc. 2010 Oct. 27; 132(42): 14942-14950. In some embodiments, a modified sugar is any of those found in an XNA (xenonucleic acid), for instance, arabinose, anhydrohexitol, threose, 2′fluoroarabinose, or cyclohexene.

Modified sugars include sugar mimetics such as cyclobutyl or cyclopentyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; and 5,359,044. Some modified sugars that are contemplated include sugars in which the oxygen atom within the ribose ring is replaced by nitrogen, sulfur, selenium, or carbon. In some embodiments, a modified sugar is a modified ribose wherein the oxygen atom within the ribose ring is replaced with nitrogen, and wherein the nitrogen is optionally substituted with an alkyl group (e.g., methyl, ethyl, isopropyl, etc).

Non-limiting examples of modified sugars include glycerol, which form glycerol nucleic acid (GNA) analogues. One example of a GNA analogue is shown below and is described in Zhang, R et al., J. Am. Chem. Soc., 2008, 130, 5846-5847; Zhang L, et al., J. Am. Chem. Soc., 2005, 127, 4174-4175 and Tsai C H et al., PNAS, 2007, 14598-14603 (X═O−):

Another example of a GNA derived analogue, flexible nucleic acid (FNA) based on the mixed acetal aminal of formyl glycerol, is described in Joyce G F et al., PNAS, 1987, 84, 4398-4402 and Heuberger B D and Switzer C, J. Am. Chem. Soc., 2008, 130, 412-413, and is shown below:

Additional non-limiting examples of modified sugars include hexopyranosyl (6′ to 4′), pentopyranosyl (4′ to 2′), pentopyranosyl (4′ to 3′), or tetrofuranosyl (3′ to 2′) sugars. In some embodiments, a hexopyranosyl (6′ to 4′) sugar is of any one in the following formulae:

wherein Xs corresponds to the P-modification group “—XLR1” described herein and Ba is as defined herein.

In some embodiments, a pentopyranosyl (4′ to 2′) sugar is of any one in the following formulae:

wherein Xs corresponds to the P-modification group “—XLR1” described herein and Ba is as defined herein.

In some embodiments, a pentopyranosyl (4′ to 3′) sugar is of any one in the following formulae:

wherein Xs corresponds to the P-modification group “—XLR1” described herein and Ba is as defined herein.

In some embodiments, a tetrofuranosyl (3′ to 2′) sugar is of either in the following formulae:

wherein Xs corresponds to the P-modification group “—XLR1” described herein and Ba is as defined herein.

In some embodiments, a modified sugar is of any one in the following formulae:

wherein Xs corresponds to the P-modification group “—XLR1” described herein and Ba is as defined herein.

In some embodiments, one or more hydroxyl group in a sugar moiety is optionally and independently replaced with halogen, R′—N(R′)2, —OR′, or —SR′, wherein each R′ is independently as defined above and described herein.

In some embodiments, a sugar mimetic is as illustrated below, wherein Xs corresponds to the P-modification group “—XLR1” described herein, Ba is as defined herein, and X1 is selected from —S—, —Se—, —CH2—, —NMe-, —NEt- or —NiPr—.

In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43% 44%, 45%, 46%, 47%, 48%, 49%, 50% or more (e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more), inclusive, of the sugars in a chirally controlled oligonucleotide composition are modified. In some embodiments, only purine residues are modified (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50% or more [e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more] of the purine residues are modified). In some embodiments, only pyrimidine residues are modified (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50% or more [e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more] of the pyridimine residues are modified). In some embodiments, both purine and pyrimidine residues are modified.

Modified sugars and sugar mimetics can be prepared by methods known in the art, including, but not limited to: A. Eschenmoser, Science (1999), 284:2118; M. Bohringer et al, Helv. Chim. Acta (1992), 75:1416-1477; M. Egli et al, J. Am. Chem. Soc. (2006), 128(33):10847-56; A. Eschenmoser in Chemical Synthesis: Gnosis to Prognosis, C. Chatgilialoglu and V. Sniekus, Ed., (Kluwer Academic, Netherlands, 1996), p. 293; K.-U. Schoning et al, Science (2000), 290:1347-1351; A. Eschenmoser et al, Helv. Chim. Acta (1992), 75:218; J. Hunziker et al, Helv. Chim. Acta (1993), 76:259; G. Otting et al, Helv. Chim. Acta (1993), 76:2701; K. Groebke et al, Helv. Chim. Acta (1998), 81:375; and A. Eschenmoser, Science (1999), 284:2118. Modifications to the 2′ modifications can be found in Verma, S. et al. Annu. Rev. Biochem. 1998, 67, 99-134 and all references therein. Specific modifications to the ribose can be found in the following references: 2′-fluoro (Kawasaki et. al., J. Med. Chem., 1993, 36, 831-841), 2′-MOE (Martin, P. Helv. Chim. Acta 1996, 79, 1930-1938), “LNA” (Wengel, J. Acc. Chem. Res. 1999, 32, 301-310). In some embodiments, a modified sugar is any of those described in PCT Publication No. WO2012/030683, incorporated herein by reference, and depicted in the FIGS. 26-30 of the present application. In some embodiments, a modified sugar is any modified sugar described in any of: Gryaznov, S; Chen, J.-K. J. Am. Chem. Soc. 1994, 116, 3143; Hendrix et al. 1997 Chem. Eur. J. 3: 110; Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Jepsen et al. 2004 Oligo. 14: 130-146; Jones et al. J. Org. Chem. 1993, 58, 2983; Koizumi et al. 2003 Nuc. Acids Res. 12: 3267-3273; Koshkin et al. 1998 Tetrahedron 54: 3607-3630; Kumar et al. 1998 Bioo. Med. Chem. Let. 8: 2219-2222; Lauritsen et al. 2002 Chem. Comm. 5: 530-531; Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; Mesmaeker et al. Angew. Chem., Int. Ed. Engl. 1994, 33, 226; Morita et al. 2001 Nucl. Acids Res. Supp. 1: 241-242; Morita et al. 2002 Bioo. Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem. Lett. 2211-2226; Nielsen et al. 1997 Chem. Soc. Rev. 73; Nielsen et al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Obika et al. 1997 Tetrahedron Lett. 38 (50): 8735-8; Obika et al. 1998 Tetrahedron Lett. 39: 5401-5404; Pallan et al. 2012 Chem. Comm. 48: 8195-8197; Petersen et al. 2003 TRENDS Biotech. 21: 74-81; Rajwanshi et al. 1999 Chem. Commun. 1395-1396; Schultz et al. 1996 Nucleic Acids Res. 24: 2966; Seth et al. 2009 J. Med. Chem. 52: 10-13; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al. 2010 J. Org. Chem. 75: 1569-1581; Seth et al. 2012 Bioo. Med. Chem. Lett. 22: 296-299; Seth et al. 2012 Mol. Ther-Nuc. Acids. 1, e47; Seth, Punit P; Siwkowski, Andrew; Allerson, Charles R; Vasquez, Guillermo; Lee, Sam; Prakash, Thazha P; Kinberger, Garth; Migawa, Michael T; Gaus, Hans; Bhat, Balkrishen; et al. From Nucleic Acids Symposium Series (2008), 52(1), 553-554; Singh et al. 1998 Chem. Comm. 1247-1248; Singh et al. 1998 J. Org. Chem. 63: 10035-39; Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Sorensen 2003 Chem. Comm. 2130-2131; Ts'o et al. Ann. N. Y. Acad. Sci. 1988, 507, 220; Van Aerschot et al. 1995 Angew. Chem. Int. Ed. Engl. 34: 1338; Vasseur et al. J. Am. Chem. Soc. 1992, 114, 4006; WO 20070900071; WO 20070900071; or WO 2016/079181.

In some embodiments, a modified sugar moiety is an optionally substituted pentose or hexose moiety. In some embodiments, a modified sugar moiety is an optionally substituted pentose moiety. In some embodiments, a modified sugar moiety is an optionally substituted hexose moiety. In some embodiments, a modified sugar moiety is an optionally substituted ribose or hexitol moiety. In some embodiments, a modified sugar moiety is an optionally substituted ribose moiety. In some embodiments, a modified sugar moiety is an optionally substituted hexitol moiety.

In some embodiments, an example modified internucleotidic linkage and/or sugar is selected from:

In some embodiments, R1 is R as defined and described. In some embodiments, R2 is R. In some embodiments, Re is R. In some embodiments, Re is H, CH3, Bn, COCF3, benzoyl, benzyl, pyren-1-ylcarbonyl, pyren-1-ylmethyl, 2-aminoethyl. In some embodiments, an example modified internucleotidic linkage and/or sugar is selected from those described in Ts'o et al. Ann. N. Y. Acad. Sci. 1988, 507, 220; Gryaznov, S.; Chen, J.-K. J. Am. Chem. Soc. 1994, 116, 3143; Mesmaeker et al. Angew. Chem., Int. Ed. Engl. 1994, 33, 226; Jones et al. J. Org. Chem. 1993, 58, 2983; Vasseur et al. J. Am. Chem. Soc. 1992, 114, 4006; Van Aerschot et al. 1995 Angew. Chem. Int. Ed. Engl. 34: 1338; Hendrix et al. 1997 Chem. Eur. J. 3: 110; Koshkin et al. 1998 Tetrahedron 54: 3607-3630; Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Nielsen et al. 1997 Chem. Soc. Rev. 73; Schultz et al. 1996 Nucleic Acids Res. 24: 2966; Obika et al. 1997 Tetrahedron Lett. 38 (50): 8735-8; Obika et al. 1998 Tetrahedron Lett. 39: 5401-5404; Singh et al. 1998 Chem. Comm. 1247-1248; Kumar et al. 1998 Bioo. Med. Chem. Let. 8: 2219-2222; Nielsen et al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Seth et al. 2010 J. Org. Chem. 75: 1569-1581; Singh et al. 1998 J. Org. Chem. 63: 10035-39; Sorensen 2003 Chem. Comm. 2130-2131; Petersen et al. 2003 TRENDS Biotech. 21: 74-81; Rajwanshi et al. 1999 Chem. Commun. 1395-1396; Jepsen et al. 2004 Oligo. 14: 130-146; Morita et al. 2001 Nucl. Acids Res. Supp. 1: 241-242; Morita et al. 2002 Bioo. Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem. Lett. 2211-2226; Koizumi et al. 2003 Nuc. Acids Res. 12: 3267-3273; Lauritsen et al. 2002 Chem. Comm. 5: 530-531; Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; WO 20070900071; Seth et al., Nucleic Acids Symposium Series (2008), 52(1), 553-554; Seth et al. 2009 J. Med. Chem. 52: 10-13; Seth et al. 2012 Mol. Ther-Nuc. Acids. 1, e47; Pallan et al. 2012 Chem. Comm. 48: 8195-8197; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al. 2012 Bioo. Med. Chem. Lett. 22: 296-299; WO 2016/079181; U.S. Pat. Nos. 6,326,199; 6,066,500; and 6,440,739, the base and sugar modifications of each of which is herein incorporated by reference.

Oligonucleotides

In some embodiments, the present disclosure provides oligonucleotides and oligonucleotide compositions that are chirally controlled. For instance, in some embodiments, a provided composition contains predetermined levels of one or more individual oligonucleotide types, wherein an oligonucleotide type is defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone P-modifications. In some embodiments, a particular oligonucleotide type may be defined by 1A) base identity; 1B) pattern of base modification; 1C) pattern of sugar modification; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone P-modifications. In some embodiments, oligonucleotides of the same oligonucleotide type are identical.

As described herein, the present disclosure provides various oligonucleotides. In some embodiments, the present disclosure provides oligonucleotides comprising a sequence that shares greater than about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% identity with a sequence found in a provided example oligonucleotide, such as those listed in various tables. In some embodiments, a provided oligonucleotide is WV-1092. In some embodiments, a provided oligonucleotide is WV-2595. In some embodiments, a provided oligonucleotide is WV-2603. In some embodiments, the present disclosure provides oligonucleotides comprising or consisting of a sequence found in a provided example oligonucleotide. In some embodiments, the present disclosure provides oligonucleotides comprising or consisting of a sequence found in WV-1092. In some embodiments, the present disclosure provides oligonucleotides comprising or consisting of a sequence found in WV-2595. In some embodiments, the present disclosure provides oligonucleotides comprising or consisting of a sequence found in WV-2603. In some embodiments, a provided oligonucleotide further comprises one or more natural phosphate linkages and one or more modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises two or more natural phosphate linkages. In some embodiments, a provided oligonucleotide comprises two or more consecutive natural phosphate linkages. In some embodiments, a provided oligonucleotide comprises two or more modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises two or more consecutive modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises 5 or more consecutive modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises 5 or more consecutive modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises 6 or more consecutive modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises 7 or more consecutive modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises 8 or more consecutive modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises 9 or more consecutive modified internucleotidic linkages. In some embodiments, a provided oligonucleotide comprises 10 or more consecutive modified internucleotidic linkages. In some embodiments, at least one of the modified internucleotidic linkages is a chirally controlled internucleotidic linkage in that oligonucleotides having the same sequence and chemical modifications within a composition share the same configuration, either Rp or Sp, at the chiral phosphorus atom of the modified internucleotidic linkage. In some embodiments, at least two modified internucleotidic linkages are chirally controlled. In some embodiments, at least one modified internucleotidic linkage within a consecutive modified internucleotidic linkage region is chirally controlled. In some embodiments, at least two modified internucleotidic linkages within a consecutive modified internucleotidic linkage region are chirally controlled. In some embodiments, each modified internucleotidic linkage within a consecutive modified internucleotidic linkage region is chirally controlled. In some embodiments, each modified internucleotidic linkage is chirally controlled. In some embodiments, a provided oligonucleotide comprises a (Sp)xRp(Sp)y pattern, wherein each of x and y is independently 1-20, and the sum of x and y is 1-50. In some embodiments, each of x and y is independently 2-20. In some embodiments, at least one of x and y is greater than 5, 6, 7, 8, 9, or 10. In some embodiments, the sum of x and y is greater than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. In some embodiments, a provided oligonucleotide comprises one or more chemical modifications as presented in a provided example oligonucleotide. In some embodiments, a provided oligonucleotide comprises one or more base modifications as presented in a provided example oligonucleotide. In some embodiments, a provided oligonucleotide comprises one or more sugar modifications as presented in a provided example oligonucleotide. In some embodiments, a sugar modification is a 2′-modification. In some embodiments, a sugar modification is LNA. In some embodiments, a sugar modification is ENA. In some embodiments, a provided oligonucleotide is a chirally controlled oligonucleotide. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a provided oligonucleotide. In some embodiments, a provided oligonucleotide composition is a chirally controlled oligonucleotide composition.

In some embodiments, a provided oligonucleotide is a unimer. In some embodiments, a provided oligonucleotide is a P-modification unimer. In some embodiments, a provided oligonucleotide is a stereounimer. In some embodiments, a provided oligonucleotide is a stereounimer of configuration Rp. In some embodiments, a provided oligonucleotide is a stereounimer of configuration Sp.

In some embodiments, a provided oligonucleotide is an altmer. In some embodiments, a provided oligonucleotide is a P-modification altmer. In some embodiments, a provided oligonucleotide is a stereoaltmer.

In some embodiments, a provided oligonucleotide is a blockmer. In some embodiments, a provided oligonucleotide is a P-modification blockmer. In some embodiments, a provided oligonucleotide is a stereoblockmer.

In some embodiments, a provided oligonucleotide is a gapmer.

In some embodiments, a provided oligonucleotide is a skipmer.

In some embodiments, a provided oligonucleotide is a hemimer. In some embodiments, a hemimer is an oligonucleotide wherein the 5′-end or the 3′-end has a sequence that possesses a structure feature that the rest of the oligonucleotide does not have. In some embodiments, the 5′-end or the 3′-end has or comprises 2 to 20 nucleotides. In some embodiments, a structural feature is a base modification. In some embodiments, a structural feature is a sugar modification. In some embodiments, a structural feature is a P-modification. In some embodiments, a structural feature is stereochemistry of the chiral internucleotidic linkage. In some embodiments, a structural feature is or comprises a base modification, a sugar modification, a P-modification, or stereochemistry of the chiral internucleotidic linkage, or combinations thereof. In some embodiments, a hemimer is an oligonucleotide in which each sugar moiety of the 5′-end sequence shares a common modification. In some embodiments, a hemimer is an oligonucleotide in which each sugar moiety of the 3′-end sequence shares a common modification. In some embodiments, a common sugar modification of the 5′ or 3′ end sequence is not shared by any other sugar moieties in the oligonucleotide. In some embodiments, an example hemimer is an oligonucleotide comprising a sequence of substituted or unsubstituted 2′-O-alkyl sugar modified nucleosides, bicyclic sugar modified nucleosides, β-D-ribonucleosides or β-D-deoxyribonucleosides (for example 2′-MOE modified nucleosides, and LNA™ or ENA™ bicyclic sugar modified nucleosides) at one terminus and a sequence of nucleosides with a different sugar moiety (such as a substituted or unsubstituted 2′-O-alkyl sugar modified nucleosides, bicyclic sugar modified nucleosides or natural ones) at the other terminus. In some embodiments, a provided oligonucleotide is a combination of one or more of unimer, altmer, blockmer, gapmer, hemimer and skipmer. In some embodiments, a provided oligonucleotide is a combination of one or more of unimer, altmer, blockmer, gapmer, and skipmer. For instance, in some embodiments, a provided oligonucleotide is both an altmer and a gapmer. In some embodiments, a provided nucleotide is both a gapmer and a skipmer. One of skill in the chemical and synthetic arts will recognize that numerous other combinations of patterns are available and are limited only by the commercial availability and/or synthetic accessibility of constituent parts required to synthesize a provided oligonucleotide in accordance with methods of the present disclosure. In some embodiments, a hemimer structure provides advantageous benefits, as exemplified by FIG. 29. In some embodiments, provided oligonucleotides are 5′-hemmimers that comprises modified sugar moieties in a 5′-end sequence. In some embodiments, provided oligonucleotides are 5′-hemmimers that comprises modified 2′-sugar moieties in a 5′-end sequence.

In some embodiments, a provided oligonucleotide comprises one or more optionally substituted nucleotides. In some embodiments, a provided oligonucleotide comprises one or more modified nucleotides. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted nucleosides. In some embodiments, a provided oligonucleotide comprises one or more modified nucleosides. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted LNAs.

In some embodiments, a provided oligonucleotide comprises one or more optionally substituted nucleobases. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted natural nucleobases. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted modified nucleobases. In some embodiments, a provided oligonucleotide comprises one or more 5-methylcytidine; 5-hydroxymethylcytidine, 5-formylcytosine, or 5-carboxylcytosine. In some embodiments, a provided oligonucleotide comprises one or more 5-methylcytidine.

In some embodiments, a provided oligonucleotide comprises one or more optionally substituted sugars. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted sugars found in naturally occurring DNA and RNA. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted ribose or deoxyribose. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted ribose or deoxyribose, wherein one or more hydroxyl groups of the ribose or deoxyribose moiety is optionally and independently replaced by halogen, R′, —N(R′)2, —OR′, or —SR′, wherein each R′ is independently as defined above and described herein. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with halogen, R′, —N(R′)2, —OR′, or —SR′, wherein each R′ is independently as defined above and described herein. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with halogen. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with one or more —F. halogen. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —OR′, wherein each R′ is independently as defined above and described herein. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —OR′, wherein each R′ is independently an optionally substituted C1-C6 aliphatic. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —OR′, wherein each R′ is independently an optionally substituted C1-C6 alkyl. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —OMe. In some embodiments, a provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2′ position of the deoxyribose is optionally and independently substituted with —O-methoxyethyl.

In some embodiments, a provided oligonucleotide is single-stranded oligonucleotide.

In some embodiments, a provided oligonucleotide is a hybridized oligonucleotide strand. In certain embodiments, a provided oligonucleotide is a partially hybridized oligonucleotide strand. In certain embodiments, a provided oligonucleotide is a completely hybridized oligonucleotide strand. In certain embodiments, a provided oligonucleotide is a double-stranded oligonucleotide. In certain embodiments, a provided oligonucleotide is a triple-stranded oligonucleotide (e.g., a triplex).

In some embodiments, a provided oligonucleotide is chimeric. For example, in some embodiments, a provided oligonucleotide is DNA-RNA chimera, DNA-LNA chimera, etc.

In some embodiments, any one of the structures comprising an oligonucleotide depicted in WO2012/030683 can be modified in accordance with methods of the present disclosure to provide chirally controlled variants thereof. For example, in some embodiments the chirally controlled variants comprise a stereochemical modification at any one or more of the linkage phosphorus and/or a P-modification at any one or more of the linkage phosphorus. For example, in some embodiments, a particular nucleotide unit of an oligonucleotide of WO2012/030683 is preselected to be stereochemically modified at the linkage phosphorus of that nucleotide unit and/or P-modified at the linkage phosphorus of that nucleotide unit. In some embodiments, a chirally controlled oligonucleotide is of any one of the structures depicted in FIGS. 26-30. In some embodiments, a chirally controlled oligonucleotide is a variant (e.g., modified version) of any one of the structures depicted in FIGS. 26-30. The disclosure of WO2012/030683 is herein incorporated by reference in its entirety.

In some embodiments, a provided oligonucleotide is a therapeutic agent.

In some embodiments, a provided oligonucleotide is an antisense oligonucleotide.

In some embodiments, a provided oligonucleotide is an antigene oligonucleotide.

In some embodiments, a provided oligonucleotide is a decoy oligonucleotide.

In some embodiments, a provided oligonucleotide is part of a DNA vaccine.

In some embodiments, a provided oligonucleotide is an immunomodulatory oligonucleotide, e.g., immunostimulatory oligonucleotide and immunoinhibitory oligonucleotide.

In some embodiments, a provided oligonucleotide is an adjuvant.

In some embodiments, a provided oligonucleotide is an aptamer.

In some embodiments, a provided oligonucleotide is a ribozyme.

In some embodiments, a provided oligonucleotide is a deoxyribozyme (DNAzymes or DNA enzymes).

In some embodiments, a provided oligonucleotide is an siRNA.

In some embodiments, a provided oligonucleotide is a microRNA, or miRNA.

In some embodiments, a provided oligonucleotide is a ncRNA (non-coding RNAs), including a long non-coding RNA (lncRNA) and a small non-coding RNA, such as piwi-interacting RNA (piRNA).

In some embodiments, a provided oligonucleotide is complementary to a structural RNA, e.g., tRNA.

In some embodiments, a provided oligonucleotide is a nucleic acid analog, e.g., GNA, LNA, PNA, TNA, GNA, ANA, FANA, CeNA, HNA, UNA, ZNA, or Morpholino.

In some embodiments, a provided oligonucleotide is a P-modified prodrug.

In some embodiments, a provided oligonucleotide is a primer. In some embodiments, a primers is for use in polymerase-based chain reactions (i.e., PCR) to amplify nucleic acids. In some embodiments, a primer is for use in any known variations of PCR, such as reverse transcription PCR (RT-PCR) and real-time PCR.

In some embodiments, a provided oligonucleotide is characterized as having the ability to modulate RNase H activation. For example, in some embodiments, RNase H activation is modulated by the presence of stereocontrolled phosphorothioate nucleic acid analogs, with natural DNA/RNA being more or equally susceptible than the Rp stereoisomer, which in turn is more susceptible than the corresponding Sp stereoisomer.

In some embodiments, a provided oligonucleotide is characterized as having the ability to indirectly or directly increase or decrease activity of a protein or inhibition or promotion of the expression of a protein. In some embodiments, a provided oligonucleotide is characterized in that it is useful in the control of cell proliferation, viral replication, and/or any other cell signaling process.

In some embodiments, a provided oligonucleotide is from about 2 to about 200 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 180 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 160 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 140 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 120 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 100 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 90 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 80 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 70 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 60 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 50 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 40 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 30 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 29 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 28 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 27 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 26 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 25 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 24 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 23 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 22 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 21 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 2 to about 20 nucleotide units in length.

In some embodiments, a provided oligonucleotide is from about 4 to about 200 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 180 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 160 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 140 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 120 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 100 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 90 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 80 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 70 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 60 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 50 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 40 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 30 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 29 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 28 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 27 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 26 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 25 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 24 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 23 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 22 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 21 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 4 to about 20 nucleotide units in length.

In some embodiments, a provided oligonucleotide is from about 5 to about 10 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 10 to about 30 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 15 to about 25 nucleotide units in length. In some embodiments, a provided oligonucleotide is from about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide units in length.

In some embodiments, an oligonucleotide is at least 2 nucleotide units in length. In some embodiments, an oligonucleotide is at least 3 nucleotide units in length. In some embodiments, an oligonucleotide is at least 4 nucleotide units in length. In some embodiments, an oligonucleotide is at least 5 nucleotide units in length. In some embodiments, an oligonucleotide is at least 6 nucleotide units in length. In some embodiments, an oligonucleotide is at least 7 nucleotide units in length. In some embodiments, an oligonucleotide is at least 8 nucleotide units in length. In some embodiments, an oligonucleotide is at least 9 nucleotide units in length. In some embodiments, an oligonucleotide is at least 10 nucleotide units in length. In some embodiments, an oligonucleotide is at least 11 nucleotide units in length. In some embodiments, an oligonucleotide is at least 12 nucleotide units in length. In some embodiments, an oligonucleotide is at least 13 nucleotide units in length. In some embodiments, an oligonucleotide is at least 14 nucleotide units in length. In some embodiments, an oligonucleotide is at least 15 nucleotide units in length. In some embodiments, an oligonucleotide is at least 16 nucleotide units in length. In some embodiments, an oligonucleotide is at least 17 nucleotide units in length. In some embodiments, an oligonucleotide is at least 18 nucleotide units in length. In some embodiments, an oligonucleotide is at least 19 nucleotide units in length. In some embodiments, an oligonucleotide is at least 20 nucleotide units in length. In some embodiments, an oligonucleotide is at least 21 nucleotide units in length. In some embodiments, an oligonucleotide is at least 22 nucleotide units in length. In some embodiments, an oligonucleotide is at least 23 nucleotide units in length. In some embodiments, an oligonucleotide is at least 24 nucleotide units in length. In some embodiments, an oligonucleotide is at least 25 nucleotide units in length. In some other embodiments, an oligonucleotide is at least 30 nucleotide units in length. In some other embodiments, an oligonucleotide is a duplex of complementary strands of at least 18 nucleotide units in length. In some other embodiments, an oligonucleotide is a duplex of complementary strands of at least 21 nucleotide units in length.

In some embodiments, the 5′-end and/or the 3′-end of a provided oligonucleotide is modified. In some embodiments, the 5′-end and/or the 3′-end of a provided oligonucleotide is modified with a terminal cap moiety. Examples of such modifications, including terminal cap moieties are extensively described herein and in the art, for example but not limited to those described in US Patent Application Publication US 2009/0023675A1.

In some embodiments, oligonucleotides of an oligonucleotide type characterized by 1) a common base sequence and length, 2) a common pattern of backbone linkages, and 3) a common pattern of backbone chiral centers, have the same chemical structure. For example, they have the same base sequence, the same pattern of nucleoside modifications, the same pattern of backbone linkages (i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, etc), the same pattern of backbone chiral centers (i.e. pattern of linkage phosphorus stereochemistry (Rp/Sp)), and the same pattern of backbone phosphorus modifications (e.g., pattern of “—XLR1” groups in formula I). Example Oligonucleotides and Compositions

In some embodiments, a provided chirally controlled oligonucleotide comprises the sequence of, or part of the sequence of mipomersen. Mipomersen is based on the following base sequence GCCT/UCAGT/UCT/UGCT/UT/UCGCACC (SEQ ID NO: 42). In some embodiments, one or more of any of the nucleotide or linkages may be modified in accordance of the present disclosure. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide having the sequence of G*-C*-C*-U*-C*-dA-dG-dT-dC-dT-dG-dmC-dT-dT-dmC-G*-C*-A*-C*-C* (SEQ ID NO: 43) [d=2′-deoxy, *=2′-O-(2-methoxyethyl)] with 3′→5′ phosphorothioate linkages. Example modified mipomersen sequences are described throughout the application, including but not limited to those in Table 2.

In certain embodiments, a provided oligonucleotide is a mipomersen unimer. In certain embodiments, a provided oligonucleotide is a mipomersen unimer of configuration Rp. In certain embodiments, a provided oligonucleotide is a mipomersen unimer of configuration Sp.

Exemplary chirally controlled oligonucleotides comprising the sequence of, or part of the sequence of mipomersen is depicted in Table 2, below.

TABLE 2 Example oligonucleotides. SEQ ID Oligo Stereochemistry/Sequence Description NO: 101 All-(Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] All-R 44 102 All-(Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] All-S 45 103 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, 5R-9S-5R 46 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 104 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, 5S-9R-5S 47 Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 105 (Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Rp, Rp, Rp, 1S-17R-1S 48 Rp, Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 106 (Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 1R-17S-1R 49 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 107 (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, (R/S)9R 50 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 108 (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, (S/R)9S 51 Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 109 (Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Rp, Rp, Sp, Sp, 3S-13R-3S 52 Sp)d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 110 (Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Rp, Rp, 3R-13S-3R 53 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 111 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R19 54 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 112 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R9 55 Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 113 (Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R2 56 Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 114 (Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, (RRS)6-R 57 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 115 (Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, S-(RRS)6 58 Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 116 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 59 Rp)d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] (RRS)5-RR 122 All-(Rp)- All-R 60 d[Gs1Cs1Cs1Ts1Cs1As1Gs1Ts1Cs1Ts1Gs1Cs1Ts1Ts1Cs1Gs1Cs1 As1Cs1C] 123 (Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Rp, Rp, Rp, 1S-17R-1S 61 Rp, Sp)-d[Gs1Cs1Cs1Ts1Cs1As1Gs1Ts1Cs1 Ts1Gs1Cs1Ts1Ts1Cs1Gs1Cs1As1Cs1C] 124 All-(Sp)-d[Gs1Cs1Cs1Ts1Cs1As1Gs1Ts1Cs1Ts1 All-S 62 Gs1Cs1Ts1Ts1Cs1Gs1Cs1As1Cs1C] 126 All-(Rp)-d[Cs2As2Gs2T] All-R 127 All-(Rp)-d[Cs3As3Gs3T] All-R 128 All-(Sp)-d[Cs4As4Gs4T] All-S 129 All-(Sp)-d[Cs5As5Gs5T] All-S 130 All-(Sp)-d[Cs6As6Gs6T] All-S 131 All-(Rp)-d[Gs7Cs7Cs7Ts7Cs7As7Gs7Ts7Cs7Ts7Gs7 All-R 63 Cs7Ts7Ts7Cs7Gs7Cs7As7Cs7C] 132 All-(Sp)-d[Gs7Cs7Cs7Ts7Cs7As7Gs7Ts7Cs7Ts7Gs7 All-S 64 Cs7Ts7Ts7Cs7Gs7Cs7As7Cs7C] 133 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, 5R-9S-5R 65 Rp)-d[Gs15mCs15mCs1Ts15mCs1As1Gs1Ts15mCs1Ts1 Gs15mCs1Ts1Ts15mCs1Gs15mCs1As15mCs15mC] 134 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, 5S-9R-5S 66 Sp)-d[Gs15mCs15mCs1Ts15mCs1As1Gs1Ts15mCs1Ts1 Gs15mCs1Ts1Ts15mCs1Gs15mCs1As15mCs15mC] 135 All-(Rp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] All-R 67 136 All-(Sp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] All-S 68 137 (Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Sp)- 1S-9R-1S 69 d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 138 (Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Sp, Sp)- 2S-7R-2S 70 d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 139 (Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp)- 1R-9S-1R 71 d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 140 (Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Rp)- 2R-7S-2R 72 d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 141 (Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp)- 3S-5R-3S 73 d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 142 (Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp)- 3R-5S-3R 74 d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 143 (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)- (SSR)3-SS 75 d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 144 (Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp)- (RRS)3-RR 76 d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 145 All-(Rp)- All-R 77 d[5mCs1Ts15mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1 Gs15mC] 146 All-(Rp)-d[Gs15mCs1Ts1G] All-R 147 All-(Rp)-d[5mCs1As1Gs1T] All-R 148 All-(Rp)-d[5mCs2As2Gs2Ts25mCs2Ts2Gs25mCs2Ts2Ts25mCs2G] All-R 78 149 All-(Rp)-d[5mCs4As4Gs4Ts45mCs4Ts4Gs45mCs4Ts4Ts45mCs4G] All-R 79 151 All-(Sp)-d[Cs1AsGs1T] All-S 152 All-(Sp)-d[Cs1AGs1T] All-S 153 All-(Sp)-d[CAs1GsT] All-S 157 All-(Sp)-d[5mCs1As1Gs1T] All-S 158 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 80 d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCs1GsCsACsC] 159 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, 5S-9R-5S 81 Sp)-d[Gs1Cs1Cs1Ts1CsAsGsTsCsTsGsCsTsTsCs1GsCs2As2Cs2C] 160 All-(Rp)- All-R 82 (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 161 All-(Sp)- All-S 83 (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 162 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, 5R-9S-5R 84 Rp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 163 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, 5S-9R-5S 85 Sp)-(Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 164 (Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Rp, Rp, Rp, 1S-17R-1S 86 Rp, Sp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 165 (Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 1R-17S-1R 87 Rp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 166 (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, (R/S)9R 88 Rp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 167 (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, (S/R)9S 89 Sp)-(Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 168 (Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Rp, Rp, Sp, Sp, 3S-13R-3S 90 Sp)(Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 169 (Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Rp, Rp, 3R-13S-3R 91 Rp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 170 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R19 92 Rp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 171 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R9 93 Sp)-(Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 172 (Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R2 94 Sp)-(Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 173 (Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, (RRS)6-R 95 Rp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 174 (Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, S-(RRS)6 96 Sp)-(Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)MOE 175 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 97 Rp)(Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (RRS)5-RR (Gs5mCsAs5mCs5mC)MOE 176 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 98 Rp)(Gs15mCs15mCs1Ts15mCs1)MOEd[As1Gs1Ts15mCs1Ts1Gs15m (RRS)5-RR Cs1Ts1Ts15mCs1] (Gs15mCs1As15mCs15mC)MOE 177 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 99 Rp)(Gs15mCs15mCs1Ts15mCs1)MOEd[AGT5mCTG5mCTT5mC] (RRS)5-RR (Gs25mCs2As25mCs25mC)MOE 178 (Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, S-(RRS)6 100 Sp)-(Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs] (Gs5mCsAs5mCs5mC)F (F: 2-fluorodeoxyribose) 179 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 101 Rp)d[Gs8Cs8Cs8Ts8Cs8As8Gs8Ts8Cs8Ts8Gs8Cs8Ts8Ts8Cs8Gs8Cs (RRS)5-RR 8As8Cs8C] 180 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 102 Rp)d[Gs9Cs9Cs9Ts9Cs9As9Gs9Ts9Cs9Ts9Gs9Cs9Ts9Ts9Cs9Gs9Cs (RRS)5-RR 9As9Cs9C] 181 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 103 Rp)d[Gs10Cs10Cs10Ts10Cs10As10Gs10Ts10Cs10Ts10Gs10Cs10Ts (RRS)5-RR 10Ts10Cs10Gs10Cs10As10Cs10C] 182 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 104 Rp)d[Gs11Cs11Cs11Ts11Cs11As11Gs11Ts11Cs11Ts11Gs11Cs11Ts (RRS)5-RR 11Ts11Cs11Gs11Cs11As11Cs11C] 183 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 105 Rp)d[Gs12Cs12Cs12Ts12Cs12As12Gs12Ts12Cs12Ts12Gs12Cs12Ts (RRS)5-RR 12Ts12Cs12Gs12Cs12As12Cs12C] 184 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 106 Rp)d[Gs13Cs13Cs13Ts13Cs13As13Gs13Ts13Cs13Ts13Gs13Cs13Ts (RRS)5-RR 13Ts13Cs13Gs13Cs13As13Cs13C] 185 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 107 Rp)d[Gs14Cs14Cs14Ts14Cs14As14Gs14Ts14Cs14Ts14Gs14Cs14Ts (RRS)5-RR 14Ts14Cs14Gs14Cs14As14Cs14C] 186 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 108 Rp)d[Gs15Cs15Cs15Ts15Cs15As15Gs15Ts15Cs15Ts15Gs15Cs15Ts (RRS)5-RR 15Ts15Cs15Gs15Cs15As15Cs15C] 187 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 109 Rp)d[GsCsCs1TsCsAs]GsUs2CsUsGsd[CsTs3TsCsGs]CsAs4CsC (RRS)5-RR 188 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 110 d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsACsC] 189 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 111 d[Gs1Cs1Cs1Ts1Cs1As1Gs1Ts1Cs1Ts1Gs1Cs1Ts1Ts1Cs1Gs1CsAC s1C] 190 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 112 d[Gs8Cs8Cs8Ts8Cs8As8Gs8Ts8Cs8Ts8Gs8Cs8Ts8Ts8Cs8Gs8Cs1A Cs8C] 191 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 113 d[Gs9Cs9Cs9Ts9Cs9As9Gs9Ts9Cs9Ts9Gs9Cs9Ts9Ts9Cs9Gs9Cs1A Cs9C] 192 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 114 d[Gs10Cs10Cs10Ts10Cs10As10Gs10Ts10Cs10Ts10Gs10Cs10Ts10T s10Cs10Gs10Cs1ACs10C] 193 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 115 d[Gs11Cs11Cs11Ts11Cs11As11Gs11Ts11Cs11Ts11Gs11Cs11Ts11T s11Cs11Gs11Cs1ACs11C] 194 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 116 d[Gs12Cs12Cs12Ts12Cs12As12Gs12Ts12Cs12Ts12Gs12Cs12Ts12T s12Cs12Gs12Cs1ACs12C] 195 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 117 d[Gs13Cs13Cs13Ts13Cs13As13Gs13Ts13Cs13Ts13Gs13Cs13Ts13T s13Cs13Gs13Cs1ACs13C] 196 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 118 d[Gs14Cs14Cs14Ts14Cs14As14Gs14Ts14Cs14Ts14Gs14Cs14Ts14T s14Cs14Gs14Cs1ACs14C] 197 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 119 d[Gs15Cs15Cs15Ts15Cs15As15Gs15Ts15Cs15Ts15Gs15Cs15Ts15T s15Cs15Gs15Cs1ACs15C] 198 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 120 GsCsCsUsCsAsGsUsCsUsGsCsUsUsCsGsCsACsC 199 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 121 Gs1Cs1Cs1Us1Cs1As1Gs1Us1Cs1Us1Gs1Cs1Us1Us1Cs1Gs1CsACs 1C 200 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 122 Gs8Cs8Cs8Us8Cs8As8Gs8Us8Cs8Us8Gs8Cs8Us8Us8Cs8Gs8Cs1AC s8C 201 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 123 Gs9Cs9Cs9Us9Cs9As9Gs9Us9Cs9Us9Gs9Cs9Us9Us9Cs9Gs9Cs1AC s9C 202 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 124 Gs10Cs10Cs10Us10Cs10As10Gs10Us10Cs10Us10Gs10Cs10Us10Us 10Cs10Gs10Cs1ACs10C 203 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 125 Gs11Cs11Cs11Us11Cs11As11Gs11Us11Cs11Us11Gs11Cs11Us11Us 11Cs11Gs11Cs1ACs11C 204 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 126 Gs12Cs12Cs12Us12Cs12As12Gs12Us12Cs12Us12Gs12Cs12Us12Us 12Cs12Gs12Cs1ACs12C 205 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 127 Gs13Cs13Cs13Us13Cs13As13Gs13Us13Cs13Us13Gs13Cs13Us13Us 13Cs13Gs13Cs1ACs13C 206 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 128 Gs14Cs14Cs14Us14Cs14As14Gs14Us14Cs14Us14Gs14Cs14Us14Us 14Cs14Gs14Cs1ACs14C 207 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 129 Gs15Cs15Cs15Us15Cs15As15Gs15Us15Cs15Us15Gs15Cs15Us15Us 15Cs15Gs15Cs1ACs15C

In some embodiments, the present disclosure provides oligonucleotides and/or oligonucleotide compositions that are useful for treating Huntington's disease, for example, selected from:

TABLE N1 Example sequences targeting rs362307 SEQ ID NO: WV-904 G*G*G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T rs362307 P13 130 WV-905 G*G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C rs362307 P12 131 WV-906 G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C rs362307 P11 132 WV-907 C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C*A rs362307 P10 133 WV-908 A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C*A*A rs362307 P9 134 WV-909 C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C*A*A*A rs362307 P8 135 WV-910 mG*mG*mG*mC*mA*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T rs362307 P13 136 WV-911 mG*mG*mC*mA*mC*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C rs362307 P12 137 WV-912 mG*mC*mA*mC*mA*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C rs362307 P11 138 WV-913 mC*mA*mC*mA*mA*G*G*G*C*A*C*A*G*A*C*T*T*C*C*A rs362307 P10 139 WV-914 mA*mC*mA*mA*mG*G*G*C*A*C*A*G*A*C*T*T*C*C*A*A rs362307 P9 140 WV-915 mC*mA*mA*mG*mG*G*C*A*C*A*G*A*C*T*T*C*C*A*A*A rs362307 P8 141 WV-916 mG*mG*mG*mC*mA*C*A*A*G*G*G*C*A*C*A*mG*mA*mC*mU*mU rs362307 P13 142 WV-917 mG*mG*mC*mA*mC*A*A*G*G*G*C*A*C*A*G*mA*mC*mU*mU*mC rs362307 P12 143 WV-918 mG*mC*mA*mC*mA*A*G*G*G*C*A*C*A*G*A*mC*mU*mU*mC*mC rs362307 P11 144 WV-919 mC*mA*mC*mA*mA*G*G*G*C*A*C*A*G*A*C*mU*mU*mC*mC*mA rs362307 P10 145 WV-920 mA*mC*mA*mA*mG*G*G*C*A*C*A*G*A*C*T*mU*mC*mC*mA*mA rs362307 P9 146 WV-921 mC*mA*mA*mG*mG*G*C*A*C*A*G*A*C*T*T*mC*mC*mA*mA*mA rs362307 P8 147 WV-922 mG*mC*mA*mC*mA*mA*mG*mG*G*C*A*C*A*G*A*mC*mU*mU*mC*mC rs362307 P11 148 WV-923 mC*mA*mC*mA*mA*mG*mG*G*C*A*C*A*G*A*mC*mU*mU*mC*mC*mA rs362307 P10 149 WV-924 mA*mC*mA*mA*mG*mG*G*C*A*C*A*G*A*mC*mU*mU*mC*mC*mA*mA rs362307 P9 150 WV-925 mC*mA*mA*mG*mG*G*C*A*C*A*G*A*mC*mU*mU*mC*mC*mA*mA*mA rs362307 P8 151 WV-926 mGmCmAmCmAmAmGmG*G*C*A*C*A*G*A*mCmUmUmCmC rs362307 P11 152 WV-927 mCmAmCmAmAmGmG*G*C*A*C*A*G*A*mCmUmUmCmCmA rs362307 P10 153 WV-928 mAmCmAmAmGmG*G*C*A*C*A*G*A*mCmUmUmCmCmAmA rs362307 P9 154 WV-929 mCmAmAmGmG*G*C*A*C*A*G*A*mCmUmUmCmCmAmAmA rs362307 P8 155 WV-930 mGmGmGmCmA*C*A*A*G*G*G*C*A*C*A*mGmAmCmUmU rs362307 P13 156 WV-931 mGmGmCmAmC*A*A*G*G*G*C*A*C*A*G*mAmCmUmUmC rs362307 P12 157 WV-932 mGmCmAmCmA*A*G*G*G*C*A*C*A*G*A*mCmUmUmCmC rs362307 P11 158 WV-933 mCmAmCmAmA*G*G*G*C*A*C*A*G*A*C*mUmUmCmCmA rs362307 P10 159 WV-934 mAmCmAmAmG*G*G*C*A*C*A*G*A*C*T*mUmCmCmAmA rs362307 P9 160 WV-935 mCmAmAmGmG*G*C*A*C*A*G*A*C*T*T*mCmCmAmAmA rs362307 P8 161 WV-936 G*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST rs362307 P13 162 WV-937 G*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC rs362307 P12 163 WV-938 G*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC rs362307 P11 164 WV-939 C*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA rs362307 P10 165 WV-940 A*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA rs362307 P9 166 WV-941 C*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*SA rs362307 P8 167 WV-1085 mG*SmG*SmC*SmA*SmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmA*SmC* rs362307 P12 168 SmU*SmU*SmC WV-1086 mG*RmG*RmC*RmA*RmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmA*RmC rs362307 P12 169 *RmU*RmU*RmC WV-1087 mGmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAmCmUmUmC rs362307 P12 170 WV-1088 mG*SmG*SmC*SmA*SmC*SmA*SmA*SmG*SG*SG*SC*SA*SC*RA*SG*SA*S rs362307 P12 171 C*ST*ST*SC WV-1089 mG*RmG*RmC*RmA*RmC*RmA*RmA*RmG*SG*SG*SC*SA*SC*RA*SG*SA* rs362307 P12 172 SC*ST*ST*SC WV-1090 mGmGmCmAmCmAmAmG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC rs362307 P12 173 WV-1091 mG*RmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAmCmUmU*R rs362307 P12 174 mC WV-1092 mG*SmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAmCmUmU*S rs362307 P12 175 mC WV-982 G*SC*SA*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA rs362307 P16 176 WV-983 C*SA*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC rs362307 P15 177 WV-984 A*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST rs362307 P14 178 WV-985 A*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*SA*SG rs362307 P7 179 WV-986 A*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*SA*SG*SG rs362307 P6 180 WV-987 G*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*SA*SG*SG*SC rs362307 P5 181 WV-1234 mG*mG*mC*mA*mC*A*A*G*G*G*C*A*C*A*G*mA*mC*mU*BrdU*mC rs362307 P12 182 WV-1235 mG*mG*mC*mA*mC*A*A*G*G*G*C*A*C*A*G*mA*mC*BrdU*BrdU*mC rs362307 P12 183 WV-1067 G*G*G*C*A*C*A*A*G*G*G*C*d2AP*C*A*G*A*C*T*T rs362307 P13 184 WV-1068 G*G*C*A*C*A*A*G*G*G*C*d2AP*C*A*G*A*C*T*T*C rs362307 P12 185 WV-1069 G*C*A*C*A*A*G*G*G*C*d2AP*C*A*G*A*C*T*T*C*C rs362307 P11 186 WV-1070 G*G*G*C*A*C*A*A*G*G*G*C*dDAP*C*A*G*A*C*T*T rs362307 P13 187 WV-1071 G*G*C*A*C*A*A*G*G*G*C*dDAP*C*A*G*A*C*T*T*C rs362307 P12 188 WV-1072 G*C*A*C*A*A*G*G*G*C*dDAP*C*A*G*A*C*T*T*C*C rs362307 P11 189 WV-1510 G*SmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAmCmUmU*SC rs362307 P12 190 WV-1511 G*mGmCmAmC*A*A*G*G*G*C*A*C*A*G*mAmCmUmU*C rs362307 P12 191 WV-1497 mG*mGmCmAmC*A*A*G*G*G*C*A*C*A*G*mAmCmUmU*mC rs362307 P12 192 WV-1655 Geo*Geom5CeoAeom5Ceo*A*A*G*G*G*C*A*C*A*G*Aeom5CeoTeoTeo*m5Ceo rs362307 P12 193

TABLE N2 Example sequences targeting rs362306 WV-1001 G*A*G*C*A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A rs362306 P10 194 WV-1002 A*G*C*A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C rs362306 P9 195 WV-1003 G*C*A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A rs362306 P8 196 WV-1004 C*A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A*A rs362306 P7 197 WV-1005 A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A*A*C rs362306 P6 198 WV-1006 G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A*A*C*C rs362306 P5 199 WV-1007 mG*mA*mG*mC*mA*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A rs362306 P10 200 WV-1008 mA*mG*mC*mA*mG*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C rs362306 P9 201 WV-1009 mG*mC*mA*mG*mC*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A rs362306 P8 202 WV-1010 mC*mA*mG*mC*mU*G*C*A*A*C*C*T*G*G*C*A*A*C*A*A rs362306 P7 203 WV-1011 mA*mG*mC*mU*mG*C*A*A*C*C*T*G*G*C*A*A*C*A*A*C rs362306 P6 204 WV-1012 mG*mC*mU*mG*mC*A*A*C*C*T*G*G*C*A*A*C*A*A*C*C rs362306 P5 205 WV-1013 mG*mA*mG*mC*mA*G*C*T*G*C*A*A*C*C*T*mG*mG*mC*mA*mA rs362306 P10 206 WV-1014 mA*mG*mC*mA*mG*C*T*G*C*A*A*C*C*T*G*mG*mC*mA*mA*mC rs362306 P9 207 WV-1015 mG*mC*mA*mG*mC*T*G*C*A*A*C*C*T*G*G*mC*mA*mA*mC*mA rs362306 P8 208 WV-1016 mC*mA*mG*mC*mU*G*C*A*A*C*C*T*G*G*C*mA*mA*mC*mA*mA rs362306 P7 209 WV-1017 mA*mG*mC*mU*mG*C*A*A*C*C*T*G*G*C*A*mA*mC*mA*mA*mC rs362306 P6 210 WV-1018 mG*mC*mU*mG*mC*A*A*C*C*T*G*G*C*A*A*mC*mA*mA*mC*mC rs362306 P5 211 WV-1019 mG*mA*mG*mC*mA*mG*mC*T*G*C*A*A*C*C*mU*mG*mG*mC*mA*mA rs362306 P10 212 WV-1020 mGmAmGmCmAmGmC*T*G*C*A*A*C*C*mUmGmGmCmAmA rs362306 P10 213 WV-1021 mA*mG*mC*mA*mG*mC*T*G*C*A*A*C*C*T*G*mG*mC*mA*mA*mC rs362306 P9 214 WV-1022 mAmGmCmAmGmC*T*G*C*A*A*C*C*T*G*mGmCmAmAmC rs362306 P9 215 WV-1023 mG*mC*mA*mG*mC*T*G*C*A*A*C*C*mU*mG*mG*mC*mA*mA*mC*mA rs362306 P8 216 WV-1024 mGmCmAmGmC*T*G*C*A*A*C*C*mUmGmGmCmAmAmCmA rs362306 P8 217 WV-1025 mGmAmGmCmA*G*C*T*G*C*A*A*C*C*T*mGmGmCmAmA rs362306 P10 218 WV-1026 mAmGmCmAmG*C*T*G*C*A*A*C*C*T*G*mGmCmAmAmC rs362306 P9 219 WV-1027 mGmCmAmGmC*T*G*C*A*A*C*C*T*G*G*mCmAmAmCmA rs362306 P8 220 WV-1028 mCmAmGmCmU*G*C*A*A*C*C*T*G*G*C*mAmAmCmAmA rs362306 P7 221 WV-1029 mAmGmCmUmG*C*A*A*C*C*T*G*G*C*A*mAmCmAmAmC rs362306 P6 222 WV-1030 mGmCmUmGmC*A*A*C*C*T*G*G*C*A*A*mCmAmAmCmC rs362306 P5 223 WV-952 G*SA*SG*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA rs362306 P10 224 WV-953 A*SG*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC rs362306 P9 225 WV-954 G*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*SA rs362306 P8 226 WV-955 C*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*SA*SA rs362306 P7 227 WV-956 A*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*SA*SA*SC rs362306 P6 228 WV-957 G*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*SA*SA*SC*SC rs362306 P5 229

TABLE N3 Example sequences targeting rs362268 WV-1031 G*G*G*C*C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A rs362268 P10 230 WV-1032 G*G*C*C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G rs362268 P9 231 WV-1033 G*C*C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G rs362268 P8 232 WV-1034 C*C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G*A rs362268 P7 233 WV-1035 C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G*A*G rs362268 P6 234 WV-1036 A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G*A*G*G rs362268 P5 235 WV-1037 mG*mG*mG*mC*mC*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A rs362268 P10 236 WV-1038 mG*mG*mC*mC*mA*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G rs362268 P9 237 WV-1039 mG*mC*mC*mA*mA*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G rs362268 P8 238 WV-1040 mC*mC*mA*mA*mC*A*G*C*C*A*G*C*C*T*G*C*A*G*G*A rs362268 P7 239 WV-1041 mC*mA*mA*mC*mA*G*C*C*A*G*C*C*T*G*C*A*G*G*A*G rs362268 P6 240 WV-1042 mA*mA*mC*mA*mG*C*C*A*G*C*C*T*G*C*A*G*G*A*G*G rs362268 P5 241 WV-1043 mG*mG*mG*mC*mC*A*A*C*A*G*C*C*A*G*C*mC*mU*mG*mC*mA rs362268 P10 242 WV-1044 mG*mG*mC*mC*mA*A*C*A*G*C*C*A*G*C*C*mU*mG*mC*mA*mG rs362268 P9 243 WV-1045 mG*mC*mC*mA*mA*C*A*G*C*C*A*G*C*C*T*mG*mC*mA*mG*mG rs362268 P8 244 WV-1046 mC*mC*mA*mA*mC*A*G*C*C*A*G*C*C*T*G*mC*mA*mG*mG*mA rs362268 P7 245 WV-1047 mC*mA*mA*mC*mA*G*C*C*A*G*C*C*T*G*C*mA*mG*mG*mA*mG rs362268 P6 246 WV-1048 mA*mA*mC*mA*mG*C*C*A*G*C*C*T*G*C*A*mG*mG*mA*mG*mG rs362268 P5 247 WV-1049 mG*mG*mG*mC*mC*mA*mA*C*A*G*C*C*A*G*mC*mC*mU*mG*mC*mA rs362268 P10 248 WV-1050 mGmGmGmCmCmAmA*C*A*G*C*C*A*G*mCmCmUmGmCmA rs362268 P10 249 WV-1051 mG*mG*mC*mC*mA*mA*C*A*G*C*C*A*G*C*C*mU*mG*mC*mA*mG rs362268 P9 250 WV-1052 mGmGmCmCmAmA*C*A*G*C*C*A*G*C*C*mUmGmCmAmG rs362268 P9 251 WV-1053 mG*mC*mC*mA*mA*C*A*G*C*C*A*G*mC*mC*mU*mG*mC*mA*mG*mG rs362268 P8 252 WV-1054 mGmCmCmAmA*C*A*G*C*C*A*G*mCmCmUmGmCmAmGmG rs362268 P8 253 WV-1055 mGmGmGmCmC*A*A*C*A*G*C*C*A*G*C*mCmUmGmCmA rs362268 P10 254 WV-1056 mGmGmCmCmA*A*C*A*G*C*C*A*G*C*C*mUmGmCmAmG rs362268 P9 255 WV-1057 mGmCmCmAmA*C*A*G*C*C*A*G*C*C*T*mGmCmAmGmG rs362268 P8 256 WV-1058 mCmCmAmAmC*A*G*C*C*A*G*C*C*T*G*mCmAmGmGmA rs362268 P7 257 WV-1059 mCmAmAmCmA*G*C*C*A*G*C*C*T*G*C*mAmGmGmAmG rs362268 P6 258 WV-1060 mAmAmCmAmG*C*C*A*G*C*C*T*G*C*A*mGmGmAmGmG rs362268 P5 259 WV-960 G*SG*SG*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA rs362268 P10 260 WV-961 G*SG*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG rs362268 P9 261 WV-962 G*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*SG rs362268 P8 262 WV-963 C*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*SG*SA rs362268 P7 263 WV-964 C*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*SG*SA*SG rs362268 P6 264 WV-965 A*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*SG*SA*SG*SG rs362268 P5 265

TABLE N4 Example sequences targeting rs7685686 ONT-450 A*T*T*A*A*T*A*A*A*T*T*G*T*C*A*T*C*A*C*C rs7685686 P13 266 ONT-451 A*ST*ST*SA*SA*ST*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SC*SA*SC*SC rs7685686 P13 267 ONT-452 A*ST*ST*SA*SA*ST*SA*SA*SA*ST*ST*SG*ST*SC*SA*RT*SC*SA*SC*SC rs7685686 P13 268 WV-1077 mA*SmU*SmU*SmA*SmA*SmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmC* rs7685686 P13 269 SmA*SmC*SmC WV-1078 mA*RmU*RmU*RmA*RmA*RmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmC rs7685686 P13 270 *RmA*RmC*RmC WV-1079 mA*SmU*SmU*SmA*SmA*SmU*SmA*SmA*SA*ST*ST*SG*ST*SC*RA*ST*SC rs7685686 P13 271 *SA*SC*SC WV-1080 mA*RmU*RmU*RmA*RmA*RmU*RmA*RmA*SA*ST*ST*SG*ST*SC*RA*ST* rs7685686 P13 272 SC*SA*SC*SC WV-1081 mAmUmUmAmAmUmAmA*SA*ST*ST*SG*ST*SC*RA*ST*SC*SA*SC*SC rs7685686 P13 273 WV-1082 mAmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmCmAmCmC rs7685686 P13 274 WV-1083 mA*SmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmCmAmC*SmC rs7685686 P13 275 WV-1084 mA*RmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmCmAmC*RmC rs7685686 P13 276 WV-1508 A*SmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmCmAmC*SC rs7685686 P13 277 WV-1509 A*mUmUmAmAmU*A*A*A*T*T*G*T*C*A*T*mCmAmC*C rs7685686 P13 278 WV-2023 T*G*T*C*A*T*C*A*C*C*A*G*A*A*A*mA*mA*mG*mU*mC rs7685686 P3 279 WV-2024 mU*T*G*T*C*A*T*C*A*C*C*A*G*A*A*mA*mA*mA*mG*mU rs7685686 P4 280 WV-2025 T*T*G*T*C*A*T*C*A*C*C*A*G*A*A*mA*mA*mA*mG*mU rs7685686 P4 281 WV-2026 mA*mU*T*G*T*C*A*T*C*A*C*C*A*G*A*mA*mA*mA*mA*mG rs7685686 P5 282 WV-2027 mA*T*T*G*T*C*A*T*C*A*C*C*A*G*A*mA*mA*mA*mA*mG rs7685686 P5 283 WV-2028 mA*mA*mU*T*G*T*C*A*T*C*A*C*C*A*G*mA*mA*mA*mA*mA rs7685686 P6 284 WV-2029 mA*mA*T*T*G*T*C*A*T*C*A*C*C*A*G*mA*mA*mA*mA*mA rs7685686 P6 285 WV-2030 mA*mA*mA*T*T*G*T*C*A*T*C*A*C*C*A*mG*mA*mA*mA*mA rs7685686 P7 286 WV-2031 mA*mA*mA*mU*T*G*T*C*A*T*C*A*C*C*A*mG*mA*mA*mA*mA rs7685686 P7 287 WV-2032 mU*mA*mA*mA*mU*T*G*T*C*A*T*C*A*C*C*A*mG*mA*mA*mA rs7685686 P8 288 WV-2033 mU*mA*mA*mA*mU*T*G*T*C*A*T*C*A*C*C*mA*mG*mA*mA*mA rs7685686 P8 289 WV-2034 mA*mU*mA*mA*mA*T*T*G*T*C*A*T*C*A*C*C*mA*mG*mA*mA rs7685686 P9 290 WV-2035 mA*mU*mA*mA*mA*T*T*G*T*C*A*T*C*A*C*mC*mA*mG*mA*mA rs7685686 P9 291 WV-2036 mA*mA*mU*mA*mA*A*T*T*G*T*C*A*T*C*A*C*C*mA*mG*mA rs7685686 P10 292 WV-2037 mA*mA*mU*mA*mA*A*T*T*G*T*C*A*T*C*A*C*mC*mA*mG*mA rs7685686 P10 293 WV-2038 mA*mA*mU*mA*mA*A*T*T*G*T*C*A*T*C*A*mC*mC*mA*mG*mA rs7685686 P10 294 WV-2039 mU*mA*mA*mU*mA*A*A*T*T*G*T*C*A*T*C*A*C*C*mA*mG rs7685686 P11 295 WV-2040 mU*mA*mA*mU*mA*A*A*T*T*G*T*C*A*T*C*A*C*mC*mA*mG rs7685686 P11 296 WV-2041 mU*mA*mA*mU*mA*A*A*T*T*G*T*C*A*T*C*A*mC*mC*mA*mG rs7685686 P11 297 WV-2042 mU*mA*mA*mU*mA*A*A*T*T*G*T*C*A*T*C*mA*mC*mC*mA*mG rs7685686 P11 298 WV-2043 mU*mU*mA*mA*mU*A*A*A*T*T*G*T*C*A*T*C*A*C*C*mA rs7685686 P12 299 WV-2044 mU*mU*mA*mA*mU*A*A*A*T*T*G*T*C*A*T*C*A*C*mC*mA rs7685686 P12 300 WV-2045 mU*mU*mA*mA*mU*A*A*A*T*T*G*T*C*A*T*C*A*mC*mC*mA rs7685686 P12 301 WV-2046 mU*mU*mA*mA*mU*A*A*A*T*T*G*T*C*A*T*C*mA*mC*mC*mA rs7685686 P12 302 WV-2047 mA*mU*mU*mA*mA*T*A*A*A*T*T*G*T*C*A*T*C*A*C*C rs7685686 P13 303 WV-2048 mA*mU*mU*mA*mA*T*A*A*A*T*T*G*T*C*A*T*C*A*C*mC rs7685686 P13 304 WV-2049 mA*mU*mU*mA*mA*T*A*A*A*T*T*G*T*C*A*T*C*A*mC*mC rs7685686 P13 305 WV-2050 mA*mU*mU*mA*mA*T*A*A*A*T*T*G*T*C*A*T*C*mA*mC*mC rs7685686 P13 306 WV-2051 mU*mA*mU*mU*mA*A*T*A*A*A*T*T*G*T*C*A*T*C*A*C rs7685686 P14 307 WV-2052 mU*mA*mU*mU*mA*A*T*A*A*A*T*T*G*T*C*A*T*C*A*mC rs7685686 P14 308 WV-2053 mU*mA*mU*mU*mA*A*T*A*A*A*T*T*G*T*C*A*T*C*mA*mC rs7685686 P14 309 WV-2054 mC*mU*mA*mU*mU*A*A*T*A*A*A*T*T*G*T*C*A*T*C*A rs7685686 P15 310 WV-2055 mC*mU*mA*mU*mU*A*A*T*A*A*A*T*T*G*T*C*A*T*C*mA rs7685686 P15 311 WV-2056 mA*mC*mU*mA*mU*T*A*A*T*A*A*A*T*T*G*T*C*A*T*C rs7685686 P16 312 WV-2057 T*G*T*C*A*T*C*A*C*C*A*G*A*A*A*mAmAmGmU*mC rs7685686 P3 313 WV-2058 mU*T*G*T*C*A*T*C*A*C*C*A*G*A*A*mAmAmAmG*mU rs7685686 P4 314 WV-2059 T*T*G*T*C*A*T*C*A*C*C*A*G*A*A*mAmAmAmG*mU rs7685686 P4 315 WV-2060 mA*mU*T*G*T*C*A*T*C*A*C*C*A*G*A*mAmAmAmA*mG rs7685686 P5 316 WV-2061 mA*T*T*G*T*C*A*T*C*A*C*C*A*G*A*mAmAmAmA*mG rs7685686 P5 317 WV-2062 mA*mAmU*T*G*T*C*A*T*C*A*C*C*A*G*mAmAmAmA*mA rs7685686 P6 318 WV-2063 mA*mA*T*T*G*T*C*A*T*C*A*C*C*A*G*mAmAmAmA*mA rs7685686 P6 319 WV-2064 mA*mAmA*T*T*G*T*C*A*T*C*A*C*C*A*mGmAmAmA*mA rs7685686 P7 320 WV-2065 mA*mAmAmU*T*G*T*C*A*T*C*A*C*C*A*mGmAmAmA*mA rs7685686 P7 321 WV-2066 mU*mAmAmAmU*T*G*T*C*A*T*C*A*C*C*A*mGmAmA*mA rs7685686 P8 322 WV-2067 mU*mAmAmAmU*T*G*T*C*A*T*C*A*C*C*mAmGmAmA*mA rs7685686 P8 323 WV-2068 mA*mUmAmAmA*T*T*G*T*C*A*T*C*A*C*C*mAmGmA*mA rs7685686 P9 324 WV-2069 mA*mUmAmAmA*T*T*G*T*C*A*T*C*A*C*mCmAmGmA*mA rs7685686 P9 325 WV-2070 mA*mAmUmAmA*A*T*T*G*T*C*A*T*C*A*C*C*mAmG*mA rs7685686 P10 326 WV-2071 mA*mAmUmAmA*A*T*T*G*T*C*A*T*C*A*C*mCmAmG*mA rs7685686 P10 327 WV-2072 mA*mAmUmAmA*A*T*T*G*T*C*A*T*C*A*mCmCmAmG*mA rs7685686 P10 328 WV-2073 mU*mAmAmUmA*A*A*T*T*G*T*C*A*T*C*A*C*C*mA*mG rs7685686 P11 329 WV-2074 mU*mAmAmUmA*A*A*T*T*G*T*C*A*T*C*A*C*mCmA*mG rs7685686 P11 330 WV-2075 mU*mAmAmUmA*A*A*T*T*G*T*C*A*T*C*A*mCmCmA*mG rs7685686 P11 331 WV-2076 mU*mAmAmUmA*A*A*T*T*G*T*C*A*T*C*mAmCmCmA*mG rs7685686 P11 332 WV-2077 mU*mUmAmAmU*A*A*A*T*T*G*T*C*A*T*C*A*C*C*mA rs7685686 P12 333 WV-2078 mU*mUmAmAmU*A*A*A*T*T*G*T*C*A*T*C*A*C*mC*mA rs7685686 P12 334 WV-2079 mU*mUmAmAmU*A*A*A*T*T*G*T*C*A*T*C*A*mCmC*mA rs7685686 P12 335 WV-2080 mU*mUmAmAmU*A*A*A*T*T*G*T*C*A*T*C*mAmCmC*mA rs7685686 P12 336 WV-2081 mA*mUmUmAmA*T*A*A*A*T*T*G*T*C*A*T*C*A*C*C rs7685686 P13 337 WV-2082 mA*mUmUmAmA*T*A*A*A*T*T*G*T*C*A*T*C*A*C*mC rs7685686 P13 338 WV-2083 mA*mUmUmAmA*T*A*A*A*T*T*G*T*C*A*T*C*A*mC*mC rs7685686 P13 339 WV-2084 mA*mUmUmAmA*T*A*A*A*T*T*G*T*C*A*T*C*mAmC*mC rs7685686 P13 340 WV-2085 mU*mAmUmUmA*A*T*A*A*A*T*T*G*T*C*A*T*C*A*C rs7685686 P14 341 WV-2086 mU*mAmUmUmA*A*T*A*A*A*T*T*G*T*C*A*T*C*A*mC rs7685686 P14 342 WV-2087 mU*mAmUmUmA*A*T*A*A*A*T*T*G*T*C*A*T*C*mA*mC rs7685686 P14 343 WV-2088 mC*mUmAmUmU*A*A*T*A*A*A*T*T*G*T*C*A*T*C*A rs7685686 P15 344 WV-2089 mC*mUmAmUmU*A*A*T*A*A*A*T*T*G*T*C*A*T*C*mA rs7685686 P15 345 WV-2090 mA*mCmUmAmU*T*A*A*T*A*A*A*T*T*G*T*C*A*T*C rs7685686 P16 346

TABLE N1 Example sequences targeting rs362307 - continued (certain features) WV-904 All DNA, stereorandom PS rs362307 P13 WV-905 All DNA, stereorandom PS rs362307 P12 WV-906 All DNA, stereorandom PS rs362307 P11 WV-907 All DNA, stereorandom PS rs362307 P10 WV-908 All DNA, stereorandom PS rs362307 P9 WV-909 All DNA, stereorandom PS rs362307 P8 WV-910 5-15 (2′-OMe-DNA), stereorandom PS rs362307 P13 WV-911 5-15 (2′-OMe-DNA), stereorandom PS rs362307 P12 WV-912 5-15 (2′-OMe-DNA), stereorandom PS rs362307 P11 WV-913 5-15 (2′-OMe-DNA), stereorandom PS rs362307 P10 WV-914 5-15 (2′-OMe-DNA), stereorandom PS rs362307 P9 WV-915 5-15 (2′-OMe-DNA), stereorandom PS rs362307 P8 WV-916 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P13 WV-917 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P12 WV-918 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P11 WV-919 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P10 WV-920 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P9 WV-921 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P8 WV-922 8-7-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P11 WV-923 7-7-6 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P10 WV-924 6-7-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P9 WV-925 5-7-8 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362307 P8 WV-926 8-7-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P11 WV-927 7-7-6 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P10 WV-928 6-7-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P9 WV-929 5-7-8 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P8 WV-930 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P13 WV-931 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P12 WV-932 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P11 WV-933 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P10 WV-934 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P9 WV-935 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362307 P8 WV-936 All DNA, stereopure, One Rp rs362307 P13 WV-937 All DNA, stereopure, One Rp rs362307 P12 WV-938 All DNA, stereopure, One Rp rs362307 P11 WV-939 All DNA, stereopure, One Rp rs362307 P10 WV-940 All DNA, stereopure, One Rp rs362307 P9 WV-941 All DNA, stereopure, One Rp rs362307 P8 WV-1085 5-10-5 (2′-OMe-DNA-2′-OMe) Gapmer, Stereopure, One Rp in DNA rs362307 P12 WV-1086 5-10-5 (2′-OMe-DNA-2′-OMe) Gapmer, Stereopure, One Rp in DNA and Rp wings rs362307 P12 WV-1087 5-10-5 (2′-OMe-DNA-2′-OMe) Gapmer, Stereopure, One Rp in DNA, PO wings rs362307 P12 WV-1088 8-12 (2′-OMe-DNA) hemimer, Stereopure, One Rp in DNA, Sp wing rs362307 P12 WV-1089 8-12 (2′-OMe-DNA) hemimer, Stereopure, One Rp in DNA and Rp wing rs362307 P12 WV-1090 8-12 (2′-OMe-DNA) hemimer, Srereopure, One Rp in DNA and PO wing rs362307 P12 WV-1091 5-10-5 (2′-OMe-DNA-2′-OMe) gapmer, Stereopure, One Rp in DNA, rs362307 P12 First and last PS as Rp and rest PO wing WV-1092 5-10-5 (2′-OMe-DNA-2′-OMe) gapmer, Stereopure, One Rp in DNA, rs362307 P12 First and last PS as Sp and rest PO wing WV-982 All DNA, stereopure, One Rp rs362307 P16 WV-983 All DNA, stereopure, One Rp rs362307 P15 WV-984 All DNA, stereopure, One Rp rs362307 P14 WV-985 All DNA, stereopure, One Rp rs362307 P7 WV-986 All DNA, stereopure, One Rp rs362307 P6 WV-987 All DNA, stereopure, One Rp rs362307 P5 WV-1234 5-10-5 (2′-OMe-DNA-2′-OMe) Gapmer, Stereorandom, One Br-dU rs362307 P12 WV-1235 5-10-5 (2′-OMe-DNA-2′-OMe) Gapmer, Stereorandom, Two Br-dU rs362307 P12 WV-1067 All DNA, stereorandom PS, one 2-amino purine rs362307 P13 WV-1068 All DNA, stereorandom PS, one 2-amino purine rs362307 P12 WV-1069 All DNA, stereorandom PS, one 2-amino purine rs362307 P11 WV-1070 All DNA, stereorandom PS, one 2,6-diamino purine rs362307 P13 WV-1071 All DNA, stereorandom PS, one 2,6-diamino purine rs362307 P12 WV-1072 All DNA, stereorandom PS, one 2,6-diamino purine rs362307 P11 WV-1510 1-4-10-4-1 (DNA/2′-OMe) gapmer, Stereopure, one Rp in the DNA, rs362307 P12 first and last nucletotide is DNA and first and last PS are Sp WV-1511 1-4-10-4-1 (DNA/2′-OMe) gapmer, Stereorandom, 1st and last PS, rs362307 P12 rest of the wing is PO WV-1497 5-10-5 (2′-OMe-DNA-2′-OMe) gapmer, Stereorandom, First and rs362307 P12 last PS and rest PO wing WV-1655 5-10-5 (2′-MOE-DNA-2′-MOE) Gapmer, Stereorandom, PO wings rs362307 P12 with One PS on each end

TABLE N2 Example sequences targeting rs362306 - continued (certain features) WV-1001 All DNA, stereorandom PS rs362306 P10 WV-1002 All DNA, stereorandom PS rs362306 P9 WV-1003 All DNA, stereorandom PS rs362306 P8 WV-1004 All DNA, stereorandom PS rs362306 P7 WV-1005 All DNA, stereorandom PS rs362306 P6 WV-1006 All DNA, stereorandom PS rs362306 P5 WV-1007 5-15 (2′-OMe-DNA), stereorandom PS rs362306 P10 WV-1008 5-15 (2′-OMe-DNA), stereorandom PS rs362306 P9 WV-1009 5-15 (2′-OMe-DNA), stereorandom PS rs362306 P8 WV-1010 5-15 (2′-OMe-DNA), stereorandom PS rs362306 P7 WV-1011 5-15 (2′-OMe-DNA), stereorandom PS rs362306 P6 WV-1012 5-15 (2′-OMe-DNA), stereorandom PS rs362306 P5 WV-1013 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362306 P10 WV-1014 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362306 P9 WV-1015 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362306 P8 WV-1016 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362306 P7 WV-1017 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362306 P6 WV-1018 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362306 P5 WV-1019 7-7-6 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362306 P10 WV-1020 7-7-6 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in wings rs362306 P10 WV-1021 6-7-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362306 P9 WV-1022 6-7-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362306 P9 WV-1023 5-7-8 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362306 P8 WV-1024 5-7-8 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362306 P8 WV-1025 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362306 P10 WV-1026 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362306 P9 WV-1027 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362306 P8 WV-1028 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362306 P7 WV-1029 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362306 P6 WV-1030 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362306 P5 WV-952 All DNA, stereopure, One Rp rs362306 P10 WV-953 All DNA, stereopure, One Rp rs362306 P9 WV-954 All DNA, stereopure, One Rp rs362306 P8 WV-955 All DNA, stereopure, One Rp rs362306 P7 WV-956 All DNA, stereopure, One Rp rs362306 P6 WV-957 All DNA, stereopure, One Rp rs362306 P5

TABLE N3 Example sequences targeting rs362268 - continued (certain features) WV-1031 All DNA, stereorandom PS rs362268 P10 WV-1032 All DNA, stereorandom PS rs362268 P9 WV-1033 All DNA, stereorandom PS rs362268 P8 WV-1034 All DNA, stereorandom PS rs362268 P7 WV-1035 All DNA, stereorandom PS rs362268 P6 WV-1036 All DNA, stereorandom PS rs362268 P5 WV-1037 5-15 (2′-OMe-DNA), stereorandom PS rs362268 P10 WV-1038 5-15 (2′-OMe-DNA), stereorandom PS rs362268 P9 WV-1039 5-15 (2′-OMe-DNA), stereorandom PS rs362268 P8 WV-1040 5-15 (2′-OMe-DNA), stereorandom PS rs362268 P7 WV-1041 5-15 (2′-OMe-DNA), stereorandom PS rs362268 P6 WV-1042 5-15 (2′-OMe-DNA), stereorandom PS rs362268 P5 WV-1043 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362268 P10 WV-1044 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362268 P9 WV-1045 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362268 P8 WV-1046 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362268 P7 WV-1047 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362268 P6 WV-1048 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362268 P5 WV-1049 7-7-6 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362268 P10 WV-1050 7-7-6 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in wings rs362268 P10 WV-1051 6-7-5 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362268 P9 WV-1052 6-7-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362268 P9 WV-1053 5-7-8 (2′-OMe-DNA-2′-OMe), stereorandom PS rs362268 P8 WV-1054 5-7-8 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362268 P8 WV-1055 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362268 P10 WV-1056 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362268 P9 WV-1057 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362268 P8 WV-1058 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362268 P7 WV-1059 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362268 P6 WV-1060 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings rs362268 P5 WV-960 All DNA, stereopure, One Rp rs362268 P10 WV-961 All DNA, stereopure, One Rp rs362268 P9 WV-962 All DNA, stereopure, One Rp rs362268 P8 WV-963 All DNA, stereopure, One Rp rs362268 P7 WV-964 All DNA, stereopure, One Rp rs362268 P6 WV-965 All DNA, stereopure, One Rp rs362268 P5

TABLE N4 Example sequences targeting rs7685686 - continued (certain features) ONT-450 All DNA, stereorandom PS rs7685686 P13 ONT-451 All DNA, stereopure, One Rp in DNA between position 14 and 15 rs7685686 P13 ONT-452 All DNA, stereopure, One Rp in DNA between position 15 and 16 rs7685686 P13 WV-1077 6-10-4 (2′-OMe-DNA-2′-OMe) Gapmer, stereopure with one rs7685686 P13 Rp in DNA between position 14 and 15 WV-1078 6-10-4 (2′-OMe-DNA-2′-OMe) Gapmer, stereopure with one rs7685686 P13 Rp in DNA between position 14 and 15 and Rp wings WV-1079 8-12 (2′-OMe-DNA) Hemimer, stereopure with one Rp in DNA rs7685686 P13 between position 14 and 15 and Sp wing WV-1080 8-12 (2′-OMe-DNA) Hemimer, stereopure with one Rp in DNA rs7685686 P13 between position 14 and 15 and Rp wing WV-1081 8-12 (2′-OMe-DNA) Hemimer, stereopure with one Rp in DNA rs7685686 P13 between position 14 and 15 and PO wing WV-1082 6-10-4 (2′-OMe-DNA-2′-OMe), stereopure with one Rp in rs7685686 P13 DNA between position 14 and 15 and PO wings WV-1083 6-10-4 (2′-OMe-DNA-2′-OMe), stereopure with one Rp in rs7685686 P13 DNA between position 14 and 15, first and last PS Sp and rest PO wing WV-1084 6-10-4 (2′-OMe-DNA-2′-OMe), stereopure with one Rp in rs7685686 P13 DNA between position 14 and 15, first and last PS Rp and rest PO wing WV-1508 1-5-10-3-1 (DNA/2′-OMe) Gapmer, Stereopure, one Rp in the rs7685686 P13 core, first and last PS is Sp, rest is PO in the wing WV-1509 1-5-10-3-1 (DNA/2′-OMe) Gapmer, Stereorandom, first and last PS, rs7685686 P13 rest is PO in the wing

In Table N1-N4, * only represents a stereorandom phosphorothioate linkage; *S represents an Sp phosphorothioate linkage, *R represents an Rp phosphorothioate linkage, all non-labeled linkage is a natural phosphate linkage, m preceding a base represents 2′-OMe, d2AP represents a 2-amino purine, and dDAP represents a 2,6-diamino purine.

In some embodiments, the present disclosure provides oligonucleotides and/or oligonucleotide compositions that are useful for treating Huntington's disease, for example, selected from:

TABLE N1A Example sequences targeting rs362307 SEQ ID NO: WV-936 G*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*S 347 A*SC*ST*ST WV-937 G*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*S 348 C*ST*ST*SC WV-938 G*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*S 349 T*ST*SC*SC WV-939 C*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*S 350 T*SC*SC*SA WV-940 A*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*S 351 C*SC*SA*SA WV-941 C*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*S 352 C*SA*SA*SA WV-1085 mG*SmG*SmC*SmA*SmC*SA*SA*SG*SG*SG*SC*SA*SC*RA* 353 SG*SmA*SmC*SmU*SmU*SmC WV-1086 mG*RmG*RmC*RmA*RmC*SA*SA*SG*SG*SG*SC*SA*SC*RA* 354 SG*SmA*RmC*RmU*RmU*RmC WV-1087 mGmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAm 355 CmUmUmC WV-1088 mG*SmG*SmC*SmA*SmC*SmA*SmA*SmG*SG*SG*SC*SA*SC* 356 RA*SG*SA*SC*ST*ST*SC WV-1089 mG*RmG*RmC*RmA*RmC*RmA*RmA*RmG*SG*SG*SC*SA*S 357 C*RA*SG*SA*SC*ST*ST*SC WV-1090 mGmGmCmAmCmAmAmG*SG*SG*SC*SA*SC*RA*SG*SA*SC* 358 ST*ST*SC WV-1091 mG*RmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*Sm 359 AmCmUmU*RmC WV-1092 mG*SmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*Sm 360 AmCmUmU*SmC WV-982 G*SC*SA*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*S 361 C*RA*SG*SA WV-983 C*SA*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*R 362 A*SG*SA*SC WV-984 A*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*S 363 G*SA*SC*ST WV-985 A*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*S 364 A*SA*SA*SG WV-986 A*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*S 365 A*SA*SG*SG WV-987 G*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*S 366 A*SG*SG*SC WV-1510 G*SmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmA 367 mCmUmU*SC

TABLE N2A Example sequences targeting rs362306 WV-952 G*SA*SG*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*S 368 G*SC*SA*SA WV-953 A*SG*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*S 369 C*SA*SA*SC WV-954 G*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*S 370 A*SA*SC*SA WV-955 C*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*S 371 A*SC*SA*SA WV-956 A*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*S 372 C*SA*SA*SC WV-957 G*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*S 373 A*SA*SC*SC

TABLE N3A Example sequences targeting rs362268 WV-960 G*SG*SG*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*S 374 T*SG*SC*SA WV-961 G*SG*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*S 375 G*SC*SA*SG WV-962 G*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*S 376 C*SA*SG*SG WV-963 C*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*S 377 A*SG*SG*SA WV-964 C*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*S 378 G*SG*SA*SG WV-965 A*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*S 379 G*SA*SG*SG

TABLE N4A Example sequences targeting rs7685686 ONT-450 A*T*T*A*A*T*A*A*A*T*T*G*T*C*A*T*C*A*C*C 380 ONT-451 A*ST*ST*SA*SA*ST*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SC 381 *SA*SC*SC ONT-452 A*ST*ST*SA*SA*ST*SA*SA*SA*ST*ST*SG*ST*SC*SA*RT*SC 382 *SA*SC*SC WV-1077 mA*SmU*SmU*SmA*SmA*SmU*SA*SA*SA*ST*ST*SG*ST*SC* 383 RA*ST*SmC*SmA*SmC*SmC WV-1078 mA*RmU*RmU*RmA*RmA*RmU*SA*SA*SA*ST*ST*SG*ST*S 384 C*RA*ST*SmC*RmA*RmC*RmC WV-1079 mA*SmU*SmU*SmA*SmA*SmU*SmA*SmA*SA*ST*ST*SG*ST* 385 SC*RA*ST*SC*SA*SC*SC WV-1080 mA*RmU*RmU*RmA*RmA*RmU*RmA*RmA*SA*ST*ST*SG*S 386 T*SC*RA*ST*SC*SA*SC*SC WV-1081 mAmUmUmAmAmUmAmA*SA*ST*ST*SG*ST*SC*RA*ST*SC*S 387 A*SC*SC WV-1082 mAmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*Sm 388 CmAmCmC WV-1083 mA*SmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*S 389 mCmAmC*SmC WV-1084 mA*RmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*S 390 mCmAmC*RmC WV-1508 A*SmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*Sm 391 CmAmC*SC

TABLE N1A Example sequences targeting rs362307 - continued WV-936 All DNA, stereopure, One Rp WV-937 All DNA, stereopure, One Rp WV-938 All DNA, stereopure, One Rp WV-939 All DNA, stereopure, One Rp WV-940 All DNA, stereopure, One Rp WV-941 All DNA, stereopure, One Rp WV-1085 5-10-5 (2′-OMe-DNA-2′-OMe) Gapmer, Stereopure, One Rp in DNA WV-1086 5-10-5 (2′-OMe-DNA-2′-OMe) Gapmer, Stereopure, One Rp in DNA and Rp wings WV-1087 5-10-5 (2′-OMe-DNA-2′-OMe) Gapmer, Stereopure, One Rp in DNA, PO wings WV-1088 8-12 (2′-OMe-DNA) hemimer, Stereopure, One Rp in DNA, Sp wing WV-1089 8-12 (2′-OMe-DNA) hemimer, Stereopure, One Rp in DNA and Rp wing WV-1090 8-12 (2′-OMe-DNA) hemimer, Srereopure, One Rp in DNA and PO wing WV-1091 5-10-5 (2′-OMe-DNA-2′-OMe) gapmer, Stereopure, One Rp in DNA, First and last PS as Rp and rest PO wing WV-1092 5-10-5 (2′-OMe-DNA-2′-OMe) gapmer, Stereopure, One Rp in DNA, First and last PS as Sp and rest PO wing WV-982 All DNA, stereopure, One Rp WV-983 All DNA, stereopure, One Rp WV-984 All DNA, stereopure, One Rp WV-985 All DNA, stereopure, One Rp WV-986 All DNA, stereopure, One Rp WV-987 All DNA, stereopure, One Rp WV-1510 1-4-10-4-1 (DNA/2′-OMe) gapmer, Stereopure, one Rp in the DNA, first and last nucletotide is DNA and first and last PS are Sp

TABLE N2A Example sequences targeting rs362306 - continued WV-952 All DNA, stereopure, One Rp WV-953 All DNA, stereopure, One Rp WV-954 All DNA, stereopure, One Rp WV-955 All DNA, stereopure, One Rp WV-956 All DNA, stereopure, One Rp WV-957 All DNA, stereopure, One Rp

TABLE N3A Example sequences targeting rs362268 - continued WV-960 All DNA, stereopure, One Rp WV-961 All DNA, stereopure, One Rp WV-962 All DNA, stereopure, One Rp WV-963 All DNA, stereopure, One Rp WV-964 All DNA, stereopure, One Rp WV-965 All DNA, stereopure, One Rp

TABLE N4A Example sequences targeting rs7685686 - continued ONT-451 All DNA, stereopure, One Rp in DNA between position 14 and 15 ONT-452 All DNA, stereopure, One Rp in DNA between position 15 and 16 WV-1077 6-10-4 (2′-OMe-DNA-2′-OMe) Gapmer, stereopure with one Rp in DNA between position 14 and 15 WV-1078 6-10-4 (2′-OMe-DNA-2′-OMe) Gapmer, stereopure with one Rp in DNA between position 14 and 15 and Rp wings WV-1079 8-12 (2′-OMe-DNA) Hemimer, stereopure with one Rp in DNA between position 14 and 15 and Sp wing WV-1080 8-12 (2′-OMe-DNA) Hemimer, stereopure with one Rp in DNA between position 14 and 15 and Rp wing WV-1081 8-12 (2′-OMe-DNA) Hemimer, stereopure with one Rp in DNA between position 14 and 15 and PO wing WV-1082 6-10-4 (2′-OMe-DNA-2′-OMe), stereopure with one Rp in DNA between position 14 and 15 and PO wings WV-1083 6-10-4 (2′-OMe-DNA-2′-OMe), stereopure with one Rp in DNA between position 14 and 15, first and last PS Sp and rest PO wing WV-1084 6-10-4 (2′-OMe-DNA-2′-OMe), stereopure with one Rp in DNA between position 14 and 15, first and last PS Rp and rest PO wing WV-1508 1-5-10-3-1 (DNA/2′-OMe) Gapmer, Stereopure, one Rp in the core, first and last PS is Sp, rest is PO in the wing

In Table N1A-N4A, * only represents a stereorandom phosphorothioate linkage; *S represents an Sp phosphorothioate linkage, *R represents an Rp phosphorothioate linkage, all non-labeled linkage is a natural phosphate linkage, m preceding a base represents 2′-OMe, d2AP represents a 2-amino purine, and dDAP represents a 2,6-diamino purine.

In some embodiments, a provided oligonucleotide composition is a chirally controlled oligonucleotide composition of an oligonucleotide type listed in Table N1A, Table N2A, Table N3A, and Table N4A. In some embodiments, a provided composition is of WV-1092. Each oligonucleotide described herein comprising a HTT sequence represents an HTT oligonucleotide which was designed, constructed and tested in various assays, for example, in vitro assays, in accordance with the present disclosure. For example, each HTT oligonucleotide listed in any of Tables N1A, N2A, N3A, N4A and 8, or described elsewhere herein were designed, constructed and tested in vitro in accordance with the present disclosure. Among others, every HTT oligonucleotide described herein was tested in a dual luciferase reporter assay. In some embodiments, HTT oligonucleotides which were found to be particularly efficacious in the dual luciferase assay were tested in further in vitro and in vivo. In some embodiments, a provided composition is selected from: WVE120101; WV-2603; WV-2595; WV-1510; WV-2378; and WV-2380; each of which was found to be highly efficacious, for example, as demonstrated in vitro in the dual luciferase reporter assay in accordance with the present disclosure. In some embodiments, a provided composition is selected from: WV-1092; WV-1497; WV-1085; WV-1086; ONT-905; and WV-2623; each of which was found to be highly efficacious, for example, as demonstrated in vitro in the dual luciferase reporter assay in accordance with the present disclosure. Various additional HTT oligonucleotides were also shown to be particularly efficacious. In some embodiments, a provided composition is of WV-1092. In some embodiments, a provided composition is of WV-1497. In some embodiments, a provided composition is of WV-1085. In some embodiments, a provided composition is of WV-1086. In some embodiments, a provided composition is of ONT-905. In some embodiments, a provided composition is of WV-2623.

The present disclosure provides compositions comprising or consisting of a plurality of provided oligonucleotides (e.g., chirally controlled oligonucleotide compositions). In some embodiments, all such provided oligonucleotides are of the same type, i.e., all have the same base sequence, pattern of backbone linkages (i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, etc), pattern of backbone chiral centers (i.e. pattern of linkage phosphorus stereochemistry (Rp/Sp)), and pattern of backbone phosphorus modifications (e.g., pattern of “—XLR1” groups in formula I). In some embodiments, all oligonucleotides of the same type are identical. In many embodiments, however, provided compositions comprise a plurality of oligonucleotides types, typically in pre-determined relative amounts.

In some embodiments, a provided composition comprises a predetermined level of an oligonucleotide selected from a Table. In some embodiments, a provided composition comprises a predetermined level of an oligonucleotide selected from Tables N1-N4. In some embodiments, a provided composition comprises a predetermined level of WV-1092. In some embodiments, a provided composition comprises a predetermined level of WV-2595. In some embodiments, a provided composition comprises a predetermined level of WV-2603. In some embodiments, a provided composition comprises a predetermined level of mG* SmGmCmAmC* SA* SA* SG* SG* SG* SC* SA* SC*RA* SG* SmAmCmUmU* SmC (SEQ ID NO: 1554), wherein the oligonucleotide has a free 5′-OH and 3′-OH, m preceding a base represents 2′-OMe modification in the nucleoside containing the base, *S represents an Sp phosphorothioate linkage, *R represents an Rp phosphorothioate linkage, and all non-labeled linkage is a natural phosphate linkage. In some embodiments, a provided composition comprises a predetermined level of mG*SmGmGmUmC*SC*ST*SC*SC*SC*SC* SC*RA*SG*SmAmGmGmG*S mA (SEQ ID NO: 11), wherein the oligonucleotide has a free 5′-OH and 3′-OH, m preceding a base represents 2′-OMe modification in the nucleoside containing the base, *S represents an Sp phosphorothioate linkage, *R represents an Rp phosphorothioate linkage, and all non-labeled linkage is a natural phosphate linkage. In some embodiments, a provided composition comprises a predetermined level of mG*SmUmGmCmA*SC*SA*SC*SA*SG*ST*SA*SG*RA*ST*SmGmAmGmG*S mG (SEQ ID NO: 13), wherein the oligonucleotide has a free 5′-OH and 3′-OH, m preceding a base represents 2′-OMe modification in the nucleoside containing the base, *S represents an Sp phosphorothioate linkage, *R represents an Rp phosphorothioate linkage, and all non-labeled linkage is a natural phosphate linkage.

In some embodiments, a provided chirally controlled oligonucleotide composition is a chirally pure mipomersen composition. That is to say, in some embodiments, a provided chirally controlled oligonucleotide composition provides mipomersen as a single diastereomer with respect to the configuration of the linkage phosphorus. In some embodiments, a provided chirally controlled oligonucleotide composition is a chirally uniform mipomersen composition. That is to say, in some embodiments, every linkage phosphorus of mipomersen is in the Rp configuration or every linkage phosphorus of mipomersen is in the Sp configuration.

In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of one or more provided oligonucleotide types. One of skill in the chemical and medicinal arts will recognize that the selection and amount of each of the one or more types of provided oligonucleotides in a provided composition will depend on the intended use of that composition. That is to say, one of skill in the relevant arts would design a provided chirally controlled oligonucleotide composition such that the amounts and types of provided oligonucleotides contained therein cause the composition as a whole to have certain desirable characteristics (e.g., biologically desirable, therapeutically desirable, etc.).

In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of two or more provided oligonucleotide types. In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of three or more provided oligonucleotide types. In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of four or more provided oligonucleotide types. In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of five or more provided oligonucleotide types. In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of six or more provided oligonucleotide types. In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of seven or more provided oligonucleotide types. In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of eight or more provided oligonucleotide types. In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of nine or more provided oligonucleotide types. In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of ten or more provided oligonucleotide types. In some embodiments, a provided chirally controlled oligonucleotide composition comprises a combination of fifteen or more provided oligonucleotide types.

In some embodiments, a provided chirally controlled oligonucleotide composition is a combination of an amount of chirally uniform mipomersen of the Rp configuration and an amount of chirally uniform mipomersen of the Sp configuration.

In some embodiments, a provided chirally controlled oligonucleotide composition is a combination of an amount of chirally uniform mipomersen of the Rp configuration, an amount of chirally uniform mipomersen of the Sp configuration, and an amount of one or more chirally pure mipomersen of a desired diastereomeric form.

In some embodiments, a provided oligonucleotide type is selected from those described in PCT/US2013/050407, which is incorporated herein by reference. In some embodiments, a provided chirally controlled oligonucleotide composition comprises oligonucleotides of an oligonucleotide type selected from those described in PCT/US2013/050407.

Example Methods for Preparing Oligonucleotides and Compositions

The present disclosure provides methods for making chirally controlled oligonucleotides and chirally controlled compositions comprising one or more specific nucleotide types. In some embodiments, the phrase “oligonucleotide type,” as used herein, defines an oligonucleotide that has a particular base sequence, pattern of backbone linkages, pattern of backbone chiral centers, and pattern of backbone phosphorus modifications (e.g., “—XLR1” groups). Oligonucleotides of a common designated “type” are structurally identical to one another with respect to base sequence, pattern of backbone linkages, pattern of backbone chiral centers, and pattern of backbone phosphorus modifications. In some embodiments, oligonucleotides of an oligonucleotide type are identical.

In some embodiments, a provided chirally controlled oligonucleotide in the disclosure has properties different from those of the corresponding stereorandom oligonucleotide mixture. In some embodiments, a chirally controlled oligonucleotide has lipophilicity different from that of the stereorandom oligonucleotide mixture. In some embodiments, a chirally controlled oligonucleotide has different retention time on HPLC. In some embodiments, a chirally controlled oligonucleotide may have a peak retention time significantly different from that of the corresponding stereorandom oligonucleotide mixture. During oligonucleotide purification using HPLC as generally practiced in the art, certain chirally controlled oligonucleotides will be largely if not totally lost. During oligonucleotide purification using HPLC as generally practiced in the art, certain chirally controlled oligonucleotides will be largely if not totally lost. One of the consequences is that certain diastereomers of a stereorandom oligonucleotide mixture (certain chirally controlled oligonucleotides) are not tested in assays. Another consequence is that from batches to batches, due to the inevitable instrumental and human errors, the supposedly “pure” stereorandom oligonucleotide will have inconsistent compositions in that diastereomers in the composition, and their relative and absolute amounts, are different from batches to batches. The chirally controlled oligonucleotide and chirally controlled oligonucleotide composition provided in this disclosure overcome such problems, as a chirally controlled oligonucleotide is synthesized in a chirally controlled fashion as a single diastereomer, and a chirally controlled oligonucleotide composition comprise predetermined levels of one or more individual oligonucleotide types.

One of skill in the chemical and synthetic arts will appreciate that synthetic methods of the present disclosure provide for a degree of control during each step of the synthesis of a provided oligonucleotide such that each nucleotide unit of the oligonucleotide can be designed and/or selected in advance to have a particular stereochemistry at the linkage phosphorus and/or a particular modification at the linkage phosphorus, and/or a particular base, and/or a particular sugar. In some embodiments, a provided oligonucleotide is designed and/or selected in advance to have a particular combination of stereocenters at the linkage phosphorus of the internucleotidic linkage.

In some embodiments, a provided oligonucleotide made using methods of the present disclosure is designed and/or determined to have a particular combination of linkage phosphorus modifications. In some embodiments, a provided oligonucleotide made using methods of the present disclosure is designed and/or determined to have a particular combination of bases. In some embodiments, a provided oligonucleotide made using methods of the present disclosure is designed and/or determined to have a particular combination of sugars. In some embodiments, a provided oligonucleotide made using methods of the present disclosure is designed and/or determined to have a particular combination of one or more of the above structural characteristics.

Methods of the present disclosure exhibit a high degree of chiral control. For instance, methods of the present disclosure facilitate control of the stereochemical configuration of every single linkage phosphorus within a provided oligonucleotide. In some embodiments, methods of the present disclosure provide an oligonucleotide comprising one or more modified internucleotidic linkages independently having the structure of formula I.

In some embodiments, methods of the present disclosure provide an oligonucleotide which is a mipomersen unimer. In some embodiments, methods of the present disclosure provide an oligonucleotide which is a mipomersen unimer of configuration Rp. In some embodiments, methods of the present disclosure provide an oligonucleotide which is a mipomersen unimer of configuration Sp.

In some embodiments, methods of the present disclosure provide a chirally controlled oligonucleotide composition, i.e., an oligonucleotide composition that contains predetermined levels of individual oligonucleotide types. In some embodiments a chirally controlled oligonucleotide composition comprises one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises a plurality of oligonucleotide types. Example chirally controlled oligonucleotide compositions made in accordance with the present disclosure are described herein.

In some embodiments, methods of the present disclosure provide chirally pure mipomersen compositions with respect to the configuration of the linkage phosphorus. That is to say, in some embodiments, methods of the present disclosure provide compositions of mipomersen wherein mipomersen exists in the composition in the form of a single diastereomer with respect to the configuration of the linkage phosphorus.

In some embodiments, methods of the present disclosure provide chirally uniform mipomersen compositions with respect to the configuration of the linkage phosphorus. That is to say, in some embodiments, methods of the present disclosure provide compositions of mipomersen in which all nucleotide units therein have the same stereochemistry with respect to the configuration of the linkage phosphorus, e.g., all nucleotide units are of the Rp configuration at the linkage phosphorus or all nucleotide units are of the Sp configuration at the linkage phosphorus.

In some embodiments, a provided chirally controlled oligonucleotide is over 50% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 55% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 60% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 65% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 70% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 75% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 80% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 85% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 90% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 91% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 92% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 93% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 94% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 95% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 96% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 97% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 98% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 99% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 99.5% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 99.6% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 99.7% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 99.8% pure. In some embodiments, a provided chirally controlled oligonucleotide is over about 99.9% pure. In some embodiments, a provided chirally controlled oligonucleotide is over at least about 99% pure.

In some embodiments, a chirally controlled oligonucleotide composition is a composition designed to comprise a single oligonucleotide type. In certain embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 55% diastereomerically pure. In some embodiments, such compositions are about 60% diastereomerically pure. In some embodiments, such compositions are about 65% diastereomerically pure. In some embodiments, such compositions are about 70% diastereomerically pure. In some embodiments, such compositions are about 75% diastereomerically pure. In some embodiments, such compositions are about 80% diastereomerically pure. In some embodiments, such compositions are about 85% diastereomerically pure. In some embodiments, such compositions are about 90% diastereomerically pure. In some embodiments, such compositions are about 91% diastereomerically pure. In some embodiments, such compositions are about 92% diastereomerically pure. In some embodiments, such compositions are about 93% diastereomerically pure. In some embodiments, such compositions are about 94% diastereomerically pure. In some embodiments, such compositions are about 95% diastereomerically pure. In some embodiments, such compositions are about 96% diastereomerically pure. In some embodiments, such compositions are about 97% diastereomerically pure. In some embodiments, such compositions are about 98% diastereomerically pure. In some embodiments, such compositions are about 99% diastereomerically pure. In some embodiments, such compositions are about 99.5% diastereomerically pure. In some embodiments, such compositions are about 99.6% diastereomerically pure. In some embodiments, such compositions are about 99.7% diastereomerically pure. In some embodiments, such compositions are about 99.8% diastereomerically pure. In some embodiments, such compositions are about 99.9% diastereomerically pure. In some embodiments, such compositions are at least about 99% diastereomerically pure.

Among other things, the present disclosure recognizes the challenge of stereoselective (rather than stereorandom or racemic) preparation of oligonucleotides. Among other things, the present disclosure provides methods and reagents for stereoselective preparation of oligonucleotides comprising multiple (e.g., more than 5, 6, 7, 8, 9, or 10) internucleotidic linkages, and particularly for oligonucleotides comprising multiple (e.g., more than 5, 6, 7, 8, 9, or 10) chiral internucleotidic linkages. In some embodiments, in a stereorandom or racemic preparation of oligonucleotides, at least one chiral internucleotidic linkage is formed with less than 90:10, 95:5, 96:4, 97:3, or 98:2 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 90:10, 95:5, 96:4, 97:3, or 98:2 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 95:5 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 96:4 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 97:3 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 98:2 diastereoselectivity. In some embodiments, for a stereoselective or chirally controlled preparation of oligonucleotides, each chiral internucleotidic linkage is formed with greater than 99:1 diastereoselectivity. In some embodiments, diastereoselectivity of a chiral internucleotidic linkage in an oligonucleotide may be measured through a model reaction, e.g. formation of a dimer under essentially the same or comparable conditions wherein the dimer has the same internucleotidic linkage as the chiral internucleotidic linkage, the 5′-nucleoside of the dimer is the same as the nucleoside to the 5′-end of the chiral internucleotidic linkage, and the 3′-nucleoside of the dimer is the same as the nucleoside to the 3′-end of the chiral internucleotidic linkage.

In some embodiments, a chirally controlled oligonucleotide composition is a composition designed to comprise multiple oligonucleotide types. In some embodiments, methods of the present disclosure allow for the generation of a library of chirally controlled oligonucleotides such that a pre-selected amount of any one or more chirally controlled oligonucleotide types can be mixed with any one or more other chirally controlled oligonucleotide types to create a chirally controlled oligonucleotide composition. In some embodiments, the pre-selected amount of an oligonucleotide type is a composition having any one of the above-described diastereomeric purities.

In some embodiments, the present disclosure provides methods for making a chirally controlled oligonucleotide comprising steps of:

(1) coupling;

(2) capping;

(3) modifying;

(4) deblocking; and

(5) repeating steps (1)-(4) until a desired length is achieved.

When describing the provided methods, the word “cycle” has its ordinary meaning as understood by a person of ordinary skill in the art. In some embodiments, one round of steps (1)-(4) is referred to as a cycle.

In some embodiments, the present disclosure provides methods for making chirally controlled oligonucleotide compositions, comprising steps of:

(a) providing an amount of a first chirally controlled oligonucleotide; and

(b) optionally providing an amount of one or more additional chirally controlled oligonucleotides.

In some embodiments, a first chirally controlled oligonucleotide is an oligonucleotide type, as described herein. In some embodiments, a one or more additional chirally controlled oligonucleotide is a one or more oligonucleotide type, as described herein.

One of skill in the relevant chemical and synthetic arts will recognize the degree of versatility and control over structural variation and stereochemical configuration of a provided oligonucleotide when synthesized using methods of the present disclosure. For instance, after a first cycle is complete, a subsequent cycle can be performed using a nucleotide unit individually selected for that subsequent cycle which, in some embodiments, comprises a nucleobase and/or a sugar that is different from the first cycle nucleobase and/or sugar. Likewise, the chiral auxiliary used in the coupling step of the subsequent cycle can be different from the chiral auxiliary used in the first cycle, such that the second cycle generates a phosphorus linkage of a different stereochemical configuration. In some embodiments, the stereochemistry of the linkage phosphorus in the newly formed internucleotidic linkage is controlled by using stereochemically pure phosphoramidites. Additionally, the modification reagent used in the modifying step of a subsequent cycle can be different from the modification reagent used in the first or former cycle. The cumulative effect of this iterative assembly approach is such that each component of a provided oligonucleotide can be structurally and configurationally tailored to a high degree. An additional advantage to this approach is that the step of capping minimizes the formation of “n−1” impurities that would otherwise make isolation of a provided oligonucleotide extremely challenging, and especially oligonucleotides of longer lengths.

In some embodiments, an example cycle of the method for making chirally controlled oligonucleotides is illustrated in example schemes described in the present disclosure. In some embodiments, an example cycle of the method for making chirally controlled oligonucleotides is illustrated in Scheme I. In some embodiments,

represents the solid support, and optionally a portion of the growing chirally controlled oligonucleotide attached to the solid support. The chiral auxiliary exemplified has the structure of formula 3-I:

which is further described below. “Cap” is any chemical moiety introduced to the nitrogen atom by the capping step, and in some embodiments, is an amino protecting group. One of ordinary skill in the art understands that in the first cycle, there may be only one nucleoside attached to the solid support when started, and cycle exit can be performed optionally before deblocking. As understood by a person of skill in the art, BPRO is a protected base used in oligonucleotide synthesis. Each step of the above-depicted cycle of Scheme I is described further below.

Synthesis on Solid Support

In some embodiments, the synthesis of a provided oligonucleotide is performed on solid phase. In some embodiments, reactive groups present on a solid support are protected. In some embodiments, reactive groups present on a solid support are unprotected. During oligonucleotide synthesis a solid support is treated with various reagents in several synthesis cycles to achieve the stepwise elongation of a growing oligonucleotide chain with individual nucleotide units. The nucleoside unit at the end of the chain which is directly linked to the solid support is termed “the first nucleoside” as used herein. A first nucleoside is bound to a solid support via a linker moiety, i.e. a diradical with covalent bonds between either of a CPG, a polymer or other solid support and a nucleoside. The linker stays intact during the synthesis cycles performed to assemble the oligonucleotide chain and is cleaved after the chain assembly to liberate the oligonucleotide from the support.

Solid supports for solid-phase nucleic acid synthesis include the supports described in, e.g., U.S. Pat. Nos. 4,659,774, 5,141,813, 4,458,066; Caruthers U.S. Pat. Nos. 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, and 5,132,418; Andrus et al. U.S. Pat. Nos. 5,047,524, 5,262,530; and Koster U.S. Pat. No. 4,725,677 (reissued as RE34,069). In some embodiments, a solid phase is an organic polymer support. In some embodiments, a solid phase is an inorganic polymer support. In some embodiments, an organic polymer support is polystyrene, aminomethyl polystyrene, a polyethylene glycol-polystyrene graft copolymer, polyacrylamide, polymethacrylate, polyvinylalcohol, highly cross-linked polymer (HCP), or other synthetic polymers, carbohydrates such as cellulose and starch or other polymeric carbohydrates, or other organic polymers and any copolymers, composite materials or combination of the above inorganic or organic materials. In some embodiments, an inorganic polymer support is silica, alumina, controlled polyglass (CPG), which is a silica-gel support, or aminopropyl CPG. Other useful solid supports include fluorous solid supports (see e.g., WO/2005/070859), long chain alkylamine (LCAA) controlled pore glass (CPG) solid supports (see e.g., S. P. Adams, K. S. Kavka, E. J. Wykes, S. B. Holder and G. R. Galluppi, J. Am. Chem. Soc., 1983, 105, 661-663; G. R. Gough, M. J. Bruden and P. T. Gilham, Tetrahedron Lett., 1981, 22, 4177-4180). Membrane supports and polymeric membranes (see e.g. Innovation and Perspectives in Solid Phase Synthesis, Peptides, Proteins and Nucleic Acids, ch 21 pp 157-162, 1994, Ed. Roger Epton and U.S. Pat. No. 4,923,901) are also useful for the synthesis of nucleic acids. Once formed, a membrane can be chemically functionalized for use in nucleic acid synthesis. In addition to the attachment of a functional group to the membrane, the use of a linker or spacer group attached to the membrane is also used in some embodiments to minimize steric hindrance between the membrane and the synthesized chain.

Other suitable solid supports include those generally known in the art to be suitable for use in solid phase methodologies, including, for example, glass sold as Primer™ 200 support, controlled pore glass (CPG), oxalyl-controlled pore glass (see, e.g., Alul, et al., Nucleic Acids Research, 1991, 19, 1527), TentaGel Support—an aminopolyethyleneglycol derivatized support (see, e.g., Wright, et al., Tetrahedron Lett., 1993, 34, 3373), and Poros-a copolymer of polystyrene/divinylbenzene.

Surface activated polymers have been demonstrated for use in synthesis of natural and modified nucleic acids and proteins on several solid supports mediums. A solid support material can be any polymer suitably uniform in porosity, having sufficient amine content, and sufficient flexibility to undergo any attendant manipulations without losing integrity. Examples of suitable selected materials include nylon, polypropylene, polyester, polytetrafluoroethylene, polystyrene, polycarbonate, and nitrocellulose. Other materials can serve as a solid support, depending on the design of the investigator. In consideration of some designs, for example, a coated metal, in particular gold or platinum can be selected (see e.g., US publication No. 20010055761). In one embodiment of oligonucleotide synthesis, for example, a nucleoside is anchored to a solid support which is functionalized with hydroxyl or amino residues. Alternatively, a solid support is derivatized to provide an acid labile trialkoxytrityl group, such as a trimethoxytrityl group (TMT). Without being bound by theory, it is expected that the presence of a trialkoxytrityl protecting group will permit initial detritylation under conditions commonly used on DNA synthesizers. For a faster release of oligonucleotide material in solution with aqueous ammonia, a diglycoate linker is optionally introduced onto the support.

In some embodiments, a provided oligonucleotide alternatively is synthesized from the 5′ to 3′ direction. In some embodiments, a nucleic acid is attached to a solid support through its 5′ end of the growing nucleic acid, thereby presenting its 3′ group for reaction, i.e. using 5′-nucleoside phosphoramidites or in enzymatic reaction (e.g. ligation and polymerization using nucleoside 5′-triphosphates). When considering the 5′ to 3′ synthesis the iterative steps of the present disclosure remain unchanged (i.e. capping and modification on the chiral phosphorus).

Linking Moiety

A linking moiety or linker is optionally used to connect a solid support to a compound comprising a free nucleophilic moiety. Suitable linkers are known such as short molecules which serve to connect a solid support to functional groups (e.g., hydroxyl groups) of initial nucleosides molecules in solid phase synthetic techniques. In some embodiments, the linking moiety is a succinamic acid linker, or a succinate linker (—CO—CH2—CH2—CO—), or an oxalyl linker (—CO—CO—). In some embodiments, the linking moiety and the nucleoside are bonded together through an ester bond. In some embodiments, a linking moiety and a nucleoside are bonded together through an amide bond. In some embodiments, a linking moiety connects a nucleoside to another nucleotide or nucleic acid. Suitable linkers are disclosed in, for example, Oligonucleotides And Analogues A Practical Approach, Ekstein, F. Ed., IRL Press, N.Y., 1991, Chapter 1 and Solid-Phase Supports for Oligonucleotide Synthesis, Pon, R. T., Curr. Prot. Nucleic Acid Chem., 2000, 3.1.1-3.1.28.

A linker moiety is used to connect a compound comprising a free nucleophilic moiety to another nucleoside, nucleotide, or nucleic acid. In some embodiments, a linking moiety is a phosphodiester linkage. In some embodiments, a linking moiety is an H-phosphonate moiety. In some embodiments, a linking moiety is a modified phosphorus linkage as described herein. In some embodiments, a universal linker (UnyLinker) is used to attached the oligonucleotide to the solid support (Ravikumar et al., Org. Process Res. Dev., 2008, 12 (3), 399-410). In some embodiments, other universal linkers are used (Pon, R. T., Curr. Prot. Nucleic Acid Chem., 2000, 3.1.1-3.1.28). In some embodiments, various orthogonal linkers (such as disulfide linkers) are used (Pon, R. T., Curr. Prot. Nucleic Acid Chem., 2000, 3.1.1-3.1.28).

Among other things, the present disclosure recognizes that a linker can be chosen or designed to be compatible with a set of reaction conditions employed in oligonucleotide synthesis. In some embodiments, to avoid degradation of oligonucleotides and to avoid desulfurization, auxiliary groups are selectively removed before de-protection. In some embodiments, DPSE group can selectively be removed by F− ions. In some embodiments, the present disclosure provides linkers that are stable under a DPSE de-protection condition, e.g., 0.1M TBAF in MeCN, 0.5M HF-Et3N in THF or MeCN, etc. In some embodiments, a provided linker is the SP linker. In some embodiments, the present disclosure demonstrates that the SP linker is stable under a DPSE de-protection condition, e.g., 0.1M TBAF in MeCN, 0.5M HF-Et3N in THF or MeCN, etc.; they are also stable, e.g., under anhydrous basic conditions, such as om1M DBU in MeCN.

In some embodiments, an example linker is:

In some embodiments, the succinyl linker, Q-linker or oxalyl linker is not stable to one or more DPSE-deprotection conditions using F−.

General Conditions—Solvents for Synthesis

Syntheses of provided oligonucleotides are generally performed in aprotic organic solvents. In some embodiments, a solvent is a nitrile solvent such as, e.g., acetonitrile. In some embodiments, a solvent is a basic amine solvent such as, e.g., pyridine. In some embodiments, a solvent is an ethereal solvent such as, e.g., tetrahydrofuran. In some embodiments, a solvent is a halogenated hydrocarbon such as, e.g., dichloromethane. In some embodiments, a mixture of solvents is used. In certain embodiments a solvent is a mixture of any one or more of the above-described classes of solvents.

In some embodiments, when an aprotic organic solvent is not basic, a base is present in the reacting step. In some embodiments where a base is present, the base is an amine base such as, e.g., pyridine, quinoline, or N,N-dimethylaniline. Examples of other amine bases include pyrrolidine, piperidine, N-methyl pyrrolidine, pyridine, quinoline, N,N-dimethylaminopyridine (DMAP), or N,N-dimethylaniline.

In some embodiments, a base is other than an amine base.

In some embodiments, an aprotic organic solvent is anhydrous. In some embodiments, an anhydrous aprotic organic solvent is freshly distilled. In some embodiments, a freshly distilled anhydrous aprotic organic solvent is a basic amine solvent such as, e.g., pyridine. In some embodiments, a freshly distilled anhydrous aprotic organic solvent is an ethereal solvent such as, e.g., tetrahydrofuran. In some embodiments, a freshly distilled anhydrous aprotic organic solvent is a nitrile solvent such as, e.g., acetonitrile.

Chiral Reagent/Chiral Auxiliary

In some embodiments, chiral reagents are used to confer stereoselectivity in the production of chirally controlled olignucleotides. Many different chiral reagents, also referred to by those of skill in the art and herein as chiral auxiliaries, may be used in accordance with methods of the present disclosure. Examples of such chiral reagents are described herein and in Wada I, II and III, referenced above. In certain embodiments, a chiral reagent is as described by Wada I. In some embodiments, a chiral reagent for use in accordance with the methods of the present disclosure are of Formula 3-I, below:

wherein W1 and W2 are any of —O—, —S—, or —NG5-, U1 and U3 are carbon atoms which are bonded to U2 if present, or to each other if r is 0, via a single, double or triple bond. U2 is —C—, —CG8-, —CG8G8-, —NG8-, —N—, —O—, or —S— where r is an integer of 0 to 5 and no more than two heteroatoms are adjacent. When any one of U2 is C, a triple bond must be formed between a second instance of U2, which is C, or to one of U1 or U3. Similarly, when any one of U2 is CG8, a double bond is formed between a second instance of U2 which is —CG8- or —N—, or to one of U1 or U3.

In some embodiments, —U1(G3G4)-(U2)r—U3(G1G2)- is -CG3G4-CG1G2-. In some embodiments, —U1—(U2)r—U3— is —CG3=CG1-. In some embodiments, —U1—(U2)r—U3— is —C≡C—. In some embodiments, —U1—(U2)r—U3— is —CG3=CG-CG1G2-. In some embodiments, —U1—(U2)r—U3— is —CG3G4-O-CG1G2-. In some embodiments, —U1—(U2)r—U3— is —CG3G4-NG-CG1G2-. In some embodiments, —U1—(U2)r—U3— is —CG3G4-N-CG2-. In some embodiments, —U1—(U2)r—U3— is —CG3G4-N═C G8-CG1G2-.

As defined herein, G1, G2, G3, G4, G5, and G8 are independently hydrogen, or an optionally substituted group selected from alkyl, aralkyl, cycloalkyl, cycloalkylalkyl, heterocyclyl, heteroaryl, and aryl; or two of G1, G2, G3, G4, and G5 are G6 (taken together to form an optionally substituted, saturated, partially unsaturated or unsaturated carbocyclic or heteroatom-containing ring of up to about 20 ring atoms which is monocyclic or polycyclic, and is fused or unfused). In some embodiments, a ring so formed is substituted by oxo, thioxo, alkyl, alkenyl, alkynyl, heteroaryl, or aryl moieties. In some embodiments, when a ring formed by taking two G6 together is substituted, it is substituted by a moiety which is bulky enough to confer stereoselectivity during the reaction.

In some embodiments, a ring formed by taking two of G6 together is optionally substituted cyclopentyl, pyrrolyl, cyclopropyl, cyclohexenyl, cyclopentenyl, tetrahydropyranyl, or piperazinyl. In some embodiments, a ring formed by taking two of G6 together is optionally substituted cyclopentyl, pyrrolyl, cyclopropyl, cyclohexenyl, cyclopentenyl, tetrahydropyranyl, pyrrolidinyl, or piperazinyl.

In some embodiments, G1 is optionally substituted phenyl. In some embodiments, G1 is phenyl. In some embodiments, G2 is methyl or hydrogen. In some embodiments, G1 is optionally substituted phenyl and G2 is methyl. In some embodiments, G1 is phenyl and G2 is methyl.

In some embodiments, r is 0.

In some embodiments, W1 is —NG5-. In some embodiments, one of G3 and G4 is taken together with G5 to form an optionally substituted pyrrolidinyl ring. In some embodiments, one of G3 and G4 is taken together with G5 to form a pyrrolidinyl ring.

In some embodiments, W2 is —O—.

In some embodiments, a chiral reagent is a compound of Formula 3-AA:

wherein each variable is independently as defined above and described herein.

In some embodiments of Formula 3AA, W1 and W2 are independently —NG5-, —O—, or —S—; G1, G2, G3, G4, and G5 are independently hydrogen, or an optionally substituted group selected from alkyl, aralkyl, cycloalkyl, cycloalkylalkyl, heterocyclyl, heteroaryl, or aryl; or two of G1, G2, G3, G4, and G5 are G6 (taken together to form an optionally substituted saturated, partially unsaturated or unsaturated carbocyclic or heteroatom-containing ring of up to about 20 ring atoms which is monocyclic or polycyclic, fused or unfused), and no more than four of G1, G2, G3, G4, and G5 are G6. Similarly to the compounds of Formula 3-I, any of G1, G2, G3, G4, or G5 are optionally substituted by oxo, thioxo, alkyl, alkenyl, alkynyl, heteroaryl, or aryl moieties. In some embodiments, such substitution induces stereoselectivity in chirally controlled oligonucleotide production.

In some embodiments, a provided chiral reagent has the structure of

In some embodiments, a provided chiral reagent has the structure of

In some embodiments, a provided chiral reagent has the structure of

In some embodiments, a provided chiral reagent has the structure of

In some embodiments, a provided chiral reagent has the structure of

In some embodiments, a provided chiral reagent has the structure of

In some embodiments, a provided chiral reagent has the structure of

In some embodiments, a provided chiral reagent has the structure of

In some embodiments, W1 is —NG5, W2 is O, each of G1 and G3 is independently hydrogen or an optionally substituted group selected from C1-10 aliphatic, heterocyclyl, heteroaryl and aryl, G2 is —C(R)2Si(R)3, and G4 and G5 are taken together to form an optionally substituted saturated, partially unsaturated or unsaturated heteroatom-containing ring of up to about 20 ring atoms which is monocyclic or polycyclic, fused or unfused. In some embodiments, each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl. In some embodiments, G2 is —C(R)2Si(R)3, wherein —C(R)2— is optionally substituted —CH2—, and each R of —Si(R)3 is independently an optionally substituted group selected from C1-10 aliphatic, heterocyclyl, heteroaryl and aryl. In some embodiments, at least one R of —Si(R)3 is independently optionally substituted C1-10 alkyl. In some embodiments, at least one R of —Si(R)3 is independently optionally substituted phenyl. In some embodiments, one R of —Si(R)3 is independently optionally substituted phenyl, and each of the other two R is independently optionally substituted C1-10 alkyl. In some embodiments, one R of —Si(R)3 is independently optionally substituted C1-10 alkyl, and each of the other two R is independently optionally substituted phenyl. In some embodiments, G2 is optionally substituted —CH2Si(Ph)(Me)2. In some embodiments, G2 is optionally substituted —CH2Si(Me)(Ph)2. In some embodiments, G2 is —CH2Si(Me)(Ph)2. In some embodiments, G4 and G5 are taken together to form an optionally substituted saturated 5-6 membered ring containing one nitrogen atom (to which G5 is attached). In some embodiments, G4 and G5 are taken together to form an optionally substituted saturated 5-membered ring containing one nitrogen atom. In some embodiments, G1 is hydrogen. In some embodiments, G3 is hydrogen. In some embodiments, both G1 and G3 are hydrogen.

In some embodiments, a chiral reagent has one of the following formulae:

In some embodiments, a chiral reagent is an aminoalcohol. In some embodiments, a chiral reagent is an aminothiol. In some embodiments, a chiral reagent is an aminophenol. In some embodiments, a chiral reagent is (S)- and (R)-2-methylamino-1-phenylethanol, (1R,2S)-ephedrine, or (1R,2S)-2-methylamino-1,2-diphenylethanol.

In some embodiments of the disclosure, a chiral reagent is a compound of one of the following formulae:

As demonstrated herein, when used for preparing a chiral internucleotidic linkage, to obtain stereoselectivity generally stereochemically pure chiral reagents are utilized. Among other things, the present disclosure provides stereochemically pure chiral reagents, including those having structures described.

The choice of chiral reagent, for example, the isomer represented by Formula Q or its stereoisomer, Formula R, permits specific control of chirality at a linkage phosphorus. Thus, either an Rp or Sp configuration can be selected in each synthetic cycle, permitting control of the overall three dimensional structure of a chirally controlled oligonucleotide. In some embodiments, a chirally controlled oligonucleotide has all Rp stereocenters. In some embodiments of the disclosure, a chirally controlled oligonucleotide has all Sp stereocenters. In some embodiments of the disclosure, each linkage phosphorus in the chirally controlled oligonucleotide is independently Rp or Sp. In some embodiments of the disclosure, each linkage phosphorus in the chirally controlled oligonucleotide is independently Rp or Sp, and at least one is Rp and at least one is Sp. In some embodiments, the selection of Rp and Sp centers is made to confer a specific three dimensional superstructure to a chirally controlled oligonucleotide. Examples of such selections are described in further detail herein.

In some embodiments, a chiral reagent for use in accordance with the present disclosure is selected for its ability to be removed at a particular step in the above-depicted cycle. For example, in some embodiments it is desirable to remove a chiral reagent during the step of modifying the linkage phosphorus. In some embodiments, it is desirable to remove a chiral reagent before the step of modifying the linkage phosphorus. In some embodiments, it is desirable to remove a chiral reagent after the step of modifying the linkage phosphorus. In some embodiments, it is desirable to remove a chiral reagent after a first coupling step has occurred but before a second coupling step has occurred, such that a chiral reagent is not present on the growing oligonucleotide during the second coupling (and likewise for additional subsequent coupling steps). In some embodiments, a chiral reagent is removed during the “deblock” reaction that occurs after modification of the linkage phosphorus but before a subsequent cycle begins. Example methods and reagents for removal are described herein.

In some embodiments, removal of chiral auxiliary is achieved when performing the modification and/or deblocking step, as illustrated in Scheme I. It can be beneficial to combine chiral auxiliary removal together with other transformations, such as modification and deblocking. A person of ordinary skill in the art would appreciate that the saved steps/transformation could improve the overall efficiency of synthesis, for instance, with respect to yield and product purity, especially for longer oligonucleotides. One example wherein the chiral auxiliary is removed during modification and/or deblocking is illustrated in Scheme I.

In some embodiments, a chiral reagent for use in accordance with methods of the present disclosure is characterized in that it is removable under certain conditions. For instance, in some embodiments, a chiral reagent is selected for its ability to be removed under acidic conditions. In certain embodiments, a chiral reagent is selected for its ability to be removed under mildly acidic conditions. In certain embodiments, a chiral reagent is selected for its ability to be removed by way of an E1 elimination reaction (e.g., removal occurs due to the formation of a cation intermediate on the chiral reagent under acidic conditions, causing the chiral reagent to cleave from the oligonucleotide). In some embodiments, a chiral reagent is characterized in that it has a structure recognized as being able to accommodate or facilitate an E1 elimination reaction. One of skill in the relevant arts will appreciate which structures would be envisaged as being prone toward undergoing such elimination reactions.

In some embodiments, a chiral reagent is selected for its ability to be removed with a nucleophile. In some embodiments, a chiral reagent is selected for its ability to be removed with an amine nucleophile. In some embodiments, a chiral reagent is selected for its ability to be removed with a nucleophile other than an amine.

In some embodiments, a chiral reagent is selected for its ability to be removed with a base. In some embodiments, a chiral reagent is selected for its ability to be removed with an amine. In some embodiments, a chiral reagent is selected for its ability to be removed with a base other than an amine.

Additional chiral auxiliaries and their use can be found in e.g., Wada I (JP4348077; WO2005/014609; WO2005/092909), Wada II (WO2010/064146), Wada III (WO2012/039448), Chiral Control (WO2010/064146), etc.

Activation

An achiral H-phosphonate moiety is treated with the first activating reagent to form the first intermediate. In one embodiment, the first activating reagent is added to the reaction mixture during the condensation step. Use of the first activating reagent is dependent on reaction conditions such as solvents that are used for the reaction. Examples of the first activating reagent are phosgene, trichloromethyl chloroformate, bis(trichloromethyl)carbonate (BTC), oxalyl chloride, Ph3PCl2, (PhO)3PCl2, N,N′-bis(2-oxo-3-oxazolidinyl)phosphinic chloride (BopCl), 1,3-dimethyl-2-(3-nitro-1,2,4-triazol-1-yl)-2-pyrrolidin-1-yl-1,3,2-diazaphospholidinium hexafluorophosphate (MNTP), or 3-nitro-1,2,4-triazol-1-yl-tris(pyrrolidin-1-yl)phosphonium hexafluorophosphate (PyNTP).

The example of achiral H-phosphonate moiety is a compound shown in the above Scheme. DBU represents 1,8-diazabicyclo[5.4.0]undec-7-ene. H+DBU may be, for example, ammonium ion, alkylammonium ion, heteroaromatic iminium ion, or heterocyclic iminium ion, any of which is primary, secondary, tertiary or quaternary, or a monovalent metal ion.

Reacting with Chiral Reagent

After the first activation step, the activated achiral H-phosphonate moiety reacts with a chiral reagent, which is represented by formula (Z-I) or (Z-I′), to form a chiral intermediate of formula (Z-Va), (Z-Vb), (Z-Va′), or (Z-Vb′).

Stereospecific Condensation Step

A chiral intermediate of Formula Z-Va ((Z-Vb), (Z-Va′), or (Z-Vb′)) is treated with the second activating reagent and a nucleoside to form a condensed intermediate. The nucleoside may be on solid support. Examples of the second activating reagent are 4,5-dicyanoimidazole (DCI), 4,5-dichloroimidazole, 1-phenylimidazolium triflate (PhIMT), benzimidazolium triflate (BIT), benztriazole, 3-nitro-1,2,4-triazole (NT), tetrazole, 5-ethylthiotetrazole (ETT), 5-benzylthiotetrazole (BTT), 5-(4-nitrophenyl)tetrazole, N-cyanomethylpyrrolidinium triflate (CMPT), N-cyanomethylpiperidinium triflate, N-cyanomethyldimethylammonium triflate. A chiral intermediate of Formula Z-Va ((Z-Vb), (Z-Va′), or (Z-Vb′)) may be isolated as a monomer. Usually, the chiral intermediate of Z-Va ((Z-Vb), (Z-Va′), or (Z-Vb′)) is not isolated and undergoes a reaction in the same pot with a nucleoside or modified nucleoside to provide a chiral phosphite compound, a condensed intermediate. In other embodiments, when the method is performed via solid phase synthesis, the solid support comprising the compound is filtered away from side products, impurities, and/or reagents.

Capping Step

If the final nucleic acid is larger than a dimer, the unreacted —OH moiety is capped with a blocking group and the chiral auxiliary in the compound may also be capped with a blocking group to form a capped condensed intermediate. If the final nucleic acid is a dimer, then the capping step is not necessary.

Modifying Step

The compound is modified by reaction with an electrophile. The capped condensed intermediate may be executed modifying step. In some embodiments, the modifying step is performed using a sulfur electrophile, a selenium electrophile or a boronating agent. Examples of modifying steps are step of oxidation and sulfurization.

In some embodiments of the method, the sulfur electrophile is a compound having one of the following formulas:


Zz1—S—S—Zz2, or Zz1—S—Vz—Zz2;  S8 (Formula Z-B),

wherein Zz1 and Zz2 are independently alkyl, aminoalkyl, cycloalkyl, heterocyclic, cycloalkylalkyl, heterocycloalkyl, aryl, heteroaryl, alkyloxy, aryloxy, heteroaryloxy, acyl, amide, imide, or thiocarbonyl, or Zz1 and Zz2 are taken together to form a 3 to 8 membered alicyclic or heterocyclic ring, which may be substituted or unsubstituted; Vz is SO2, O, or NRf; and Rf is hydrogen, alkyl, alkenyl, alkynyl, or aryl.

In some embodiments of the method, the sulfur electrophile is a compound of following Formulae Z-A, Z-B, Z-C, Z-D, Z-E, or Z-F:

In some embodiments, a sulfurization reagent is 3-phenyl-1,2,4-dithiazolin-5-one.

In some embodiments, the selenium electrophile is a compound having one of the following formulae:


Zz3—Se—Se—Zz4, or Zz3—Se—Vz—Zz4;  Se (Formula Z-G),

wherein Zz3 and Zz4 are independently alkyl, aminoalkyl, cycloalkyl, heterocyclic, cycloalkylalkyl, heterocycloalkyl, aryl, heteroaryl, alkyloxy, aryloxy, heteroaryloxy, acyl, amide, imide, or thiocarbonyl, or Zz3 and Zz4 are taken together to form a 3 to 8 membered alicyclic or heterocyclic ring, which may be substituted or unsubstituted; Vz is SO2, S, O, or NRf; and Rf is hydrogen, alkyl, alkenyl, alkynyl, or aryl.

In some embodiments, the selenium electrophile is a compound of Formula Z-G, Z-H, Z-I, Z-J, Z-K, or Z-L.

In some embodiments, the boronating agent is borane-N,N-diisopropylethylamine (BH3DIPEA), borane-pyridine (BH3Py), borane-2-chloropyridine (BH3CPy), borane-aniline (BH3An), borane-tetrahydrofurane (BH3THF), or borane-dimethylsulfide (BH3Me2S).

In some embodiments, after the modifying step, a chiral auxiliary group falls off from the growing oligonucleotide chain. In some embodiments, after the modifying step, a chiral auxiliary group remains connected to the internucleotidic phosphorus atom.

In some embodiments of the method, the modifying step is an oxidation step. In some embodiments of the method, the modifying step is an oxidation step using similar conditions as described above in this application. In some embodiments, an oxidation step is as disclosed in, e.g., JP 2010-265304 A and WO2010/064146.

Chain Elongation Cycle and De-Protection Step

The capped condensed intermediate is deblocked to remove the blocking group at the 5′-end of the growing nucleic acid chain to provide a compound. The compound is optionally allowed to re-enter the chain elongation cycle to form a condensed intermediate, a capped condensed intermediate, a modified capped condensed intermediate, and a 5′-deprotected modified capped intermediate. Following at least one round of chain elongation cycle, the 5′-deprotected modified capped intermediate is further deblocked by removal of the chiral auxiliary ligand and other protecting groups for, e.g., nucleobase, modified nucleobase, sugar and modified sugar protecting groups, to provide a nucleic acid. In other embodiments, the nucleoside comprising a 5′-OH moiety is an intermediate from a previous chain elongation cycle as described herein. In yet other embodiments, the nucleoside comprising a 5′-OH moiety is an intermediate obtained from another known nucleic acid synthetic method. In embodiments where a solid support is used, the phosphorus-atom modified nucleic acid is then cleaved from the solid support. In certain embodiments, the nucleic acids is left attached on the solid support for purification purposes and then cleaved from the solid support following purification.

In yet other embodiments, the nucleoside comprising a 5′-OH moiety is an intermediate obtained from another known nucleic acid synthetic method. In yet other embodiments, the nucleoside comprising a 5′-OH moiety is an intermediate obtained from another known nucleic acid synthetic method as described in this application. In yet other embodiments, the nucleoside comprising a 5′-OH moiety is an intermediate obtained from another known nucleic acid synthetic method comprising one or more cycles illustrated in Scheme I. In yet other embodiments, the nucleoside comprising a 5′-OH moiety is an intermediate obtained from another known nucleic acid synthetic method comprising one or more cycles illustrated in Scheme I-b, I-c or I-d.

In some embodiments, the present disclosure provides oligonucleotide synthesis methods that use stable and commercially available materials as starting materials. In some embodiments, the present disclosure provides oligonucleotide synthesis methods to produce stereocontrolled phosphorus atom-modified oligonucleotide derivatives using an achiral starting material.

In some embodiments, the method of the present disclosure does not cause degradations under the de-protection steps. Further the method does not require special capping agents to produce phosphorus atom-modified oligonucleotide derivatives.

Condensing Reagent

Condensing reagents (CR) useful in accordance with methods of the present disclosure are of any one of the following general formulae:

wherein Z1, Z2, Z3, Z4, Z5, Z6, Z7, Z8, and Z9 are independently optionally substituted group selected from alkyl, aminoalkyl, cycloalkyl, heterocyclic, cycloalkylalkyl, heterocycloalkyl, aryl, heteroaryl, alkyloxy, aryloxy, or heteroaryloxy, or wherein any of Z2 and Z3, Z5 and Z6, Z7 and Z8, Z8 and Z9, Z9 and Z7, or Z7 and Z8 and Z9 are taken together to form a 3 to 20 membered alicyclic or heterocyclic ring; Q− is a counter anion; and LG is a leaving group.

In some embodiments, a counter ion of a condensing reagent CR is Cl−, Br−, BF4−, PF6−, TfO−, Tf2N−, AsF6−, ClO4−, or SbF6−, wherein Tf is CF3SO2. In some embodiments, a leaving group of a condensing reagent CR is F, Cl, Br, I, 3-nitro-1,2,4-triazole, imidazole, alkyltriazole, tetrazole, pentafluorobenzene, or 1-hydroxybenzotriazole.

Examples of condensing reagents used in accordance with methods of the present disclosure include, but are not limited to, pentafluorobenzoyl chloride, carbonyldiimidazole (CDI), 1-mesitylenesulfonyl-3-nitrotriazole (MSNT), 1-ethyl-3-(3′-dimethylaminopropyl)carbodiimide hydrochloride (EDCI-HCl), benzotriazole-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate (PyBOP), N,N′-bis(2-oxo-3-oxazolidinyl)phosphinic chloride (BopCl), 2-(1H-7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), and O-benzotriazole-N,N,N′,N′-tetramethyluronium hexafluorophosphate (HBTU), DIPCDI; N,N′-bis(2-oxo-3-oxazolidinyl)phosphinic bromide (BopBr), 1,3-dimethyl-2-(3-nitro-1,2,4-triazol-1-yl)-2-pyrrolidin-1-yl-1,3,2-diazaphospholidinium hexafluorophosphate (MNTP), 3-nitro-1,2,4-triazol-1-yl-tris(pyrrolidin-1-yl)phosphonium hexafluorophosphate (PyNTP), bromotripyrrolidinophosphonium hexafluorophosphate (PyBrOP); O—(benzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium tetrafluoroborate (TBTU); and tetramethylfluoroformamidinium hexafluorophosphate (TFFH). In certain embodiments, a counter ion of the condensing reagent CR is Cl−, Br−, BF4−, PF6−, TfO−, Tf2N−, AsF6−, ClO4−, or SbF6−, wherein Tf is CF3SO2.

In some embodiments, a condensing reagent is 1-(2,4,6-trii sopropylbenzenesulfonyl)-5-(pyridin-2-yl) tetrazolide, pivaloyl chloride, bromotrispyrrolidinophosphonium hexafluorophosphate, N,N′-bis(2-oxo-3-oxazolidinyl) phosphinic chloride (BopCl), or 2-chloro-5,5-dimethyl-2-oxo-1,3,2-dioxaphosphinane. In some embodiment, a condensing reagent is N,N′-bis(2-oxo-3-oxazolidinyl)phosphinic chloride (BopCl). In some embodiments, a condensing reagent is selected from those described in WO/2006/066260).

In some embodiments, a condensing reagent is 1,3-dimethyl-2-(3-nitro-1,2,4-triazol-1-yl)-2-pyrrolidin-1-yl-1,3,2-diazaphospholidinium hexafluorophosphate (MNTP), or 3-nitro-1,2,4-triazol-1-yl-tris(pyrrolidin-1-yl)phosphonium hexafluorophosphate (PyNTP):

Selection of Base and Sugar of Nucleoside Coupling Partner

As described herein, nucleoside coupling partners for use in accordance with methods of the present disclosure can be the same as one another or can be different from one another. In some embodiments, nucleoside coupling partners for use in the synthesis of a provided oligonucleotide are of the same structure and/or stereochemical configuration as one another. In some embodiments, each nucleoside coupling partner for use in the synthesis of a provided oligonucleotide is not of the same structure and/or stereochemical configuration as certain other nucleoside coupling partners of the oligonucleotide. Example nucleobases and sugars for use in accordance with methods of the present disclosure are described herein. One of skill in the relevant chemical and synthetic arts will recognize that any combination of nucleobases and sugars described herein are contemplated for use in accordance with methods of the present disclosure.

Coupling Step

Example coupling procedures and chiral reagents and condensing reagents for use in accordance with the present disclosure are outlined in, inter alia, Wada I (JP4348077; WO2005/014609; WO2005/092909), Wada II (WO2010/064146), Wada III (WO2012/039448), and Chiral Control (WO2010/064146). Chiral nucleoside coupling partners for use in accordance with the present disclosure are also referred to herein as “Wada amidites.” In some embodiments, a coupling partner has the structure of

wherein BPRO is a protected nucleobase. In some embodiments, a coupling partner has the structure of

wherein BPRO is a protected nucleobase. In some embodiments, a coupling partner has the structure of

wherein BPRO is a protected nucleobase, and R1 is as defined and described herein. In some embodiments, a coupling partner has the structure of

wherein BPRO is a protected nucleobase, and R1 is as defined and described herein. In some embodiments, R1 is optionally substituted C1-6 alkyl. In some embodiments, R1 is Me.

Example chiral phosphoramidites as coupling partner are depicted below:

Additional examples are described in Chiral Control (WO2010/064146).

One of the methods used for synthesizing the coupling partner is depicted in Scheme II, below.

In some embodiments, the step of coupling comprises reacting a free hydroxyl group of a nucleotide unit of an oligonucleotide with a nucleoside coupling partner under suitable conditions to effect the coupling. In some embodiments, the step of coupling is preceded by a step of deblocking. For instance, in some embodiments, the 5′ hydroxyl group of the growing oligonucleotide is blocked (i.e., protected) and must be deblocked in order to subsequently react with a nucleoside coupling partner.

Once the appropriate hydroxyl group of the growing oligonucleotide has been deblocked, the support is washed and dried in preparation for delivery of a solution comprising a chiral reagent and a solution comprising an activator. In some embodiments, a chiral reagent and an activator are delivered simultaneously. In some embodiments, co-delivery comprises delivering an amount of a chiral reagent in solution (e.g., a phosphoramidite solution) and an amount of activator in a solution (e.g., a CMPT solution) in a polar aprotic solvent such as a nitrile solvent (e.g., acetonitrile).

In some embodiments, the step of coupling provides a crude product composition in which the chiral phosphite product is present in a diastereomeric excess of >95%. In some embodiments, the chiral phosphite product is present in a diastereomeric excess of >96%. In some embodiments, the chiral phosphite product is present in a diastereomeric excess of >97%. In some embodiments, the chiral phosphite product is present in a diastereomeric excess of >98%. In some embodiments, the chiral phosphite product is present in a diastereomeric excess of >99%.

Capping Step:

Provided methods for making chirally controlled oligonucleotides comprise a step of capping. In some embodiments, a step of capping is a single step. In some embodiments, a step of capping is two steps. In some embodiments, a step of capping is more than two steps.

In some embodiments, a step of capping comprises steps of capping the free amine of the chiral auxiliary and capping any residual unreacted 5′ hydroxyl groups. In some embodiments, the free amine of the chiral auxiliary and the unreacted 5′ hydroxyl groups are capped with the same capping group. In some embodiments, the free amine of the chiral auxiliary and the unreacted 5′ hydroxyl groups are capped with different capping groups. In certain embodiments, capping with different capping groups allows for selective removal of one capping group over the other during synthesis of the oligonucleotide. In some embodiments, the capping of both groups occurs simultaneously. In some embodiments, the capping of both groups occurs iteratively.

In certain embodiments, capping occurs iteratively and comprises a first step of capping the free amine followed by a second step of capping the free 5′ hydroxyl group, wherein both the free amine and the 5′ hydroxyl group are capped with the same capping group. For instance, in some embodiments, the free amine of the chiral auxiliary is capped using an anhydride (e.g., phenoxyacetic anhydride, i.e., Pac2O) prior to capping of the 5′ hydroxyl group with the same anhydride. In certain embodiments, the capping of the 5′ hydroxyl group with the same anhydride occurs under different conditions (e.g., in the presence of one or more additional reagents). In some embodiments, capping of the 5′ hydroxyl group occurs in the presence of an amine base in an etherial solvent (e.g., NMI (N-methylimidazole) in THF). The phrase “capping group” is used interchangeably herein with the phrases “protecting group” and “blocking group”.

In some embodiments, an amine capping group is characterized in that it effectively caps the amine such that it prevents rearrangement and/or decomposition of the intermediate phosphite species. In some embodiments, a capping group is selected for its ability to protect the amine of the chiral auxiliary in order to prevent intramolecular cleavage of the internucleotide linkage phosphorus.

In some embodiments, a 5′ hydroxyl group capping group is characterized in that it effectively caps the hydroxyl group such that it prevents the occurrence of “shortmers,” e.g., “n−m” (m and n are integers and m<n; n is the number of bases in the targeted oligonucleotide) impurities that occur from the reaction of an oligonucleotide chain that fails to react in a first cycle but then reacts in one or more subsequent cycles. The presence of such shortmers, especially “n−1”, has a deleterious effect upon the purity of the crude oligonucleotide and makes final purification of the oligonucleotide tedious and generally low-yielding.

In some embodiments, a particular cap is selected based on its tendency to facilitate a particular type of reaction under particular conditions. For instance, in some embodiments, a capping group is selected for its ability to facilitate an E1 elimination reaction, which reaction cleaves the cap and/or auxiliary from the growing oligonucleotide. In some embodiments, a capping group is selected for its ability to facilitate an E2 elimination reaction, which reaction cleaves the cap and/or auxiliary from the growing oligonucleotide. In some embodiments, a capping group is selected for its ability to facilitate a β-elimination reaction, which reaction cleaves the cap and/or auxiliary from the growing oligonucleotide.

Modifying Step:

As used herein, the phrase “modifying step”, “modification step” and “P-modification step” are used interchangeably and refer generally to any one or more steps used to install a modified internucleotidic linkage. In some embodiments, the modified internucleotidic linkage having the structure of formula I. A P-modification step of the present disclosure occurs during assembly of a provided oligonucleotide rather than after assembly of a provided oligonucleotide is complete. Thus, each nucleotide unit of a provided oligonucleotide can be individually modified at the linkage phosphorus during the cycle within which the nucleotide unit is installed.

In some embodiments, a suitable P-modification reagent is a sulfur electrophile, selenium electrophile, oxygen electrophile, boronating reagent, or an azide reagent.

For instance, in some embodiments, a selemium reagent is elemental selenium, a selenium salt, or a substituted diselenide. In some embodiments, an oxygen electrophile is elemental oxygen, peroxide, or a substituted peroxide. In some embodiments, a boronating reagent is a borane-amine (e.g., N,N-diisopropylethylamine (BH3.DIPEA), borane-pyridine (BH3.Py), borane-2-chloropyridine (BH3.CPy), borane-aniline (BH3.An)), a borane-ether reagent (e.g., borane-tetrahydrofuran (BH3-THF)), a borane-dialkylsulfide reagent (e.g., BH3.Me2S), aniline-cyanoborane, or a triphenylphosphine-carboalkoxyborane. In some embodiments, an azide reagent is comprises an azide group capable of undergoing subsequent reduction to provide an amine group.

In some embodiments, a P-modification reagent is a sulfurization reagent as described herein. In some embodiments, a step of modifying comprises sulfurization of phosphorus to provide a phosphorothioate linkage or phosphorothioate triester linkage. In some embodiments, a step of modifying provides an oligonucleotide having an internucleotidic linkage of formula I.

In some embodiments, the present disclosure provides sulfurizing reagents, and methods of making, and use of the same.

In some embodiments, such sulfurizing reagents are thiosulfonate reagents. In some embodiments, a thiosulfonate reagent has a structure of formula S-I:

wherein:

Rs1 is R; and

each of R, L and R1 is independently as defined and described above and herein.

In some embodiments, the sulfurizing reagent is a bis(thiosulfonate) reagent. In some embodiments, the bis(thiosulfonate) reagent has the structure of formula S-II:

wherein each of Rs1 and L is independently as defined and described above and herein.

As defined generally above, Rs1 is R, wherein R is as defined and described above and herein. In some embodiments, Rs1 is optionally substituted aliphatic, aryl, heterocyclyl or heteroaryl. In some embodiments, Rs1 is optionally substituted alkyl. In some embodiments, Rs1 is optionally substituted alkyl. In some embodiments, Rs1 is methyl. In some embodiments, Rs1 is cyanomethyl. In some embodiments, Rs1 is nitromethyl. In some embodiments, Rs1 is optionally substituted aryl. In some embodiments, Rs1 is optionally substituted phenyl. In some embodiments, Rs1 is phenyl. In some embodiments, Rs1 is p-nitrophenyl. In some embodiments, Rs1 is p-methylphenyl. In some embodiments, Rs1 is p-chlorophenyl. In some embodiments, Rs1 is o-chlorophenyl. In some embodiments, Rs1 is 2,4,6-trichlorophenyl. In some embodiments, Rs1 is pentafluorophenyl. In some embodiments, Rs1 is optionally substituted heterocyclyl. In some embodiments, Rs1 is optionally substituted heteroaryl.

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments,

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, Rs1—S(O)2S— is

In some embodiments, the sulfurizing reagent has the structure of S-I or S-II, wherein L is —S—RL3— or —S—C(O)—RL3—. In some embodiments, L is —S—RL3— or —S—C(O)—RL3—, wherein RL3 is an optionally substituted C1-C6 alkylene. In some embodiments, L is —S—RL3— or —S—C(O)—RL3—, wherein RL3 is an optionally substituted C1-C6 alkenylene. In some embodiments, L is —S—RL3— or —S—C(O)—RL3—, wherein RL3 is an optionally substituted C1-C6 alkylene wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkenylene, arylene, or heteroarylene. In some embodiments, In some embodiments, RL3 is an optionally substituted —S—(C1-C6 alkenylene)-, —S—(C1-C6 alkylene)-, —S—(C1-C6 alkylene)-arylene-(C1-C6 alkylene)-, —S—CO-arylene-(C1-C6 alkylene)-, or —S—CO—(C1-C6 alkylene)-arylene-(C1-C6 alkylene)-. In some embodiments, the sulfurizing reagent has the structure of S-I or S-II, wherein L is —S—RL3— or —S—C(O)—RL3—, and the sulfur atom is connected to R1.

In some embodiments, the sulfurizing reagent has the structure of S-I or S-II, wherein L is alkylene, alkenylene, arylene or heteroarylene.

In some embodiments, the sulfurizing reagent has the structure of S-I or S-II, wherein L is

In some embodiments, L is

wherein the sulfur atom is connected to R1.

In some embodiments, the sulfurizing reagent has the structure of S-I or S-II, wherein R1 is

In some embodiments, R1 is

wherein the sulfur atom is connected to L.

In some embodiments, the sulfurizing reagent has the structure of S-I or S-II, wherein L is

wherein the sulfur atom is connected to R1; and R1 is

wherein the sulfur atom is connected to L.

In some embodiments, the sulfurizing reagent has the structure of S-I or S-II, wherein R1 is —S—RL2, wherein RL2 is as defined and described above and herein. In some embodiments, RL2 is an optionally substituted group selected from —S—(C1-C6 alkylene)-heterocyclyl, —S—(C1-C6 alkenylene)-heterocyclyl, —S—(C1-C6 alkylene)-N(R′)2, —S—(C1-C6 alkylene)-N(R′)3, wherein each R′ is as defined above and described herein.

In some embodiments, -L-R1 is —RL3—S—S—RL2, wherein each variable is independently as defined above and described herein. In some embodiments, -L-R1 is —RL3—C(O)—S—S—RL2, wherein each variable is independently as defined above and described herein.

Example bis(thiosulfonate) reagents of formula S—II are depicted below:

In some embodiments, the sulfurization reagent is a compound having one of the following formulae:


Rs2—S—S—Rs3, or Rs2—S—Xs—Rs3,  S8,

wherein:

  • each of Rs2 and Rs3 is independently an optionally substituted group selected from aliphatic, aminoalkyl, carbocyclyl, heterocyclyl, heterocycloalkyl, aryl, heteroaryl, alkyloxy, aryloxy, heteroaryloxy, acyl, amide, imide, or thiocarbonyl; or
    • Rs2 and Rs3 are taken together with the atoms to which they are bound to form an optionally substituted heterocyclic or heteroaryl ring;
  • Xs is —S(O)2—, —O—, or —N(R′)—; and
  • R′ is as defined and described above and herein.

In some embodiments, the sulfurization reagent is S8,

In some embodiments, the sulfurization reagent is S8,

In some embodiments, the sulfurization reagent is

Example sulfuring reagents are depicted in Table 5 below.

TABLE 5 Example sulfurization reagents. S8 POS

In some embodiments, a provided sulfurization reagent is used to modify an H-phosphonate. For instance, in some embodiments, an H-phosphonate oligonucleotide is synthesized using, e.g., a method of Wada I or Wada II, and is modified using a sulfurization reagent of formula S-I or S-II:

wherein each of RS1, L, and R1 are as described and defined above and herein.

In some embodiments, the present disclosure provides a process for synthesizing a phosphorothioate triester, comprising steps of:

i) reacting an H-phosphonate of structure:

wherein each of W, Y, and Z are as described and defined above and herein, with a silylating reagent to provide a silyloxyphosphonate; and

ii) reacting the silyloxyphosphonate with a sulfurization reagent of structure S-I or S-II:

to provide a phosphorothiotriester.

In some embodiments, a selenium electrophile is used instead of a sulfurizing reagent to introduce modification to the internucleotidic linkage. In some embodiments, a selenium electrophile is a compound having one of the following formulae:


Rs2—Se—Se—Rs3, or Rs2—Se—Xs—Rs3,  Se,

wherein:

  • each of Rs2 and Rs3 is independently an optionally substituted group selected from aliphatic, aminoalkyl, carbocyclyl, heterocyclyl, heterocycloalkyl, aryl, heteroaryl, alkyloxy, aryloxy, heteroaryloxy, acyl, amide, imide, or thiocarbonyl; or
    • Rs2 and Rs3 are taken together with the atoms to which they are bound to form an optionally substituted heterocyclic or heteroaryl ring;
  • Xs is —S(O)2—, —O—, or —N(R′)—; and
  • R′ is as defined and described above and herein.

In other embodiments, the selenium electrophile is a compound of Se, KSeCN,

In some embodiments, the selenium electrophile is Se or

In some embodiments, a sulfurization reagent for use in accordance with the present disclosure is characterized in that the moiety transferred to phosphorus during sulfurization is a substituted sulfur (e.g., —SR) as opposed to a single sulfur atom (e.g., —S— or ═S).

In some embodiments, a sulfurization reagent for use in accordance with the present disclosure is characterized in that the activity of the reagent is tunable by modifying the reagent with a certain electron withdrawing or donating group.

In some embodiments, a sulfurization reagent for use in accordance with the present disclosure is characterized in that it is crystalline. In some embodiments, a sulfurization reagent for use in accordance with the present disclosure is characterized in that it has a high degree of crystallinity. In certain embodiments, a sulfurization reagent for use in accordance with the present disclosure is characterized by ease of purification of the reagent via, e.g., recrystallization. In certain embodiments, a sulfurization reagent for use in accordance with the present disclosure is characterized in that it is substantially free from sulfur-containing impurities. In some embodiments, sulfurization reagents which are substantially free from sulfur-containing impurities show increased efficiency.

In some embodiments, the provided chirally controlled oligonucleotide comprises one or more phosphate diester linkages. To synthesize such chirally controlled oligonucleotides, one or more modifying steps are optionally replaced with an oxidation step to install the corresponding phosphate diester linkages. In some embodiments, the oxidation step is performed in a fashion similar to ordinary oligonucleotide synthesis. In some embodiments, an oxidation step comprises the use of 12. In some embodiments, an oxidation step comprises the use of 12 and pyridine. In some embodiments, an oxidation step comprises the use of 0.02 M 12 in a THF/pyridine/water (70:20:10—v/v/v) co-solvent system. An example cycle is depicted in Scheme I-c.

In some embodiments, a phosphorothioate is directly formed through sulfurization by a sulfurization reagents, e.g., 3-phenyl-1,2,4-dithiazolin-5-one. In some embodiments, after a direct installation of a phosphorothioate, a chiral auxiliary group remains attached to the internucleotidic phosphorus atom. In some embodiments, an additional de-protecting step is required to remove the chiral auxiliary (e.g., for DPSE-type chiral auxiliary, using TBAF, HF-Et3N, etc.).

In some embodiments, a phosphorothioate precursor is used to synthesize chirally controlled oligonucleotides comprising phosphorothioate linkages. In some embodiments, such a phosphorothioate precursor is

In some embodiments,

is converted into phosphorothioate diester linkages during standard deprotection/release procedure after cycle exit. Examples are further depicted below.

In some embodiments, the provided chirally controlled oligonucleotide comprises one or more phosphate diester linkages and one or more phosphorothioate diester linkages. In some embodiments, the provided chirally controlled oligonucleotide comprises one or more phosphate diester linkages and one or more phosphorothioate diester linkages, wherein at least one phosphate diester linkage is installed after all the phosphorothioate diester linkages when synthesized from 3′ to 5′. To synthesize such chirally controlled oligonucleotides, in some embodiments, one or more modifying steps are optionally replaced with an oxidation step to install the corresponding phosphate diester linkages, and a phosphorothioate precursor is installed for each of the phosphorothioate diester linkages. In some embodiments, a phosphorothioate precursor is converted to a phosphorothioate diester linkage after the desired oligonucleotide length is achieved. In some embodiments, the deprotection/release step during or after cycle exit converts the phosphorothioate precursors into phosphorothioate diester linkages. In some embodiments, a phosphorothioate precursor is characterized in that it has the ability to be removed by a beta-elimination pathway. In some embodiments, a phosphorothioate precursor is

As understood by one of ordinary skill in the art, one of the benefits of using a phosphorothioate precursor, for instance,

during synthesis is that

is more stable than phosphorothioate in certain conditions.

In some embodiments, a phosphorothioate precursor is a phosphorus protecting group as described herein, e.g., 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl. Examples are further depicted below.

Methods for synthesizing a desired sulfurization reagent are described herein and in the examples section.

As noted above, in some embodiments, sulfurization occurs under conditions which cleave the chiral reagent from the growing oligonucleotide. In some embodiments, sulfurization occurs under conditions which do not cleave the chiral reagent from the growing oligonucleotide.

In some embodiments, a sulfurization reagent is dissolved in a suitable solvent and delivered to the column. In certain embodiments, the solvent is a polar aprotic solvent such as a nitrile solvent. In some embodiments, the solvent is acetonitrile. In some embodiments, a solution of sulfurization reagent is prepared by mixing a sulfurization reagent (e.g., a thiosulfonate derivative as described herein) with BSTFA (N,O-bis-trimethylsilyl-trifluoroacetamide) in a nitrile solvent (e.g., acetonitrile). In some embodiments, BSTFA is not included. For example, the present inventors have found that relatively more reactive sulfurization reagents of general formula Rs2—S—S(O)2—Rs3 can often successfully participate in sulfurization reactions in the absence of BSTFA. To give but one example, the inventors have demonstrated that where Rs2 is p-nitrophenyl and Rs3 is methyl then no BSTFA is required. In light of this disclosure, those skilled in the art will readily be able to determine other situations and/or sulfurization reagents that do not require BSTFA.

In some embodiments, the sulfurization step is performed at room temperature. In some embodiments, the sulfurization step is performed at lower temperatures such as about 0° C., about 5° C., about 10° C., or about 15° C. In some embodiments, the sulfurization step is performed at elevated temperatures of greater than about 20° C.

In some embodiments, a sulfurization reaction is run for about 1 minute to about 120 minutes. In some embodiments, a sulfurization reaction is run for about 1 minute to about 90 minutes. In some embodiments, a sulfurization reaction is run for about 1 minute to about 60 minutes. In some embodiments, a sulfurization reaction is run for about 1 minute to about 30 minutes. In some embodiments, a sulfurization reaction is run for about 1 minute to about 25 minutes. In some embodiments, a sulfurization reaction is run for about 1 minute to about 20 minutes. In some embodiments, a sulfurization reaction is run for about 1 minute to about 15 minutes. In some embodiments, a sulfurization reaction is run for about 1 minute to about 10 minutes. In some embodiments, a sulfurization reaction is run for about 5 minute to about 60 minutes.

In some embodiments, a sulfurization reaction is run for about 5 minutes. In some embodiments, a sulfurization reaction is run for about 10 minutes. In some embodiments, a sulfurization reaction is run for about 15 minutes. In some embodiments, a sulfurization reaction is run for about 20 minutes. In some embodiments, a sulfurization reaction is run for about 25 minutes. In some embodiments, a sulfurization reaction is run for about 30 minutes. In some embodiments, a sulfurization reaction is run for about 35 minutes. In some embodiments, a sulfurization reaction is run for about 40 minutes. In some embodiments, a sulfurization reaction is run for about 45 minutes. In some embodiments, a sulfurization reaction is run for about 50 minutes. In some embodiments, a sulfurization reaction is run for about 55 minutes. In some embodiments, a sulfurization reaction is run for about 60 minutes.

It was unexpectedly found that certain of the sulfurization modification products made in accordance with methods of the present disclosure are unexpectedly stable. In some embodiments, it the unexpectedly stable products are phosphorothioate triesters. In some embodiments, the unexpectedly stable products are chirally controlled oligonucleotides comprising one or more internucleotidic linkages having the structure of formula I-c.

One of skill in the relevant arts will recognize that sulfurization methods described herein and sulfurization reagents described herein are also useful in the context of modifying H-phosphonate oligonucleotides such as those described in Wada II (WO2010/064146).

In some embodiments, the sulfurization reaction has a stepwise sulfurization efficiency that is at least about 80%, 85%, 90%, 95%, 96%, 97%, or 98%. In some embodiments, the sulfurization reaction provides a crude dinucleotide product composition that is at least 98% pure. In some embodiments, the sulfurization reaction provides a crude tetranucleotide product composition that is at least 90% pure. In some embodiments, the sulfurization reaction provides a crude dodecanucleotide product composition that is at least 70% pure. In some embodiments, the sulfurization reaction provides a crude icosanucleotide product composition that is at least 50% pure.

Once the step of modifying the linkage phosphorus is complete, the oligonucleotide undergoes another deblock step in preparation for re-entering the cycle. In some embodiments, a chiral auxiliary remains intact after sulfurization and is deblocked during the subsequent deblock step, which necessarily occurs prior to re-entering the cycle. The process of deblocking, coupling, capping, and modifying, are repeated until the growing oligonucleotide reaches a desired length, at which point the oligonucleotide can either be immediately cleaved from the solid support or left attached to the support for purification purposes and later cleaved. In some embodiments, one or more protecting groups are present on one or more of the nucleotide bases, and cleaveage of the oligonucleotide from the support and deprotection of the bases occurs in a single step. In some embodiments, one or more protecting groups are present on one or more of the nucleotide bases, and cleaveage of the oligonucleotide from the support and deprotection of the bases occurs in more than one step. In some embodiments, deprotection and cleavage from the support occurs under basic conditions using, e.g., one or more amine bases. In certain embodiments, the one or more amine bases comprise propyl amine. In certain embodiments, the one or more amine bases comprise pyridine.

In some embodiments, cleavage from the support and/or deprotection occurs at elevated temperatures of about 30° C. to about 90° C. In some embodiments, cleavage from the support and/or deprotection occurs at elevated temperatures of about 40° C. to about 80° C. In some embodiments, cleavage from the support and/or deprotection occurs at elevated temperatures of about 50° C. to about 70° C. In some embodiments, cleavage from the support and/or deprotection occurs at elevated temperatures of about 60° C. In some embodiments, cleavage from the support and/or deprotection occurs at ambient temperatures.

Example purification procedures are described herein and/or are known generally in the relevant arts.

Noteworthy is that the removal of the chiral auxiliary from the growing oligonucleotide during each cycle is beneficial for at least the reasons that (1) the auxiliary will not have to be removed in a separate step at the end of the oligonucleotide synthesis when potentially sensitive functional groups are installed on phosphorus; and (2) unstable phosphorus-auxiliary intermediates prone to undergoing side reactions and/or interfering with subsequent chemistry are avoided. Thus, removal of the chiral auxiliary during each cycle makes the overall synthesis more efficient.

While the step of deblocking in the context of the cycle is described above, additional general methods are included below.

Deblocking Step

In some embodiments, the step of coupling is preceded by a step of deblocking. For instance, in some embodiments, the 5′ hydroxyl group of the growing oligonucleotide is blocked (i.e., protected) and must be deblocked in order to subsequently react with a nucleoside coupling partner.

In some embodiments, acidification is used to remove a blocking group. In some embodiments, the acid is a Brønsted acid or Lewis acid. Useful Brønsted acids are carboxylic acids, alkylsulfonic acids, arylsulfonic acids, phosphoric acid and its derivatives, phosphonic acid and its derivatives, alkylphosphonic acids and their derivatives, arylphosphonic acids and their derivatives, phosphinic acid, dialkylphosphinic acids, and diarylphosphinic acids which have a pKa (25° C. in water) value of −0.6 (trifluoroacetic acid) to 4.76 (acetic acid) in an organic solvent or water (in the case of 80% acetic acid). The concentration of the acid (1 to 80%) used in the acidification step depends on the acidity of the acid. Consideration to the acid strength must be taken into account as strong acid conditions will result in depurination/depyrimidination, wherein purinyl or pyrimidinyl bases are cleaved from ribose ring and or other sugar ring. In some embodiments, an acid is selected from Ra1COOH, Ra1SO3H, Ra3SO3H,

wherein each of Ra1 and Ra2 is independently hydrogen or an optionally substituted alkyl or aryl, and Ra3 is an optionally substituted alkyl or aryl.

In some embodiments, acidification is accomplished by a Lewis acid in an organic solvent. Examples of such useful Lewis acids are Zn(Xa)2 wherein Xa is Cl, Br, I, or CF3SO3.

In some embodiments, the step of acidifying comprises adding an amount of a Brønsted or Lewis acid effective to remove a blocking group without removing purine moieties from the condensed intermediate.

Acids that are useful in the acidifying step also include, but are not limited to 10% phosphoric acid in an organic solvent, 10% hydrochloric acid in an organic solvent, 1% trifluoroacetic acid in an organic solvent, 3% dichloroacetic acid or trichloroacetic acid in an organic solvent or 80% acetic acid in water. The concentration of any Brønsted or Lewis acid used in this step is selected such that the concentration of the acid does not exceed a concentration that causes cleavage of a nucleobase from a sugar moiety.

In some embodiments, acidification comprises adding 1% trifluoroacetic acid in an organic solvent. In some embodiments, acidification comprises adding about 0.1% to about 8% trifluoroacetic acid in an organic solvent. In some embodiments, acidification comprises adding 3% dichloroacetic acid or trichloroacetic acid in an organic solvent. In some embodiments, acidification comprises adding about 0.1% to about 10% dichloroacetic acid or trichloroacetic acid in an organic solvent. In some embodiments, acidification comprises adding 3% trichloroacetic acid in an organic solvent. In some embodiments, acidification comprises adding about 0.1% to about 10% trichloroacetic acid in an organic solvent. In some embodiments, acidification comprises adding 80% acetic acid in water. In some embodiments, acidification comprises adding about 50% to about 90%, or about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 70% to about 90% acetic acid in water. In some embodiments, the acidification comprises the further addition of cation scavengers to an acidic solvent. In certain embodiments, the cation scavengers can be triethylsilane or triisopropylsilane. In some embodiments, a blocking group is deblocked by acidification, which comprises adding 1% trifluoroacetic acid in an organic solvent. In some embodiments, a blocking group is deblocked by acidification, which comprises adding 3% dichloroacetic acid in an organic solvent. In some embodiments, a blocking group is deblocked by acidification, which comprises adding 3% trichloroacetic acid in an organic solvent. In some embodiments, a blocking group is deblocked by acidification, which comprises adding 3% trichloroacetic acid in dichloromethane.

In certain embodiments, methods of the present disclosure are completed on a synthesizer and the step of deblocking the hydroxyl group of the growing oligonucleotide comprises delivering an amount solvent to the synthesizer column, which column contains a solid support to which the oligonucleotide is attached. In some embodiments, the solvent is a halogenated solvent (e.g., dichloromethane). In certain embodiments, the solvent comprises an amount of an acid. In some embodiments, the solvent comprises an amount of an organic acid such as, for instance, trichloroacetic acid. In certain embodiments, the acid is present in an amount of about 1% to about 20% w/v. In certain embodiments, the acid is present in an amount of about 1% to about 10% w/v. In certain embodiments, the acid is present in an amount of about 1% to about 5% w/v. In certain embodiments, the acid is present in an amount of about 1 to about 3% w/v. In certain embodiments, the acid is present in an amount of about 3% w/v. Methods for deblocking a hydroxyl group are described further herein. In some embodiments, the acid is present in 3% w/v is dichloromethane.

In some embodiments, the chiral auxiliary is removed before the deblocking step. In some embodiments, the chiral auxiliary is removed during the deblocking step.

In some embodiments, cycle exit is performed before the deblocking step. In some embodiments, cycle exit is preformed after the deblocking step.

General Conditions for Blocking Group/Protecting Group Removal

Functional groups such as hydroxyl or amino moieties which are located on nucleobases or sugar moieties are routinely blocked with blocking (protecting) groups (moieties) during synthesis and subsequently deblocked. In general, a blocking group renders a chemical functionality of a molecule inert to specific reaction conditions and can later be removed from such functionality in a molecule without substantially damaging the remainder of the molecule (see e.g., Green and Wuts, Protective Groups in Organic Synthesis, 2nd Ed., John Wiley & Sons, New York, 1991). For example, amino groups can be blocked with nitrogen blocking groups such as phthalimido, 9-fluorenylmethoxycarbonyl (FMOC), triphenylmethylsulfenyl, t-BOC, 4,4′-dimethoxytrityl (DMTr), 4-methoxytrityl (MMTr), 9-phenylxanthin-9-yl (Pixyl), trityl (Tr), or 9-(p-methoxyphenyl)xanthin-9-yl (MOX). Carboxyl groups can be protected as acetyl groups. Hydroxy groups can be protected such as tetrahydropyranyl (THP), t-butyldimethylsilyl (TBDMS), 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (Ctmp), 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp), 1-(2-chloroethoxy)ethyl, 3-methoxy-1,5-dicarbomethoxypentan-3-yl (MDP), bis(2-acetoxyethoxy)methyl (ACE), triisopropylsilyloxymethyl (TOM), 1-(2-cyanoethoxy)ethyl (CEE), 2-cyanoethoxymethyl (CEM), [4-(N-dichloroacetyl-N-methylamino)benzyloxy]methyl, 2-cyanoethyl (CN), pivaloyloxymethyl (PivOM), levunyloxymethyl (ALE). Other representative hydroxyl blocking groups have been described (see e.g., Beaucage et al., Tetrahedron, 1992, 46, 2223). In some embodiments, hydroxyl blocking groups are acid-labile groups, such as the trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 9-phenylxanthin-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthin-9-yl (MOX). Chemical functional groups can also be blocked by including them in a precursor form. Thus an azido group can be considered a blocked form of an amine as the azido group is easily converted to the amine. Further representative protecting groups utilized in nucleic acid synthesis are known (see e.g. Agrawal et al., Protocols for Oligonucleotide Conjugates, Eds., Humana Press, New Jersey, 1994, Vol. 26, pp. 1-72).

Various methods are known and used for removal of blocking groups from nucleic acids. In some embodiments, all blocking groups are removed. In some embodiments, a portion of blocking groups are removed. In some embodiments, reaction conditions can be adjusted to selectively remove certain blocking groups.

In some embodiments, nucleobase blocking groups, if present, are cleavable with an acidic reagent after the assembly of a provided oligonucleotide. In some embodiment, nucleobase blocking groups, if present, are cleavable under neither acidic nor basic conditions, e.g. cleavable with fluoride salts or hydrofluoric acid complexes. In some embodiments, nucleobase blocking groups, if present, are cleavable in the presence of base or a basic solvent after the assembly of a provided oligonucleotide. In certain embodiments, one or more of the nucleobase blocking groups are characterized in that they are cleavable in the presence of base or a basic solvent after the assembly of a provided oligonucleotide but are stable to the particular conditions of one or more earlier deprotection steps occurring during the assembly of the provided oligonucleotide.

In some embodiments, blocking groups for nucleobases are not required. In some embodiments, blocking groups for nucleobases are required. In some embodiments, certain nucleobases require one or more blocking groups while other nucleobases do not require one or more blocking groups.

In some embodiments, the oligonucleotide is cleaved from the solid support after synthesis. In some embodiments, cleavage from the solid support comprises the use of propylamine. In some embodiments, cleavage from the solid support comprises the use of propylamine in pyridine. In some embodiments, cleavage from the solid support comprises the use of 20% propylamine in pyridine. In some embodiments, cleavage from the solid support comprises the use of propylamine in anhydrous pyridine. In some embodiments, cleavage from the solid support comprises the use of 20% propylamine in anhydrous pyridine. In some embodiments, cleavage from the solid support comprises use of a polar aprotic solvent such as acetonitrile, NMP, DMSO, sulfone, and/or lutidine. In some embodiments, cleavage from the solid support comprises use of solvent, e.g., a polar aprotic solvent, and one or more primary amines (e.g., a C1-10 amine), and/or one or more of methoxylamine, hydrazine, and pure anhydrous ammonia.

In some embodiments, deprotection of oligonucleotide comprises the use of propylamine. In some embodiments, deprotection of oligonucleotide comprises the use of propylamine in pyridine. In some embodiments, deprotection of oligonucleotide comprises the use of 20% propylamine in pyridine. In some embodiments deprotection of oligonucleotide comprises the use of propylamine in anhydrous pyridine. In some embodiments, deprotection of oligonucleotide comprises the use of 20% propylamine in anhydrous pyridine.

In some embodiments, the oligonucleotide is deprotected during cleavage.

In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at about room temperature. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at elevated temperature. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at above about 30° C., 40° C., 50° C., 60° C., 70° C., 80° C. 90° C. or 100° C. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at about 30° C., 40° C., 50° C., 60° C., 70° C., 80° C. 90° C. or 100° C. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at about 40-80° C. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at about 50-70° C. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at about 60° C.

In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for more than 0.1 hr, 1 hr, 2 hrs, 5 hrs, 10 hrs, 15 hrs, 20 hrs, 24 hrs, 30 hrs, or 40 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 0.1-5 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 3-10 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 5-15 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 10-20 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 15-25 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 20-40 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 2 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 5 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 10 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 15 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 18 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed for about 24 hrs.

In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at room temperature for more than 0.1 hr, 1 hr, 2 hrs, 5 hrs, 10 hrs, 15 hrs, 20 hrs, 24 hrs, 30 hrs, or 40 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at room temperature for about 5-48 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at room temperature for about 10-24 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at room temperature for about 18 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at elevated temperature for more than 0.1 hr, 1 hr, 2 hrs, 5 hrs, 10 hrs, 15 hrs, 20 hrs, 24 hrs, 30 hrs, or 40 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at elevated temperature for about 0.5-5 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at about 60° C. for about 0.5-5 hrs. In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide, is performed at about 60° C. for about 2 hrs.

In some embodiments, cleavage of oligonucleotide from solid support, or deprotection of oligonucleotide comprises the use of propylamine and is performed at room temperature or elevated temperature for more than 0.1 hr, 1 hr, 2 hrs, 5 hrs, 10 hrs, 15 hrs, 20 hrs, 24 hrs, 30 hrs, or 40 hrs. Example conditions are 20% propylamine in pyridine at room temperature for about 18 hrs, and 20% propylamine in pyridine at 60° C. for about 18 hrs,

In some embodiments, prior to cleavage from solid support, a step is performed to remove a chiral auxiliary group, if one is still attached to an internucleotidic phosphorus atom. In some embodiments, for example, one or more DPSE type chiral auxiliary groups remain attached to internucleotidic phosphorus atoms during the oligonucleotide synthesis cycle. Suitable conditions for removing remaining chiral auxiliary groups are widely known in the art, e.g., those described in Wada I, Wada II, Wada III, Chiral Control, etc. In some embodiments, a condition for removing DPSE type chiral auxiliary is TBAF or HF-Et3N, e.g., 0.1M TBAF in MeCN, 0.5M HF-Et3N in THF or MeCN, etc. In some embodiments, the present disclosure recognizes that a linker may be cleaved during the process of removing a chiral auxiliary group. In some embodiments, the present disclosure provides linkers, such as the SP linker, that provides better stability during chiral auxiliary group removal. Among other things, certain linkers provided by the present disclosure provided improved yield and/or purity.

In some embodiments, an activator is a “Wada” activator, i.e., the activator is from any one of Wada I, II, or III documents cited above.

Example activating groups are depicted below:

In some embodiments, an activating reagent is selected from

In some embodiments, an example cycle is depicted in Scheme I-b.

In some embodiments, an example cycle is illustrated in Scheme I-c.

In Scheme I-c, oligonucleotide (or nucleotide, or oligonucleotide with modified internucleotidic linkage) on solid support (C-1) is coupled with phosphoramidite C-2. After coupling and capping, an oxidation step is performed. After deblocking, a phosphate diester linkage is formed. The cycle product C-3 can either re-enter cycle C to install more phosphate diester linkage, or enter other cycles to install other types of internucleotidic linkages, or go to cycle exit.

In some embodiments, non-chirally pure phosphoramidite can be used instead of C-2 in Scheme I-c. In some embodiments, β-cyanoethylphosphoramidites protected with DMTr is used. In some embodiments, the phosphoramidite being used has the structure of

In some embodiments, the use of a phosphorothioate diester precursor increases the stability of oligonucleotide during synthesis. In some embodiments, the use of a phosphorothioate diester precursor improves the efficiency of chirally controlled oligonucleotide synthesis. In some embodiments, the use of a phosphorothioate diester precursor improves the yield of chirally controlled oligonucleotide synthesis. In some embodiments, the use of a phosphorothioate diester precursor improves the product purity of chirally controlled oligonucleotide synthesis.

In some embodiments, the phosphorothioate diester precursor in the above-mentioned methods is

In some embodiments,

is converted to a phosphorothioate diester linkage during deprotection/release. In some embodiments, an example cycle is depicted in Scheme I-d. More examples are depicted below.

As illustrated in Scheme I-d, both phosphorothioate and phosphate diester linkages can be incorporated into the same chirally controlled oligonucleotide. As understood by a person of ordinary skill in the art, the provided methods do not require that the phosphorothioate diester and the phosphate diester to be consecutive—other internucleotidic linkages can form between them using a cycle as described above. In Scheme I-d, phosphorothioate diester precursors,

are installed in place of the phosphorothioate diester linkages. In some embodiments, such replacement provided increased synthesis efficiency during certain steps, for instance, the oxidation step. In some embodiments, the use of phosphorothioate diester precursors generally improve the stability of chirally controlled oligonucleotides during synthesis and/or storage. After cycle exit, during deprotection/release, the phosphorothioate diester precursor is converted to phosphorothioate diester linkage. In some embodiments, it is beneficial to use phosphorothioate diester precursor even when no phosphate diester linkage is present in the chirally controlled oligonucleotide, or no oxidation step is required during synthesis.

As in Scheme I-c, in some embodiments, non-chirally pure phosphoramidite can be used for cycles comprising oxidation steps. In some embodiments, β-cyanoethylphosphoramidites protected with DMTr is used. In some embodiments, the phosphoramidite being used has the structure of

In some embodiments, methods of the present disclosure provide chirally controlled oligonucleotide compositions that are enriched in a particular oligonucleotide type.

In some embodiments, at least about 10% of a provided crude composition is of a particular oligonucleotide type. In some embodiments, at least about 20% of a provided crude composition is of a particular oligonucleotide type. In some embodiments, at least about 30% of a provided crude composition is of a particular oligonucleotide type. In some embodiments, at least about 40% of a provided crude composition is of a particular oligonucleotide type. In some embodiments, at least about 50% of a provided crude composition is of a particular oligonucleotide type. In some embodiments, at least about 60% of a provided crude composition is of a particular oligonucleotide type. In some embodiments, at least about 70% of a provided crude composition is of a particular oligonucleotide type. In some embodiments, at least about 80% of a provided crude composition is of a particular oligonucleotide type. In some embodiments, at least about 90% of a provided crude composition is of a particular oligonucleotide type. In some embodiments, at least about 95% of a provided crude composition is of a particular oligonucleotide type.

In some embodiments, at least about 1% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 2% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 3% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 4% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 5% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 10% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 20% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 30% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 40% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 50% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 60% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 70% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 80% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 90% of a provided composition is of a particular oligonucleotide type. In some embodiments, at least about 95% of a provided composition is of a particular oligonucleotide type.

In some embodiments, an example cycle is depicted in Scheme I-e, below.

In some embodiments, X is H or a 2′-modification. In some embodiments, X is H or —OR1, wherein R1 is not hydrogen. In some embodiments, X is H or —OR1, wherein R1 is optionally substituted C1-6 alkyl. In some embodiments, X is H. In some embodiments, X is —OMe. In some embodiments, X is —OCH2CH2OCH3. In some embodiments, X is —F.

In some embodiments, an example cycle is depicted in Scheme I-f.

In some embodiments, X is H or a 2′-modification. In some embodiments, X is H or —OR1, wherein R1 is not hydrogen. In some embodiments, X is H or —OR1, wherein R1 is optionally substituted C1-6 alkyl. In some embodiments, X is H. In some embodiments, X is —OMe. In some embodiments, X is —OCH2CH2OCH3. In some embodiments, X is —F.

It is understood by a person having ordinary skill in the art that different types of cycles may be combined to provide complete control of the chemical modifications and stereochemistry of oligonucleotides. In some embodiments, for example, an oligonucleotide synthesis process may contain one or more Cycles A-F. In some embodiments, a provided method comprises at least one cycle using a DPSE-type chiral auxiliary.

In some embodiments, the present disclosure provides methods for preparing provided oligonucleotide and oligonucleotide compositions. In some embodiments, a provide methods comprising providing a provided chiral reagent having the structure of

wherein W1 is —NG5, W2 is O, each of G1 and G3 is independently hydrogen or an optionally substituted group selected from C1-10 aliphatic, heterocyclyl, heteroaryl and aryl, G2 is —C(R)2Si(R)3, and G4 and G5 are taken together to form an optionally substituted saturated, partially unsaturated or unsaturated heteroatom-containing ring of up to about 20 ring atoms which is monocyclic or polycyclic, fused or unfused, wherein each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl. In some embodiments, a provided chiral reagent has the structure of

In some embodiments, a provided methods comprises providing a phosphoramidite comprising a moiety from a chiral reagent having the structure of

wherein —W1H and —W2H, or the hydroxyl and amino groups, form bonds with the phosphorus atom of the phosphoramidite. In some embodiments, —W1H and —W2H, or the hydroxyl and amino groups, form bonds with the phosphorus atom of the phosphoramidite, e.g., in

In some embodiments, a phosphoramidite has the structure of

In some embodiments, R is a protection group. In some embodiments, R is DMTr. In some embodiments, G2 is —C(R)2Si(R)3, wherein —C(R)2— is optionally substituted —CH2—, and each R of —Si(R)3 is independently an optionally substituted group selected from C1-10 aliphatic, heterocyclyl, heteroaryl and aryl. In some embodiments, at least one R of —Si(R)3 is independently optionally substituted C1-10 alkyl. In some embodiments, at least one R of —Si(R)3 is independently optionally substituted phenyl. In some embodiments, one R of —Si(R)3 is independently optionally substituted phenyl, and each of the other two R is independently optionally substituted C1-10 alkyl. In some embodiments, one R of —Si(R)3 is independently optionally substituted C1-10 alkyl, and each of the other two R is independently optionally substituted phenyl. In some embodiments, G2 is optionally substituted —CH2Si(Ph)(Me)2. In some embodiments, G2 is optionally substituted —CH2Si(Me)(Ph)2. In some embodiments, G2 is —CH2Si(Me)(Ph)2. In some embodiments, G4 and G5 are taken together to form an optionally substituted saturated 5-6 membered ring containing one nitrogen atom (to which G5 is attached). In some embodiments, G4 and G5 are taken together to form an optionally substituted saturated 5-membered ring containing one nitrogen atom. In some embodiments, G1 is hydrogen. In some embodiments, G3 is hydrogen. In some embodiments, both G1 and G3 are hydrogen. In some embodiments, both G1 and G3 are hydrogen, G2 is —C(R)2Si(R)3, wherein —C(R)2— is optionally substituted —CH2—, and each R of —Si(R)3 is independently an optionally substituted group selected from C1-10 aliphatic, heterocyclyl, heteroaryl and aryl, and G4 and G5 are taken together to form an optionally substituted saturated 5-membered ring containing one nitrogen atom. In some embodiments, a provided method further comprises providing a fluoro-containing reagent. In some embodiments, a provided fluoro-containing reagent removes a chiral reagent, or a product formed from a chiral reagent, from oligonucleotides after synthesis. Various known fluoro-containing reagents, including those F sources for removing —SiR3 groups, can be utilized in accordance with the present disclosure, for example, TBAF, HF3-Et3N etc. In some embodiments, a fluoro-containing reagent provides better results, for example, shorter treatment time, lower temperature, less desulfurization, etc, compared to traditional methods, such as concentrated ammonia. In some embodiments, for certain fluoro-containing reagent, the present disclosure provides linkers for improved results, for example, less cleavage of oligonucleotides from support during removal of chiral reagent (or product formed therefrom during oligonucleotide synthesis). In some embodiments, a provided linker is an SP linker. In some embodiments, the present disclosure demonstrated that a HF-base complex can be utilized, such as HF—NR3, to control cleavage during removal of chiral reagent (or product formed therefrom during oligonucleotide synthesis). In some embodiments, HF—NR3 is HF—NEt3. In some embodiments, HF—NR3 enables use of traditional linkers, e.g., succinyl linker.

Biological Applications and Example of Use

Among other things, the present disclosure recognizes that properties and activities of an oligonucleotide can be adjusted by optimizing its pattern of backbone chiral centers through the use of provided chirally controlled oligonucleotide compositions. In some embodiments, the present disclosure provides chirally controlled oligonucleotide compositions, wherein the oligonucleotides have a common pattern of backbone chiral centers which enhances their stability and/or biological activity. In some embodiments, a pattern of backbone chiral centers provides unexpectedly increased stability. In some embodiments, a pattern of backbone chiral centers, surprisingly, provides greatly increased activity. In some embodiments, a pattern of backbone chiral centers provides both increased stability and activity. In some embodiments, when an oligonucleotide is utilized to cleave a nucleic acid polymer, a pattern of backbone chiral centers of the oligonucleotide, surprisingly by itself, changes the cleavage pattern of a target nucleic acid polymer. In some embodiments, a pattern of backbone chiral centers effectively prevents cleavage at secondary sites. In some embodiments, a pattern of backbone chiral centers creates new cleavage sites. In some embodiments, a pattern of backbone chiral centers minimizes the number of cleavage sites. In some embodiments, a pattern of backbone chiral centers minimizes the number of cleavage sites so that a target nucleic acid polymer is cleaved at only one site within the sequence of the target nucleic acid polymer that is complementary to the oligonucleotide. In some embodiments, a pattern of backbone chiral centers enhances cleavage efficiency at a cleavage site. In some embodiments, a pattern of backbone chiral centers of the oligonucleotide improves cleavage of a target nucleic acid polymer. In some embodiments, a pattern of backbone chiral centers increases selectivity. In some embodiments, a pattern of backbone chiral centers minimizes off-target effect. In some embodiments, a pattern of backbone chiral centers increase selectivity, e.g., cleavage selectivity among target sequences differing by point mutations or single nucleotide polymorphisms (SNPs). In some embodiments, a pattern of backbone chiral centers increase selectivity, e.g., cleavage selectivity among target sequences differing by only one point mutation or single nucleotide polymorphism (SNP).

Among other things, it is surprisingly found that certain provided oligonucleotide compositions achieve unprecedented control of cleavage of target sequences, e.g., cleavage of target RNA by RNase H. In some embodiments, the present disclosure demonstrates that precise control of chemical and stereochemical attributes of oligonucleotides achieves improved activity of oligonucleotide preparations as compared with otherwise comparable preparations for which stereochemical attributes are not controlled. Among other things, the present disclosure specifically demonstrates improved rate, degree, and or specificity of cleavage of nucleic acid targets to which provided oligonucleotides hybridize.

In some embodiments, the present disclosure provides various uses of oligonucleotide compositions. Among other things, the present disclosure demonstrates that by controlling structural elements of oligonucleotides, such as base sequence, chemical modifications, stereochemistry, etc., properties of oligonucleotides can be greatly improved. For example, in some embodiments, the present disclosure provides methods for highly selective suppression of transcripts of a target nucleic acid sequence. In some embodiments, the present disclosure provides methods for treating a subject by suppressing transcripts from a diseasing-causing copy (e.g., a disease-causing allele). In some embodiments, the present disclosure provides methods for designing and preparing oligonucleotide compositions with surprisingly enhanced activity and/or selectivity when suppressing a transcript of a target sequence. In some embodiments, the present disclosure provides methods for designing and/or preparing oligonucleotide compositions which provide allele-specific suppression of a transcript from a target nucleic acid sequence.

In some embodiments, the present disclosure provides a method for controlled cleavage of a nucleic acid polymer, the method comprising steps of:

contacting a nucleic acid polymer whose nucleotide sequence comprises a target sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to a target sequence found in the nucleic acid polymer;
    • 2) a common pattern of backbone linkages; and
    • 3) a common pattern of backbone chiral centers;
      which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of the particular oligonucleotide type.

In some embodiments, the present disclosure provides a method for altering a cleavage pattern observed when a nucleic acid polymer whose nucleotide sequence includes a target sequence is contacted with a reference oligonucleotide composition that comprises oligonucleotides having a particular base sequence and length, which particular base sequence is or comprises a sequence that is complementary to the target sequence, the method comprising:

contacting the nucleic acid polymer with a chirally controlled oligonucleotide composition of oligonucleotides having the particular base sequence and length, which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of a single oligonucleotide type characterized by:

    • 1) the particular base sequence and length;
    • 2) a particular pattern of backbone linkages; and
    • 3) a particular pattern of backbone chiral centers.

In some embodiments, the present disclosure provides a method for controlled cleavage of a nucleic acid polymer, comprising providing a chirally controlled oligonucleotide composition comprising oligonucleotides defined by having:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to a sequence found in the nucleic acid polymer;
    • 2) a common pattern of backbone linkages;
    • 3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that at least about 10% of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers; and
      wherein the nucleic acid polymer is cleaved in a cleavage pattern that is different than the cleavage pattern when chirally uncontrolled oligonucleotide composition is provided.

As used herein, a cleavage pattern of a nucleic acid polymer is defined by the number of cleavage sites, the locations of the cleavage sites, and the percentage of cleavage at each sites. In some embodiments, a cleavage pattern has multiple cleavage sites, and the percentage of cleavage at each site is different. In some embodiments, a cleavage pattern has multiple cleavage sites, and the percentage of cleavage at each site is the same. In some embodiments, a cleavage pattern has only one cleavage site. In some embodiments, cleavage patterns differ from each other in that they have different numbers of cleavage sites. In some embodiments, cleavage patterns differ from each other in that at least one cleavage location is different. In some embodiments, cleavage patterns differ from each other in that the percentage of cleavage at least one common cleavage site is different. In some embodiments, cleavage patterns differ from each other in that they have different numbers of cleavage sites, and/or at least one cleavage location is different, and/or the percentage of cleavage at least one common cleavage site is different.

In some embodiments, the present disclosure provides a method for controlled cleavage of a nucleic acid polymer, the method comprising steps of:

contacting a nucleic acid polymer whose nucleotide sequence comprises a target sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to a target sequence found in the nucleic acid polymer;
    • 2) a common pattern of backbone linkages; and
    • 3) a common pattern of backbone chiral centers;
      which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of the particular oligonucleotide type, the contacting being performed under conditions so that cleavage of the nucleic acid polymer occurs.

In some embodiments, the present disclosure provides a method for changing a first cleavage pattern of a nucleic acid polymer resulted from using a first oligonucleotide composition, comprising providing a second chirally controlled oligonucleotide composition comprising oligonucleotides defined by having:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to a sequence found in the nucleic acid polymer;
    • 2) a common pattern of backbone linkages;
    • 3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that at least about 10% of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers; and
      wherein the nucleic acid polymer is cleaved in a cleavage pattern that is different than the first cleavage pattern.

In some embodiments, the present disclosure provides a method for altering a cleavage pattern observed when a nucleic acid polymer whose nucleotide sequence includes a target sequence is contacted with a reference oligonucleotide composition that comprises oligonucleotides having a particular base sequence and length, which particular base sequence is or comprises a sequence that is complementary to the target sequence, the method comprising:

contacting the nucleic acid polymer with a chirally controlled oligonucleotide composition of oligonucleotides having the particular base sequence and length, which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of a single oligonucleotide type characterized by:

1) the particular base sequence and length;

2) a particular pattern of backbone linkages; and

3) a particular pattern of backbone chiral centers,

the contacting being performed under conditions so that cleavage of the nucleic acid polymer occurs.

In some embodiments, a provided chirally controlled oligonucleotide composition reduces the number of cleavage sites within the target sequence. In some embodiments, a provided chirally controlled oligonucleotide composition provides single-site cleavage within the target sequence. In some embodiments, a chirally controlled oligonucleotide composition provides enhanced cleavage rate at a cleavage site within the target sequence. In some embodiments, a chirally controlled oligonucleotide composition provides enhanced efficiency at a cleavage site within the target sequence. In some embodiments, a chirally controlled oligonucleotide composition provides increased turn-over in cleaving a target nucleic acid polymer. In some embodiments, a chirally controlled oligonucleotide composition increase percentage of cleavage at a site within or in the vicinity of a characteristic sequence element. In some embodiments, a chirally controlled oligonucleotide composition increase percentage of cleavage at a site in the vicinity of a mutation. In some embodiments, a chirally controlled oligonucleotide composition increase percentage of cleavage at a site in the vicinity of a SNP. Example embodiments of a site within or in the vicinity of a characteristic sequence element, in the vicinity of a mutation, in the vicinity of a SNP, are described in the present disclosure. For example, in some embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away from a mutation; in some other embodiments, a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away from a SNP.

In some embodiments, cleavage occurs with a cleavage pattern differs from a reference cleavage pattern. In some embodiments, a reference cleavage pattern is one observed when a nucleic acid polymer is contacted under comparable conditions with a reference oligonucleotide composition. In some embodiments, a reference oligonucleotide composition is a chirally uncontrolled (e.g., stereorandom) oligonucleotide composition of oligonucleotides that share the common base sequence and length of a chirally controlled oligonucleotide composition. In some embodiments, a reference oligonucleotide composition is a substantially racemic preparation of oligonucleotides that share the common sequence and length.

In some embodiments, a nucleic acid polymer is RNA. In some embodiments, a nucleic acid polymer is an oligonucleotide. In some embodiments, a nucleic acid polymer is an RNA oligonucleotide. In some embodiments, a nucleic acid polymer is a transcript. In some embodiments, oligonucleotides of a provided chirally controlled oligonucleotide composition form duplexes with a nucleic acid polymer to be cleaved.

In some embodiments, a nucleic acid polymer is cleaved by an enzyme. In some embodiments, an enzyme cleaves a duplex formed by a nucleic acid polymer. In some embodiments, an enzyme is RNase H. In some embodiments, an enzyme is Dicer. In some embodiments, an enzyme is an Argonaute protein. In some embodiments, an enzyme is Ago2. In some embodiments, an enzyme is within a protein complex. An example protein complex is RNA-induced silencing complex (RISC).

In some embodiments, a provided chirally controlled oligonucleotide composition comprising oligonucleotides with a common pattern of backbone chiral centers provides unexpectedly high selectivity so that nucleic acid polymers that have only small sequence variations within a target region can be selectively targeted. In some embodiments, a nucleic acid polymer is a transcript from an allele. In some embodiments, transcripts from different alleles can be selectively targeted by provided chirally controlled oligonucleotide compositions.

In some embodiments, provided chirally controlled oligonucleotide compositions and methods thereof enables precise control of cleavage sites within a target sequence. In some embodiments, a cleavage site is around a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is upstream of and near a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 5 base pairs upstream of a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 4 base pairs upstream of a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 3 base pairs upstream of a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 2 base pairs upstream of a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 1 base pair upstream of a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is downstream of and near a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 5 base pairs downstream of a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 4 base pairs downstream of a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 3 base pairs downstream of a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 2 base pairs downstream of a sequence of RpSpSp backbone chiral centers. In some embodiments, a cleavage site is within 1 base pair downstream of a sequence of RpSpSp backbone chiral centers. Among other things, the present disclosure therefore provides control of cleavage sites with in a target sequence. In some embodiments, an example cleavage is depicted in FIG. 21. In some embodiments, cleavage depicted in FIG. 21 is designated as cleavage at a site two base pairs downstream a sequence of RpSpSp backbone chiral centers. As extensively described in the present disclosure, a sequence of RpSpSp backbone chiral centers can be found in a single or repeating units of (Np)m(Rp)n(Sp)t, (Np)t(Rp)n(Sp)m, (Sp)m(Rp)n(Sp)t, (Sp)t(Rp)n(Sp)m, (Rp)n(Sp)m, (Rp)m(Sp)n, (Sp)mRp and/or Rp(Sp)m, each of which is independently as defined above and described herein. In some embodiments, a provided chirally controlled oligonucleotide composition creates a new cleavage site 2 base pairs downstream of RpSpSp backbone chiral centers in a target molecule (e.g., see FIG. 21), wherein said new cleavage site does not exist if a reference (e.g., chirally uncontrolled) oligonucleotide composition is used (cannot be detected). In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a cleavage site 2 base pairs downstream of RpSpSp backbone chiral centers in a target molecule (e.g., see FIG. 21), wherein cleavage at such a site occurs at a higher percentage than when a reference (e.g., chirally uncontrolled) oligonucleotide composition is used. In some embodiments, cleavage at such a site by a provided chirally controlled oligonucleotide composition is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500 or 1000 fold of that by a reference oligonucleotide composition (for example, when measured by percentage of cleavage at a site). In some embodiments, a provided chirally controlled oligonucleotide composition provides accelerated cleavage at a cleavage site 2 base pairs downstream of RpSpSp backbone chiral centers in a target molecule (e.g., see FIG. 21), compared to when a reference (e.g., chirally uncontrolled) oligonucleotide composition is used. In some embodiments, cleavage by a provided chirally controlled oligonucleotide composition is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500 or 1000 fold faster than that by a reference oligonucleotide composition. In some embodiments, a cleavage site of a provided chirally controlled oligonucleotide composition 2 base pairs downstream of RpSpSp backbone chiral centers in a target molecule (e.g., see FIG. 21) is a cleavage site when a reference (e.g., chirally uncontrolled) oligonucleotide composition is used. In some embodiments, a cleavage site of a provided chirally controlled oligonucleotide composition 2 base pairs downstream of RpSpSp backbone chiral centers in a target molecule (e.g., see FIG. 21) is within one base pair of a cleavage site when a reference (e.g., chirally uncontrolled) oligonucleotide composition is used. In some embodiments, a cleavage site of a provided chirally controlled oligonucleotide composition 2 base pairs downstream of RpSpSp backbone chiral centers in a target molecule (e.g., see FIG. 21) is within 2 base pairs of a cleavage site when a reference (e.g., chirally uncontrolled) oligonucleotide composition is used. In some embodiments, it is within 3 base pairs. In some embodiments, it is within 4 base pairs. In some embodiments, it is within 5 base pairs. In some embodiments, a cleavage site of a provided chirally controlled oligonucleotide composition 2 base pairs downstream of RpSpSp backbone chiral centers in a target molecule is one of the major cleavage sites when a reference (e.g., chirally uncontrolled) oligonucleotide composition is used. In some embodiments, such a site is the cleavage site with the highest cleavage percentage when a reference (e.g., chirally uncontrolled) oligonucleotide composition is used. In some embodiments, a cleavage site of a provided chirally controlled oligonucleotide composition 2 base pairs downstream of RpSpSp backbone chiral centers in a target molecule is one of the cleavage sites with higher cleavage rate when a reference (e.g., chirally uncontrolled) oligonucleotide composition is used. In some embodiments, such a site is the cleavage site with the highest cleavage rate when a reference (e.g., chirally uncontrolled) oligonucleotide composition is used.

In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at one or more sites, e.g., relative to a reference (e.g., chirally uncontrolled/stereorandom) oligonucleotide composition. In some embodiments, a provided chirally controlled oligonucleotide composition selectively enhances cleavage at a single site relative to a reference (e.g., chirally uncontrolled/stereorandom) composition. In some embodiments, a chirally controlled oligonucleotide composition enhances cleavage at a site by providing a higher cleavage rate. In some embodiments, a chirally controlled oligonucleotide composition enhances cleavage at a site by providing a higher percentage of cleavage at said site. Percentage of cleavage at a site can be determined by various methods widely known and practiced in the art. In some embodiments, percentage of cleavage at a site is determined by analysis of cleavage products, for example, as by HPLC-MS as illustrated in FIG. 18, FIG. 19 and FIG. 30; see also example cleavage maps such as FIG. 9, FIG. 10, FIG. 11, FIG. 14, FIG. 22, FIG. 25 and FIG. 26. In some embodiments, enhancement is relative to a reference oligonucleotide composition. In some embodiments, enhancement is relative to another cleavage site. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a site that is a preferred cleavage site of a reference oligonucleotide composition. In some embodiments, a preferred cleavage site, or a group of preferred cleavage sites, is a site or sites that have relatively higher percentage of cleavage compared to one or more other cleavage sites. In some embodiments, preferred cleavage sites can indicate preference of an enzyme. For example, for RNase H, when a DNA oligonucleotide is used, resulting cleavage sites may indicate preference of RNase H. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a site that is a preferred cleavage site of an enzyme. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a site that is not a preferred cleavage site of a reference oligonucleotide composition. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a site that is not a cleavage site of a reference oligonucleotide composition, effectively creating a new cleavage site which does not exist when a reference oligonucleotide composition is used. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a site within 5 base pairs from a targeted mutation or SNP, thereby increasing selective cleavage of the undesired target oligonucleotide. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a site within 4 base pairs from a targeted mutation or SNP, thereby increasing selective cleavage of the undesired target oligonucleotide. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a site within 3 base pairs from a targeted mutation or SNP, thereby increasing selective cleavage of the undesired target oligonucleotide. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a site within 2 base pairs from a targeted mutation or SNP, thereby increasing selective cleavage of the undesired target oligonucleotide. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage at a site immediately upstream or downstream targeted mutation or SNP, thereby increasing selective cleavage of the undesired target oligonucleotide (e.g., FIG. 22, Panel D, muRNA).

In some embodiments, a provided chirally controlled oligonucleotide composition suppresses cleavage at one or more sites, e.g., relative to a reference (e.g., chirally uncontrolled/stereorandom) oligonucleotide composition. In some embodiments, a provided chirally controlled oligonucleotide composition selectively suppresses cleavage at a single site relative to a reference (e.g., chirally uncontrolled/stereorandom) composition. In some embodiments, a chirally controlled oligonucleotide composition suppresses cleavage at a site by providing a lower cleavage rate. In some embodiments, a chirally controlled oligonucleotide composition suppresses cleavage at a site by providing a lower percentage of cleavage at said site. In some embodiments, suppression is relative to a reference oligonucleotide composition. In some embodiments, suppression is relative to another cleavage site. In some embodiments, a provided chirally controlled oligonucleotide composition suppresses cleavage at a site that is a preferred cleavage site of a reference oligonucleotide composition. In some embodiments, a preferred cleavage site, or a group of preferred cleavage sites, is a site or sites that have relatively higher percentage of cleavage compared to one or more other cleavage sites. In some embodiments, preferred cleavage sites can indicate preference of an enzyme. For example, for RNase H, when a DNA oligonucleotide is used, resulting cleavage sites may indicate preference of RNase H. In some embodiments, a provided chirally controlled oligonucleotide composition suppresses cleavage at a site that is a preferred cleavage site of an enzyme. In some embodiments, a provided chirally controlled oligonucleotide composition suppresses cleavage at a site that is not a preferred cleavage site of a reference oligonucleotide composition. In some embodiments, a provided chirally controlled oligonucleotide composition suppresses all cleavage sites of a reference oligonucleotide composition. In some embodiments, a provided chirally controlled oligonucleotide composition generally enhances cleavage of target oligonucleotides. In some embodiments, a provided chirally controlled oligonucleotide composition generally suppresses cleavage of non-target oligonucleotides. In some embodiments, a provided chirally controlled oligonucleotide composition enhances cleavage of target oligonucleotides and suppresses cleavage of non-target oligonucleotides. Using FIG. 22, Panel D, as an example, a target oligonucleotide for cleavage is muRNA, while a non-target oligonucleotide is wtRNA. In a subject comprising a diseased tissue comprising a mutation or SNP, a target oligonucleotide for cleavage can be transcripts with a mutation or SNP, while a non-target oligonucleotide can be normal transcripts without a mutation or SNP, such as those expressed in healthy tissues.

In some embodiments, a reference oligonucleotide composition is a stereorandom oligonucleotide composition. In some embodiments, a reference oligonucleotide composition is a stereorandom composition of oligonucleotides of which all internucleotidic linkages are phosphorothioate. In some embodiments, a reference oligonucleotide composition is a DNA oligonucleotide composition with all phosphate linkages.

In some embodiments, besides patterns of backbone chiral centers described herein, provided oligonucleotides optionally comprises modified bases, modified sugars, modified backbone linkages and any combinations thereof. In some embodiments, a provided oligonucleotide is a unimer, altmer, blockmer, gapmer, hemimer and skipmer. In some embodiments, a provided oligonucleotide comprises one or more unimer, altmer, blockmer, gapmer, hemimer or skipmer moieties, or any combinations thereof. In some embodiments, besides patterns of backbone chiral centers herein, a provided oligonucleotide is a hemimer. In some embodiments, besides patterns of backbone chiral centers herein, a provided oligonucleotide is a 5′-hemimer with modified sugar moieties. In some embodiments, a provided oligonucleotide is 5′-hemimer with 2′-modified sugar moieties. Suitable modifications are widely known in the art, e.g., those described in the present application. In some embodiments, a modification is 2′-F. In some embodiments, a modification is 2′-MOE. In some embodiments, a modification is s-cEt.

In some embodiments, the present disclosure provides a method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines the target nucleic acid sequence, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target nucleic acid sequence and a similar nucleic acid sequences, transcripts of the target nucleic acid sequence are suppressed at a greater level than a level of suppression observed for a similar nucleic acid sequence.

In some embodiments, the present disclosure provides a method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines the target nucleic acid sequence, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target nucleic acid sequence and a similar nucleic acid sequences, transcripts of the target nucleic acid sequence are suppressed at a greater level than a level of suppression observed for a similar nucleic acid sequence.

In some embodiments, a common base sequence is or comprises a sequence that is 100% complementary to the characteristic sequence elements. In some embodiments, suppression can be assessed through various suitable assays as known by a person having ordinary skill in the art. In some embodiments, an assay is a RNase H assay as described in the present disclosure, which can assess suppression by evaluating cleavage of a sequence found in a transcript of a target nucleic acid sequence comprising the characteristic sequence element and cleavage of a sequence found in a transcript of a similar sequence. In some embodiments, transcripts of the target nucleic acid sequence are suppressed at a greater level than a level of suppression observed for any one of the similar nucleic acid sequence. In some embodiments, example target and similar sequences are described in the present disclosure.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, transcripts of the particular allele are suppressed at a greater level than a level of suppression observed for another allele of the same nucleic acid sequence.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, transcripts of the particular allele are suppressed at a greater level than a level of suppression observed for another allele of the same nucleic acid sequence.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, transcripts of the particular allele are suppressed at a greater level than a level of suppression observed for another allele of the same nucleic acid sequence,
the contacting being performed under conditions determined to permit the composition to suppress transcripts of the particular allele.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for another allele of the same nucleic acid sequence; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for another allele of the same nucleic acid sequence; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for another allele of the same nucleic acid sequence; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence,

the contacting being performed under conditions determined to permit the composition to suppress transcripts of the particular allele.

In some embodiments, a transcript is suppressed by cleavage of said transcript. In some embodiments, a specific nucleotide characteristic sequence element is in an intron. In some embodiments, a specific nucleotide characteristic sequence element is in an exon. In some embodiments, a specific nucleotide characteristic sequence element is partially in an exon and partially in an intron. In some embodiments, a specific nucleotide characteristic sequence element comprises a mutation that differentiates an allele from other alleles. In some embodiments, a mutation is a deletion. In some embodiments, a mutation is an insertion. In some embodiments, a mutation is a point mutation. In some embodiments, a specific nucleotide characteristic sequence element comprises at least one single nucleotide polymorphism (SNP) that differentiates an allele from other alleles.

In some embodiments, a target nucleic acid sequence is a target gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a gene whose sequence comprises at least one single nucleotide polymorphism (SNP), comprising providing a chirally controlled oligonucleotide composition comprising oligonucleotides defined by having:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is completely complementary to a sequence found in a transcript from the first allele but not to the corresponding sequence found in a transcript from the second allele, wherein the sequence found in the transcripts comprises a SNP site;
    • 2) a common pattern of backbone linkages;
    • 3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that at least about 10% of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers;
      wherein the transcript from the first allele is suppressed at least five folds more than that from the second allele.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;

wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene,
the contacting being performed under conditions determined to permit the composition to suppress transcripts of the particular allele.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene,
the contacting being performed under conditions determined to permit the composition to suppress expression of the particular allele.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene,

the contacting being performed under conditions determined to permit the composition to suppress transcripts of the particular allele.

In some embodiments, the present disclosure provides a method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene,

the contacting being performed under conditions determined to permit the composition to suppress expression of the particular allele.

As described herein, in some embodiments, in a provided method contacting is performed under conditions determined to permit a composition to suppress transcripts of a particular allele. In some embodiments, contacting is performed under conditions determined to permit a composition to suppress expression of a particular allele.

In some embodiments, suppression of transcripts of a particular allele is at a level that is greater than when the composition is absent. In some embodiments, suppression of transcripts of a particular allele is at a level that is at least 1.1 fold relative to when the composition is absent, in that transcripts from the particular allele are detected in amounts that are at least 1.1 fold lower when the composition is present relative to when it is absent. In some embodiments, a level is at least 1.2 fold. In some embodiments, a level is at least 1.3 fold. In some embodiments, a level is at least 1.4 fold. In some embodiments, a level is at least 1.5 fold. In some embodiments, a level is at least 1.6 fold. In some embodiments, a level is at least 1.7 fold. In some embodiments, a level is at least 1.8 fold. In some embodiments, a level is at least 1.9 fold. In some embodiments, a level is at least 2 fold. In some embodiments, a level is at least 3 fold. In some embodiments, a level is at least 4 fold. In some embodiments, a level is at least 5 fold. In some embodiments, a level is at least 6 fold. In some embodiments, a level is at least 7 fold. In some embodiments, a level is at least 8 fold. In some embodiments, a level is at least 9 fold. In some embodiments, a level is at least 10 fold. In some embodiments, a level is at least 11 fold. In some embodiments, a level is at least 12 fold. In some embodiments, a level is at least 13 fold. In some embodiments, a level is at least 14 fold. In some embodiments, a level is at least 15 fold. In some embodiments, a level is at least 20 fold. In some embodiments, a level is at least 30 fold. In some embodiments, a level is at least 40 fold. In some embodiments, a level is at least 50 fold. In some embodiments, a level is at least 75 fold. In some embodiments, a level is at least 100 fold. In some embodiments, a level is at least 150 fold. In some embodiments, a level is at least 200 fold. In some embodiments, a level is at least 300 fold. In some embodiments, a level is at least 400 fold. In some embodiments, a level is at least 500 fold. In some embodiments, a level is at least 750 fold. In some embodiments, a level is at least 1000 fold. In some embodiments, a level is at least 5000 fold.

In some embodiments, suppression of transcripts of a particular allele is at a level that is greater than a level of suppression observed for another allele of the same nucleic acid sequence. In some embodiments, suppression of transcripts of a particular allele is at a level that is at least 1.1 fold greater than a level of suppression observed for another allele of the same nucleic acid sequence. In some embodiments, a level is at least 1.2 fold. In some embodiments, a level is at least 1.3 fold. In some embodiments, a level is at least 1.4 fold. In some embodiments, a level is at least 1.5 fold. In some embodiments, a level is at least 1.6 fold. In some embodiments, a level is at least 1.7 fold. In some embodiments, a level is at least 1.8 fold. In some embodiments, a level is at least 1.9 fold. In some embodiments, a level is at least 2 fold. In some embodiments, a level is at least 3 fold. In some embodiments, a level is at least 4 fold. In some embodiments, a level is at least 5 fold. In some embodiments, a level is at least 6 fold. In some embodiments, a level is at least 7 fold. In some embodiments, a level is at least 8 fold. In some embodiments, a level is at least 9 fold. In some embodiments, a level is at least 10 fold. In some embodiments, a level is at least 11 fold. In some embodiments, a level is at least 12 fold. In some embodiments, a level is at least 13 fold. In some embodiments, a level is at least 14 fold. In some embodiments, a level is at least 15 fold. In some embodiments, a level is at least 20 fold. In some embodiments, a level is at least 30 fold. In some embodiments, a level is at least 40 fold. In some embodiments, a level is at least 50 fold. In some embodiments, a level is at least 75 fold. In some embodiments, a level is at least 100 fold. In some embodiments, a level is at least 150 fold. In some embodiments, a level is at least 200 fold. In some embodiments, a level is at least 300 fold. In some embodiments, a level is at least 400 fold. In some embodiments, a level is at least 500 fold. In some embodiments, a level is at least 750 fold. In some embodiments, a level is at least 1000 fold. In some embodiments, a level is at least 5000 fold.

In some embodiments, suppression of transcripts of a particular allele is at a level that is greater than when the composition is absent, and at a level that is greater than a level of suppression observed for another allele of the same nucleic acid sequence. In some embodiments, suppression of transcripts of a particular allele is at a level that is at least 1.1 fold relative to when the composition is absent, and at least 1.1 fold greater than a level of suppression observed for another allele of the same nucleic acid sequence. In some embodiments, each fold is independently as described above.

In some embodiments, a system is a composition comprising a transcript. In some embodiments, a system is a composition comprising transcripts from different alleles. In some embodiments, a system can be in vivo or in vitro, and in either way can comprise one or more cells, tissues, organs or organisms. In some embodiments, a system comprises one or more cells. In some embodiments, a system comprises one or more tissues. In some embodiments, a system comprises one or more organs. In some embodiments, a system comprises one or more organisms. In some embodiments, a system is a subject.

In some embodiments, suppression of a transcript, or suppression of expression of an allele from which a transcript is transcribed, can be measured in in vitro assay. In some embodiments, a sequence from a transcript and comprising a specific nucleotide characteristic sequence element is used in assays instead of the full-length transcript. In some embodiments, an assay is a biochemical assay. In some embodiments, an assay is a biochemical assay wherein a nucleic acid polymer, for example, a transcript or a sequence from a transcript and comprising a specific nucleotide characteristic sequence element, is tested for cleavage by an enzyme in the presence of a chirally controlled oligonucleotide composition.

In some embodiments, a provided chirally controlled oligonucleotide composition is administered to a subject. In some embodiments, a subject is an animal. In some embodiments, a subject is a plant. In some embodiments, a subject is a human.

In some embodiments, for allele-specific suppression of transcripts from a particular allele, transcripts are cleaved at a site near a sequence difference, for example a mutation, within a specific nucleotide characteristic sequence element, which sequence difference differentiates transcripts from a particular allele from transcripts from the other alleles. In some embodiments, transcripts are selectively cleaved at a site near such a sequence difference. In some embodiments, transcripts are cleaved at a higher percentage at a site near such a sequence difference that when a chirally uncontrolled oligonucleotide composition is used. In some embodiments, transcripts are cleaved at the site of a sequence difference. In some embodiments, transcripts are cleaved only at the site of a sequence difference within a specific nucleotide characteristic sequence element. In some embodiments, transcripts are cleaved at a site within 5 base pairs downstream or upstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 4 base pairs downstream or upstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 3 base pairs downstream or upstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 2 base pairs downstream or upstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 1 base pair downstream or upstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 5 base pairs downstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 4 base pairs downstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 3 base pairs downstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 2 base pairs downstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 1 base pair downstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 5 base pairs upstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 4 base pairs upstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 3 base pairs upstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 2 base pairs upstream a sequence difference. In some embodiments, transcripts are cleaved at a site within 1 base pair upstream a sequence difference. Such precise control of cleavage patterns, and the resulting highly selective suppression of transcripts from a particular allele, would not be possible without chirally controlled oligonucleotide compositions and methods thereof provided by Applicant in this disclosure.

In some embodiments, the present disclosure provides methods for treating a subject, or preventing a disease in a subject, by specifically suppress transcripts from a particular allele, for example, an allele that causes or may cause a disease. In some embodiments, the present disclosure provides methods for treating a subject suffering from a disease, comprising administering to the subject a pharmaceutical composition comprising a chirally controlled oligonucleotide composition, wherein transcripts from an allele that causes or contributes to the disease is selectively suppressed. In some embodiments, the present disclosure provides methods for treating a subject suffering from a disease, comprising administering to the subject a pharmaceutical composition comprising a chirally controlled oligonucleotide composition, wherein transcripts from an allele that causes the disease is selectively suppressed. In some embodiments, the present disclosure provides methods for treating a subject suffering from a disease, comprising administering to the subject a pharmaceutical composition comprising a chirally controlled oligonucleotide composition, wherein transcripts from an allele that contributes to the disease is selectively suppressed. In some embodiments, the present disclosure provides methods for treating a subject suffering from a disease, comprising administering to the subject a pharmaceutical composition comprising a chirally controlled oligonucleotide composition, wherein transcripts from an allele that is related to the disease is selectively suppressed. In some embodiments, the present disclosure provides methods for preventing a disease in a subject, by specifically suppress transcripts from a particular allele that may cause a disease. In some embodiments, the present disclosure provides methods for preventing a disease in a subject, by specifically suppress transcripts from a particular allele that increases risk of a disease in the subject. In some embodiments, a provided method comprises administering to the subject a pharmaceutical composition comprising a chirally controlled oligonucleotide composition. In some embodiments, a pharmaceutical composition further comprises a pharmaceutical carrier.

In some embodiments, a nucleotide characteristic sequence comprises a mutation that defines the target sequence relative to other similar sequences. In some embodiments, a nucleotide characteristic sequence comprises a point mutation that defines the target sequence relative to other similar sequences. In some embodiments, a nucleotide characteristic sequence comprises a SNP that defines the target sequence relative to other similar sequences.

In some embodiments, the present disclosure provides a method for preparing an oligonucleotide composition for selective suppression of a transcript of a target nucleic acid sequence, comprising providing an oligonucleotide composition comprising a predetermined level of oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which pattern comprises (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein each of m, n, t, Np is independently as defined and described herein;

wherein the target nucleic acid sequence comprises a characteristic sequence element that defines the target nucleic acid sequence relative to a similar nucleic acid sequence;

wherein the common base sequence is a sequence whose DNA cleavage pattern and/or stereorandom cleavage pattern has a cleavage site within or in the vicinity of the characteristic sequence element.

In some embodiments, the present disclosure provides a method for preparing an oligonucleotide composition for selective suppression of a transcript of a target nucleic acid sequence, comprising providing an oligonucleotide composition comprising a predetermined level of oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which pattern comprises (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein each of m, n, t, Np is independently as defined and described herein;

wherein the target nucleic acid sequence comprises a characteristic sequence element that defines the target nucleic acid sequence relative to a similar nucleic acid sequence;

wherein the common base sequence is a sequence whose DNA cleavage pattern and/or stereorandom cleavage pattern has a major cleavage site within or in the vicinity of characteristic sequence element.

In some embodiments, a common pattern of backbone chiral centers comprises (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m as described above. In some embodiments, a common pattern of backbone chiral centers comprises (Sp)m(Rp)n as described above. In some embodiments, a common pattern of backbone chiral centers comprises (Rp)n(Sp)m as described above. In some embodiments, a common pattern of backbone chiral centers comprises (Np)t(Rp)n(Sp)m as described above. In some embodiments, a common pattern of backbone chiral centers comprises (Sp)t(Rp)n(Sp)m as described above. In some embodiments, n is 1. In some embodiments, m>2. In some embodiments, n is 1 and m>2. In some embodiments, t>2. In some embodiments, n is 1, m>2, and t>2.

In some embodiments, oligonucleotides of the particular oligonucleotide type have a wing-core structure. In some embodiments, oligonucleotides of the particular oligonucleotide type have a core-wing structure. In some embodiments, oligonucleotides of the particular oligonucleotide type have a wing-core-wing structure. In some embodiments, each sugar moieties in the wing regions has a sugar modification. In some embodiments, each sugar moiety in the wing regions has a 2′-modification. In some embodiments, each sugar moieties in the wing regions has a 2′-modification, wherein the 2′-modification is 2′-OR1, wherein R1 is optionally substituted C1-6 alkyl. In some embodiments, each sugar moiety in the wing regions has 2′-OMe. In some embodiments, each wing independently comprises a chiral internucleotidic linkage and a natural phosphate linkage. In some embodiments, a chiral internucleotidic linkage is phosphorothioate. In some embodiments, for a wing-core-wing structure, like in WV-1092, the 5′-wing has an Sp internucleotidic linkage at each of its 5′- and 3′-end, and phosphate linkages in between, and 3′-wing has an Sp internucleotidic linkage at its 3′-end, and the rest of its internucleotidic linkages are phosphate. Additional embodiments for the wing and/or core, e.g., sugar modification, stereochemistry, etc., are described in the present disclosure.

Common base sequences which are sequences whose DNA cleavage patterns and/or stereorandom cleavage patterns have cleavage sites within or in the vicinity of the target nucleic acid sequence are extensively described in the present disclose. In some embodiments, a cleavage site within or in the vicinity of the target nucleic acid sequence is a cleavage site in the vicinity of a mutation which defines the target sequence from its similar sequences. In some embodiments, a cleavage site within or in the vicinity of the target nucleic acid sequence is a cleavage site in the vicinity of a SNP which defines the target sequence from its similar sequences. In some embodiments, as described above, in the vicinity of a mutation or a SNP is 0, 1, 2, 3, 4, 5 internucleotidic linkages away from the mutation or SNP. Additional embodiments are described above in the present disclosure.

In some embodiments, a common base sequence is a sequence whose DNA cleavage pattern and/or stereorandom cleavage pattern has a major cleavage site within or in the vicinity of the target nucleic acid sequence. In some embodiments, a major cleavage site is defined by absolute cleavage at that site (% of cleavage at that site over total target sequence). Additional example embodiments of a major cleavage site are described in the present disclosure. In some embodiments, as exemplified by FIG. 33, a common base sequence (P12) may be identified by comparing cleavage maps of different sequences complementary to the characteristic sequence element.

In some embodiments, the present disclosure provides a method for preparing an oligonucleotide composition comprising oligonucleotides of a particular sequence, which composition provides selective suppression of a transcript of a target sequence, comprising providing a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence which is the same as the particular sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which pattern comprises (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein:

each n and t is independently 1, 2, 3, 4, 5, 6, 7 or 8;

m is 2, 3, 4, 5, 6, 7 or 8, and

each Np is independent Rp or Sp.

Diseases that involves disease-causing alleles are widely known in the art, including but not limited to those described in Hohjoh, Pharmaceuticals 2013, 6, 522-535; US patent application publication US 2013/0197061; Østergaard et al., Nucleic Acids Research 2013, 41(21), 9634-9650; and Jiang et al., Science 2013, 342, 111-114. In some embodiments, a disease is Huntington's disease. In some embodiments, a disease is human hypertrophic cardiomyopathy (HCM). In some embodiments, a disease is dilated cardiomyopathy. In some embodiments, a disease-causing allele is an allele of myosin heavy chains (MHC). In some embodiments, an example disease is selected from:

Disease Target gene Target variation Familial Alzheimer's Amyloid K670N-M671L disease precursor protein (Swedish mutant) (APP) Amyloid K670N-M671L precursor protein (Swedish mutant) (APP) Amyloid V717F precursor protein (London mutant) (APP) Amyloid V717I precursor protein (London mutant) (APP) Preseniline 1 L392V (PSEN1) Amyotrophic lateral Superoxide G93A sclerosis (ALS) dismutase (SOD1) Superoxide G85R dismutase (SOD1) Slow channel Acetylcholine aS226F congenital receptor (AChR) myasthenic syndrome (SCCMS) Frontotemporal Microtubule- V337M dementia with associated protein parkinsonism TAU (MAPT) linked to chromosome 17 (FTDP-17) Ehlers-Danlos Procollagen type III G252V syndrome (COL3A1) (vEDS) Sickle cell Hemoglobin-beta E6V anemia locus (HBB) Familial Transthyretin (TTR) V30M amyloidotic polyneuropathy (FAP) Fibrodysplasia Activin A receptor R206H, G356D ossificans type I (ACVR1) progressiva Activin A receptor R206H (FOP) type I (ACVR1) Tumors Phosphoinositide-3- 1633G −> A kinase, catalytic, alpha 3140A −> G polypeptide (PIK3CA) Spinocerebellar Ataxin-1 (ATXN1) flanking ataxia type 1 region of (SCA1) expanded CAG repeat Machado-Joseph ATAXIN3/MJD1 SNPs linked disease/ to expanded spinocerebellar CAG repeat ataxia type 3 (MJD/SCA3) Spinocerebellar Ataxin-7 (ATXN7) SNP linked ataxia type 7 to expanded (SCA7) CAG repeat Parkinson's Leucine-rich repeat R1441G, R1441C disease kinase 2 (LRRK2) Leucine-rich repeat G20195S kinase 2 (LRRK2) alpha-synuclein A30P Huntington Huntingtin (HTT) SNPs linked disease to expanded CAG repeat Hypertrophic MYH7 R403Q cardiomyopathy

In some embodiments, example targets of, and diseases that can be treated by, provided chirally controlled oligonucleotide compositions and methods, comprises:

Disease Target gene Target variation Familial Alzheimer's Amyloid K670N-M671L disease precursor protein (Swedish mutant) (APP) Amyloid K670N-M671L precursor protein (Swedish mutant) (APP) Amyloid V717F precursor protein (London mutant) (APP) Amyloid V717I precursor protein (London mutant) (APP) Preseniline 1 L392V (PSEN1) Amyotrophic lateral Superoxide G93A sclerosis (ALS) dismutase (SOD1) Superoxide G85R dismutase (SOD1) Slow channel Acetylcholine aS226F, aT254I, congenital receptor (AChR) aS269I myasthenic syndrome (SCCMS) Frontotemporal Microtubule- V337M dementia with associated protein parkinsonism TAU (MAPT) linked to chromosome 17 (FTDP-17) Ehlers-Danlos Procollagen type III G252V syndrome (COL3A1) (vEDS) Sickle cell Hemoglobin-beta E6V anemia locus (HBB) Familial Transthyretin (TTR) V30M amyloidotic polyneuropathy (FAP) Fibrodysplasia Activin A receptor R206H, G356D ossificans type I (ACVR1) progressiva Activin A receptor R206H (FOP) type I (ACVR1) Tumors KRAS G12V, G12D, G13D Tumors Phosphoinositide-3- G1633A, A3140G kinase, catalytic, alpha polypeptide (PIK3CA) Spinocerebellar Ataxin-1 (ATXN1) SNPs linked ataxia type 1 to expanded (SCA1) CAG repeat Spinocerebellar Ataxin-7 (ATXN7) SNPs linked ataxia type 7 to expanded (SCA7) CAG repeat Spinocerebellar Ataxin-3 (ATXN3) SNPs linked Ataxia Type to expanded 3 (SCA3)/Machado- CAG repeat Joseph Disease Parkinson's Leucine-rich repeat R1441G, R1441C disease kinase 2 (LRRK2) Leucine-rich repeat G20195S kinase 2 (LRRK2) Alpha-synuclein (SNCA) A30P, A53T, E46K Huntington's Huntingtin (HTT) SNPs linked disease to expanded CAG repeat Huntington's JPH3 SNPs linked disease-like 2 to expanded CTG repeat Friedreich's FXN SNPs linked ataxia to expanded GAA repeat Fragile X mental FMR1 SNPs linked retardation to expanded syndrome/fragile CGG repeat X tremor ataxia syndrome Myotonic DMPK SNPs linked Dystophy (DM1) to expanded CTG repeat Myotonic ZNF9 SNPs linked Dystophy (DM2) to expanded CTG repeat Spinal-Bulbar AR SNPs linked Muscular Atrophy to expanded CAG repeat Hypertrophic MHY7 R403Q cardiomyopathy

In some embodiments, oligonucleotide compositions and technologies described herein are particularly useful in the treatment of Huntington's disease. For example, in some embodiments, the present disclosure defines stereochemically controlled oligonucleotide compositions that direct cleavage (e.g., RNAse H-mediated cleavage) of nucleic acids associated with Huntington's disease. In some embodiments, such compositions direct preferential cleavage of a Huntington's disease-associated allele of a particular target sequence, relative to one or more (e.g., all non-Huntington's disease-associated) other alleles of the sequence.

In some embodiments, a provided method for treating or preventing Huntington's disease in a subject, comprising administering to the subject a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type. In some embodiments, oligonucleotides of a particular oligonucleotide type are identical. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition.

SNPs related to Huntington's disease are widely known in the art. In some embodiments, a common base sequence is complementary to a nucleic acid sequence comprising a SNP related to Huntington's disease. In some embodiments, a provided composition selectively suppresses transcripts from the disease-causing allele. In some embodiments, a provided composition selectively cleaves transcripts from the disease-causing allele. Example SNPs that can be targeted by a provided composition (target Huntingtin sites) are described herein.

In some embodiments, a target Huntingtin site is selected from rs9993542_C, rs362310_C, rs362303_C, rs10488840_G, rs363125_C, rs363072_A, rs7694687_C, rs363064_C, rs363099_C, rs363088_A, rs34315806_C, rs2298967_T, rs362272 G, rs362275_C, rs362306_G, rs3775061_A, rs1006798_A, rs16843804_C, rs3121419_C, rs362271_G, rs362273_A, rs7659144_C, rs3129322_T, rs3121417_G, rs3095074_G, rs362296_C, rs108850_C, rs2024115_A, rs916171_C, rs7685686_A, rs6844859_T, rs4690073_G, rs2285086_A, rs362331_T, rs363092_C, rs3856973_G, rs4690072_T, rs7691627_G, rs2298969_A, rs2857936_C, rs6446723_T, rs762855_A, rs1263309_T, rs2798296G_, rs363096_T, rs10015979_G, rs11731237_T, rs363080_C, rs2798235_G and rs362307_T. In some embodiments, a target Huntingtin site is selected from rs34315806_C, rs362273_A, rs362331_T, rs363099_C, rs7685686_A, rs362306_G, rs363064_C, rs363075_G, rs2276881_G, rs362271_G, rs362303_C, rs362322_A, rs363088_A, rs6844859_T, rs3025838_C, rs363081_G, rs3025849_A, rs3121419_C, rs2298967_T, rs2298969_A, rs16843804_C, rs4690072_T, rs362310_C, rs3856973_G, rs2530595_C, rs2530595_T, and rs2285086_A. In some embodiments, a target Huntingtin site is selected from rs34315806_C, rs362273_A, rs362331_T, rs363099_C, rs7685686_A, rs362306_G, rs363064_C, rs363075_G, rs2276881_G, rs362271_G, rs362303_C, rs362322_A, rs363088_A, rs6844859_T, rs3025838_C, rs363081_G, rs3025849_A, rs3121419_C, rs2298967_T, rs2298969_A, rs16843804_C, rs4690072_T, rs362310_C, rs3856973_G, and rs2285086_A. In some embodiments, a target Huntingtin site is selected from rs362331_T, rs7685686_A, rs6844859_T, rs2298969_A, rs4690072_T, rs2024115_A, rs3856973_G, rs2285086_A, rs363092_C, rs7691627_G, rs10015979_G, rs916171_C, rs6446723_T, rs11731237_T, rs362272_G, rs4690073_G, and rs363096_T. In some embodiments, a target Huntingtin site is selected from rs362267, rs6844859, rs1065746, rs7685686, rs362331, rs362336, rs2024115, rs362275, rs362273, rs362272, rs3025805, rs3025806, rs35892913, rs363125, rs17781557, rs4690072, rs4690074, rs1557210, rs363088, rs362268, rs362308, rs362307, rs362306, rs362305, rs362304, rs362303, rs362302, rs363075, rs2530595, and rs2298969. In some embodiments, a target Huntingtin site is selected from rs362267, rs6844859, rs1065746, rs7685686, rs362331, rs362336, rs2024115, rs362275, rs362273, rs362272, rs3025805, rs3025806, rs35892913, rs363125, rs17781557, rs4690072, rs4690074, rs1557210, rs363088, rs362268, rs362308, rs362307, rs362306, rs362305, rs362304, rs362303, rs362302, rs363075 and rs2298969. In some embodiments, a target Huntingtin site is selected from:

Frequency of Heterozygosity for 24 SNP Sites in the Huntingtin mRNA Location in mRNA Reference Percent Heterozygosity (Position, nt) Number Controls HD Patients ORF, exon 20 rs363075 G/A, 10.3% (G/G, G/A, 12.8% (G/G, (2822) 89.7%) 86.2%; A/A, 0.9%) ORF, exon 25 rs35892913 G/A, 10.3% (G/G, G/A, 13.0% (G/G, (3335) 89.7%) 86.1%; A/A, 0.9%) ORF, exon 25 rs1065746 G/C, 0% (G/G, G/C, 0.9% (G/G, (3389) 100%) 99.1%) ORF, exon 25 rs17781557 T/G, 12.9% (T/T, T/G, 1.9% (T/T, (3418) 87.1%) 98.1%) ORF, exon 29 rs4690074 C/T, 37.9% (C/C, C/T, 35.8% (C/C, (3946) 50.9%; T/T, 11.2) 59.6%; T/T, 4.6%) ORF, exon 39 rs363125 C/A, 17.5% (C/C, C/A, 11.0% (C/C, (5304) 79.0%; A/A, 3.5%) 87.2%; A/A, 1.8%) ORF, exon 44 exon 44 G/A, 0% (G/G, G/A, 2.8% (G/G, (6150) 100%) 97.2%) ORF, exon 48 rs362336 G/A, 38.7% (G/G, G/A, 37.4% (G/G, (6736) 49.6%; A/A, 11.7%) 57.9%; A/A, 4.7%) ORF, exon 50 rs362331 T/C, 45.7% (T/T, T/C, 39.4% (T/T, (7070) 31.0%; C/C, 23.3%) 49.5%; C/C, 11.0%) ORF, exon 57 rs362273 A/G, 40.3% (A/A, A/G, 35.2% (A/A, (7942) 48.2%; G/G, 11.4%) 60.2%; G/G, 4.6%) ORF, exon 61 rs362272 G/A, 37.1% (G/G, G/A, 36.1% (G/G, (8501) 51.7%; A/A, 11.2%) 59.3%; A/A, 4.6%) ORF, exon 65 rs3025806 A/T, 0% (C/C, A/T, 0% (C/C, (9053) 100%) 100%) ORF, exon 65 exon 65 G/A, 2.3% (G/G, G/A, 0% (G/G, (9175) 97.7%) 100%) ORF, exon 67 rs362308 T/C, 0% (T/T, T/C, 0% (T/T, (9523) 100%) 100%) 3′UTR, exon rs362307 C/T, 13.0% (C/C, C/T, 48.6% (C/C, 67 (9633) 87.0%) 49.5%; T/T, 1.9%) 3′UTR, exon rs362306 G/A, 36.0% (G/G, G/A, 35.8% (G/G, 67 (9888) 52.6%; A/A, 11.4%) 59.6%; A/A, 4.6%) 3′UTR, exon rs362268 C/G, 36.8% (C/C, C/G, 35.8% (C/C, 67 (9936) 50.0%; G/G 13.2%) 59.6%; G/G, 4.6%) 3′UTR, exon rs362305 C/G, 20.2% (C/C, C/G, 11.9% (C/C, 67 (9948) 78.1%; G/G 1.8%) 85.3%; G/G, 2.8%) 3′UTR, exon rs362304 C/A, 22.8% (C/C, C/A, 11.9% (C/C, 67 (10060) 73.7%; A/A, 3.5%) 85.3%; AA, 2.8%) 3′UTR, exon rs362303 C/T, 18.4% (C/C, C/A, 11.9% (C/C, 67 (10095) 79.8%; T/T, 1.8%) 85.3%; T/T, 2.8%) 3′UTR, exon rs1557210 C/T, 0% (C/C, C/T, 0% (C/C, 67 (10704) 100%) 100%) 3′UTR, exon rs362302 C/T, 4.3% (C/C, C/T, 0% (C/C, 67 (10708) 95.7%) 100%) 3′UTR, exon rs3025805 G/T, 0% (G/G, G/T, 0% (G/G, 67 (10796) 100%) 100%) 3′UTR, exon rs362267 C/T, 36.2% (C/C, C/T, 35.5% (C/C, 67 (11006) 52.6%; T/T, 11.2%) 59.8%; T/T, 4.7%)

In some embodiments, a chirally controlled oligonucleotide composition targets two or more sites. In some embodiments, targeted two or more sites are selected from sited listed herein. In some embodiments, a targeted SNP is rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In some embodiments, a targeted SNP is rs362307, rs7685686, rs362268 or rs362306. In some embodiments, a targeted SNP is rs362307. In some embodiments, a targeted SNP is rs7685686. In some embodiments, a targeted SNP is not rs7685686. In some embodiments, a targeted SNP is rs362268. In some embodiments, a targeted SNP is rs362306.

In some embodiments, a chirally controlled oligonucleotide composition is able to differentiate between two alleles of a particular SNP.

A chirally controlled oligonucleotide compositions of both WVE120101 and WV-1092 were able to differentiate between wt and mutant versions of SNP rs362307, which differ by one nt; both WVE120101 and WV-1092 chirally controlled oligonucleotide compositions significantly knocked down the mutant allele but not the wt, while the stereorandom oligonucleotide composition, WV-1497, was not able to significantly differentiate between the wt and mutant alleles (see FIG. 39D).

A chirally controlled oligonucleotide composition of WV-2595 was also able to differentiate between the C and T alleles at SNP rs2530595, which also differ at only the one nt. A chirally controlled WV-2595 oligonucleotide composition significantly knocked down the T allele but not the C allele, unlike the stereorandom oligonucleotide composition of WV-2611, which was not able to significantly differentiate the alleles (see FIG. 39F).

A chirally controlled oligonucleotide composition of WV-2603 was able to differentiate between the C and T alleles of SNP rs362331, which also differ at only the one nt. A chirally controlled WV-2603 oligonucleotide composition significantly knocked down the T allele but not the C allele, unlike the stereorandom oligonucleotide composition of WV-2619, which was not able to significantly differentiate between the alleles (see FIGS. 39A, 39B, 39C and 39E).

In some embodiments, a provided composition for treating Huntington's disease is selected from Tables N1, N2, N3 or N4. In some embodiments, a provided composition for treating Huntington's disease is selected from Table N1. In some embodiments, a provided composition for treating Huntington's disease is selected from Table N2. In some embodiments, a provided composition for treating Huntington's disease is selected from Table N3. In some embodiments, a provided composition for treating Huntington's disease is selected from Table N4. In some embodiments, a provided composition for treating Huntington's disease is selected from Tables N1A, N2A, N3A or N4A. In some embodiments, a provided composition for treating Huntington's disease is selected from Table N1A. In some embodiments, a provided composition for treating Huntington's disease is selected from Table N2A. In some embodiments, a provided composition for treating Huntington's disease is selected from Table N3A. In some embodiments, a provided composition for treating Huntington's disease is selected from Table N4A. In some embodiments, a provided composition is WV-1092. In some embodiments, a provided composition is selected from: an oligonucleotide having a sequence of WVE120101; WV-2603; WV-2595; WV-1510; WV-2378; and WV-2380; each of these was constructed and found to be very effective, for example, as demonstrated in vitro in the dual luciferase reporter assay. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WVE120101, WV-2603, WV-2595, WV-1510, WV-2378, or WV-2380. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-937. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-1087. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-1090. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-1091. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-1092. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-1510. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-2378. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-2380. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-2595. In some embodiments, a provided composition is a chirally controlled oligonucleotide composition of WV-2603. In some embodiments, provided oligonucleotides comprise base sequence, pattern of backbone linkages, pattern or backbone chiral centers, and/or pattern of chemical modifications (e.g., base modifications, sugar modifications, etc.) of any oligonucleotide disclosed herein.

In some embodiments, a provided composition is not a composition of ONT-451, ONT-452 or ONT-450. In some embodiments, a provided composition is not a composition of ONT-451. In some embodiments, a provided composition is not a composition of ONT-452. In some embodiments, a provided composition is not a composition of ONT-450. In some embodiments, a composition does not contain a pre-determined level of ONT-451 or ONT-452. In some embodiments, a composition does not contain a pre-determined level of ONT-451. In some embodiments, a composition does not contain a pre-determined level of ONT-452. In some embodiments, an oligonucleotide type is not ONT-451 or ONT-452. In some embodiments, an oligonucleotide type is not ONT-451. In some embodiments, an oligonucleotide type is not ONT-452. In some embodiments, a composition is not a chirally controlled oligonucleotide composition of ONT-451 or ONT-452. In some embodiments, a composition is not a chirally controlled oligonucleotide composition of ONT-451. In some embodiments, a composition is not a chirally controlled oligonucleotide composition of ONT-452.

In some embodiments, a provided method ameliorates a symptom of Huntington's disease. In some embodiments, a provided method slows onset of Huntington's disease. In some embodiments, a provided method slows progression of Huntington's disease. In some embodiments, a provided method stops progression of Huntington's disease. In some embodiments, a provided method cures Huntington's disease according to a clinical standard.

In some embodiments, the present disclosure provides methods for identifying patients for a given oligonucleotide composition. In some embodiments, the present disclosure provides methods for patient stratification. In some embodiments, a provided method comprises identifying a mutation and/or SNP associated with a disease-causing allele. For example, in some embodiments, a provided method comprises identifying in a subject a SNP associated with expanded CAG repeats that are associated with or causing Huntington's disease. In some embodiments, a provided method comprises identifying in a subject a SNP associated with more than 35 CAG repeats in Huntingtin. In some embodiments, a provided method comprises identifying in a subject a SNP associated with more than 36 CAG repeats in Huntingtin. In some embodiments, a provided method comprises identifying in a subject a SNP associated with more than 37 CAG repeats in Huntingtin. In some embodiments, a provided method comprises identifying in a subject a SNP associated with more than 38 CAG repeats in Huntingtin. In some embodiments, a provided method comprises identifying in a subject a SNP associated with more than 39 CAG repeats in Huntingtin. In some embodiments, a provided method comprises identifying in a subject a SNP associated with more than 40 CAG repeats in Huntingtin.

In some embodiments, a subject has a SNP in the subject's Huntingtin gene. In some embodiments, a subject has a SNP, wherein one allele is mutant Huntingtin associated with expanded CAG repeats. In some embodiments, a subject has a SNP as described herein. In some embodiments, a subject has a SNP selected from rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In some embodiments, a subject has a SNP selected from rs362307, rs7685686, rs362268, or rs362306. In some embodiments, a subject has a SNP selected from rs362307. In some embodiments, a subject has a SNP selected from rs7685686. In some embodiments, a subject has a SNP selected from rs362268. In some embodiments, a subject has a SNP selected from rs362306.

In some embodiments, oligonucleotides of a provided composition have a sequence complementary to a sequence comprising a SNP from the disease-causing allele (mutant), and the composition selectively suppresses expression from the diseasing-causing allele. In some embodiments, a SNP is rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In some embodiments, a SNP is rs362307, rs7685686, rs362268, or rs362306. In some embodiments, a SNP is rs362307. In some embodiments, a SNP is rs7685686. In some embodiments, a SNP is rs362268. In some embodiments, a SNP is rs362306. In some embodiments, a SNP is rs2530595. In some embodiments, a SNP is rs362331.

As understood by a person having ordinary skill in the art, various methods may be used to monitor a treatment process. In some embodiments, mutant HTT (mHTT) may be assessed from cerebrospinal fluid (Wild et al., Quantification of mutant Huntingtin protein in cerebrospinal fluid from Huntington's disease patients, J Clin Invest. 2015; 125 (5): 1979-86), and may be used to monitor a treatment. In some embodiments, this approach may be used to determined and/or optimize a regimen, monitor pharmacodynamic endpoints, and/or determine dosage and frequency for administration, etc.

It is understood by a person having ordinary skill in the art that provided methods apply to any similar targets containing a mismatch. In some embodiments, a mismatch is between a maternal and paternal gene. Additional example targets for suppression and/or knockdown, including allele-specific suppression and/or knockdown, can be any genetic abnormalities, e.g., mutations, related to any diseases. In some embodiments, a target, or a set of targets, is selected from genetic determinants of diseases, e.g., as disclosed in Xiong, et al., The human splicing code reveals new insights into the genetic determinants of disease. Science Vol. 347 no. 6218 DOI: 10.1126/science.1254806. In some embodiments, a mismatch is between a mutant and a wild type.

In some embodiments, provided chirally controlled oligonucleotide compositions and methods are used to selectively suppress oligonucleotides with a mutation in a disease. In some embodiments, a disease is cancer. In some embodiments, provided chirally controlled oligonucleotide compositions and methods are used to selectively suppress transcripts with mutations in cancer. In some embodiments, provided chirally controlled oligonucleotide compositions and methods are used to suppress transcripts of KRAS. Example target KRAS sites comprises G12V=GGU->GUU Position 227 G->U, G12D=GGU->GAU Position 227 G->A and G13D=GGC->GAC Position 230 G->A.

In some embodiments, provided chirally controlled oligonucleotide compositions and methods provide allele-specific suppression of a transcript in an organism. In some embodiments, an organism comprises a target gene for which two or more alleles exist. For example, a subject has a wild type gene in its normal tissues, while the same gene is mutated in diseased tissues such as in a tumor. In some embodiments, the present disclosure provides chirally controlled oligonucleotide compositions and methods that selectively suppress one allele, for example, one with a mutation or SNP. In some embodiments, the present disclosure provides treatment with higher efficacy and/or low toxicity, and/or other benefits as described in the application.

In some embodiments, provided chirally controlled oligonucleotide compositions comprises oligonucleotides of one oligonucleotide type. In some embodiments, provided chirally controlled oligonucleotide compositions comprises oligonucleotides of only one oligonucleotide type. In some embodiments, provided chirally controlled oligonucleotide compositions has oligonucleotides of only one oligonucleotide type. In some embodiments, provided chirally controlled oligonucleotide compositions comprises oligonucleotides of two or more oligonucleotide types. In some embodiments, using such compositions, provided methods can target more than one target. In some embodiments, a chirally controlled oligonucleotide composition comprising two or more oligonucleotide types targets two or more targets. In some embodiments, a chirally controlled oligonucleotide composition comprising two or more oligonucleotide types targets two or more mismatches. In some embodiments, a single oligonucleotide type targets two or more targets, e.g., mutations. In some embodiments, a target region of oligonucleotides of one oligonucleotide type comprises two or more “target sites” such as two mutations or SNPs.

In some embodiments, oligonucleotides in a provided chirally controlled oligonucleotide composition optionally comprise modified bases or sugars. In some embodiments, a provided chirally controlled oligonucleotide composition does not have any modified bases or sugars. In some embodiments, a provided chirally controlled oligonucleotide composition does not have any modified bases. In some embodiments, oligonucleotides in a provided chirally controlled oligonucleotide composition comprise modified bases and sugars. In some embodiments, oligonucleotides in a provided chirally controlled oligonucleotide composition comprise a modified base. In some embodiments, oligonucleotides in a provided chirally controlled oligonucleotide composition comprise a modified sugar. Modified bases and sugars for oligonucleotides are widely known in the art, including but not limited in those described in the present disclosure. In some embodiments, a modified base is 5-mC. In some embodiments, a modified sugar is a 2′-modified sugar. Suitable 2′-modification of oligonucleotide sugars are widely known by a person having ordinary skill in the art. In some embodiments, 2′-modifications include but are not limited to 2′-OR1, wherein R1 is not hydrogen. In some embodiments, a 2′-modification is 2′-OR, wherein R1 is optionally substituted C1-6 aliphatic. In some embodiments, a 2′-modification is 2′-MOE. In some embodiments, a modification is 2′-halogen. In some embodiments, a modification is 2′-F. In some embodiments, modified bases or sugars may further enhance activity, stability and/or selectivity of a chirally controlled oligonucleotide composition, whose common pattern of backbone chiral centers provides unexpected activity, stability and/or selectivity.

In some embodiments, a provided chirally controlled oligonucleotide composition does not have any modified sugars. In some embodiments, a provided chirally controlled oligonucleotide composition does not have any 2′-modified sugars. In some embodiments, the present disclosure surprisingly found that by using chirally controlled oligonucleotide compositions, modified sugars are not needed for stability, activity, and/or control of cleavage patterns. Furthermore, in some embodiments, the present disclosure surprisingly found that chirally controlled oligonucleotide compositions of oligonucleotides without modified sugars deliver better properties in terms of stability, activity, turn-over and/or control of cleavage patterns. For example, in some embodiments, it is surprisingly found that chirally controlled oligonucleotide compositions of oligonucleotides having no modified sugars dissociates much faster from cleavage products and provide significantly increased turn-over than compositions of oligonucleotides with modified sugars.

In some embodiments, oligonucleotides of provided chirally controlled oligonucleotide compositions useful for provided methods have structures as extensively described in the present disclosure. In some embodiments, an oligonucleotide has a wing-core-wing structure as described. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)mRp as described. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)2Rp. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)m(Rp)n as described. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Rp)n(Sp)m as described. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises Rp(Sp)m as described. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises Rp(Sp)2. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)m(Rp)n(Sp)t as described. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)mRp(Sp)t as described. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)t(Rp)n(Sp)m as described. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)tRp(Sp)m as described. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises SpRpSpSp. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)2Rp(Sp)2. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)3Rp(Sp)3. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)4Rp(Sp)4. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)tRp(Sp)5. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises SpRp(Sp)5. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)2Rp(Sp)5. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)3Rp(Sp)5. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)4Rp(Sp)5. In some embodiments, the common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises (Sp)5Rp(Sp)5. In some embodiments, a common pattern of backbone chiral centers has only one Rp, and each of the other internucleotidic linkages is Sp. In some embodiments, a common base length is greater than 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 35, 40, 45 or 50 as described in the present disclosure. In some embodiments, a common base length is greater than 10. In some embodiments, a common base length is greater than 11. In some embodiments, a common base length is greater than 12. In some embodiments, a common base length is greater than 13. In some embodiments, a common base length is greater than 14. In some embodiments, a common base length is greater than 15. In some embodiments, a common base length is greater than 16. In some embodiments, a common base length is greater than 17. In some embodiments, a common base length is greater than 18. In some embodiments, a common base length is greater than 19. In some embodiments, a common base length is greater than 20. In some embodiments, a common base length is greater than 21. In some embodiments, a common base length is greater than 22. In some embodiments, a common base length is greater than 23. In some embodiments, a common base length is greater than 24. In some embodiments, a common base length is greater than 25. In some embodiments, a common base length is greater than 26. In some embodiments, a common base length is greater than 27. In some embodiments, a common base length is greater than 28. In some embodiments, a common base length is greater than 29. In some embodiments, a common base length is greater than 30. In some embodiments, a common base length is greater than 31. In some embodiments, a common base length is greater than 32. In some embodiments, a common base length is greater than 33. In some embodiments, a common base length is greater than 34. In some embodiments, a common base length is greater than 35.

In some embodiments, a provided chirally controlled oligonucleotide composition provides higher turn-over. In some embodiments, cleavage products from a nucleic acid polymer dissociate from oligonucleotides of a provided chirally controlled oligonucleotide composition at a faster rate than from oligonucleotides of a reference oligonucleotide composition, for example, a chirally uncontrolled oligonucleotide composition. In some embodiments, a provided chirally controlled oligonucleotide composition can be administered in lower unit dosage, and/or total dosage, and/or fewer doses than chirally uncontrolled oligonucleotide composition.

In some embodiments, a chirally controlled oligonucleotide composition provides fewer cleavage sites in the sequence of a nucleic acid polymer that is complementary to its common base sequence or a sequence within its common base sequence when compared to a reference oligonucleotide composition. In some embodiments, a chirally controlled oligonucleotide composition provides fewer cleavage sites in the sequence of a nucleic acid polymer that is complementary to its common base sequence. In some embodiments, a nucleic acid polymer is selectively cleaved at a single site within the sequence that is complementary to the common base sequence, or a sequence within the common base sequence, of a chirally controlled oligonucleotide composition. In some embodiments, a chirally controlled oligonucleotide composition provides higher cleavage percentage at a cleavage site within the sequence that is complementary to the common base sequence, or a sequence within the common base sequence, of the chirally controlled oligonucleotide composition. In some embodiments, a chirally controlled oligonucleotide composition provides higher cleavage percentage at a cleavage site within the sequence that is complementary to the common base sequence of the chirally controlled oligonucleotide composition. In some embodiments, a site having a higher cleavage percentage is a cleavage site when a reference oligonucleotide composition is used. In some embodiments, a site having a higher cleavage percentage is a cleavage site that is not present when a reference oligonucleotide composition is used.

It is surprisingly found that with reduced number of cleavage sites in the complementary sequence, cleavage rate can be unexpectedly increased and/or higher cleavage percentage can be achieved. As demonstrated in the examples of this disclosure, provided chirally controlled oligonucleotide compositions that produce fewer cleavage sites, especially those that provide single-site cleavage, within the complementary sequences of target nucleic acid polymers provide much higher cleavage rates and much lower levels of remaining un-cleaved nucleic acid polymers. Such results are in sharp contrast to general teachings in the art in which more cleavage sites have been pursued in order to increase the cleavage rate.

In some embodiments, a chirally controlled oligonucleotide composition increases cleavage rate by 1.5 fold compared to a reference oligonucleotide composition. In some embodiments, cleavage rate is increased by at least 2 fold. In some embodiments, cleavage rate is increased by at least 3 fold. In some embodiments, cleavage rate is increased by at least 4 fold. In some embodiments, cleavage rate is increased by at least 5 fold. In some embodiments, cleavage rate is increased by at least 6 fold. In some embodiments, cleavage rate is increased by at least 7 fold. In some embodiments, cleavage rate is increased by at least 8 fold. In some embodiments, cleavage rate is increased by at least 9 fold. In some embodiments, cleavage rate is increased by at least 10 fold. In some embodiments, cleavage rate is increased by at least 11 fold. In some embodiments, cleavage rate is increased by at least 12 fold. In some embodiments, cleavage rate is increased by at least 13 fold. In some embodiments, cleavage rate is increased by at least 14 fold. In some embodiments, cleavage rate is increased by at least 15 fold. In some embodiments, cleavage rate is increased by at least 20 fold. In some embodiments, cleavage rate is increased by at least 30 fold. In some embodiments, cleavage rate is increased by at least 40 fold. In some embodiments, cleavage rate is increased by at least 50 fold. In some embodiments, cleavage rate is increased by at least 60 fold. In some embodiments, cleavage rate is increased by at least 70 fold. In some embodiments, cleavage rate is increased by at least 80 fold. In some embodiments, cleavage rate is increased by at least 90 fold. In some embodiments, cleavage rate is increased by at least 100 fold. In some embodiments, cleavage rate is increased by at least 200 fold. In some embodiments, cleavage rate is increased by at least 300 fold. In some embodiments, cleavage rate is increased by at least 400 fold. In some embodiments, cleavage rate is increased by at least 500 fold. In some embodiments, cleavage rate is increased by at least more than 500 fold.

In some embodiments, a chirally controlled oligonucleotide composition provides a lower level of remaining, un-cleaved target nucleic acid polymer compared to a reference oligonucleotide composition. In some embodiments, it is 1.5 fold lower. In some embodiments, it is at least 2 fold lower. In some embodiments, it is at least 3 fold lower. In some embodiments, it is at least 4 fold lower. In some embodiments, it is at least 5 fold lower. In some embodiments, it is at least 6 fold lower. In some embodiments, it is at least 7 fold lower. In some embodiments, it is at least 8 fold lower. In some embodiments, it is at least 9 fold lower. In some embodiments, it is at least 10 fold lower. In some embodiments, it is at least 11 fold lower. In some embodiments, it is at least 12 fold lower. In some embodiments, it is at least 13 fold lower. In some embodiments, it is at least 14 fold lower. In some embodiments, it is at least 15 fold lower. In some embodiments, it is at least 20 fold lower. In some embodiments, it is at least 30 fold lower. In some embodiments, it is at least 40 fold lower. In some embodiments, it is at least 50 fold lower. In some embodiments, it is at least 60 fold lower. In some embodiments, it is at least 70 fold lower. In some embodiments, it is at least 80 fold lower. In some embodiments, it is at least 90 fold lower. In some embodiments, it is at least 100 fold lower. In some embodiments, it is at least 200 fold lower. In some embodiments, it is at least 300 fold lower. In some embodiments, it is at least 400 fold lower. In some embodiments, it is at least 500 fold lower. In some embodiments, it is at least 1000 fold lower.

As discussed in detail herein, the present disclosure provides, among other things, a chirally controlled oligonucleotide composition, meaning that the composition contains a plurality of oligonucleotides of at least one type. Each oligonucleotide molecule of a particular “type” is comprised of preselected (e.g., predetermined) structural elements with respect to: (1) base sequence; (2) pattern of backbone linkages; (3) pattern of backbone chiral centers; and (4) pattern of backbone P-modification moieties. In some embodiments, provided oligonucleotide compositions contain oligonucleotides that are prepared in a single synthesis process. In some embodiments, provided compositions contain oligonucleotides having more than one chiral configuration within a single oligonucleotide molecule (e.g., where different residues along the oligonucleotide have different stereochemistry); in some such embodiments, such oligonucleotides may be obtained in a single synthesis process, without the need for secondary conjugation steps to generate individual oligonucleotide molecules with more than one chiral configuration.

Oligonucleotide compositions as provided herein can be used as agents for modulating a number of cellular processes and machineries, including but not limited to, transcription, translation, immune responses, epigenetics, etc. In addition, oligonucleotide compositions as provided herein can be used as reagents for research and/or diagnostic purposes. One of ordinary skill in the art will readily recognize that the present disclosure herein is not limited to particular use but is applicable to any situations where the use of synthetic oligonucleotides is desirable. Among other things, provided compositions are useful in a variety of therapeutic, diagnostic, agricultural, and/or research applications.

In some embodiments, provided oligonucleotide compositions comprise oligonucleotides and/or residues thereof that include one or more structural modifications as described in detail herein. In some embodiments, provided oligonucleotide compositions comprise oligonucleoties that contain one or more nucleic acid analogs. In some embodiments, provided oligonucleotide compositions comprise oligonucleotides that contain one or more artificial nucleic acids or residues (e.g., a nucleotide analog), including but not limited to: a peptide nucleic acid (PNA), locked nucleic acid (LNA), morpholino, threose nucleic acid (TNA), glycol nucleic acid (GNA), arabinose nucleic acid (ANA), 2′-fluoroarabinose nucleic acid (FANA), cyclohexene nucleic acid (CeNA), anhydrohexitol nucleic acid (HNA), and/or unlocked nucleic acid (UNA), threose nucleic acids (TNA), and/or Xeno nucleic acids (XNA), and any combination thereof.

In any of the embodiments, the disclosure is useful for oligonucleotide-based modulation of gene expression, immune response, etc. Accordingly, stereodefined, oligonucleotide compositions of the disclosure, which contain oligonucleotides of predetermined type (i.e., which are chirally controlled, and optionally chirally pure), can be used in lieu of conventional stereo-random or chirally impure counterparts. In some embodiments, provided compositions show enhanced intended effects and/or reduced unwanted side effects. Certain embodiments of biological and clinical/therapeutic applications of the disclosure are discussed explicitly below.

Various dosing regimens can be utilized to administer provided chirally controlled oligonucleotide compositions. In some embodiments, multiple unit doses are administered, separated by periods of time. In some embodiments, a given composition has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second (or subsequent) dose amount that is same as or different from the first dose (or another prior dose) amount. In some embodiments, a dosing regimen comprises administering at least one unit dose for at least one day. In some embodiments, a dosing regimen comprises administering more than one dose over a time period of at least one day, and sometimes more than one day. In some embodiments, a dosing regimen comprises administering multiple doses over a time period of at least week. In some embodiments, the time period is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more (e.g., about 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more) weeks. In some embodiments, a dosing regimen comprises administering one dose per week for more than one week. In some embodiments, a dosing regimen comprises administering one dose per week for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more (e.g., about 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more) weeks. In some embodiments, a dosing regimen comprises administering one dose every two weeks for more than two week period. In some embodiments, a dosing regimen comprises administering one dose every two weeks over a time period of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more (e.g., about 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more) weeks. In some embodiments, a dosing regimen comprises administering one dose per month for one month. In some embodiments, a dosing regimen comprises administering one dose per month for more than one month. In some embodiments, a dosing regimen comprises administering one dose per month for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more months. In some embodiments, a dosing regimen comprises administering one dose per week for about 10 weeks. In some embodiments, a dosing regimen comprises administering one dose per week for about 20 weeks. In some embodiments, a dosing regimen comprises administering one dose per week for about 30 weeks. In some embodiments, a dosing regimen comprises administering one dose per week for 26 weeks. In some embodiments, a chirally controlled oligonucleotide composition is administered according to a dosing regimen that differs from that utilized for a chirally uncontrolled (e.g., stereorandom) oligonucleotide composition of the same sequence, and/or of a different chirally controlled oligonucleotide composition of the same sequence. In some embodiments, a chirally controlled oligonucleotide composition is administered according to a dosing regimen that is reduced as compared with that of a chirally uncontrolled (e.g., stereorandom) oligonucleotide composition of the same sequence in that it achieves a lower level of total exposure over a given unit of time, involves one or more lower unit doses, and/or includes a smaller number of doses over a given unit of time. In some embodiments, a chirally controlled oligonucleotide composition is administered according to a dosing regimen that extends for a longer period of time than does that of a chirally uncontrolled (e.g., stereorandom) oligonucleotide composition of the same sequence Without wishing to be limited by theory, Applicant notes that in some embodiments, the shorter dosing regimen, and/or longer time periods between doses, may be due to the improved stability, bioavailability, and/or efficacy of a chirally controlled oligonucleotide composition. In some embodiments, a chirally controlled oligonucleotide composition has a longer dosing regimen compared to the corresponding chirally uncontrolled oligonucleotide composition. In some embodiments, a chirally controlled oligonucleotide composition has a shorter time period between at least two doses compared to the corresponding chirally uncontrolled oligonucleotide composition. Without wishing to be limited by theory, Applicant notes that in some embodiments longer dosing regimen, and/or shorter time periods between doses, may be due to the improved safety of a chirally controlled oligonucleotide composition.

A single dose can contain various amounts of a type of chirally controlled oligonucleotide, as desired suitable by the application. In some embodiments, a single dose contains about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300 or more (e.g., about 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000 or more) mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 1 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 5 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 10 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 15 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 20 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 50 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 100 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 150 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 200 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 250 mg of a type of chirally controlled oligonucleotide. In some embodiments, a single dose contains about 300 mg of a type of chirally controlled oligonucleotide. In some embodiments, a chirally controlled oligonucleotide is administered at a lower amount in a single dose, and/or in total dose, than a chirally uncontrolled oligonucleotide. In some embodiments, a chirally controlled oligonucleotide is administered at a lower amount in a single dose, and/or in total dose, than a chirally uncontrolled oligonucleotide due to improved efficacy. In some embodiments, a chirally controlled oligonucleotide is administered at a higher amount in a single dose, and/or in total dose, than a chirally uncontrolled oligonucleotide. In some embodiments, a chirally controlled oligonucleotide is administered at a higher amount in a single dose, and/or in total dose, than a chirally uncontrolled oligonucleotide due to improved safety.

Biologically Active Oligonucleotides

A provided oligonucleotide composition as used herein may comprise single stranded and/or multiply stranded oligonucleotides. In some embodiments, single-stranded oligonucleotides contain self-complementary portions that may hybridize under relevant conditions so that, as used, even single-stranded oligonucleotides may have at least partially double-stranded character. In some embodiments, an oligonucleotide included in a provided composition is single-stranded, double-stranded, or triple-stranded. In some embodiments, an oligonucleotide included in a provided composition comprises a single-stranded portion and a multiple-stranded portion within the oligonucleotide. In some embodiments, as noted above, individual single-stranded oligonucleotides can have double-stranded regions and single-stranded regions.

In some embodiments, provided compositions include one or more oligonucleotides fully or partially complementary to strand of: structural genes, genes control and/or termination regions, and/or self-replicating systems such as viral or plasmid DNA. In some embodiments, provided compositions include one or more oligonucleotides that are or act as siRNAs or other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, self-cleaving RNAs, ribozymes, fragment thereof and/or variants thereof (such as Peptidyl transferase 23S rRNA, RNase P, Group I and Group II introns, GIR1 branching ribozymes, Leadzyme, Hairpin ribozymes, Hammerhead ribozymes, HDV ribozymes, Mammalian CPEB3 ribozyme, VS ribozymes, glmS ribozymes, CoTC ribozyme, etc.), microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, Ul adaptors, triplex-forming oligonucleotides, RNA activators, long non-coding RNAs, short non-coding RNAs (e.g., piRNAs), immunomodulatory oligonucleotides (such as immunostimulatory oligonucleotides, immunoinhibitory oligonucleotides), GNA, LNA, ENA, PNA, TNA, HNA, TNA, XNA, HeNA, CeNA, morpholinos, G-quadruplex (RNA and DNA), antiviral oligonucleotides, and decoy oligonucleotides.

In some embodiments, provided compositions include one or more hybrid (e.g., chimeric) oligonucleotides. In the context of the present disclosure, the term “hybrid” broadly refers to mixed structural components of oligonucleotides. Hybrid oligonucleotides may refer to, for example, (1) an oligonucleotide molecule having mixed classes of nucleotides, e.g., part DNA and part RNA within the single molecule (e.g., DNA-RNA); (2) complementary pairs of nucleic acids of different classes, such that DNA:RNA base pairing occurs either intramolecularly or intermolecularly; or both; (3) an oligonucleotide with two or more kinds of the backbone or internucleotide linkages.

In some embodiments, provided compositions include one or more oligonucleotide that comprises more than one classes of nucleic acid residues within a single molecule. For example, in any of the embodiments described herein, an oligonucleotide may comprise a DNA portion and an RNA portion. In some embodiments, an oligonucleotide may comprise a unmodified portion and modified portion.

Provided oligonucleotide compositions can include oligonucleotides containing any of a variety of modifications, for example as described herein. In some embodiments, particular modifications are selected, for example, in light of intended use. In some embodiments, it is desirable to modify one or both strands of a double-stranded oligonucleotide (or a double-stranded portion of a single-stranded oligonucleotide). In some embodiments, the two strands (or portions) include different modifications. In some embodiments, the two strands include the same modifications. One of skill in the art will appreciate that the degree and type of modifications enabled by methods of the present disclosure allow for numerous permutations of modifications to be made. Examples of such modifications are described herein and are not meant to be limiting.

The phrase “antisense strand” as used herein, refers to an oligonucleotide that is substantially or 100% complementary to a target sequence of interest. The phrase “antisense strand” includes the antisense region of both oligonucleotides that are formed from two separate strands, as well as unimolecular oligonucleotides that are capable of forming hairpin or dumbbell type structures. The terms “antisense strand” and “guide strand” are used interchangeably herein.

The phrase “sense strand” refers to an oligonucleotide that has the same nucleoside sequence, in whole or in part, as a target sequence such as a messenger RNA or a sequence of DNA. The terms “sense strand” and “passenger strand” are used interchangeably herein.

By “target sequence” is meant any nucleic acid sequence whose expression or activity is to be modulated. The target nucleic acid can be DNA or RNA, such as endogenous DNA or RNA, viral DNA or viral RNA, or other RNA encoded by a gene, virus, bacteria, fungus, mammal, or plant. In some embodiments, a target sequence is associated with a disease or disorder. In some embodiments, a target sequence is or comprises a portion of the Huntingtin gene. In some embodiments, a target sequence is or comprises a portion of the Huntingtin gene comprising a SNP.

By “specifically hybridizable” and “complementary” is meant that a nucleic acid can form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. In reference to the nucleic molecules of the present disclosure, the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNAi activity. Determination of binding free energies for nucleic acid molecules is well known in the art (see, e.g., Turner et al, 1987, CSH Symp. Quant. Biol. LIT pp. 123-133; Frier et al., 1986, Proc. Nat. Acad. Sci. USA 83:9373-9377; Turner et al., 1987, /. Ain. Chem. Soc. 109:3783-3785)

A percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” or 100% complementarity means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. Less than perfect complementarity refers to the situation in which some, but not all, nucleoside units of two strands can hydrogen bond with each other. “Substantial complementarity” refers to polynucleotide strands exhibiting 90% or greater complementarity, excluding regions of the polynucleotide strands, such as overhangs, that are selected so as to be noncomplementary. Specific binding requires a sufficient degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target sequences under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays, under conditions in which the assays are performed. In some embodiments, non-target sequences differ from corresponding target sequences by at least 5 nucleotides.

When used as therapeutics, a provided oligonucleotide is administered as a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a provided oligonucleotide comprising, or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable inactive ingredient selected from pharmaceutically acceptable diluents, pharmaceutically acceptable excipients, and pharmaceutically acceptable carriers. In another embodiment, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ophthalmic administration, intrathecal administration, or otic administration. In another embodiment, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ophthalmic administration or otic administration. In further embodiments, the pharmaceutical composition is a tablet, a pill, a capsule, a liquid, an inhalant, a nasal spray solution, a suppository, a suspension, a gel, a colloid, a dispersion, a suspension, a solution, an emulsion, an ointment, a lotion, an eye drop, an ear drop, or a preparation comprising artificial cerebrospinal fluid. In further embodiments, the pharmaceutical composition is a tablet, a pill, a capsule, a liquid, an inhalant, a nasal spray solution, a suppository, a suspension, a gel, a colloid, a dispersion, a suspension, a solution, an emulsion, an ointment, a lotion, an eye drop or an ear drop. In some embodiments, a pharmaceutical composition comprises cerebrospinal fluid. In some embodiments, a pharmaceutical composition comprises artificial cerebrospinal fluid. In some embodiments, a pharmaceutical composition comprises an oligonucleotide, wherein the sequence of the oligonucleotide comprises a sequence which targets a portion of the Huntingtin gene. In some embodiments, the sequence targets a portion of the Huntingtin gene comprising a SNP. In some embodiments, the base sequence, pattern of backbone linkages, pattern of backbone chiral centers, and/or pattern of sugar modifications of the oligonucleotide is or comprises the base sequence, pattern of backbone linkages, pattern of backbone chiral centers, and/or pattern of sugar modifications of any oligonucleotide disclosed herein, and the oligonucleotide is comprised in a pharmaceutical composition comprising any component of a pharmaceutical composition disclosed herein. In some embodiments, the oligonucleotide targets the Huntingtin gene (as a non-limiting example, a SNP in the Huntingtin gene), and the base sequence, pattern of backbone linkages, pattern of backbone chiral centers, and/or pattern of sugar modifications of the oligonucleotide is or comprises the base sequence, pattern of backbone linkages, pattern of backbone chiral centers, and/or pattern of sugar modifications of any oligonucleotide disclosed herein, and the oligonucleotide is comprised in a pharmaceutical composition comprising artificial cerebrospinal fluid, and the pharmaceutical composition is administered via intrathecal administration.

Pharmaceutical Compositions

When used as therapeutics, a provided oligonucleotide or oligonucleotide composition described herein is administered as a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a provided oligonucleotides, or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable inactive ingredient selected from pharmaceutically acceptable diluents, pharmaceutically acceptable excipients, and pharmaceutically acceptable carriers. In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ophthalmic administration, intrathecal administration, or otic administration. In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ophthalmic administration or otic administration. In some embodiments, the pharmaceutical composition is a tablet, a pill, a capsule, a liquid, an inhalant, a nasal spray solution, a suppository, a suspension, a gel, a colloid, a dispersion, a suspension, a solution, an emulsion, an ointment, a lotion, an eye drop, an ear drop, or a preparation comprising artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition is a tablet, a pill, a capsule, a liquid, an inhalant, a nasal spray solution, a suppository, a suspension, a gel, a colloid, a dispersion, a suspension, a solution, an emulsion, an ointment, a lotion, an eye drop or an ear drop. In some embodiments, a provided composition comprises cerebrospinal fluid. In some embodiments, a provided composition comprises artificial cerebrospinal fluid.

In some embodiments, the present disclosure provides a pharmaceutical composition comprising chirally controlled oligonucleotide, or composition thereof, in admixture with a pharmaceutically acceptable excipient. One of skill in the art will recognize that the pharmaceutical compositions include the pharmaceutically acceptable salts of the chirally controlled oligonucleotide, or composition thereof, described above.

A variety of supramolecular nanocarriers can be used to deliver nucleic acids. Example nanocarriers include, but are not limited to liposomes, cationic polymer complexes and various polymeric. Complexation of nucleic acids with various polycations is another approach for intracellular delivery; this includes use of PEGlyated polycations, polyethyleneamine (PEI) complexes, cationic block co-polymers, and dendrimers. Several cationic nanocarriers, including PEI and polyamidoamine dendrimers help to release contents from endosomes. Other approaches include use of polymeric nanoparticles, polymer micelles, quantum dots and lipoplexes.

Additional nucleic acid delivery strategies are known in addition to the example delivery strategies described herein.

In therapeutic and/or diagnostic applications, the compounds of the disclosure can be formulated for a variety of modes of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remington, The Science and Practice of Pharmacy, (20th ed. 2000).

Provided oligonucleotides, and compositions thereof, are effective over a wide dosage range. For example, in the treatment of adult humans, dosages from about 0.01 to about 1000 mg, from about 0.5 to about 100 mg, from about 1 to about 50 mg per day, and from about 5 to about 100 mg per day are examples of dosages that may be used. The exact dosage will depend upon the route of administration, the form in which the compound is administered, the subject to be treated, the body weight of the subject to be treated, and the preference and experience of the attending physician.

Pharmaceutically acceptable salts are generally well known to those of ordinary skill in the art, and may include, by way of example but not limitation, acetate, benzenesulfonate, besylate, benzoate, bicarbonate, bitartrate, bromide, calcium edetate, carnsylate, carbonate, citrate, edetate, edisylate, estolate, esylate, fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate, hexylresorcinate, hydrabamine, hydrobromide, hydrochloride, hydroxynaphthoate, iodide, isethionate, lactate, lactobionate, malate, maleate, mandelate, mesylate, mucate, napsylate, nitrate, pamoate (embonate), pantothenate, phosphate/diphosphate, polygalacturonate, salicylate, stearate, subacetate, succinate, sulfate, tannate, tartrate, or teoclate. Other pharmaceutically acceptable salts may be found in, for example, Remington, The Science and Practice of Pharmacy (20th ed. 2000). Preferred pharmaceutically acceptable salts include, for example, acetate, benzoate, bromide, carbonate, citrate, gluconate, hydrobromide, hydrochloride, maleate, mesylate, napsylate, pamoate (embonate), phosphate, salicylate, succinate, sulfate, or tartrate.

Depending on the specific conditions being treated, such agents may be formulated into liquid or solid dosage forms and administered systemically or locally. The agents may be delivered, for example, in a timed- or sustained-low release form as is known to those skilled in the art. Techniques for formulation and administration may be found in Remington, The Science and Practice of Pharmacy (20th ed. 2000). Suitable routes may include oral, buccal, by inhalation spray, sublingual, rectal, transdermal, vaginal, transmucosal, nasal or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intra-articullar, intra-sternal, intra-synovial, intra-hepatic, intralesional, intracranial, intraperitoneal, intranasal, or intraocular injections or other modes of delivery.

In some embodiments of a method or composition of the present disclosure, a composition comprising an oligonucleotide is administered via intrathecal administration. In some embodiments of a method or composition of the present disclosure, a composition comprising an oligonucleotide comprises artificial cerebrospinal fluid and is administered via intrathecal administration. In some embodiments of a method or composition of the present disclosure, a composition comprising an oligonucleotide comprises one or more components of artificial cerebrospinal fluid (for example, NaCl, NaHCO3, KCl, NaH2PO4, MgCl2 and glucose) and is administered via intrathecal administration. In some embodiments of a method or composition of the present disclosure, a composition comprising an oligonucleotide comprises one or more components of artificial cerebrospinal fluid (for example, NaCl, NaHCO3, KCl, NaH2PO4, MgCl2 and glucose) and is administered via intrathecal administration, wherein the sequence of the oligonucleotide comprises a sequence which targets a portion of the Huntingtin gene. In some embodiments of a method or composition of the present disclosure, a composition comprising an oligonucleotide comprises two or more components of artificial cerebrospinal fluid (for example, NaCl, NaHCO3, KCl, NaH2PO4, MgCl2 and glucose) and is administered via intrathecal administration, wherein the sequence of the oligonucleotide comprises a sequence which targets a portion of the Huntingtin gene. In some embodiments of a method or composition of the present disclosure, a composition comprising an oligonucleotide comprises three or more components of artificial cerebrospinal fluid (for example, NaCl, NaHCO3, KCl, NaH2PO4, MgCl2 and glucose) and is administered via intrathecal administration, wherein the sequence of the oligonucleotide comprises a sequence which targets a portion of the Huntingtin gene. In some embodiments, provided oligonucleotides comprise base sequence, pattern of backbone linkages, pattern or backbone chiral centers, and/or pattern of chemical modifications (e.g., base modifications, sugar modifications, etc.) of any oligonucleotide disclosed herein. In some embodiments, the sequence targets a portion of the Huntingtin gene comprising a SNP.

For injection, the agents of the disclosure may be formulated and diluted in aqueous solutions, such as in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer. For such transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

Use of pharmaceutically acceptable inert carriers to formulate the compounds herein disclosed for the practice of the disclosure into dosages suitable for systemic administration is within the scope of the disclosure. With proper choice of carrier and suitable manufacturing practice, the compositions of the present disclosure, in particular, those formulated as solutions, may be administered parenterally, such as by intravenous injection.

The compounds can be formulated readily using pharmaceutically acceptable carriers well known in the art into dosages suitable for oral administration. Such carriers enable the compounds of the disclosure to be formulated as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject (e.g., patient) to be treated.

For nasal or inhalation delivery, the agents of the disclosure may also be formulated by methods known to those of skill in the art, and may include, for example, but not limited to, examples of solubilizing, diluting, or dispersing substances such as, saline, preservatives, such as benzyl alcohol, absorption promoters, and fluorocarbons.

In certain embodiments, oligonucleotides and compositions are delivered to the CNS. In certain embodiments, oligonucleotides and compositions are delivered to the cerebrospinal fluid. In certain embodiments, oligonucleotides and compositions are administered to the brain parenchyma. In certain embodiments, oligonucleotides and compositions are delivered to an animal/subject by intrathecal administration, or intracerebroventricular administration. Broad distribution of oligonucleotides and compositions, described herein, within the central nervous system may be achieved with intraparenchymal administration, intrathecal administration, or intracerebroventricular administration.

In certain embodiments, parenteral administration is by injection, by, e.g., a syringe, a pump, etc. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue, such as striatum, caudate, cortex, hippocampus and cerebellum.

In certain embodiments, methods of specifically localizing a pharmaceutical agent, such as by bolus injection, decreases median effective concentration (EC50) by a factor of 20, 25, 30, 35, 40, 45 or 50. In certain embodiments, the pharmaceutical agent in an antisense compound as further described herein. In certain embodiments, the targeted tissue is brain tissue. In certain embodiments the targeted tissue is striatal tissue. In certain embodiments, decreasing EC50 is desirable because it reduces the dose required to achieve a pharmacological result in a patient in need thereof.

In certain embodiments, an antisense oligonucleotide is delivered by injection or infusion once every month, every two months, every 90 days, every 3 months, every 6 months, twice a year or once a year.

Pharmaceutical compositions suitable for use in the present disclosure include compositions wherein the active ingredients are contained in an effective amount to achieve its intended purpose. Determination of the effective amounts is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. The preparations formulated for oral administration may be in the form of tablets, dragees, capsules, or solutions.

Pharmaceutical preparations for oral use can be obtained by combining the active compounds with solid excipients, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethyl-cellulose (CMC), and/or polyvinylpyrrolidone (PVP: povidone). If desired, disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol (PEG), and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dye-stuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin, and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols (PEGs). In addition, stabilizers may be added.

Depending upon the particular condition, or disease state, to be treated or prevented, additional therapeutic agents, which are normally administered to treat or prevent that condition, may be administered together with oligonucleotides of this disclosure. For example, chemotherapeutic agents or other anti-proliferative agents may be combined with the oligonucleotides of this disclosure to treat proliferative diseases and cancer. Examples of known chemotherapeutic agents include, but are not limited to, adriamycin, dexamethasone, vincristine, cyclophosphamide, fluorouracil, topotecan, taxol, interferons, and platinum derivatives.

The function and advantage of these and other embodiments of the present disclosure will be more fully understood from the examples described below. The following examples are intended to illustrate the benefits of the present disclosure, but do not exemplify the full scope of the disclosure.

Lipids

In some embodiments, provided oligonucleotide compositions further comprise one or more lipids. In some embodiments, the lipids are conjugated to provided oligonucleotides in the compositions. In some embodiments, two or more same or different lipids can be conjugated to one oligonucleotide, through either the same or differently chemistry and/or locations. In some embodiments, a composition can comprise an oligonucleotide disclosed herein (as non-limiting examples, a chirally controlled oligonucleotide composition, or a chirally controlled oligonucleotide composition wherein the sequence of the oligonucleotide comprises, consists of or is the sequence of any oligonucleotide disclosed herein, or a chirally controlled oligonucleotide composition wherein the sequence of the oligonucleotide comprises, consists of or is the sequence of any oligonucleotide disclosed in Table 8 or any other Table herein, etc.) and a lipid. In some embodiments, a provided oligonucleotide comprises base sequence, pattern of backbone linkages, pattern or backbone chiral centers, and/or pattern of chemical modifications (e.g., base modifications, sugar modifications, etc.) of any oligonucleotide disclosed herein, and is conjugated to a lipid. In some embodiments, a provided composition comprises an oligonucleotide disclosed herein and a lipid, wherein the lipid is conjugated to the oligonucleotide.

In some embodiments, the present disclosure provides a composition comprising an oligonucleotide amd a lipid. Many lipids can be utilized in provided technologies in accordance with the present disclosure.

In some embodiments, a lipid comprises an RLD group, wherein RLD is an optionally substituted, C10-C80 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein:

  • each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or:
    • two R′ are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
  • -Cy- is an optionally substituted bivalent ring selected from carbocyclylene, arylene, heteroarylene, and heterocyclylene; and
  • each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl.

In some embodiments, a lipid comprises an RLD group, wherein RLD is an optionally substituted, C10-C60 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein:

  • each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or:
    • two R′ are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
  • -Cy- is an optionally substituted bivalent ring selected from carbocyclylene, arylene, heteroarylene, and heterocyclylene; and
  • each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl.

In some embodiments, a lipid comprises an RLD group, wherein RLD is an optionally substituted, C10-C40 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein:

  • each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or:
    • two R′ are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
  • -Cy- is an optionally substituted bivalent ring selected from carbocyclylene, arylene, heteroarylene, and heterocyclylene; and
  • each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl.

In some embodiments, RLD is an optionally substituted, C10-C80 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, and -Cy-. In some embodiments, RLD is an optionally substituted, C10-C60 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, and -Cy-. In some embodiments, RLD is a hydrocarbon group consisting carbon and hydrogen atoms.

In some embodiments, RLD is an optionally substituted, C10-C60 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, and -Cy-. In some embodiments, RLD is an optionally substituted, C10-C60 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, and -Cy-. In some embodiments, RLD is a hydrocarbon group consisting carbon and hydrogen atoms.

In some embodiments, RLD is an optionally substituted, C10-C40 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, and -Cy-. In some embodiments, RLD is an optionally substituted, C10-C60 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, and -Cy-. In some embodiments, RLD is a hydrocarbon group consisting carbon and hydrogen atoms.

The aliphatic group of RLD can be a variety of suitable length. In some embodiments, it is C10-C80. In some embodiments, it is C10-C75. In some embodiments, it is C10-C70. In some embodiments, it is C10-C65. In some embodiments, it is C10-C60. In some embodiments, it is C10-C50. In some embodiments, it is C10-C40. In some embodiments, it is C10-C35. In some embodiments, it is C10-C30. In some embodiments, it is C10-C25. In some embodiments, it is C10-C24. In some embodiments, it is C10-C23. In some embodiments, it is C10-C22. In some embodiments, it is C10-C21. In some embodiments, it is C12-C22. In some embodiments, it is C13-C22. In some embodiments, it is C14-C22. In some embodiments, it is C15-C22. In some embodiments, it is C16-C22. In some embodiments, it is C17-C22. In some embodiments, it is C18-C22. In some embodiments, it is C10-C20. In some embodiments, the lower end of the range is C10, C11, C12, C13, C14, C15, C16, C17, or C18. In some embodiments, the higher end of the range is Cis, C19, C20, C21, C22, C23, C24, C25, C26, C27, C28, C29, C30, C35, C40, C45, C50, C55, or C60. In some embodiments, it is C10. In some embodiments, it is C11. In some embodiments, it is C12. In some embodiments, it is C13. In some embodiments, it is C14. some embodiments, it is Cis. In some embodiments, it is C16. In some embodiments, it is C17. In some embodiments, it is Cis. In some embodiments, it is C19. In some embodiments, it is C20. In some embodiments, it is C21. In some embodiments, it is C22. In some embodiments, it is C23. In some embodiments, it is C24. In some embodiments, it is C25. In some embodiments, it is C30. In some embodiments, it is C35. In some embodiments, it is C40. In some embodiments, it is C45. In some embodiments, it is C50. In some embodiments, it is C55. In some embodiments, it is C60.

In some embodiments, a lipid comprises no more than one RLD group. In some embodiments, a lipid comprises two or more RLD groups.

In some embodiments, a lipid is conjugated to a biologically active agent, optionally through a linker, as a moiety comprising an RLD group. In some embodiments, a lipid is conjugated to a biologically active agent, optionally through a linker, as a moiety comprising no more than one RLD group. In some embodiments, a lipid is conjugated to a biologically active agent, optionally through a linker, as an RLD group. In some embodiments, a lipid is conjugated to a biologically active agent, optionally through a linker, as a moiety comprising two or more RLD groups.

In some embodiments, RLD is an optionally substituted, C10-C40 saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises an optionally substituted C10-C40 saturated or partially unsaturated, aliphatic chain.

In some embodiments, RLD is an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, RLD is a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic groups. In some embodiments, a lipid comprises a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic groups. In some embodiments, RLD is a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-2 aliphatic groups. In some embodiments, a lipid comprises a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-2 aliphatic groups. In some embodiments, RLD is a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more methyl groups. In some embodiments, a lipid comprises a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more methyl groups.

In some embodiments, RLD is an unsubstituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises an unsubstituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises no more than one optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises two or more optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, RLD is an optionally substituted, C10-C60 saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises an optionally substituted C10-C60 saturated or partially unsaturated, aliphatic chain.

In some embodiments, RLD is an optionally substituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises an optionally substituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, RLD is a C10-C60 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic groups. In some embodiments, a lipid comprises a C10-C60 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic groups. In some embodiments, RLD is a C10-C60 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-2 aliphatic groups. In some embodiments, a lipid comprises a C10-C60 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-2 aliphatic groups. In some embodiments, RLD is a C10-C60 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more methyl groups. In some embodiments, a lipid comprises a C10-C60 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more methyl groups.

In some embodiments, RLD is an unsubstituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises an unsubstituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises no more than one optionally substituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises two or more optionally substituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, RLD is an optionally substituted, C10-C80 saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises an optionally substituted C10-C80 saturated or partially unsaturated, aliphatic chain.

In some embodiments, RLD is an optionally substituted C10-C80 linear, saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises an optionally substituted C10-C80 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, RLD is a C10-C80 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic groups. In some embodiments, a lipid comprises a C10-C80 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic groups. In some embodiments, RLD is a C10-C80 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-2 aliphatic groups. In some embodiments, a lipid comprises a C10-C80 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-2 aliphatic groups. In some embodiments, RLD is a C10-C80 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more methyl groups. In some embodiments, a lipid comprises a C10-C80 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more methyl groups.

In some embodiments, RLD is an unsubstituted C10-C80 linear, saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises an unsubstituted C10-C80 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, a lipid comprises no more than one optionally substituted C10-C80 linear, saturated or partially unsaturated, aliphatic chain. In some embodiments, a lipid comprises two or more optionally substituted C10-C80 linear, saturated or partially unsaturated, aliphatic chain.

In some embodiments, RLD is or comprises a C10 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C10 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C11 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C11 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C12 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C12 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C13 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C13 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C14 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C14 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C15 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C15 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C16 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C16 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C17 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C17 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a Cis saturated linear aliphatic chain. In some embodiments, RLD is or comprises a Cis partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C19 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C19 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C20 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C20 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C21 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C21 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C22 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C22 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C23 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C23 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C24 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C24 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C25 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C25 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C26 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C26 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C27 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C27 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C28 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C28 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C29 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C29 partially unsaturated linear aliphatic chain. In some embodiments, RLD is or comprises a C30 saturated linear aliphatic chain. In some embodiments, RLD is or comprises a C30 partially unsaturated linear aliphatic chain.

In some embodiments, a lipid has the structure of RLD—OH. In some embodiments, a lipid has the structure of RLD—C(O)OH. In some embodiments, RLD is

In some embodiments, a lipid is lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (DHA or cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl. In some embodiments, a lipid is lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (DHA or cis-DHA), turbinaric acid, and dilinoleyl. In some embodiments, a lipid has a structure of:

In some embodiments, a lipid is, comprises or consists of any of: an at least partially hydrophobic or amphiphilic molecule, a phospholipid, a triglyceride, a diglyceride, a monoglyceride, a fat-soluble vitamin, a sterol, a fat and a wax. In some embodiments, a lipid is any of: a fatty acid, glycerolipid, glycerophospholipid, sphingolipid, sterol lipid, prenol lipid, saccharolipid, polyketide, and other molecule.

Lipids can be incorporated into provided technologies through many types of methods in accordance with the present disclosure. In some embodiments, lipids are physically mixed with provided oligonucleotides to form provided compositions. In some embodiments, lipids are chemically conjugated with oligonucleotides.

In some embodiments, provided compositions comprise two or more lipids. In some embodiments, provided oligonucleotides comprise two or more conjugated lipids. In some embodiments, the two or more conjugated lipids are the same. In some embodiments, the two or more conjugated lipids are different. In some embodiments, provided oligonucleotides comprise no more than one lipid. In some embodiments, oligonucleotides of a provided composition comprise different types of conjugated lipids. In some embodiments, oligonucleotides of a provided composition comprise the same type of lipids.

Lipids can be conjugated to oligonucleotides optionally through linkers. Various types of linkers in the art can be utilized in accordance of the present disclosure. In some embodiments, a linker comprise a phosphate group, which can, for example, be used for conjugating lipids through chemistry similar to those employed in oligonucleotide synthesis. In some embodiments, a linker comprises an amide, ester, or ether group. In some embodiments, a linker has the structure of -L-. In some embodiments, after conjugation to oligonucleotides, a lipid forms a moiety having the structure of -L-RLD, wherein each of L and RLD is independently as defined and described herein.

In some embodiments, -L- comprises a bivalent aliphatic chain. In some embodiments, -L- comprises a phosphate group. In some embodiments, -L- comprises a phosphorothioate group. In some embodiments, -L- has the structure of —C(O)NH—(CH2)6—OP(═O)(S−)—.

Lipids, optionally through linkers, can be conjugated to oligonucleotides at various suitable locations. In some embodiments, lipids are conjugated through the 5′-OH group. In some embodiments, lipids are conjugated through the 3′-OH group. In some embodiments, lipids are conjugated through one or more sugar moieties. In some embodiments, lipids are conjugated through one or more bases. In some embodiments, lipids are incorporated through one or more internucleotidic linkages. In some embodiments, an oligonucleotide may contain multiple conjugated lipids which are independently conjugated through its 5′-OH, 3′-OH, sugar moieties, base moieties and/or internucleotidic linkages.

In some embodiments, a lipid is conjugated to an oligonucleotide optionally through a linker moiety. A person having ordinary skill in the art appreciates that various technologies can be utilized to conjugate lipids to an oligonucleotide in accordance with the present disclosure. For example, for lipids comprising carboxyl groups, such lipids can be conjugated through the carboxyl groups. In some embodiments, a lipid is conjugated through a linker having the structure of -L-, wherein L is as defined and described in formula I. In some embodiments, L comprises a phosphate diester or modified phosphate diester moiety. In some embodiments, a compound formed by lipid conjugation has the structure of (RLD-L-)x-(oligonucleotide), wherein x is 1 or an integer greater than 1, and each of RLD and L is independently as defined and described herein. In some embodiments, x is 1. In some embodiments, x is greater than 1. In some embodiments, an oligonucleotide is an oligonucleotide. For example, in some embodiments, a conjugate has the following structures:

In some embodiments, a linker is selected from: an uncharged linker; a charged linker; a linker comprising an alkyl; a linker comprising a phosphate; a branched linker; an unbranched linker; a linker comprising at least one cleavage group; a linker comprising at least one redox cleavage group; a linker comprising at least one phosphate-based cleavage group; a linker comprising at least one acid-cleavage group; a linker comprising at least one ester-based cleavage group; and a linker comprising at least one peptide-based cleavage group.

In some embodiments, a lipid is not conjugated to an oligonucleotide.

In some embodiments, the present disclosure pertains to compositions and methods related to a composition comprising an oligonucleotide and a lipid comprising a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, wherein the lipid is conjugated to the biologically active agent. In some embodiments, the present disclosure pertains to compositions and methods related to a composition comprising an oligonucleotide and a lipid comprising a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic group, wherein the lipid is conjugated to the biologically active agent.

In some embodiments, the present disclosure pertains to compositions and methods related to a composition comprising an oligonucleotide and a lipid comprising a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, wherein the lipid is not conjugated to the biologically active agent. In some embodiments, the present disclosure pertains to compositions and methods related to a composition comprising an oligonucleotide and a lipid comprising a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic group, wherein the lipid is not conjugated to the biologically active agent.

In some embodiments, a composition comprises an oligonucleotide and a lipid selected from: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl, wherein the lipid is not conjugated to the biologically active agent. In some embodiments, a composition comprises an oligonucleotide and a lipid selected from: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl, wherein the lipid is not conjugated to the biologically active agent.

In some embodiments, a composition comprises an oligonucleotide and a lipid selected from: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl, wherein the lipid is conjugated to the biologically active agent. In some embodiments, a composition comprises an oligonucleotide and a lipid selected from: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl, wherein the lipid is conjugated to the biologically active agent.

In some embodiments, a composition comprises an oligonucleotide and a lipid selected from: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl, wherein the lipid is directly conjugated to the biologically active agent (without a linker interposed between the lipid and the biologically active agent). In some embodiments, a composition comprises an oligonucleotide and a lipid selected from: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl, wherein the lipid is directly conjugated to the biologically active agent (without a linker interposed between the lipid and the biologically active agent).

In some embodiments, a composition comprises an oligonucleotide and a lipid selected from: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl, wherein the lipid is indirectly conjugated to the biologically active agent (with a linker interposed between the lipid and the biologically active agent). In some embodiments, a composition comprises an oligonucleotide and a lipid selected from: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl, wherein the lipid is indirectly conjugated to the biologically active agent (with a linker interposed between the lipid and the biologically active agent).

A linker is a moiety that connects two parts of a composition; as a non-limiting example, a linker physically connects an oligonucleotide to a lipid.

Non-limiting examples of suitable linkers include: an uncharged linker; a charged linker; a linker comprising an alkyl; a linker comprising a phosphate; a branched linker; an unbranched linker; a linker comprising at least one cleavage group; a linker comprising at least one redox cleavage group; a linker comprising at least one phosphate-based cleavage group; a linker comprising at least one acid-cleavage group; a linker comprising at least one ester-based cleavage group; a linker comprising at least one peptide-based cleavage group.

In some embodiments, a linker comprises an uncharged linker or a charged linker.

In some embodiments, a linker comprises an alkyl.

In some embodiments, a linker comprises a phosphate. In various embodiments, a phosphate can also be modified by replacement of bridging oxygen, (i.e. oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates). The replacement can occur at the either linking oxygen or at both the linking oxygens. When the bridging oxygen is the 3′-oxygen of a nucleoside, replacement with carbon can be done. When the bridging oxygen is the 5′-oxygen of a nucleoside, replacement with nitrogen can be done. In various embodiments, the linker comprising a phosphate comprises any one or more of: a phosphorodithioate, phosphoramidate, boranophosphonoate, or a compound of formula (I):

where R3 is selected from OH, SH, NH2, BH3, CH3, C1-6 alkyl, C6-10 aryl, C1-6 alkoxy and C6-io aryloxy, wherein C1-6 alkyl and C6-io aryl are unsubstituted or optionally independently substituted with 1 to 3 groups independently selected from halo, hydroxyl and NH2; and R4 is selected from O, S, NH, or CH2.

In some embodiments, a linker comprises a direct bond or an atom such as oxygen or sulfur, a unit such as NR1, C(O), C(O)NH, SO, SO2, SO2NH or a chain of atoms, such as substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, where one or more methylenes can be interrupted or terminated by O, S, S(O), SO2, N(R1)2, C(O), cleavable linking group, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R1 is hydrogen, acyl, aliphatic or substituted aliphatic.

In some embodiments, a linker is a branched linker. In some embodiments, a branchpoint of the branched linker may be at least trivalent, but may be a tetravalent, pentavalent or hexavalent atom, or a group presenting such multiple valencies. In some embodiments, a branchpoint is —N, —N(Q)-C, —O—C, —S—C, —SS—C, —C(O)N(Q)-C, —OC(O)N(Q)-C, —N(Q)C(O)—C, or —N(Q)C(O)O—C; wherein Q is independently for each occurrence H or optionally substituted alkyl. In other embodiment, the branchpoint is glycerol or glycerol derivative.

In one embodiment, a linker comprises at least one cleavable linking group.

As a non-limiting example, a cleavable linking group can be sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. As a non-limiting example, a cleavable linking group is cleaved at least 10 times or more, at least 100 times faster in the target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum). Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

As a non-limiting example, a cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a desired pH, thereby releasing the cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

As a non-limiting example, a linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, liver targeting ligands can be linked to the cationic lipids through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

As a non-limiting example, a linker can contain a peptide bond, which can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

As a non-limiting example, suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It may be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. As a non-limiting example, useful candidate compounds are cleaved at least 2, 4, 10 or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

In some embodiments, a linker comprises a redox cleavable linking group. As a non-limiting example, one class of cleavable linking groups are redox cleavable linking groups that are cleaved upon reduction or oxidation. A non-limiting example of reductively cleavable linking group is a disulphide linking group (—S—S—). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. As a non-limiting example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. As a non-limiting example, candidate compounds are cleaved by at most 10% in the blood. As a non-limiting example, useful candidate compounds are degraded at least 2, 4, 10 or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

In some embodiments, a linker comprises a phosphate-based cleavable linking groups are cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are —O—P(O)(ORk)-O—, —O—P(S)(ORk)-O—, —O—P(S)(SRk)-O—, —S—P(O)(ORk)-O—, —O—P(O)(ORk)-S—, —S—P(O)(ORk)-S—, —O—P(S)(ORk)-S—, —S—P(S)(ORk)-O—, —O—P(O)(Rk)-O—, —O—P(S)(Rk)-O—, —S—P(O)(Rk)-O—, —S—P(S)(Rk)-O—, —S—P(O)(Rk)-S—, —O—P(S)(Rk)-S—. Additional non-limiting examples are —O—P(O)(OH)—O—, —O—P(S)(OH)—O—, —O—P(S)(SH)—O—, —S—P(O)(OH)—O—, —O—P(O)(OH)—S—, —S—P(O)(OH)—S—, —O—P(S)(OH)—S—, —S—P(S)(OH)—O—, —O—P(O)(H)—O—, —O—P(S)(H)—O—, —S—P(O)(H)—O—, —S—P(S)(H)—O—, —S—P(O)(H)—S—, —O—P(S)(H)—S—. An additional non-limiting examples is —O—P(O)(OH)—O—.

In some embodiments, a linker comprises an acid cleavable linking groups are linking groups that are cleaved under acidic conditions. As a non-limiting example, acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula —C═NN—, C(O)O, or —OC(O). In an additional non-limiting example, when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl.

In some embodiments, a linker comprises an ester-based linking groups. As a non-limiting example, ester-based cleavable linking groups are cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula —C(O)O—, or —OC(O)—. These candidates can be evaluated using methods analogous to those described above.

In some embodiments, a linker comprises a peptide-based cleaving group. Peptide-based cleavable linking groups are cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. As a non-limiting example, peptide-based cleavable groups do not include the amide group (—C(O)NH—). The amide group can be formed between any alkylene, alkenylene or alkynylene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. As a non-limiting example, a peptide based cleavage group can be limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. As a non-limiting example, a peptide-based cleavable linking groups can have the general formula —NHCHRAC(O)NHCHRBC(O)—, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

Any linker reported in the art can be used, including, as non-limiting examples, those described in: U.S. Pat. App. No. 20150265708.

A non-limiting example of a method of conjugating a lipid and an oligonucleotide is presented in Example 1.

A non-limiting example of a linker is a C6 amino linker.

Target Components

In some embodiments, a provided composition further comprises a targeting component (targeting compound or moiety). A target component can be either conjugated or not conjugated to a lipid or a biologically active agent. In some embodiments, a target component is conjugated to a biologically active agent. In some embodiments, a biologically active agent is conjugated to both a lipid and a targeting component. As described in here, in some embodiments, a biologically active agent is a provided oligonucleotide. Thus, in some embodiments, a provided oligonucleotide composition further comprises, besides a lipid and oligonucleotides, a target elements. Various targeting components can be used in accordance with the present disclosure, e.g., lipids, antibodies, peptides, carbohydrates, etc.

Target components can be incorporated into provided technologies through many types of methods in accordance with the present disclosure. In some embodiments, target components are physically mixed with provided oligonucleotides to form provided compositions. In some embodiments, target components are chemically conjugated with oligonucleotides.

In some embodiments, provided compositions comprise two or more target components. In some embodiments, provided oligonucleotides comprise two or more conjugated target components. In some embodiments, the two or more conjugated target components are the same. In some embodiments, the two or more conjugated target components are different. In some embodiments, provided oligonucleotides comprise no more than one target component. In some embodiments, oligonucleotides of a provided composition comprise different types of conjugated target components. In some embodiments, oligonucleotides of a provided composition comprise the same type of target components.

Target components can be conjugated to oligonucleotides optionally through linkers. Various types of linkers in the art can be utilized in accordance of the present disclosure. In some embodiments, a linker comprise a phosphate group, which can, for example, be used for conjugating target components through chemistry similar to those employed in oligonucleotide synthesis. In some embodiments, a linker comprises an amide, ester, or ether group. In some embodiments, a linker has the structure of -L-. Target components can be conjugated through either the same or different linkers compared to lipids.

Target components, optionally through linkers, can be conjugated to oligonucleotides at various suitable locations. In some embodiments, target components are conjugated through the 5′-OH group. In some embodiments, target components are conjugated through the 3′-OH group. In some embodiments, target components are conjugated through one or more sugar moieties. In some embodiments, target components are conjugated through one or more bases. In some embodiments, target components are incorporated through one or more internucleotidic linkages. In some embodiments, an oligonucleotide may contain multiple conjugated target components which are independently conjugated through its 5′-OH, 3′-OH, sugar moieties, base moieties and/or internucleotidic linkages. Target components and lipids can be conjugated either at the same, neighboring and/or separated locations. In some embodiments, a target component is conjugated at one end of an oligonucleotide, and a lipid is conjugated at the other end.

In some embodiments, the oligonucleotide or oligonucleotides in a chirally controlled oligonucleotide composition is or are antisense oligonucleotide or oligonucleotides. In some embodiments, the sequence of the oligonucleotide(s) comprises or consists of the sequence of any oligonucleotide disclosed herein. In some embodiments, provided oligonucleotides comprise base sequence, pattern of backbone linkages, pattern or backbone chiral centers, and/or pattern of chemical modifications (e.g., base modifications, sugar modifications, etc.) of any oligonucleotide disclosed herein. In some embodiments, the sequence of the oligonucleotide(s) comprises or consists of the sequence of any oligonucleotide disclosed in Table 8.

In some embodiments, an antisense oligonucleotide is an oligonucleotide which participates in RNaseH-mediated cleavage; for example, an antisense oligonucleotide hybridizes in a sequence-specific manner to a portion of a target mRNA, thus targeting the mRNA for cleavage by RNaseH. In some embodiments, an antisense oligonucleotide is able to differentiate between different alleles of the same gene or target. In some embodiments, an antisense oligonucleotide is able to differentiate between a wild-type and a mutant allele of a target. In some embodiments, an antisense oligonucleotide significantly participates in RNaseH-mediated cleavage of a mutant allele but participates in RNaseH-mediated cleavage of a wild-type allele to a much less degree (e.g., does not significantly participate in RNaseH-mediated cleavage of the wild-type allele of the target). In some embodiments, an antisense oligonucleotide is capable of participating in RNAseH-mediated cleavage of a nucleic acid comprising a mutation. In some embodiments, an antisense oligonucleotide targets a mutant allele. In some embodiments, an antisense oligonucleotide targets a mutant allele of the Huntingtin gene.

In some embodiments, an antisense oligonucleotide is able to differentiate between a wild-type and a mutant allele of a target in the Huntingtin gene.

In some embodiments, the present disclosure pertains to:

A method for inhibiting expression of a mutant Huntingtin gene in a mammal comprising preparing a composition comprising a lipid and an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene) and administering the composition to the mammal.

A method of treating a disease that is caused by the over-expression of a mutant Huntingtin gene in a subject, said method comprising the administration of a composition comprising a lipid and an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene).

A method of treating Huntington's Disease, said method comprising the administration of a composition comprising a lipid and an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene).

A method for treating a sign and/or symptom of Huntington's Disease in a subject by providing a composition comprising a lipid and an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene) and administering a therapeutically effective amount of the composition to the subject.

A method of administering an oligonucleotide to a subject in need thereof, comprising steps of providing a composition comprising an oligonucleotide and a lipid, and administering the composition to the subject, wherein the biologically active compound is an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene), and wherein the lipid is any lipid disclosed herein.

A method of treating a disease in a subject, the method comprising steps of providing a composition comprising an oligonucleotide and a lipid, and administering a therapeutically effective amount of the composition to the subject, wherein the biologically active compound is an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene), and wherein the lipid is any lipid disclosed herein, and wherein the disease is any disease disclosed herein.

A method for inhibiting expression of a mutant Huntingtin gene in a mammal, the method comprising steps of preparing a composition comprising a lipid and an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene) and administering the composition to the mammal.

A method of administering a biologically active agent to a subject in need thereof, comprising steps of providing a composition comprising a biologically active agent and a lipid, and administering the composition to the subject, wherein the biologically active compound is an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene), and wherein the lipid is any lipid disclosed herein.

A method of treating Huntington's Disease in a subject, the method comprising steps of providing a composition comprising a biologically active agent and a lipid, and administering a therapeutically effective amount of the composition to the subject, wherein the biologically active compound is an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene), and wherein the lipid is any lipid disclosed herein.

A method for mediating RNAseH-mediated cleavage of a nucleic acid comprising a mutant Huntingtin gene in a mammal, the method comprising steps of preparing a composition comprising a lipid and an antisense oligonucleotide and administering the composition to the mammal.

A method of treating a disease that is caused by a mutation in a Huntingtin gene, said method comprising the administration of a composition comprising a lipid and an antisense oligonucleotide, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation.

A method for treating a sign and/or symptom of Huntington's Disease in a subject by providing a composition comprising a lipid and an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene) and administering a therapeutically effective amount of the composition to the subject.

A method of administering an oligonucleotide to a subject in need thereof, comprising steps of providing a composition comprising an oligonucleotide and a lipid, and administering the composition to the subject, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising a mutation, and wherein the lipid is any lipid disclosed herein.

A method of treating Huntington's Disease in a subject, wherein the disease or disorder is related to a mutation in a gene, the method comprising steps of providing a composition comprising an oligonucleotide and a lipid, and administering a therapeutically effective amount of the composition to the subject, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation, and wherein the lipid is any lipid disclosed herein.

A method for mediating RNAseH-mediated cleavage of a nucleic acid comprising a mutant Huntingtin gene in a mammal, the method comprising steps of preparing a composition comprising a lipid and an antisense oligonucleotide and administering the composition to the mammal.

A method of treating a disease related to a mutation in the Huntingtin gene, said method comprising the administration of a composition comprising a lipid and an antisense oligonucleotide, wherein the antisense oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation.

A method of treating a disease that is caused by a mutation in the Huntingtin gene, said method comprising the administration of a composition comprising a lipid and an oligonucleotide, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation.

A method for treating a sign and/or symptom of Huntington's Disease in a subject by providing a composition comprising a lipid and an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene) and administering a therapeutically effective amount of the composition to the subject.

A method of administering an oligonucleotide to a subject in need thereof, comprising steps of providing a composition comprising an oligonucleotide and a lipid, and administering the composition to the subject, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation, and wherein the lipid is any lipid disclosed herein.

A method of treating Huntington's Disease in a subject, wherein the Huntington's Disease is related to a mutation in the Huntingtin gene, the method comprising steps of providing a composition comprising an oligonucleotide and a lipid, and administering a therapeutically effective amount of the composition to the subject, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation, and wherein the lipid is any lipid disclosed herein.

A method for mediating RNAseH-mediated cleavage of a nucleic acid comprising a mutant Huntingtin gene in a mammal, the method comprising steps of preparing a composition comprising a lipid and an antisense oligonucleotide and administering the composition to the mammal, wherein the lipid is any lipid disclosed herein, and wherein the sequence of the antisense oligonucleotide comprises or consists of the sequence of any antisense oligonucleotide disclosed herein (e.g., in Table 8). In some embodiments, provided oligonucleotides comprise base sequence, pattern of backbone linkages, pattern or backbone chiral centers, and/or pattern of chemical modifications (e.g., base modifications, sugar modifications, etc.) of any oligonucleotide disclosed herein (e.g., in Table 8).

A method of treating a disease related to a mutation in the Huntingtin gene, said method comprising the administration of a composition comprising a lipid and an antisense oligonucleotide, wherein the antisense oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation, wherein the lipid is any lipid disclosed herein, and wherein the sequence of the antisense oligonucleotide comprises or consists of the sequence of any antisense oligonucleotide disclosed herein (e.g., in Table 8).

A method of treating a disease that is caused by a mutation in the Huntingtin gene, said method comprising the administration of a composition comprising a lipid and an oligonucleotide, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation, wherein the lipid is any lipid disclosed herein, and wherein the oligonucleotide comprises or consists of the sequence of any antisense oligonucleotide disclosed herein (e.g., in Table 8).

A method for treating a sign and/or symptom of Huntington's Disease in a subject by providing a composition comprising a lipid and an oligonucleotide (as a non-limiting example, an antisense oligonucleotide that targets a mutant allele of the Huntingtin gene) and administering a therapeutically effective amount of the composition to the subject, wherein the lipid is any lipid disclosed herein, and wherein the sequence of the oligonucleotide comprises or consists of the sequence of any antisense oligonucleotide disclosed herein (e.g., in Table 8).

A method of administering an oligonucleotide to a subject in need thereof, comprising steps of providing a composition comprising an oligonucleotide and a lipid, and administering the composition to the subject, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation, and wherein the lipid is any lipid disclosed herein, wherein the lipid is any lipid disclosed herein, and wherein the sequence of the oligonucleotide comprises or consists of the sequence of any antisense oligonucleotide disclosed herein (e.g., in Table 8).

A method of treating Huntington's Disease in a subject, wherein the Huntington's Disease is related to a mutation in the Huntingtin gene, the method comprising steps of providing a composition comprising an oligonucleotide and a lipid, and administering a therapeutically effective amount of the composition to the subject, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a nucleic acid comprising the mutation, and wherein the lipid is any lipid disclosed herein, and wherein the oligonucleotide comprises or consists of the sequence of any antisense oligonucleotide disclosed herein (e.g., in Table 8).

In some embodiments, provided oligonucleotides comprise base sequence, pattern of backbone linkages, pattern or backbone chiral centers, and/or pattern of chemical modifications (e.g., base modifications, sugar modifications, etc.) of any oligonucleotide disclosed herein.

In some embodiments, an oligonucleotide composition comprises a plurality of oligonucleotides, which share:

1) a common base sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone phosphorus modifications;

wherein one or more oligonucleotides of the plurality are individually conjugated to a lipid.

In some embodiments, a chirally controlled oligonucleotide composition comprises a plurality of oligonucleotides, which share:

1) a common base sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone phosphorus modifications;

wherein:

the composition is chirally controlled in that the plurality of oligonucleotides share the same stereochemistry at one or more chiral internucleotidic linkages;

one or more oligonucleotides of the plurality are individually conjugated to a lipid; and

one or more oligonucleotides of the plurality are optionally and individually conjugated to a targeting compound or moiety.

In some embodiments, an antisense oligonucleotide is in a chirally controlled oligonucleotide composition. In some embodiments, an oligonucleotide is in a chirally controlled oligonucleotide composition.

Various oligonucleotides are listed in Table 8. Many of these are capable of participating in RNaseH-mediated cleavage of the human Huntingtin gene, as shown in data presented in U.S. Pat. Application No. 62/195,779, filed Jul. 22, 2015, and U.S. Pat. Application No. 62/331,960, filed May 4, 2016, which are incorporated by reference in its entirety; and in data shown here.

Various oligonucleotides particularly capable of participating in RNaseH-mediated cleavage of human Huntingtin gene target or a mutant variant thereof include: WV-1092, WVE120101, WV-2603 or WV-2595, or any other nucleic acid disclosed herein (including, but not limited to, those listed in Table 8).

Any oligonucleotide or chirally controlled oligonucleotide composition can be used in combination with any method or composition (e.g., any pharmaceutical composition, modification, and/or method of use and/or manufacture) disclosed herein.

In some embodiments, the present disclosure provides the following embodiments:

1. A chirally controlled oligonucleotide composition comprising oligonucleotides defined by having:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that a predetermined level of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.

2. A chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type.
2a. A chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type, wherein the oligonucleotides target a mutant Huntingtin gene, and the length is from about 10 to about 50 nucleotides, wherein the backbone linkages comprise at least one phosphorothioate, and wherein the pattern of backbone chiral centers comprises at least one chiral center in a Rp conformation and at least one chiral center in a Sp conformation.
3. A chirally controlled oligonucleotide composition comprising oligonucleotides defined by having:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that at least about 10% of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.

4. A composition of any one of the preceding embodiments, wherein the oligonucleotides comprise one or more wing regions and a common core region, wherein:

each wing region independently has a length of two or more bases, and independently and optionally comprises one or more chiral internucleotidic linkages; and

the core region independently has a length of two or more bases and independently comprises one or more chiral internucleotidic linkages.

5. An oligonucleotide composition comprising a predetermined level of oligonucleotides which comprise one or more wing regions and a common core region, wherein:

each wing region independently has a length of two or more bases, and independently and optionally comprises one or more chiral internucleotidic linkages;

the core region independently has a length of two or more bases, and independently comprises one or more chiral internucleotidic linkages, and the common core region has:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers.

6. An oligonucleotide composition comprising a predetermined level of oligonucleotides which comprise one or more wing regions and a common core region, wherein:

each wing region independently has a length of two or more bases, and independently and optionally comprises one or more chiral internucleotidic linkages;

the core region independently has a length of two or more bases, and independently comprises one or more chiral internucleotidic linkages, and the core region has:

1) a common base sequence;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers; and

4) a common pattern of backbone phosphorus modifications.

6a. A composition of any one of the preceding embodiments, wherein oligonucleotides of the oligonucleotide type comprises at least one wing region and a core region, wherein:

each wing region independently has a length of two or more bases, and independently and optionally comprises one or more chiral internucleotidic linkages;

the core region independently has a length of two or more bases, and independently comprises one or more chiral internucleotidic linkages; and

wherein at least one nucleotide in a wing region differs from at least one nucleotide of the core region, wherein the difference is in one or more of:

1) backbone linkage;

2) pattern of backbone chiral centers;

3) sugar modification.

7. A composition of any one of the preceding embodiments, wherein the oligonucleotides are defined by having a common pattern of backbone phosphorus modifications.
8. A composition of any one of the preceding embodiments, wherein the composition contains a predetermined level of oligonucleotides of an individual oligonucleotide type, wherein an oligonucleotide type is defined by:

1) base sequence;

2) pattern of backbone linkages;

3) pattern of backbone chiral centers; and

4) pattern of backbone phosphorus modifications.

9. A composition of any one of the preceding embodiments, wherein oligonucleotides having a common base sequence is of the same oligonucleotide type characterized by base sequence, pattern of backbone linkages, pattern of backbone chiral centers, and pattern of backbone phosphorus modifications.
10. A composition of any one of the preceding embodiments, wherein the composition contains predetermined levels of oligonucleotides of two or more individual oligonucleotide types, wherein an oligonucleotide type is defined by:

1) base sequence;

2) pattern of backbone linkages;

3) pattern of backbone chiral centers; and

4) pattern of backbone phosphorus modifications.

11. An oligonucleotide composition that is chirally controlled in that the composition contains a predetermined level of oligonucleotides of an individual oligonucleotide type, wherein an oligonucleotide type is defined by:

1) base sequence;

2) pattern of backbone linkages;

3) pattern of backbone chiral centers; and

4) pattern of backbone phosphorus modifications.

12. A composition of any one of the preceding embodiments, wherein the composition comprises two or more individual oligonucleotide types.
13. A composition of any one of the preceding embodiments, wherein an oligonucleotide type is defined by base identity, pattern of base modification, pattern of sugar modification, pattern of backbone linkages, pattern of backbone chiral centers, and pattern of backbone phosphorus modifications.
14. A composition of any one of the preceding embodiments, wherein oligonucleotides having a common sequence have identical structure.
15. A composition of any one of the preceding embodiments, wherein oligonucleotides of the same oligonucleotide type have identical structure.
16. A composition of any one of the preceding embodiments, wherein the oligonucleotides have one wing.
17. A composition of any one of the preceding embodiments, wherein the oligonucleotides are hemimers having the structure of wing-core.
18. A composition of any one of the preceding embodiments, wherein the oligonucleotides are hemimers having the structure of core-wing.
19. A composition of any one of embodiments 1-15, wherein the oligonucleotides have two wings.
20. A composition of any one of embodiments 1-15, wherein the oligonucleotides are gapmers having the structure of wing-core-wing.
21. A composition of any one of the preceding embodiments, wherein a wing comprises a chiral internucleotidic linkage.
22. A composition of any one of the preceding embodiments, wherein each wing independently comprises a chiral internucleotidic linkage.
23. A composition of any one of embodiments 1-17 and 19-22, wherein a wing to the 5′-end of the core comprises a chiral internucleotidic linkage at the 5′-end of the wing.
24. A composition of any one of embodiments 1-16 and 18-22, wherein a wing to the 3′-end of the core comprises a chiral internucleotidic linkage at the 3′-end of the wing.
25. A composition of any one the preceding embodiments, wherein a wing has only one chiral internucleotidic linkage, and each of the other internucleotidic linkages of the wing is a natural phosphate linkage

26. A composition of any one of the preceding embodiments, wherein the chiral internucleotidic linkage has the structure of formula I.
27. A composition of any one of the preceding embodiments, wherein a chiral internucleotidic linkage has the structure of formula I, and wherein X is S, and Y and Z are O.
28. A composition of any one of the preceding embodiments, wherein a chiral internucleotidic linkage is a phosphorothioate linkage.
29. A composition of any one of the preceding embodiments, wherein a chiral internucleotidic linkage is Sp.
30. A composition of any one of the preceding embodiments, wherein each chiral internucleotidic linkage is Sp.
31. A composition of any one of embodiments 1-29, wherein a chiral internucleotidic linkage is Rp.
32. A composition of any one of embodiments 1-28, wherein each chiral internucleotidic linkage is Rp.
33. A composition of any one of embodiments 1-31, wherein a wing comprises an Sp phosphorothioate linkage.
34. A composition of any one of embodiments 1-31, wherein each wing independently comprises an Sp phosphorothioate linkage.
35. A composition of any one of embodiments 1-17, 19-31, and 33-34, wherein a wing is to the 5′-end of the core, and the wing has an Sp phosphorothioate linkage.
36. A composition of any one of embodiments 1-17, 19-31, and 33-35, wherein a wing is to the 5′-end of the core, and the wing has an Sp phosphorothioate linkage at the 5′-end of the wing.
37. A composition of any one of embodiments 1-17, 19-31, and 33-36, wherein a wing is to the 5′-end of the core, the wing has an Sp phosphorothioate linkage at the 5′-end of the wing, and each of the other internucleotidic linkages of the wing is a natural phosphate linkage

38. A composition of any one of embodiments 1-16, 18-31 and 33-34, wherein a wing is to the 3′-end of the core, and the wing has an Sp phosphorothioate linkage at the 3′-end of the wing.
39. A composition of any one of embodiments 1-16, 18-31, 33-34 and 38, wherein a wing is to the 3′-end of the core, and the wing has an Sp phosphorothioate linkage at the 3′-end of the wing.
40. A composition of any one of embodiments 1-16, 18-31, 33-34 and 38-39, wherein one wing is to the 3′-end of the common core, the wing has an Sp phosphorothioate linkage at the 3′-end of the wing, and each of the other internucleotidic linkages of the wing is a natural phosphate linkage

41. A composition of any one of embodiments 1-29 and 31-40, wherein a wing comprises an Rp phosphorothioate linkage.
42. A composition of any one of embodiments 1-29 and 31-40, wherein each wing independently comprises an Rp phosphorothioate linkage.
43. A composition of any one of embodiments 1-17, 19-29 and 31-42, wherein a wing is to the 5′-end of the core, and the wing has an Rp phosphorothioate linkage.
44. A composition of any one of embodiments 1-17, 19-29 and 31-43, wherein a wing is to the 5′-end of the core, and the wing has an Rp phosphorothioate linkage at the 5′-end of the wing.
45. A composition of any one of embodiments 1-17, 19-29 and 31-44, wherein a wing is to the 5′-end of the core, the wing has an Rp phosphorothioate linkage at the 5′-end of the wing, and each of the other internucleotidic linkages of the wing is a natural phosphate linkage

46. A composition of any one of embodiments 1-16, 18-29 and 31-42, wherein a wing is to the 3′-end of the core, and the wing has an Rp phosphorothioate.
47. A composition of any one of embodiments 1-16, 18-29 and 31-42, wherein a wing is to the 3′-end of the core, and the wing has an Rp phosphorothioate linkage at the 3′-end of the wing.
48. A composition of any one of embodiments 1-16, 18-29 and 31-42, wherein one wing is to the 3′-end of the common core, the wing has an Rp phosphorothioate linkage at the 3′-end of the wing, and each of the other internucleotidic linkages of the wing is a natural phosphate linkage

49. A composition of any one of embodiments 1-28, wherein a wing is to the 5′-end of a core, and its 5′-end internucleotidic linkage is a chiral internucleotidic linkage.
50. A composition of any one of embodiments 1-28, wherein a wing is to the 5′-end of a core, and its 5′-end internucleotidic linkage is an Sp chiral internucleotidic linkage.
51. A composition of any one of embodiments 1-28, wherein a wing is to the 5′-end of a core, and its 5′-end internucleotidic linkage is an Rp chiral internucleotidic linkage.
52. A composition of any one of embodiments 1-28 and 49-51, wherein a wing is to the 3′-end of a core, and its 3′-end internucleotidic linkage is a chiral internucleotidic linkage.
53. A composition of any one of embodiments 1-28 and 49-51, wherein a wing is to the 3′-end of a core, and its 3′-end internucleotidic linkage is an Sp chiral internucleotidic linkage.
54. A composition of any one of embodiments 1-28 and 49-51, wherein a wing is to the 3′-end of a core, and its 3′-end internucleotidic linkage is an Rp chiral internucleotidic linkage.
55. A composition of any one of the preceding embodiments, wherein each wing independently comprises a natural phosphate linkage

56. A composition of any one of the preceding embodiments, wherein each wing independently comprises two or more natural phosphate linkages

57. A composition of any one of the preceding embodiments, wherein each wing independently comprises two or more natural phosphate linkages, and all natural phosphate linkages are consecutive.
58. A composition of any one of the preceding embodiments, wherein a wing has a length of three or more bases.
59. A composition of any one of the preceding embodiments, wherein one wing has a length of four or more bases.
60. A composition of any one of the preceding embodiments, wherein one wing has a length of five or more bases.
61. A composition of any one of the preceding embodiments, wherein one wing has a length of six or more bases.
62. A composition of any one of the preceding embodiments, wherein one wing has a length of seven or more bases.
63. A composition of any one of the preceding embodiments, wherein one wing has a length of eight or more bases.
64. A composition of any one of the preceding embodiments, wherein one wing has a length of nine or more bases.
65. A composition of any one of the preceding embodiments, wherein one wing has a length of ten or more bases.
66. A composition of any one of the preceding embodiments, wherein each wing independently has a length of three or more bases.
67. A composition of any one of the preceding embodiments, wherein each wing independently has a length of four or more bases.
68. A composition of any one of the preceding embodiments, wherein each wing independently has a length of five or more bases.
69. A composition of any one of the preceding embodiments, wherein each wing independently has a length of six or more bases.
70. A composition of any one of the preceding embodiments, wherein each wing independently has a length of seven or more bases.
71. A composition of any one of the preceding embodiments, wherein each wing independently has a length of eight or more bases.
72. A composition of any one of the preceding embodiments, wherein each wing independently has a length of nine or more bases.
73. A composition of any one of the preceding embodiments, wherein each wing independently has a length of ten or more bases.
74. A composition of any one of embodiments 1-57, wherein a wing has a length of two bases.
75. A composition of any one of embodiments 1-57, wherein a wing has a length of three bases.
76. A composition of any one of embodiments 1-57, wherein a wing has a length of four bases.
77. A composition of any one of embodiments 1-57, wherein a wing has a length of five bases.
78. A composition of any one of embodiments 1-57, wherein a wing has a length of six bases.
79. A composition of any one of embodiments 1-57, wherein a wing has a length of seven bases.
80. A composition of any one of embodiments 1-57, wherein a wing has a length of eight bases.
81. A composition of any one of embodiments 1-57, wherein a wing has a length of nine bases.
82. A composition of any one of embodiments 1-57, wherein a wing has a length of ten bases.
83. A composition of any one of embodiments 1-57, wherein a wing has a length of 11 bases.
84. A composition of any one of embodiments 1-57, wherein a wing has a length of 12 bases.
85. A composition of any one of embodiments 1-57, wherein a wing has a length of 13 bases.
86. A composition of any one of embodiments 1-57, wherein a wing has a length of 14 bases.
87. A composition of any one of embodiments 1-57, wherein a wing has a length of 15 bases.
88. A composition of any one of embodiments 1-11 and 15-76, wherein each wing has the same length.
89. A composition of any one of the preceding embodiments, wherein a wing is defined by sugar modifications relative to a core.
90. A composition of any one of the preceding embodiments, wherein each wing independently comprises a modified sugar moiety.
91. A composition of any one of the preceding embodiments, wherein each wing sugar moiety is independently a modified sugar moiety.
92. A composition of any one of the preceding embodiments, wherein a modified sugar moiety comprises a high-affinity sugar modification.
93. A composition of any one of the preceding embodiments, wherein a modified sugar moiety has a 2′-modification.
94. A composition of any one of the preceding embodiments, wherein a modified sugar moiety comprises a bicyclic sugar modification.
95. A composition of any one of the preceding embodiments, wherein a modified sugar moiety comprises a bicyclic sugar modification having a -L- or —O-L- bridge connecting two ring carbon atoms.
96. A composition of any one of the preceding embodiments, wherein a modified sugar moiety comprises a bicyclic sugar modification having a 4′-CH(CH3)—O-2′ bridge.
97. A composition of any one of embodiments 1-93, wherein a modified sugar moiety comprises a 2′-modification, wherein a 2′-modification is 2′-OR1.
98. A composition of any one of embodiments 1-93, wherein a modified sugar moiety comprises a 2′-modification, wherein a 2′-modification is 2′-OR1, wherein R1 is optionally substituted C1-6 alkyl.
99. A composition of any one of embodiments 1-93, wherein a modified sugar moiety comprises a 2′-modification, wherein a 2′-modification is 2′-MOE.
100. A composition of any one of embodiments 1-93, wherein a modified sugar moiety comprises a 2′-modification, wherein a 2′-modification is 2′-OMe.
101. A composition of any one of embodiments 1-96, wherein a modified sugar moiety comprises a 2′-modification, wherein the 2′-modification is S-cEt.
102. A composition of any one of embodiments 1-93, wherein a modified sugar moiety comprises a 2′-modification, wherein the 2′-modification is FANA.
103. A composition of any one of embodiments 1-93, wherein a modified sugar moiety comprises a 2′-modification, wherein the 2′-modification is FRNA.
104. A composition of any one of embodiments 1-92, wherein a modified sugar moiety has a 5′-modification.
105. A composition of any one of embodiments 1-92, wherein a modified sugar moiety is R-5′-Me-DNA.
106. A composition of any one of embodiments 1-92, wherein a modified sugar moiety is S-5′-Me-DNA.
107. A composition of any one of embodiments 1-92, wherein a modified sugar moiety is FHNA.
108. A composition of any one of the preceding embodiments, wherein each wing sugar moiety is modified.
109. A composition of any one of the preceding embodiments, wherein all modified wing sugar moieties within a wing have the same modification.
110. A composition of any one of the preceding embodiments, wherein all modified wing sugar moieties have the same modification.
111. A composition of any one of embodiments 1-108, wherein at least one modified wing sugar moiety is different than another modified wing sugar moiety.
112. A composition of any one of the preceding embodiments, wherein a wing comprises a modified base.
113. A composition of any one of the preceding embodiments, wherein a wing comprises a 2S-dT.
114. A composition of any one of the preceding embodiments, wherein the core region has a length of five or more bases.
115. A composition of any one of the preceding embodiments, wherein the core region has a length of six or more bases.
116. A composition of any one of the preceding embodiments, wherein the core region has a length of seven or more bases.
117. A composition of any one of the preceding embodiments, wherein the core region has a length of eight or more bases.
118. A composition of any one of the preceding embodiments, wherein the core region has a length of nine or more bases.
119. A composition of any one of the preceding embodiments, wherein the core region has a length of ten or more bases.
120. A composition of any one of the preceding embodiments, wherein the core region has a length of 11 or more bases.
121. A composition of any one of the preceding embodiments, wherein the core region has a length of 12 or more bases.
122. A composition of any one of the preceding embodiments, wherein the core region has a length of 13 or more bases.
123. A composition of any one of the preceding embodiments, wherein the core region has a length of 14 or more bases.
124. A composition of any one of the preceding embodiments, wherein the core region has a length of 15 or more bases.
125. A composition of any one of 1-113, wherein the core region has a length of five bases.
126. A composition of any one of 1-113, wherein the core region has a length of six bases.
127. A composition of any one of 1-113, wherein the core region has a length of seven bases.
128. A composition of any one of 1-113, wherein the core region has a length of eight bases.
129. A composition of any one of 1-113, wherein the core region has a length of nine bases.
130. A composition of any one of 1-113, wherein the core region has a length of ten bases.
131. A composition of any one of 1-113, wherein the core region has a length of 11 bases.
132. A composition of any one of 1-113, wherein the core region has a length of 12 bases.
133. A composition of any one of 1-113, wherein the core region has a length of 13 bases.
134. A composition of any one of 1-113, wherein the core region has a length of 14 bases.
135. A composition of any one of 1-113, wherein the core region has a length of 15 bases.
136. A composition of any one of the preceding embodiments, wherein the core region does not have any 2′-modification.
137. A composition of any one of the preceding embodiments, wherein each core sugar moiety is not modified.
138. A composition of any one of the preceding embodiments, wherein each sugar moiety of the core region is the natural DNA sugar moiety.
139. A composition of any one of the preceding embodiments, wherein the core region comprises a chiral internucleotidic linkage.
140. A composition of any one of the preceding embodiments, wherein each internucleotidic linkage of the core region is a chiral internucleotidic linkage.
141. A composition of any one of the preceding embodiments, wherein each internucleotidic linkage of the core region is a chiral internucleotidic linkage having the structure of formula I.
142. A composition of any one of the preceding embodiments, wherein each internucleotidic linkage of the core region is a chiral internucleotidic linkage having the structure of formula I, and wherein X is S, and Y and Z are O.
143. A composition of any one of the preceding embodiments, wherein each internucleotidic linkage of the core region is a chiral internucleotidic linkage having the structure of formula I, and wherein one -L-R1 is not —H.
144. A composition of any one of embodiments 1-142, wherein each internucleotidic linkage of the core region is a phosphorothioate linkage.
145. A composition of any one of the preceding embodiments, wherein the core region has a pattern of backbone chiral center comprises (Sp)m(Rp)n, wherein m is 1-50, and n is 1-10.
146. A composition of any one of the preceding embodiments, wherein the core region has a pattern of backbone chiral center comprises (Sp)m(Rp)n, wherein m is 1-50, n is 1-10, and m>n.
147. A composition of any one of the preceding embodiments, wherein the core region has a pattern of backbone chiral center comprises (Sp)m(Rp)n, wherein m is 2, 3, 4, 5, 6, 7 or 8, and n is 1.
148. A composition of any one of embodiments 1-144, wherein the core region has a pattern of backbone chiral centers comprising (Rp)n(Sp)m, wherein m is 1-50 and n is 1-10.
149. A composition of any one of embodiments 1-144 and 148, wherein the core region has a pattern of backbone chiral centers comprising Rp(Sp)m, wherein m is 2, 3, 4, 5, 6, 7 or 8.
150. A composition of any one of embodiments 1-144 and 148-149, wherein the core region has a pattern of backbone chiral centers comprising Rp(Sp)2.
151. A composition of any one of embodiments 1-144, wherein the core region has a pattern of backbone chiral centers comprising (Np)t(Rp)n(Sp)m, wherein t is 1-10, n is 1-10, m is 1-50, and each Np is independent Rp or Sp.
152. A composition of any one of embodiments 1-144 and 151, wherein the core region has a pattern of backbone chiral centers comprising (Sp)t(Rp)n(Sp)m, wherein t is 1-10, n is 1-10, m is 1-50.
153. A composition of any one of embodiments 1-144 and 151-152, wherein n is 1.
154. A composition of any one of embodiments 1-144 and 151-153, wherein t is 2, 3, 4, 5, 6, 7 or 8.
155. A composition of any one of embodiments 1-144 and 151-154, wherein m is 2, 3, 4, 5, 6, 7 or 8.
156. A composition of any one of embodiments 1-144 and 151-155, wherein at least one of t and m is greater than 5.
157. A composition of any one of the preceding embodiments, wherein the core region has a pattern of backbone chiral centers comprising SpSpRpSpSp.
158. A composition of any one of the preceding embodiments, wherein 50% or more of the chiral internucleotidic linkages in the core region have Sp configuration.
159. A composition of any one of the preceding embodiments, wherein 60% or more of the chiral internucleotidic linkages in the core region have Sp configuration.
160. A composition of any one of the preceding embodiments, wherein 70% or more of the chiral internucleotidic linkages in the core region have Sp configuration.
161. A composition of any one of the preceding embodiments, wherein 80% or more of the chiral internucleotidic linkages in the core region have Sp configuration.
162. A composition of any one of the preceding embodiments, wherein 90% or more of the chiral internucleotidic linkages in the core region have Sp configuration.
163. A composition of any one of the preceding embodiments, wherein each internucleotidic linkage in the core region is chiral, the core region has only one Rp, and each of the other internucleotidic linkages in the core region is Sp.
164. A composition of any one of the preceding embodiments, wherein each base moiety in the core is not modified.
165. A composition of any one of embodiments 1-163, wherein the core region comprises a modified base.
166. A composition of any one of embodiments 1-163, wherein the core region comprises a modified base, wherein a modified base is substituted A, T, C or G.
167. A composition of any one of embodiments 1-164, wherein each base moiety in the core region is independently selected from A, T, C and G.
168. A composition of any one of embodiments 1-163, wherein the core region is a DNA sequence whose phosphate linkages are independently replaced with phosphorothioate linkages.
169. A composition of any one of the preceding embodiments, wherein the oligonucleotides are single stranded.
170. A composition of any one of the preceding embodiments, wherein the oligonucleotides are antisense oligonucleotide, antagomir, microRNA, pre-microRNs, antimir, supermir, ribozyme, Ul adaptor, RNA activator, RNAi agent, decoy oligonucleotide, triplex forming oligonucleotide, aptamer or adjuvant.
171. A composition of any one of the preceding embodiments, wherein the oligonucleotides are antisense oligonucleotides.
172. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 10 bases.
173. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 11 bases.
174. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 12 bases.
175. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 13 bases.
176. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 14 bases.
177. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 15 bases.
178. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 16 bases.
179. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 17 bases.
180. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 18 bases.
181. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 19 bases.
182. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 20 bases.
183. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 21 bases.
184. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 22 bases.
185. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 23 bases.
186. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 24 bases.
187. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of greater than 25 bases.
188. A composition of any one of the preceding embodiments, wherein the oligonucleotides have a length of less than about 200 bases.
189. A composition of any one of the preceding embodiments, wherein the oligonucleotides have a length of less than about 150 bases.
190. A composition of any one of the preceding embodiments, wherein the oligonucleotides have a length of less than about 100 bases.
191. A composition of any one of the preceding embodiments, wherein the oligonucleotides have a length of less than about 50 bases.
192. A composition of any one of the preceding embodiments, wherein the oligonucleotides have a length of less than about 40 bases.
193. A composition of any one of the preceding embodiments, wherein the oligonucleotides have a length of less than about 30 bases.
194. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 10 bases.
195. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 11 bases.
196. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 12 bases.
197. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 13 bases.
198. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 14 bases.
199. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 15 bases.
200. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 16 bases.
201. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 17 bases.
202. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 18 bases.
203. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 19 bases.
204. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 20 bases.
205. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 21 bases.
206. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 22 bases.
207. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 23 bases.
208. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 24 bases.
209. A composition of any one of embodiments 1-171, wherein the oligonucleotides have a length of 25 bases.
210. A composition of any one of the preceding embodiments, wherein the oligonucleotide type is not (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] (SEQ ID NO: 1505) or (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC (5R-(SSR)3-5R) (SEQ ID NO: 1506), wherein in the underlined nucleotide are 2′-MOE modified.
211. A composition of any one of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from: (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] (SEQ ID NO: 1505) or (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC (5R-(SSR)3-5R) (SEQ ID NO: 1506), wherein in the underlined nucleotide are 2′-MOE modified.
212. A composition of any one of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from:

ONT-106 (SEQ ID NO: 1507) PCSK9 sense (Rp)-uucuAGAccuGuuuuGcuudTsdT ONT-107 (SEQ ID NO: 1508) PCSK9 sense (Sp)-uucuAGAccuGuuuuGcuudTsdT ONT-108 (SEQ ID NO: 1509) PCSK9 antisense (Rp)-AAGcAAAAcAGGUCuAGAAdTsdT ONT-109 (SEQ ID NO: 1510) PCSK9 antisense (Sp)-AAGcAAAAcAGGUCuAGAAdTsdT ONT-110 (SEQ ID NO: 1511) PCSK9 antisense (Rp, Rp)-asAGcAAAAcAGGUCuAGAAdTsdT ONT-111 (SEQ ID NO: 1512) PCSK9 antisense (Sp, Rp)-asGcAAAAcAGGUCuAGAAdTsdT ONT-112 (SEQ ID NO: 1513) PCSK9 antisense (Sp, Sp)-asGcAAAAcAGGUCuAGAAdTsdT ONT-113 (SEQ ID NO: 1514) PCSK9 antisense (Rp, Sp)-asGcAAAAcAGGUCuAGAAdTsdT

wherein lower case letters represent 2′OMe RNA residues; capital letters represent 2′OH RNA residues; and bolded and “s” indicates a phosphorothioate moiety; and

PCSK9 (1) (SEQ ID NO: 1515) (All (Sp))-ususcsusAsGsAscscsusGsususususGscsususd TsdT PCSK9 (2) (SEQ ID NO: 1516) (All (Rp))-ususcsusAsGsAscscsusGsususususGscsususd TsdT PCSK9 (3) (SEQ ID NO: 1517) (All (Sp))-usucuAsGsAsccuGsuuuuGscuusdTsdT PCSK9 (4) (SEQ ID NO: 1518) (All (Rp))-usucuAsGsAsccuGsuuuuGscuusdTsdT PCSK9 (5) (SEQ ID NO: 1519) (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp)-ususcsusAsGsAscscs usGsususususGscsususdTsdT PCSK9 (6) (SEQ ID NO: 1520) (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp)-ususcsusAsGsAscscs usGsususususGscsususdTsdT

wherein lower case letters represent 2′-OMe RNA residues; capital letters represent RNA residues; d=2′-deoxy residues; and “s” indicates a phosphorothioate moiety; and

PCSK9 (7) (SEQ ID NO: 1521) (All (Rp))-AsAsGscsAsAsAsAscsAsGsGsUsCsusAsGsAsAsd TsdT PCSK9 (8) (SEQ ID NO: 1522) (All (Sp))-AsAsGscsAsAsAsAscsAsGsGsUsCsusAsGsAsAsd TsdT PCSK9 (9) (SEQ ID NO: 1523) (All (Rp))-AsAGcAAAAcsAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (10) (SEQ ID NO: 1524) (All (Sp))-AsAGcAAAAcsAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (11) (SEQ ID NO: 1525) (All (Rp))-AAsGscsAsAsAsAscAGGUCuAGAAdTsdT PCSK9 (12) (SEQ ID NO: 1526) (All (Sp))-AAsGscsAsAsAsAscAGGUCuAGAAdTsdT PCSK9 (13) (SEQ ID NO: 1527) (All (Rp))-AsAsGscAsAsAsAscAsGsGsUsCsuAsGsAsAsdTsd T PCSK9 (14) (SEQ ID NO: 1528) (All (Sp))-AsAsGscAsAsAsAscAsGsGsUsCsuAsGsAsAsdTsd T PCSK9 (15) (SEQ ID NO: 1529) (All (Rp))-AsAGcAAAsAscAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (16) (SEQ ID NO: 1530) (All (Sp))-AsAGcAAAsAscAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (17) (SEQ ID NO: 1531) (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp)-AsAGcAAAsAscAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (18) (SEQ ID NO: 1532) (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp)-AsAGcAAAsAscAsGsGsUsCsusAsGsAsAsdTsdT

wherein lower case letters represent 2′-OMe RNA residues; capital letters represent RNA residues; d=2′-deoxy residues; “s” indicates a phosphorothioate moiety; and

PCSK9 (19) (SEQ ID NO: 1533) (All (Rp))-UfsusCfsusAfsgsAfscsCfsusGfsusUfsusUfsg sCfsusUfsdTsdT PCSK9 (20) (SEQ ID NO: 1534) (All (Sp))-UfsusCfsusAfsgsAfscsCfsusGfsusUfsusUfsg sCfsusUfsdTsdT PCSK9 (21) (SEQ ID NO: 1535) (All (Rp))-UfsuCfsuAfsgAfscCfsuGfsuUfsuUfsgCfsuUfs dTsdT PCSK9 (22) (SEQ ID NO: 1536) (All (Sp))-UfsuCfsuAfsgAfscCfsuGfsuUfsuUfsgCfsuUfs dTsdT PCSK9 (23) (SEQ ID NO: 1537) (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp)-UfsusCfsusAfsgsAfs csCfsusGfsusUfsusUfsgsCfsusUfsdTsdT PCSK9 (24) (SEQ ID NO: 1538) (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp)-UfsusCfsusAfsgsAfs csCfsusGfsusUfsusUfsgsCfsusUfsdTsdT

wherein lower case letters represent 2′-OMe RNA residues; capital letters represent 2′-F RNA residues; d=2′-deoxy residues; and “s” indicates a phosphorothioate moiety; and

PCSK9 (25) (SEQ ID NO: 1539) (All (Rp))-asAfsgsCfsasAfsasAfscsAfsgsGfsusCfsusAf sgsAfsasdTsdT PCSK9 (26) (SEQ ID NO: 1540) (All (Sp))-asAfsgsCfsasAfsasAfscsAfsgsGfsusCfsusAf sgsAfsasdTsdT PCSK9 (27) (SEQ ID NO: 1541) (All (Rp))-asAfgCfaAfaAfcsAfsgsGfsusCfsusAfsgsAfsa sdTsdT PCSK9 (28) (SEQ ID NO: 1542) (All (Sp))-asAfgCfaAfaAfcsAfsgsGfsusCfsusAfsgsAfsa sdTsdT PCSK9 (29) (SEQ ID NO: 1543) (All (Rp))-asAfsgCfsaAfsaAfscAfsgGfsuCfsuAfsgAfsad TsdT PCSK9 (30) (SEQ ID NO: 1544) (All (Sp))-asAfsgCfsaAfsaAfscAfsgGfsuCfsuAfsgAfsad TsdT PCSK9 (31) (SEQ ID NO: 1544) (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp)-asAfgCfaAfasAfscAfsgsGfsusCfsusAfsgsAfsasd TsdT PCSK9 (32) (SEQ ID NO: 1546) (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp)-asAfgCfaAfasAfscAfsgsGfsusCfsusAfsgsAfsasd TsdT

213. A composition of any one of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from: d[ARCSARCSARCSARCSARC] (SEQ ID NO: 1555), d[CSCSCSCRCRCSCSCSCSC] (SEQ ID NO: 1556), d[CSCSCSCSCSCSCRCRCSC] (SEQ ID NO: 1557) and d[CSCSCSCSCSCRCRCSCSC] (SEQ ID NO: 1558), wherein R is Rp phosphorothioate linkage, and S is Sp phosphorothioate linkage.
214. A composition of any one of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from: GGARTSGRTSTRmCSTCGA (SEQ ID NO: 1547), GGARTRGSTSTRmCRTCGA (SEQ ID NO: 1548), GGASTSGRTRTSmCSTCGA (SEQ ID NO: 1549), wherein R is Rp phosphorothioate linkage, S is Sp phosphorothioate linkage, all other linkages are PO, and each mC is a 5-methylcytosine modified nucleoside.
215. A composition of any one of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from: TkTkmCkAGTmCATGAmCTkTmCkmCk (SEQ ID NO: 1550), wherein each nucleoside followed by a subscript ‘k’ indicates a (S)-cEt modification, R is Rp phosphorothioate linkage, S is Sp phosphorothioate linkage, each mC is a 5-methylcytosine modified nucleoside, and all internucleoside linkages are phosphorothioates (PS) with stereochemistry patterns selected from RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.
215a. A composition of any one of the preceding embodiments, wherein the common pattern of backbone chiral centers comprises SSR, RSS, SSRSS, SSRSSR, RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, or SSSSRRRRSR.
215b. A composition of any one of the preceding embodiments, wherein the common pattern of backbone chiral centers comprises SSRSS, SSRSSR, RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, or SSSSRRRRSR.
215c. A composition of any one of the preceding embodiments, wherein the common pattern of backbone chiral centers comprises RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, or SSSSRRRRSR.
216. A composition of any one of the preceding embodiments, wherein the oligonucleotide is not an oligonucleotide selected from: TkTkmCkAGTmCATGAmCTTkmCkmCk (SEQ ID NO: 1551), wherein each nucleoside followed by a subscript ‘k’ indicates a (S)-cEt modification, R is Rp phosphorothioate linkage, S is Sp phosphorothioate linkage, each mC is a 5-methylcytosine modified nucleoside and all internucleoside linkages in the underlined core are phosphorothioates (PS) with stereochemistry patterns selected from: RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSR SRSSRSS, RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RSRRSSRRSRS, RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.
217. A composition of embodiment 215 or 216, wherein each phosphorothioate moiety of each nucleotide comprising (S)-cEt modification is stereorandom.
218. A composition of any one of the preceding embodiments, wherein the base sequence is or comprises a sequence that is complementary to a target sequence, wherein when contacted with a nucleic acid polymer comprising the target sequence, the composition provides an altered cleavage pattern than a reference cleavage pattern from a reference oligonucleotide composition.
219. A composition of any one of the preceding embodiments, wherein the nucleic acid polymer is RNA, and a reference oligonucleotide composition is a substantially racemic preparation of oligonucleotides that share the common sequence and length.
220. A composition of any one of the preceding embodiments, wherein the nucleic acid polymer is RNA, and a reference oligonucleotide composition is a chirally uncontrolled oligonucleotide composition of oligonucleotides that share the common sequence and length.
221. A composition of any one of the preceding embodiments, wherein the altered cleavage pattern has fewer cleavage sites than the reference cleavage pattern.
222. A composition of any one of the preceding embodiments, wherein the altered cleavage pattern has only one cleavage site within the target sequence, and the reference cleavage pattern has two or more cleavage sites within the target sequence.
223. A composition of any one of the preceding embodiments, wherein the base sequence for the oligonucleotides is or comprises a sequence that is complementary to a characteristic sequence element that defines a particular allele of a target gene relative to other alleles of the same target gene that exist in a population, the composition being characterized in that, when it is contacted with a system expressing transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.
224. A composition of any one of the preceding embodiments, wherein the base sequence for the oligonucleotides is or comprises a sequence that is complementary to a characteristic sequence element that defines a particular allele of a target gene relative to other alleles of the same target gene that exist in a population, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene.

225. A composition of any one of the preceding embodiments, wherein the base sequence comprises a sequence that is complementary to a characteristic sequence element of a target, wherein a characteristic sequence element defines that target sequence relative to a similar sequence.
226. A composition of any one of the preceding embodiments, wherein the base sequence of a core region comprises a sequence that is complementary to a characteristic sequence element of a target, wherein a characteristic sequence element defines that target sequence relative to a similar sequence.
227. A composition of any one of the preceding embodiments, wherein a target sequence is a sequence comprising a mutation, and a similar sequence is the wild-type sequence.
228. A composition of any one of the preceding embodiments, wherein a characteristic sequence element defines a particular allele of a target sequence relative to other alleles of the same target sequence.
229. A composition of any one of the preceding embodiments, wherein a characteristic sequence element defines a particular allele of a target gene relative to other alleles of the same target gene.
230. A composition of any one of the preceding embodiments, wherein the sequence is 100% complementary to a characteristic sequence element.
231. A composition of any one of the preceding embodiments, wherein position 11, 12, or 13 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a characteristic sequence element.
232. A composition of any one of embodiments 1-230, wherein position 11 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a characteristic sequence element.
233. A composition of any one of embodiments 1-230, wherein position 12 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a characteristic sequence element.
234. A composition of any one of embodiments 1-230, wherein position 13 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a characteristic sequence element.
235. A composition of any one of embodiments 1-230, wherein position 8, 9 or 10 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a characteristic sequence element.
236. A composition of any one of embodiments 1-230, wherein position 8 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a characteristic sequence element.
237. A composition of any one of embodiments 1-230, wherein position 9 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a characteristic sequence element.
238. A composition of any one of embodiments 1-230, wherein position 10 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a characteristic sequence element.
239. A composition of any one of embodiments 1-230, wherein position 6, 7 or 8 of the core region as counted from the 5′-terminus of the core region aligns with a characteristic sequence element.
240. A composition of any one of embodiments 1-230, wherein position 6 of the core region as counted from the 5′-terminus of the core region aligns with a characteristic sequence element.
241. A composition of any one of embodiments 1-230, wherein position 7 of the core region as counted from the 5′-terminus of the core region aligns with a characteristic sequence element.
242. A composition of any one of embodiments 1-230, wherein position 8 of the core region as counted from the 5′-terminus of the core region aligns with a characteristic sequence element.
243. A composition of any one of embodiments 1-230, wherein position 3, 4 or 5 of the core region as counted from the 3′-terminus of the core region aligns with a characteristic sequence element.
244. A composition of any one of embodiments 1-230, wherein position 3 of the core region as counted from the 3′-terminus of the core region aligns with a characteristic sequence element.
245. A composition of any one of embodiments 1-230, wherein position 4 of the core region as counted from the 3′-terminus of the core region aligns with a characteristic sequence element.
246. A composition of any one of embodiments 1-230, wherein position 5 of the core region as counted from the 3′-terminus of the core region aligns with a characteristic sequence element.
247. A composition of any one of the preceding embodiments, wherein a common base sequence or a base sequence of an oligonucleotide type is a sequence whose DNA cleavage pattern has a cleavage site within or in the vicinity of a characteristic sequence element of a target nucleic acid sequence.
248. A composition of any one of the preceding embodiments, wherein the DNA cleavage pattern is the cleavage pattern of an oligonucleotide composition of DNA oligonucleotides having the sequence, wherein each oligonucleotide in the composition has the same structure.
249. A composition of any one of the preceding embodiments, wherein a common base sequence or a base sequence of an oligonucleotide type is a sequence whose stereorandom cleavage pattern has a cleavage site within or in the vicinity of a characteristic sequence element of a target nucleic acid sequence.
250. A composition of any one of the preceding embodiments, wherein the stereorandom cleavage pattern is the cleavage pattern of a stereorandom composition of oligonucleotides having the sequence, wherein each internucleotidic linkage is phosphorothioate.
251. A composition of any one of the preceding embodiments, wherein the cleavage site with or in the vicinity of a characteristic sequence element of a target nucleic acid sequence is in a core region.
252. A composition of any one of the preceding embodiments, wherein the cleavage site is in the vicinity of a characteristic sequence element of a target nucleic acid sequence.
253. A composition of any one of the preceding embodiments, wherein a cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away from the characteristic sequence element.
254. A composition of any one of the preceding embodiments, wherein a cleavage site in the vicinity is a cleavage site 0 internucleotidic linkages away from the characteristic sequence element.
255. A composition of any one of the preceding embodiments, wherein a cleavage site in the vicinity is a cleavage site 1 internucleotidic linkage away from the characteristic sequence element.
256. A composition of any one of the preceding embodiments, wherein a cleavage site in the vicinity is a cleavage site 2 internucleotidic linkages away from the characteristic sequence element.
257. A composition of any one of the preceding embodiments, wherein a cleavage site in the vicinity is a cleavage site 3 internucleotidic linkages away from the characteristic sequence element.
258. A composition of any one of the preceding embodiments, wherein a cleavage site in the vicinity is a cleavage site 4 internucleotidic linkages away from the characteristic sequence element.
259. A composition of any one of the preceding embodiments, wherein a cleavage site in the vicinity is a cleavage site 5 internucleotidic linkages away from the characteristic sequence element.
260. A composition of any one of the preceding embodiments, wherein a cleavage site in the vicinity is a cleavage site is 5′ to the cleavage site.
261. A composition of any one of the preceding embodiments, wherein a cleavage site in the vicinity is a cleavage site is 3′ to the cleavage site.
261a. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a major cleavage site.
262. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a relative major cleavage site.
263. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a relative major cleavage site, wherein greater than 40% of total cleavage occurs at the site.
264. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a relative major cleavage site, wherein greater than 50% of total cleavage occurs at the site.
265. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a relative major cleavage site, wherein greater than 60% of total cleavage occurs at the site.
266. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a relative major cleavage site, wherein greater than 70% of total cleavage occurs at the site.
267. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a relative major cleavage site, wherein greater than 80% of total cleavage occurs at the site.
268. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a relative major cleavage site, wherein greater than 90% of total cleavage occurs at the site.
269. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a relative major cleavage site, wherein greater than 95% of total cleavage occurs at the site.
270. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is a relative major cleavage site, wherein greater than 100% of total cleavage occurs at the site.
271. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 5% of total target is cleaved at the site.
272. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 10% of total target is cleaved at the site.
273. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 15% of total target is cleaved at the site.
274. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 20% of total target is cleaved at the site.
275. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 25% of total target is cleaved at the site.
276. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 30% of total target is cleaved at the site.
277. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 35% of total target is cleaved at the site.
278. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 40% of total target is cleaved at the site.
279. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 45% of total target is cleaved at the site.
280. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 50% of total target is cleaved at the site.
281. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 60% of total target is cleaved at the site.
282. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 70% of total target is cleaved at the site.
283. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 80% of total target is cleaved at the site.
284. A composition of any one of the preceding embodiments, wherein a cleavage site within or in the vicinity of a characteristic sequence element is an absolute major cleavage site, wherein greater than 90% of total target is cleaved at the site.
285. A composition of any one the preceding embodiments, wherein a relative or absolute major cleavage site is determined by RNase H assay.
286. A composition of any one of the preceding embodiments, wherein the characteristic sequence element comprises a single nucleotide polymorphism (SNP) or a mutation.
287. A composition of any one of the preceding embodiments, wherein the characteristic sequence element comprises a single nucleotide polymorphism.
288. A composition of any one of the preceding embodiments, wherein the characteristic sequence element is a single nucleotide polymorphism.
289. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is a single nucleotide polymorphism associated with Huntington's disease.
290. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is a single nucleotide polymorphism found in the Huntingtin gene.
291. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is selected from rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306.
291a. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is selected from rs362307, rs7685686, rs362268, or rs362306.
292. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is rs362307.
293. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is rs7685686.
294. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is rs362268.
295. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is rs362306.
295a. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is rs2530595.
295b. A composition of any one of the preceding embodiments, wherein the single nucleotide polymorphism is rs362331.
296. A composition of any one of embodiments 1-290, wherein the single nucleotide polymorphism is in an exon.
297. A composition of any one of embodiments 1-290, wherein the single nucleotide polymorphism is in an intron.
298. A composition of any one of embodiments 1-290, wherein the composition is selected from Tables N1, N2, N3, N4 and 8.
298a. A composition of any one of embodiments 1-290, wherein the composition is selected from Tables N1, N2, N3 and N4.
299. A composition of any one of embodiments 1-290, wherein the composition is selected from Tables N1A, N2A, N3A, N4A and 8; and WV-1092, WVE120101, WV-2603 and WV-2595.
299a. A composition of any one of embodiments 1-290, wherein the composition is selected from Tables N1A, N2A, N3A and N4A.
300. A composition of any one of embodiments 1-290, wherein the composition is WV-1092.
300a. A composition of any one of embodiments 1-290, wherein the composition is WVE120101.
300b. A composition of any one of embodiments 1-290, wherein the composition is WV-2603.
300c. A composition of any one of embodiments 1-290, wherein the composition is WV-2595.
301. A composition of any one of embodiments 1-290, wherein the composition is not ONT-450, ONT-451, or ONT-452.
302. A composition of any one of the preceding embodiments, wherein the characteristic sequence element comprises a mutation.
303. A composition of any one of the preceding embodiments, wherein the characteristic sequence element is a mutation.
304. A composition of any one of the preceding embodiments, wherein the oligonucleotides are at least 95% complementary to a mutant allele.
305. A composition of any one of the preceding embodiments, wherein the oligonucleotides are 100% complementary to a mutant allele.
306. A composition of any one of the preceding embodiments, wherein the oligonucleotides are at least 95% complementary to a target sequence comprising a SNP, wherein the SNP is associated with a disease.
307. A composition of any one of the preceding embodiments, wherein the oligonucleotides are 100% complementary to a target sequence comprising a SNP, wherein the SNP is associated with a disease.
307a. A composition of any one of the preceding embodiments, wherein the oligonucleotides selectively reduce RNA level of a mutant allele.
308. A pharmaceutical composition, comprising a composition of any one of the preceding embodiments, and a pharmaceutical carrier.
308a. A composition of any one of the preceding embodiments, further comprising cerebrospinal fluid.
309. A composition of any one of the preceding embodiments, further comprising artificial cerebrospinal fluid.
310. A method for controlled cleavage of a nucleic acid polymer, the method comprising steps of:

contacting a nucleic acid polymer whose nucleotide sequence comprises a target sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to a target sequence found in the nucleic acid polymer;
    • 2) a common pattern of backbone linkages; and
    • 3) a common pattern of backbone chiral centers;
      which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of the particular oligonucleotide type.
      310a. A method for cleavage of a nucleic acid having a base sequence comprising a target sequence, the method comprising steps of:

(a) contacting a nucleic acid having a base sequence comprising a target sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to the target sequence in the nucleic acid;
    • 2) a common pattern of backbone linkages; and
    • 3) a common pattern of backbone chiral centers;
      which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of the particular oligonucleotide type, wherein the oligonucleotide targets a mutant Huntingtin gene, and the length is from about 10 to about 50 nucleotides, wherein the backbone linkages comprise at least one phosphorothioate, and wherein the pattern of backbone chiral centers comprises at least one chiral center in a Rp conformation and at least one chiral center in a Sp conformation.
      310b. A method for cleavage of a nucleic acid having a base sequence comprising a target sequence, the method comprising steps of:

(a) contacting a nucleic acid having a base sequence comprising a target sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

    • 1) a common base sequence and length, wherein the common base sequence is or comprises a sequence that is complementary to the target sequence in the nucleic acid;
    • 2) a common pattern of backbone linkages; and
    • 3) a common pattern of backbone chiral centers;
      which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of the particular oligonucleotide type, wherein the oligonucleotide targets a mutant Huntingtin gene, and the length is from about 10 to about 50 nucleotides, wherein the backbone linkages comprise at least one phosphorothioate, and wherein the pattern of backbone chiral centers comprises at least one chiral center in a Rp conformation and at least one chiral center in a Sp conformation; and

(b) cleavage of the nucleic acid mediated by a RNAseH or RNA interference mechanism.

311. A method of embodiment 310, wherein the contacting being performed under conditions so that cleavage of the nucleic acid polymer occurs.
312. A method of any one of embodiments 310-311, wherein the cleavage occurs with a cleavage pattern that differs from a reference cleavage pattern observed when the nucleic acid polymer is contacted under comparable conditions with a reference oligonucleotide composition.
313. A method for altering a cleavage pattern observed when a nucleic acid polymer whose nucleotide sequence includes a target sequence is contacted with a reference oligonucleotide composition that comprises oligonucleotides having a particular base sequence and length, which particular base sequence is or comprises a sequence that is complementary to the target sequence, the method comprising:

contacting the nucleic acid polymer with a chirally controlled oligonucleotide composition of oligonucleotides having the particular base sequence and length, which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the particular base sequence and length, for oligonucleotides of a single oligonucleotide type characterized by:

1) the particular base sequence and length;

2) a particular pattern of backbone linkages; and

3) a particular pattern of backbone chiral centers.

314. A method of embodiment 313, wherein the contacting being performed under conditions so that cleavage of the nucleic acid polymer occurs.
315. A method of any one of embodiments 312-314, wherein the reference oligonucleotide composition is a substantially racemic preparation of oligonucleotides that share the common sequence and length.
316. A method of any one of embodiments 312-314, wherein the reference oligonucleotide composition is a chirally uncontrolled oligonucleotide composition of oligonucleotides that share the common sequence and length.
317. A method of any one of embodiments 312-316, wherein the cleavage pattern provided by the chirally controlled oligonucleotide composition differs from a reference cleavage pattern in that it has fewer cleavage sites within the target sequence found in the nucleic acid polymer than the reference cleavage pattern.
318. A method of embodiment 317, wherein the cleavage pattern provided by the chirally controlled oligonucleotide composition has a single cleavage site within the target sequence found in the nucleic acid polymer than the reference cleavage pattern.
319. A method of embodiment 318, wherein the single cleavage site is a cleavage site in the reference cleavage pattern.
320. A method of embodiment 318, wherein the single cleavage site is a cleavage site not in the reference cleavage pattern.
321. A method of any one of embodiments 312-316, wherein the cleavage pattern provided by the chirally controlled oligonucleotide composition differs from a reference cleavage pattern in that it increases cleavage percentage at a cleavage site.
322. A method of embodiment 321, wherein the cleavage site with increased cleavage percentage is a cleavage site in the reference cleavage pattern.
323. A method of embodiment 321, wherein the cleavage site with increased cleavage percentage is a cleavage site not in the reference cleavage pattern.
324. A method of any one of embodiments 310-323, wherein the chirally controlled oligonucleotide composition provides a higher cleavage rate of the target nucleic acid polymer than a reference oligonucleotide composition.
325. A method of any one of embodiments 310-324, where the cleavage rate is at least 5 fold higher.
326. A method of any one of embodiments 310-325, wherein the chirally controlled oligonucleotide composition provides a lower level of remaining un-cleaved target nucleic acid polymer than a reference oligonucleotide composition.
327. A method of any one of embodiments 310-326, wherein the remaining un-cleaved target nucleic acid polymer is at least 5 fold lower.
328. A methods of any one of embodiments 310-327, wherein the cleavage products from the nucleic acid polymer dissociate from oligonucleotides of the particular oligonucleotide type in the chirally controlled oligonucleotide composition at a faster rate than from oligonucleotides of the reference oligonucleotide composition.
329. A method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines the target nucleic acid sequence, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target nucleic acid sequence and a similar nucleic acid sequences, transcripts of the target nucleic acid sequence are suppressed at a greater level than a level of suppression observed for a similar nucleic acid sequence.

330. A method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines the target nucleic acid sequence, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target nucleic acid sequence and a similar nucleic acid sequences, transcripts of the target nucleic acid sequence are suppressed at a greater level than a level of suppression observed for a similar nucleic acid sequence.

331. A method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular target sequence relative to its similar sequences, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.

332. A method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular target sequence relative to its similar sequences, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.

333. A method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular target sequence relative to its similar sequences, the composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular target sequence at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for a similar; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for a similar sequence.

334. A method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular target sequence relative to its similar sequences, the composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular target sequence at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for a similar; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for a similar sequence.

335. A method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:
contacting a sample comprising transcripts of the target gene with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular target nucleic acid sequence, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target nucleic acid sequence, it shows suppression of expression of transcripts of the particular target nucleic acid sequence at a level that is:

a) at least 2 fold in that transcripts from the particular target nucleic acid sequence are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for a similar sequence; or

c) both at least 2 fold in that transcripts from the particular target nucleic acid sequence are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for a similar sequence.

336. A method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising steps of:
contacting a sample comprising transcripts of the target gene with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular target nucleic acid sequence, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target nucleic acid sequence, it shows suppression of expression of transcripts of the particular target nucleic acid sequence at a level that is:

a) at least 2 fold in that transcripts from the particular target nucleic acid sequence are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for a similar sequence; or

c) both at least 2 fold in that transcripts from the particular target nucleic acid sequence are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for a similar sequence.

337. A method of any one of the preceding embodiments, wherein a target sequence is a sequence comprising a mutation, and a similar sequence is the wild-type sequence.
338. A method of any one of the preceding embodiments, wherein a characteristic sequence element defines a particular allele of a target sequence relative to other alleles of the same target sequence.
339. A method of any one of the preceding embodiments, wherein a characteristic sequence element defines a particular allele of a target gene relative to other alleles of the same target gene.
340. A method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, transcripts of the particular allele are suppressed at a greater level than a level of suppression observed for another allele of the same nucleic acid sequence.

341. A method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;

wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same nucleic acid sequence, transcripts of the particular allele are suppressed at a greater level than a level of suppression observed for another allele of the same nucleic acid sequence.

342. A method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.

343. A method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;

wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.

344. A method of embodiment 340 or 342, the contacting being performed under conditions determined to permit the composition to suppress transcripts of the particular allele.
345. A method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;
wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.
346. A method of embodiment 345, wherein the contacting being performed under conditions determined to permit the composition to suppress expression of the particular allele.
347. A method of any one of embodiments 340-346, wherein transcripts of the particular allele are suppressed at a level at least 5, 10, 20, 50, 100, 200 or 500 fold greater than a level of suppression observed for another allele of the same gene.
348. A method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for another allele of the same nucleic acid sequence; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

349. A method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising steps of:

contacting a sample comprising transcripts of the target nucleic acid sequence with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;

wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for another allele of the same nucleic acid sequence; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

350. A method for controlled cleavage of a nucleic acid polymer, the method comprising contacting a nucleic acid polymer whose nucleotide sequence comprises a target sequence with an oligonucleotide or an oligonucleotide composition of any one of embodiments 540-574.
351. A method for suppression of a transcript from a target nucleic acid sequence for which one or more similar nucleic acid sequences exist within a population, each of the target and similar sequences contains a specific nucleotide characteristic sequence element that defines the target sequence relative to the similar sequences, the method comprising contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide or an oligonucleotide composition of any one of embodiments 540-574, wherein the base sequence of the oligonucleotide is or comprises a sequence that is complementary to the characteristic sequence element that defines the target nucleic acid sequence.
352. A method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide or an oligonucleotide composition of any one of embodiments 540-574, wherein the base sequence of the oligonucleotide is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele.
353. A method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide or an oligonucleotide composition of any one of embodiments 540-574, wherein the base sequence of the oligonucleotide is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the oligonucleotide or oligonucleotide composition being characterized in that, when it is contacted with a system comprising transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.
354. A method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide or an oligonucleotide composition of any one of embodiments 540-574, wherein the base sequence of the oligonucleotide is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the oligonucleotide or oligonucleotide composition being characterized in that, when it is contacted with a system expressing transcripts of both the target allele and another allele of the same gene, transcripts of the particular allele are suppressed at a level at least 2 fold greater than a level of suppression observed for another allele of the same gene.
355. A method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide or an oligonucleotide composition of any one of embodiments 540-574, wherein the base sequence of the oligonucleotide is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the oligonucleotide or oligonucleotide composition being characterized in that, when it is contacted with a system comprising transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for another allele of the same nucleic acid sequence; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

356. A method for allele-specific suppression of a transcript from a target nucleic acid sequence for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target nucleic acid sequence, the method comprising contacting a sample comprising transcripts of the target nucleic acid sequence with an oligonucleotide or an oligonucleotide composition of any one of embodiments 540-574, wherein the base sequence of the oligonucleotide is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the oligonucleotide or oligonucleotide composition being characterized in that, when it is contacted with a system expressing transcripts of the same target nucleic acid sequence, it shows suppression of transcripts of the particular allele at a level that is:

a) greater than when the composition is absent;

b) greater than a level of suppression observed for another allele of the same nucleic acid sequence; or

c) both greater than when the composition is absent, and greater than a level of suppression observed for another allele of the same nucleic acid sequence.

357. A method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages;

wherein the common base sequence is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene.

358. A method for allele-specific suppression of a transcript from a target gene for which a plurality of alleles exist within a population, each of which contains a specific nucleotide characteristic sequence element that defines the allele relative to other alleles of the same target gene, the method comprising steps of:

contacting a sample comprising transcripts of the target gene with a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages;

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type;

wherein the common base sequence for the oligonucleotides of the particular oligonucleotide type is or comprises a sequence that is complementary to the characteristic sequence element that defines a particular allele, the composition being characterized in that, when it is contacted with a system expressing transcripts of the target gene, it shows suppression of expression of transcripts of the particular allele at a level that is:

a) at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent;

b) at least 2 fold greater than a level of suppression observed for another allele of the same gene; or

c) both at least 2 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent, and at least 2 fold greater than a level of suppression observed for another allele of the same gene.

359. A method of any one of the preceding embodiments, wherein transcripts from the particular allele are detected in amounts that are 2 fold or more when the composition is absent relative to when it is present.
360. A method of any one of the preceding embodiments, wherein the level of transcripts of another allele of the same gene is at least 2 fold greater than the level of transcripts of the particular allele.
361. A method of any one of the preceding embodiments, wherein transcripts from the particular allele are detected in amounts that are 2 fold or more when the composition is absent relative to when it is present, and the level of transcripts of another allele of the same gene is at least 2 fold greater than the level of transcripts of the particular allele.
362. A method of any one of the preceding embodiments, the contacting being performed under conditions determined to permit the composition to suppress transcripts of the particular allele.
363. A method of any one of the preceding embodiments, wherein the contacting being performed under conditions determined to permit the composition to suppress expression of the particular allele.
364. A method of any one of the preceding embodiments, wherein transcripts of the particular allele are suppressed at a level that is at least 5, 10, 20, 50, 100, 200 or 500 fold in that transcripts from the particular allele are detected in amounts that are 2 fold lower when the composition is present relative to when it is absent.
365. A method of any one of the preceding embodiments, wherein transcripts of the particular allele are suppressed at a level that is at least 5, 10, 20, 50, 100, 200 or 500 fold greater than a level of suppression observed for another allele of the same gene.
366. A method of any one of the preceding embodiments, wherein the system is an in vitro or in vivo system.
366a A method of any one of the preceding embodiments, wherein the method is performed in vitro or in vivo.
367. A method of any one of the preceding embodiments, wherein the system comprises one or more cells, tissues or organs.
368. A method of any one of the preceding embodiments, wherein the system comprises one or more organisms.
369. A method of any one of the preceding embodiments, wherein the system comprises one or more subjects.
370. A method of any one of the preceding embodiments, wherein transcripts of the particular allele are cleaved.
371. A method of any one of the preceding embodiments, wherein the specific nucleotide characteristic sequence element is present within an intron of the target nucleic acid sequence or gene.
372. A method of any one of the preceding embodiments, wherein the specific nucleotide characteristic sequence element is present within an exon of the target nucleic acid sequence or gene.
373. A method of any one of the preceding embodiments, wherein the specific nucleotide characteristic sequence element spans an exon and an intron of the target nucleic acid sequence or gene.
374. A method of any one of the preceding embodiments, wherein the specific nucleotide characteristic sequence element comprises a mutation.
375. A method of any one of the preceding embodiments, wherein the specific nucleotide characteristic sequence element is a mutation.
376. A method of any one of the preceding embodiments, wherein the specific nucleotide characteristic sequence element comprises a SNP.
377. A method of any one of the preceding embodiments, wherein the specific nucleotide characteristic sequence element is a SNP.
378. A method of any one of the preceding embodiments, wherein the oligonucleotide composition is administered to a subject.
379. A method of any one of the preceding embodiments, wherein the target nucleic acid polymer or transcripts are oligonucleotides.
380. A method of any one of the preceding embodiments, wherein the target nucleic acid polymer or transcripts are RNA.
381. A method of any one of the preceding embodiments, wherein the target nucleic acid polymer or transcripts are newly transcribed RNA.
382. A method of any one of the preceding embodiments, wherein oligonucleotides of the particular oligonucleotide type in the chirally controlled oligonucleotide composition form duplexes with the nucleic acid polymer or transcripts.
383. A method of any one of the preceding embodiments, wherein the nucleic acid polymer or transcripts are cleaved by an enzyme.
384. A method of any one of the preceding embodiments, wherein the enzyme is RNase H.
385. A method of any one of the preceding embodiments, wherein the SNP is a SNP related to Huntington's disease.
386. A method of any one of the preceding embodiments, wherein the SNP is a SNP found in the Huntingtin gene.
387. A method of any one of the preceding embodiments, wherein the SNP is selected from rs362307, rs7685686, rs362268, or rs362306.
388. A method of embodiments 310-387, wherein the SNP is rs362307.
389. A method of embodiments 310-387, wherein the single nucleotide polymorphism is rs7685686.
390. A method of embodiments 310-387, wherein the single nucleotide polymorphism is rs362268.
391. A method of embodiments 310-387, wherein the single nucleotide polymorphism is rs362306.
392. A method of embodiments 310-391, wherein position 11 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
393. A method of embodiments 310-391, wherein position 12 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
394. A method of embodiments 310-391, wherein position 13 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
395. A method of embodiments 310-391, wherein position 8 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
396. A method of embodiments 310-391, wherein position 9 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
397. A method of embodiments 310-391, wherein position 10 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
398. A method of any one of the preceding embodiments, wherein the oligonucleotides comprise one or more wing regions and a common core region, wherein:

each wing region independently has a length of two or more bases, and independently and optionally comprises one or more chiral internucleotidic linkages; and

the core region independently has a length of two or more bases and independently comprises one or more chiral internucleotidic linkages.

399. A method of any one of embodiments 310-398, wherein position 6 of the core region as counted from the 5′-terminus of the core region aligns with a single nucleotide polymorphism.
400. A method of any one of embodiments 310-398, wherein position 7 of the core region as counted from the 5′-terminus of the core region aligns with a single nucleotide polymorphism.
401. A method of any one of embodiments 310-398, wherein position 8 of the core region as counted from the 5′-terminus of the core region aligns with a single nucleotide polymorphism.
402. A method of any one of embodiments 310-398, wherein position 3 of the core region as counted from the 3′-terminus of the core region aligns with a single nucleotide polymorphism.
403. A method of any one of embodiments 310-398, wherein position 4 of the core region as counted from the 3′-terminus of the core region aligns with a single nucleotide polymorphism.
404. A method of any one of embodiments 310-398, wherein position 5 of the core region as counted from the 3′-terminus of the core region aligns with a single nucleotide polymorphism.
405. A method of any one of the preceding embodiments, wherein:

each wing region independently has a length of two or more bases, and independently comprises one or more chiral internucleotidic linkages and one or more natural phosphate linkage; and

the core region independently has a length of two or more bases, wherein each internucleotidic linkage in the core region is chiral, only one of internucleotidic linkage in the core region is Rp, and each of the other internucleotidic linkages in the core region is Sp.

406. A method of any one of the preceding embodiments, wherein the oligonucleotides are hemimers having the structure of wing-core.
407. A method of any one of embodiments 310-405, wherein the oligonucleotides are hemimers having the structure of core-wing.
408. A method of any one of embodiments 310-405, wherein the oligonucleotides are gapmers having the structure of wing-core-wing.
409. A method of any one of the preceding embodiments, wherein level of transcripts from a disease-causing allele is selectively suppressed.
410. A method of any one of the preceding embodiments, wherein level of a protein translated from transcripts from a disease-causing allele are suppressed.
411. A method for treating or preventing Huntington's Disease in a subject, comprising administering to the subject an oligonucleotide composition comprising oligonucleotides having:

1) a common base sequence and length; and

2) a common pattern of backbone linkages.

412. A method for treating or preventing Huntington's Disease in a subject, comprising administering to the subject a chirally controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type.
413. A method of embodiment 411 or 412, wherein the oligonucleotides comprise one or more wing regions and a common core region, wherein:

each wing region independently has a length of two or more bases, and independently and optionally comprises one or more chiral internucleotidic linkages; and

the core region independently has a length of two or more bases and independently comprises one or more chiral internucleotidic linkages.

414. A method of any one of embodiments 411-4113, wherein:

each wing region independently has a length of two or more bases, and independently comprises one or more chiral internucleotidic linkages and one or more natural phosphate linkage; and

the core region independently has a length of two or more bases, wherein each internucleotidic linkage in the core region is chiral, only one of internucleotidic linkage in the core region is Rp, and each of the other internucleotidic linkages in the core region is Sp.

415. A method of any one of embodiments 411-414, wherein the oligonucleotides are hemimers having the structure of wing-core.
416. A method of any one of embodiments 411-414, wherein the oligonucleotides are hemimers having the structure of core-wing.
417. A method of any one of embodiments 411-414, wherein the oligonucleotides are gapmers having the structure of wing-core-wing.
418. A method of any one of embodiments 411-417, wherein position 11 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
419. A method of any one of embodiments 411-417, wherein position 12 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
420. A method of any one of embodiments 411-417, wherein position 13 of the oligonucleotides as counted from the 5′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
421. A method of any one of embodiments 411-417, wherein position 8 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
422. A method of any one of embodiments 411-417, wherein position 9 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
423. A method of any one of embodiments 411-417, wherein position 10 of the oligonucleotides as counted from the 3′-terminus of the oligonucleotides aligns with a single nucleotide polymorphism.
424. A method of any one of embodiments 411-417, wherein position 6 of the core region as counted from the 5′-terminus of the core region aligns with a single nucleotide polymorphism.
425. A method of any one of embodiments 411-417, wherein position 7 of the core region as counted from the 5′-terminus of the core region aligns with a single nucleotide polymorphism.
426. A method of any one of embodiments 411-417, wherein position 8 of the core region as counted from the 5′-terminus of the core region aligns with a single nucleotide polymorphism.
427. A method of any one of embodiments 411-417, wherein position 3 of the core region as counted from the 3′-terminus of the core region aligns with a single nucleotide polymorphism.
428. A method of any one of embodiments 411-417, wherein position 4 of the core region as counted from the 3′-terminus of the core region aligns with a single nucleotide polymorphism.
429. A method of any one of embodiments 411-417, wherein position 5 of the core region as counted from the 3′-terminus of the core region aligns with a single nucleotide polymorphism.
430. A method of any one of embodiments 411-429, wherein the method ameliorating a symptom of Huntington's Disease.
431. A method of any one of embodiments 411-429, wherein the method slowing onset of Huntington's Disease.
432. A method of any one of embodiments 411-429, wherein the method slowing progression of Huntington's Disease.
433. A method of any one of embodiments 411-432, wherein the subject has a SNP related to Huntington's Disease.
434. A method of any one of embodiments 411-433, wherein the subject has a SNP in the subject's Huntingtin gene.
435. A method of any one of embodiments 411-434, wherein the subject has a SNP, wherein one allele is mutant Huntingtin associated with expanded CAG repeats.
436. A method of any one of embodiments 411-435, wherein the subject has a SNP selected from rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306.
436a. A method of any one of embodiments 411-435, wherein the subject has a SNP selected from rs362307, rs7685686, rs362268, or rs362306.
437. A method of any one of embodiments 411-436, wherein the subject has the SNP rs362307.
438. A method of any one of embodiments 411-436, wherein the subject has the SNP rs7685686.
439. A method of any one of embodiments 411-436, wherein the subject has the SNP rs362268.
440. A method of any one of embodiments 411-436, wherein the subject has the SNP rs362306.
440a. A method of any one of embodiments 411-436, wherein the subject has the SNP rs2530595.
440b. A method of any one of embodiments 411-436, wherein the subject has the SNP rs362331.
441. A composition of any of embodiments 1-309, wherein a substantially racemic preparation of oligonucleotides is prepared by non-stereoselective preparation.
442. A composition of any one of embodiments 1-309 and 441, wherein a substantially racemic preparation of oligonucleotides is prepared by non-stereoselective preparation, wherein a chiral auxiliary is not used for formation of a chiral internucleotidic linkage.
443. A composition of any one of embodiments 1-309 and 441-442, wherein a substantially racemic preparation of oligonucleotides is prepared by non-stereoselective preparation, wherein at least one chiral internucleotidic linkage is formed with less than 80:20 diastereomeric selectivity.
444. A composition of any one of embodiments 1-309 and 441-443, wherein a substantially racemic preparation of oligonucleotides is prepared by non-stereoselective preparation, wherein at least one chiral internucleotidic linkage is formed with less than 90:10 diastereomeric selectivity.
445. A composition of any one of embodiments 1-309 and 441-444, wherein a substantially racemic preparation of oligonucleotides is prepared by non-stereoselective preparation, wherein at least one chiral internucleotidic linkage is formed with less than 95:5 diastereomeric selectivity.
446. A composition of any one of embodiments 1-309 and 441-445, wherein a substantially racemic preparation of oligonucleotides is prepared by non-stereoselective preparation, wherein at least one chiral internucleotidic linkage is formed with less than 97:3 diastereomeric selectivity.
447. A composition of any one of embodiments 1-309, wherein each chiral internucleotidic linkage is formed with greater than 90:10 diastereomeric selectivity.
448. A composition of any one of embodiments 1-309, wherein each chiral internucleotidic linkage is formed with greater than 95:5 diastereomeric selectivity.
449. A composition of any one of embodiments 1-309, wherein each chiral internucleotidic linkage is formed with greater than 96:4 diastereomeric selectivity.
450. A composition of any one of embodiments 1-309, wherein each chiral internucleotidic linkage is formed with greater than 97:3 diastereomeric selectivity.
451. A composition of any one of embodiments 1-309, wherein each chiral internucleotidic linkage is formed with greater than 98:2 diastereomeric selectivity.
452. A composition of any one of embodiments 1-309, wherein each chiral internucleotidic linkage is formed with greater than 98:2 diastereomeric selectivity.
453. A composition of any one of embodiments 443-452, wherein the diastereomeric selectivity for forming a chiral internucleotidic linkage is measured by forming a dimeric oligonucleotide comprising the chiral internucleotidic linkage and the nucleosides to both sides of the chiral internucleotidic linkage under the same or comparable reaction conditions.
454. A method for preparing an oligonucleotide composition for selective suppression of a transcript of a target nucleic acid sequence, comprising providing an oligonucleotide composition comprising a predetermined level of oligonucleotides of a particular oligonucleotide type characterized by:

1) a common base sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which pattern comprises (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein:

m is 1-50;

n is 1-10;

t is 1-50;

each Np is independently Rp or Sp;

wherein the target nucleic acid sequence comprises a characteristic sequence element that defines the target nucleic acid sequence from a similar nucleic acid sequence;

wherein the common base sequence is a sequence whose DNA cleavage pattern and/or stereorandom cleavage pattern has a cleavage site within or in the vicinity of the target nucleic acid sequence.

455. A method of embodiment 454, wherein the pattern comprises (Sp)m(Rp)n.
456. A method of embodiment 454, wherein the pattern comprises (Rp)n(Sp)m.
457. A method of embodiment 454, wherein the pattern comprises (Np)t(Rp)n(Sp)m.
458. A method of embodiment 454, wherein the pattern comprises (Sp)t(Rp)n(Sp)m.
459. A method of embodiment 454, wherein the pattern is a pattern in any one of embodiments 145-157.
460. A method of any one of embodiments 454-458, wherein a cleavage site is in any one of embodiments 247-285.
461. A method of any one of the preceding embodiments, wherein the oligonucleotide composition is a composition of any one of embodiments 1-309 and 441-453.
462. A composition or method of any one of the preceding embodiments, wherein the sequence of the oligonucleotide in a chirally controlled oligonucleotide composition comprises, consists of, or is the sequence of any oligonucleotide described herein, or selected from Tables N1A, N2A, N3A, N4A or 8; or WV-1092, WVE120101, WV-2603 or WV-2595.
463. A composition comprising a lipid and an oligonucleotide.
463a. The composition of any one of the preceding embodiments, wherein the composition comprises one or more lipids conjugated with one or more oligonucleotides in the composition.
464. A composition comprising an oligonucleotide and a lipid selected from the list of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl.
464a. A composition comprising an oligonucleotide and a lipid selected from the list of: lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl.
465. A composition comprising an oligonucleotide and a lipid selected from:

466. A composition comprising an oligonucleotide and a lipid, wherein the lipid comprises a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic group.
467. An oligonucleotide composition comprising a plurality of oligonucleotides, which share:
1) a common base sequence;
2) a common pattern of backbone linkages; and
3) a common pattern of backbone phosphorus modifications; wherein one or more oligonucleotides of the plurality are individually conjugated to a lipid.
468. A chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, which share:
1) a common base sequence;
2) a common pattern of backbone linkages; and
3) a common pattern of backbone phosphorus modifications;
wherein:
the composition is chirally controlled in that the plurality of oligonucleotides share the same stereochemistry at one or more chiral internucleotidic linkages;
one or more oligonucleotides of the plurality are individually conjugated to a lipid; and one or more oligonucleotides of the plurality are optionally and individually conjugated to a targeting compound or moiety.
469. A method of delivering an oligonucleotide to a cell or tissue in a human subject, comprising:
(a) providing a composition of any one of the preceding embodiments; and
(b) Administering the composition to the human subject such that the oligonucleotide is delivered to a cell or tissue in the subject.
470. A method for delivering an oligonucleotide to a cell or tissue comprising preparing a composition according to any one of the preceding embodiments and treating [contacting] the cell or tissue with the composition.
471. A method of modulating the level of a transcript or gene product of a gene in a cell, the method comprising the step of contacting the cell with a composition according to any one of the preceding embodiments, wherein the oligonucleotide is capable of modulating the level of the transcript or gene product.
472. A method for inhibiting expression of a gene in a cell or tissue comprising preparing a composition according to any one of the preceding embodiments and treating the cell or tissue with the composition.
473. A method for inhibiting expression of a gene in a cell or tissue in a mammal comprising preparing a composition according to any one of the preceding embodiments and administering the composition to the mammal.
474. A method of treating a disease that is caused by the over-expression of one or several proteins in a cell or tissue in a subject, said method comprising the administration of a composition according to any one of the preceding embodiments to the subject.
475. A method of treating a disease that is caused by a reduced, suppressed or missing expression of one or several proteins in a subject, said method comprising the administration of a composition according to any one of the preceding embodiments to the subject.
476. A method for generating an immune response in a subject, said method comprising the administration of a composition according to any one of the preceding embodiments to the subject, wherein the biologically active compound is an immunomodulating nucleic acid.
477. A method for treating a sign and/or symptom of Huntington's Disease by providing a composition of any one of the preceding embodiments and administering the composition to the subject.
478. A method of modulating the amount of RNaseH-mediated cleavage in a cell, the method comprising the step of contacting the cell with a composition according to any one of the preceding embodiments, wherein the oligonucleotide is capable of modulating the amount of RNaseH-mediated cleavage.
479. A method of administering an oligonucleotide to a subject in need thereof, comprising steps of providing a composition comprising the agent a lipid, and administering the composition to the subject, wherein the agent is any agent disclosed herein, and wherein the lipid is any lipid disclosed herein.
480. A method of treating a disease in a subject, the method comprising steps of providing a composition comprising the agent a lipid, and administering a therapeutically effective amount of the composition to the subject, wherein the agent is any agent disclosed herein, and wherein the lipid is any lipid disclosed herein, and wherein the disease is any disease disclosed herein.
481. The composition or method of any one of the preceding embodiments, wherein a lipid comprises an optionally substituted C10-C40 saturated or partially unsaturated aliphatic chain.
482. The composition or method of any one of the preceding embodiments, wherein a lipid comprises an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.
483. The composition or method of any one of the preceding embodiments, wherein a lipid comprises a C10-C40 linear, saturated or partially unsaturated, aliphatic chain, optionally substituted with one or more C1-4 aliphatic group.
484. The composition or method of any one of the preceding embodiments, wherein a lipid comprises an unsubstituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.
485. The composition or method of any one of the preceding embodiments, wherein a lipid comprises no more than one optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.
486. The composition or method of any one of the preceding embodiments, wherein a lipid comprises two or more optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.
487. The composition or method of any one of the preceding embodiments, wherein a lipid comprises no tricyclic or polycyclic moiety.
488. The composition or method of any one of the preceding embodiments, wherein a lipid has the structure of R1—COOH, wherein R1 is an optionally substituted C10-C40 saturated or partially unsaturated aliphatic chain.
489. The composition or method of any one of embodiment 16, wherein the lipid is conjugated through its carboxyl group.
490. The composition or method according to any one of the preceding embodiments, wherein the lipid is selected from:

491. The composition or method of any one of the preceding embodiments, wherein the lipid is conjugated to the oligonucleotide.
492. The composition or method of any one of the preceding embodiments, wherein the lipid is directly conjugated to the oligonucleotide.
493. The composition or method of any one of the preceding embodiments, wherein the lipid is conjugated to the oligonucleotide via a linker.
494. The composition or method of any one of the preceding embodiments, wherein the linker is selected from: an uncharged linker; a charged linker; a linker comprising an alkyl; a linker comprising a phosphate; a branched linker; an unbranched linker; a linker comprising at least one cleavage group; a linker comprising at least one redox cleavage group; a linker comprising at least one phosphate-based cleavage group; a linker comprising at least one acid-cleavage group; a linker comprising at least one ester-based cleavage group; and a linker comprising at least one peptide-based cleavage group.
495. The composition or method of any one of the preceding embodiments, wherein each oligonucleotide of the plurality is individually conjugated to the same lipid at the same location.
496. The composition or method of any one of the preceding embodiments, wherein a lipid is conjugated to an oligonucleotide through a linker.
497. The composition or method of any one of the preceding embodiments, wherein one or more oligonucleotides of the plurality are independently conjugated to a targeting compound or moiety.
498. The composition or method of any one of the preceding embodiments, wherein one or more oligonucleotides of the plurality are independently conjugated to a lipid and a targeting compound or moiety.
499. The composition or method of any one of the preceding embodiments, wherein one or more oligonucleotides of the plurality are independently conjugated to a lipid at one end and a targeting compound or moiety at the other.
500. The composition or method of any one of the preceding embodiments, wherein oligonucleotides of the plurality share the same chemical modification patterns.
501. The composition or method of any one of the preceding embodiments, wherein oligonucleotides of the plurality share the same chemical modification patterns comprising one or more base modifications.
502. The composition or method of any one of the preceding embodiments, wherein oligonucleotides of the plurality share the same chemical modification patterns comprising one or more sugar modifications.
503. The composition or method of any one of the preceding embodiments, wherein the common base sequence is capable of hybridizing with a transcript in a cell, which transcript contains a mutation that is linked to a muscle disease, or whose level, activity and/or distribution is linked to a muscle disease.
504. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide is a nucleic acid.
505. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide is an oligonucleotide.
506. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide is an oligonucleotide which mediates exon skipping.
507. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide is a stereodefined oligonucleotide which mediates exon skipping.
508. The composition or method of any one of the preceding embodiments, wherein the disease or disorder is a muscle-related disease or disorder.
509. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted, C10-C80 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein each variable is independently as defined and described herein.
510. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C80 saturated or partially unsaturated, aliphatic chain.
511. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C80 linear, saturated or partially unsaturated, aliphatic chain.
512. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C60 saturated or partially unsaturated, aliphatic chain.
513. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain.
514. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C40 saturated or partially unsaturated, aliphatic chain.
515. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.
516. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted, C10-C60 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein each variable is independently as defined and described herein.
517. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C80 saturated or partially unsaturated, aliphatic chain.
518. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C60 linear, saturated or partially unsaturated, aliphatic chain.
519. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.
520. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted, C10-C40 saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, a C1-C6 heteroaliphatic moiety, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein each variable is independently as defined and described herein.
521. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C40 saturated or partially unsaturated, aliphatic chain.
522. The composition or method of any one of the preceding embodiments, wherein the lipid comprises an optionally substituted C10-C40 linear, saturated or partially unsaturated, aliphatic chain.
523. The composition or method of any one of the preceding embodiments, wherein the composition further comprises one or more additional components selected from: a polynucleotide, carbonic anhydrase inhibitor, a dye, an intercalating agent, an acridine, a cross-linker, psoralene, mitomycin C, a porphyrin, TPPC4, texaphyrin, Sapphyrin, a polycyclic aromatic hydrocarbon phenazine, dihydrophenazine, an artificial endonuclease, a chelating agent, EDTA, an alkylating agent, a phosphate, an amino, a mercapto, a PEG, PEG-40K, MPEG, [MPEG]2, a polyamino, an alkyl, a substituted alkyl, a radiolabeled marker, an enzyme, a hapten biotin, a transport/absorption facilitator, aspirin, vitamin E, folic acid, a synthetic ribonuclease, a protein, a glycoprotein, a peptide, a molecule having a specific affinity for a co-ligand, an antibody, a hormone, a hormone receptor, a non-peptidic species, a lipid, a lectin, a carbohydrate, a vitamin, a cofactor, or a drug.
524. The composition or method of any one of the preceding embodiments, wherein the lipid comprises a C10-C80 linear, saturated or partially unsaturated, aliphatic chain.
525. The composition or method of any one of the preceding embodiments, wherein the composition further comprises a linker linking the oligonucleotide and the lipid, wherein the linker is selected from: an uncharged linker; a charged linker; a linker comprising an alkyl; a linker comprising a phosphate; a branched linker; an unbranched linker; a linker comprising at least one cleavage group; a linker comprising at least one redox cleavage group; a linker comprising at least one phosphate-based cleavage group; a linker comprising at least one acid-cleavage group; a linker comprising at least one ester-based cleavage group; a linker comprising at least one peptide-based cleavage group.
526. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is an oligonucleotide or oligonucleotide composition or chirally controlled oligonucleotide composition.
527. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is an oligonucleotide or oligonucleotide composition or chirally controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises or consists of the sequence of any oligonucleotide described herein.
528. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is an oligonucleotide or oligonucleotide composition or chirally controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises or consists of the sequence of any oligonucleotide listed in Table 4.
529. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is an oligonucleotide or oligonucleotide composition or chirally controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises or consists of the sequence of a splice-switching oligonucleotide.
530. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is an oligonucleotide or oligonucleotide composition or chirally controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises or consists of the sequence of an oligonucleotide capable of skipping or mediating skipping of an exon in the dystrophin gene.
531. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is a chirally controlled oligonucleotide composition.
532. The composition or method of any of the preceding embodiments, wherein the disease or disorder is Huntington's Disease.
533. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a mutant Huntingtin gene mRNA.
534. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises, consists of or is the sequence of any oligonucleotide disclosed herein.
535. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is capable of differentiating between a wild-type and a mutant Huntingtin allele.
536. The composition or method of any of the preceding embodiments, wherein the oligonucleotide is capable of participating in RNaseH-mediated cleavage of a mutant Huntingtin gene mRNA.
537. The composition or method of any of the preceding embodiments, wherein the oligonucleotide comprises, consists of or is the sequence of any oligonucleotide disclosed in Table 4.
538. The composition or method of any one of the preceding embodiments, wherein the oligonucleotide comprises or consists of or is an oligonucleotide or oligonucleotide composition or chirally controlled oligonucleotide composition, wherein the sequence of the oligonucleotide comprises or consists of the sequence of any of: WV-1092, WV-2595, or WV-2603.
539. The composition or method of any one of the preceding embodiments, wherein the sequence of an oligonucleotide includes any one or more of: base sequence (including length); pattern of chemical modifications to sugar and base moieties; pattern of backbone linkages; pattern of natural phosphate linkages, phosphorothioate linkages, phosphorothioate triester linkages, and combinations thereof; pattern of backbone chiral centers; pattern of stereochemistry (Rp/Sp) of chiral internucleotidic linkages; pattern of backbone phosphorus modifications; pattern of modifications on the internucleotidic phosphorus atom, such as —S—, and -L-R1 of formula I.
540. An oligonucleotide comprising a sequence that shares greater than about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% identity with a sequence found in a provided example oligonucleotide.
540a. The oligonucleotide of embodiment 540, wherein the sequence of the oligonucleotide is the sequence of a provided example oligonucleotide.
540b. The oligonucleotide of embodiment 540 or 540a, wherein the provided example oligonucleotide is an oligonucleotide selected from Table N1A, N2A, N3A, N4A or 8.
541. The oligonucleotide of embodiment 540, wherein the provided example oligonucleotide is WV-1092.
542. The oligonucleotide of embodiment 540, wherein the provided example oligonucleotide is WV-2595.
543. The oligonucleotide of embodiment 540, wherein the provided example oligonucleotide is WV-2603
544. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises the sequence found in the provided example oligonucleotide.
545. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide consists of the sequence found in the provided example oligonucleotide.
546. An oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises one or more natural phosphate linkages and one or more modified internucleotidic linkages.
547. The oligonucleotide of embodiment 546, wherein the oligonucleotide is an oligonucleotide of any one of embodiments 540-545.
548. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, or more natural phosphate linkages.
549. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises one or more modified internucleotidic linkages.
550. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises two or more modified internucleotidic linkages.
551. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more modified internucleotidic linkages.
552. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more modified internucleotidic linkages.
553. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises 10 or more modified internucleotidic linkages.
554. The oligonucleotide of any one of the preceding embodiments, wherein at least one of the modified internucleotidic linkages is a chirally controlled internucleotidic linkage in that oligonucleotides having the same sequence and chemical modifications within a composition share the same configuration, either Rp or Sp, at the chiral phosphorus atom of the modified internucleotidic linkage.
555. The oligonucleotide of any one of the preceding embodiments, wherein at least two modified internucleotidic linkages are chirally controlled.
556. The oligonucleotide of any one of the preceding embodiments, wherein at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 modified internucleotidic linkages are chirally controlled.
557. The oligonucleotide of any one of the preceding embodiments, wherein at least one modified internucleotidic linkage within a consecutive modified internucleotidic linkage region is chirally controlled.
558. The oligonucleotide of any one of the preceding embodiments, wherein at least two modified internucleotidic linkages within a consecutive modified internucleotidic linkage region are chirally controlled.
559. The oligonucleotide of any one of the preceding embodiments, wherein at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 modified internucleotidic linkages within a consecutive modified internucleotidic linkage region are chirally controlled.
560. The oligonucleotide of any one of the preceding embodiments, wherein each modified internucleotidic linkage within a consecutive modified internucleotidic linkage region is chirally controlled.
561. The oligonucleotide of any one of the preceding embodiments, wherein each modified internucleotidic linkage is chirally controlled.
562. The oligonucleotide of any one of the preceding embodiments, wherein a provided oligonucleotide comprises a (Sp)xRp(Sp)y pattern, wherein each of x and y is independently 1-20, and the sum of x and y is 1-50.
563. The oligonucleotide of any one of the preceding embodiments, wherein each of x and y is independently 2-20.
564. The oligonucleotide of any one of the preceding embodiments, wherein at least one of x and y is greater than 5, 6, 7, 8, 9, or 10.
565. The oligonucleotide of any one of the preceding embodiments, wherein the sum of x and y is greater than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
566. The oligonucleotide of any one of the preceding embodiments, wherein a provided oligonucleotide comprises one or more chemical modifications.
567. The oligonucleotide of any one of the preceding embodiments, wherein a provided oligonucleotide comprises one or more base modifications.
568. The oligonucleotide of any one of the preceding embodiments, wherein a provided oligonucleotide comprises one or more sugar modifications.
569. The oligonucleotide of any one of the preceding embodiments, wherein a sugar modification is a 2′-modification.
570. The oligonucleotide of any one of the preceding embodiments, wherein a sugar modification is LNA.
571. The oligonucleotide of any one of the preceding embodiments, wherein a provided oligonucleotide is a chirally controlled oligonucleotide.
572. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide is conjugated to a targeting component.
573. A oligonucleotide composition, comprising an oligonucleotide of any one of the preceding embodiments.
573a. The composition of embodiment 573, wherein the composition is a chirally controlled oligonucleotide composition comprising a predetermined level of the oligonucleotide.
574. The composition of any one of the preceding embodiments, or the composition in the method of any one of the preceding embodiments, further comprising a selectivity agent selected from: the group of compounds which binds specifically to one or more neurotransmitter transporters selected from the group consisting of a dopamine transporter (DAT), a serotonin transporter (SERT), and a norepinephrine transporter (NET); the group consisting of a dopamine reuptake inhibitor (DRI), a selective serotonin reuptake inhibitor (SSRI), a noradrenaline reuptake inhibitor (NRI), a norepinephrine-dopamine reuptake inhibitor (NDRI), and a serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI); the group consisting of a triple reuptake inhibitor, a noradrenaline dopamine double reuptake inhibitor, a serotonin single reuptake inhibitor, a noradrenaline single reuptake inhibitor, and a dopamine single reuptake inhibitor; and the group consisting of a dopamine reuptake inhibitor (DRI), a Norepinephrine-Dopamine Reuptake Inhibitor (NDRI) and a serotonin-Norepinephrine-Dopamine Reuptake Inhibitor (SNDRI).
575. A method for treating or preventing Huntington's Disease in a subject, comprising administering to the subject an oligonucleotide or a composition of any one of the preceding embodiments.
575a. A method of any one of the preceding embodiments, wherein the oligonucleotide or composition is administered via intrathecal administration.
576. A method for preparing an oligonucleotide, comprising providing a chiral reagent having the structure of Formula 3-AA.
577. A method for preparing an oligonucleotide, comprising providing a chiral reagent having the structure of

578. The method of any one of the preceding embodiments, wherein the chiral reagent is chirally pure.
579. A method for preparing an oligonucleotide, comprising providing a compound comprising a moiety from a chiral reagent having the structure of any one of the preceding embodiments, wherein —W1H and —W2H, or the hydroxyl and amino groups, form bonds with the phosphorus atom of the phosphoramidite.
580. The method of embodiment 579, wherein the compound has the structure of

581. The method of embodiment 580, wherein R connected to the 5′-O is a hydroxyl protecting group.
582. The method of embodiment 581, wherein the hydroxyl protecting group is DMTr.
583. The method of embodiment 582, wherein BPRO is a protected nucleobase.
584. The method of embodiment 583, wherein the nucleobase is an optionally substituted nucleobase selected from A, T, C and G.
585. The method of any one of the preceding embodiments, wherein W1 is —NG5, W2 is O.
586. The method of any one of the preceding embodiments, wherein each of G1 and G3 is independently hydrogen or an optionally substituted group selected from C1-10 aliphatic, heterocyclyl, heteroaryl and aryl, G2 is —C(R)2Si(R)3, and G4 and G5 are taken together to form an optionally substituted saturated, partially unsaturated or unsaturated heteroatom-containing ring of up to about 20 ring atoms which is monocyclic or polycyclic, fused or unfused.
587. The method of any one of the preceding embodiments, wherein each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl.
588. The method of any one of the preceding embodiments, wherein G1 is hydrogen.
589. The method of any one of the preceding embodiments, wherein G2 is —C(R)2Si(R)3, wherein —C(R)2— is optionally substituted —CH2—, and each R of —Si(R)3 is independently an optionally substituted group selected from C1-10 aliphatic, heterocyclyl, heteroaryl and aryl.
590. The method of any one of the preceding embodiments, wherein at least one R of —Si(R)3 is independently optionally substituted C1-10 alkyl.
591. The method of any one of the preceding embodiments, wherein at least one R of —Si(R)3 is independently optionally substituted phenyl.
592. The method of any one of the preceding embodiments, wherein one R of —Si(R)3 is independently optionally substituted C1-10 alkyl, and each of the other two R is independently optionally substituted phenyl.
593. The method of any one of the preceding embodiments, wherein G2 is optionally substituted —CH2Si(Me)(Ph)2.
594. The method of any one of the preceding embodiments, wherein G2 is —CH2Si(Me)(Ph)2.
595. The method of any one of the preceding embodiments, wherein G3 is hydrogen.
596. The method of any one of the preceding embodiments, wherein G4 and G5 are taken together to form an optionally substituted saturated 5-6 membered ring containing one nitrogen atom.
597. The method of any one of the preceding embodiments, wherein G4 and G5 are taken together to form an optionally substituted saturated 5-membered ring containing one nitrogen atom.
598. The method of any one of the preceding embodiments, wherein the chiral reagent is

599. The method of any one of the preceding embodiments, comprising providing a fluoro-containing reagent.
600. The method of any one of the preceding embodiments, wherein the fluoro-containing reagent is TBAF.
601. The method of any one of the preceding embodiments, comprising using a linker that is stable to a TBAF condition for removing the chiral reagent.
602. The method of any one of the preceding embodiments, wherein the linker is an SP linker.
603. The method of any one of embodiments 576-599, wherein the fluoro-containing reagent is HF—NR3.
604. The method of embodiment 603, wherein the fluoro-containing reagent is HF-NEt3.
605. The method of embodiment 603 or 604, comprising using a linker that is stable to a HF—NR3 condition for removing the chiral reagent.
606. The method of any one of embodiments 603-605, wherein the linker is a succinyl linker.

EXAMPLES

The foregoing has been a description of certain non-limiting embodiments of the disclosure. Accordingly, it is to be understood that the embodiments of the disclosure herein described are merely illustrative of the application of the principles of the disclosure. Reference herein to details of the illustrated embodiments is not intended to limit the scope of the claims.

Example 1. In Vitro Metabolic Stabilities of Human Chiromersens in Preincubated Rat Whole Liver Homogenates

The present Example describes comparisons of in vitro whole rat liver homogenate stability of Mipomersen (stereochemical mixture) with chirally controlled oligonucleotide compositions of Mipomersen (“chiromersens”). The method, among other things, is useful in screening compounds to predict in vivo half lives.

As is known in the art, Mipomersen (previously ISIS 301012, sold under the trade name Kynamro) is a 20mer oligonucleotide whose base sequence is antisense to a portion of the apolipoprotein B gene. Mipomersen inhibits apolipoprotein B gene expression, presumably by targeting mRNA. Mipomersen has the following structure:

(SEQ ID NO: 43) G*-C*-C*-U*-C*-dA-dG-dT-dC-dT-dG-dmC-dT-dT-dmC-G*- C*-A*-C*-C* [d = 2′-deoxy, *= 2′-O-(2-methoxyethyl)]

with 3′→5′ phosphorothioate linkages. Thus, Mipomersen has 2′-O-methoxyethyl-modified ribose residues at both ends, and deoxyribose residues in the middle.

Tested chirally pure Mipomersen analogs described in this Example included 3′→5′ phosphorothioate linkages. In some embodiments, tested analogs include one or more 2′-O-(2-methoxyethyl)-modified residues; in some embodiments, tested analogs include only 2′-deoxy residues. Particular tested analogs had the structures set forth below in Tables 3 and 4.

Protocol:

We used the protocol reported by Geary et al. (Oligonucleotides, Volume 20, Number 6, 2010) with some modifications.

Test System:

Six male Sprague-Dawley rats (Rattus norvegicus) were supplied by Charles River Laboratories, Inc., (Hollister, Calif.), and were received at SNBL USA.

Tissue Collection:

Animals were acclimated to the study room for two days prior to tissue collection. At the time of tissue collection, animals were anesthetized with an intraperitoneal (IP) injection of sodium pentobarbital solution. Liver perfusion was performed using 500 mL of chilled saline/animal, administered via the hepatic portal vein. After perfusion, the livers were dissected and maintained on ice. Livers were minced into small pieces then weighed.

Liver Homogenate Preparation:

The minced pieces of liver tissues were transferred to tared 50 mL centrifuge tubes and weighed. Chilled homogenization buffer (100 mM Tris pH 8.0, 1 mM magnesium acetate, with antibiotic-antimycotic agents) was added to each tube, such that the tube(s) contained 5 mL of buffer per gram of tissue. Using a QIAGEN TissueRuptor tissue homogenizer, the liver/buffer mixture was homogenized while maintaining the tube on ice. The protein concentration of the liver homogenate pool was determined using a Pierce BCA protein assay. Liver homogenates were divided into 5 mL aliquots, transferred to appropriately sized labeled cryovials and stored at −60° C.

Incubation Conditions:

5 ml aliquots of frozen liver homogenate (protein concentration=22.48 mg/ml) were thawed and incubated at 37° C. for 24 hrs. Six eppendorf tubes (2 ml) were taken for each oligomer in table land 450 ul of homogenate was added in each tube. 50 ul ASO (200 uM) was added to each tube. Immediately after mixing, 125 ul of (5×) stop buffer (2.5% IGEPAL, 0.5M NaCl, 5 mM EDTA, 50 mM Tris, pH=8.0) and 12.5 ul of 20 mg/ml Proteinase K (Ambion, # AM2546) was added to one tube for 0 hour time point. The remaining reaction mixtures were incubated at 37° C. with shaking at 400 rpm on VWR Incubating Microplate shaker. After incubation for a designated period (1, 2, 3, 4, and 5 days), each mixture was treated with 125 ul of (5×) stop buffer (2.5% IGEPAL, 0.5M NaCl, 5 mM EDTA, 50 mM Tris, pH=8.0) and 12.5 ul of 20 mg/ml Proteinase K (Ambion, # AM2546).

Work up and Bioanalysis: ISIS 355868 (5′-GCGTTT√{square root over (GCTCTT)}CTTCTTGCGTTTTTT-3′ (SEQ ID NO: 392)), a 27-mer oligonucleotide (underlined bases are MOE modified) was used as the internal standard for quantitation of chiromersens. 50 ul of internal standard (200 uM) was added to each tube followed by addition of 250 ul of 30% ammonium hydroxide, 800 ul of Phenol: Chloroform: isoamyl alcohol (25:24:1). After mixing and centrifugation at 600 rpg, the aqueous layer was evaporated on speed vac to 100 ul and loaded on Sep Pak column (C18, 1 g, WAT 036905). All the aqueous washings (2×20 ml) of Sep pak column were tested with quick Ion Exchange method to ensure that no product was found there. 50% ACN (3.5 ml) was used to elute the oligonucleotide and metabolites and the column was further washed with 70% CAN (3.5) ensure that there was nothing left on the column. Five fractions were collected for each sequence. Water wash 1, 2, 3, ACN1 and 2 using Visiprep system (Sigma, part number: 57031-U).

Ion Exchange Method

Time Flow (ml/min) % A % B Curve Time 1.0 95 5 1 2 1.0 95 5 1 2 3 1.0 75 25 6 3 10 1.0 35 65 6 4 10.1 1.0 95 5 6 5 12.5 1.0 95 5 1

Buffer A=10 mM Tris HCl, 50% ACN, pH=8.0

Buffer B=A+800 mM NaClO4 Column=DNA pac 100 Column Temperature 60° C.

Wash method was used after each run (Described in M9-Exp21) using the same buffers as above and 50:50 (methanol:water) in buffer line C.

Time Flow (ml/min) % A % B % C Curve Time 1.0 0 0 100 1 5.5 1.0 0 0 100 1 2 5.6 1.0 100 0 0 6 3 7.5 1.0 100 0 0 6 4 7.6 1.0 95 5 0 6 5 12.5 1.0 95 5 0 1

Acetonitrile eluate was concentrated to dryness and dissolved in 100 ul water to be analyzed using RPHPIPC.
Eluant A=10 mM Tributylammonium acetate, pH=7.0
Eluant B=ACN (HPLC grade, B& J)
Column: XTerra MS C18, 3.5 um, 4.6×50 mm, Part number: 186000432
Guard column from Phenomenex, part number: KJ0-4282 Column Temperature=60° C.

HPLC Gradient:

Time Flow (ml/min) % A % B Curve 1 1.0 65 35 2 5.0 1.0 65 35 1 3 30.0 1.0 40 60 6 4 35.0 1.0 5 90 6 5 36.0 1.0 65 35 6 6 40.0 1.0 65 35 1

For Analytical RP HPLC, 10 ul of this stock solution was added to 40 ul water and 40 ul was injected.

TABLE 3 S.NO. Sequence Description ONT- Gs5mCs5mCs Ts5mCsAs GsTs5mCs TsGs5mCs TsTs5mCs Gs5mCsAs 5mCs5mC Mipomersen 41 (SEQ ID NO: 393) ONT- Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC MOE-wing- 87 (SEQ ID NO: 394) core-wing design - (human) RNAse H substrate 1 5R-(SSR)3-5R ONT- Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC All deoxy, (5S- 154 (SEQ ID NO: 395) (SSR)3-5S) ONT- Gs5mCsGsTsTsTsGs5mCsTs5mCsTsTs5mCsTsTs5mCsTsTsGs5mCGsTsTsTsTsTsT ISIS 355868 70 (SEQ ID NO: 396) internal standard for quantitation of Mipomersen

Discussion:

2′ modifications in antisense and siRNAs are predicted to stabilize these molecules and increase their the persistence in plasma and tissues compared with wild-type DNAs and siRNAs.

2′-MOE Wing-Core-Wing Design in Mipomersen.

The first generation antisense oligonucleotides employed in the first antisense clinical trials had 2′-deoxy ribonucleotide residues and phosphorothioate internucleoside linkages. Subsequently, second generation antisense oligonucleotides were developed, which were typically of what is referred to herein as “5-10-5 2′-MOE wing-core-wing design”, in that five (5) residues at each end were 2′-O-methoxyethyl (2′-MOE)-modified residues and ten (10) residues in the middle were 2′-deoxy ribonucleotides; the internucleotide linkages of such oligonucleotides were phosphorothioates. Such “5-10-5 2′-MOE wing-core-wing” oligonucleotides exhibited marked improvement in potency over first generation (PCT/US2005/033837). Similar wing-core-wing motifs like 2-16-2, 3-14-3, 4-12-4, or 5-10-5 were designed to improve the stability of oligonucleotides to nucleases, while at the same time maintaining enough DNA structure for RNase activity.

Chirally pure oligonucleotides. The present disclosure provides chirally pure oligonucleotides and demonstrates, among other things, that selection of stereochemistry in and of itself can improve oligonucleotide stability (i.e., independent of residue modification such as 2′MOE modification). Indeed, the present disclosure demonstrates that chirally pure phosphorothioate oligonucleotides can provide same or better stability than corresponding 2′-modified stereorandom phosphorothioate compounds.

In some embodiments, tested chirally pure oligonucleotides are of the general structure X—Y—X with respect to stereochemistry in that they contain wing “X” regions (typically about 1-10 residues long) where all residues have the same stereochemistry flanking a core “Y” region in which stereochemistry varies. In many embodiments, about 20-50% of the nucleotide analogs in tested such oligonucleotides are not substrates for RNase H. The ability to control the stereochemistry of phosphorothioates in DNA enables us to protect the oligomers from degradation by nucleases while maintaining the RNase active sites. One of these designs is ONT-154 where wings of the oligonucleotide have been stabilized by Sp phosphorothioate chemistry with retention of few Rp phosphorothioates which are better substrates for RNase H (Molecular Cell, 2007). The crystal structure of human RNase H complexed with DNA/RNA duplex shows that the Phosphate-binding pocket of the enzyme makes contacts with four contiguous phosphates of DNA. The first three contacts seem stronger than fourth one and they prefer Pro-R/Pro-R/Pro-S oxygen atoms of each of these three phosphates. Combining the stability advantage coming from Sp stereochemistry with RNase H active sites, several sequences can be designed to compete with/or improve upon 2′-modifications. From rat whole liver homogenate stability experiment comparing Mipomersen (ONT-41) with our rational (chiral control) design with and without 2′-modifications (ONT-87 and ONT-154) (Table 1 and FIG. 1), it is evident that through removal of the 2′-modifications and careful chiral control with Rp and Sp phosphorothioates, we can improve the stability of these oligonucleotides which later affect the efficacy in vivo.

TABLE 4 Hu chiromersens studied for rat whole live homogenate stability SEQ ID Sequence Description Target Tm (° C.) NO: ONT-41 Gs5mCs5mCs Ts5mCsAs GsTs5mCs TsGs5mCs Hu ApoB 80.7 397 TsTs5mCs Gs5mCsAs 5mCs5mC ONT-75 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTs Hu ApoB 85.0 398 Ts5mCsGs5mCsAs5mCs5mC ONT-77 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTs Hu ApoB 79.9 399 Ts5mCsGs5mCsAs5mCs5mC ONT-80 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT Hu ApoB 75.8 400 s5mCsGs5mCsAs5mCs5mC ONT-81 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT Hu ApoB 80.7 401 s5mCsGs5mCsAs5mCs5mC ONT-87 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT Hu ApoB 82.4 402 s5mCsGs5mCsAs5mCs5mC ONT-88 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT Hu ApoB 78.9 403 s5mCsGs5mCsAs5mCs5mC ONT-89 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT Hu ApoB 80.9 404 s5mCsGs5mCsAs5mCs5mC ONT-70 Gs5mCsGsTsTsTsGs5mCsTs5mCsTsTs5mCsTsTs ISIS 405 5mCsTsTsGs5mCGsTsTsTsTsTsT 355868 internal standard

TABLE 5 Mouse chiromersens studied for rat whole live homogenate stability SEQ ID Sequence Description Target NO: ONT-83 GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC Mouse 406 ApoB ONT-82 GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC Mouse 407 ApoB ONT-84 GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC Mouse 408 ApoB ONT-85 GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC Mouse 409 ApoB ONT-86 GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC Mouse 410 ApoB

Example 2. Example Chirally Controlled siRNA Molecules

TABLE 1 Summary of Phosphodiester Polar interactions with h-Ago-2 and h-Ago-1 Science 2012 hAgo-2 Phosphate* Residue Length/Å Config 2 Asn551 2.7 Pro(S) Gln548 2.9 Pro(S) 3 Lys566 3.1 Pro(R) Arg792 3.4 Pro(R) 4 Tyr790 2.6 Pro(R) Arg792 3.0 Pro(R) 2.8 Pro(R) 3.4 Pro(S) 5 Ser798 2.7 Pro(R) 2.9 Pro(R) Tyr804 2.8 Pro(S) 6 Lys709 3.0 Pro(S) Arg761 2.9 Pro(R) His753 2.8 Pro(R) 7 Arg714 2.9 Pro(R) 3.0 Pro(R) Arg761 3.0 Pro(S) *Phosphate No. from 5′-end Cell 2012 hAgo-2 Phosphate Residue Length/Å Config 2 Asn551 2.7 Pro(S) Gln548 3.1 Pro(S) Gln548 2.9 Pro(R) 3 Lys566 2.9 Pro(R) Arg792 3.3 Pro(R) 4 Tyr790 2.8 Pro(R) Arg792 2.8 Pro(R) 5 Ser798 2.6 Pro(R) 2.9 Pro(R) Tyr804 2.5 Pro(S) 6 Lys709 3.2 Pro(S) Arg761 2.8 Pro(R) His753 3.0 Pro(R) 7 Arg714 2.8 Pro(R) 3.1 Pro(R) Arg761 2.8 Pro(S) 8 Arg761 2.4 Pro(S) Ala221 3.5 Pro(R) 9 Arg351 2.2 Pro(R) 10 Arg710 2.5 Pro(R) 18 No contacts 19 Tyr311 3.1 Pro(R) Arg315 2.8 Pro(R) 20 His271 3.1 Pro(R) His319 3.4 Pro(S) Tyr311 2.2 Pro(S) Cell Rep 2013, h-Ago-1† Phosphate Residue Length/Å Config 2 Asn549 2.7 Pro(S) Gln546 2.9 Pro(S) 2.8 Pro(R) 2 Lys564 2.9 Pro(R) Arg790 3.4 Pro(R) 3.3 Pro(R) 4 Try788 2.7 Pro(R) Arg790 3.3 Pro(R) 5 Ser796 2.5 Pro(R) 2.8 Pro(R) Tyr802 2.6 Pro(S) 6 Lys707 2.8 Pro(S) Arg759 2.7 Pro(R) His751 3.0 Pro(R) 7 Arg712 3.1 Pro(S) 3.3 Pro(S) Arg373 3.4 Pro(R) Thr757 2.9 Pro(R) 8 Arg759 2.2 Pro(S) His710 3.4 Pro(R) Ser218 2.7 Pro(R) 9 Arg349 3.5 Pro(R) Arg708 2.9 Pro(S) 10 Arg708 3.2 Pro(R) 2.9 Pro(R) 21 Tyr309 2.6 Pro(S) Tyr314 2.6 Pro(S) His269 3.0 Pro(R) †Complexed with h-let-7 22mer

The present disclosure, despite teachings in the art to the contrary, recognizes that stereochemistry of internucleotidic linkages can be utilized to increase stability and activity of oligonucleotides through chirally controlled oligonucleotide compositions. Such chirally controlled oligonucleotide compositions can provide much better results than chirally uncontrolled oligonucleotide compositions as demonstrated in this disclosure.

There are two reported crystal structures of RNA complexed with human Argonaute-2 protein (hAgo2): The Crystal Structure of Human Argonaute-2, Science, 2012 (PDB-4ei3); and The Structure of Human Argonaute-2 in Complex with miR-20a Cell, 2012 PDB-4f3t). In addition, there is one reported crystal structure of Let-7 RNA complexed with human Argonaute-1 protein (hAgo-1): The Making of a Slicer: Activation of Human Argonaute-1, Cell Rep. 2013 (PDB-4krf).

Based upon the information contained in these publications, it was anticipated that some judgments could be made about advantageous preferences for stereochemistry at the internucleotidic phosphate linkage if the phosphodiester bonds were to be replaced by phosphorothioate diester bonds. These advantages could relate to significantly improved potency, stability and other pharmacological properties. With this in mind, the computer program Pymol was used to locate all polar interactions between the protein and the internucleotidic phosphodiester linkage of the crystallized RNA for all three structures. Polar interactions at a distance of more than 3.5 A were ignored.

The results of this analysis are summarized in Table 1. A particular phosphorus atom from the phosphodiester backbone on the RNA was assigned a Pro(R) or a Pro(S) configuration based upon the assumption that in the phosphorothioate diester analog the quite similar bond would be made between the polar group on an amino acid residue and the respectful phosphate oxygen atom. The sulfur substitution, instead of non-bridging oxygen would therefore confer a unique stereochemistry (either (Sp) or (Rp) absolute configuration) on the phosphorus atom within that motif.

Of note is the extraordinarily good agreement between the two structures of hAgo-2 in complex with RNA. Also, there is an excellent agreement between the structures of hAgo-1 and hAgo-2 in complex with RNA, indicating that the conformation that the RNA molecule adopts is highly conserved between these two proteins. Any conclusions or rules which are formed based upon the results of this analysis are likely, therefore, to be valid for both protein molecules.

As can be seen, there is usually more than one polar interaction at any one phosphodiester group, with the exception of those between the phosphodiesters at phosphate positions 9 and 10 and hAgo-2 (Cell 2012) which adopt exclusively Pro(Rp) preference through bonding with Arg351 and Arg710 respectively.

However, shorter distances (corresponding to stronger interactions) as well as the number of bonds per oxygen can suggest a predominant interaction for the Pro(Rp) or the Pro(Sp) oxygens: hence resulting in several interactions which are predominantly of one stereochemical type or the other. Within this group are the interactions between the phosphodiesters at phosphate positions 2 (Sp), 3 (Rp), 4 (Rp), 6 (Rp), 8 (Sp), 19 (Rp), 20 (Sp) and 21 (Sp).

Of the remaining interactions, there does not appear to be a preference for one particular stereochemistry to be adopted over the other, so the preferred stereochemistry could be either (Sp) or (Rp).

Within this category are the interactions formed between the phosphodiesters at phosphate positions 5 (Rp or Sp) and 7 (Rp or Sp).

For interactions at the other phosphate backbone, there is no crystal structure information, so stereochemistry at these positions can similarly be either (Rp) or (Sp) until empirical data shows otherwise.

To this end, Table 6 contains several non-limiting example siRNA general constructs which can be conceived to take advantage of this preference for stereochemistry at individual phosphorothioate diester motifs.

TABLE 6 Example general siRNA constructs PS* Chirally Controlled Antisense Strand Construct 2 (Sp) (Rp) (Sp) (Rp) (Sp) (Rp) 3 (Rp) (Sp) (Rp) (Sp) (Rp) (Sp) 4 (Rp) (Sp) PO PO (Rp) (Sp) 5 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 6 (Rp) (Sp) PO PO (Rp) (Sp) 7 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 8 (Sp) (Rp) PO PO (Sp) (Rp) 9 (Rp) (Sp) PO PO (Rp) (Sp) 10 (Rp) (Sp) PO PO (Rp) (Sp) 11 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 12 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 13 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 14 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 15 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 16 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 17 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 18 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 19 (Rp) (Sp) PO PO (Rp) (Sp) 20 (Sp) (Rp) (Sp) (Rp) (Sp) (Rp) 21 (Sp) (Rp) (Sp) (Rp) (Sp) (Rp) *The number indicates the phosphate position from the 5′ end of the antisense strand of the siRNA, (e.g. #2 is located between nucleotides 1 and 2 and #21 is located between nucleotides 20 and 21). (Sp) and (Rp) designates stereochemistry of phosphorus atom on phosphorothioate (PS) diester internucleotidic linkage at the indicated position. PO designates a phosphodiester internucleotidic linkage at the indicated position.

Example siRNAs include but are not limited to siRNAs having a Sp configuration for a chiral phosphorothioate at the 3′end and at the 5′end of the antisense strand of the siRNA duplex, which confers unprecedentedly increased stability in human serum or biological fluids. That same Sp configuration for the chiral phosphorothioate at the 3′end and at the 5′end of the antisense strand of the siRNA duplex confers unprecedentedly increased biological potency caused by increased affinity to the Ago2 protein leading to increased activity within the RISC RNAi silencing complex.

In one embodiment, a single chiral phosphorothioate motif is introduced independently at each position along the antisense or sense strand of the siRNA molecule. For a 21mer, this provides 80 unique sequences, with either an (Sp) or an (Rp) chirally controlled phosphorothioate group. When duplexed independently, 1600 unique combinations of siRNAs are prepared.

siRNA Transfection of Chiral siRNA Molecules

Hep3B, or HeLa cells are reverse transfected at a density of 2.0×104 cells/well in 96-well plates. Transfection of siRNA is carried out with lipofectamine RNAiMax (Life Technologies, cat. No. 13778-150) using the manufacturer's protocol, except with a decreased amount of Lipofectamine RNAiMax of 0.2 ul per well. Twelve, 1:3 siRNA duplex dilutions are created starting at 1 uM. 10 ul of 10×siRNA duplex is then lipoplexed with a prepared mixture of 9.8 ul of serum-free medium and 0.2 ul of Lipofectamine RNAiMax per well. After a 10-15 minute incubation, 2.0×104 cells in 80 ul of EMEM cell growing media (ATCC, 30-2003) is added to bring the final volume to 100 ul per well. Two separate transfection events are performed for each dose.

24 hours after transfection Hep3B or HeLa cells are lysed and mRNA against which the siRNA is targeted is purified using MagMAX™-96 Total RNA Isolation Kit (Life Technologies, AM1830); 15 ul of cDNA is synthesized with High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Life Technologies, 4374967). Gene expression is evaluated by Real-Time PCR on a Lightcycler 480(Roche) using a Probes Master Mix (Roche, 04 707 494 001) according to manufacturer's protocol.

IC50s and Data Analysis

Delta Ct method is used to calculate values. Samples are normalized to hGAPDH and calibrated to mock transfected and untreated samples. A stereo-random molecule is used as a control. The data is represented as a mean of 2 biological replicates using Graphpad Prism. A four-parameter linear regression curve is fitted to the data and the bottom and top are constrained to a 0 and 100 constants respectively in order to calculate a relative IC50.

The present Example demonstrates successful inhibition of target gene expression using siRNA agents comprised of chirally controlled oligonucleotides as described herein. Specifically, this Example describes hybridization of individual oligonucleotide strands prepared through chirally controlled synthesis as described herein, so that double-stranded chirally controlled siRNA oligonucleotide compositions are provided. This Example further demonstrates successful transfection of cells with such agents and, moreover, successful inhibition of target gene expression.

In Vitro Metabolic Stabilities of Human PCSK9 siRNA Duplexes Having Stereocontrolled Phosphorothioate Diester Linkages in Human Serum.

10 μM siRNA duplexes were incubated in 90% human serum (50 μL, Sigma, H4522) at 37° C. for 24 hours. A 0 min time point (50 μL) was prepared as well as a PBS control incubation time point (50 μL), where the 10 μM siRNA duplex was incubated in 90% 1×PBS (50 μL at 37° C. for 24 hours. After completion of the incubation, to each time point, were added 10 μL of Stop-Solution (0.5 M NaCl, 50 mM TRIS, 5 mM EDTA, 2.5% IGEPAL), followed by 3.2 μL of Proteinase K (20 mg/mL, Ambion). The samples were incubated at 60° C. for 20 min, and then centrifuged at 2000 rpm for 15 min. The final reaction mixtures were directly analyzed in denaturing IEX HPLC (injection volume 50 μL). The ratio of integrated area at 24 h and 0 min was used to determine the % of degradation for each siRNA.

It was observed that the stereochemistry configuration of the single phosphorothioate at position 21 (3′end) of both the antisense strand and the sense strand of the siRNA had a crucial impact on the stability of the duplex upon incubation in Human Serum (FIG. 1). As illustrated in the FIG. 1 and as determined following the integration ratio of the degradation pattern, an (Rp, Rp) siRNA duplex exhibited a significant 55.0% degradation after 24 h. The stereorandom mixture of phosphorothioates in the stereorandom siRNA showed 25.2% degradation after 24 h. The (Sp/Sp) siRNA showed only minor 7.3% degradation after 24 h. This illustrates the drastic impact that phosphorothioate stereochemistry confers to therapeutic siRNAs. Additional example data were presented in FIG. 2, FIG. 3, FIG. 4 and FIG. 5.

It is observed that each of the stereopure constructs show different potency (IC50 values) dependent on the position of the phosphorothioate motif along the backbone. It is also observered that different IC50 values are obtained dependent upon whether the phosphorothioate motif at any single position is (Sp) or (Rp). The impact of stereochemistry upon stability is likewise clear and differentiating, using either Human Serum described above, or Human Hepatic Cytosol extract or Snake Venom Phosphodiesterase, or isolated endonuclease or isolated exonuclease.

Certain design rules may be formulated based upon data obtained in the above example. These design information can be applied for the introduction of multiple chiral phosphorothioate linkages within the antisense and/or sense strand of the siRNA as exemplified below. The present disclosure recognizes that an increased amount of chiral phosphorothioate within the antisense and/or sense strand of the siRNA, introduced at the right positions and having the right stereochemistry configuration leads to greatly improved siRNA constructs in terms of potency and metabolic stability in vitro—translating into greatly pharmacologically enhanced therapeutic siRNAs.

Example Chirally Controlled siRNA Oligonucleotides Targeting PCSK9

Proprotein convertase subtilisin/kexin type 9 (PCSK9), is an enzyme involved in cholesterol metabolism. PCSK9 binds to the receptor for low density lipoprotein (LDL), triggering its destruction. Although LDL associated with the receptor is also eliminated when the receptor is destroyed, the net effect of PCSK9 binding in fact increases LDL levels, as the receptor would otherwise cycle back to the cell surface and remove more cholesterol.

Several companies are developing therapeutic agents that target PCSK9. Of particular relevance to the present disclosure, each of Isis Pharmaceuticals, Santaris Pharma, and Alnylam Pharmaceuticals is developing a nucleic acid agent that inhibits PCSK9. The Isis Pharmaceuticals product, an antisense oligonucleotide, has been shown to increase expression of the LDLR and decrease circulating total cholesterol levels in mice (Graham et al “Antisense inhibition of proprotein convertase subtilisin/kexin type 9 reduces serum LDL in hyperlipidemic mice”. J. Lipid Res. 48 (4): 763-7, April 2007). Initial clinical trials with the Alnylam Pharmaceuticals product, ALN-PCS, reveal that RNA interference offers an effective mechanism for inhibiting PCSK9 (Frank-Kamenetsky et al “Therapeutic RNAi targeting PCSK9 acutely lowers plasma cholesterol in rodents and LDL cholesterol in nonhuman primates”. Proc. Natl. Acad. Sci. U.S.A. 105 (33): 11915-20, August 2008).

In some embodiments, despite known results to the contrary, the present disclosure recognizes that phosphorothioate motifs of one stereochemical conformation or another can be rationally designed to take advantage of increased potency, stability and other pharmacological qualities through chirally controlled oligonucleotide compositions. To reinforce this concept, table 3 contains example stereochemically pure constructs based on an siRNA sequence which targets PCSK9 messenger RNA.

In this example embodiment, a single chiral phosphorothioate motif is introduced independently at each position along the antisense or sense strand of the siRNA molecule. For a 21mer, this provides 80 unique sequences, with either an (Sp) or an (Rp) chirally controlled phosphorothioate group. When duplexed independently, 1600 unique combinations of siRNAs are prepared.

In other example embodiments, a single chiral phosphorothioate motif is introduced independently at each position along the antisense or sense strand of the siRNA molecule, while a 3′-(Sp) phosphorothioate linkage is conserved. For a 21mer, this provides another additional 80 unique sequences, with either an (Sp) or an (Rp) chirally controlled phosphorothioate group. When duplexed independently, 1600 unique combinations of siRNAs are prepared.

In other example embodiments, multiple chiral phosphorothioate motifs are introduced independently at several positions along the antisense or sense strand of the siRNA molecule, following the codes described in Table 7, while a 3′-(Sp) phosphorothioate linkage is conserved.

TABLE 7 Example of PCSK-9 Sense and Antisense RNAs SEQ PCSK9 siRNA Sense Strands ID NO: PCSK9 (1) (Rp)-uucuAGAccuGuuuuGcuudTsdT 411 PCSK9 (2) (Sp)-uucuAGAccuGuuuuGcuudTsdT 412 PCSK9 (3) (Rp)-uucuAGAccuGuuuuGcuusdTdT 413 PCSK9 (4) (Sp)-uucuAGAccuGuuuuGcuusdTdT 414 PCSK9 (5) (Rp)-uucuAGAccuGuuuuGcusudTdT 415 PCSK9 (6) (Sp)-uucuAGAccuGuuuuGcusudTdT 416 PCSK9 (7) (Rp)-uucuAGAccuGuuuuGcsuudTdT 417 PCSK9 (8) (Sp)-uucuAGAccuGuuuuGcsuudTdT 418 PCSK9 (9) (Rp)-uucuAGAccuGuuuuGscuudTdT 419 PCSK9 (10) (Sp)-uucuAGAccuGuuuuGscuudTdT 420 PCSK9 (11) (Rp)-uucuAGAccuGuuuusGcuudTdT 421 PCSK9 (12) (Sp)-uucuAGAccuGuuuusGcuudTdT 422 PCSK9 (13) (Rp)-uucuAGAccuGuuusuGcuudTdT 423 PCSK9 (14) (Sp)-uucuAGAccuGuuusuGcuudTdT 424 PCSK9 (15) (Rp)-uucuAGAccuGuusuuGcuudTdT 425 PCSK9 (16) (Sp)-uucuAGAccuGuusuuGcuudTdT 426 PCSK9 (17) (Rp)-uucuAGAccuGusuuuGcuudTdT 427 PCSK9 (18) (Sp)-uucuAGAccuGusuuuGcuudTdT 428 PCSK9 (19) (Rp)-uucuAGAccuGsuuuuGcuudTdT 429 PCSK9 (20) (Sp)-uucuAGAccuGsuuuuGcuudTdT 430 PCSK9 (21) (Rp)-uucuAGAccusGuuuuGcuudTdT 431 PCSK9 (22) (Sp)-uucuAGAccusGuuuuGcuudTdT 432 PCSK9 (23) (Rp)-uucuAGAccsuGuuuuGcuudTdT 433 PCSK9 (24) (Sp)-uucuAGAccsuGuuuuGcuudTdT 434 PCSK9 (25) (Rp)-uucuAGAcscuGuuuuGcuudTdT 435 PCSK9 (26) (Sp)-uucuAGAcscuGuuuuGcuudTdT 436 PCSK9 (27) (Rp)-uucuAGAsccuGuuuuGcuudTdT 437 PCSK9 (28) (Sp)-uucuAGAsccuGuuuuGcuudTdT 438 PCSK9 (29) (Rp)-uucuAGsAccuGuuuuGcuudTdT 439 PCSK9 (30) (Sp)-uucuAGsAccuGuuuuGcuudTdT 440 PCSK9 (31) (Rp)-uucuAsGAccuGuuuuGcuudTdT 441 PCSK9 (32) (Sp)-uucuAsGAccuGuuuuGcuudTdT 442 PCSK9 (33) (Rp)-uucusAGAccuGuuuuGcuudTdT 443 PCSK9 (34) (Sp)-uucusAGAccuGuuuuGcuudTdT 444 PCSK9 (35) (Rp)-uucsuAGAccuGuuuuGcuudTdT 445 PCSK9 (36) (Sp)-uucsuAGAccuGuuuuGcuudTdT 446 PCSK9 (37) (Rp)-uuscuAGAccuGuuuuGcuudTdT 447 PCSK9 (38) (Sp)-uuscuAGAccuGuuuuGcuudTdT 448 PCSK9 (38) (Rp)-usucuAGAccuGuuuuGcuudTdT 449 PCSK9 (40) (Sp)-usucuAGAccuGuuuuGcuudTdT 450 NOTE: lower case letters represent 2′-OMe RNA residues; capital letters represent RNA residues; d = 2′-deoxy residues; and “s” indicates a phosphorothioate moiety.

Synthesis examples for Human PCSK9 siRNA Antisense Strands having several chiral phosphorothioate internucleotide linkages and full chiral phosphorothioate internucleotide linkages.

Human PCSK9 siRNA Antisense Strands SEQ ID NO: PCSK9 (41) (Rp)-AAGcAAAAcAGGUCuAGAAdTsdT 451 PCSK9 (42) (Sp)-AAGcAAAAcAGGUCuAGAAdTsdT 452 PCSK9 (43) (Rp)-AAGcAAAAcAGGUCuAGAAsdTdT 453 PCSK9 (44) (Sp)-AAGcAAAAcAGGUCuAGAAsdTdT 454 PCSK9 (45) (Rp)-AAGcAAAAcAGGUCuAGAsAdTdT 455 PCSK9 (46) (Sp)-AAGcAAAAcAGGUCuAGAsAdTdT 456 PCSK9 (47) (Rp)-AAGcAAAAcAGGUCuAGsAAdTdT 457 PCSK9 (48) (Sp)-AAGcAAAAcAGGUCuAGsAAdTdT 458 PCSK9 (49) (Rp)-AAGcAAAAcAGGUCuAsGAAdTdT 459 PCSK9 (50) (Sp)-AAGcAAAAcAGGUCuAsGAAdTdT 460 PCSK9 (51) (Rp)-AAGcAAAAcAGGUCusAGAAdTdT 461 PCSK9 (52) (Sp)-AAGcAAAAcAGGUCusAGAAdTdT 462 PCSK9 (53) (Rp)-AAGcAAAAcAGGUCsuAGAAdTdT 463 PCSK9 (54) (Sp)-AAGcAAAAcAGGUCsuAGAAdTdT 464 PCSK9 (55) (Rp)-AAGcAAAAcAGGUsCuAGAAdTdT 465 PCSK9 (56) (Sp)-AAGcAAAAcAGGUsCuAGAAdTdT 466 PCSK9 (57) (Rp)-AAGcAAAAcAGGsUCuAGAAdTdT 467 PCSK9 (58) (Sp)-AAGcAAAAcAGGsUCuAGAAdTdT 468 PCSK9 (59) (Rp)-AAGcAAAAcAGsGUCuAGAAdTdT 469 PCSK9 (60) (Sp)-AAGcAAAAcAGsGUCuAGAAdTdT 470 PCSK9 (61) (Rp)-AAGcAAAAcAsGGUCuAGAAdTdT 471 PCSK9 (62) (Sp)-AAGcAAAAcAsGGUCuAGAAdTdT 472 PCSK9 (63) (Rp)-AAGcAAAAcsAGGUCuAGAAdTdT 473 PCSK9 (64) (Sp)-AAGcAAAAcsAGGUCuAGAAdTdT 474 PCSK9 (65) (Rp)-AAGcAAAAscAGGUCuAGAAdTdT 475 PCSK9 (66) (Sp)-AAGcAAAAscAGGUCuAGAAdTdT 476 PCSK9 (67) (Rp)-AAGcAAAsAcAGGUCuAGAAdTdT 477 PCSK9 (68) (Sp)-AAGcAAAsAcAGGUCuAGAAdTdT 478 PCSK9 (69) (Rp)-AAGcAAsAAcAGGUCuAGAAdTdT 479 PCSK9 (70) (Sp)-AAGcAAsAAcAGGUCuAGAAdTdT 480 PCSK9 (71) (Rp)-AAGcAsAAAcAGGUCuAGAAdTdT 481 PCSK9 (72) (Sp)-AAGcAsAAAcAGGUCuAGAAdTdT 482 PCSK9 (73) (Rp)-AAGcsAAAAcAGGUCuAGAAdTdT 483 PCSK9 (74) (Sp)-AAGcsAAAAcAGGUCuAGAAdTdT 484 PCSK9 (75) (Rp)-AAGscAAAAcAGGUCuAGAAdTdT 485 PCSK9 (76) (Sp)-AAGscAAAAcAGGUCuAGAAdTdT 486 PCSK9 (77) (Rp)-AAsGcAAAAcAGGUCuAGAAdTdT 487 PCSK9 (78) (Sp)-AAsGcAAAAcAGGUCuAGAAdTdT 488 PCSK9 (77) (Rp)-AsAGcAAAAcAGGUCuAGAAdTdT 489 PCSK9 (78) (Sp)-AsAGcAAAAcAGGUCuAGAAdTdT 490 PCSK9 (79) (Rp, Sp)-AAGcAAAAcAGGUCuAGAAsdTsdT 491 PCSK9 (80) (Sp, Sp)-AAGcAAAAcAGGUCuAGAAsdTsdT 492 PCSK9 (81) (Rp, Sp)-AAGcAAAAcAGGUCuAGAsAdTsdT 493 PCSK9 (82) (Sp, Sp)-AAGcAAAAcAGGUCuAGAsAdTsdT 494 PCSK9 (83) (Rp, Sp)-AAGcAAAAcAGGUCuAGsAAdTsdT 495 PCSK9 (84) (Sp, Sp)-AAGcAAAAcAGGUCuAGsAAdTsdT 496 PCSK9 (85) (Rp, Sp)-AAGcAAAAcAGGUCuAsGAAdTsdT 497 PCSK9 (86) (Sp, Sp)-AAGcAAAAcAGGUCuAsGAAdTsdT 498 PCSK9 (87) (Rp, Sp)-AAGcAAAAcAGGUCusAGAAdTsdT 499 PCSK9 (88) (Sp, Sp)-AAGcAAAAcAGGUCusAGAAdTsdT 500 PCSK9 (89) (Rp, Sp)-AAGcAAAAcAGGUCsuAGAAdTsdT 501 PCSK9 (90) (Sp, Sp)-AAGcAAAAcAGGUCsuAGAAdTsdT 502 PCSK9 (91) (Rp, Sp)-AAGcAAAAcAGGUsCuAGAAdTsdT 503 PCSK9 (92) (Sp, Sp)-AAGcAAAAcAGGUsCuAGAAdTsdT 504 PCSK9 (93) (Rp, Sp)-AAGcAAAAcAGGsUCuAGAAdTsdT 505 PCSK9 (94) (Sp, Sp)-AAGcAAAAcAGGsUCuAGAAdTsdT 506 PCSK9 (95) (Rp, Sp)-AAGcAAAAcAGsGUCuAGAAdTsdT 507 PCSK9 (96) (Sp, Sp)-AAGcAAAAcAGsGUCuAGAAdTsdT 508 PCSK9 (97) (Rp, Sp)-AAGcAAAAcAsGGUCuAGAAdTsdT 509 PCSK9 (98) (Sp, Sp)-AAGcAAAAcAsGGUCuAGAAdTsdT 510 PCSK9 (99) (Rp, Sp)-AAGcAAAAcsAGGUCuAGAAdTsdT 511 PCSK9 (100) (Sp, Sp)-AAGcAAAAcsAGGUCuAGAAdTsdT 512 PCSK9 (101) (Rp, Sp)-AAGcAAAAscAGGUCuAGAAdTsdT 513 PCSK9 (102) (Sp, Sp)-AAGcAAAAscAGGUCuAGAAdTsdT 514 PCSK9 (103) (Rp, Sp)-AAGcAAAsAcAGGUCuAGAAdTsdT 515 PCSK9 (104) (Sp, Sp)-AAGcAAAsAcAGGUCuAGAAdTsdT 516 PCSK9 (105) (Rp, Sp)-AAGcAAsAAcAGGUCuAGAAdTsdT 517 PCSK9 (106) (Sp, Sp)-AAGcAAsAAcAGGUCuAGAAdTsdT 518 PCSK9 (107) (Rp, Sp)-AAGcAsAAAcAGGUCuAGAAdTsdT 519 PCSK9 (108) (Sp, Sp)-AAGcAsAAAcAGGUCuAGAAdTsdT 520 PCSK9 (109) (Rp, Sp)-AAGcsAAAAcAGGUCuAGAAdTsdT 521 PCSK9 (110) (Sp, Sp)-AAGcsAAAAcAGGUCuAGAAdTsdT 522 PCSK9 (111) (Rp, Sp)-AAGscAAAAcAGGUCuAGAAdTsdT 523 PCSK9 (112) (Sp, Sp)-AAGscAAAAcAGGUCuAGAAdTsdT 524 PCSK9 (113) (Rp, Sp)-AAsGcAAAAcAGGUCuAGAAdTsdT 525 PCSK9 (114) (Sp, Sp)-AAsGcAAAAcAGGUCuAGAAdTsdT 526 PCSK9 (115) (Rp, Sp)-AsAGcAAAAcAGGUCuAGAAdTsdT 527 PCSK9 (116) (Sp, Sp)-AsAGcAAAAcAGGUCuAGAAdTsdT 528 PCSK9 (117) (Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Rp)- 529 AsAsGscAsAAsAscsAGGUCuAGAsAsdTsdT PCSK9 (118) (Sp, Rp, Rp, Rp, Sp, Rp, Rp, Rp, Sp, Sp)- 530 AsAsGscAsAAsAscsAGGUCuAGAsAsdTsdT NOTE: lower case letters represent 2′-OMe RNA residues; capital letters represent RNA residues; d = 2′-deoxy residues; and “s” indicates a phosphorothioate moiety.

Example 3. Stereopure FOXO—1 Antisense Analogs Rational Design—Chirally Controlled Antisense Oligonucleotide Compositions

The unprecedented nuclease stability determined in vivo and in a whole rat liver homogenate model of the Sp-chiral phosphorothioate internucleotide linkage is applied in the novel design of new types of RNaseH substrate gapmers, whereby the external flanks are composed of unmodified DNA and the internal gap core is modified with 2′ chemical modifications (2′OMe, 2′MOE, 2′LNA, 2′F, etc). Eventually this design is extended to fully unmodified DNA therapeutic oligonucleotides wherein careful chiral control of the phosphorothioate backbone confers the desired pharmacological properties of the RNaseH therapeutic oligonucleotide.

The application of the triplet-phosphate repeating motif designed after studying the crystal structure of human RNaseH has been employed as well. The crystal structure of RNaseH has been previously published (Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse Transcription, Nowotny et al., Molecular Cell, Volume 28, Issue 2, 264-276, 2007, pdb file: 2 qkb). Among other things, the present disclosure recognizes the importance of internucleotidic linkage stereochemistry of oligonucleotides, for example, in settings herein. Upon performing in silico analysis upon this structure using the program Pymol, Applicant found that the phosphate-binding pocket of Human RNase H1 makes polar contacts with three contiguous phosphates of the complexed DNA, and interacts preferentially with the Pro-R/Pro-R/Pro-S(or with the Pro-S/Pro-S/Pro-R) respective oxygen atoms of each of these three phosphates. Based on this observation we designed two chiral architectures with repeating (RRS) and (SSR) triplet phosphorothioates motifs as designed RNase H substrates. Applicant also designed other internucleotidic linkage stereochemical patterns. As demonstrated by example results provide herein, provided chirally controlled oligonucleotide compositions of oligonucleotide types that comprises certain backbone internucleotidic linkage patterns (patterns backbone chiral centers) provides significantly increased activity and/or kinetics. Among others, a sequence of 5′-RSS-3′ backbone chiral centers is particularly useful and delivers unexpected results as described in the present disclosure.

The combination of increased Sp chiral backbone (for enzymatic stability and other pharmacologically advantageous properties) and (RRS) or (SSR) repeating triplet chiral backbone motifs (for enhancing the property as RNase H substrate) are also utilized in the novel designs.; “S” represents Sp-phosphorothioate linkage and “R” represents Rp-phosphorothioate linkage.

Another alternative design is based on the increased amount of Sp chiral phosphorothioate backbone in extended repeating motifs such as: (SSSR)n, SR(SSSR)n, SSR(SSSR)n, SSR(SSSR)n; (SSSSR)n, SR(SSSSR)n, SSR(SSSSR)n, SSR(SSSSR)n, SSSR(SSSSR)n; (SSSSSR)n; SR(SSSSSR)n, SSR(SSSSSR)n, SSR(SSSSSR)n, SSSR(SSSSSR)n, SSSSR(SSSSSR)n; etc., where n=0-50, depending on the number of respective internucleotide linkages.; “S” represents Sp-phosphorothioate linkage and “R” represents Rp-phosphorothioate linkage. In some embodiments, n is 0. In some embodiments, R is 1-50. In some embodiments, R is 1. In some embodiments, a common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises a motif described herein. In some embodiments, a motif is in the core region. In some embodiments, n is 0. In some embodiments, R is 1-50. In some embodiments, R is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5.

Another alternative design is based on the “invert” architecture design of the stereo backbone (“stereo invert-mers”). These result from positioning the stereochemistry of the chiral phosphorothioate in a inverting manner, exposing some Sp-rich motifs at the 5′ and 3′ end extremities of the oligonucleotide as well as the middle portion of the oligonucleotide and having the repeating stereochemistry motifs positioned in a invert image manner on both sides, such as:

SS(SSR)n(SSS)(RSS)nSS;
SS(SSR)n(SRS)(RSS)nSS;
SS(SSR)n(SSR)(RSS)nSS;
SS(SSR)n(RSS)(RSS)nSS;
SS(RSS)n(SSS)(SSR)nSS;
SS(RSS)n(SRS)(SSR)nSS;
SS(RSS)n(SSR)(SSR)nSS;
SS(RSS)n(RSS)(SSR)nSS; etc.,
where n=0-50, depending on the number of respective internucleotide linkages. “S” represents Sp-phosphorothioate linkage and “R” represents Rp-phosphorothioate linkage. In some embodiments, a common pattern of backbone chiral centers of a provided chirally controlled oligonucleotide composition comprises a motif described herein. In some embodiments, a motif is in the core region. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 1-50. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5.

Initial Screen Synthesis: Summary for Oligonucleotide Synthesis on a DNA/RNA Synthesizer MerMade-12 (2′-Deoxy and 2′-OMe Cycle)

delivery step reaction reagent volume (mL) wait time (sec) 1 detritylation 3% TCA in DCM 4 × 1     N.A. 2 coupling 0.15M 2 × 0.5 mL 60 + 60 (DNA), phosphoramidite 300 + 300 (2′- in ACN + 0.45M OMe RNA) ETT in ACN 3 capping 5% Pac2O in 1  60 THF/2,6- lutidine + 16% NMI in THF 4 oxidation 0.02 Iodine in 1 240 water/pyridine

Stereorandom PS Oligonucleotides Having DNA-2′-OMe-DNA (7-6-7) Design

ONT-141 (SEQ ID NO: 531) d(CsCsCsTsCsTsGs)gsaststsgsasd(GsCsAsTsCsCsA) ONT-142 (SEQ ID NO: 532) d(AsAsGsCsTsTsTs)gsgststsgsgsd(GsCsAsAsCsAsC) ONT-143 (SEQ ID NO: 533) d(AsGsTsCsAsCsTs)tsgsgsgsasgsd(CsTsTsCsTsCsC) ONT-144 (SEQ ID NO: 534) d(CsAsCsTsTsGsGs)gsasgscststsd(CsTsCsCsTsGsG) ONT-145 (SEQ ID NO: 535) d(AsTsAsGsCsCsAs)tstsgscsasgsd(CsTsGsCsTsCsA) ONT-146 (SEQ ID NO: 536) d(TsGsGsAsTsTsGs)asgscsastscsd(CsAsCsCsAsAsG) ONT-147 (SEQ ID NO: 537) d(CsCsAsTsAsGsCs)csaststsgscsd(AsGsCsTsGsCsT) ONT-148 (SEQ ID NO: 538) d(GsTsCsAsCsTsTs)gsgsgsasgscsd(TsTsCsTsCsCsT) ONT-149 (SEQ ID NO: 539) d(CsCsAsGsGsGsCs)ascstscsastsd(CsTsGsCsAsTsG) ONT-150 (SEQ ID NO: 540) d(GsCsCsAsTsCsCs)asasgstscsasd(CsTsTsGsGsGsA) ONT-151 (SEQ ID NO: 541) d(GsAsAsGsCsTsTs)tsgsgststsgsd(GsGsCsAsAsCsA) ONT-152 (SEQ ID NO: 542) d(CsTsGsGsAsTsTs)gsasgscsastsd(CsCsAsCsCsAsA) ONT-183 (SEQ ID NO: 543) d(CsAsAsGsTsCsAs)cststsgsgsgsd(AsGsCsTsTsCsT) ONT-184 (SEQ ID NO: 544) d(AsTsGsCsCsAsTs)cscsasasgstsd(CsAsCsTsTsGsG) ONT-185 (SEQ ID NO: 545) d(AsTsGsAsGsAsTs)gscscstsgsgsd(CsTsGsCsCsAsT) ONT-186 (SEQ ID NO: 546) d(TsTsGsGsGsAsGs)cststscstscsd(CsTsGsGsTsGsG) ONT-187 (SEQ ID NO: 547) d(TsGsGsGsAsGsCs)tstscstscscsd(TsGsGsTsGsGsA) ONT-188 (SEQ ID NO: 548) d(TsTsAsTsGsAsGs)astsgscscstsd(GsGsCsTsGsCsC) ONT-189 (SEQ ID NO: 549) d(GsTsTsAsTsGsAs)gsastsgscscsd(TsGsGsCsTsGsC) ONT-190 (SEQ ID NO: 550) d(CsCsAsAsGsTsCs)ascststsgsgsd(GsAsGsCsTsTsC) ONT-191 (SEQ ID NO: 551) d(AsGsCsTsTsTsGs)gststsgsgsgsd(CsAsAsCsAsCsA) ONT-192 (SEQ ID NO: 552) d(TsAsTsGsAsGsAs)tsgscscstsgsd(GsCsTsGsCsCsA) ONT-193 (SEQ ID NO: 553) d(TsGsTsTsAsTsGs)asgsastsgscsd(CsTsGsGsCsTsG) ONT-194 (SEQ ID NO: 554) d(AsTsCsCsAsAsGs)tscsascststsd(GsGsGsAsGsCsT) ONT-195 (SEQ ID NO: 555) d(GsGsGsAsAsGsCs)tststsgsgstsd(TsGsGsGsCsAsA) ONT-196 (SEQ ID NO: 556) d(CsTsCsCsAsTsCs)csastsgsasgsd(GsTsCsAsTsTsC) ONT-197 (SEQ ID NO: 557) d(AsAsGsTsCsAsCs)tstsgsgsgsasd(GsCsTsTsCsTsC) ONT-198 (SEQ ID NO: 558) d(CsCsAsTsCsCsAs)asgstscsascsd(TsTsGsGsGsAsG) ONT-199 (SEQ ID NO: 559) d(TsCsCsAsAsGsTs)csascststsgsd(GsGsAsGsCsTsT) ONT-200 (SEQ ID NO: 560) d(CsCsTsCsTsGsGs)aststsgsasgsd(CsAsTsCsCsAsC) ONT-201 (SEQ ID NO: 561) d(AsCsTsTsGsGsGs)asgscststscsd(TsCsCsTsGsGsT) ONT-202 (SEQ ID NO: 562) d(CsTsTsGsGsGsAs)gscststscstsd(CsCsTsGsGsTsG) ONT-203 (SEQ ID NO: 563) d(CsAsTsGsCsCsAs)tscscsasasgsd(TsCsAsCsTsTsG) ONT-204 (SEQ ID NO: 564) d(TsGsCsCsAsTsCs)csasasgstscsd(AsCsTsTsGsGsG) ONT-205 (SEQ ID NO: 565) d(TsCsCsAsTsCsCs)astsgsasgsgsd(TsCsAsTsTsCsC) ONT-206 (SEQ ID NO: 566) d(AsGsGsGsCsAsCs)tscsastscstsd(GsCsAsTsGsGsG) ONT-207 (SEQ ID NO: 567) d(CsCsAsGsTsTsCs)cststscsastsd(TsCsTsGsCsAsC) ONT-208 (SEQ ID NO: 568) d(CsAsTsAsGsCsCs)aststsgscsasd(GsCsTsGsCsTsC) ONT-209 (SEQ ID NO: 569) d(TsCsTsGsGsAsTs)tsgsasgscsasd(TsCsCsAsCsCsA) ONT-210 (SEQ ID NO: 570) d(GsGsAsTsTsGsAs)gscsastscscsd(AsCsCsAsAsGsA)

Biology In Vitro Data in HepG2 Cells for the Initial DNA-2′-OMe-DNA (7-6-7) Design: (d Upper Case)=DNA; Lower Case=2′-OMe; s=Phosphorothioate

FOXO1 Levels at 20 nM (%) SD ONT-141 89 6 ONT-142 45 1 ONT-143 98 2 ONT-144 89 1 ONT-145 46 5 ONT-146 99 1 ONT-147 66 6 ONT-148 101 2 ONT-149 95 6 ONT-150 58 4 ONT-151 41 5 ONT-152 84 5 ONT-183 95 2 ONT-184 58 4 ONT-185 42 2 ONT-186 96 4 ONT-187 92 3 ONT-188 47 5 ONT-189 63 5 ONT-190 83 2 ONT-191 58 4 ONT-192 46 2 ONT-193 58 2 ONT-194 76 1 ONT-195 66 0 ONT-196 77 2 ONT-197 90 6 ONT-198 42 4 ONT-199 68 1 ONT-200 89 6 ONT-201 91 2 ONT-202 94 2 ONT-203 86 1 ONT-204 58 2 ONT-205 75 3 ONT-206 94 5 ONT-207 96 0 ONT-208 54 0 ONT-209 87 4 ONT-210 92 4 Levels at 200 nM (%) SD ONT-141 37 4 ONT-142 45 4 ONT-143 46 2 ONT-144 42 5 ONT-145 53 4 ONT-146 31 2 ONT-147 28 8 ONT-148 45 4 ONT-149 29 5 ONT-150 32 6 ONT-151 38 4 ONT-152 30 5 ONT-183 60 5 ONT-184 34 2 ONT-185 50 2 ONT-186 86 3 ONT-187 76 6 ONT-188 50 5 ONT-189 38 2 ONT-190 51 1 ONT-191 43 5 ONT-192 54 7 ONT-193 41 6 ONT-194 50 1 ONT-195 43 6 ONT-196 33 7 ONT-197 57 4 ONT-198 40 5 ONT-199 50 5 ONT-200 28 9 ONT-201 46 6 ONT-202 57 9 ONT-203 27 7 ONT-204 36 6 ONT-205 29 5 ONT-206 81 0 ONT-207 37 4 ONT-208 43 3 ONT-209 35 4 ONT-210 40 4

Stereorandom PS Oligonucleotides Having 2′-OMe-DNA-2′OMe (3-14-3) Design: (d Upper Case)=DNA; Lower Case=2′-OMe; s=Phosphorothioate

ONT-129 (SEQ ID NO: 571) cscscsd(TsCsTsGsGsAsTsTsGsAsGsCsAsTs)cscsa ONT-130 (SEQ ID NO: 572) asasgsd(CsTsTsTsGsGsTsTsGsGsGsCsAsAs)csasc ONT-131 (SEQ ID NO: 573) asgstsd(CsAsCsTsTsGsGsGsAsGsCsTsTsCs)tscsc ONT-132 (SEQ ID NO: 574) csascsd(TsTsGsGsGsAsGsCsTsTsCsTsCsCs)tsgsg ONT-133 (SEQ ID NO: 575) astsasd(GsCsCsAsTsTsGsCsAsGsCsTsGsCs)tscsa ONT-134 (SEQ ID NO: 576) tsgsgsd(AsTsTsGsAsGsCsAsTsCsCsAsCsCs)asasg ONT-135 (SEQ ID NO: 577) cscsasd(TsAsGsCsCsAsTsTsGsCsAsGsCsTs)gscst ONT-136 (SEQ ID NO: 578) gstscsd(AsCsTsTsGsGsGsAsGsCsTsTsCsTs)cscst ONT-137 (SEQ ID NO: 579) cscsasd(GsGsGsCsAsCsTsCsAsTsCsTsGsCs)astsg ONT-138 (SEQ ID NO: 580) gscscsd(AsTsCsCsAsAsGsTsCsAsCsTsTsGs)gsgsa ONT-139 (SEQ ID NO: 581) gsasasd(GsCsTsTsTsGsGsTsTsGsGsGsCsAs)ascsa ONT-140 (SEQ ID NO: 582) cstsgsd(GsAsTsTsGsAsGsCsAsTsCsCsAsCs)csasa ONT-155 (SEQ ID NO: 583) csasasd(GsTsCsAsCsTsTsGsGsGsAsGsCsTs)tscst ONT-156 (SEQ ID NO: 584) astsgsd(CsCsAsTsCsCsAsAsGsTsCsAsCsTs)tsgsg ONT-157 (SEQ ID NO: 585) astsgsd(AsGsAsTsGsCsCsTsGsGsCsTsGsCs)csast ONT-158 (SEQ ID NO: 586) tstsgsd(GsGsAsGsCsTsTsCsTsCsCsTsGsGs)tsgsg ONT-159 (SEQ ID NO: 587) tsgsgsd(GsAsGsCsTsTsCsTsCsCsTsGsGsTs)gsgsa ONT-160 (SEQ ID NO: 588) tstsasd(TsGsAsGsAsTsGsCsCsTsGsGsCsTs)gscsc ONT-161 (SEQ ID NO: 589) gststsd(AsTsGsAsGsAsTsGsCsCsTsGsGsCs)tsgsc ONT-162 (SEQ ID NO: 590) cscsasd(AsGsTsCsAsCsTsTsGsGsGsAsGsCs)tstsc ONT-163 (SEQ ID NO: 591) asgscsd(TsTsTsGsGsTsTsGsGsGsCsAsAsCs)ascsa ONT-164 (SEQ ID NO: 592) tsastsd(GsAsGsAsTsGsCsCsTsGsGsCsTsGs)cscsa ONT-165 (SEQ ID NO: 593) tsgstsd(TsAsTsGsAsGsAsTsGsCsCsTsGsGs)cstsg ONT-166 (SEQ ID NO: 594) astscsd(CsAsAsGsTsCsAsCsTsTsGsGsGsAs)gscst ONT-167 (SEQ ID NO: 595) gsgsgsd(AsAsGsCsTsTsTsGsGsTsTsGsGsGs)csasa ONT-168 (SEQ ID NO: 596) cstscsd(CsAsTsCsCsAsTsGsAsGsGsTsCsAs)tstsc ONT-169 (SEQ ID NO: 597) asasgsd(TsCsAsCsTsTsGsGsGsAsGsCsTsTs)cstsc ONT-170 (SEQ ID NO: 598) cscsasd(TsCsCsAsAsGsTsCsAsCsTsTsGsGs)gsasg ONT-171 (SEQ ID NO: 599) tscscsd(AsAsGsTsCsAsCsTsTsGsGsGsAsGs)cstst ONT-172 (SEQ ID NO: 600) cscstsd(CsTsGsGsAsTsTsGsAsGsCsAsTsCs)csasc ONT-173 (SEQ ID NO: 601) ascstsd(TsGsGsGsAsGsCsTsTsCsTsCsCsTs)gsgst ONT-174 (SEQ ID NO: 602) cststsd(GsGsGsAsGsCsTsTsCsTsCsCsTsGs)gstsg ONT-175 (SEQ ID NO: 603) csastsd(GsCsCsAsTsCsCsAsAsGsTsCsAsCs)tstsg ONT-176 (SEQ ID NO: 604) tsgscsd(CsAsTsCsCsAsAsGsTsCsAsCsTsTs)gsgsg ONT-177 (SEQ ID NO: 605) tscscsd(AsTsCsCsAsTsGsAsGsGsTsCsAsTs)tscsc ONT-178 (SEQ ID NO: 606) asgsgsd(GsCsAsCsTsCsAsTsCsTsGsCsAsTs)gsgsg ONT-179 (SEQ ID NO: 607) cscsasd(GsTsTsCsCsTsTsCsAsTsTsCsTsGs)csasc ONT-180 (SEQ ID NO: 608) csastsd(AsGsCsCsAsTsTsGsCsAsGsCsTsGs)cstsc ONT-181 (SEQ ID NO: 609) tscstsd(GsGsAsTsTsGsAsGsCsAsTsCsCsAs)cscsa ONT-182 (SEQ ID NO: 610) gsgsasd(TsTsGsAsGsCsAsTsCsCsAsCsCsAs)asgsa

Biology In Vitro Data in HepG2 Cells for the 2′-OMe-DNA-2′-OMe (3-14-3) Design

FOXO1 Levels at 20 nM (%) SD ONT-129 82 5 ONT-130 49 4 ONT-131 92 3 ONT-132 91 2 ONT-133 58 3 ONT-134 73 2 ONT-135 65 5 ONT-136 92 2 ONT-137 94 2 ONT-138 78 1 ONT-139 61 1 ONT-140 82 4 ONT-155 95 2 ONT-156 74 1 ONT-157 56 2 ONT-158 93 1 ONT-159 94 1 ONT-160 71 1 ONT-161 67 1 ONT-162 89 1 ONT-163 55 7 ONT-164 68 4 ONT-165 70 1 ONT-166 89 4 ONT-167 81 0 ONT-168 81 0 ONT-169 94 0 ONT-170 88 1 ONT-171 92 4 ONT-172 86 2 ONT-173 90 1 ONT-174 93 2 ONT-175 84 1 ONT-176 80 2 ONT-177 83 2 ONT-178 95 2 ONT-179 93 8 ONT-180 68 7 ONT-181 85 5 ONT-182 80 5 Levels at 200 nM (%) SD ONT-129 27 1 ONT-130 46 4 ONT-131 53 9 ONT-132 53 2 ONT-133 48 6 ONT-134 35 9 ONT-135 45 15 ONT-136 40 7 ONT-137 50 4 ONT-138 80 3 ONT-139 40 3 ONT-140 33 13 ONT-155 52 2 ONT-156 35 4 ONT-157 39 2 ONT-158 87 6 ONT-159 89 5 ONT-160 33 10 ONT-161 40 11 ONT-162 60 7 ONT-163 42 8 ONT-164 34 10 ONT-165 38 1 ONT-166 62 9 ONT-167 64 1 ONT-168 38 2 ONT-169 67 3 ONT-170 74 8 ONT-171 65 5 ONT-172 33 18 ONT-173 72 15 ONT-174 65 15 ONT-175 38 21 ONT-176 48 8 ONT-177 28 5 ONT-178 97 11 ONT-179 47 6 ONT-180 56 12 ONT-181 45 26 ONT-182 33 17

Hit Selection:

ONT-151 (SEQ ID NO: 611) d(GsAsAsGsCsTsTs)tsgsgststsgsd(GsGsCsAsAsCsA) ONT-198 (SEQ ID NO: 612) d(CsCsAsTsCsCsAs)asgstscsascsd(TsTsGsGsGsAsG) ONT-185 (SEQ ID NO: 613) d(AsTsGsAsGsAsTs)gscscstsgsgsd(CsTsGsCsCsAsT) ONT-142 (SEQ ID NO: 614) d(AsAsGsCsTsTsTs)gsgststsgsgsd(GsCsAsAsCsAsC) ONT-145 (SEQ ID NO: 615) d(AsTsAsGsCsCsAs)tstsgscsasgsd(CsTsGsCsTsCsA) ONT-192 (SEQ ID NO: 616) d(TsAsTsGsAsGsAs)tsgscscstsgsd(GsCsTsGsCsCsA) ONT-188 (SEQ ID NO: 617) d(TsTsAsTsGsAsGs)astsgscscstsd(GsGsCsTsGsCsC)

Secondary Screen. Chemistry and Stereochemistry Screen Summary for Oligonucleotide Synthesis on a DNA/RNA Synthesizer MerMade-12 (Stereodefined Phosphorothioate 2′-Deoxy and 2′-OMe Cycle)

delivery wait time step reaction reagent vol (mL) (sec) 1 detritylation 3% TCA in DCM 4 × 1   N.A. 2 coupling 0.15 M chiral 2 × 0.5 2 × 450 phosphoramidite in (2′-OMe ACN + 2 M CMPT in RNA) ACN 2 × 300 (DNA) 3 capping 1 5% Pac20 in THF/2,6- 1 60  lutidine 4 capping 2 5% Pac20 in THF/2,6- 1 60  lutidine + 16% NMI in THF 5 sulfurization 0.3 M S-(2-cyanoethyl) 1 600 methylthiosulfonate in ACN/BSTFA

Examples Applied on the FOXO1 Hit Sequences: Examples Include but are not Limited to:

(SEQ ID NO: 618) (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 619) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 620) (Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp)d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA] (SEQ ID NO: 621) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 622) (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 623) (Sp, Sp, Sp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Sp, Sp, Sp) d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA] (SEQ ID NO: 624) (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 625) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 626) (Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 627) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 628) (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp) d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA] (SEQ ID NO: 629) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)d[CsCsAsTsCsCsAs](AsGsTsCsAsCs)OMed[TsTsGsGsGsAsG] (SEQ ID NO: 630) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)d[AsTsGsAsGsAsTs](GsCsCsTsGsGs)OMed[CsTsGsCsCsAsT] (SEQ ID NO: 631) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)d[CsCsAsTsCsCsAs](AsGsTsCsAsCs)LNAd[TsTsGsGsGsAsG] (SEQ ID NO: 632) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)d[AsTsGsAsGsAsTs](GsCsCsTsGsGs)LNAd[CsTsGsCsCsAsT] (SEQ ID NO: 633) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)d[CsCsAsTsCsCsAs](AsGsTsCsAsCs)MOEd[TsTsGsGsGsAsG] (SEQ ID NO: 634) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)d[AsTsGsAsGsAsTs](GsCsCsTsGsGs)MOEd[CsTsGsCsCsAsT] (SEQ ID NO: 635) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp)(CsCsAs)OMed[TsCsCsAsAsGsTsCsAsCsTsTsGsGs](GsAsG)OMe (SEQ ID NO: 636) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp)(AsTsGs)MOEd[AsGsAsTsGsCsCsTsGsGsCsTsGsCs](CsAsT)MOE (SEQ ID NO: 637) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)(CsCsAs)LNAd[TsCsCsAsAsGsTsCsAsCsTsTsGsGs](GsAsG)LNA (SEQ ID NO: 638) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)(AsTsGs)OMed[AsGsAsTsGsCsCsTsGsGsCsTsGsCs](CsAsT)OMe (SEQ ID NO: 639) (Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 640) (Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 641) (Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp) d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA] (SEQ ID NO: 642) (Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 643) (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 644) (Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 645) (Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp) d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA] (SEQ ID NO: 646) (Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 647) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 648) (Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 649) (Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 650) (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 651) (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 652) (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 653) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 654) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 655) (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 656) (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)(CsCs)OMed[AsTsCsCsAsAs](GsTsCs)OMed[AsCsTsTsGsGsGs](AsG)OMe (SEQ ID NO: 657) (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp) (CsCs)LNAd[AsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGs](AsG)LNA (SEQ ID NO: 658) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp) (CsCs)MOEd[AsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGs](AsG)MOE (SEQ ID NO: 659) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp) (CsCs)OMed[AsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGs](AsG)OMe

Example 4. Suppression of Nucleic Acid Polymer

Among other things, the present disclosure provides chirally controlled oligonucleotide compositions and methods thereof that deliver unexpected results when, e.g., used for suppressing nucleic acid polymers through, in some cases, cleavage of such nucleic acid polymers. Examples include but are not limited to those presented herein.

RNase H Assay

Cleavage rate of nucleic acid polymers by nucleases, for example, RNA by RNase H, is important with respect to the use of oligonucleotides in therapeutic technologies such as antisense technology. Using our assay, we investigated the cleavage rates and analyzed the metabolites for chirally controlled oligonucleotide compositions of particular oligonucleotide types (P-diastereomers) when oligonucleotides of the particular oligonucleotide types are bound to complementary RNA. Results below also illustrate the importance of cleavage patterns recognized by the present disclosure.

RNase H used herein is a ubiquitously expressed endonuclease that hydrolyses the RNA strand of a RNA/DNA hybrid. It plays an important role in the mode of action of antisense oligonucleotides. In some embodiments, RNase H cleavage rate is significantly reduced when the RNA substrate is structured (Lima, W. F., Venkatraman, M., Crooke, S. T. The Influence of Antisense Oligonucleotide-induced RNA Structure on Escherichia coli RNase H1 Activity The Journal Of Biological Chemistry 272, No. 29, 18191-18199, (1997)). Furthermore, the 2′-MOE gapmer designs (5-10-5) offer higher affinities for RNA targets leading to minimal turnover of the antisense strand. Presence of 2′-MOE modifications in the wings also reduce the number of RNase H cleavage sites.

To study the RNA cleavage rate, the present disclosure provides a simple assay to quantify the length of RNA remaining after incubation with RNase H. The provided method, among other things, provides the relative rates of RNase H cleavage for stereorandom 2′-modified gapmers, stereorandom DNA oligonucleotide compositions and chirally pure P-diastereomers (chirally controlled oligonucleotide compositions of a corresponding oligonucleotide type) for various oligomers for different targets. Changing the stereochemistry at 2′-modified regions and the DNA core provides information with respect to how stereochemistry in these regions affects the interaction of RNase H to its substrates. RNase H reaction mixtures at different time points were analyzed by LCMS to determine the cleavage pattern. The present disclosure, among other things, provides nucleic acid polymer, for example RNA, cleavage rates and cleavage patterns (maps) that are critical to design stereochemical nucleic acid architectures for optimal activity, e.g., antisense activity.

Equipment:

Alliance HPLC, 2489—TUV, 2695E—Equipped with autosampler

Caryl00 (Agilent Technologies)

Methods:

DNA/RNA Duplex Preparation:

Oligonucleotide concentrations were determined by measuring the absorbance in water at 260 nm. DNA/RNA duplexes were prepared by mixing equimolar solutions oligonucleotides with each strand concentration of 10 uM. The mixtures were heated at 90° C. for 2 minutes in water bath and were cooled down slowly over several hours.

Human RNase H Protein Expression and Purification:

Human RNase HC clone was obtained from Prof Wei Yang's laboratory at NIH Bethesda. The protocol for obtaining this human RNase HC (residues 136-286) has been described (Nowotny, M. et al. Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse Transcription. Molecular Cell 28, 264-276, (2007). The protein expression was carried out by following reported protocol with the exception that the resulting protein had an N-terminal His6 tag (SEQ ID NO: 1552). BL21(DE3) E. coli cells in LB medium were used for protein expression. Cells were grown at 37° C. till OD600 reached around 0.7. The cultures were then cooled and 0.4 mM IPTG was added to induce protein expression overnight at 16° C. E. coli extract was prepared by sonication in buffer A (40 mM NaH2PO4 (pH 7.0), 1 M NaCl, 5% glycerol, 2.8 mM β-mercaptoethanol and 10 mM imidazole) with the addition of protease inhibitors (Sigma-Aldrich). The extract was purified by Ni affinity column using buffer A plus 60 mM imidazole. The protein was eluted with a linear gradient of 60 to 300 mM imidazole. The protein peak was collected and was further purified on a Mono S column (GE Healthcare) with a 100 mM-500 mM gradient of NaCl in buffer B. Fractions containing RNase HC were concentrated to 0.3 mg/ml in the storage buffer (20 mM HEPES (pH 7.0), 100 mM NaCl, 5% glycerol, 0.5 mM EDTA, 2 mM DTT) and stored at −20° C. 0.3 mg/ml enzyme concentration corresponds to 17.4 uM based on its reported extinction coefficient (32095 cm−1 M−1) and MW (18963.3 Da units).

RNase H Assay:

In a 96-well plate, to 25 μL DNA/RNA duplex (10 μM) was added 5 μL of 10×RNase H buffer followed by 15 μL water. The mixture was incubated at 37° C. for a few minutes and then 5 μL of 0.1 μM stock solution of enzyme was added to give total volume of 50 μL with final substrate/enzyme concentration 5 μM/0.01 μM (500:1) and was further incubated at 37° C. Various ratios of the DNA/RNA duplex: RNase H protein were studied using these conditions to find an optimal ratio to study the kinetics. The reactions were quenched at different time points using 10 μL of 500 mM EDTA disodium solution in water. For zero min time point, EDTA was added to the reaction mixture before the addition of enzyme. Controls were run to ensure that EDTA was able to successfully inhibit the enzyme activity completely. After all the reactions were quenched 10 μL of each reaction mixture was injected on to analytical HPLC column (XBridge C18, 3.5 um, 4.6×150 mm, Waters Part #186003034). Kcat/Km can be measured by a number of methods, such as FRET (Fluorescence Resonance Energy Transfer) dependent RNase H assay using dual labeled RNA and monitored by SpectraMax.

Solid Phase Extraction Protocol for Sample Preparation for LCMS:

96 well plate (Waters part #186002321) was used to clean the RNase H reaction mixture before running LCMS. 500 μL of acetonitrile followed by water was used to equilibrate the plate under mild vacuum with the help of manifold (Millipore part # MSV MHTS00). Precaution was taken not to let the plate dry. About 50-100 μL of RNase H reaction mixture was loaded in each well followed by water washings (2 mL) under mild vacuum. 2×500 μL of 70% ACN/Water was used to recover the sample. The recovered samples were transferred to 2 mL centrifuge tubes and were concentrated to dryness in speed vac. Each dry sample was reconstituted in 100 μL water and 10 μL was injected on Acquity UPLC@OST C18 1.7 um, 2.1×50 mm (part #186003949) for LCMS analysis.

For mass spectrometry analysis, the reaction mixtures after quenching were cleaned using Cis 96 well plate (Waters). The oligomers were eluted in 70% Acetonitrile/Water. The Acetonitrile was evaporated using speedvac and the resulting residue was reconstituted in water for injection.

Eluent A=50 mM Triethyl ammonium acetate

Eluent B=Acetonitrile Column Temperature=60° C.

UV was recorded at 254 nm and 280 nm

RP-HPLC Gradient Method

Time (min) Flow (ml/min) % A % B Curve 1 0.0 1.00 95.0 5.0 2 2.00 1.00 95.0 5.0 1 3 22.00 1.00 80.0 20.0 6 4 25.00 1.00 5.0 95.0 6 5 25.5 1.00 95.0 5.0 1 6 30 1.00 95.0 5.0 1

On HPLC chromatograms, peak areas corresponding to full length RNA oligomer (ONT-28) were integrated, normalized using the DNA peak and were plotted against time (FIG. 8). ONT-87 demonstrated superior cleavage for complementary RNA when in duplex form, in comparison to the other product candidates and Mipomersen. Since all the diastereomers in this panel have 2′-MOE modified wings that do not activate RNase H enzyme, without the intention to be limited by theory, Applicant notes that activity is likely dictated by the stereochemistry in the DNA core. Heteroduplexes with ONT-77 to ONT-81 including Mipomersen in the antisense strand show very similar RNA cleavage rates. ONT-89 with alternating Sp/Rp stereochemistry showed the least activity in the tested time frame under the tested conditions. Among the tested oligonucleotides with MOE modifications, ONT-87 and ONT-88 units in the antisense strand exhibited increased in activity in comparison to the rest of the heteroduplexes. Particularly, ONT-87 provided surprisingly high cleavage rate and unexpected low level of remaining target RNA. Additional example data were illustrated in FIG. 6 and FIG. 24.

In Vitro Oligonucleotide Transfection Assay:

Transfection assays are widely known and practiced by persons having ordinary skill in the art. An example protocol is described herein. Hep3B cells are reverse transfected with Lipofectamine 2000 (Life Technologies, Cat. No. 11668-019) at 18×103 cells/well density in 96-well plates using the manufacturer's protocol. For dose response curves eight ⅓ serial dilutions are used starting from 60-100 nM. 25 μL of 6× oligonucleotide concentration is mixed with a prepared mixture of 0.4 μL Lipofectamine 2000 with 25 μL of serum-free medium Opti-MEM medium (Gibco, Cat. No. 31985-062) per well. After a 20 min minute incubation, 100 μL of 180×103 cells/ml suspended in 10% FBS in DMEM cell culture media (Gibco, Cat. No. 11965-092) is added to bring the final volume to 150 μL per well. 24-48 hours post transfection Hep3B cells are lysed by adding 75 μL of Lysis Mixture with 0.5 mg/ml Proteinase K using QuantiGene Sample Processing Kit for Cultured Cells (Affymetrix, Cat. No. QS0103). The Target mRNA and GAPDH mRNA expression levels in cell lysates are measured using Affymetrix QuantiGene 2.0 Assay Kit (Cat. No. QS0011) according to the manufacturer's protocol. The Target mRNA expression is normalized to GAPDH mRNA expression from the same sample; and relative Target/GAPDH levels are compared to transfections using Lipofectamine 2000 only (no oligonucleotide) control. Dose response curves are generated by GraphPad Prism 6 using nonlinear regression log (inhibitor) vs. response curve fit with variable slope (4 parameters). For example results, see FIG. 24, FIG. 27 and FIG. 29.

Example 5. Provided Compositions and Methods Provide Control of Cleavage Patterns

The present disclosure surprisingly found that internucleotidic linkage stereochemistry pattern has unexpected impact on cleavage patterns of nucleic acid polymers. By changing common patterns of backbone chiral centers of chirally controlled oligonucleotide compositions, numbers of cleavage sites, cleavage percentage at a cleavage site, and/or locations of cleavage sits can be surprisingly altered, both independently and in combination. As described in the example herein, provided compositions and methods can provide control over cleavage patterns of nucleic acid polymers.

Using similar assay conditions, various chirally controlled oligonucleotide compositions of different oligonucleotide types were tested. Example cleavage patterns of the target RNA sequence is presented in FIG. 9. Certain pattern of backbone chiral centers, such as that in ONT-87 and ONT-154, surprisingly produces only one cleavage site in the target sequence. Moreover, it is surprisingly found that oligonucleotides providing single cleavage site, such as ONT-87 and ONT-154, provide unexpectedly high cleavage rate and low level of remaining target nucleic acid polymer. See also FIG. 8, FIG. 10 and FIG. 11.

Example 6. Example Cleavage of FOXO1 mRNA

Oligonucleotide compositions targeting different regions of FOXO1 mRNA were tested in cleavage assays as described above. In each case, chirally controlled oligonucleotide compositions were shown to be capable of providing altered cleavage patterns relative to reference cleavage patterns from chirally uncontrolled oligonucleotide compositions sharing the same common base sequence and length. For example results, see FIG. 10 and FIG. 11. As shown in FIG. 12, example chirally controlled oligonucleotide compositions provide both significantly faster cleavage rates and unexpectedly low levels of remaining substrates when compared to reference chirally uncontrolled oligonucleotide compositions. In some embodiments, as shown in FIG. 11, the cleavage sites are associated with RpSpSp backbone chiral center sequence. In some embodiments, cleavage sites are two base pairs upstream of RpSpSp.

Example oligonucleotide compositions are listed below.

Tm SEQ Oligo Sequence Description (° C.) ID NO: ONT-366 dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsd All DNA 66.5 660 GsdCsdCsdAsdTsdA ONT-389 dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsd S7RSSRSSR 64.3 661 GsdCsdCsdAsdTsdA S5 ONT-390 dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsd S6RSSRSSR 64.6 662 GsdCsdCsdAsdTsdA S6 ONT-391 dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsd S5RSSRSSR 64.3 663 GsdCsdCsdAsdTsdA S7 ONT-387 rUrArUrGrGrCrArGrCrCrArGrGrCrArUrCrUrCrA complementary 664 RNA ONT-367 dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsd All DNA 62.9 665 GsdCsdTsdCsdAsdC ONT-392 dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsd S7RSSRSSR 59.5 666 GsdCsdTsdCsdAsdC S5 ONT-393 dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsd S6RSSRSSR 60 667 GsdCsdTsdCsdAsdC S6 ONT-394 dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsd S5RSSRSSR 59.5 668 GsdCsdTsdCsdAsdC S7 ONT-388 rGrUrGrArGrCrArGrCrUrGrCrArArUrGrGrCrUrA complementary 669 RNA

Example 7. Example Chirally Controlled Oligonucleotide Compositions Provide Higher Turn-Over

In cases where the Tm of cleaved nucleic acid polymer fragments, for example RNA fragments, to oligonucleotides is greater than a physiological temperature, product dissociation may be inhibited and oligonucleotides may not be able to dissociate and find other target strands to form duplexes and cause the target strands to be cleaved. The Tm of ONT-316 (5-10-5 2′-MOE Gapmer) to complementary RNA is 76° C. After a cut or a few cuts in the RNA sequence complementary to the oligonucleotides, the 2′-MOE fragments may remain bound to RNA and thus cannot cause the other target molecules to be cleaved. Thermal melting temperatures of DNA strands generally are much lower when duplexed to RNA, for example, ONT-367 (63° C.) and ONT-392 60° C.). Additionally, thermal stability in DNA sequences is often relatively uniformly distributed compared to 2′-MOE modified oligonucleotides. In some embodiments, oligonucleotides in provided chirally controlled oligonucleotide compositions do not contain 2′-modifications such as 2′-MOE. In some embodiments, oligonucleotides in provided chirally controlled oligonucleotide compositions, which do not contain 2′-modifications such as 2′-MOE, more easily dissociate from nucleic acid polymer cleavage fragments, and have higher turn-over than oligonucleotides having 2′-modifications such as 2′-MOE. In some embodiments, the present disclosure provides an all DNA designs, in which oligonucleotides do not have 2′-modifications. In some embodiments, chirally controlled oligonucleotide compositions wherein oligonucleotides having no 2′-modification provides higher turn-over of a nuclease such as RNase H. In some embodiments, after cleavage RNase H dissociates more easily from duplex formed by RNA and oligonucleotides of provided chirally controlled oligonucleotide compositions. Using similar protocols as described above, turn-over of two example chirally controlled oligonucleotide compositions of oligonucleotide type ONT-367 and ONT-392 indeed showed higher turn-over rate than reference chirally uncontrolled oligonucleotide compositions (see FIG. 13).

Example 8. Example Cleavage of FOXO1 mRNA

As exemplified in FIG. 14, chirally controlled oligonucleotide compositions and methods thereof in the present disclosure can provide controlled cleavage of nucleic acid polymers. In some embodiments, chirally controlled oligonucleotide compositions of the present disclosure produces altered cleavage pattern in terms of number of cleavage sites, location of cleavage sites, and/or relative cleavage percentage of cleavage sites. In some embodiments, as exemplified by ONT-401 and ONT-406, chirally controlled oligonucleotide compositions provide single site cleavage.

In some embodiments, only one component from RNA cleavage was detected. Without the intention to be limited by theory, Applicant notes that such observation could be due to the processive nature of RNase H enzyme which could make multiple cuts on the same duplex resulting in much shorter 5′-OH 3′-OH fragments.

Additional chirally controlled oligonucleotide compositions were further tested. As described above, provided chirally controlled oligonucleotide compositions provides unexpected results, for example, in terms of cleavage rate and % RNA remaining in DNA/RNA duplex. See FIGS. 15-17. Example analytical data were presented in FIGS. 18-20. Without the intention to be limited by theory, Applicant notes that in some embodiments, cleavage may happen as depicted in FIG. 21. In FIG. 17, it is noted ONT-406 was observed to elicit cleavage of duplexed RNA at a rate in slight excess of that of the natural DNA oligonucleotide ONT-415 having the same base sequence and length. Applicant notes that chirally controlled oligonucleotide compositions of ONT-406, and other chirally controlled oligonucleotide compositions provided in this disclosure, have other preferred properties that an ONT-415 composition does not have, for example, better stability profiles in vitro and/or in vivo. Additional example data were presented in FIG. 25. Also, as will be appreciated by those skilled in the art, example data illustrated in FIG. 26 and FIG. 27 confirm that provided example chirally controlled oligonucleotide compositions, especially when so designed to control the cleavage patterns through patterns of backbone chiral centers, produced much better results than reference oligonucleotide compositions, e.g., a stereorandom oligonucleotide composition. As exemplified in FIG. 26, controlled patterns of backbone chiral centers, among other things, can selectively increase and/or decrease cleavage at existing cleavage site when a DNA oligonucleotide is used, or creates entirely new cleavage sites that do not exist when a DNA oligonucleotide is used (see FIG. 25, ONT-415). In some embodiments, cleavage sites from a DNA oligonucleotide indicate endogenous cleavage preference of RNase H. As confirmed by FIG. 27, provided chirally controlled oligonucleotide compositions are capable of modulating target cleavage rate. In some embodiments, approximately 75% of the variance in cellular activity is accounted for by differences in cleavage rate which can be controlled through patterns of backbone chiral centers. As provided in this Application, further structural features such as base modifications and their patterns, sugar modification and their patterns, internucleotidic linkage modifications and their patterns, and/or any combinations thereof, can be combined with patterns of backbone chiral centers to provide desired oligonucleotide properties.

Example 9. Example Allele-Specific Suppression of mHTT

In some embodiments, the present disclosure provides chirally controlled oligonucleotide compositions and methods thereof for allele-specific suppression of transcripts from one particular allele with selectivity over the others. In some embodiments, the present disclosure provides allele-specific suppression of mHTT.

FIG. 22 illustrates example chirally controlled oligonucleotide compositions that specifically suppress transcripts from one allele but not the others. Oligonucleotides 451 and 452 were tested with transcripts from both exemplified alleles using biochemical assays described above. Allele-specific suppression is also tested in cells and animal models using similar procedures as described in Hohjoh, Pharmaceuticals 2013, 6, 522-535; US patent application publication US 2013/0197061; and Østergaard et al., Nucleic Acids Research, 2013, 41(21), 9634-9650. In all cases, transcripts from the target allele are selectively suppressed over those from the other alleles. As will be appreciated by those skilled in the art, example data illustrated in FIG. 22 confirm that provided example chirally controlled oligonucleotide compositions, especially when so designed to control the cleavage patterns through stereochemistry, produced much better results than reference oligonucleotide compositions, in this case, a stereorandom oligonucleotide composition. As confirmed by FIG. 22, patterns of backbone chiral centers can dramatically change cleavage patterns (FIG. 22 C-E), and stereochemistry patterns can be employed to position cleavage site at the mismatch site(FIG. 22 C-E), and/or can dramatically improve selectivity between the mutant and wild type (FIG. 22 G-H). In some embodiments, chirally controlled oligonucleotide compositions are incubated with wtRNA and muRNA of a target and both the duplexes are incubated with RNase H.

Huntingtin Allele Tm

Mutant Huntingtin Allele ONT-453/ONT-451 38.8° C. Wild Type Huntingtin Allele ONT-454/ONT-451 37.3° C. Mutant Huntingtin Allele ONT-453/ONT-452 38.8° C. Wild Type Huntingtin Allele ONT-454/ONT-452 36.5° C. Mutant Huntingtin Allele ONT-453/ONT-450 40.3° C. Wild Type Huntingtin Allele ONT-454/ONT-450 38.8° C.

Example 10. Example Allele-Specific Suppression of FOXO1

In some embodiments, the present disclosure provides allele-specific suppression of FOXO1.

FIG. 23 illustrates example chirally controlled oligonucleotide compositions that specifically suppress transcripts from one allele but not the others. Oligonucleotides ONT-400, ONT-402 and ONT-406 were tested with transcripts from both exemplified alleles using biochemical assays described above. Allele-specific suppression is also tested in cells and animal models using similar procedures as described in Hohjoh, Pharmaceuticals 2013, 6, 522-535; US patent application publication US 2013/0197061; Østergaard et al., Nucleic Acids Research 2013, 41(21), 9634-9650; and Jiang et al., Science 2013, 342, 111-114. Transcripts from the target allele are selectively suppressed over those from the other alleles. In some cases, two RNAs with mismatch ONT-442 (A/G, position 7th) and ONT-443 (A/G, position 13th) from ONT-388 are synthesized and are duplexed with ONT-396 to ONT-414. RNase H assay are performed to obtain cleavage rates and cleavage maps.

Example 11. Certain Example Oligonucleotides and Oligonucleotide Compositions

Stereorandom oligonucleotides with different 2′ substitution chemistries targeting three distinct regions of FOXO1 mRNA with the thermal melting temperatures when duplexed with complementary RNA. The concentration of each strand was 1 uM in 1×PBS buffer.

SEQ Oligo Sequence Description Tm (° C.) ID NO: ONT-316 TeosAeosGeos5mCeos5mCeosdAsdTsdTsdGs5md 5-10-5 (2′-MOE 76.7 670 CsdAsdGs5mdCsdTsdGs5mCeosTeos5mCeosAeos Gapmer) 5mCeo ONT-355 dTsdAsdGsdCsdCsdAsdTstsgscsasgscsdTsdGsdCs 7-6-7 (DNA-2′- 71.2 671 dTsdCsdAsdC OMe-DNA) Gapmer ONT-361 tsasgsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsdG 3-14-3 (2′-OMe- 65.8 672 sdCsdTscsascs DNA-2′-OMe) Gapmer ONT-367 dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsd All DNA 62.9 673 TsdGsdCsdTsdCsdAsdC ONT-373 tsasgscscsdAsdTsdTsdGsdCsdAsdGsdCsdTsdGscst 5-10-5 (2′-OMe 71.8 674 scsasc Gapmer) ONT-388 rGrUrGrArGrCrArGrCrUrGrCrArArUrGrGrCrUrA Complementary 675 RNA ONT-302 Teos5mCeos5mCeosAeosGeosdTsdTs5mdCs5mdC 5-10-5 (2′-MOE 72.5 676 sdTsdTs5mdCsdAsdTsdTs5mCeosTeosGeos5mCe Gapmer) osAeo ONT-352 dTsdCsdCsdAsdGsdTsdTscscststscsasdTsdTsdCsd 7-6-7 (DNA-2′- 65.4 677 TsdGsdCsdA OMe-DNA) Gapmer ONT-358 tscscsdAsdGsdTsdTsdCsdCsdTsdTsdCsdAsdTsdTs 3-14-3 (2′-OMe- 62.6 678 dCsdTsgscsas DNA-2′-OMe) Gapmer ONT-364 dTsdCsdCsdAsdGsdTsdTsdCsdCsdTsdTsdCsdAsd All DNA 58.4 679 TsdTsdCsdTsdGsdCsdA ONT-370 tscscsasgsdTsdTsdCsdCsdTsdTsdCsdAsdTsdTscsts 5-10-5 (2′-OMe 68 680 gscsa Gapmer) ONT-386 rUrGrCrArGrArArUrGrArArGrGrArArCrUrGrGrA Complementary 681 RNA ONT-315 TeosGeosAeosGeosAeosdTsdGs5mdCs5mdCsdTs 5-10-5 (2′-MOE 77.5 682 dGsdGs5mdCsdTsdGs5mCeos5mCeosAeosTeosAeo Gapmer) ONT-354 dTsdGsdAsdGsdAsdTsdGscscstsgsgscsdTsdGsdCs 7-6-7 (DNA-2′- 75.5 683 dCsdAsdTsdA OMe-DNA) Gapmer ONT-360 tsgsasdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsdG 3-14-3 (2′-OMe- 69 684 sdCsdCsastsas DNA-2′-OMe) Gapmer ONT-366 dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCs All DNA 66.5 685 dTsdGsdCsdCsdAsdTsdA ONT-372 tsgsasgsasdTsdGsdCsdCsdTsdGsdGsdCsdTsdGscs 5-10-5 (2′-OMe 74.4 686 csastsa Gapmer) ONT-387 rUrArUrGrGrCrArGrCrCrArGrGrCrArUrCrUrCrA Complementary 687 RNA

Additional example stereorandom oligonucleotide compositions are listed below.

SEQ ID Oligo Sequence (5′ to 3′) NO: ONT-41 (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs](Gs 688 5mCsAs5mCs5mC)MOE ONT-70 (Gs5mCs)MOEd[GsTsTsTsGs5mCsTs5mCsTsTs5mCsTsTs](5mCsTsT 689 sGs5mCGs)MOEd[TsTsTsTs](TsT)MOE ONT-83 (GsTs5mCs5mCs5mCs)MOEd(TsGsAsAsGsAsTsGsTs5mCs](AsAsTs 690 Gs5mC)MOE ONT-302 (Ts5mCs5mCsAsGs)MOEd[TsTs5mCs5mCsTsTs5mCsAsTsTs](5mCs 691 TsGs5mCsA)MOE ONT-315 (TsGsAsGsAs)MOEd[TsGs5mCs5mCsTsGsGs5mCsTsGs](5mCs5mCs 692 AsTsA)MOE ONT-316 (TsAsGs5mCs5mCs)MOEd[AsTsTsGs5mCsAsGs5mCsTsGs5m] 693 (CsTs5mCsAs5mC)MOE ONT-352 [TsCsCsAsGsTsTs](cscststscsas)OMed[TsTsCsTsGsCsA] 694 ONT-354 [TsGsAsGsAsTsGs](CsCsTsGsGsCs)OMed[TsGsCsCsAsTsA] 695 ONT-355 [TsAsGsCsCsAsTs](TsGsCsAsGsCs)OMed[TsGsCsTsCsAsC] 696 ONT-358 (TsCsCs)OMed[AsGsTsTsCsCsTsTsCsAsTsTsCsTs](GsCsA)OMe 697 ONT-360 (TsGsAs)OMed[GsAsTsGsCsCsTsGsGsCsTsGsCsCs](AsTsA)OMe 698 ONT-361 (TsAsGs)OMed[CsCsAsTsTsGsCsAsGsCsTsGsCsTs](CsAsC)OMe 699 ONT-364 [TsCsCsAsGsTsTsCsCsTsTsCsAsTsTsCsTsGsCsA] 700 ONT-366 [TsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsTsA] 701 ONT-367 [TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 702 ONT-370 (TsCsCsAsGs)OMed[TsTsCsCsTsTsCsAsTsTs](CsTsGsCsA)OMe 703 ONT-372 (TsGsAsGsAs)OMed[TsGsCsCsTsGsGsCsTsGs](CsCsAsTsA)OMe 704 ONT-373 (TsAsGsCsCs)OMed[AsTsTsGsCsAsGsCsTsGs](CsTsCsAsC)OMe 705 ONT-440 (UsAsGsCsCs)Fd[AsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 706 ONT-441 (UsAsGsCsCs)Fd[AsTsTsGsCsAsGsCsTsGsC] 707 ONT-460 (TsAsGsCsCs)OMed[AsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 708 ONT-450 [AsTsTsAsAsTsAsAsAsTsTsGsTsCsAsTsCsAsCsC] 709

Example RNA and DNA oligonucleotides are listed below.

SEQ ID Oligo Sequence (5′ to 3′) NO: ONT-28 rGrGrUrGrCrGrArArGrCrArGrArCrUrGrAr 710 GrGrC ONT-386 rUrGrCrArGrArArUrGrArArGrGrArArCrUr 711 GrGrA ONT- rUrArUrGrGrCrArGrCrCrArGrGrCrArUrCr 712 387 UrCrA ONT- rGrUrGrArGrCrArGrCrUrGrCrArArUrGrGr 713 388 CrUrA ONT- d[TAGCCATTGCAGCTGCTCAC] 714 415 ONT- rGrUrGrArGrCrGrGrCrUrGrCrArArUrGrGr 715 442 CrUrA ONT- rGrUrGrArGrCrArGrCrUrGrCrGrArUrGrGr 716 443 CrUrA ONT- rGrGrUrGrArUrGrArCrArArUrUrUrArUrUr 717 453 ArArU ONT- rGrGrUrGrArUrGrGrCrArArUrUrUrArUrUr 718 454 ArArU

Example chirally pure oligonucleotides are presented below. In some embodiments, the present disclosure provides corresponding chirally controlled oligonucleotide compositions of each of the following example oligonucleotides.

SEQ Oligo Stereochemistry/Sequence (5′ to 3′) Description ID NO: ONT-389 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, 7S-(RSS)3- 719 Rp, Sp, Sp, Sp, Sp, Sp)- 3S d[TsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsTsA] ONT-390 (Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, 6S-(RSS)3- 720 Sp, Sp, Sp, Sp, Sp, Sp)- 4S d[TsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsTsA] ONT-391 (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, 5S-(RSS)3- 721 Sp, Sp, Sp, Sp, Sp, Sp)- 5S d[TsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsTsA] ONT-392 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, 7S-(RSS)3- 722 Rp, Sp, Sp, Sp, Sp, Sp)- 3S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-393 (Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, 6S-(RSS)3- 723 Sp, Sp, Sp, Sp, Sp, Sp)- 4S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-394 (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, 5S-(RSS)3- 724 Sp, Sp, Sp, Sp, Sp, Sp)- 5S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-396 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S-1R 725 Sp, Sp, Sp, Sp, Sp, Rp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-397 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 17S-RS 726 Sp, Sp, Sp, Sp, Rp, Sp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-398 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 16S-(RSS) 727 Sp, Sp, Sp, Rp, Sp, Sp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-399 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 15S-(RSS)- 728 Sp, Sp, Rp, Sp, Sp, Sp)- 1S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-400 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 14S-(RSS)- 729 Sp, Rp, Sp, Sp, Sp, Sp)- 2S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-401 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 13S-(RSS)- 730 Rp, Sp, Sp, Sp, Sp, Sp)- 3S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-402 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, 12S-(RSS)- 731 Sp, Sp, Sp, Sp, Sp, Sp)- 4S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-403 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, 11S-(RSS)- 732 Sp, Sp, Sp, Sp, Sp, Sp)- 5S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-404 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, 10S-(RSS)- 733 Sp, Sp, Sp, Sp, Sp, Sp)- 6S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-405 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, 9S-(RSS)- 734 Sp, Sp, Sp, Sp, Sp, Sp)- 7S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-406 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, 8S-(RSS)- 735 Sp, Sp, Sp, Sp, Sp, Sp)- 8S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-407 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, 7S-(RSS)- 736 Sp, Sp, Sp, Sp, Sp, Sp)- 9S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-408 (Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, 6S-(RSS)- 737 Sp, Sp, Sp, Sp, Sp, Sp)- 10S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-409 (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 5S-(RSS)- 738 Sp, Sp, Sp, Sp, Sp, Sp)- 11S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-410 (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 4S-(RSS)- 739 Sp, Sp, Sp, Sp, Sp, Sp)- 12S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-411 (Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 3S-(RSS)- 740 Sp, Sp, Sp, Sp, Sp, Sp)- 13S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-412 (Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 2S-(RSS)- 741 Sp, Sp, Sp, Sp, Sp, Sp)- 14S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-413 (Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, S-(RSS)- 742 Sp, Sp, Sp, Sp, Sp, Sp)- 15S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-414 (Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, (RSS)-16S 743 Sp, Sp, Sp, Sp, Sp, Sp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-421 All-(Sp)- All S 744 d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-422 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, 8S-(RSS)- 745 Sp, Rp, Sp, Sp, Sp, Sp)-C6-amino- 3S-(RSS)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 2S ONT-455 All-(Rp)- All R 746 d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-451 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 13S-(RSS)- 747 Rp, Sp, Sp, Sp, Sp, Sp)- 3S d[AsTsTsAsAsTsAsAsAsTsTsGsTsCsAsTsCsAsCsC] ONT-452 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 14S-(RSS)- 748 Sp, Rp, Sp, Sp, Sp, Sp)- 2S d[AsTsTsAsAsTsAsAsAsTsTsGsTsCsAsTsCsAsCsC] ONT-75 All-(Rp)- All R 749 (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs 5mCsTsTs5mCs](Gs5mCsAs5mCs5mC)MOE ONT-76 (Sp, Rp, Rp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, SRRSR- 750 Sp, Rp, Sp, Rp)- 11S-RSR (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCs TsTs5mCs](Gs5mCsAs5mCs5mC)MOE ONT-77 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 5R-10S-4R 751 Sp, Rp, Rp, Rp, Rp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTs Ts5mCs](Gs5mCsAs5mCs5mC)MOE ONT-80 All-(Sp)- All S 752 (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTs Ts5mCs](Gs5mCsAs5mCs5mC)MOE ONT-81 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, 5S-10R-4S 753 Rp, Sp, Sp, Sp, Sp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCs TsTs5mCs](Gs5mCsAs5mCs5mC)MOE ONT-82 All-(Rp)- All R 754 (GsTs5mCs5mCs5mCs)MOEd[TsGsAsAsGsAsTsGsTs 5mCs](AsAsTsGs5mC)MOE ONT-84 All-(Sp)- All S 755 (GsTs5mCs5mCs5mCs)MOEd[TsGsAsAsGsAsTsGsTs 5mCs](AsAsTsGs5mC)MOE ONT-85 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 5R-10S-4R 756 Sp, Rp, Rp, Rp, Rp)- (GsTs5mCs5mCs5mCs)MOEd[TsGsAsAsGsAsTsGsTs 5mCs](AsAsTsGs5mC)MOE ONT-86 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, 5S-10R-4S 757 Rp, Sp, Sp, Sp, Sp)- (GsTs5mCs5mCs5mCs)MOEd[TsGsAsAsGsAsTsGsTs 5mCs](AsAsTsGs5mC)MOE ONT-87 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, 5R-2S- 758 Rp, Rp, Rp, Rp, Rp)- (RSS)2-6R (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCs TsTs5mCs](Gs5mCsAs5mCs5mC)MOE ONT-88 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, 5S-(RRS)3- 759 Sp, Sp, Sp, Sp, Sp)- 5S (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCsTs Ts5mCs](Gs5mCsAs5mCs5mC)MOE ONT-89 (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, (SR)9S 760 Sp, Rp, Sp, Rp, Sp)- (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCs TsTs5mCs](Gs5mCsAs5mCs5mC)MOE ONT-154 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, 7S-(RSS)3- 761 Sp, Sp, Sp, Sp)- 3S d[Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs 5mCsGs5mCsAs5mCs5mC] ONT-75 All-(Rp)- All-R 762 (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCs TsTs5mCs] (Gs5mCsAs5mCs5mC)MOE ONT-80 All-(Sp)- All-S 763 (Gs5mCs5mCsTs5mCs)MOEd[AsGsTs5mCsTsGs5mCs TsTs5mCs] (Gs5mCsAs5mCs5mC)MOE

Additional example oligonucleotides targeting FOXO1 with Tm are presented below. In some embodiments, the present disclosure provides corresponding chirally controlled oligonucleotide compositions of each of the following example oligonucleotides.

SEQ ID Oligo Sequence (5′ to 3′) Tm (° C.) NO: ONT-439 [UsAsGs]Fd[CsCsAsTsTsGsCsAsGsCsTsGsCsTs][CsAs 68.3 764 C]F ONT-440 [UsAsGsCsCs]Fd[AsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 70.0 765 ONT-441 [UsAsGsCsCs]Fd[AsTsTsGsCsAsGsCsTsGsC] 65.5 766 ONT-455 All-(Rp)- 66.8 767 d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-316 [TsAsGs5mCs5mCs]MOEd[AsTsTsGs5mCsAsGs5mCsTs 76.9 768 Gs][5mCsTs5mCsAs5mC]MOE ONT-367 d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 62.8 769 ONT-415 d[TAGCCATTGCAGCTGCTCAC] 72.6 770 ONT-416 [TsAsGsCsCsAsTsTsGsCsAsGsCs]OMed[TsGsCsTsCsAs 78.4 771 C] ONT-421 All-(Sp)- 59.2 772 d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-394 (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, 60.0 773 Sp, Sp, Sp, Sp, Sp, Sp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-406 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, 58.5 774 Sp, Sp, Sp, Sp, Sp, Sp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC]

Example 12. Example Additional Controlled Cleavage by Provided Chirally Controlled Oligonucleotide Compositions

As will be appreciated by those skilled in the art, example data illustrated in FIG. 26 confirm that provided chirally controlled oligonucleotide compositions and methods thereof provided unexpected results compared to reference compositions, such as stereorandom oligonucleotide compositions. Among other things, chirally controlled oligonucleotide compositions can produce controlled cleavage patterns, including but not limited to controlling of positions of cleavage sites, numbers of cleavage sites, and relative cleavage percentage of cleavage sites. See also example data presented in FIG. 27.

Example 13. Stability of Chirally Controlled Oligonucleotide Compositions

As will be appreciated by those skilled in the art, example data illustrated in FIG. 26 confirm that stability of provided chirally controlled oligonucleotide compositions can be adjusted by varying patterns of backbone chiral centers. For example data, see FIG. 7 and FIG. 28. An example protocol for performing serum stability experiment is described below.

Protocol:

P-stereochemically pure PS DNA (ONT-396-ONT-414 (single Rp walk from 3′end to 5′end)), stereorandom PS DNA (ONT-367), all-Sp PS DNA (ONT-421) and all-Rp PS DNA (ONT-455) were incubated in Rat serum (Sigma, R9759) (0 h and 48 h) and analyzed by IEX-HPLC.

Incubation Method:

5 μL of 250 μM of each DNA solutions and 45 μL of Rat serum were mixed and incubated at 37° C. for each time points (0 h and 48 h). At each time points, reaction was stopped by adding 25 μL of 150 mM EDTA solution, 30 μL of Lysis buffer (erpicentre, MTC096H) and 3 μL of Proteinase K solution (20 mg/mL). The mixture was incubated at 60° C. for 20 min then 20 μL of the mixture was injected to IEX-HPLC and analyzed.

Incubation Control Sample:

Mixture of 5 μL of 250 μM of each DNA solutions and 103 μL of 1×PBS buffer were prepared and 20 μL of the mixture was analyzed by IEX-HPLC as controls in order to check the absolute quantification.

Example Analytical Method:

IEx-HPLC A: 10 mM TrisHCl, 50% ACN (pH 8.0) B: 10 mM TrisHCl, 800 mM NaCl, 50% ACN (pH 8.0)

C: Water-ACN (1:1, v/v)

Temp: 60° C. Column: DIONEX DNAPac PA-100, 250×4 mm Gradient:

Time Flow % A % B % C % D Curve 1 0.00 1.00 95.0 5.0 0.0 0.0 6 2 1.00 1.00 95.0 5.0 0.0 0.0 1 3 2.00 1.00 75.0 25.0 0.0 0.0 6 4 10.00 1.00 5.0 95.0 0.0 0.0 6 5 10.10 1.00 95.0 5.0 0.0 0.0 6 6 12.50 1.00 95.0 5.0 0.0 0.0 1

Washing:

Time Flow % A % B % C % D Curve 1 0.01 1.00 0.0 0.0 100.0 0.0 6 2 5.50 1.00 0.0 0.0 100.0 0.0 1 3 5.60 1.00 0.0 100.0 0.0 0.0 6 4 7.50 1.00 0.0 100.0 0.0 0.0 1 5 7.60 1.00 95.0 5.0 0.0 0.0 6 6 12.50 1.00 95.0 5.0 0.0 0.0 1

Column Temperature: 60° C.

Washing was performed every after the sample run.
Percentage of remained PS DNA was calculated by the analysis of the ratio from the 0 h to 48 h using the area of integration of HPLC chromatogram.

Example 14. Example Analytical Results (FIG. 19)

Peak Assignments for FIG. 19 (Top Panel, M12-Exp11 B10, ONT-354, 30 Min)

Retention time (minutes) (M-2)2− (M-3)3− (M-4)4− (M-5)5− (M-6)6− 2.34 1100.6 733.7 11.91 1390.6 1042.6 13.07 1500.08 1125.5 750.73 1805.29 1354.19 13.58 1603.39 1202.2 961.35 801.15 14.80 1589.9 1271.4 1059.5 18.59 1653.3 1323.3 1101.6 Retention Assignment based on mass match time Observed 5′-p-RNA 3′-OH and 5′-OH, (minutes) MW fragment RNA DNA 2.34 2203.2  7mer 11.91 4176 13mer 13.07 4505.7 14mer 5418.87 17mer 13.58 4812.8 15mer 14.80 6362.5 20mer, ONT-387 18.59 6615.4 ONT-354

Peak Assignments for FIG. 19 (Bottom Panel, M12-Exp11 A10, ONT-315, 30 Min)

Retention time (minutes) (M-2)2− (M-3)3− (M-4)4− (M-5)5− (M-6)6− 4.01 1425.33 950.15 4.4 1100.83 733.69 4.94 1578.34 1051.54 6.21 1741.91 1161.89 870.37 1445.42 963.31 722.97 8.48 1610 1073.3 9.15 1391.2 1043.1 9.93 1763.4 1174.7 11.8 1602.3 1201.7 14.82 20.73 1809.94 1447.82 1205.9 Retention Assignment based on mass match time Observed 5′-p-RNA 3′-OH and 5′-OH, (minutes) MW fragment RNA DNA 4.01 2853.45  9mer 4.4 2203.66  7mer 4.94 3158.47 10mer 6.21 3487.52 11mer 2892.84  9mer 8.48 3220.94 10mer 9.15 4177 13mer 9.93 3528.88 11mer 11.8 4810 15mer 14.82 20mer, ONT-387 20.73 7244.3 ONT-315

Example 15. Example Analytical Results (FIG. 30)

Peak Assignments for FIG. 30 (Top Panel, M12-Exp11 D2, ONT-367, 30 Min)

Retention time (minutes) (M-2)2− (M-3)3− (M-4)4− (M-5)5− (M-6)6− 2.36 1120.28 746.25 3.15 1292.41 861.32 4.04 975.92 4.49 1140.6 759.78 5.83 1305.21 869.65 652.31 6.88 1923.23 1281.69 961.28 9.32 1390.76 1043.29 833.72 9.96 1783.85 1187.98 891.6 712.94 11.01 1936.14 1289.93 1501.52 1125.4 899.89 11.93 1405.25 1053.78 842.84 13.15 1514.72 1135.72 14.81 1609.95 1287.53 1072.58 18.33 1587.9 1270.2 1058.3 Retention Assignment based on mass match time Observed 5′-p-RNA 3′-OH and 5′-OH, (minutes) MW fragment RNA DNA 2.36 2242.56  7mer 3.15 2586.82  8mer 4.04 1953.84  6mer 4.49 2283.2  7mer 5.83 2612.42  8mer 6.88 3849.14 12mer 9.32 4175.28 13mer 9.96 3569.7 11mer 11.01 3874.28 12mer 4507.56 14mer 11.93 4218.75 13mer 13.15 4547.16 14mer 14.81 6441.8 20mer, ONT-388 18.33 6355.6 ONT-367

Peak Assignments for FIG. 30 (Bottom Panel, M12-Exp21 NM Plate1 (Pool) F11 ONT-406 30 Min

Retention time (minutes) (M-2)2− (M-3)3− (M-4)4− (M-5)5− (M-6)6− 4.72 1140.6 759.78 9.46 1390.76 1043.29 833.72 16.45 1609.95 1287.53 1072.58 19.48 1588.1 1270.4 1058.4 Retention Assignment based on mass match time Observed 5′-p-RNA 3′-OH and 5′-OH, (minutes) MW fragment RNA DNA 4.72 2203.2 2283.2 7mer 9.46 4176 4175.28 13mer 16.45 6362.5 6441.8 20mer, ONT-388 19.48 6615.4 6355.9

Example 16. Example Preparation of Linkers

In some embodiments, the SP linker was prepared following the scheme below:

Example 17. Example Designs of Base Sequence

As described in the present disclosure, the present disclosure recognizes the importance of base sequence, e.g., for provided chirally controlled oligonucleotide composition. In some embodiments, the present disclosure, as exemplified herein, provides methods for designing base sequence for oligonucleotides, such as antisense oligonucleotides.

In some embodiments, among other things, bioinformatics is used to design a sequence for a target, e.g., a disease-associated mutant allele of Huntington's disease. The present example describes example steps that may be used for design antisense oligonucleotides for, e.g., rs362268, rs362306, rs2530595, rs362331, rs362307, etc. In some embodiments, a provided methods comprising a step of examining sequence features for off-target, binding affinity with target, contiguous Gs, and paliandromic moieties. In some embodiments, a provided methods comprising a step of examining off-target effects in the presence of mismatches. In some embodiments, a sequence found in a target comprising a characteristic sequence element, e.g., a mutation, a SNP, etc., and having a length of about 10-1000, e.g., about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 200, about 250, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1000, about 2000, about 3000, about 4000, about 5000, etc., nucleotides are used in assays, e.g., RNase H assay, reporter assay, etc. In some embodiments, as in the present example, 40-bp flanking sequences for a SNP, e.g., rs362268, rs362306, rs2530595, rs362331, rs362307, etc., were used. A number of such sequences, for example 6 to 12, could be readily assessed by provided methods. Example tested sequences are listed in FIG. 42.

As described in the present disclosure and understood by a person having ordinary skill in the art, in some embodiments, assays, for example, RNase cleavage assay described herein, are useful in the assessment of one or more features (e.g., rate, extent, and/or selectivity of cleavage). In some embodiments, an RNase cleavage assay provides a cleavage pattern of an oligonucleotide composition. In some embodiments, a composition of DNA oligonucleotides having the same sequence is used, an RNase H assay may provide a DNA cleavage pattern of the sequence. In some embodiments, for generating a DNA cleavage pattern, all DNA oligonucleotides in the composition are identical. In some embodiments, when a stereorandom composition of all-phosphorothioate oligonucleotides having the same sequence is used, an RNase H assay may provide a stereorandom cleavage pattern of the sequence. In some embodiments, for generating stereorandom cleavage pattern, all oligonucleotides in the stereorandom composition are identical. In some embodiments, when a chirally controlled oligonucleotide composition is used, an RNase H assay may provide a stereorandom cleavage pattern of the chirally controlled oligonucleotide composition. In some embodiments, for generating cleavage pattern of a chirally controlled oligonucleotide composition, all oligonucleotides in the chirally controlled oligonucleotide composition are identical. In some embodiments, an RNase H assay provides cleavage rate information. In some embodiments, an RNase H assay provides relative cleavage extent, e.g., (cleavage at a site)/(all cleavage). In some embodiments, an RNase H assay provides absolute cleavage extent, (cleaved target at a site)/(all target both cleaved and non-cleaved). In some embodiments, an RNase H assay provides selectivity. In some embodiments, an RNase H assay provides suppression level information.

In some embodiments, as exemplified herein, an RNase H assay provides cleavage rates. For example results, see FIG. 31. P represents position of mismatch in oligonucleotides from the 5′-end.

Analysis of human RNase H1 cleavage of a 25-mer RNA when hybridized with different phosphorothioate oligonucleotides targeting rs362307 SNP was performed. WV-944 and WV-945 are 25mer RNAs which include WT and mutant variant of rs362307, respectively. WV-936 to WV-941 are stereopure DNAs while WV-904 to WV-909 are all stereorandom DNAs. All duplexes were incubated with RNase H1C in the presence of 1×RNase H buffer at 37° C. Reactions were quenched at fixed time points by 30 mM Na2EDTA. One tenth of this reaction mixture was injected on Reverse Phase HPLC and peak areas were measured for full length RNA remaining in the reaction mixtures at different time points. Cleavage rates were determined by plotting these peak areas with respective time points. In some embodiments, differentiation between rates of cleavage of WT RNA vs. mu RNA was observed.

In some embodiments, as shown in FIG. 31, when position 11, 12 or 13 of a sequence as counted from its 5′-terminus aligns with a SNP, or position 8, 9 or 10 of a sequence as counted from its 3′-terminus aligns with a SNP, better cleavage selectivity was observed.

Example 18. Example Wing, Core, Wing-Core, Core-Wing and Wing-Core-Wing Designs

Among other things, the present disclosure provides various embodiments of wing, core, wing-core, core-wing, and wing-core-wing structures. In some embodiments, it was surprisingly found that oligonucleotides with wings comprising phosphate linkages and cores comprising phosphorothioate linkages provided unexpectedly increased cleavage efficiency and selectivity. For example, see FIG. 32 C, F, G, H, etc.

Analysis of human RNase H1 cleavage of a 25-mer RNA when hybridized with different chirally controlled oligonucleotide compositions targeting rs362307 SNP. WV-944 and WV-945 are 25mer RNAs which include WT and mutant variant of rs362307, respectively. WV-1085 to WV-1092 are all stereopure 2′-OMe/DNAs with mixed PO/PS backbone. All duplexes were incubated with RNase H1C in the presence of 1×RNase H buffer at 37° C. Reactions were quenched at fixed time points by 30 mM Na2EDTA. One tenth of this reaction mixture was injected on Reverse Phase HPLC and peak areas were measured for full length RNA remaining in the reaction mixtures at different time points. Cleavage rates were determined by plotting these peak areas with respective time points.

In some embodiments, 2′-OMe phosphate wings change cleavage rate and/or selectivity. In some embodiments, 2′-OMe phosphate wings change cleavage rate and selectivity. In some embodiments, 2′-OMe phosphate wings change cleavage rate or selectivity. In some embodiments, 2′-OMe phosphate wing change cleavage rate. In some embodiments, 2′-OMe phosphate wing change cleavage rates of both the mutant and the wild-type allele. In some embodiments, 2′-OMe phosphate wing change cleavage selectivity. In some embodiments, 2′-OMe phosphate wing change cleavage pattern.

In some embodiments, incorporation of a phosphate internucleotidic linkage surprisingly improves cleavage rate and/or selectivity. In some embodiments, incorporation of a phosphate internucleotidic linkage surprisingly improves cleavage rate and selectivity. In some embodiments, incorporation of a phosphate internucleotidic linkage surprisingly improves cleavage rate or selectivity. In some embodiments, incorporation of a phosphate internucleotidic linkage surprisingly improves cleavage rate. In some embodiments, a phosphate internucleotidic linkage improves cleavage rates of both the mutant and the wild-type allele, but at a greater level for the mutant than for the wild-type allele. In some embodiments, incorporation of a phosphate internucleotidic linkage surprisingly improves cleavage selectivity.

In some embodiments, as demonstrated by data exemplified herein, stereopure oligonucleotide compositions provided surprisingly high cleavage rate and/or selectivity compared to corresponding stereorandom compositions; for examples, see stereopure WV-1497/stereorandom WV-1092, 905/937, 931/1087, etc.

Example 19. Example Cleavage Maps

As described herein, in some embodiments, an assay, such as RNase H assay, provides cleavage maps for stereorandom or chirally controlled oligonucleotide compositions. Example cleavage maps are illustrated in FIG. 33, which exemplifies stereorandom cleavage patterns of multiple base sequences. Additional cleavage maps are presented in FIG. 35, which exemplifies, among other things, stereorandom cleavage patterns of base sequence having no nucleoside modifications (WV-905), as well as base sequence having nucleoside modifications.

Example cleavage patterns of chirally controlled stereopure oligonucleotide compositions are presented in FIG. 34. As described in the present disclosure, major cleavage sites may be identified through assays such RNase H assay from cleavage patterns. For example, for WV-937, the relative major cleavage site, as assessed by (cleavage at the site/total cleavage) and reflected by the lengths of the arrows, are between GCGC and CCUU for the wild-type (2 internucleotidic linkages away from the SNP), and between CUGU and GCCC for the mutant (at the SNP site, 0 internucleotidic linkage away from the SNP). In some embodiments, a relative major cleavage site is not necessarily an absolute major cleavage site, which requires certain percentage of the total target, in this case, RNA, is cleaved at the site. For example, in some embodiments, the site between GCGC and CCUU for WV-937/wild type is not a major cleavage site if over 20% of total target needs to be cleaved at a site for a site to qualify as a major cleavage site (see FIG. 32, M); the site between CUGU and GCCC for WV-937/mutant remains a major cleavage site if the threshold for a major site is 20% of total target being cleaved at that site.

In some embodiments, different oligonucleotide compositions have different cleave rates. In some embodiments, cleavage maps are generated at different time points. For example, for an oligonucleotide composition having a faster cleavage rate, its cleavage map can be generated at an earlier time point (e.g., 5 minutes, 10 minutes, 15 minutes, etc.) than an oligonucleotide composition having a slower cleavage rate (e.g., 30 minutes, 45 minutes, 60 minutes, etc.).

In some embodiments, when cleavage products at only one site can be identified by an analytical methods, e.g., HPLC, HPLC-MS, etc., the corresponding cleavage pattern is considered to have a single cleavage site. In some embodiments, when greater than about 90%, greater than about 91%, greater than about 92%, greater than about 93%, greater than about 94%, greater than about 95%, greater than about 96%, greater than about 97%, greater than about 98%, greater than about 99%, or greater than about 99.5% of total cleavage occurs at a site, the corresponding cleavage pattern may be considered to have a single cleavage site. In some embodiments, as understood by a person having ordinary skill in the art, selectivity in e.g., cells, tissues, organs, subjects, etc., may be higher than that observed in an RNase H assay. In some embodiments, a site having greater than about 90%, greater than about 91%, greater than about 92%, greater than about 93%, greater than about 94%, greater than about 95%, greater than about 96%, greater than about 97%, greater than about 98%, greater than about 99%, or greater than about 99.5% of total cleavage in an RNase H assay may have higher selectivity in cells, tissues, organs, or subjects. In some embodiments, a site having greater than about 90% of total cleavage in an RNase H assay may be the only cleavage site (e.g., greater than about 99%, greater than about 99.5%, 100%, etc.) in cells, tissues, organs, or subjects.

In some embodiments, selectivity may be assessed by comparing absolute values of remaining transcripts (or representative sequences thereof, such as RNA sequences used in examples described herein) of a target sequence and a similar sequence, e.g., RNA, or representative synthetic sequences, of a mutant allele as a target, and a wild-type allele as a similar sequence. In some embodiments, selectivity may be assessed by comparing absolute amounts of remaining transcripts (or representative sequences thereof, such as RNA sequences used in examples described herein) of a target sequence and a similar sequence, when the starting amounts are the same. In some embodiments, selectivity may be assessed by percentages of cleavage of transcripts (or representative sequences thereof, such as RNA sequences used in examples described herein) of a target sequence and a similar sequence. In some embodiments, selectivity may be assessed by comparing ratios of cleaved and non-cleaved transcripts (or representative sequences thereof, such as RNA sequences used in examples described herein).

In some embodiments, selectivity can be assessed by one or more assays exemplified herein. In some embodiments, selectivity can be measured by an RNase H cleavage assay. For example, selective cleavage of a target (e.g., RNA from a mutant allele) can be measured by a biochemical RNase H cleavage assay, wherein cleavage of a mutant target sequence is compared to that of a wild-type RNA sequence, and the selectivity can be represented by either the rate of cleavage, ratio of cleaved mutant RNA and wild-type RNA at a time point, or ratio of remaining mutant RNA and wild-type RNA at a time point, or combinations thereof. In some embodiments, a time point is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 or more minutes. In some embodiments, a time point is 10 minutes. In some embodiments, a time point is 15 minutes. In some embodiments, a time point is 20 minutes. In some embodiments, a time point is 25 minutes. In some embodiments, a time point is 30 minutes. In some embodiments, a time point is 35 minutes. In some embodiments, a time point is 40 minutes. In some embodiments, a time point is 45 minutes. In some embodiments, a time point is 50 minutes. In some embodiments, a time point is 55 minutes. In some embodiments, a time point is 60 minutes. In some embodiments, a time point is 60 or minutes. A person having ordinary skill in the art understands how to choose a time point, for example, for cleavage shown in FIG. 32, one or more time points of 5, 10, 15, 20, 20, 45 and 60 minutes can be chosen to assess selectivity. In some embodiments, selectivity can be measured by ratios of IC50 for target (e.g., mutant) and non-target (e.g, wild-type) sequences, e.g., from cell-based assays or animal models.

Example HPLC-MS traces are presented in FIG. 36. In some embodiments, example RNase H assay conditions were described below.

DNA/RNA Duplex Preparation: Oligonucleotide concentrations were determined by measuring the absorbance in water at 260 nm. DNA/RNA duplexes were prepared by mixing equimolar solutions oligonucleotides with each strand concentration of 20 μM. The mixtures were heated at 90° C. for 2 minutes in water bath and were cooled down slowly over several hours.

Human RNase H Protein Expression and Purification: Human RNase HC clone was obtained from Prof. Wei Yang's laboratory at NIH Bethesda. The protocol for obtaining this human RNase HC (residues 136-286) has been described (Nowotny, M. et al. Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse Transcription. Molecular Cell 28, 264-276, (2007)). The protein expression was carried out by following reported protocol with the exception that the resulting protein had an N-terminal His6 tag (SEQ ID NO: 1552). BL21(DE3) E. coli cells in LB medium were used for protein expression. Cells were grown at 37° C. till OD600nm reached around 0.7. The cultures were then cooled and 0.4 mM IPTG was added to induce protein expression overnight at 16° C. E. coli extract was prepared by sonication in buffer A (40 mM NaH2PO4 (pH 7.0), 1 M NaCl, 5% glycerol, 2.8 mM β-mercaptoethanol and 10 mM imidazole) with the addition of protease inhibitors (Sigma-Aldrich). The extract was purified by Ni affinity column using buffer A plus 60 mM imidazole. The protein was eluted with a linear gradient of 60 to 300 mM imidazole. The protein peak was collected and was further purified on a Mono S column (GE Healthcare) with a 100 mM-500 mM gradient of NaCl in buffer B. Fractions containing RNase HC were concentrated to 0.3 mg/mL in the storage buffer (20 mM HEPES (pH 7.0), 100 mM NaCl, 5% glycerol, 0.5 mM EDTA, 2 mM DTT) and stored at −20° C. 0.3 mg/mL enzyme concentration corresponds to 17.4 μM based on its reported extinction coefficient (32095 cm−1 M−1) and MW (18963.3 Da units).

In a 96-well plate, to 50 μL DNA/RNA duplex (20 μM) was added 10 μL of 10×RNase H buffer followed by 30 μL water. The mixture was incubated at 37° C. for a few minutes and then 10 μL of 0.2 μM stock solution of enzyme was added to give a total volume of 100 μL with final substrate/enzyme concentration 10 μM/0.02 μM (500:1) and was further incubated at 37° C. Various ratios of the DNA/RNA duplex to RNase H protein were previously studied using these conditions to find this optimal ratio (500:1) to study the kinetics. The reactions were quenched at different time points using 7 μL of 500 mM EDTA disodium solution in water. For zero min time point, EDTA was added to the reaction mixture before the addition of enzyme. Controls were run to ensure that EDTA was able to inhibit the enzyme activity completely. After all the reactions were quenched 10 μL or 20 μL of each reaction mixture was injected on to LCMS-TOF using analytical column (Agilent Poroshell 120 EC-C18 2.7 micron, 2.1×150 mm, Part #699775-902). Ratio of peak area of remaining full length RNA to DNA in each reaction mixture was normalized against this ratio at zero point reaction to obtain the % of full length RNA remaining.

In some embodiments, an example HPLC condition is:

Eluant A=8 mM TEA, 200 mM HFIP in Water Eluant B=50:50 (Eluant A: Methanol) Column Temperature=50° C.

Auto sampler temperature=4° C.
UV was recorded at 254 nm and 280 nm

LC Gradient Method

Time (min) Flow (mL/min) % A % B 1 0.0 0.2 90 10 2 15.0 0.2 65 35 3 22.0 0.2 40 60 4 25.0 0.2 5.0 95.0 5 25.5 0.2 90 10 6 30 0.2 90 10

Example 20. Example Assays for Assessing Oligonucleotides

In some embodiments, the present disclosure provides reporter assays for assessing properties of provided oligonucleotides and compositions. In some embodiments, a provided reporter assay is a dual-luciferase assay, e.g., as described below.

Determination of mRNA inhibition by oligonucleotides using Dual Glo Luciferase System: The psiCheck2 vector system from Promega is a commercially available vector which encodes both Photinus pyralis and Renilla Reniformis luciferase genes on a single plasmid with a multiple cloning site in the 3′ UTR of Renilla luciferase for insertion of oligonucleotides encoding the miRNA target sites (or other cloned regulatory sequences, such as target 3′UTRs). A 250 base pairs fragment containing the targeting region of interest and its reverse complement and having appropriate overhanging bases corresponding to the restriction enzyme(s) used to digest the psiCheck vector was cloned into the psiCHECK-2 vector (Promega, C8021) between NotI and XhoI restriction enzyme sites. The vector containing the insert was sequenced to confirm correct orientation of insert, expanded and purified. Multiple vectors were generated using above design for SNPs of interest. In a typical co-transfection experiment, after the cells were at the correct density (30 to 40% confluency), oligonucleotides and vector were reverse-transfected using Lipofectamine 2000 (Life Technologies). Effects of oligonucleotides on target mRNA can be seen as early as 24 h post-transfection and were still present after 48 h. 24 hour or 48 hours after transfection of psiCheck vectors, cells were assayed for luciferase activity. Briefly, cells are washed with PBS, lysed in passive lysis buffer, luciferin reagents were added, and samples were read on a Spectramax M5 instrument (Molecular Devices). Measurements were taken at vector concentrations of 20 ng per well of a 96-well plate. The experiments were performed at various oligonucleotide concentrations (30, 10 and 3.3 nM) and two time points (24 and 48 hours). The relative levels of Renilla luciferase vs. Firefly were measured for untreated cells and cells which were treated with oligonucleotides targeting Renilla (WV-975) to measure the maximum Renilla knockdown. Control oligonucleotides (e.g., WV-437, WV-993, etc.) were chosen to normalize the R/F levels. In some embodiments, dual luciferase reporter assay was used to assess oligonucleotides in Cos7 cell line. In some embodiments, the cell line was cotransfected for 24 hrs with oligonucleotides and either of the psiCHECK2 plasmids, including rs362307 (T) or rs362307 (C) SNP. In some embodiments, rs362307 (T) and rs362307 (C) are referred as mu and wt.

Various chirally controlled and stereorandom oligonucleotide compositions were tested at 30 nM using the dual-luciferase assay. For oligonucleotides with mismatch at the same position (e.g., positions 8, 9, 10, 11, 12 and 13 relative to the 5′-end), chirally controlled compositions maintained high levels of wide-type measurements.

In some embodiments, when tested at 30 nM, WV-1092 selectively suppressed expression of the mutant sequence at 24 and/or 48 hours as shown by the dual luciferase reporter assay. In some embodiments, the observed selectivity for WV-1092 at 30 nM 24 hours and/or 48 hours was several fold more than other oligonucleotide compositions, e.g., WV-917, WV-1497, certain P12 stereopure oligonucleotides, etc. In some embodiments, at 30 nM, 48 hours, WV-1092 maintained over 90% wild-type, and decreased the mutant to about 30%, while WV-917 decreased the wild-type to about 60%, and mutant to about 30%. Oligonucleotides are tested at multiple conditions (e.g., concentrations, time points, etc.), and show improved properties, e.g., activity, selectivity, etc.

As understood by a person having ordinary skill in the art, oligonucleotide properties, e.g., activity, selectivity, etc., may be assessed by many other assays, such as cell-based assays, animal models, etc. In some embodiments, allele-specific suppression may be tested in cells and animal models using similar procedures as described in Hohjoh, Pharmaceuticals 2013, 6, 522-535; US patent application publication US 2013/0197061; Østergaard et al., Nucleic Acids Research 2013, 41(21), 9634-9650; Jiang et al., Science 2013, 342, 111-114; and U.S. Pat. No. 9,006,198. In some embodiments, selectivity can be assessed by IC50 values for the wild-type and the mutant allele. Provided compositions, including those targeting SNPs associated with Huntington's disease, suppress disease-associated alleles selectively over wild type alleles.

Example 21. Example Methods for Preparing Oligonucleotides and Compositions Abbreviations

AMA: conc. NH3—40% MeNH2 in H2O (1:1, v/v)
CMIMT: N-cyanomethylimidazolium triflate
DBU: 1,8-diazabicyclo[5.4.0]undec-7-ene
DCA: dichloroacetic acid
DCM: dichloromethane, CH2Cl2
DMTr: 4,4′-dimethoxytrityl
DVB: divinylbenzene
HCP: highly cross-linked polystyrene (contains 50% DVB, non-swelling polystyrene)

MeIm: N-methylimidazole

MQ: water obtained from “Milli-Q Reference”
PhIMT: N-phenylimidazolium triflate
POS: 3-phenyl-1,2,4-dithiazolin-5-one
PS200: primer support 200, commercially available from GE Healthcare
PS5G: primer support 5G, commercially available from GE Healthcare
TBAF: tetrabutylammonium fluoride
TBHP: tert-butylhydroperoxide
TEAA: triethylammonium aceate

Solid support: Various types of solid support (varied nucleosides loading) were tested. In some embodiments, HCP>PS5G≈PS200≥CPG. In some embodiments, a solid support is HCP. In some embodiments, a solid support is PS5G. In some embodiments, a solid support is PS200. In some embodiments, a solid support is CPG. For nucleosides loading, various range (30-300 μmol/g) were tested. In some embodiments, 70-80 μmol/g loading performed than others. In some embodiments, nucleoside loading is 70-80 μmol/g. CPG was purchased from various suppliers (GlenReseach, LinkTechnologies, ChemGenes, PrimeSynthesis, and 3-Prime).

Various linkers were tested and can be used. In some embodiments, during preparation of chirally controlled oligonucleotide compositions by using DPSE-type chemistry, SP-linker was used.

Various activators were prepared and/or purchased, and evaluated. In some embodiments, for DPSE-type chemistry, CMIMT was used.

Example Analytical conditions:

1) RP-UPLC-MS

    • System: Waters, Acquity UPLC I-Class, Xevo G2-Tof
    • Column: Waters, BEH C18, 1.7 m, 2.1×150 mm
    • Temp. & Flow rate: 55° C., 0.3 mL/min
    • Buffer: A: 0.1M TEAA; B: MeCN
    • Gradient: % B: 1-30%/30 min

2) AEX-HPLC

    • System: Waters, Alliance e2695
    • Column: Thermo, DNAPac PA-200, 4×250 mm
    • Temp. & Flow rate: 50° C., 1 mL/min
    • Buffer: A: 20 mM NaOH; B: A+1M NaClO4
    • Gradient: % B: 10-50%/30 min

Example procedure for the synthesis of chrial-oligos (1 μmol scale):

Automated solid-phase synthesis of chiral-oligos was performed according to example cycles shown herein. After the synthesis cycles, the resin was treated with 0.1M TBAF in MeCN (1 mL) for 2 h (30 min usually enough) at room temperature, washed with MeCN, dried, and add AMA (1 mL) for 30 min at 45° C. The mixture was cooled to room temperature and the resin was removed by membrane filtration. The filtrate was concentrated under reduced pressure to about 1 mL. The residue was diluted with 1 mL of H2O and analyzed by AEX-HPLC and RP-UPLC-MS (example conditions: refer to the analytical conditions).

waiting step operation reagents and solvent volume time 1 detritylation 3% DCA in toluene 10 mL 65 s 2 coupling 0.15M monomer in iPrCN + 0.5 mL 5 min 0.5M CMIMT in MeCN 3 capping 20% Ac2O, 30% 2,6- 1.2 mL 60 s lutidine in MeCN + 20% MeIm in MeCN 4 oxidation or 1.1M TBHP in DCM- 1.0 mL 300 s sulfurization decane or 0.1M POS in MeCN

As described, TBAF treatment can provide better results, for example, less desulfurization. In some embodiments, SP linker provided better yields and/or purity through, without the intention to be limited by theory, better stability during chiral auxiliary removal as described. In some embodiments, fluoro-containing reagents such as HF—NR3 (e.g., HF-TEA (triethylamine)), provided better yields and/or purity when succinyl linker was used by, without the intention to be limited by theory, less cleavage during chiral auxiliary removal. In some embodiments, after synthesis, the resin was treated with 1M TEA-HF in DMF-H2O (3:1, v/v; 1 mL) for 2 h at 50° C. PS5G support was washed with MeCN, H2O, and add AMA (conc. NH3—40% MeNH2 (1:1, v/v)) (1 mL) for 45 min at 50° C. The mixture was cooled to room temperature and the resin was removed by membrane filtration (washed with H2O for 2 mL). The filtrate was concentrated under reduced pressure until it becomes about 1 mL. The residue was diluted with 1 mL of H2O and analyzed by AEX-HPLC and RP-UPLC-MS (conditions: refer to the analytical conditions section).

Example procedure for the purification of chrial-oligos (1 μmol scale): in some embodiments, crude oligos were purified by AEX-MPLC according to the following example conditions:

    • System: AKTA Purifier-10
    • Column: TOHSOH, DNA STAT, 4.6×100 mm
    • Temp. & Flow rate: 60° C., 0.5 mL/min
    • Buffer: A: 20 mM Tris-HCl (pH 9.0)+20% MeCN, B: A+1.5M NaCl
    • Gradient: % B: 20-70%/25 CV (2%/CV)

All fractions were analyzed by analytical AEX-HPLC, and fractions containing chiral oligo more than 80% purity were corrected and desalted by Sep-Pak Plus tC18 (WAT036800) using example conditions below:

1. Conditioning Sep-Pak Plus with 15 mL of MeCN.

2. Rinse cartridge with 15 mL of 50% MeCN/MQ.

3. Equilibrate cartridge with 30 mL of MQ.

4. Load sample, and wash with 40 mL of MQ.

5. Elute chiral oligos with 10 mL of 50% MeCN/MQ.

Eluted sample were evaporated under reduced pressure to remove MeCN, and lyophilized. The product were dissolved in MQ (1 mL), filtered by 0.2 μm mesh syringe filter, and analyzed. After yield calculation by UV absorbance, the preparation was lyophilized again.

Example methods, conditions and reagents were described in, e.g., JP 2002-33436, WO2005/092909, WO2010/064146, WO2012/039448, WO2011/108682, WO2014/010250, WO2014/010780, WO2014/012081, etc., and may be useful for preparing provided oligonucleotides and/or compositions.

Additional example oligonucleotides are listed below. In some embodiments, one or more of the oligonucleotides below are used as controls. In some embodiments, one or more of the oligonucleotides below are RNA sequences as cleavage targets in one or more assays.

TABLE 5N Example Control Oligonucleotides. WV-975 G*T*A*G*G*A*G*T*A*G*T*G*A*A*A*G*G*C*C*A (SEQ ID NO: 783) WV-1061 mG*mU*mA*mG*mG*A*G*T*A*G*T*G*A*A*A*mG*mG*mC *mC*mA (SEQ ID NO: 784) WV-1062 mGmUmAmGmG*A*G*T*A*G*T*G*A*A*A*mGmGmCmCmA (SEQ ID NO: 785) WV-1063 mG*mU*mA*mG*mG*A*G*T*A*G*T*G*A*A*A*G*G*C*C* A (SEQ ID NO: 786) WV-1064 mC*mU*mC*mU*mU*A*C*T*G*T*G*C*T*G*T*mG*mG*mA *mC*mA (SEQ ID NO: 787) WV-1065 mCmUmCmUmU*A*C*T*G*T*G*C*T*G*T*mGmGmAmCmA (SEQ ID NO: 788) WV-1066 mC*mU*mC*mU*mU*A*C*T*G*T*G*C*T*G*T*G*G*A*C*A (SEQ ID NO: 789) WV-993 mC*mC*mU*mU*mC*C*C*T*G*A*A*G*G*T*T*mC*mC*mU *mC*mC (SEQ ID NO: 790) WV-975 All DNA, Stereorandom PS, positive control for Renilla luciferase in psiCHECK2 plasmid WV-1061 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, +ve Luciferase control for psiCHECK2 WV-1062 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings: +ve Luciferase control for psiCHECK2 WV-1063 5-15 (2′-OMe-DNA), stereorandom PS, +ve Luciferase control for psiCHECK2 WV-1064 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, Negative Luciferase control for psiCHECK2 WV-1065 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, PO in the wings: Negative Luciferase control for psiCHECK2 WV-1066 5-15 (2′-OMe-DNA), stereorandom PS, Negative Luciferase control for psiCHECK2 WV-993 5-10-5 (2′-OMe-DNA-2′-OMe), stereorandom PS, Negative Luciferase control for psiCHECK2

TABLE 6N Example RNA Sequences. WV-944 rUrUrUrGrGrArArGrUrCrUrGrCrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID NO: 791) WV-945 rUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID NO: 792) WV-1073 rGrArGrCrCrUrUrUrGrGrArArGrUrCrUrGrCrGrCrCrCrUrUrGrUr GrCrCrCrUrGrCrCrU (SEQ ID NO: 793) WV-1074 rGrArGrCrCrUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUr GrCrCrCrUrGrCrCrU (SEQ ID NO: 794) WV-950 rGrGrUrUrGrUrUrGrCrCrArGrGrUrUrArCrArGrCrUrGrCrUrC (SEQ ID NO: 795) WV-951 rGrGrUrUrGrUrUrGrCrCrArGrGrUrUrGrCrArGrCrUrGrCrUrC (SEQ ID NO: 796) WV-958 rCrCrUrCrCrUrGrCrArGrGrCrUrGrGrGrUrGrUrUrGrGrCrCrC (SEQ ID NO: 797) WV-959 rCrCrUrCrCrUrGrCrArGrGrCrUrGrGrCrUrGrUrUrGrGrCrCrC (SEQ ID NO: 798) ONT-453 rGrGrUrGrArUrGrArCrArArUrUrUrArUrUrArArU (SEQ ID NO: 799) ONT-454 rGrGrUrGrArUrGrGrCrArArUrUrUrArUrUrArArU (SEQ ID NO: 800) WV-944 rs362307 WT WV-945 rs362307 mu WV-1073 rs362307 WT WV-1074 rs362307 mu WV-950 rs362306 WT WV-951 rs362306 mu WV-958 rs362268 WT WV-959 rs362268 mu ONT-453 rs7685686 WT ONT-454 rs7685686 mu

Example 22. Example Oligonucleotides

Additional example oligonucleotides are listed below in Table 8.

TABLE 8 HTT Oligonucleotides. SEQ SEQ SEQ Naked ID ID ID Sequence NO: Modified Sequence NO: Stereochemistry Comment 1 Comment 2 ONT- ATTAATA 801 A * T * T * A * A * T * A * A * 1153 XXXXXXXXX Stereorandom Htt Htt SNP 450 AATTGTC A * T * T * G * T * C * A * T * XXXXXXXXX sequence rs7685686 ATCACC C * A * C * C X ONT- ATTAATA 802 A * ST * ST * SA * SA * ST * 1154 SSSSSSSSSSS Stereopure Htt Htt SNP 451 AATTGTC SA * SA * SA * ST * ST * SG * SSRSSSSS sequence I rs7685686 ATCACC ST * SC * RA * ST * SC * SA * SC * SC ONT- ATTAATA 803 A * ST * ST * SA * SA * ST * 1155 SSSSSSSSSSS Stereopure Htt Htt SNP 452 AATTGTC SA * SA * SA * ST * ST * SG * SSSRSSSS sequence II rs7685686 ATCACC ST * SC * SA * RT * SC * SA * SC * SC ONT- GGUGAUG 804 rGrGrUrGrArUrGrArCrArArUr 1156 OOOOOOOOO RNA against Htt Htt SNP 453 ACAAUUU UrUrArUrUrArArU OOOOOOOOO sequence Mutant rs7685686 AUUAAU O ONT- GGUGAUG 805 rGrGrUrGrArUrGrGrCrArArUr 1157 OOOOOOOOO RNA against Htt Htt SNP 454 GCAAUUU UrUrArUrUrArArU OOOOOOOOO sequence Wild rs7685686 AUUAAU O Type WV- UUUGGAA 806 rUrUrUrGrGrArArGrUrCrUrGr 1158 OOOOOOOOO wtRNA muHTT 902 GUCUGCG CrGrCrCrCrUrUrGrUrGrCrCrC OOOOOOOOO SNP CCCUUGU OOOOOO 362307 GCCC WV- UUUGGAA 807 rUrUrUrGrGrArArGrUrCrUrGr 1159 OOOOOOOOO mRNA muHTT 903 GUCUGUG UrGrCrCrCrUrUrGrUrGrCrCrC OOOOOOOOO SNP CCCUUGU OOOOOO 362307 GCCC WV- GGGCACA 808 G * G * G * C * A * C * A * A * 1160 XXXXXXXXX ASO1 All DNA; muHTT 904 AGGGCAC G * G * G * C * A * C * A * G * XXXXXXXXX stereorandom PS SNP AGACTT A * C * T * T X 362307 WV- GGCACAA 809 G * G * C * A * C * A * A * G * 1161 XXXXXXXXX ASO2 All DNA; muHTT 905 GGGCACA G * G * C * A * C * A * G * A * XXXXXXXXX stereorandom PS SNP GACTTC C * T * T * C X 362307 WV- GCACAAG 810 G * C * A * C * A * A * G * G * 1162 XXXXXXXXX ASO3 All DNA; muHTT 906 GGCACAG G * C * A * C * A * G * A * C * XXXXXXXXX stereorandom PS SNP ACTTCC T * T * C * C X 362307 WV- CACAAGG 811 C * A * C * A * A * G * G * G * 1163 XXXXXXXXX ASO4 All DNA; muHTT 907 GCACAGA C * A * C * A * G * A * C * T * XXXXXXXXX stereorandom PS SNP CTTCCA T * C * C * A X 362307 WV- ACAAGGG 812 A * C * A * A * G * G * G * C * 1164 XXXXXXXXX ASO5 All DNA; muHTT 908 CACAGAC A * C * A * G * A * C * T * T * XXXXXXXXX stereorandom PS SNP TTCCAA C * C * A * A X 362307 WV- CAAGGGC 813 C * A * A * G * G * G * C * A * 1165 XXXXXXXXX ASO6 All DNA; muHTT 909 ACAGACT C * A * G * A * C * T * T * C * XXXXXXXXX stereorandom PS SNP TCCAAA C * A * A * A X 362307 WV- GGGCACA 814 mG * mG * mG * mC * mA * C 1166 XXXXXXXXX ASO7 5-15 (2′- muHTT 910 AGGGCAC * A * A * G * G * G * C * A * C XXXXXXXXX OMe-DNA); SNP AGACTT * A * G * A * C * T * T X stereorandom PS 362307 WV- GGCACAA 815 mG * mG * mC * mA * mC * A 1167 XXXXXXXXX ASO8 5-15 (2′- muHTT 911 GGGCACA * A * G * G * G * C * A * C * A XXXXXXXXX OMe-DNA); SNP GACTTC * G * A * C * T * T * C X stereorandom PS 362307 WV- GCACAAG 816 mG * mC * mA * mC * mA * A 1168 XXXXXXXXX ASO9 5-15 (2′- muHTT 912 GGCACAG * G * G * G * C * A * C * A * G XXXXXXXXX OMe-DNA); SNP ACTTCC * A * C * T * T * C * C X stereorandom PS 362307 WV- CACAAGG 817 mC * mA * mC * mA * mA * G 1169 XXXXXXXXX ASO10 5-15 (2′- muHTT 913 GCACAGA * G * G * C * A * C * A * G * A XXXXXXXXX OMe-DNA); SNP CTTCCA * C * T * T * C * C * A X stereorandom PS 362307 WV- ACAAGGG 818 mA * mC * mA * mA * mG * G 1170 XXXXXXXXX ASO11 5-15 (2′- muHTT 914 CACAGAC * G * C * A * C * A * G * A * C XXXXXXXXX OMe-DNA); SNP TTCCAA * T * T * C * C * A * A X stereorandom PS 362307 WV- CAAGGGC 819 mC * mA * mA * mG * mG * G 1171 XXXXXXXXX ASO12 5-15 (2′- muHTT 915 ACAGACT * C * A * C * A * G * A * C * T XXXXXXXXX OMe-DNA); SNP TCCAAA * T * C * C * A * A * A X stereorandom PS 362307 WV- GGGCACA 820 mG * mG * mG * mC * mA * C 1172 XXXXXXXXX ASO13 5-10-5 (2′- muHTT 916 AGGGCAC * A * A * G * G * G * C * A * C XXXXXXXXX OMe-DNA-2′- SNP AGACUU * A * mG * mA * mC * mU * X OMe); 362307 mU stereorandom PS WV- GGCACAA 821 mG * mG * mC * mA * mC * A 1173 XXXXXXXXX ASO14 5-10-5 (2′- muHTT 917 GGGCACA * A * G * G * G * C * A * C * A XXXXXXXXX OMe-DNA-2′- SNP GACUUC * G * mA * mC * mU * mU * X OMe); 362307 mC stereorandom PS WV- GCACAAG 822 mG * mC * mA * mC * mA * A 1174 XXXXXXXXX ASO15 5-10-5 (2′- muHTT 918 GGCACAG * G * G * G * C * A * C * A * G XXXXXXXXX OMe-DNA-2′- SNP ACUUCC * A * mC * mU * mU * mC * X OMe); 362307 mC stereorandom PS WV- CACAAGG 823 mC * mA * mC * mA * mA * G 1175 XXXXXXXXX ASO16 5-10-5 (2′- muHTT 919 GCACAGA * G * G * C * A * C * A * G * A XXXXXXXXX OMe-DNA-2′- SNP CUUCCA * C * mU * mU * mC * mC * X OMe); 362307 mA stereorandom PS WV- ACAAGGG 824 mA * mC * mA * mA * mG * G 1176 XXXXXXXXX ASO17 5-10-5 (2′- muHTT 920 CACAGAC * G * C * A * C * A * G * A * C XXXXXXXXX OMe-DNA-2′- SNP TUCCAA * T * mU * mC * mC * mA * X OMe); 362307 mA stereorandom PS WV- CAAGGGC 825 mC * mA * mA * mG * mG * G 1177 XXXXXXXXX ASO18 5-10-5 (2′- muHTT 921 ACAGACT * C * A * C * A * G * A * C * T XXXXXXXXX OMe-DNA-2′- SNP TCCAAA * T * mC * mC * mA * mA * X OMe); 362307 mA stereorandom PS WV- GCACAAG 826 mG * mC * mA * mC * mA * 1178 XXXXXXXXX ASO19 8-7-5 (2′- muHTT 922 GGCACAG * mA * mG * mG * G * C * A * C XXXXXXXXX OMe-DNA-2′- SNP ACUUCC * A * G * A * mC * mU * mU * X OMe); 362307 mC * mC stereorandom PS WV- CACAAGG 827 mC * mA * mC * mA * mA * 1179 XXXXXXXXX ASO20 7-7-6 (2′- muHTT 923 GCACAGA mG * mG * G * C * A * C * A * XXXXXXXXX OMe-DNA-2′- SNP CUUCCA G * A * mC * mU * mU * mC * X OMe); 362307 mC * mA stereorandom PS WV- ACAAGGG 828 mA * mC * mA * mA * mG * 1180 XXXXXXXXX ASO21 6-7-5 (2′- muHTT 924 CACAGAC mG * G * C * A * C * A * G * A XXXXXXXXX OMe-DNA-2′- SNP UUCCAA * mC * mU * mU * mC * mC * X OMe); 362307 mA * mA stereorandom PS; PO in the wings WV- CAAGGGC 829 mC * mA * mA * mG * mG * G 1181 XXXXXXXXX ASO22 5-7-8 (2′- muHTT 925 ACAGACU * C * A * C * A * G * A * mC * XXXXXXXXX OMe-DNA-2′- SNP UCCAAA mU * mU * mC * mC * mA * X OMe); 362307 mA * mA stereorandom PS; PO in the wings WV- GCACAAG 830 mGmCmAmCmAmAmGmG * 1182 OOOOOOOXX ASO23 8-7-5 (2′- muHTT 926 GGCACAG G * C * A * C * A * G * A * XXXXXXOOO OMe-DNA-2′- SNP ACUUCC mCmUmUmCmC O OMe); 362307 stereorandom PS; PO in the wings WV- CACAAGG 831 mCmAmCmAmAmGmG * G * 1183 OOOOOOXXX ASO24 7-7-6 (2′- muHTT 927 GCACAGA C * A * C * A * G * A * XXXXXOOOO OMe-DNA-2′- SNP CUUCCA mCmUmUmCmCmA O OMe); 362307 stereorandom PS; PO in the wings WV- ACAAGGG 832 mAmCmAmAmGmG * G * C * 1184 OOOOOXXXX ASO25 6-7-5 (2′- muHTT 928 CACAGAC A * C * A * G * A * XXXXOOOOO OMe-DNA-2′- SNP UUCCAA mCmUmUmCmCmAmA O OMe); 362307 stereorandom PS; PO in the wings WV- CAAGGGC 833 mCmAmAmGmG * G * C * A * 1185 OOOOXXXXX ASO26 5-7-8 (2′- muHTT 929 ACAGACU C * A * G * A * XXXOOOOOO OMe-DNA-2′- SNP UCCAAA mCmUmUmCmCmAmAmA O OMe); 362307 stereorandom PS; PO in the wings WV- GGGCACA 834 mGmGmGmCmA * C * A * A * 1186 OOOOXXXXX ASO27 5-10-5 (2′- muHTT 930 AGGGCAC G * G * G * C * A * C * A * XXXXXXOOO OMe-DNA-2′- SNP AGACUU mGmAmCmUmU O OMe); 362307 stereorandom PS; PO in the wings WV- GGCACAA 835 mGmGmCmAmC * A * A * G * 1187 OOOOXXXXX ASO28 5-10-5 (2′- muHTT 931 GGGCACA G * G * C * A * C * A * G * XXXXXXOOO OMe-DNA-2′- SNP GACUUC mAmCmUmUmC O OMe); 362307 stereorandom PS; PO in the wings WV- GCACAAG 836 mGmCmAmCmA * A * G * G * 1188 OOOOXXXXX ASO29 5-10-5 (2′- muHTT 932 GGCACAG G * C * A * C * A * G * A * XXXXXXOOO OMe-DNA-2′- SNP ACUUCC mCmUmUmCmC O OMe); 362307 stereorandom PS; PO in the wings WV- CACAAGG 837 mCmAmCmAmA * G * G * G * 1189 OOOOXXXXX ASO30 5-10-5 (2′- muHTT 933 GCACAGA C * A * C * A * G * A * C * XXXXXXOOO OMe-DNA-2′- SNP CUUCCA mUmUmCmCmA O OMe); 362307 stereorandom PS; PO in the wings WV- ACAAGGG 838 mAmCmAmAmG * G * G * C * 1190 OOOOXXXXX ASO31 5-10-5 (2′- muHTT 934 CACAGAC A * C * A * G * A * C * T * XXXXXXOOO OMe-DNA-2′- SNP TUCCAA mUmCmCmAmA O OMe); 362307 stereorandom PS; PO in the wings WV- CAAGGGC 839 mCmAmAmGmG * G * C * A * 1191 OOOOXXXXX ASO32 5-10-5 (2′- muHTT 935 ACAGACT C * A * G * A * C * T * T * XXXXXXOOO OMe-DNA-2′- SNP TCCAAA mCmCmAmAmA O OMe); 362307 stereorandom PS; PO in the wings WV- GGGCACA 840 G * SG * SG * SC * SA * SC * 1192 SSSSSSSSSSS ASO33 Stereopure muHTT 936 AGGGCAC SA * SA * SG * SG * SG * SC * SSRSSSSS DNA; One Rp; SNP AGACTT SA * SC * RA * SG * SA * SC * position 14 362307 ST * ST WV- GGCACAA 841 G * SG * SC * SA * SC * SA * 1193 SSSSSSSSSSS ASO34 Stereopure muHTT 937 GGGCACA SA * SG * SG * SG * SC * SA * SRSSSSSS DNA; One Rp; SNP GACTTC SC * RA * SG * SA * SC * ST * position 13 362307 ST * SC WV- GCACAAG 842 G * SC * SA * SC * SA * SA * 1194 SSSSSSSSSSS ASO35 Stereopure muHTT 938 GGCACAG SG * SG * SG * SC * SA * SC * RSSSSSSS DNA; One Rp; SNP ACTTCC RA * SG * SA * SC * ST * ST * position 12 362307 SC * SC WV- CACAAGG 843 C * SA * SC * SA * SA * SG * 1195 SSSSSSSSSSR ASO36 Stereopure muHTT 939 GCACAGA SG * SG * SC * SA * SC * RA * SSSSSSSS DNA; One Rp; SNP CTTCCA SG * SA * SC * ST * ST * SC * position 11 362307 SC * SA WV- ACAAGGG 844 A * SC * SA * SA * SG * SG * 1196 SSSSSSSSSRS ASO37 Stereopure muHTT 940 CACAGAC SG * SC * SA * SC * RA * SG * SSSSSSSS DNA; One Rp; SNP TTCCAA SA * SC * ST * ST * SC * SC * position 10 362307 SA * SA WV- CAAGGGC 845 C * SA * SA * SG * SG * SG * 1197 SSSSSSSSRSS ASO38 Stereopure muHTT 941 ACAGACT SC * SA * SC * RA * SG * SA * SSSSSSSS DNA; One Rp; SNP TCCAAA SC * ST * ST * SC * SC * SA * position 9 362307 SA * SA WV- UUUGGAA 846 rUrUrUrGrGrArArGrUrCrUrGr 1198 OOOOOOOOO HTT-rs362307 Huntington 944 GUCUGCG CrGrCrCrCrUrUrGrUrGrCrCrC OOOOOOOOO human CCCUUGU OOOOOO GCCC WV- UUUGGAA 847 rUrUrUrGrGrArArGrUrCrUrGr 1199 OOOOOOOOO HTT-rs362307 Huntington 945 GUCUGUG UrGrCrCrCrUrUrGrUrGrCrCrC OOOOOOOOO human CCCUUGU OOOOOO GCCC WV- GAGCAGC 848 G * A * G * C * A * G * C * T * 1200 XXXXXXXXX HTT-rs362306 HTT- 948 TGCAACC G * C * A * A * C * C * T * G * XXXXXXXXX rs362306 TGGCAA G * C * A * A X WV- GGGCCAA 849 G * G * G * C * C * A * A * C * 1201 XXXXXXXXX HTT-rs362268 HTT- 949 CAGCCAG A * G * C * C * A * G * C * C * XXXXXXXXX rs362268 CCTGCA T * G * C * A X WV- GGUUGUU 850 rGrGrUrUrGrUrUrGrCrCrArGr 1202 OOOOOOOOO HTT- 950 GCCAGGU GrUrUrArCrArGrCrUrGrCrUrC OOOOOOOOO rs362306 UACAGCU OOOOOO GCUC WV- GGUUGUU 851 rGrGrUrUrGrUrUrGrCrCrArGr 1203 OOOOOOOOO HTT- 951 GCCAGGU GrUrUrGrCrArGrCrUrGrCrUrC OOOOOOOOO rs362306 UGCAGCU OOOOOO GCUC WV- GAGCAGC 852 G * SA * SG * SC * SA * SG * 1204 SSSSSSSSSSR Stereopure PS HTT- 952 TGCAACC SC * ST * SG * SC * SA * RA * SSSSSSSS DNA; One Rp at rs362306 TGGCAA SC * SC * ST * SG * SG * SC * position 11 SA * SA WV- AGCAGCT 853 A * SG * SC * SA * SG * SC * 1205 SSSSSSSSSRS Stereopure PS HTT- 953 GCAACCT ST * SG * SC * SA * RA * SC * SSSSSSSS DNA; One Rp at rs362306 GGCAAC SC * ST * SG * SG * SC * SA * position 10 SA * SC WV- GCAGCTG 854 G * SC * SA * SG * SC * ST * 1206 SSSSSSSSRSS Stereopure PS HTT- 954 CAACCTG SG * SC * SA * RA * SC * SC * SSSSSSSS DNA; One Rp at rs362306 GCAACA ST * SG * SG * SC * SA * SA * position 9 SC * SA WV- CAGCTGC 855 C * SA * SG * SC * ST * SG * 1207 SSSSSSSRSSS Stereopure PS HTT- 955 AACCTGG SC * SA * RA * SC * SC * ST * SSSSSSSS DNA; One Rp at rs362306 CAACAA SG * SG * SC * SA * SA * SC * position 8 SA * SA WV- AGCTGCA 856 A * SG * SC * ST * SG * SC * 1208 SSSSSSRSSSS Stereopure PS HTT- 956 ACCTGGC SA * RA * SC * SC * ST * SG * SSSSSSSS DNA; One Rp at rs362306 AACAAC SG * SC * SA * SA * SC * SA * position 7 SA * SC WV- GCTGCAA 857 G * SC * ST * SG * SC * SA * 1209 SSSSSRSSSSS Stereopure PS HTT- 957 CCTGGCA RA * SC * SC * ST * SG * SG * SSSSSSSS DNA; One Rp at rs362306 ACAACC SC * SA * SA * SC * SA * SA * position 6 SC * SC WV- CCUCCUG 858 rCrCrUrCrCrUrGrCrArGrGrCrU 1210 OOOOOOOOO HTT- 958 CAGGCUG rGrGrGrUrGrUrUrGrGrCrCrC OOOOOOOOO rs362268 GGUGUUG OOOOOO GCCC WV- CCUCCUG 859 rCrCrUrCrCrUrGrCrArGrGrCrU 1211 OOOOOOOOO HTT- 959 CAGGCUG rGrGrCrUrGrUrUrGrGrCrCrC OOOOOOOOO rs362268 GCUGUUG OOOOOO GCCC WV- GGGCCAA 860 G * SG * SG * SC * SC * SA * 1212 SSSSSSSSSSR Stereopure PS HTT- 960 CAGCCAG SA * SC * SA * SG * SC * RC * SSSSSSSS DNA; One Rp at rs362268 CCTGCA SA * SG * SC * SC * ST * SG * position 11 SC * SA WV- GGCCAAC 861 G * SG * SC * SC * SA * SA * 1213 SSSSSSSSSRS Stereopure PS HTT- 961 AGCCAGC SC * SA * SG * SC * RC * SA * SSSSSSSS DNA; One Rp at rs362268 CTGCAG SG * SC * SC * ST * SG * SC * position 10 SA * SG WV- GCCAACA 862 G * SC * SC * SA * SA * SC * 1214 SSSSSSSSRSS Stereopure PS HTT- 962 GCCAGCC SA * SG * SC * RC * SA * SG * SSSSSSSS DNA; One Rp at rs362268 TGCAGG SC * SC * ST * SG * SC * SA * position 9 SG * SG WV- CCAACAG 863 C * SC * SA * SA * SC * SA * 1215 SSSSSSSRSSS Stereopure PS HTT- 963 CCAGCCT SG * SC * RC * SA * SG * SC * SSSSSSSS DNA; One Rp at rs362268 GCAGGA SC * ST * SG * SC * SA * SG * position 8 SG * SA WV- CAACAGC 864 C * SA * SA * SC * SA * SG * 1216 SSSSSSRSSSS Stereopure PS HTT- 964 CAGCCTG SC * RC * SA * SG * SC * SC * SSSSSSSS DNA; One Rp at rs362268 CAGGAG ST * SG * SC * SA * SG * SG * position 7 SA * SG WV- AACAGCC 865 A * SA * SC * SA * SG * SC * 1217 SSSSSRSSSSS Stereopure PS HTT- 965 AGCCTGC RC * SA * SG * SC * SC * ST * SSSSSSSS DNA; One Rp at rs362268 AGGAGG SG * SC * SA * SG * SG * SA * position 6 SG * SG WV- GGCCUUU 866 rGrGrCrCrUrUrUrCrArCrUrArC 1218 OOOOOOOOO siRNA (+control Htt 973 CACUACU rUrCrCrUrArCTT OOOOOOOOO for Renilla CCUACTT OO luciferase in psiCHECK2 plasmid) antisense strand WV- GUAGGAG 867 rGrUrArGrGrArGrUrArGrUrGr 1219 OOOOOOOOO siRNA (+control Htt SNP 974 UAGUGAA ArArArGrGrCrCTT OOOOOOOOO for Renilla rs362268 AGGCCTT OO luciferase in psiCHECK2 plasmid) sense strand WV- GTAGGAG 868 G * T * A * G * G * A * G * T * 1220 XXXXXXXXX ASO (+control for Htt SNP 975 TAGTGAA A * G * T * G * A * A * A * G * XXXXXXXXX Renilla luciferase in rs362268 AGGCCA G * C * C * A X psiCHECK2 plasmid) WV- GCAGGGC 869 G * SC * SA * SG * SG * SG * 1221 SSSSSSSSSSS Htt seq 307 Htt 982 ACAAGGG SC * SA * SC * SA * SA * SG * SSSSSRSS expanding 3 nt rs362307 CACAGA SG * SG * SC * SA * SC * RA * towards 3′ example 3 SG * SA WV- CAGGGCA 870 C * SA * SG * SG * SG * SC * 1222 SSSSSSSSSSS Htt seq 307 Htt 983 CAAGGGC SA * SC * SA * SA * SG * SG * SSSSRSSS expanding 3 nt rs362307 ACAGAC SG * SC * SA * SC * RA * SG * towards 3′ example 2 SA * SC WV- AGGGCAC 871 A * SG * SG * SG * SC * SA * 1223 SSSSSSSSSSS Htt seq 307 Htt 984 AAGGGCA SC * SA * SA * SG * SG * SG * SSSRSSSS expanding 3 nt rs362307 CAGACT SC * SA * SC * RA * SG * SA * towards 3′ example 1 SC * ST WV- AAGGGCA 872 A * SA * SG * SG * SG * SC * 1224 SSSSSSSRSSS Htt seq 307 Htt 985 CAGACTT SA * SC * RA * SG * SA * SC * SSSSSSSS expanding 3 nt rs362307 CCAAAG ST * ST * SC * SC * SA * SA * towards 5′ example 1 SA * SG WV- AGGGCAC 873 A * SG * SG * SG * SC * SA * 1225 SSSSSSRSSSS Htt seq 307 Htt 986 AGACTTC SC * RA * SG * SA * SC * ST * SSSSSSSS expanding 3 nt rs362307 CAAAGG ST * SC * SC * SA * SA * SA * towards 5′ example 2 SG * SG WV- GGGCACA 874 G * SG * SG * SC * SA * SC * 1226 SSSSSRSSSSS Htt seq 307 Htt 987 GACTTCC RA * SG * SA * SC * ST * ST * SSSSSSSS expanding 3 nt rs362307 AAAGGC SC * SC * SA * SA * SA * SG * towards 5′ example 3 SG * SC WV- GAGCAGC 875 G * A * G * C * A * G * C * T * 1227 XXXXXXXXX All DNA; HTT- 1001 TGCAACC G * C * A * A * C * C * T * G * XXXXXXXXX stereorandom PS rs362306 TGGCAA G * C * A * A X WV- AGCAGCT 876 A * G * C * A * G * C * T * G * 1228 XXXXXXXXX All DNA; HTT- 1002 GCAACCT C * A * A * C * C * T * G * G * XXXXXXXXX stereorandom PS rs362306 GGCAAC C * A * A * C X WV- GCAGCTG 877 G * C * A * G * C * T * G * C * 1229 XXXXXXXXX All DNA; HTT- 1003 CAACCTG A * A * C * C * T * G * G * C * XXXXXXXXX stereorandom PS rs362306 GCAACA A * A * C * A X WV- CAGCTGC 878 C * A * G * C * T * G * C * A * 1230 XXXXXXXXX All DNA; HTT- 1004 AACCTGG A * C * C * T * G * G * C * A * XXXXXXXXX stereorandom PS rs362306 CAACAA A * C * A * A X WV- AGCTGCA 879 A * G * C * T * G * C * A * A * 1231 XXXXXXXXX All DNA; HTT- 1005 ACCTGGC C * C * T * G * G * C * A * A * XXXXXXXXX stereorandom PS rs362306 AACAAC C * A * A * C X WV- GCTGCAA 880 G * C * T * G * C * A * A * C * 1232 XXXXXXXXX All DNA; HTT- 1006 CCTGGCA C * T * G * G * C * A * A * C * XXXXXXXXX stereorandom PS rs362306 ACAACC A * A * C * C X WV- GAGCAGC 881 mG * mA * mG * mC * mA * G 1233 XXXXXXXXX 5-15 (2′-OMe- HTT- 1007 TGCAACC * C * T * G * C * A * A * C * C XXXXXXXXX DNA); rs362306 TGGCAA * T * G * G * C * A * A X stereorandom PS WV- AGCAGCT 882 mA * mG * mC * mA * mG * C 1234 XXXXXXXXX 5-15 (2′-OMe- HTT- 1008 GCAACCT * T * G * C * A * A * C * C * T XXXXXXXXX DNA); rs362306 GGCAAC * G * G * C * A * A * C X stereorandom PS WV- GCAGCTG 883 mG * mC * mA * mG * mC * T 1235 XXXXXXXXX 5-15 (2′-OMe- HTT- 1009 CAACCTG * G * C * A * A * C * C * T * G XXXXXXXXX DNA); rs362306 GCAACA * G * C * A * A * C * A X stereorandom PS WV- CAGCUGC 884 mC * mA * mG * mC * mU * G 1236 XXXXXXXXX 5-15 (2′-OMe- HTT- 1010 AACCTGG * C * A * A * C * C * T * G * G XXXXXXXXX DNA); rs362306 CAACAA * C * A * A * C * A * A X stereorandom PS WV- AGCUGCA 885 mA * mG * mC * mU * mG * C 1237 XXXXXXXXX 5-15 (2′-OMe- HTT- 1011 ACCTGGC * A * A * C * C * T * G * G * C XXXXXXXXX DNA); rs362306 AACAAC * A * A * C * A * A * C X stereorandom PS WV- GCUGCAA 886 mG * mC * mU * mG * mC * A 1238 XXXXXXXXX 5-15 (2′-OMe- HTT- 1012 CCTGGCA * A * C * C * T * G * G * C * A XXXXXXXXX DNA); rs362306 ACAACC * A * C * A * A * C * C X stereorandom PS WV- GAGCAGC 887 mG * mA * mG * mC * mA * G 1239 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1013 TGCAACC * C * T * G * C * A * A * C * C XXXXXXXXX DNA-2′-OMe); rs362306 TGGCAA * T * mG * mG * mC * mA * X stereorandom PS mA WV- AGCAGCT 888 mA * mG * mC * mA * mG * C 1240 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1014 GCAACCT * T * G * C * A * A * C * C * T XXXXXXXXX DNA-2′-OMe); rs362306 GGCAAC * G * mG * mC * mA * mA * X stereorandom PS mC WV- GCAGCTG 889 mG * mC * mA * mG * mC * T 1241 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1015 CAACCTG * G * C * A * A * C * C * T * G XXXXXXXXX DNA-2′-OMe); rs362306 GCAACA * G * mC * mA * mA * mC * X stereorandom PS mA WV- CAGCUGC 890 mC * mA * mG * mC * mU * G 1242 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1016 AACCTGG * C * A * A * C * C * T * G * G XXXXXXXXX DNA-2′-OMe); rs362306 CAACAA * C * mA * mA * mC * mA * X stereorandom PS mA WV- AGCUGCA 891 mA * mG * mC * mU * mG * C 1243 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1017 ACCTGGC * A * A * C * C * T * G * G * C XXXXXXXXX DNA-2′-OMe); rs362306 AACAAC * A * mA * mC * mA * mA * X stereorandom PS mC WV- GCUGCAA 892 mG * mC * mU * mG * mC * A 1244 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1018 CCTGGCA * A * C * C * T * G * G * C * A XXXXXXXXX DNA-2′-OMe); rs362306 ACAACC * A * mC * mA * mA * mC * X stereorandom PS mC WV- GAGCAGC 893 mG * mA * mG * mC * mA * 1245 XXXXXXXXX 7-7-6 (2′-OMe- HTT- 1019 TGCAACC mG * mC * T * G * C * A * A * XXXXXXXXX DNA-2′-OMe); rs362306 UGGCAA C * C * mU * mG * mG * mC * X stereorandom PS mA * mA WV- GAGCAGC 894 mGmAmGmCmAmGmC * T * 1246 OOOOOOXXX 7-7-6 (2′-OMe- HTT- 1020 TGCAACC G * C * A * A * C * C * XXXXXOOOO DNA-2′-OMe); rs362306 UGGCAA mUmGmGmCmAmA O stereorandom PS; PO in wings WV- AGCAGCT 895 mA * mG * mC * mA * mG * 1247 XXXXXXXXX 6-7-5 (2′-OMe- HTT- 1021 GCAACCT mC * T * G * C * A * A * C * C XXXXXXXXX DNA-2′-OMe); rs362306 GGCAAC * T * G * mG * mC * mA * mA X stereorandom PS * mC WV- AGCAGCT 896 mAmGmCmAmGmC * T * G * 1248 OOOOOXXXX 6-7-5 (2′-OMe- HTT- 1022 GCAACCT C * A * A * C * C * T * G * XXXXXXOOO DNA-2′-OMe); rs362306 GGCAAC mGmCmAmAmC O stereorandom PS; PO in the wings WV- GCAGCTG 897 mG * mC * mA * mG * mC * T 1249 XXXXXXXXX 5-7-8 (2′-OMe- HTT- 1023 CAACCUG * G * C * A * A * C * C * mU * XXXXXXXXX DNA-2′-OMe); rs362306 GCAACA mG * mG * mC * mA * mA * X stereorandom PS mC * mA WV- GCAGCTG 898 mGmCmAmGmC * T * G * C * 1250 OOOOXXXXX 5-7-8 (2′-OMe- HTT- 1024 CAACCUG A * A * C * C * XXXOOOOOO DNA-2′-OMe); rs362306 GCAACA mUmGmGmCmAmAmCmA O stereorandom PS; PO in the wings WV- GAGCAGC 899 mGmAmGmCmA * G * C * T * 1251 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1025 TGCAACC G * C * A * A * C * C * T * XXXXXXOOO DNA-2′-OMe); rs362306 TGGCAA mGmGmCmAmA O stereorandom PS; PO in the wings WV- AGCAGCT 900 mAmGmCmAmG * C * T * G * 1252 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1026 GCAACCT C * A * A * C * C * T * G * XXXXXXOOO DNA-2′-OMe); rs362306 GGCAAC mGmCmAmAmC O stereorandom PS; PO in the wings WV- GCAGCTG 901 mGmCmAmGmCT * G * C * A 1253 OOOOOXXXX 5-10-5 (2′-OMe- HTT- 1027 CAACCTG * A * C * C * T * G * G * XXXXXXOOO DNA-2′-OMe); rs362306 GCAACA mCmAmAmCmA O stereorandom PS; PO in the wings WV- CAGCUGC 902 mCmAmGmCmU * G * C * A * 1254 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1028 AACCTGG A * C * C * T * G * G * C * XXXXXXOOO DNA-2′-OMe); rs362306 CAACAA mAmAmCmAmA O stereorandom PS; PO in the wings WV- AGCUGCA 903 mAmGmCmUmG * C * A * A * 1255 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1029 ACCTGGC C * C * T * G * G * C * A * XXXXXXOOO DNA-2′-OMe); rs362306 AACAAC mAmCmAmAmC O stereorandom PS; PO in the wings WV- GCUGCAA 904 mGmCmUmGmC * A * A * C * 1256 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1030 CCTGGCA C * T * G * G * C * A * A * XXXXXXOOO DNA-2′-OMe); rs362306 ACAACC mCmAmAmCmC O stereorandom PS; PO in the wings WV- GGGCCAA 905 G * G * G * C * C * A * A * C * 1257 XXXXXXXXX All DNA; HTT- 1031 CAGCCAG A * G * C * C * A * G * C * C * XXXXXXXXX stereorandom PS rs362268 CCTGCA T * G * C * A X WV- GGCCAAC 906 G * G * C * C * A * A * C * A * 1258 XXXXXXXXX All DNA; HTT- 1032 AGCCAGC G * C * C * A * G * C * C * T * XXXXXXXXX stereorandom PS rs362268 CTGCAG G * C * A * G X WV- GCCAACA 907 G * C * C * A * A * C * A * G * 1259 XXXXXXXXX All DNA; HTT- 1033 GCCAGCC C * C * A * G * C * C * T * G * XXXXXXXXX stereorandom PS rs362268 TGCAGG C * A * G * G X WV- CCAACAG 908 C * C * A * A * C * A * G * C * 1260 XXXXXXXXX All DNA; HTT- 1034 CCAGCCT C * A * G * C * C * T * G * C * XXXXXXXXX stereorandom PS rs362268 GCAGGA A * G * G * A X WV- CAACAGC 909 C * A * A * C * A * G * C * C * 1261 XXXXXXXXX All DNA; HTT- 1035 CAGCCTG A * G * C * C * T * G * C * A * XXXXXXXXX stereorandom PS rs362268 CAGGAG G * G * A * G X WV- AACAGCC 910 A * A * C * A * G * C * C * A * 1262 XXXXXXXXX All DNA; HTT- 1036 AGCCTGC G * C * C * T * G * C * A * G * XXXXXXXXX stereorandom PS rs362268 AGGAGG G * A * G * G X WV- GGGCCAA 911 mG * mG * mG * mC * mC * A 1263 XXXXXXXXX 5-15 (2′-OMe- HTT- 1037 CAGCCAG * A * C * A * G * C * C * A * G XXXXXXXXX DNA); rs362268 CCTGCA * C * C * T * G * C * A X stereorandom PS WV- GGCCAAC 912 mG * mG * mC * mC * mA * A 1264 XXXXXXXXX 5-15 (2′-OMe- HTT- 1038 AGCCAGC * C * A * G * C * C * A * G * C XXXXXXXXX DNA); rs362268 CTGCAG * C * T * G * C * A * G X stereorandom PS WV- GCCAACA 913 mG * mC * mC * mA * mA * C 1265 XXXXXXXXX 5-15 (2′-OMe- HTT- 1039 GCCAGCC * A * G * C * C * A * G * C * C XXXXXXXXX DNA); rs362268 TGCAGG * T * G * C * A * G * G X stereorandom PS WV- CCAACAG 914 mC * mC * mA * mA * mC * A 1266 XXXXXXXXX 5-15 (2′-OMe- HTT- 1040 CCAGCCT * G * C * C * A * G * C * C * T XXXXXXXXX DNA); rs362268 GCAGGA * G * C * A * G * G * A X stereorandom PS WV- CAACAGC 915 mC * mA * mA * mC * mA * G 1267 XXXXXXXXX 5-15 (2′-OMe- HTT- 1041 CAGCCTG * C * C * A * G * C * C * T * G XXXXXXXXX DNA); rs362268 CAGGAG * C * A * G * G * A * G X stereorandom PS WV- AACAGCC 916 mA * mA * mC * mA * mG * C 1268 XXXXXXXXX 5-15 (2′-OMe- HTT- 1042 AGCCTGC * C * A * G * C * C * T * G * C XXXXXXXXX DNA); rs362268 AGGAGG * A * G * G * A * G * G X stereorandom PS WV- GGGCCAA 917 mG * mG * mG * mC * mC * A 1269 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1043 CAGCCAG * A * C * A * G * C * C * A * G XXXXXXXXX DNA-2′-OMe); rs362268 CCUGCA * C * mC * mU * mG * mC * X stereorandom PS mA WV- GGCCAAC 918 mG * mG * mC * mC * mA * A 1270 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1044 AGCCAGC * C * A * G * C * C * A * G * C XXXXXXXXX DNA-2′-OMe); rs362268 CUGCAG * C * mU * mG * mC * mA * X stereorandom PS mG WV- GCCAACA 919 mG * mC * mC * mA * mA * C 1271 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1045 GCCAGCC * A * G * C * C * A * G * C * C XXXXXXXXX DNA-2′-OMe); rs362268 TGCAGG * T * mG * mC * mA * mG * X stereorandom PS mG WV- CCAACAG 920 mC * mC * mA * mA * mC * A 1272 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1046 CCAGCCT * G * C * C * A * G * C * C * T XXXXXXXXX DNA-2′-OMe); rs362268 GCAGGA * G * mC * mA * mG * mG * X stereorandom PS mA WV- CAACAGC 921 mC * mA * mA * mC * mA * G 1273 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1047 CAGCCTG * C * C * A * G * C * C * T * G XXXXXXXXX DNA-2′-OMe); rs362268 CAGGAG * C * mA * mG * mG * mA * X stereorandom PS mG WV- AACAGCC 922 mA * mA * mC * mA * mG * C 1274 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1048 AGCCTGC * C * A * G * C * C * T * G * C XXXXXXXXX DNA-2′-OMe); rs362268 AGGAGG * A * mG * mG * mA * mG * X stereorandom PS mG WV- GGGCCAA 923 mG * mG * mG * mC * mC * 1275 XXXXXXXXX 7-7-6 (2′-OMe- HTT- 1049 CAGCCAG mA * mA * C * A * G * C * C * XXXXXXXXX DNA-2′-OMe); rs362268 CCUGCA A * G * mC * mC * mU * mG * X stereorandom PS mC * mA WV- GGGCCAA 924 mGmGmGmCmCmAmA * C * 1276 OOOOOOXXX 7-7-6 (2′-OMe- HTT- 1050 CAGCCAG A * G * C * C * A * G * XXXXXOOOO DNA-2′-OMe); rs362268 CCUGCA mCmCmUmGmCmA O stereorandom PS; PO in wings WV- GGCCAAC 925 mG * mG * mC * mC * mA * 1277 XXXXXXXXX 6-7-5 (2′-OMe- HTT- 1051 AGCCAGC mA * C * A * G * C * C * A * G XXXXXXXXX DNA-2′-OMe); rs362268 CUGCAG * C * C * mU * mG * mC * mA X stereorandom PS * mG WV- GGCCAAC 926 mGmGmCmCmAmA * C * A * 1278 OOOOOXXXX 6-7-5 (2′-OMe- HTT- 1052 AGCCAGC G * C * C * A * G * C * C * XXXXXXOOO DNA-2′-OMe); rs362268 CUGCAG mUmGmCmAmG O stereorandom PS; PO in the wings WV- GCCAACA 927 mG * mC * mC * mA * mA * C 1279 XXXXXXXXX 5-7-8 (2′-OMe- HTT- 1053 GCCAGCC * A * G * C * C * A * G * mC * XXXXXXXXX DNA-2′-OMe); rs362268 UGCAGG mC * mU * mG * mC * mA * X stereorandom PS mG * mG WV- GCCAACA 928 mGmCmCmAmA * C * A * G * 1280 OOOOXXXXX 5-7-8 (2′-OMe- HTT- 1054 GCCAGCC C * C * A * G * XXXOOOOOO DNA-2′-OMe); rs362268 UGCAGG mCmCmUmGmCmAmGmG O stereorandom PS; PO in the wings WV- GGGCCAA 929 mGmGmGmCmC * A * A * C * 1281 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1055 CAGCCAG A * G * C * C * A * G * C * XXXXXXOOO DNA-2′-OMe); rs362268 CCUGCA mCmUmGmCmA O stereorandom PS; PO in the wings WV- GGCCAAC 930 mGmGmCmCmA * A * C * A * 1282 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1056 AGCCAGC G * C * C * A * G * C * C * XXXXXXOOO DNA-2′-OMe); rs362268 CUGCAG mUmGmCmAmG O stereorandom PS; PO in the wings WV- GCCAACA 931 mGmCmCmAmA * C * A * G * 1283 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1057 GCCAGCC C * C * A * G * C * C * T * XXXXXXOOO DNA-2′-OMe); rs362268 TGCAGG mGmCmAmGmG O stereorandom PS; PO in the wings WV- CCAACAG 932 mCmCmAmAmC * A * G * C * 1284 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1058 CCAGCCT C * A * G * C * C * T * G * XXXXXXOOO DNA-2′-OMe); rs362268 GCAGGA mCmAmGmGmA O stereorandom PS; PO in the wings WV- CAACAGC 933 mCmAmAmCmA * G * C * C * 1285 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1059 CAGCCTG A * G * C * C * T * G * C * XXXXXXOOO DNA-2′-OMe); rs362268 CAGGAG mAmGmGmAmG O stereorandom PS; PO in the wings WV- AACAGCC 934 mAmAmCmAmG * C * C * A * 1286 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1060 AGCCTGC G * C * C * T * G * C * A * XXXXXXOOO DNA-2′-OMe); rs362268 AGGAGG mGmGmAmGmG O stereorandom PS; PO in the wings: HTT-rs362268 WV- GUAGGAG 935 mG * mU * mA * mG * mG * A * 1287 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1061 TAGTGAA * G * T * A * G * T * G * A * A XXXXXXXXX DNA-2′-OMe); rs362268 AGGCCA * A * mG * mG * mC * mC * X stereorandom PS: mA +ve Luciferase control for psiCHECK2; WV- 975 analogue WV- GUAGGAG 936 mGmUmAmGmG * A * G * T * 1288 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1062 TAGTGAA A * G * T * G * A * A * A * XXXXXXOOO DNA-2′-OMe); control AGGCCA mGmGmCmCmA O stereorandom PS; PO in the wings: +ve Luciferase control for psiCHECK2; WV- 975 analogue WV- GUAGGAG 937 mG * mU * mA * mG * mG * A 1289 XXXXXXXXX 5-15 (2′-OMe- HTT- 1063 TAGTGAA * G * T * A * G * T * G * A * A XXXXXXXXX DNA); control AGGCCA * A * G * G * C * C * A X stereorandom PS: +ve Luciferase control for psiCHECK2; WV- 975 analogue WV- CUCUUAC 938 mC * mU * mC * mU * mU * A 1290 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1064 TGTGCTG * C * T * G * T * G * C * T * G XXXXXXXXX DNA-2′-OMe); control TGGACA * T * mG * mG * mA * mC * X stereorandom PS: mA Negative Luciferase control for psiCHECK2; ONT- 67 analogue WV- CUCUUAC 939 mCmUmCmUmU * A * C * T * 1291 OOOOXXXXX 5-10-5 (2′-OMe- HTT- 1065 TGTGCTG G * T * G * C * T * G * T * XXXXXXOOO DNA-2′-OMe); control TGGACA mGmGmAmCmA O stereorandom PS; PO in the wings: Negative Luciferase control for psiCHECK2; ONT- 67 analogue WV- CUCUUAC 940 mC * mU * mC * mU * mU * A 1292 XXXXXXXXX 5-15 (2′-OMe- HTT- 1066 TGTGCTG * C * T * G * T * G * C * T * G XXXXXXXXX DNA); control TGGACA * T * G * G * A * C * A X stereorandom PS: Negative Luciferase control for psiCHECK2; ONT- 67 analogue WV- GGGCACA 941 G * G * G * C * A * C * A * A * 1293 XXXXXXXXX All DNA HTT- 1067 AGGGCAC G * G * G * C * d2AP * C * A * XXXXXXXXX stereorandom; P13 control AGACTT G * A * C * T * T X (2-aminopurine): rs362307; WV-904 analogue WV- GGCACAA 942 G * G * C * A * C * A * A * G * 1294 XXXXXXXXX All DNA rs362307 1068 GGGCACA G * G * C * d2AP * C * A * G * XXXXXXXXX stereorandom; P12 GACTTC A * C * T * T * C X (2-aminopurine): rs362307; WV-905 analogue WV- GCACAAG 943 G * C * A * C * A * A * G * G * 1295 XXXXXXXXX All DNA rs362307 1069 GGCACAG G * C * d2AP * C * A * G * A * XXXXXXXXX stereorandom; P11 ACTTCC C * T * T * C * C X (2-aminopurine): rs362307; WV-906 analogue WV- GGGCACA 944 G * G * G * C * A * C * A * A * 1296 XXXXXXXXX All DNA rs362307 1070 AGGGCAC G * G * G * C * dDAP * C * A * XXXXXXXXX stereorandom; P13 AGACTT G * A * C * T * T X (2;6- diaminopurine): rs362307; WV-904 analogue WV- GGCACAA 945 G * G * C * A * C * A * A * G * 1297 XXXXXXXXX All DNA rs362307 1071 GGGCACA G * G * C * dDAP * C * A * G * XXXXXXXXX stereorandom; P12 GACTTC A * C * T * T * C X (2;6- diaminopurine): rs362307; WV-905 analogue WV- GCACAAG 946 G * C * A * C * A * A * G * G * 1298 XXXXXXXXX All DNA rs362307 1072 GGCACAG G * C * dDAP * C * A * G * A * XXXXXXXXX stereorandom; P12 ACTTCC C * T * T * C * C X (2;6- diaminopurine): rs362307; WV-906 analogue WV- GAGCCUU 947 rGrArGrCrCrUrUrUrGrGrArAr 1299 OOOOOOOOO wtRNA rs362307 1073 UGGAAGU GrUrCrUrGrCrGrCrCrCrUrUrGr OOOOOOOOO CUGCGCC UrGrCrCrCrUrGrCrCrU OOOOOOOOO CUUGUGC OOOOOOO CCUGCCU WV- GAGCCUU 948 rGrArGrCrCrUrUrUrGrGrArAr 1300 OOOOOOOOO muRNA rs362307 1074 UGGAAGU GrUrCrUrGrUrGrCrCrCrUrUrGr OOOOOOOOO CUGUGCC UrGrCrCrCrUrGrCrCrU OOOOOOOOO CUUGUGC OOOOOOO CCUGCCU WV- CACACGG 949 rCrArCrArCrGrGrGrCrArCrArG 1301 OOOOOOOOO Antisense strand: rs362307 1075 GCACAGA rArCrUrUrCrCrArA OOOOOOOOO Positive control; CUUCCAA OO Curr. Bio. Vol 19 No 9; 776 WV- GGAAGUC 950 rGrGrArArGrUrCrUrGrUrGrCr 1302 OOOOOOOOO Sense strand: rs362307 1076 UGUGCCC CrCrGrUrGrUrGrCrC OOOOOOOOO Positive control; GUGUGCC OO Curr. Bio. Vol 19 No 9; 777: Note: incorrectly added as rGrGrArArGrUrCr UrGrUrGrCrCrCrG rUrGrUrUrCrC (SEQ ID NO: 1553) in earlier versions of databse WV- AUUAAUA 951 mA * SmU * SmU * SmA * 1303 SSSSSSSSSSS 6-10-4 (2′-OMe- HTT 1077 AATTGTC SmA * SmU * SA * SA * SA * SSRSSSSS DNA-2′-OMe) rs7685686 ATCACC ST * ST * SG * ST * SC * RA * Gapmer: Analogue ST * SmC * SmA * SmC * SmC of WV-451 WV- AUUAAUA 952 mA * RmU * RmU * RmA * 1304 RRRRRSSSSS 6-10-4 (2′-OMe- HTT 1078 AATTGTC RmA * RmU * SA * SA * SA * SSSRSSRRR DNA-2′-OMe) rs7685686 ATCACC ST * ST * SG * ST * SC * RA * Gapmer: Analogue ST * SmC * RmA * RmC * of WV-451 RmC WV- AUUAAUA 953 mA * SmU * SmU * SmA * 1305 SSSSSSSSSSS 8-12 (2′-OMe- HTT 1079 AATTGTC SmA * SmU * SmA * SmA * SSRSSSSS DNA) hemimer: rs7685686 ATCACC SA * ST * ST * SG * ST * SC * Analogue of WV- RA * ST * SC * SA * SC * SC 451 WV- AUUAAUA 954 mA * RmU * RmU * RmA * 1306 RRRRRRRSSS 8-12 (2′-OMe- HTT 1080 AATTGTC RmA * RmU * RmA * RmA * SSSRSSSSS DNA) hemimer: rs7685686 ATCACC SA * ST * ST * SG * ST * SC * Analogue of WV- RA * ST * SC * SA * SC * SC 451 WV- AUUAAUA 955 mAmUmUmAmAmUmAmA * 1307 OOOOOOOSS 8-12 (2′-OMe- HTT 1081 AATTGTC SA * ST * ST * SG * ST * SC * SSSSRSSSSS DNA) hemimer; rs7685686 ATCACC RA * ST * SC * SA * SC * SC PO wing: Analogue of WV-451 WV- AUUAAUA 956 mAmUmUmAmAmU * SA * 1308 OOOOOSSSSS 6-10-4 (2′-OMe- HTT 1082 AATTGTC SA * SA * ST * ST * SG * ST * SSSRSSOOO DNA-2′-OMe); PO rs7685686 ATCACC SC * RA * ST * SmCmAmCmC wings: Analogue of WV-451 WV- AUUAAUA 957 mA * SmUmUmAmAmU * SA 1309 SOOOOSSSSS 6-10-4 (2′-OMe- HTT 1083 AATTGTC * SA * SA * ST * ST * SG * ST SSSRSSOOS DNA-2′-OMe) rs7685686 ATCACC * SC * RA * ST * SmCmAmC * Gapmer: Analogue SmC of WV-451 WV- AUUAAUA 958 mA * RmUmUmAmAmU * SA 1310 ROOOOSSSSS 6-10-4 (2′-OMe- HTT 1084 AATTGTC * SA * SA * ST * ST * SG * ST SSSRSSOOR DNA-2′-OMe) rs7685686 ATCACC * SC * RA * ST * SmCmAmC * Gapmer: Analogue RmC of WV-451 WV- GGCACAA 959 mG * SmG * SmC * SmA * 1311 SSSSSSSSSSS 5-10-5 (2′-OMe- HTT 1085 GGGCACA SmC * SA * SA * SG * SG * SG SRSSSSSS DNA-2′-OMe) rs362307 GACUUC * SC * SA * SC * RA * SG * Gapmer: Analogue SmA * SmC * SmU * SmU * of WV-905 and SmC WV-937 WV- GGCACAA 960 mG * RmG * RmC * RmA * 1312 RRRRSSSSSSS 5-10-5 (2′-OMe- HTT 1086 GGGCACA RmC * SA * SA * SG * SG * SRSSRRRR DNA-2′-OMe) rs362307 GACUUC SG * SC * SA * SC * RA * SG * Gapmer: Analogue SmA * RmC * RmU * RmU * of WV-905 and RmC WV-937 WV- GGCACAA 961 mGmGmCmAmC * SA * SA * 1313 OOOOSSSSSS 5-10-5 (2′-OMe- HTT 1087 GGGCACA SG * SG * SG * SC * SA * SC * SSRSSOOOO DNA-2′-OMe); PO rs362307 GACUUC RA * SG * SmAmCmUmUmC wings: Analogue of WV-905 and WV- 937 WV- GGCACAA 962 mG * SmG * SmC * SmA * 1314 SSSSSSSSSSS 8-12 (2′-OMe- HTT 1088 GGGCACA SmC * SmA * SmA * SmG * SG SRSSSSSS DNA) hemimer: rs362307 GACTTC * SG * SC * SA * SC * RA * SG Analogue of WV- * SA * SC * ST * ST * SC 905 and WV-937 WV- GGCACAA 963 mG * RmG * RmC * RmA * 1315 RRRRRRRSSS 8-12 (2′-OMe- HTT 1089 GGGCACA RmC * RmA * RmA * RmG * SSRSSSSSS DNA) hemimer: rs362307 GACTTC SG * SG * SC * SA * SC * RA * Analogue of WV- SG * SA * SC * ST * ST * SC 905 and WV-937 WV- GGCACAA 964 mGmGmCmAmCmAmAmG * 1316 OOOOOOOSS 8-12 (2′-OMe- HTT 1090 GGGCACA SG * SG * SC * SA * SC * RA * SSSRSSSSSS DNA) hemimer; rs362307 GACTTC SG * SA * SC * ST * ST * SC PO wing: Analogue of WV-905 and WV-937 WV- GGCACAA 965 mG * RmGmCmAmC * SA * 1317 ROOOSSSSSS 8-12 (2′-OMe- HTT 1091 GGGCACA SA * SG * SG * SG * SC * SA * SSRSSOOOR DNA) gapmer PO rs362307 GACUUC SC * RA * SG * SmAmCmUmU wing: Analogue of * RmC WV-905 and WV- 937: incorrectly added as gsSgcacsSdAsSdAs SdGsSdGsSdGsSd CsSdAsSdCsRdAs SdGsSacuusSc in earlier version of database WV- GGCACAA 966 mG * SmGmCmAmC * SA * 1318 SOOOSSSSSS 8-12 (2′-OMe- HTT 1092 GGGCACA SA * SG * SG * SG * SC * SA * SSRSSOOOS DNA) gapmer PO rs362307 GACUUC SC * RA * SG * SmAmCmUmU wing: Analogue of * SmC WV-905 and WV- 937 WV- GCAGGGC 967 G * C * A * G * G * G * C * A * 1319 XXXXXXXXX Phosphorothioate Huntington 1183 ACAAGGG C * A * A * G * G * G * C * A * XXXXXXXXX DNA; rs362307 CACAGA C * A * G * A X Stereorandom WV- GCAGGGC 968 mG * mC * mA * mG * mG * G 1320 XXXXXXXXX 5-15 (2′-OMe- Huntington 1184 ACAAGGG * C * A * C * A * A * G * G * G XXXXXXXXX DNA) Hemimer rs362307 CACAGA * C * A * C * A * G * A X WV- GCAGGGC 969 mGmCmAmGmG * G * C * A * 1321 OOOOXXXXX 5-15 (2′-OMe- Huntington 1185 ACAAGGG C * A * A * G * G * G * C * A * XXXXXXXXX DNA) Hemimer; rs362307 CACAGA C * A * G * A X PO wing WV- GCAGGGC 970 mG * mC * mA * mG * mG * 1322 XXXXXXXXX 7-13 (2′-OMe- Huntington 1186 ACAAGGG mG * mC * A * C * A * A * G * XXXXXXXXX DNA) Hemimer rs362307 CACAGA G * G * C * A * C * A * G * A X WV- GCAGGGC 971 mGmCmAmGmGmGmC * A * 1323 OOOOOOXXX 7-13 (2′-OMe- Huntington 1187 ACAAGGG C * A * A * G * G * G * C * A * XXXXXXXXX DNA) Hemimer; rs362307 CACAGA C * A * G * A X PO wing WV- CAGGGCA 972 C * A * G * G * G * C * A * C * 1324 XXXXXXXXX Phosphorothioate Huntington 1188 CAAGGGC A * A * G * G * G * C * A * C * XXXXXXXXX DNA; rs362307 ACAGAC A * G * A * C X Stereorandom WV- CAGGGCA 973 mC * mA * mG * mG * mG * C 1325 XXXXXXXXX 5-15 (2′-OMe- Huntington 1189 CAAGGGC * A * C * A * A * G * G * G * C XXXXXXXXX DNA) Hemimer rs362307 ACAGAC * A * C * A * G * A * C X WV- CAGGGCA 974 mCmAmGmGmG * C * A * C * 1326 OOOOXXXXX 5-15 (2′-OMe- Huntington 1190 CAAGGGC A * A * G * G * G * C * A * C * XXXXXXXXX DNA) Hemimer; rs362307 ACAGAC A * G * A * C X PO wing WV- CAGGGCA 975 mC * mA * mG * mG * mG * 1327 XXXXXXXXX 7-13 (2′-OMe- Huntington 1191 CAAGGGC mC * mA * C * A * A * G * G * XXXXXXXXX DNA) Hemimer rs362307 ACAGAC G * C * A * mC * mA * mG * X mA * mC WV- CAGGGCA 976 mCmAmGmGmGmCmA * C * 1328 OOOOOOXXX 7-13 (2′-OMe- Huntington 1192 CAAGGGC A * A * G * G * G * C * A * XXXXXXOOO DNA) Hemimer; rs362307 ACAGAC mCmAmGmAmC O PO wing WV- AGGGCAC 977 A * G * G * G * C * A * C * A * 1329 XXXXXXXXX Phosphorothioate Huntington 1193 AAGGGCA A * G * G * G * C * A * C * A * XXXXXXXXX DNA; rs362307 CAGACT G * A * C * T X Stereorandom WV- AGGGCAC 978 mA * mG * mG * mG * mC * A 1330 XXXXXXXXX 5-15 (2′-OMe- Huntington 1194 AAGGGCA * C * A * A * G * G * G * C * A XXXXXXXXX DNA) Hemimer rs362307 CAGACT * C * A * G * A * C * T X WV- AGGGCAC 979 mAmGmGmGmC * A * C * A * 1331 OOOOXXXXX 5-15 (2′-OMe- Huntington 1195 AAGGGCA A * G * G * G * C * A * C * A * XXXXXXXXX DNA) Hemimer; rs362307 CAGACT G * A * C * T X PO wing WV- AGGGCAC 980 mA * mG * mG * mG * mC * 1332 XXXXXXXXX 7-12-1 (2′-OMe- Huntington 1196 AAGGGCA mA * mC * A * A * G * G * G * XXXXXXXXX DNA-2′-DNA) rs362307 CAGACU C * A * C * A * G * A * C * mU X Gapmer WV- AGGGCAC 981 mAmGmGmGmCmAmC * A * 1333 OOOOOOXXX 7-12-1 (2′-OMe- Huntington 1197 AAGGGCA A * G * G * G * C * A * C * A * XXXXXXXXX DNA-2′-DNA) rs362307 CAGACU G * A * C * mU X Gapmer; PO wings WV- AAGGGCA 982 A * A * G * G * G * C * A * C * 1334 XXXXXXXXX Phosphorothioate Huntington 1198 CAGACTT A * G * A * C * T * T * C * C * XXXXXXXXX DNA; rs362307 CCAAAG A * A * A * G X Stereorandom WV- AAGGGCA 983 mA * mA * mG * mG * mG * C 1335 XXXXXXXXX 5-15 (2′-OMe- Huntington 1199 CAGACTT * A * C * A * G * A * C * T * T XXXXXXXXX DNA) Hemimer rs362307 CCAAAG * C * C * A * A * A * G X WV- AAGGGCA 984 mAmAmGmGmG * C * A * C * 1336 OOOOXXXXX 5-15 (2′-OMe- Huntington 1200 CAGACTT A * G * A * C * T * T * C * C * XXXXXXXXX DNA) Hemimer; rs362307 CCAAAG A * A * A * G X PO wing WV- AAGGGCA 985 mA * mA * mG * mG * mG * C 1337 XXXXXXXXX 5-10-5 (2′-OMe- Huntington 1201 CAGACTT * A * C * A * G * A * C * T * T XXXXXXXXX DNA-2′-DNA) rs362307 CCAAAG * C * mC * mA * mA * mA * X Gapmer mG WV- AAGGGCA 986 mAmAmGmGmG * C * A * C * 1338 OOOOXXXXX 5-10-5 (2′-OMe- Huntington 1202 CAGACTT A * G * A * C * T * T * C * XXXXXXOOO DNA-2′-DNA) rs362307 CCAAAG mCmAmAmAmG O Gapmer; PO wings WV- AAGGGCA 987 mA * mA * mG * mG * G * C * 1339 XXXXXXXXX 4-10-6 (2′-OMe- Huntington 1203 CAGACTT A * C * A * G * A * C * T * T * XXXXXXXXX DNA-2′-DNA) rs362307 CCAAAG mC * mC * mA * mA * mA * X Gapmer mG WV- AAGGGCA 988 mAmAmGmGG * C * A * C * 1340 OOOOXXXXX 4-10-6 (2′-OMe- Huntington 1204 CAGACTT A * G * A * C * T * T * XXXXXOOOO DNA-2′-DNA) rs362307 CCAAAG mCmCmAmAmAmG O Gapmer; PO wings WV- AGGGCAC 989 A * G * G * G * C * A * C * A * 1341 XXXXXXXXX Phosphorothioate Huntington 1205 AGACTTC G * A * C * T * T * C * C * A * XXXXXXXXX DNA; rs362307 CAAAGG A * A * G * G X Stereorandom WV- AGGGCAC 990 mA * mG * mG * mG * mC * A 1342 XXXXXXXXX 5-15 (2′-OMe- Huntington 1206 AGACTTC * C * A * G * A * C * T * T * C XXXXXXXXX DNA) Hemimer rs362307 CAAAGG * C * A * A * A * G * G X WV- AGGGCAC 991 mAmGmGmGmC * A * C * A * 1343 OOOOXXXXX 5-15 (2′-OMe- Huntington 1207 AGACTTC G * A * C * T * T * C * C * A * XXXXXXXXX DNA) Hemimer; rs362307 CAAAGG A * A * G * G X PO wing WV- AGGGCAC 992 mA * mG * mG * mG * mC * A 1344 XXXXXXXXX 5-10-5 (2′-OMe- Huntington 1208 AGACTTC * C * A * G * A * C * T * T * C XXXXXXXXX DNA-2′-DNA) rs362307 CAAAGG * C * mA * mA * mA * mG * X Gapmer mG WV- AGGGCAC 993 mAmGmGmGmC * A * C * A * 1345 OOOOXXXXX 5-10-5 (2′-OMe- Huntington 1209 AGACTTC G * A * C * T * T * C * C * XXXXXXOOO DNA-2′-DNA) rs362307 CAAAGG mAmAmAmGmG O Gapmer; PO wings WV- AGGGCAC 994 mA * mG * mG * mG * C * A * 1346 XXXXXXXXX 4-10-6 (2′-OMe- Huntington 1210 AGACTTC C * A * G * A * C * T * T * C * XXXXXXXXX DNA-2′-DNA) rs362307 CAAAGG mC * mA * mA * mA * mG * X Gapmer mG WV- AGGGCAC 995 mAmGmGmG * C * A * C * A 1347 OOOXXXXXX 4-10-6 (2′-OMe- Huntington 1211 AGACTTC * G * A * C * T * T * C * XXXXXOOOO DNA-2′-DNA) rs362307 CAAAGG mCmAmAmAmGmG O Gapmer; PO wings WV- GGGCACA 996 G * G * G * C * A * C * A * G * 1348 XXXXXXXXX Phosphorothioate Huntington 1212 GACTTCC A * C * T * T * C * C * A * A * XXXXXXXXX DNA; rs362307 AAAGGC A * G * G * C X Stereorandom WV- GGGCACA 997 mG * mG * mG * mC * mA * C 1349 XXXXXXXXX 4-16 (2′-OMe- Huntington 1213 GACTTCC * A * G * A * C * T * T * C * C XXXXXXXXX DNA) Hemimer rs362307 AAAGGC * A * A * A * G * G * C X WV- GGGCACA 998 mGmGmGmCmA * C * A * G * 1350 OOOOXXXXX 4-16 (2′-OMe- Huntington 1214 GACTTCC A * C * T * T * C * C * A * A * XXXXXXXXX DNA) Hemimer; rs362307 AAAGGC A * G * G * C X PO wing WV- GGGCACA 999 mG * mG * mG * mC * mA * C 1351 XXXXXXXXX 4-10-6 (2′-OMe- Huntington 1215 GACTTCC * A * G * A * C * T * T * C * C XXXXXXXXX DNA-2′-DNA) rs362307 AAAGGC * A * mA * mA * mG * mG * X Gapmer mC WV- GGGCACA 1000 mGmGmGmCmA * C * A * G * 1352 OOOOXXXXX 4-10-6 (2′-OMe- Huntington 1216 GACTTCC A * C * T * T * C * C * A * XXXXXXOOO DNA-2′-DNA) rs362307 AAAGGC mAmAmGmGmC O Gapmer; PO wings WV- GGCACAA 1001 mG * mG * mC * mA * mC * A 1353 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1234 GGGCACA * A * G * G * G * C * A * C * A XXXXXXXXX DNA-2′-OMe) rs362307 GACUTC * G * mA * mC * mU * BrdU * X Gapmer; One Br- mC dU WV- GGCACAA 1002 mG * mG * mC * mA * mC * A 1354 XXXXXXXXX 5-10-5 (2′-OMe- HTT- 1235 GGGCACA * A * G * G * G * C * A * C * A XXXXXXXXX DNA-2′-OMe) rs362307 GACTTC * G * mA * mC * BrdU * BrdU X Gapmer; two Br-dU * mC WV- GGCACAA 1003 mG * mGmCmAmC * A * A * 1355 XOOOXXXXX stereo random HTT 1497 GGGCACA G * G * G * C * A * C * A * G * XXXXXXOOO version of WV- rs362307 GACUUC mAmCmUmU * mC X 1092 WV- AUUAAUA 1004 A * SmUmUmAmAmU * SA * 1356 SOOOOSSSSS 1-5-10-3-1 HTT 1508 AATTGTC SA * SA * ST * ST * SG * ST * SSSRSSOOS (DNA/2′-OMe) rs7685686 ATCACC SC * RA * ST * SmCmAmC * Gapmer: : SC Analogue of WV- 1083 WV- AUUAAUA 1005 A * mUmUmAmAmU * A * A * 1357 XOOOOXXXX 1-5-10-3-1 HTT 1509 AATTGTC A * T * T * G * T * C * A * T * XXXXXXXOO (DNA/2′-OMe) rs7685686 ATCACC mCmAmC * C X Gapmer; 1st and last PS: : Analogue of WV-1083 WV- GGCACAA 1006 G * SmGmCmAmC * SA * SA * 1358 SOOOSSSSSS 1-4-10-4-1 HTT 1510 GGGCACA SG * SG * SG * SC * SA * SC * SSRSSOOOS (DNA/2′-OMe) rs362307 GACUUC RA * SG * SmAmCmUmU * SC gapmer: : Analogue of WV-1092 WV- GGCACAA 1007 G * mGmCmAmC * A * A * G 1359 XOOOXXXXX 1-4-10-4-1 HTT 1511 GGGCACA * G * G * C * A * C * A * G * XXXXXXOOO (DNA/2′-OMe) rs362307 GACUUC mAmCmUmU * C X gapmer; 1st and last PS: : Analogue of WV-1092 WV- GGCACAA 1008 Geo * Geo * m5Ceo * Aeo * 1360 XXXXXXXXX 5-10-5; 2′-OMOE HTT 1654 GGGCACA m5Ceo * A * A * G * G * G * C XXXXXXXXX gapmer; All PS rs362307 GACTTC * A * C * A * G * Aeo * m5Ceo X * Teo * Teo * m5Ceo WV- GGCACAA 1009 Geo * Geom5CeoAeom5Ceo * A 1361 XOOOXXXXX 5-10-5; 2′-OMOE HTT 1655 GGGCACA * A * G * G * G * C * A * C * A XXXXXXOOO gapmer; 1st and last rs362307 GACTTC * G * Aeom5CeoTeoTeo * X PS in the wing; rest m5Ceo of the wing is PO WV- CTCAGTA 1010 m5Ceo * Teo * m5Ceo * Aeo * 1362 XXXXXXXXX 5-10-5; 2′-OMOE Huntington 1656 ACATTGA Geo * T * A * A * C * A * T * T XXXXXXXXX gapmer; All PS CACCAC * G * A * C * Aeo * m5Ceo * X m5Ceo * Aeo * m5Ceo WV- CUCAGTA 1011 mC * mU * mC * mA * mG * T 1363 XXXXXXXXX 5-10-5; 2′-OMe Huntington 1657 ACATTGA * A * A * C * A * T * T * G * A XXXXXXXXX gapmer; All PS CACCAC * C * mA * mC * mC * mA * X mC WV- GGCACAA 1012 mG * mGmCmAmC * A * A * 1364 XOOOXXXXX 5/10/5 2′Ome HTT 1788 GGGCACA G * G * G * C * A * C * A * G * XXXXXXOOX Gapmer BrdU PO GACUTC mAmCmU * BrdU * mC X wings WV- CTCAGTA 1013 mC * BrdU * mC * mA * mG * 1365 XXXXXXXXX 5/10/5 2′Ome HTT 1789 ACATTGA T * A * A * C * A * T * T * G * XXXXXXXXX Gapmer BrdU CACCAC A * C * mA * mC * mC * mA * X mC WV- CTCAGTA 1014 mC * BrdU * mCmAmG * T * A 1366 XXOOXXXXX 5/10/5 2′Ome HTT 1790 ACATTGA * A * C * A * T * T * G * A * C XXXXXXOOO Gapmer BrdU PO CACCAC * mAmCmCmA * mC X wings WV- GAAGUCU 1015 rGrArArGrUrCrUrGrUrGrCrCrC 1367 OOOOOOOOO RNA HTT 1799 GUGCCCU rUrUrGrUrGrCrC OOOOOOOOO complementary to UGUGCC O WV1092 WV- GGCACAA 1016 mG * SmGmCmAmC * SA * 1368 SOOOSSSSSS BrdU version of HTT 2022 GGGCACA SA * SG * SG * SG * SC * SA * SSRSSOOSS WV-1092 rs362307 GACUTC SC * RA * SG * SmAmCmU * SBrdU * SmC WV- TGTCATC 1017 T * G * T * C * A * T * C * A * 1369 XXXXXXXXX 15-5 hemimer full rs7685686 2023 ACCAGAA C * C * A * G * A * A * A * mA XXXXXXXXX PS (A/G) AAAGUC * mA * mG * mU * mC X WV- UTGTCAT 1018 mU * T * G * T * C * A * T * C 1370 XXXXXXXXX 1-14-5 gapmer full rs7685686 2024 CACCAGA * A * C * C * A * G * A * A * XXXXXXXXX PS (A/G) AAAAGU mA * mA * mA * mG * mU X WV- TTGTCAT 1019 T * T * G * T * C * A * T * C * 1371 XXXXXXXXX 15-5 hemimer full rs7685686 2025 CACCAGA A * C * C * A * G * A * A * mA XXXXXXXXX PS (A/G) AAAAGU * mA * mA * mG * mU X WV- AUTGTCA 1020 mA * mU * T * G * T * C * A * 1372 XXXXXXXXX 2-13-5 gapmer full rs7685686 2026 TCACCAG T * C * A * C * C * A * G * A * XXXXXXXXX PS (A/G) AAAAAG mA * mA * mA * mA * mG X WV- ATTGTCA 1021 mA * T * T * G * T * C * A * T 1373 XXXXXXXXX 1-14-5 gapmer full rs7685686 2027 TCACCAG * C * A * C * C * A * G * A * XXXXXXXXX PS (A/G) AAAAAG mA * mA * mA * mA * mG X WV- AAUTGTC 1022 mA * mA * mU * T * G * T * C 1374 XXXXXXXXX 3-12-5 gapmer full rs7685686 2028 ATCACCA * A * T * C * A * C * C * A * G XXXXXXXXX PS (A/G) GAAAAA * mA * mA * mA * mA * mA X WV- AATTGTC 1023 mA * mA * T * T * G * T * C * 1375 XXXXXXXXX 2-13-5 gapmer full rs7685686 2029 ATCACCA A * T * C * A * C * C * A * G * XXXXXXXXX PS (A/G) GAAAAA mA * mA * mA * mA * mA X WV- AAATTGT 1024 mA * mA * mA * T * T * G * T 1376 XXXXXXXXX 3-12-5 gapmer full rs7685686 2030 CATCACC * C * A * T * C * A * C * C * A XXXXXXXXX PS (A/G) AGAAAA * mG * mA * mA * mA * mA X WV- AAAUTGT 1025 mA * mA * mA * mU * T * G * 1377 XXXXXXXXX 4-11-5 gapmer full rs7685686 2031 CATCACC T * C * A * T * C * A * C * C * XXXXXXXXX PS (A/G) AGAAAA A * mG * mA * mA * mA * mA X WV- UAAAUTG 1026 mU * mA * mA * mA * mU * T 1378 XXXXXXXXX 5-11-4 gapmer full rs7685686 2032 TCATCAC * G * T * C * A * T * C * A * C XXXXXXXXX PS (A/G) CAGAAA * C * A * mG * mA * mA * mA X WV- UAAAUTG 1027 mU * mA * mA * mA * mU * T 1379 XXXXXXXXX 5-10-5 gapmer full rs7685686 2033 TCATCAC * G * T * C * A * T * C * A * C XXXXXXXXX PS (A/G) CAGAAA * C * mA * mG * mA * mA * X mA WV- AUAAATT 1028 mA * mU * mA * mA * mA * T 1380 XXXXXXXXX 5-11-4 gapmer full rs7685686 2034 GTCATCA * T * G * T * C * A * T * C * A XXXXXXXXX PS (A/G) CCAGAA * C * C * mA * mG * mA * mA X WV- AUAAATT 1029 mA * mU * mA * mA * mA * T 1381 XXXXXXXXX 5-10-5 gapmer full rs7685686 2035 GTCATCA * T * G * T * C * A * T * C * A XXXXXXXXX PS (A/G) CCAGAA * C * mC * mA * mG * mA * X mA WV- AAUAAAT 1030 mA * mA * mU * mA * mA * A 1382 XXXXXXXXX 5-12-3 gapmer full rs7685686 2036 TGTCATC * T * T * G * T * C * A * T * C XXXXXXXXX PS (A/G) ACCAGA * A * C * C * mA * mG * mA X WV- AAUAAAT 1031 mA * mA * mU * mA * mA * A 1383 XXXXXXXXX 5-11-4 gapmer full rs7685686 2037 TGTCATC * T * T * G * T * C * A * T * C XXXXXXXXX PS (A/G) ACCAGA * A * C * mC * mA * mG * mA X WV- AAUAAAT 1032 mA * mA * mU * mA * mA * A 1384 XXXXXXXXX 5-10-5 gapmer full rs7685686 2038 TGTCATC * T * T * G * T * C * A * T * C XXXXXXXXX PS (A/G) ACCAGA * A * mC * mC * mA * mG * X mA WV- UAAUAAA 1033 mU * mA * mA * mU * mA * A 1385 XXXXXXXXX 5-13-2 gapmer full rs7685686 2039 TTGTCAT * A * T * T * G * T * C * A * T XXXXXXXXX PS (A/G) CACCAG * C * A * C * C * mA * mG X WV- UAAUAAA 1034 mU * mA * mA * mU * mA * A 1386 XXXXXXXXX 5-12-3 gapmer full rs7685686 2040 TTGTCAT * A * T * T * G * T * C * A * T XXXXXXXXX PS (A/G) CACCAG * C * A * C * mC * mA * mG X WV- UAAUAAA 1035 mU * mA * mA * mU * mA * A 1387 XXXXXXXXX 5-11-4 gapmer full rs7685686 2041 TTGTCAT * A * T * T * G * T * C * A * T XXXXXXXXX PS (A/G) CACCAG * C * A * mC * mC * mA * mG X WV- UAAUAAA 1036 mU * mA * mA * mU * mA * A 1388 XXXXXXXXX 5-10-5 gapmer full rs7685686 2042 TTGTCAT * A * T * T * G * T * C * A * T XXXXXXXXX PS (A/G) CACCAG * C * mA * mC * mC * mA * X mG WV- UUAAUAA 1037 mU * mU * mA * mA * mU * A 1389 XXXXXXXXX 5-14-1 gapmer full rs7685686 2043 ATTGTCA * A * A * T * T * G * T * C * A XXXXXXXXX PS (A/G) TCACCA * T * C * A * C * C * mA X WV- UUAAUAA 1038 mU * mU * mA * mA * mU * A 1390 XXXXXXXXX 5-13-2 gapmer full rs7685686 2044 ATTGTCA * A * A * T * T * G * T * C * A XXXXXXXXX PS (A/G) TCACCA * T * C * A * C * mC * mA X WV- UUAAUAA 1039 mU * mU * mA * mA * mU * A 1391 XXXXXXXXX 5-12-3 gapmer full rs7685686 2045 ATTGTCA * A * A * T * T * G * T * C * A XXXXXXXXX PS (A/G) TCACCA * T * C * A * mC * mC * mA X WV- UUAAUAA 1040 mU * mU * mA * mA * mU * A 1392 XXXXXXXXX 5-11-4 gapmer full rs7685686 2046 ATTGTCA * A * A * T * T * G * T * C * A XXXXXXXXX PS (A/G) TCACCA * T * C * mA * mC * mC * mA X WV- AUUAATA 1041 mA * mU * mU * mA * mA * T 1393 XXXXXXXXX 5-15 hemimer full rs7685686 2047 AATTGTC * A * A * A * T * T * G * T * C XXXXXXXXX PS (A/G) ATCACC * A * T * C * A * C * C X WV- AUUAATA 1042 mA * mU * mU * mA * mA * T 1394 XXXXXXXXX 5-14-1 gapmer full rs7685686 2048 AATTGTC * A * A * A * T * T * G * T * C XXXXXXXXX PS (A/G) ATCACC * A * T * C * A * C * mC X WV- AUUAATA 1043 mA * mU * mU * mA * mA * T 1395 XXXXXXXXX 5-13-2 gapmer full rs7685686 2049 AATTGTC * A * A * A * T * T * G * T * C XXXXXXXXX PS (A/G) ATCACC * A * T * C * A * mC * mC X WV- AUUAATA 1044 mA * mU * mU * mA * mA * T 1396 XXXXXXXXX 5-12-3 gapmer full rs7685686 2050 AATTGTC * A * A * A * T * T * G * T * C XXXXXXXXX PS (A/G) ATCACC * A * T * C * mA * mC * mC X WV- UAUUAAT 1045 mU * mA * mU * mU * mA * A 1397 XXXXXXXXX 5-15 hemimer full rs7685686 2051 AAATTGT * T * A * A * A * T * T * G * T XXXXXXXXX PS (A/G) CATCAC * C * A * T * C * A * C X WV- UAUUAAT 1046 mU * mA * mU * mU * mA * A 1398 XXXXXXXXX 5-14-1 gapmer full rs7685686 2052 AAATTGT * T * A * A * A * T * T * G * T XXXXXXXXX PS (A/G) CATCAC * C * A * T * C * A * mC X WV- UAUUAAT 1047 mU * mA * mU * mU * mA * A 1399 XXXXXXXXX 5-13-2 gapmer full rs7685686 2053 AAATTGT * T * A * A * A * T * T * G * T XXXXXXXXX PS (A/G) CATCAC * C * A * T * C * mA * mC X WV- CUAUUAA 1048 mC * mU * mA * mU * mU * A 1400 XXXXXXXXX 5-15 hemimer full rs7685686 2054 TAAATTG * A * T * A * A * A * T * T * G XXXXXXXXX PS (A/G) TCATCA * T * C * A * T * C * A X WV- CUAUUAA 1049 mC * mU * mA * mU * mU * A 1401 XXXXXXXXX 5-14-1 gapmer full rs7685686 2055 TAAATTG * A * T * A * A * A * T * T * G XXXXXXXXX PS (A/G) TCATCA * T * C * A * T * C * mA X WV- ACUAUTA 1050 mA * mC * mU * mA * mU * T 1402 XXXXXXXXX 5-15 hemimer full rs7685686 2056 ATAAATT * A * A * T * A * A * A * T * T XXXXXXXXX PS (A/G) GTCATC * G * T * C * A * T * C X WV- TGTCATC 1051 T * G * T * C * A * T * C * A * 1403 XXXXXXXXX 15-5 hemimer 1 PS rs7685686 2057 ACCAGAA C * C * A * G * A * A * A * XXXXXXOOO on each end and (A/G) AAAGUC mAmAmGmU * mC X between dN-mN and dN-dN WV- UTGTCAT 1052 mU * T * G * T * C * A * T * C 1404 XXXXXXXXX 1-14-5 gapmer 1 rs7685686 2058 CACCAGA * A * C * C * A * G * A * A * XXXXXXOOO PS on each end and (A/G) AAAAGU mAmAmAmG * mU X between dN-mN and dN-dN WV- TTGTCAT 1053 T * T * G * T * C * A * T * C * 1405 XXXXXXXXX 15-5 hemimer 1 PS rs7685686 2059 CACCAGA A * C * C * A * G * A * A * XXXXXXOOO on each end and (A/G) AAAAGU mAmAmAmG * mU X between dN-mN and dN-dN WV- AUTGTCA 1054 mA * mU * T * G * T * C * A * 1406 XXXXXXXXX 2-13-5 gapmer 1 rs7685686 2060 TCACCAG T * C * A * C * C * A * G * A * XXXXXXOOO PS on each end and (A/G) AAAAAG mAmAmAmA * mG X between dN-mN and dN-dN WV- ATTGTCA 1055 mA * T * T * G * T * C * A * T 1407 XXXXXXXXX 1-14-5 gapmer 1 rs7685686 2061 TCACCAG * C * A * C * C * A * G * A * XXXXXXOOO PS on each end and (A/G) AAAAAG mAmAmAmA * mG X between dN-mN and dN-dN WV- AAUTGTC 1056 mA * mAmU * T * G * T * C * 1408 XOXXXXXXX 3-12-5 gapmer 1 rs7685686 2062 ATCACCA A * T * C * A * C * C * A * G * XXXXXXOOO PS on each end and (A/G) GAAAAA mAmAmAmA * mA X between dN-mN and dN-dN WV- AATTGTC 1057 mA * mA * T * T * G * T * C * 1409 XXXXXXXXX 2-13-5 gapmer 1 rs7685686 2063 ATCACCA A * T * C * A * C * C * A * G * XXXXXXOOO PS on each end and (A/G) GAAAAA mAmAmAmA * mA X between dN-mN and dN-dN WV- AAATTGT 1058 mA * mAmA * T * T * G * T * 1410 XOXXXXXXX 3-12-5 gapmer 1 rs7685686 2064 CATCACC C * A * T * C * A * C * C * A * XXXXXXOOO PS on each end and (A/G) AGAAAA mGmAmAmA * mA X between dN-mN and dN-dN WV- AAAUTGT 1059 mA * mAmAmU * T * G * T * 1411 XOOXXXXXX 4-11-5 gapmer 1 rs7685686 2065 CATCACC C * A * T * C * A * C * C * A * XXXXXXOOO PS on each end and (A/G) AGAAAA mGmAmAmA * mA X between dN-mN and dN-dN WV- UAAAUTG 1060 mU * mAmAmAmU * T * G * T 1412 XOOOXXXXX 5-11-4 gapmer 1 rs7685686 2066 TCATCAC * C * A * T * C * A * C * C * A XXXXXXXOO PS on each end and (A/G) CAGAAA * mGmAmA * mA X between dN-mN and dN-dN WV- UAAAUTG 1061 mU * mAmAmAmU * T * G * T 1413 XOOOXXXXX 5-10-5 gapmer 1 rs7685686 2067 TCATCAC * C * A * T * C * A * C * C * XXXXXXOOO PS on each end and (A/G) CAGAAA mAmGmAmA * mA X between dN-mN and dN-dN WV- AUAAATT 1062 mA * mUmAmAmA * T * T * G 1414 XOOOXXXXX 5-11-4 gapmer 1 rs7685686 2068 GTCATCA * T * C * A * T * C * A * C * C XXXXXXXOO PS on each end and (A/G) CCAGAA * mAmGmA * mA X between dN-mN and dN-dN WV- AUAAATT 1063 mA * mUmAmAmA * T * T * G 1415 XOOOXXXXX 5-10-5 gapmer 1 rs7685686 2069 GTCATCA * T * C * A * T * C * A * C * XXXXXXOOO PS on each end and (A/G) CCAGAA mCmAmGmA * mA X between dN-mN and dN-dN WV- AAUAAAT 1064 mA * mAmUmAmA * A * T * T 1416 XOOOXXXXX 5-12-3 gapmer 1 rs7685686 2070 TGTCATC * G * T * C * A * T * C * A * C XXXXXXXXO PS on each end and (A/G) ACCAGA * C * mAmG * mA X between dN-mN and dN-dN WV- AAUAAAT 1065 mA * mAmUmAmA * A * T * T 1417 XOOOXXXXX 5-11-4 gapmer 1 rs7685686 2071 TGTCATC * G * T * C * A * T * C * A * C XXXXXXXOO PS on each end and (A/G) ACCAGA * mCmAmG * mA X between dN-mN and dN-dN WV- AAUAAAT 1066 mA * mAmUmAmA * A * T * T 1418 XOOOXXXXX 5-10-5 gapmer 1 rs7685686 2072 TGTCATC * G * T * C * A * T * C * A * XXXXXXOOO PS on each end and (A/G) ACCAGA mCmCmAmG * mA X between dN-mN and dN-dN WV- UAAUAAA 1067 mU * mAmAmUmA * A * A * 1419 XOOOXXXXX 5-13-2 gapmer 1 rs7685686 2073 TTGTCAT T * T * G * T * C * A * T * C * XXXXXXXXX PS on each end and (A/G) CACCAG A * C * C * mA * mG X between dN-mN and dN-dN WV- UAAUAAA 1068 mU * mAmAmUmA * A * A * 1420 XOOOXXXXX 5-12-3 gapmer 1 rs7685686 2074 TTGTCAT T * T * G * T * C * A * T * C * XXXXXXXXO PS on each end and (A/G) CACCAG A * C * mCmA * mG X between dN-mN and dN-dN WV- UAAUAAA 1069 mU * mAmAmUmA * A * A * 1421 XOOOXXXXX 5-11-4 gapmer 1 rs7685686 2075 TTGTCAT T * T * G * T * C * A * T * C * XXXXXXXOO PS on each end and (A/G) CACCAG A * mCmCmA * mG X between dN-mN and dN-dN WV- UAAUAAA 1070 mU * mAmAmUmA * A * A * 1422 XOOOXXXXX 5-10-5 gapmer 1 rs7685686 2076 TTGTCAT T * T * G * T * C * A * T * C * XXXXXXOOO PS on each end and (A/G) CACCAG mAmCmCmA * mG X between dN-mN and dN-dN WV- UUAAUAA 1071 mU * mUmAmAmU * A * A * 1423 XOOOXXXXX 5-14-1 gapmer 1 rs7685686 2077 ATTGTCA A * T * T * G * T * C * A * T * XXXXXXXXX PS on each end and (A/G) TCACCA C * A * C * C * mA X between dN-mN and dN-dN WV- UUAAUAA 1072 mU * mUmAmAmU * A * A * 1424 XOOOXXXXX 5-13-2 gapmer 1 rs7685686 2078 ATTGTCA A * T * T * G * T * C * A * T * XXXXXXXXX PS on each end and (A/G) TCACCA C * A * C * mC * mA X between dN-mN and dN-dN WV- UUAAUAA 1073 mU * mUmAmAmU * A * A * 1425 XOOOXXXXX 5-12-3 gapmer 1 rs7685686 2079 ATTGTCA A * T * T * G * T * C * A * T * XXXXXXXXO PS on each end and (A/G) TCACCA C * A * mCmC * mA X between dN-mN and dN-dN WV- UUAAUAA 1074 mU * mUmAmAmU * A * A * 1426 XOOOXXXXX 5-11-4 gapmer 1 rs7685686 2080 ATTGTCA A * T * T * G * T * C * A * T * XXXXXXXOO PS on each end and (A/G) TCACCA C * mAmCmC * mA X between dN-mN and dN-dN WV- AUUAATA 1075 mA * mUmUmAmA * T * A * 1427 XOOOXXXXX 5-15 hemimer 1 PS rs7685686 2081 AATTGTC A * A * T * T * G * T * C * A * XXXXXXXXX on each end and (A/G) ATCACC T * C * A * C * C X between dN-mN and dN-dN WV- AUUAATA 1076 mA * mUmUmAmA * T * A * 1428 XOOOXXXXX 5-14-1 gapmer 1 rs7685686 2082 AATTGTC A * A * T * T * G * T * C * A * XXXXXXXXX PS on each end and (A/G) ATCACC T * C * A * C * mC X between dN-mN and dN-dN WV- AUUAATA 1077 mA * mUmUmAmA * T * A * 1429 XOOOXXXXX 5-13-2 gapmer 1 rs7685686 2083 AATTGTC A * A * T * T * G * T * C * A * XXXXXXXXX PS on each end and (A/G) ATCACC T * C * A * mC * mC X between dN-mN and dN-dN WV- AUUAATA 1078 mA * mUmUmAmA * T * A * 1430 XOOOXXXXX 5-12-3 gapmer 1 rs7685686 2084 AATTGTC A * A * T * T * G * T * C * A * XXXXXXXXO PS on each end and (A/G) ATCACC T * C * mAmC * mC X between dN-mN and dN-dN WV- UAUUAAT 1079 mU * mAmUmUmA * A * T * 1431 XOOOXXXXX 5-15 hemimer 1 PS rs7685686 2085 AAATTGT A * A * A * T * T * G * T * C * XXXXXXXXX on each end and (A/G) CATCAC A * T * C * A * C X between dN-mN and dN-dN WV- UAUUAAT 1080 mU * mAmUmUmA * A * T * 1432 XOOOXXXXX 5-14-1 gapmer 1 rs7685686 2086 AAATTGT A * A * A * T * T * G * T * C * XXXXXXXXX PS on each end and (A/G) CATCAC A * T * C * A * mC X between dN-mN and dN-dN WV- UAUUAAT 1081 mU * mAmUmUmA * A * T * 1433 XOOOXXXXX 5-13-2 gapmer 1 rs7685686 2087 AAATTGT A * A * A * T * T * G * T * C * XXXXXXXXX PS on each end and (A/G) CATCAC A * T * C * mA * mC X between dN-mN and dN-dN WV- CUAUUAA 1082 mC * mUmAmUmU * A * A * T 1434 XOOOXXXXX 5-15 hemimer 1 PS rs7685686 2088 TAAATTG * A * A * A * T * T * G * T * C XXXXXXXXX on each end and (A/G) TCATCA * A * T * C * A X between dN-mN and dN-dN WV- CUAUUAA 1083 mC * mUmAmUmU * A * A * T 1435 XOOOXXXXX 5-14-1 gapmer 1 rs7685686 2089 TAAATTG * A * A * A * T * T * G * T * C XXXXXXXXX PS on each end and (A/G) TCATCA * A * T * C * mA X between dN-mN and dN-dN WV- ACUAUTA 1084 mA * mCmUmAmU * T * A * A 1436 XOOOXXXXX 5-15 hemimer 1 PS rs7685686 2090 ATAAATT * T * A * A * A * T * T * G * T XXXXXXXXX on each end and (A/G) GTCATC * C * A * T * C X between dN-mN and dN-dN WV- GACUUUU 1085 rGrArCrUrUrUrUrUrCrUrGrGr 1437 OOOOOOOOO HTT rs7685686 HTT 2163 UCUGGUG UrGrArUrGrGrCrArArUrUrUrA OOOOOOOOO rs7685686 AUGGCAA rUrUrArArUrArG OOOOOOOOO UUUAUUA OOOO AUAG WV- GACUUUU 1086 rGrArCrUrUrUrUrUrCrUrGrGr 1438 OOOOOOOOO HTT rs7685686 HTT 2164 UCUGGUG UrGrArUrGrArCrArArUrUrUrA OOOOOOOOO rs7685686 AUGACAA rUrUrArArUrArG OOOOOOOOO UUUAUUA OOOO AUAG WV- UAAAUTG 1087 mU * SmAmAmAmU * ST * 1439 SOOOSSSSSR 5-10-5 2′ OMe- HTT 2269 TCATCAC SG * ST * SC * SA * RT * SC * SSSSSOOOS DNA-2′-OMe rs7685686 CAGAAA SA * SC * SC * SmAmGmAmA Gapmer 1-3-11-3-1 * SmA (PS/PO) WV- AUAAATT 1088 mA * SmUmAmAmA * ST * ST 1440 SOOOSSSSSS 5-10-5 2′ OMe- HTT 2270 GTCATCA * SG * ST * SC * SA * RT * SC RSSSSOOOS DNA-2′-OMe rs7685686 CCAGAA * SA * SC * SmCmAmGmA * Gapmer 1-3-11-3-1 SmA (PS/PO) WV- AAUAAAT 1089 mA * SmAmUmAmA * SA * 1441 SOOOSSSSSS 5-10-5 2′ OMe- HTT 2271 TGTCATC ST * ST * SG * ST * SC * SA * SRSSSOOOS DNA-2′-OMe rs7685686 ACCAGA RT * SC * SA * SmCmCmAmG Gapmer 1-3-11-3-1 * SmA (PS/PO) WV- UAAUAAA 1090 mU * SmAmAmUmA * SA * 1442 SOOOSSSSSS 5-10-5 2′ OMe- HTT 2272 TTGTCAT SA * ST * ST * SG * ST * SC * SSRSSOOOS DNA-2′-OMe rs7685686 CACCAG SA * RT * SC * SmAmCmCmA Gapmer 1-3-11-3-1 * SmG (PS/PO) WV- AAUAAAT 1091 mA * SmAmUmAmA * SA * 1443 SOOOSSSSSS P10 stereopure HTT 2374 TGTCATC ST * ST * SG * ST * SC * SA * SRSSSSOOS analogue of WV- rs7685686 ACCAGA RT * SC * SA * SC * 2071 5-11-4 2′- SmCmAmG * SmA OMe-DNA-2′-OMe Gapmer 1-3-12-2-1 (PS/PO) WV- UAAUAAA 1092 mU * SmAmAmUmA * SA * 1444 SOOOSSSSSS P11 stereopure HTT 2375 TTGTCAT SA * ST * ST * SG * ST * SC * SSRSSSOOS analogue of WV- rs7685686 CACCAG SA * RT * SC * SA * 20755-11-4 2′- SmCmCmA * SmG OMe-DNA-2′-OMe Gapmer 1-3-12-2-1 (PS/PO) WV- GCACAAG 1093 mG * mCmAmCmA * A * G * 1445 XOOOXXXXX P11 stereorandom HTT 2377 GGCACAG G * G * C * A * C * A * G * A * XXXXXXOOO analogue of WV- rs362307 ACUUCC mCmUmUmC * mC X 932 5-10-5 2′- OMe-DNA-2′-OMe Gapmer and 1-3- 11-3-1 (PS/PO) WV- GCACAAG 1094 mG * SmCmAmCmA * SA * 1446 SOOOSSSSSS P11 stereorandom HTT 2378 GGCACAG SG * SG * SG * SC * SA * SC * SRSSSOOOS analogue of WV- rs362307 ACUUCC RA * SG * SA * SmCmUmUmC 932 5-10-5 2′- * SmC OMe-DNA-2′-OMe Gapmer and 1-3- 11-3-1 (PS/PO) WV- CACAAGG 1095 mC * mAmCmAmA * G * G * 1447 XOOOXXXXX P10 sereorandom HTT 2379 GCACAGA G * C * A * C * A * G * A * C * XXXXXXOOO analogue of WV- rs362307 CUUCCA mUmUmCmC * mA X 933 5-10-5 2′- OMe-DNA-2′-OMe Gapmer and 1-3- 11-3-1 (PS/PO) WV- CACAAGG 1096 mC * SmAmCmAmA * SG * 1448 SOOOSSSSSS P10 stereopure HTT 2380 GCACAGA SG * SG * SC * SA * SC * RA * RSSSSOOOS analogue of WV- rs362307 CUUCCA SG * SA * SC * SmUmUmCmC 933 5-10-5 2′- * SmA OMe-DNA-2′-OMe Gapmer and 1-3- 11-3-1 (PS/PO) WV- UAAAUTG 1097 mU * SmAmAmAmU * ST * 1449 SOOOSSSSRS P8 5-10-5 2′ HTT 2416 TCATCAC SG * ST * SC * RA * ST * SC * SSSSSOOOS OMe-DNA-2′-OMe rs7685686 CAGAAA SA * SC * SC * SmAmGmAmA Gapmer 1-3-11-3-1 * SmA (PS/PO) WV- AUAAATT 1098 mA * SmUmAmAmA * ST * ST 1450 SOOOSSSSSR P9 5-10-5 2′ HTT 2417 GTCATCA * SG * ST * SC * RA * ST * SC SSSSSOOOS OMe-DNA-2′-OMe rs7685686 CCAGAA * SA * SC * SmCmAmGmA * Gapmer 1-3-11-3-1 SmA (PS/PO) WV- AAUAAAT 1099 mA * SmAmUmAmA * SA * 1451 SOOOSSSSSS P10 5-10-5 2′ HTT 2418 TGTCATC ST * ST * SG * ST * SC * RA * RSSSSOOOS OMe-DNA-2′-OMe rs7685686 ACCAGA ST * SC * SA * SmCmCmAmG Gapmer 1-3-11-3-1 * SmA (PS/PO) WV- UAAUAAA 1100 mU * SmAmAmUmA * SA * 1452 SOOOSSSSSS P11 5-10-5 2′ HTT 2419 TTGTCAT SA * ST * ST * SG * ST * SC * SRSSSOOOS OMe-DNA-2′-OMe rs7685686 CACCAG RA * ST * SC * SmAmCmCmA Gapmer 1-3-11-3-1 * SmG (PS/PO) WV- UCCCCAC 1101 mU * SmCmCmCmC * SA * SC 1453 SOOOSSRSSS P6 5-10-5 (2′- HTT 2589 AGAGGGA * RA * SG * SA * SG * SG * SSSSSOOOS OMe-DNA-2′- rs2530595 GGAAGC SG * SA * SG * SmGmAmAmG OMe) 1-3-11-3-1 (C/T) * SmC (PS/PO) Gapmer WV- CUCCCCA 1102 mC * SmUmCmCmC * SC * SA 1454 SOOOSSSRSS P7 5-10-5 (2′- HTT 2590 CAGAGGG * SC * RA * SG * SA * SG * SG SSSSSOOOS OMe-DNA-2′- rs2530595 AGGAAG * SG * SA * SmGmGmAmA * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV- CCUCCCC 1103 mC * SmCmUmCmC * SC * SC 1455 SOOOSSSSRS P8 5-10-5 (2′- HTT 2591 ACAGAGG * SA * SC * RA * SG * SA * SG SSSSSOOOS OMe-DNA-2′- rs2530595 GAGGAA * SG * SG * SmAmGmGmA * OMe) 1-3-11-3-1 (C/T) SmA (PS/PO) Gapmer WV- UCCUCCC 1104 mU * SmCmCmUmC * SC * SC 1456 SOOOSSSSSR P9 5-10-5 (2′- HTT 2592 CACAGAG * SC * SA * SC * RA * SG * SA SSSSSOOOS OMe-DNA-2′- rs2530595 GGAGGA * SG * SG * SmGmAmGmG * OMe) 1-3-11-3-1 (C/T) SmA (PS/PO) Gapmer WV- GUCCUCC 1105 mG * SmUmCmCmU * SC * SC 1457 SOOOSSSSSS P10 5-10-5 (2′- HTT 2593 CCACAGA * SC * SC * SA * SC * RA * SG RSSSSOOOS OMe-DNA-2′- rs2530595 GGGAGG * SA * SG * SmGmGmAmG * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV- GGUCCTC 1106 mG * SmGmUmCmC * ST * SC 1458 SOOOSSSSSS P11 5-10-5 (2′- HTT 2594 CCCACAG * SC * SC * SC * SA * SC * RA SRSSSOOOS OMe-DNA-2′- rs2530595 AGGGAG * SG * SA * SmGmGmGmA * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV- GGGUCCT 1107 mG * SmGmGmUmC * SC * ST 1459 SOOOSSSSSS P12 5-10-5 (2′- HTT 2595 CCCCACA * SC * SC * SC * SC * SA * SC SSRSSOOOS OMe-DNA-2′- rs2530595 GAGGGA * RA * SG * SmAmGmGmG * OMe) 1-3-11-3-1 (C/T) SmA (PS/PO) Gapmer WV- CGGGUCC 1108 mC * SmGmGmGmU * SC * SC 1460 SOOOSSSSSS P13 5-10-5 (2′- HTT 2596 TCCCCAC * ST * SC * SC * SC * SC * SA SSSRSOOOS OMe-DNA-2′- rs2530595 AGAGGG * SC * RA * SmGmAmGmG * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV- ACAGUAG 1109 mA * SmCmAmGmU * SA * 1461 SOOOSSRSSS P6 5-10-5 (2′- HTT 2597 ATGAGGG SG * RA * ST * SG * SA * SG * SSSSSOOOS OMe-DNA-2′- (rs362331) AGCAGG SG * SG * SA * SmGmCmAmG OMe) 1-3-11-3-1 (C/T) * SmG (PS/PO) Gapmer WV- CACAGTA 1110 mC * SmAmCmAmG * ST * SA 1462 SOOOSSSRSS P7 5-10-5 (2′- HTT 2598 GATGAGG * SG * RA * ST * SG * SA * SG SSSSSOOOS OMe-DNA-2′- (rs362331) GAGCAG * SG * SG * SmAmGmCmA * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV- ACACAGT 1111 mA * SmCmAmCmA * SG * ST 1463 SOOOSSSSRS P8 5-10-5 (2′- HTT 2599 AGATGAG * SA * SG * RA * ST * SG * SA SSSSSOOOS OMe-DNA-2′- (rs362331) GGAGCA * SG * SG * SmGmAmGmC * OMe) 1-3-11-3-1 (C/T) SmA (PS/PO) Gapmer WV- CACACAG 1112 mC * SmAmCmAmC * SA * SG 1464 SOOOSSSSSR P9 5-10-5 (2′- HTT 2600 TAGATGA * ST * SA * SG * RA * ST * SG SSSSSOOOS OMe-DNA-2′- (rs362331) GGGAGC * SA * SG * SmGmGmAmG * OMe) 1-3-11-3-1 (C/T) SmC (PS/PO) Gapmer WV- GCACACA 1113 mG * SmCmAmCmA * SC * SA 1465 SOOOSSSSSS P10 5-10-5 (2′- HTT 2601 GTAGATG * SG * ST * SA * SG * RA * ST RSSSSOOOS OMe-DNA-2′- (rs362331) AGGGAG * SG * SA * SmGmGmGmA * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV- UGCACAC 1114 mU * SmGmCmAmC * SA * SC 1466 SOOOSSSSSS P11 5-10-5 (2′- HTT 2602 AGTAGAT * SA * SG * ST * SA * SG * RA SRSSSOOOS OMe-DNA-2′- (rs362331) GAGGGA * ST * SG * SmAmGmGmG * OMe) 1-3-11-3-1 (C/T) SmA (PS/PO) Gapmer WV- GUGCACA 1115 mG * SmUmGmCmA * SC * 1467 SOOOSSSSSS P12 5-10-5 (2′- HTT 2603 CAGTAGA SA * SC * SA * SG * ST * SA * SSRSSOOOS OMe-DNA-2′- (rs362331) TGAGGG SG * RA * ST * SmGmAmGmG OMe) 1-3-11-3-1 (C/T) * SmG (PS/PO) Gapmer WV- AGUGCAC 1116 mA * SmGmUmGmC * SA * 1468 SOOOSSSSSS P13 5-10-5 (2′- HTT 2604 ACAGTAG SC * SA * SC * SA * SG * ST * SSSRSOOOS OMe-DNA-2′- (rs362331) AUGAGG SA * SG * RA * OMe) 1-3-11-3-1 (C/T) SmUmGmAmG * SmG (PS/PO) Gapmer WV- UCCCCAC 1117 mU * mCmCmCmC * A * C * A 1469 XOOOXXXXX P6 5-10-5 (2′- HTT 2605 AGAGGGA * G * A * G * G * G * A * G * XXXXXXOOO OMe-DNA-2′- r2530595 GGAAGC mGmAmAmG * mC X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- CUCCCCA 1118 mC * mUmCmCmC * C * A * C 1470 XOOOXXXXX P7 5-10-5 (2′- HTT 2606 CAGAGGG * A * G * A * G * G * G * A * XXXXXXOOO OMe-DNA-2′- r2530595 AGGAAG mGmGmAmA * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- CCUCCCC 1119 mC * mCmUmCmC * C * C * A 1471 XOOOXXXXX P8 5-10-5 (2′- HTT 2607 ACAGAGG * C * A * G * A * G * G * G * XXXXXXOOO OMe-DNA-2′- r2530595 GAGGAA mAmGmGmA * mA X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- UCCUCCC 1120 mU * mCmCmUmC * C * C * C 1472 XOOOXXXXX P9 5-10-5 (2′- HTT 2608 CACAGAG * A * C * A * G * A * G * G * XXXXXXOOO OMe-DNA-2′- r2530595 GGAGGA mGmAmGmG * mA X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GUCCUCC 1121 mG * mUmCmCmU * C * C * C 1473 XOOOXXXXX P10 5-10-5 (2′- HTT 2609 CCACAGA * C * A * C * A * G * A * G * XXXXXXOOO OMe-DNA-2′- r2530595 GGGAGG mGmGmAmG * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GGUCCTC 1122 mG * mGmUmCmC * T * C * C 1474 XOOOXXXXX P11 5-10-5 (2′- HTT 2610 CCCACAG * C * C * A * C * A * G * A * XXXXXXOOO OMe-DNA-2′- r2530595 AGGGAG mGmGmGmA * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GGGUCCT 1123 mG * mGmGmUmC * C * T * C 1475 XOOOXXXXX P12 5-10-5 (2′- HTT 2611 CCCCACA * C * C * C * A * C * A * G * XXXXXXOOO OMe-DNA-2′- r2530595 GAGGGA mAmGmGmG * mA X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- CGGGUCC 1124 mC * mGmGmGmU * C * C * T 1476 XOOOXXXXX P13 5-10-5 (2′- HTT 2612 TCCCCAC * C * C * C * C * A * C * A * XXXXXXOOO OMe-DNA-2′- r2530595 AGAGGG mGmAmGmG * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- ACAGUAG 1125 mA * mCmAmGmU * A * G * 1477 XOOOXXXXX P6 5-10-5 (2′- HTT 2613 ATGAGGG A * T * G * A * G * G * G * A * XXXXXXOOO OMe-DNA-2′- (r362331) AGCAGG mGmCmAmG * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- CACAGTA 1126 mC * mAmCmAmG * T * A * G 1478 XOOOXXXXX P7 5-10-5 (2′- HTT 2614 GATGAGG * A * T * G * A * G * G * G * XXXXXXOOO OMe-DNA-2′- (r362331) GAGCAG mAmGmCmA * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- ACACAGT 1127 mA * mCmAmCmA * G * T * A 1479 XOOOXXXXX P8 5-10-5 (2′- HTT 2615 AGATGAG * G * A * T * G * A * G * G * XXXXXXOOO OMe-DNA-2′- (r362331) GGAGCA mGmAmGmC * mA X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- CACACAG 1128 mC * mAmCmAmC * A * G * T 1480 XOOOXXXXX P9 5-10-5 (2′- HTT 2616 TAGATGA * A * G * A * T * G * A * G * XXXXXXOOO OMe-DNA-2′- (r362331) GGGAGC mGmGmAmG * mC X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GCACACA 1129 mG * mCmAmCmA * C * A * 1481 XOOOXXXXX P10 5-10-5 (2′- HTT 2617 GTAGATG G * T * A * G * A * T * G * A * XXXXXXOOO OMe-DNA-2′- (r362331) AGGGAG mGmGmGmA * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- UGCACAC 1130 mU * mGmCmAmC * A * C * 1482 XOOOXXXXX P11 5-10-5 (2′- HTT 2618 AGTAGAT A * G * T * A * G * A * T * G * XXXXXXOOO OMe-DNA-2′- (r362331) GAGGGA mAmGmGmG * mA X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GUGCACA 1131 mG * mUmGmCmA * C * A * 1483 XOOOXXXXX P12 5-10-5 (2′- HTT 2619 CAGTAGA C * A * G * T * A * G * A * T * XXXXXXOOO OMe-DNA-2′- (r362331) TGAGGG mGmAmGmG * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- AGUGCAC 1132 mA * mGmUmGmC * A * C * 1484 XOOOXXXXX P13 5-10-5 (2′- HTT 2620 ACAGTAG A * C * A * G * T * A * G * A * XXXXXXOOO OMe-DNA-2′- (r362331) AUGAGG mUmGmAmG * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GGCACAA 1133 GGCACAAGGGCACAGACTTC 1485 OOOOOOOOO DNA version of HTT 2623 GGGCACA OOOOOOOOO WV-1092 rs362307 GACTTC O (C/T) WV- GGCACAA 1134 mG * SmGmCmAmC * SA * 1486 SOOOSSSSSS WV-1092 analogue rs362307 2659 GGGCACA SA * SG * SG * SG * SC * SA * SSSSSOOOS with All Sp Human GACUUC SC * SA * SG * SmAmCmUmU stereochemistry HTT * SmC WV- GGGUCCT 1135 mG * SmG * SmGmUmC * SC 1487 SSOOSSSSSSS P12 5-10-5 (2′- HTT 2671 CCCCACA * ST * SC * SC * SC * SC * SA SRSSOOSS OMe-DNA-2′- rs2530595 GAGGGA * SC * RA * SG * SmAmGmG * OMe) 2-2-11-2-2 (C/T) SmG * SmA (PS/PO) Gapmer with Sp wings WV- GGGUCCT 1136 mG * RmG * RmGmUmC * SC 1488 RROOSSSSSS P12 5-10-5 (2′- HTT 2672 CCCCACA * ST * SC * SC * SC * SC * SA SSRSSOORR OMe-DNA-2′- rs2530595 GAGGGA * SC * RA * SG * SmAmGmG * OMe) 4-11-4 (C/T) RmG * RmA (PS/PO) Gapmer with Rp wings WV- GGGUCCT 1137 mG * SmG * SmG * SmU * 1489 SSSSSSSSSSS P12 5-10-5 (2′- HTT 2673 CCCCACA SmC * SC * ST * SC * SC * SC SRSSSSSS OMe-DNA-2′- rs2530595 GAGGGA * SC * SA * SC * RA * SG * OMe) 2-2-11-2-2 (C/T) SmA * SmG * SmG * SmG * (PS/PO) Gapmer SmA with Sp wings WV- GGGUCCT 1138 mG * RmG * RmG * RmU * 1490 RRRRSSSSSSS P12 5-10-5 (2′- HTT 2674 CCCCACA RmC * SC * ST * SC * SC * SC SRSSRRRR OMe-DNA-2′- rs2530595 GAGGGA * SC * SA * SC * RA * SG * OMe) 2-2-11-2-2 (C/T) SmA * RmG * RmG * RmG * (PS/PO) Gapmer RmA with Rp wings WV- GGGUUCT 1139 mG * SmGmGmUmU * SC * ST 1491 SOOOSSSSSS P12 analogue of HTT 2675 CCCCACA * SC * SC * SC * SC * SA * SC SSRSSOOOS WV-2595 with G:U rs2530595 GAGGGA * RA * SG * SmAmGmGmG * mismatch at (C/T) SmA position 5 WV- GGCACAA 1140 mG * RmGmCmAmC * SA * 1492 ROOOSSSSSS WV-1092 analogue rs362307 2676 GGGCACA SA * SG * SG * SG * SC * SA * SSSSSOOOS for CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA 1141 mG * SmGmCmAmC * RA * 1493 SOOORSSSSS WV-1092 analogue rs362307 2682 GGGCACA SA * SG * SG * SG * SC * SA * SSSSSOOOS for CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA 1142 mG * SmGmCmAmC * SA * 1494 SOOOSRSSSS WV-1092 analogue rs362307 2683 GGGCACA RA * SG * SG * SG * SC * SA * SSSSSOOOS for CMC Human SC * SA * SG * SmAmCmUmU HTT GACUUC * SmC WV- GGCACAA 1143 mG * SmGmCmAmC * SA * 1495 SOOOSSRSSS WV-1092 analogue rs362307 2684 GGGCACA SA * RG * SG * SG * SC * SA * SSSSSOOOS for CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA 1144 mG * SmGmCmAmC * SA * 1496 SOOOSSSRSS WV-1092 analogue rs362307 2685 GGGCACA SA * SG * RG * SG * SC * SA * SSSSSOOOS for CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA 1145 mG * SmGmCmAmC * SA * 1497 SOOOSSSSRS WV-1092 analogue rs362307 2686 GGGCACA SA * SG * SG * RG * SC * SA * SSSSSOOOS for CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA 1146 mG * SmGmCmAmC * SA * 1498 SOOOSSSSSR WV-1092 analogue rs362307 2687 GGGCACA SA * SG * SG * SG * RC * SA * SSSSSOOOS for CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA 1147 mG * SmGmCmAmC * SA * 1499 SOOOSSSSSS WV-1092 analogue rs362307 2688 GGGCACA SA * SG * SG * SG * SC * RA * RSSSSOOOS for CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA 1148 mG * SmGmCmAmC * SA * 1500 SOOOSSSSSS WV-1092 analogue rs362307 2689 GGGCACA SA * SG * SG * SG * SC * SA * SRSSSOOOS for CMC Human GACUUC RC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA 1149 mG * SmGmCmAmC * SA * 1501 SOOOSSSSSS WV-1092 analogue rs362307 2690 GGGCACA SA * SG * SG * SG * SC * SA * SSSRSOOOS for CMC Human GACUUC SC * SA * RG * SmAmCmUmU HTT * SmC WV- GGCACAA 1150 mG * SmGmCmAmC * SA * 1502 SOOOSSSSSS WV-1092 analogue rs362307 2691 GGGCACA SA * SG * SG * SG * SC * SA * SSSSROOOS for CMC Human GACUUC SC * SA * SG * RmAmCmUmU HTT * SmC WV- GGCACAA 1151 mG * SmGmCmAmC * SA * 1503 SOOOSSSSSS WV-1092 analogue rs362307 2692 GGGCACA SA * SG * SG * SG * SC * SA * SSSSSOOOR for CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * RmC WV- GGCAC mG * SmGmCmAmC SOOO WV-1092 fragment rs362307 2728 for CMC Human HTT WV- GGCAC mG * RmGmCmAmC ROOO WV-1092 fragment rs362307 2729 for CMC Human HTT WV- ACUUC mAmCmUmU * SmC OOOS WV-1092 fragment rs362307 2730 for CMC Human HTT WV- ACUUC mAmCmUmU * RmC OOOR WV-1092 fragment rs362307 2731 for CMC Human HTT WV- GGCACAA 1152 mG * SmGmCmAmC * SA * 1504 SOOOSSSSSS WV-1092 for CM rs362307 2732 GGGCACA SA * SG * SG * SG * SC * RA * RSRSSOOOS Human GACUUC SC * RA * SG * SmAmCmUmU HTT * SmC Abbreviations: 2\′: 2′ 3\′: 3′ 5\′: 5′ 307: SNP rs362307 C6: C6 amino linker F, f: 2′-F Htt, HTT: Huntingtin gene or Huntington's Disease Laurie, Myristic, Palmitic, Stearic, Oleic, Linoleic, alpha-Linoleic, gamma-Linoleic, DHA, Turbinaric, Dilinoleic: Laurie acid, Myristic acid, Palmitic acid, Stearic acid, Oleic acid, Linoleic acid, alpha-Linoleic acid, gamma-Linoleic acid, docosahexaenoic acid, Turbinaric acid, Dilinoreic acid, respectively. muHtt or muHTT: mutant Huntingtin gene or gene product OMe: 2′-OMe O, PO: phoshodiester (phosphate) *, PS: Phosphorothioate R, Rp: Phosphorothioate in Rp conformation S, Sp: Phosphorothioate in Sp conformation WV: WV- WV-: WV X: Phosphorothioate, stereorandom

EQUIVALENTS

Having described some illustrative embodiments of the disclosure, it should be apparent to those skilled in the art that the foregoing is merely illustrative and not limiting, having been presented by way of example only. Numerous modifications and other illustrative embodiments are within the scope of one of ordinary skill in the art and are contemplated as falling within the scope of the disclosure. In particular, although many of the examples presented herein involve specific combinations of method acts or system elements, it should be understood that those acts and those elements may be combined in other ways to accomplish the same objectives. Acts, elements, and features discussed only in connection with one embodiment are not intended to be excluded from a similar role in other embodiments. Further, for the one or more means-plus-function limitations recited in the following claims, the means are not intended to be limited to the means disclosed herein for performing the recited function, but are intended to cover in scope any means, known now or later developed, for performing the recited function.

Use of ordinal terms such as “first”, “second”, “third”, etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements. Similarly, use of a), b), etc., or i), ii), etc. does not by itself connote any priority, precedence, or order of steps in the claims. Similarly, the use of these terms in the specification does not by itself connote any required priority, precedence, or order.

The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the disclosure. The present disclosure is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the disclosure and other functionally equivalent embodiments are within the scope of the disclosure. Various modifications of the disclosure in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the disclosure are not necessarily encompassed by each embodiment of the disclosure.

Claims

1-41. (canceled)

42. A method for treating Huntington's disease in a subject, comprising administering to the subject a therapeutically effective amount of an oligonucleotide having the structure of:

mG * SmGmCmAmC * SA * SA * SG * SG * SG * SC * SA * SC * RA * SG * SmAmCmUmU * SmC (SEQ ID NO: 360), or a pharmaceutically acceptable salt thereof, wherein:
S represents a Sp phosphorothioate;
R represents a Rp phosphorothioate; and
m represents a 2′-OMe modification to a nucleoside.

43. The method of claim 42, wherein the oligonucleotide is in a salt form.

44. The method of claim 42, wherein the oligonucleotide is a sodium salt.

45. The method of claim 42, wherein the subject has an rs362307 allele which is associated with Huntington's disease and is 100% complementary to the base sequence of the oligonucleotide.

46. The method of claim 43, wherein the subject has an rs362307 allele which is associated with Huntington's disease and is 100% complementary to the base sequence of the oligonucleotide.

47. The method of claim 44, wherein the subject has an rs362307 allele which is associated with Huntington's disease and is 100% complementary to the base sequence of the oligonucleotide.

48. A method for treating Huntington's disease in a subject, comprising administering to the subject a pharmaceutical composition which comprises a therapeutically effective amount of an oligonucleotide and at least one pharmaceutically acceptable inactive ingredient selected from pharmaceutically acceptable diluents, pharmaceutically acceptable excipients, and pharmaceutically acceptable carriers, wherein the oligonucleotide has the structure of:

mG * SmGmCmAmC * SA * SA * SG * SG * SG * SC * SA * SC * RA * SG* SmAmCmUmU * SmC (SEQ ID NO: 360), or a pharmaceutically acceptable salt thereof, wherein:
* S represents a Sp phosphorothioate;
*R represents a Rp phosphorothioate; and
m represents a 2′-OMe modification to a nucleoside.

49. The method of claim 48, wherein the oligonucleotide is in a salt form.

50. The method of claim 48, wherein the oligonucleotide is a sodium salt.

51. The method of claim 48, wherein the subject has an rs362307 allele which is associated with Huntington's disease and is 100% complementary to the base sequence of the oligonucleotide.

52. The method of claim 49, wherein the subject has an rs362307 allele which is associated with Huntington's disease and is 100% complementary to the base sequence of the oligonucleotide.

53. The method of claim 50, wherein the subject has an rs362307 allele which is associated with Huntington's disease and is 100% complementary to the base sequence of the oligonucleotide.

Patent History
Publication number: 20200080083
Type: Application
Filed: Aug 26, 2019
Publication Date: Mar 12, 2020
Inventors: Chandra Vargeese (Schwenksville, PA), Meena . (Belmont, MA), Nenad Svrzikapa (Cambridge, MA), Susovan Mohapatra (Belmont, MA), Christopher J. Francis (Arlington, MA), Gregory L. Verdine (Boston, MA), Anna Sokolovska (Somerville, MA)
Application Number: 16/551,503
Classifications
International Classification: C12N 15/113 (20060101); A61P 25/28 (20060101); C12N 15/115 (20060101);