GUT-PROTECTIVE EFFECT OF RIG-1/MAVS AND STING ACTIVATION
Disclosed herein are methods for inhibiting irradiation- and chemo-induced impact on intestinal barrier function and graft versus host disease following allogeneic hematopoietic stem cell transplantation by targeting the RIG-I or STING signaling pathways.
Latest MEMORIAL SLOAN-KETTERING CANCER CENTER Patents:
This application claims priority to U.S. provisional application No. 62/486,213 filed Apr. 17, 2017 and U.S. provisional application No. 62/589,845 filed Nov. 22, 2017; the contents of both are hereby incorporated by reference in their entirety into the present disclosure.
STATEMENT OF RIGHTS UNDER FEDERALLY-SPONSORED RESEARCHThis invention was made with government support under HL069929, AI100288, AI080455, AI101406, CA023766 and CA008748 awarded by the National Institutes of Health. The government has certain rights in the invention.
SEQUENCE LISTINGThe instant application contains a Sequence Listing, created on Jul. 24, 2017; the file, in ASCII format, is designated 3314087AWO_SequenceListing_ST25.txt and is 2.26 KB in size. The file is hereby incorporated by reference in its entirety into the instant application.
TECHNICAL FIELDThe present disclosure relates generally to activation of retinoic acid-inducible gene 1 (RIG-I) or STING signaling pathways, which guards against irradiation- and chemo-induced impact on intestinal barrier function and more particularly to the ability of RIG-I agonists to reduce/prevent graft versus host disease (GVHD).
BACKGROUND OF THE DISCLOSUREAllogeneic hematopoietic stem cell transplantation is a treatment of choice for a range of malignant and nonmalignant disorders. Pre-transplant conditioning requires ablation of the patient's own hematopoietic cells either by total body irradiation (TBI) or chemotherapeutic agent followed by introduction of the allogeneic HSCs into the patient. One complication of the conditioning is graft versus host disease (GVHD) in which the transplanted stem cells become T lymphocytes and start attacking the host's own cells.
During conditioning, the drug treatment and irradiation damage the epithelial cells that form part of the intestinal mucosal. Loss of the intestinal epithelial layer is believed to be the trigger for GVHD.
In an effort to identify a mechanism for protecting the intestinal epithelium, the inventors explored the role of two proteins in the body known for their role in fighting bacteria and viruses: RIG-I and STING. RIG-I belongs to the pattern recognition family of cytoplasmic RIG-I-like receptors. Its primary function is to detect double-stranded 5′-triphosphate RNA (3pRNA) during viral or bacterial infection (1-3). In contrast, the cytosolic DNA receptor cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) synthase (cGAS) and its adapter protein STING (STimulator of INterferon Genes, TMEM173), recognize DNA in various contexts e.g. microbial DNA or nuclear DNA released into the cytosol by necrotic cells (4).
Upon binding of ligand, RIG-I recruits the adaptor mitochondrial antiviral-signaling protein (MAVS) to induce pro-inflammatory cytokines, type-I interferons (IFN-I) and inflammasome activation (1, 5-8), orchestrating a diverse innate and adaptive immune response. cGAS binds to double-stranded (ds) DNA and catalyzes the formation of cyclic dinucleotides. The latter can form cyclic GAMP (cGMP-AMP=2′3 cGAMP) which activates STING to trigger innate immune gene transcription and IFN-I production (4). Whereas the role of IFN-I in initiating host defense against pathogens is well established, recent work highlights the regenerative function of this cytokine family, particularly at epithelial surfaces. IFN-I produced by plasmacytoid dendritic cells (pDC) promotes skin repair upon mechanical barrier disruption (9) and increases intestinal epithelial turnover and repair of chemically damaged tissue. The effects of IFN-I on gut epithelial turnover have been attributed to both macrophage-dependent mechanisms (10) and Toll-like receptor (TLR) stimulation of pDC (11). However, the role of cytosolic nucleic acid sensors in this context is poorly understood.
Similarly, the involvement of IFN-I in the repair of acute tissue damage by genotoxic insults has not been addressed. Unlike chemical injury of intestinal mucosa, irradiation-induced or chemotherapy-induced intestinal barrier dysfunction is a problem clinically.
Mucosal barriers like the intestinal epithelial cell (IEC) layer protect sterile microenvironments from physical, chemical and microbial challenge. Epithelial integrity depends on constant and inducible IEC renewal by pluripotent intestinal stem cells (ISCs) which reside in the stem cell niche at the base of each intestinal crypt (12). Genotoxic stress by total body irradiation (TBI) or chemotherapy affects ISC and results in damage to the intestinal epithelium, ultimately causing translocation of microbes to sterile compartments and subsequent immune activation (13).
During allogeneic hematopoietic stem cell transplantation (allo-HSCT), alteration of intestinal barrier function by chemotherapy or TBI administered pre-transplant has detrimental consequences: “misplaced” bacterial components together with endogenous danger signals released during epithelial cell death are sensed by pattern recognition receptors on antigen-presenting cells, which then produce pro-inflammatory cytokines and prime donor-derived T cells (13). These alloreactive T cells attack and destroy host tissues primarily the gastrointestinal (GI) tract, liver and skin, causing morbidity and mortality in a process called acute graft-versus-host disease (GVHD). GVHD is the leading complication after allo-HSCT and occurs in as many as 50% of transplant recipients.
Thus, investigating molecular mechanisms that promote intestinal epithelial integrity and repair during tissue injury is fundamental to the development of new approaches to prevent treatment-associated inflammation and GVHD. The RIG-I-MAVS and STING signaling pathways are important regulators of IFN-I production, and IFN-I can initiate epithelial repair. Thus, we hypothesized that activation of these pathways during pre-transplant bone marrow ablative therapy in mice may protect epithelial integrity and could be exploited to promote intestinal barrier function and prevent GVHD.
SUMMARY OF THE DISCLOSUREThe present disclosure shows that properly timed therapeutic activation of RIG-I or cGAS/STING, for example by administration of a RIG-I agonist such as 3pRNA reduces gut epithelial barrier dysfunction, promotes epithelial integrity and prevents thymic damage during acute tissue damage caused by chemotherapy or TBI, providing a mechanism to prevent the development of GVHD.
In one aspect, therefore, the disclosure relates to a method for attenuating or inhibiting treatment-associated inflammation and GVHD comprising administering to a subject in need thereof a therapeutically effective amount of a RIG-I agonist, a STING agonist or a combination thereof.
In another aspect, the disclosure relates to a method for attenuating or inhibiting acute intestinal injury during allogeneic hematopoietic stem cell transplantation (HSCT or allo-HSCT) comprising administering to a subject in need thereof a therapeutically effective amount of a RIG-I agonist, a STING agonist or a combination thereof. In one embodiment the agonist is 3pRNA or double-stranded DNA including interferon stimulatory DNA (ISD). In some embodiments, administration of agonist occurs prior to allo-HSCT, e.g., agonist may be administered from 2-3 days prior to transplantation up until transplantation.
In yet another aspect, the disclosure relates to a method for inhibiting GVHD following allo-HSCT comprising administering to a subject in need thereof a therapeutically effective amount of a RIG-I agonist, a STING agonist or a combination thereof.
In yet another related aspect, the disclosure relates to a method to promote growth of intestinal organoids in vitro comprising contacting said intestinal organoids with a RIG-I agonist.
All patents, publications, published applications and other references cited herein are hereby incorporated in their entirety into the present application.
Generally, unless otherwise specified, terms used herein are intended to be interpreted consistently with the meaning of those terms as they are known to those of skill in the art.
The term “treatment-associated” when used to characterize inflammation, GVHD, tissue damage or injury which the disclosed method seeks to minimize, prevent or otherwise ameliorate means that the inflammation, GVHD, tissue damage or injury is the result of preconditioning treatment prior to allo-HSCT. Non-limiting examples are radiation, typically total body irradiation (TBI) and administration of a chemotherapeutic agent.
RIG-I Agonists
In practicing the disclosed method, RIG-I agonists known to those of skill in the art include: 3pRNA, e.g., in vitro transcribed 3pRNA, a selective RIG-I agonist; small endogenous non-coding RNAs (sncRNAs, U1/U2)-RIG-I agonist induced via irradiation of tumor cells; double stranded RNA, e.g. ImOI-100 (Rigontec)-minimal RNA mimic of PPP-RNA, selective RIG-I agonist; Kineta small molecule RIG-I agonist (KIN1148), RIG-I agonist; SB-9200 (Spring Bank Pharmaceuticals): not specific for RIG-I, but also NOD2); double stranded RNA MCT-465 (Multicell Technologies): not specific for RIG-I, also activates MDA5 and TLR3; double stranded RNA PolyICLC (Hiltonol)-targets both RIG-I and TLR3. Oncolytic viruses that target RIG-I signaling may also be used.
cGAS/STING Agonists
cGAS/STING agonists known to those of skill in the art include: Interferon stimulatory DNA (ISD); ADU-S100 (Aduro and Novartis): Cyclical dinucleotides (e.g. cyclic diguanylate (c-di-GMP)=>less active in human STING activation; better synthetic CDN agonist, ML RR-S2 CDA=>better human STING activation, 2′,3′ CDNs); oncolytic viruses, e.g alimogene laherparepvec (T-Vec), a recombinant engineered herpes simplex virus-1 (HSV-1)—a double-stranded DNA virus encoding granulocyte-macrophage CSF (GM-CSF); 5,6-dimethyllxanthenone-4-acetic acid (DMXAA); Dispiro diketopiperzine (DSDP).
Administration of a RIG-I agonist, cGAS/STING agonist or combination thereof is most efficacious when administered prior to allo-HSCT transplantation, for example from 72 hours (3 days before) prior to transplantation until about 1 hour or immediately prior to transplantation. In some embodiments, administration may be between 48 hours (2 days before) and immediately prior to transplantation; in another embodiment administration may be between 24 hours (1 day before) and immediately prior to transplantation; in another embodiment administration may be between 12 hours and immediately prior to transplantation.
The molecular pathways that regulate the tissue repair function of type I interferon (IFN-I) during acute tissue damage are poorly understood. Described herein is a protective role for IFN-I and the RIG-I/MAVS and STING signaling pathways during acute tissue damage in mice.
Mice lacking mitochondrial antiviral-signaling protein (MAVS) were more sensitive to total body irradiation (TBI)-induced and chemotherapy-induced intestinal barrier damage. They developed worse graft-versus-host disease (GVHD) in a preclinical model of allogeneic hematopoietic stem cell transplantation (allo-HSCT) than did wild-type mice. This phenotype was not associated with changes in the intestinal microbiota, but was associated with reduced gut epithelial integrity. Conversely, targeted activation of the RIG-I pathway during tissue injury promoted gut barrier integrity and reduced GVHD.
Recombinant IFN-I or IFN-I induced by RIG-I promoted growth of intestinal organoid cultures in vitro and expression of the antimicrobial peptide regenerating islet-derived protein 3 gamma (Reglllγ). Importantly, these findings were not confined to RIG-I/MAVS signaling, as targeted engagement of the STING (STimulator of INterferon Genes) pathway also protected gut barrier function and reduced GVHD. Consistent with this, STING-deficient animals suffered worse GVHD in the allo-HSCT model compared to wild-type mice. Overall, these data suggested that activation of either RIG-I/MAVS or STING during allo-HSCT in mice resulted in IFN-I signaling that maintained gut epithelial barrier integrity. Targeting these pathways provides a novel mechanism to prevent acute intestinal injury during allogeneic transplantation.
Previous studies have proposed a protective function of IFN-I in the setting of allo-HSCT (32) and of stromal MAVS signaling in a dextran sodium sulfate (DSS)-induced mouse model of colitis (18), but the mechanisms by which IFN-I contributes to this protection remain ill defined. Chen and coworkers used a model of low-dose DSS to induce chronic tissue damage and demonstrated that MAVS signaling in stromal cells controlled tissue homeostasis by monitoring commensal bacteria (18). However, erosive epithelial damage by DSS is an artificial experimental approach that does not mirror common clinical scenarios, in which patients suffer from tissue damage after cytotoxic chemotherapy or radiation therapy or through immune activation.
A series of genetically modified (Ddx58−/−, Mavs−/−, Stinggt/gt) and chimeric mice were used to analyze clinically relevant models of injury to the intestinal stem-cell compartment (TBI, chemotherapy) or immune-mediated acute tissue damage (allo-HSCT/GVHD), respectively. It demonstrated the role of the RIG-I/MAVS/IFN-I and STING/IFN-I pathways for the maintenance of intestinal barrier function and prevention of GVHD. Specifically, it is shown that defective MAVS or STING signaling leads to breakdown of intestinal barrier function and increased GVHD pathology. Given that cohoused wild-type and Mavs−/− or Stinggt/gt mice harbored similar intestinal bacterial populations, it is unlikely that differences in bacterial composition contributed to the protective role of MAVS or STING during GVHD development, unlike what has been proposed for IFN-I-mediated control of Paneth cell function (33). Rig-I−/− mouse recipients of allogeneic bone marrow and T cells similarly suffered from worse GVHD, and there was a non-significant trend towards higher mortality and more weight loss in Rig-I−/− mouse recipients receiving allogeneic bone marrow only. This is reminiscent of the colitis-like phenotype of Rig-I−/− mice and their increased susceptibility to DSS-induced colitis (34). However, since Rig-I−/− mice seemed to be viable only on the 129/sv background, their higher susceptibility to external insults may be attributable to strain-specific differences.
Exogenous stimulation of the RIG-I and STING pathways with 3pRNA or interferon stimulatory DNA in a preventive setting (one day before allo-HSCT) promoted intestinal barrier function (as measured by FITC-dextran translocation) and Paneth cell function (measured by expression of Lysozyme P), Lgr5 marker expression and the production of mucosal homeostatic factors (expression of ltgb6 and Reglllγ), ultimately protecting the recipient from the lethal consequences of systemic GVHD. Application of RIG-I agonists one day after allo-HSCT did not result in protection and even decreased expression of Lysozyme P and Lgr5. As we also noticed reduced expression of Lysozyme P and Lgr5 in the gut post-TBI and allo-HSCT, we deduced that this lack of therapeutic efficacy of 3pRNA could at least in part be explained by the loss of targetable intestinal epithelial cells following pre-transplant conditioning. Importantly, we elucidated the temporal requirements for effective IFN-I dependent signaling: IFNAR needed to be activated at the time of tissue damage, as early blockade of IFNAR before allo-HSCT but not late blockade after allo-HSCT totally abolished the protective effect of 3pRNA. An earlier study has reported reduction of GVHD if recombinant IFN-α was applied one day prior to allo-HSCT (32). Emphasizing the non-redundant role of the RIG-I/MAVS/IFN-I pathway in epithelial protection, RIG-I ligand-mediated protection was independent of IL-22, a cytokine that enhanced intestinal barrier integrity during allo-HSCT via protection of the intestinal stem cell compartment (23, 35).
Mechanistically, IFN-I (both RIG-I−/STING-induced and recombinant IFN-β) triggered growth of primary intestinal crypt cultures, an effect that was abrogated by blocking IFNAR. Growth of these epithelial “mini-guts” relies on sufficient expansion of Lgr5+ intestinal stem cells that eventually give rise to transient amplifying cells and, ultimately, to mature intestinal epithelial cells. Here, we found that organoid formation capacity and production of Paneth cell-derived signals (Lysozyme P) were both reduced in Mavs−/− allo-HSCT recipients compared to Mavs+/+ allo-HSCT recipients. In contrast, we could not detect any differences in organoid formation or Paneth cell numbers between Mavs+/+ and Mavs−/− mice in the steady-state, suggesting that MAVS and IFN-I might exert their protective functions during acute damage by activation of the intestinal stem cell compartment. Along these lines, Stinggt/gt and Ifnar1−/− mice also showed defects in organoid formation.
Given that Paneth cells constitute the intestinal stem cell niche and produce factors that are critical for homeostasis of Lgr5+ intestinal stem cells and self-renewal in the small intestine (27, 36) including WNT, EGF and Notch ligands, accurately timed RIG-I-induced or STING-induced IFN-I signaling could modulate the production of these Paneth cell-derived signals during acute tissue damage. We observed that RIG-I ligands protected Paneth cells in allo-HSCT mouse recipients and enhanced expression of Lysozyme P and Lgr5. Moreover, RIG-I-induced and STING-induced IFN-I enhanced the production of Reglllγ that could contribute to limiting intestinal tissue damage by sustaining a protective shield against bacterial colonisation and translocation (21, 37). Finally, we found that administration of 3pRNA prior to allo-HSCT allowed retrieval of more organoids from the small intestine of treated recipients compared to untreated control recipients and required the RIG-I adaptor MAVS to induce epithelial regeneration. Engagement of RIG-I in vivo thus augmented intestinal stem cell function and epithelial regeneration during allo-HSCT. Given that expression of RIG-I, MAVS and STING have previously been identified in Lgr5+ intestinal stem cells in a proteomic screen (38), future studies will clarify whether endogenous RIG-I and STING ligands and IFN-I enhance organoid growth by directly acting on Lgr5+ intestinal stem cells. Alternatively, Bmi+ intestinal stem cells, considered to be injury-inducible cells with full potential for epithelial regeneration shortly after irradiation damage (39), could be targets for RIG-I/MAVS, STING or IFN-I dependent signals.
Under conditions of chronic viral challenge and chronic IFN-I signaling, myeloid cells are the main targets of IFN-I signals, controlling epithelial barrier integrity through secretion of apolipoproteins L9a/b (10). In addition, NK cells (both donor or recipient) reduce inflammation after irradiation-induced gut epithelial barrier loss and GVHD in several mouse models (40) and are activated by IFN-I after 3pRNA injection (22). Non-intestinal epithelial cell IFN-I targets could contribute to the 3pRNA-induced protection against gut barrier loss and GVHD. 3pRNA increased expression of apolipoproteins L9a/b in the small intestine of irradiated wild-type mice, an effect that was entirely dependent on IFN-I signaling. In contrast, weight loss during GVHD in Ifnar1fl/fl CD11cCre mice was higher, but reduction of GVHD-associated weight loss by RIG-I activation was not affected. This suggested that although IFN-I signaling through DCs appears to be important for limiting tissue damage under certain conditions, protection from tissue injury in GVHD via RIG-I activation is not mediated by IFN-I signaling in DCs.
Our data suggested that endogenous RIG-I/MAVS and STING signaling resulted in protective IFN-I signaling to maintain epithelial barrier integrity, specifically in the context of tissue damage induced by TBI, chemotherapy and GVHD. In this respect, identifying endogenous ligands that engage these pathways and mediate protection is of particular interest.
EXAMPLES Example 1: Materials and MethodsThe goal of this study was to evaluate the impact of RIG-I/MAVS and STING signaling on gut integrity during acute tissue injury and GVHD. To assess this, acute tissue damage was induced by total body irradiation (TBI), cytotoxic chemotherapy and mouse models of allogeneic hematopoietic stem cell transplantation (allo-HSCT). GVHD intensity was quantified using survival, weight loss, histopathology and immunohistochemistry. Intestinal barrier function was analyzed by using FITC-Dextran translocation, expression of antimicrobial peptides and neutrophil influx into the lamina propria. Bacteremia was measured in the serum by counting colony-forming units (CFUs). Organoid cultures of small intestinal crypts were used as an indicator for epithelial regeneration. Damage-associated DNA release was quantified using total DNA isolated from mouse plasma. Quantitative PCR was performed for gene expression analysis of interferon signaling, antimicrobial peptides and small intestine stem or Paneth cell markers. 16S rRNA sequencing was performed to detect potential differences in the intestinal bacterial composition of wild-type, Mavs−/− or Stinggt/gt mice. For animal studies, sample sizes were chosen according to the power of the statistical test of each experiment. For all studies, animal numbers are depicted in the figures and the number of independent experiments is listed in the figure legends. Wild-type and genetically modified mice were randomized into experimental groups and randomly assigned to different cages. Experienced GVHD-pathologists performed histopathologic scoring of intestinal damage after allo-HSCT in a blinded fashion. All mouse antibodies used were validated for use with flow cytometry by the supplier, either eBioscience, BD Biosciences or BioLegend. Mouse antibodies and their clones are listed in Supplementary Table 1 (Clone number, 1DegreeBio, Reference ID). Cell lines are tested for mycoplasma at frequent intervals. We did not exclude outliers in any experiment. For all results, statistical tests are described in the figure legend.
Mice
C57BL/6 (H-2kb, Thy-1.2), BALB/c (H-2kd, Thy-1.2) were purchased from Janvier Labs (France). Mavs−/− (C57BL/6) were provided by the late J. Tschopp. Ifnar1−/− (C57BL/6) mice were provided by Joseph C. Sun (MSKCC), II-22−/− (Balb/c) mice were provided by Genentech. Rig-I−/− mice (129/sv) were provided by Zhu-gang Wang (State Key Laboratory of Medical Genomics, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R.China) (34). Ifn-β-βΔβ-luc mice used for in vivo imaging were backcrossed to C57BL/6 albino background (42). Floxed Ifnar1 mice (C57BL/6) crossed with CD11c-Cre mice (C57BL/6) were provided by U. Kalinke (Twincore, Hannover, Germany). Stinggt/gt mice were from Jackson (Stock number 017537). Mice were used between 6 and 12 weeks of age at the onset of experiments and were maintained in specific pathogen free conditions. We used littermates derived from heterozygous breeding pairs (Mavs−/−, Mavs+/+; Ifnar1fl/fl CD11c-Cre+, Ifnar1fl/fl CD11c-Cre−; Rig-I−/−, Rig-I+/−) or cohoused m ice as indicated in the results or figure legends. Animal studies were approved by the local regulatory agencies (Regierung von Oberbayern, Munich, and Landesamt für Verbraucherschutz and Lebensmittelsicherheit (LAVES), Oldenburg, Germany) and by the Memorial Sloan-Kettering Cancer Center (MSKCC) Institutional Animal Care and Use Committee (IACUC).
Bone Marrow Transplantation (BMT) Model
Allogeneic bone marrow transplants were performed as previously described (43). Briefly, recipients were given 5×106 BM cells directly after lethal total body irradiation (TBI) with 2×4.5Gy (BALB/c), 2×5.5Gy (C57BL/6) or 2×5Gy (129/sv). T cell doses (CD4/CD8 or CD5 MACS enrichment, Miltenyi) varied depending on the transplant model: Donor C57BL/6 into recipient BALB/c (0.5×106 or 1×106 when indicated), donor BALB/c into recipient C57BL/6 (2×106), donor C57BL/6 into recipient 129/sv (1×106), donor B10.BR into C57BL/6 (1×106). We used T cell depleted BM in all allo-HSCT experiments with BM only controls. T cell depletion of BM cells was performed as previously described (44).
Generation of Chimeric Recipients with Mavs or Ifnar1 Deficiency of Hematopoietic or Non-Hematopoietic Tissues
WT, Mavs−/− and Ifnar1−/− recipients (C57BL/6J) were injected as syngeneic bone marrow transplantation (BMT) with 5×106 WT or Mavs−/− or Ifnar1−/− BM cells (C5761/6) intravenously directly after TBI with 2×5.5Gy. Between 45 and 90 days after first syngeneic BMT, allogeneic HSCT (donor BALB/c into recipient C5761/6: T cell dose 2×106, TBI 2×5.5Gy; donor B10.BR into recipient C57BL/6: T cell dose 1×106, TBI 2×4.5 Gy) was performed.
In Vivo Permeability Assay
FITC-dextran assay was performed as previously described (35). Mice were kept without food and water for 8 hours and then FITC-dextran (# FD4-1G, Sigma) was administered by oral gavage at a concentration of 50 mg/ml in water (750 mg/kg). 4.5 h later, plasma was collected from peripheral blood (8800rcf, 10 min), then mixed 1:1 with PBS and analyzed on a plate reader at an excitation wavelength of 485 nm and an emission wavelength of 535 nm.
Determination of Bacteremia
To determine bacteremia, peripheral blood was collected and centrifuged at 400 g for 5 min, supernatant (blood plasma) was collected, plated and incubated at 37° C. under anaerobic conditions using Columbia Agar plates. After 48 h CFUs were counted and bacteremia was quantified in CFUs per ml blood plasma.
Isolation of Lamina Propria Leukocytes and Intestinal Epithelial Cells (IEC) from the Small Intestine
Isolation was performed as previously described (43). Briefly, Peyer's patches were excised from ileum (defined as distal 1/3 of small intestine) and ileums were flushed with cold PBS and cut into 2 cm pieces. Longitudinally opened intestines were washed and incubated with HBSS solution containing 2 mM EDTA, 10 mM HEPES, 10% FCS (Hyclone), 1% Penicillin-Streptomycin, 1% L-Glutamine and 1 mM DTT (all Sigma-Aldrich). After incubation on a shaker (225 rpm) at 37° C. for 2×15 min, tissues were washed and filtered through a 100 μm strainer (BD 352360). The flow-through were centrifuged for 5 min at 1,500 r.p.m and the remaining pellet was lysed in TRIzol (Ambion) for subsequent RNA extraction. Next, intestines were incubated for 45 min in PBS+Ca+/+Mg supplemented with FCS (10%), Collagenase 11 (200 U/ml; Worthington), and DNase I (0.05 mg/ml; Roche) on a shaker at 37° C. Lamina Propria Leukocytes (LPL) in suspension were then purified on a 40/80% Percoll gradient (Biochrom).
In Vivo Analysis of Neutrophil Infiltration
Phenotypical analysis of neutrophils was performed as previously described (45). For assessment of neutrophil infiltration after TBI or doxorubicin treatment, 6-12 weeks old mice were irradiated with 9Gy (Balb/c) or 11Gy (C57BL/6) or treated with doxorubicin injected intraperitoneally (i.p.) (7.5 mg/KG body weight, unless indicated otherwise). On day 3 after intervention mice were sacrificed, Lamina Propria Leukocytes were isolated, counted and neutrophils within the LPLs were analyzed by flow cytometry and normalized to the absolute number of averagely isolated cells (1×106).
Flow Cytometry
Cell suspensions were stained in PBS with 3% FCS. Fluorochrome-coupled antibodies were purchased from eBioscience or BioLegend and are listed in Table 1. For intracellular cytokine staining (ICS), T cells were activated with 80 nM Phorbol-12-myristat-13-acetat (PMA; Sigma), 1 μM ionomycin (Merck Millipor) and Brefeldin A for 4 hours. For ICS, the Foxp3 Transcription Factor Fixation/Permeabilization Kit (eBioscience) was used according to manufacturer's instructions. Data were acquired on a FACS Canto II (BD Biosciences) and analyzed using FlowJo software (TreeStar).
Analysis of T Cell Proliferation In Vivo
In vivo T cell analysis was performed as previously described (46). T cell and BM preparation was performed as described above. T cells were stained with 3.5 μM carboxyfluorescein diacetate succinimidyl ester (CFSE, eBioscience) for 12 minutes at 37° C., washed and counted. 15×106 stained cells were transplanted into lethally irradiated allogeneic recipients as described above. Spleens were harvested on day 3 and analyzed with FACS.
Crypt Isolation
Isolation of intestinal epithelial crypts was performed as previously described (26). Briefly, after harvesting small intestines, the organs were opened longitudinally and washed. Small intestine was incubated in 10 mM ethylenediamine-tetraacetatic acid (EDTA) for 25 min (4° C.) to dissociate the crypts. The supernatant containing crypts was collected.
Organoid Culture
250 crypts per well were suspended in growth factor reduced Matrigel (Corning) (33% ENR-medium; 66% growth factor reduced Matrigel) at 4° C. Then, they were plated in delta-surface Nunc 24-well plates in 30 μL drops, each containing approximately 250 crypts. After the Matrigel drops polymerized, 500 ul complete crypt culture medium was added to small intestine crypt cultures (ENR-medium: advanced DMEM/F12 (Life technologies), 2 mM L-glutamine (Sigma), 10 mM HEPES (Life technologies), 100 U/ml penicillin/100 μg/ml streptomycin (Life technologies), 1.25 mM N-acetyl cysteine (Sigma), 1×B27 supplement (Life technologies), 1×N2 supplement (Life technologies), 50 ng/ml mEGF (Peprotech), 100 ng/ml rec. mNoggin (Peprotech), 5% human R-spondin-1 conditioned medium of hR-spondin-1-transfected HEK 293T cells). Together with the crypt culture medium, 2 μg/ml of 3pRNA or 2 μg/ml of ISD complexed with Lipofectamine 2000 (Invitrogen) or recombinant murine (rm) IFN-β (20 U/ml; PBL (12400-1)) was added. All plates were incubated at 37° C./5% CO2 and medium was replaced every 2-3 days. IFN-β was added again with every medium change. For IFNαR1 blockade, 10 ug/ml of antibody were added to the matrigel before polymerization and with every medium change (MAR1-5A3 anti-mIFNalphaR1 antibody or MOPC-21 Mouse IgG1 as isotype control (BioXCell)).
Histopathologic Analysis
Intestines were harvested 8 days after allo-HSCT or 72 hours after TBI for histopathologic assessment of intestinal tissue injury. Samples were formalin-preserved, paraffin-embedded, sectioned, and stained with hematoxylin and eosin (H&E). For evaluation of intestinal GVHD after allo-HSCT, blinded scoring was performed by experienced pathologists (C.L. or M.R.) as previously described (47). For evidence of intestinal tissue damage after TBI, tissues were examined by four established criteria in a blinded fashion by a pathologist (S.M.): crypt apoptosis (% of crypt containing at least 1 apoptotic cell), crypt abscesses (Absent (0), Present (1)), granulocytic infiltrates (Absent (0), minimal (1), mild (2), moderate (3), marked (4)) and villus atrophy (absent (0), minimal (1), mild (2), moderate (3), marked (4)). Each mouse was given an individual cumulative score (histopathology score) based on the above criteria.
Immunohistochemistry
Intestines of mice 8 days after allo-HSCT were harvested, formalin-fixed, paraffin embedded. The immunohistochemical detection of Lysozyme was performed using Discovery XT processor (Ventana Medical Systems). The tissue sections were deparaffinized with EZPrep buffer (Ventana Medical Systems), antigen retrieval was performed with CC1 buffer (Ventana Medical Systems) and sections were blocked for 30 minutes with Background Buster solution (Innovex). Slides were incubated with anti-Lysozyme antibodies (DAKO; cat # A099; 2 ug/ml) for 5 h, followed by 60 minutes incubation with biotinylated goat anti-rabbit IgG (Vector labs, cat # PK6101) at 1:200 dilution. The detection was performed with DAB detection kit (Ventana Medical Systems) according to manufacturer's instruction. Slides were counterstained with hematoxylin (Ventana Medical Systems) and coverslipped with Permount (Fisher Scientific). To quantify Lysozyme+ Paneth cells, the number of positive cells per crypt was evaluated over a 5000 μm length of intestinal mucosa. Lysozyme+ Paneth cells are depicted as mean Paneth cell number/crypt. Quantification was performed in a blinded fashion by S.M.
Detection of Bioluminescence and In Vivo Imaging
Ifn-βΔβ-luc mice were injected i.v. with 100 μl luciferin (30 mg/ml in PBS)/20 g mouse weight and anesthesized using isoflurane. Within 10 min after luciferin injection, mice or isolated organs were analyzed with an in vivo imaging instrument (IVIS 200; PerkinElmer). The acquired images were analyzed using Living Image 4.4. software.
Quantitative PCR
RNA was isolated from cells lysed in TRIzol (ambion) or from whole tissue homogenates. Tissue homogenates were prepared as follows: 1 cm large or small intestine was flushed and longitudinally opened pieces were frozen in 500 ul TRIzol reagent using liquid nitrogen. After thawing, samples were supplemented with stainless stell beads 5 mm (Qiagen) and homogenized using a Tissuelyser II (Qiagen) 1 min with 30 Hz (1800 oscillations/minute). Total RNA was isolated and transcribed using standard methods and kits according to manufacturer's protocols (RNeasy Mini Kit, Qiagen; SuperScript III Reverse Transcriptase, invitrogen). The specific primer pairs were as follows: mReglllγ fwd TTCCTGTCCTCCATGATCAAAA (SEQ ID NO: 1), rev CATCCACCTCTGTTGGGTTCA (SEQ ID NO: 2); mActin fwd CACACCCGCCACCAGTTCG (SEQ ID NO: 3), rev CACCATCACACCCTGGTGC (SEQ ID NO: 4); mLgr5 fwd ACCCGCCAGTCTCCTACATC (SEQ ID NO: 5) rev GCATCTAGGCGCAGGGATTG (SEQ ID NO: 6); mLysozymeP fwd CAG GCCAAGGTCTACAATCG (SEQ ID NO: 7), rev TTGATCCCACAGGCATTCTT (SEQ ID NO: 8); mltgb6 fwd ATTGTCATTCCCAATGATGG (SEQ ID NO: 9), rev CATAGTTCTCATACAGATGGAC (SEQ ID NO: 10). The qPCR Core kit for SYBR Green I (Eurogentec) and a LightCycler 480 II (Roche) Real-Time PCR System were used as indicated by the manufacturer. The relative transcript level of each gene was calculated according to the 2-Ct, for unnormalized genes, and the 2-ΔΔCt method, for the genes normalized to β-Actin. Alternatively, the following Taqman Expression Assay IDs were used: BETA-ACTIN Mm01205647_g1; IFNB1 Mm00439552_s1; REG3G Mm00441127_m1.
Measurement of Cytokines
TNF and IL-6 were analyzed using the Cytometric Bead Array Enhanced Sensitivity Flex Set System (BD) according to manufacturer's instructions. IFNα and IFNβ were analyzed by ELISA (PBL Assay Science) according to manufacturer's instructions.
Assessment of Epithelial Regeneration in Intestinal Organoid Cultures
To determine the effect of 3pRNA/interferon stimulatory DNA/rmIFN-β on organoid size and morphology, bright-field microscopy images were taken using a Zeiss Axiovision Observer microscope with a 5× objective lens after 5 or 7 days in culture. 2D area and perimeter were analyzed using border perimeter tracing of organoids found in four representative fields of each well using Image J software. For assessment of gene expression by quantitative (q) PCR, organoids were subjected to RNA extraction 24 hours after culture using Trizol reagent (Invitrogen) according to manufacturer's protocol. Isolated RNA was reverse-transcribed using the Quantitect Reverse Transcription Kit (Qiagen). Gene expression was assessed by quantitative real-time PCR using Taqman Expression Assay pre-designed probes (Applied Biosystems). Signals were normalized to β-Actin. mRNA expression. Normalized values were used to calculate relative expression by ΔΔCt analysis or absolute expression by ΔCt. Taqman IDs are depicted below (qPCR).
Reagents
OptiMEM reduced-serum medium was from Invitrogen. Double-stranded in vitro-transcribed 3pRNA (sense, 5′-UCA AAC AGU CCU CGC AUG CCU AUA GUG AGU CG-3′ (SEQ ID NO: 11) was generated as described (22). Synthetic dsRNA with the same sequence but lacking the 5′-triphosphate (synRNA) was purchased from Eurofins (Ebersberg, Germany). Interferon stimulatory DNA was purchased from Invivogen.
Drug Treatment
Mice were treated on indicated time points with 3pRNA or interferon stimulatory DNA (25 μg if not indicated otherwise). 3pRNA or interferon stimulatory DNA was complexed in 3.5 μl in vivo-jetPEI (Polyplus) and injected intravenously. In some experiments mice were treated i.p. with 500 ug IFNaR1 blocking antibody (Clone: MAR1-5A3, BioXCell, West Lebanon, N.H.) or IgG1 Isotype control (Clone: MOPC-21, BioXCell, West Lebanon, N.H.) as indicated.
16S RNA Gene Sequencing
Stool specimens were stored at −80° C. DNA was purified using a phenol-chloroform extraction technique with mechanical disruption (bead-beating) based on a previously described protocol (48) and analyzed using the Illumina MiSeq platform to sequence the V4-V5 region of the 16S rRNA gene. Sequence data were compiled and processed using mothur version 1.34(49), screened and filtered for quality (50), then classified to the species level (51) using a modified form of the Greengenes reference database (52), screened and filtered for quality (50), then classified to the species level (51) using a modified form of the Greengenes reference database (52).
Quantification of Plasma DNA Levels
Mouse plasma was collected from peripheral blood (8800rcf, 10 min). Plasma samples of 3-4 mice were combined to a final volume of 400-500 μl and DNA extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen). dsDNA was quantified using a Qubit 2.0 Fluorometer with the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific).
GVT Model and Bioluminescence Imaging
A20-TGL (H-2d), a BALB/c B-cell lymphoma, were generated as described previously (53). A20-TGL tumor cells were inoculated via separate intravenous injection on the day of allo-BMT (54). To visualize and quantify tumor burden, A20-TGL inoculated mice were administered D-luciferin (Goldbio), anesthetized, and imaged using in vivo bioluminescence imaging systems (Caliper Life Sciences)
Cell Lines, Culture and RNA Transfection, Feces RNA Isolation
Mode-K cells were purchased from Dominique Kaiserlian (French Institute of Health and Medical Research, Unit of Immunity Infection Vaccination, France) and cultured as previously described (31). Cell lines were tested as mycoplasma negative. Where indicated, MODE-K cells were transfected with mouse RIG-I siRNA (100 μM, Eurofins Genomics) or control siRNA (Qiagen) using Lipofectamine 2000 (Life Technologies) according to manufacturer's instructions. After 48 h, cells were transfected with 3pRNA (0.8 μg/mL) or mouse feces-derived RNA complexed to Lipofectamine 2000. Supernatants were collected and RNA was extracted 18 h after transfection followed by IFN-β measurement with ELISA (PBL Assay Science) or by assessment of IFN-β mRNA by qPCR. Mouse feces from healthy WT mice was diluted (RNAprotect Reagent, Quiagen) and homogenized with Glass beads (Sigma) and a Tissuelyser II (Qiagen). After centrifugation, supernatant was subtracted and total feces RNA was isolated using standard methods and kits according to manufacturers' protocols.
Gene Expression Profiling Analysis
For gene expression profiling analysis, (i) Balb/c mice were solely irradiated (9Gy) (n=3), (ii) pretreated with 3pRNA prior (d−1) to irradiation (n=3) or (iii) pre-treated with 3pRNA (d−1)+α-IFNαR1 blocking antibody (d−2) prior to irradiation (n=3). RNA from small intestines was isolated 12 h after irradiation and used for RNA sequencing. Poly(A) RNA sequencing was performed with three biological replicates for each group and analyzed with an Illumina HiSeq2500 platform. The heatmap depicted in
Data Analysis
The output data (FASTQ files) were mapped to the target genome using the rnaStar aligner that maps reads genomically and resolves reads across splice junctions. We used the 2 pass mapping method in which the reads are mapped twice. The first mapping pass used a list of known annotated junctions from Ensemble. Novel junctions found in the first pass were then added to the known junctions and a second mapping pass was done. After mapping we computed the expression count matrix from the mapped reads using HTSeq (www-huber.embl.de/users/anders/HTSeq) and one of several possible gene model databases. The raw count matrix generated by HTSeq was then processed using the R/Bioconductor package DESeq (www-huber.embl.de/users/anders/DESeq) which was used to both normalize the full dataset and analyze differential expression between sample groups.
A heatmap was generated using the heatmap.2 function from the gplots R package. The data plot was the mean centered normalized log 2 expression of the top 100 significant genes. For simple hierarchical clustering the correlation metric was used (Dij=1−cor(Xi,Xj)) with the Pearson correlation on the normalized log 2 expression values.
Statistics
Animal numbers per group (n) are depicted in the figure legends. Technical replicates were never used. GraphPad Prism version 6 was used for statistical analysis. Survival was analyzed using the Log-rank test. Differences between means of experimental groups were analyzed using two-tailed unpaired t test or ordinary one-way Anova correspondingly to the distribution shape of our observations. We used ordinary one-way Anova for multiple comparisons and always performed Dunnett's test for Multiple-test corrections. Applied statistical tests are indicated in the figure legends. Significance was set at p values <0.05, p<0.01 and p<0.001 and was then indicated with asterisks (*, ** and ***). Data are presented as mean±S.E.M.
First, genotoxic tissue damage and regeneration in wild-type (WT) mice and mice genetically deficient for MAVS (Mavs−/−) was assessed. Mice were exposed to lethal TBI, which causes damage to dividing cells and induces loss of intestinal epithelial barrier function (14, 15). Compared to Mavs+/+ littermates, Mavs−/− mice exhibited worse mucosal damage in the small intestine with increased crypt apoptosis, villus atrophy, crypt abscesses and granulocytic infiltrates (
MAVS Signaling in Non-Hematopoietic Cells Attenuates GVHD and Maintains Intestinal Barrier Function in Mice
Given that the RIG-I/MAVS pathway senses bacterial RNA (18), one hypothesis to explain our findings was that there may be mouse strain-specific differences in the intestinal bacterial microbiota. We could not detect differences between the intestinal bacterial composition of cohoused Mavs−/− and Mavs+/+ littermates as assessed by 16S rRNA sequencing (
We observed that a single dose of intravenous 3pRNA, a RIG-I agonist, one day before allo-HSCT reduced mortality (
We next analyzed the role of IFN-I in intestinal tissue protection and prevention of GVHD. Systemic application of 3pRNA led to a rapid increase in IFN-α and IFN-β in the serum (
RIG-I-Induced Type I IFN Signaling in Non-Hematopoietic Cells Promotes Proliferation of the Intestinal Stem Cell Compartment
The observed increase in gut barrier function and increased IFN-β production in the intestine after 3pRNA administration (
Similar to our in vivo findings demonstrating that 3pRNA-induced augmentation of gut barrier function was mediated by IFNAR signaling (
To determine the impact of endogenous RIG-I/MAVS signaling on intestinal regeneration during ongoing GVHD, we next analyzed the capacity to form intestinal organoids ex vivo in Mavs+/+ compared to Mavs−/− allo-HSCT recipients. Strikingly, fewer organoids could be retrieved from Mavs−/− allo-HSCT recipients than from Mavs+/+ littermates (
Considering the protective role of RIG-I/MAVS against genotoxic tissue damage, we wondered if other IFN-I inducing cytosolic nucleic acid sensors would have similar effects. We therefore transplanted STING Goldenticket (Stinggt/gt) mice with allogeneic bone marrow and T cells. Similar to our observation in Mavs−/− mice, we found that Stinggt/gt allo-HSCT recipients showed increased mortality compared to cohoused wild-type mice (
Given that pre-transplant conditioning by either TBI or chemotherapy leads to accumulation of aberrant self-DNA found in apoptotic bodies, extracellular space and cytosol resulting in IFN-I production (30), we hypothesized that the STING pathway might mediate protection from GVHD via detection of endogenous DNA. Indeed, we observed increased dsDNA in the plasma of mice undergoing TBI compared to untreated mice (
We did not succeed in detecting endogenous RNA in mouse plasma. If endogenous RNA was released into the extracellular space upon damage, we presumed it was rapidly degraded. Given that commensal microbiota including bacteria in the gut could potentially deliver endogenous ligands required for activation of RIG-I (18), we tested if RNA isolated from mouse feces could induce RIG-I-dependent IFN-I signaling in intestinal epithelial cells. Feces-derived RNA induced a RIG-I-dependent IFN-I response in Mode-K cells, a murine intestinal epithelial cell line with morphological and phenotypic characteristics of normal enterocytes (31), arguing that 3pRNA and RNA derived from commensals including viruses, phages or bacteria could potentially induce protective IFN-I signaling via activation of RIG-I (
Together, our data suggest that activation of the RIG/MAVS and STING pathways, either through endogenous or applied ligands (ISD, 3pRNA), may be essential for protection of gut epithelial integrity after genotoxic insult and for the prevention of GVHD following allo-HSCT.
Data and Materials Availability:
The RNA sequencing data for this study have been deposited in the database GEO and can be found at GEO GS E87386.
REFERENCES
- 1. Z. Abdullah, M. Schlee, S. Roth, M. A. Mraheil, W. Barchet, J. Bottcher, T. Hain, S. Geiger, Y. Hayakawa, J. H. Fritz, F. Civril, K. P. Hopfner, C. Kurts, J. Ruland, G. Hartmann, T. Chakraborty, P. A. Knolle, RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids. The EMBO journal 31, 4153-4164 (2012).
- 2. V. Hornung, J. Ellegast, S. Kim, K. Brzozka, A. Jung, H. Kato, H. Poeck, S. Akira, K. K. Conzelmann, M. Schlee, S. Endres, G. Hartmann, 5′-Triphosphate RNA is the ligand for RIG-I. Science 314, 994-997 (2006).
- 3. A. Pichlmair, O. Schulz, C. P. Tan, T. I. Naslund, P. Liljestrom, F. Weber, C. Reis e Sousa, RIG-I-mediated antiviral responses to single-stranded RNA bearing 5′-phosphates. Science 314, 997-1001 (2006).
- 4. G. N. Barber, STING-dependent cytosolic DNA sensing pathways. Trends in immunology 35, 88-93 (2014).
- 5. H. Poeck, M. Bscheider, O. Gross, K. Finger, S. Roth, M. Rebsamen, N. Hannesschlager, M. Schlee, S. Rothenfusser, W. Barchet, H. Kato, S. Akira, S. Inoue, S. Endres, C. Peschel, G. Hartmann, V. Hornung, J. Ruland, Recognition of RNA virus by RIG-I results in activation of CARD9 and inflammasome signaling for interleukin 1 beta production. Nature immunology 11, 63-69 (2010).
- 6. M. Yoneyama, K. Onomoto, M. Jogi, T. Akaboshi, T. Fujita, Viral RNA detection by RIG-I-like receptors. Current opinion in immunology 32C, 48-53 (2015).
- 7. J. Pothlichet, I. Meunier, B. K. Davis, J. P. Ting, E. Skamene, V. von Messling, S. M. Vidal, Type I IFN triggers RIG-I/TLR3/NLRP3-dependent inflammasome activation in influenza A virus infected cells. PLoS pathogens 9, e1003256 (2013).
- 8. L. Franchi, T. Eigenbrod, R. Munoz-Planillo, U. Ozkurede, Y. G. Kim, A. Chakrabarti, M. Gale, Jr., R. H. Silverman, M. Colonna, S. Akira, G. Nunez, Cytosolic double-stranded RNA activates the NLRP3 inflammasome via MAVS-induced membrane permeabilization and K+ efflux. Journal of immunology 193, 4214-4222 (2014).
- 9. J. Gregorio, S. Meller, C. Conrad, A. Di Nardo, B. Homey, A. Lauerma, N. Arai, R. L. Gallo, J. Digiovanni, M. Gilliet, Plasmacytoid dendritic cells sense skin injury and promote wound healing through type I interferons. The Journal of experimental medicine 207, 2921-2930 (2010).
- 10. L. Sun, H. Miyoshi, S. Origanti, T. J. Nice, A. C. Barger, N. A. Manieri, L. A. Fogel, A. R. French, D. Piwnica-Worms, H. Piwnica-Worms, H. W. Virgin, D. J. Lenschow, T. S. Stappenbeck, Type I interferons link viral infection to enhanced epithelial turnover and repair. Cell host & microbe 17, 85-97 (2015).
- 11. J. Y. Yang, M. S. Kim, E. Kim, J. H. Cheon, Y. S. Lee, Y. Kim, S. H. Lee, S. U. Seo, S. H. Shin, S. S. Choi, B. Kim, S. Y. Chang, H. J. Ko, J. W. Bae, M. N. Kweon, Enteric Viruses Ameliorate Gut Inflammation via Toll-like Receptor 3 and Toll-like Receptor 7-Mediated Interferon-beta Production. Immunity 44, 889-900 (2016).
- 12. L. W. Peterson, D. Artis, Intestinal epithelial cells: regulators of barrier function and immune homeostasis. Nature reviews. Immunology 14, 141-153 (2014).
- 13. S. Heidegger, M. R. van den Brink, T. Haas, H. Poeck, The role of pattern-recognition receptors in graft-versus-host disease and graft-versus-leukemia after allogeneic stem cell transplantation. Frontiers in immunology 5, 337 (2014).
- 14. B. R. Blazar, W. J. Murphy, M. Abedi, Advances in graft-versus-host disease biology and therapy. Nature reviews. Immunology 12, 443-458 (2012).
- 15. R. R. Jenq, M. R. van den Brink, Allogeneic haematopoietic stem cell transplantation: individualized stem cell and immune therapy of cancer. Nature reviews. Cancer 10, 213-221 (2010).
- 16. L. Schwab, L. Goroncy, S. Palaniyandi, S. Gautam, A. Triantafyllopoulou, A. Mocsai, W. Reichardt, F. J. Karlsson, S. V. Radhakrishnan, K. Hanke, A. Schmitt-Graeff, M. Freudenberg, F. D. von Loewenich, P. Wolf, F. Leonhardt, N. Baxan, D. Pfeifer, O. Schmah, A. Schonle, S. F. Martin, R. Mertelsmann, J. Duyster, J. Finke, M. Prinz, P. Henneke, H. Hacker, G. C. Hildebrandt, G. Hacker, R. Zeiser, Neutrophil granulocytes recruited upon translocation of intestinal bacteria enhance graft-versus-host disease via tissue damage. Nature medicine 20, 648-654 (2014).
- 17. S. Viaud, F. Saccheri, G. Mignot, T. Yamazaki, R. Daillere, D. Hannani, D. P. Enot, C. Pfirschke, C. Engblom, M. J. Pittet, A. Schlitzer, F. Ginhoux, L. Apetoh, E. Chachaty, P. L. Woerther, G. Eberl, M. Berard, C. Ecobichon, D. Clermont, C. Bizet, V. Gaboriau-Routhiau, N. Cerf-Bensussan, P. Opolon, N. Yessaad, E. Vivier, B. Ryffel, C. O. Elson, J. Dore, G. Kroemer, P. Lepage, I. G. Boneca, F. Ghiringhelli, L. Zitvogel, The intestinal microbiota modulates the anticancer immune effects of cyclophosphamide. Science 342, 971-976 (2013).
- 18. X. D. Li, Y. H. Chiu, A. S. Ismail, C. L. Behrendt, M. Wight-Carter, L. V. Hooper, Z. J. Chen, Mitochondrial antiviral signaling protein (MAVS) monitors commensal bacteria and induces an immune response that prevents experimental colitis. Proceedings of the National Academy of Sciences of the United States of America 108, 17390-17395 (2011).
- 19. J. M. Breuss, J. Gallo, H. M. DeLisser, I. V. Klimanskaya, H. G. Folkesson, J. F. Pittet, S. L. Nishimura, K. Aldape, D. V. Landers, W. Carpenter, et al., Expression of the beta 6 integrin subunit in development, neoplasia and tissue repair suggests a role in epithelial remodeling. J Cell Sci 108 (Pt 6), 2241-2251 (1995).
- 20. J. M. Breuss, N. Gillett, L. Lu, D. Sheppard, R. Pytela, Restricted distribution of integrin beta 6 mRNA in primate epithelial tissues. J Histochem Cytochem 41, 1521-1527 (1993).
- 21. S. Vaishnava, M. Yamamoto, K. M. Severson, K. A. Ruhn, X. Yu, O. Koren, R. Ley, E. K. Wakeland, L. V. Hooper, The antibacterial lectin Reglllgamma promotes the spatial segregation of microbiota and host in the intestine. Science 334, 255-258 (2011).
- 22. H. Poeck, R. Besch, C. Maihoefer, M. Renn, D. Tormo, S. S. Morskaya, S. Kirschnek, E. Gaffal, J. Landsberg, J. Hellmuth, A. Schmidt, D. Anz, M. Bscheider, T. Schwerd, C. Berking, C. Bourquin, U. Kalinke, E. Kremmer, H. Kato, S. Akira, R. Meyers, G. Hacker, M. Neuenhahn, D. Busch, J. Ruland, S. Rothenfusser, M. Prinz, V. Hornung, S. Endres, T. Tuting, G. Hartmann, 5′-Triphosphate-siRNA: turning gene silencing and Rig-I activation against melanoma. Nature medicine 14, 1256-1263 (2008).
- 23. J. A. Dudakov, A. M. Hanash, M. R. van den Brink, Interleukin-22: immunobiology and pathology. Annual review of immunology 33, 747-785 (2015).
- 24. J. A. Dudakov, A. M. Hanash, R. R. Jenq, L. F. Young, A. Ghosh, N. V. Singer, M. L. West, O. M. Smith, A. M. Holland, J. J. Tsai, R. L. Boyd, M. R. van den Brink, Interleukin-22 drives endogenous thymic regeneration in mice. Science 336, 91-95 (2012).
- 25. A. Dann, H. Poeck, A. L. Croxford, S. Gaupp, K. Kierdorf, M. Knust, D. Pfeifer, C. Maihoefer, S. Endres, U. Kalinke, S. G. Meuth, H. Wiendl, K. P. Knobeloch, S. Akira, A. Waisman, G. Hartmann, M. Prinz, Cytosolic RIG-I-like helicases act as negative regulators of sterile inflammation in the CNS. Nature neuroscience 15, 98-106 (2012).
- 26. T. Sato, R. G. Vries, H. J. Snippert, M. van de Wetering, N. Barker, D. E. Stange, J. H. van Es, A. Abo, P. Kujala, P. J. Peters, H. Clevers, Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 459, 262-265 (2009).
- 27. B. K. Koo, H. Clevers, Stem cells marked by the R-spondin receptor LGR5. Gastroenterology 147, 289-302 (2014).
- 28. K. Yasuda, P. Yu, C. J. Kirschning, B. Schlatter, F. Schmitz, A. Heit, S. Bauer, H. Hochrein, H. Wagner, Endosomal translocation of vertebrate DNA activates dendritic cells via TLR9-dependent and -independent pathways. Journal of immunology 174, 6129-6136 (2005).
- 29. H. Ishikawa, Z. Ma, G. N. Barber, STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature 461, 788-792 (2009).
- 30. J. Ahn, D. Gutman, S. Saijo, G. N. Barber, STING manifests self DNA-dependent inflammatory disease. Proceedings of the National Academy of Sciences of the United States of America 109, 19386-19391 (2012).
- 31. K. Vidal, I. Grosjean, J. P. evillard, C. Gespach, D. Kaiserlian, Immortalization of mouse intestinal epithelial cells by the SV40-large T gene. Phenotypic and immune characterization of the MODE-K cell line. Journal of immunological methods 166, 63-73 (1993).
- 32. R. J. Robb, E. Kreijveld, R. D. Kuns, Y. A. Wilson, S. D. Olver, A. L. Don, N. C. Raffelt, N. A. De Weerd, K. E. Lineburg, A. Varelias, K. A. Markey, M. Koyama, A. D. Clouston, P. J. Hertzog, K. P. Macdonald, G. R. Hill, Type I-IFNs control GVHD and GVL responses after transplantation. Blood 118, 3399-3409 (2011).
- 33. M. Tschurtschenthaler, J. Wang, C. Fricke, T. M. Fritz, L. Niederreiter, T. E. Adolph, E. Sarcevic, S. Kunzel, F. A. Offner, U. Kalinke, J. F. Baines, H. Tilg, A. Kaser, Type I interferon signalling in the intestinal epithelium affects Paneth cells, microbial ecology and epithelial regeneration. Gut 63, 1921-1931 (2014).
- 34. Y. Wang, H. X. Zhang, Y. P. Sun, Z. X. Liu, X. S. Liu, L. Wang, S. Y. Lu, H. Kong, Q. L. Liu, X. H. Li, Z. Y. Lu, S. J. Chen, Z. Chen, S. S. Bao, W. Dai, Z. G. Wang, Rig-I−/−mice develop colitis associated with downregulation of G alpha i2. Cell research 17, 858-868 (2007).
- 35. A. M. Hanash, J. A. Dudakov, G. Hua, M. H. O'Connor, L. F. Young, N. V. Singer, M. L. West, R. R. Jenq, A. M. Holland, L. W. Kappel, A. Ghosh, J. J. Tsai, U. K. Rao, N. L. Yim, 0. M. Smith, E. Velardi, E. B. Hawryluk, G. F. Murphy, C. Liu, L. A. Fouser, R. Kolesnick, B. R. Blazar, M. R. van den Brink, Interleukin-22 protects intestinal stem cells from immune-mediated tissue damage and regulates sensitivity to graft versus host disease. Immunity 37, 339-350 (2012).
- 36. L. Pellegrinet, V. Rodilla, Z. Liu, S. Chen, U. Koch, L. Espinosa, K. H. Kaestner, R. Kopan, J. Lewis, F. Radtke, DII1- and dII4-mediated notch signaling are required for homeostasis of intestinal stem cells. Gastroenterology 140, 1230-1240 e1231-1237 (2011).
- 37. R. L. Gallo, L. V. Hooper, Epithelial antimicrobial defence of the skin and intestine. Nature reviews. Immunology 12, 503-516 (2012).
- 38. J. Munoz, D. E. Stange, A. G. Schepers, M. van de Wetering, B. K. Koo, S. Itzkovitz, R. Volckmann, K. S. Kung, J. Koster, S. Radulescu, K. Myant, R. Versteeg, O. J. Sansom, J. H. van Es, N. Barker, A. van Oudenaarden, S. Mohammed, A. J. Heck, H. Clevers, The Lgr5 intestinal stem cell signature: robust expression of proposed quiescent ‘+4’ cell markers. The EMBO journal 31, 3079-3091 (2012).
- 39. K. S. Yan, L. A. Chia, X. Li, A. Ootani, J. Su, J. Y. Lee, N. Su, Y. Luo, S. C. Heilshorn, M. R. Amieva, E. Sangiorgi, M. R. Capecchi, C. J. Kuo, The intestinal stem cell markers Bmi1 and Lgr5 identify two functionally distinct populations. Proceedings of the National Academy of Sciences of the United States of America 109, 466-471 (2012).
- 40. S. C. Nalle, J. R. Turner, Intestinal barrier loss as a critical pathogenic link between inflammatory bowel disease and graft-versus-host disease. Mucosal Immunol 8, 720-730 (2015).
- 41. B. Funke, F. Lasitschka, W. Roth, R. Penzel, S. Meuer, M. Saile, N. Gretz, B. Sido, P. Schirmacher, F. Autschbach, Selective downregulation of retinoic acid-inducible gene I within the intestinal epithelial compartment in Crohn's disease. Inflammatory bowel diseases 17, 1943-1954 (2011).
- 42. D. Jankovic, J. Ganesan, M. Bscheider, N. Stickel, F. C. Weber, G. Guarda, M. Follo, D. Pfeifer, A. Tardivel, K. Ludigs, A. Bouazzaoui, K. Keri, J. C. Fischer, T. Haas, A. Schmitt-Graff, A. Manoharan, L. Muller, J. Finke, S. F. Martin, O. Gorka, C. Peschel, J. Ruland, M. Idzko, J. Duyster, E. Holler, L. E. French, H. Poeck, E. Contassot, R. Zeiser, The NIrp3 inflammasome regulates acute graft-versus-host disease. The Journal of experimental medicine 210, 1899-1910 (2013).
- 43. O. Alpdogan, S. J. Muriglan, J. M. Eng, L. M. Willis, A. S. Greenberg, B. J. Kappel, M. R. van den Brink, IL-7 enhances peripheral T cell reconstitution after allogeneic hematopoietic stem cell transplantation. The Journal of clinical investigation 112, 1095-1107 (2003).
- 44. K. Neumann, M. Castineiras-Vilarino, U. Hockendorf, N. Hannesschlager, S. Lemeer, D. Kupka, S. Meyermann, M. Lech, H. J. Anders, B. Kuster, D. H. Busch, A. Gewies, R. Naumann, O. Gross, J. Ruland, Clec12a is an inhibitory receptor for uric acid crystals that regulates inflammation in response to cell death. Immunity 40, 389-399 (2014).
- 45. T. D. Kim, T. H. Terwey, J. L. Zakrzewski, D. Suh, A. A. Kochman, M. E. Chen, C. G. King, C. Borsotti, J. Grubin, O. M. Smith, G. Heller, C. Liu, G. F. Murphy, O. Alpdogan, M. R. van den Brink, Organ-derived dendritic cells have differential effects on alloreactive T cells. Blood 111, 2929-2940 (2008).
Claims
1. A method, administering to a subject in need thereof a therapeutically effective amount of a RIG-I agonist, a cGAS/STING agonist or a combination thereof, wherein the administering is for inhibiting treatment-associated inflammation and graft versus host disease (GVHD), for inhibiting acute intestinal injury during allogeneic hemopoietic stem cell transplantation (allo-HSCT), for inhibiting GVHD following allo-HSCT, to enhance intestinal regeneration in vivo following allo-HSCT, or any combination of two or more of the foregoing.
2. The method of claim 1, wherein the administering is for inhibiting acute intestinal injury during allogeneic hemopoietic stem cell transplantation (allo-HSCT).
3. The method of claim 1, wherein the administration is for inhibiting GVHD following allo-HSCT.
4. A method to promote growth of intestinal organoids in vitro comprising contacting said intestinal organoids with a RIG-I agonist.
5. The method of claim 1, wherein the administration is to enhance intestinal regeneration in vivo following allo-HSCT.
6. The method of claim 1, wherein the RIG-I agonist is selected from 3pRNA; interferon stimulatory DNA (ISD); in vitro transcribed 3pRNA; small endogenous non-coding RNAs (sncRNAs, U1/U2); double stranded RNA such as Poly-ICLC (Hiltonol), MCT-465 (Multicell Technologies), ImOl-100 (Rigontec), and small molecule, Kineta KIN1148, SB-9200 (Spring Bank Pharmaceuticals).
7. The method of claim 1, wherein the cGAS/STING agonist is selected from Interferon stimulatory DNA (ISD); ADU-S100 (Aduro and Novartis): cyclical dinucleotides, 2′,3′ CDNs; alimogene laherparepvec (T-Vec), herpes simplex virus-1 (HSV-1); 5,6-dimethyllxanthenone-4-acetic acid (DMXAA); and Dispiro diketopiperzine (DSDP).
8. The method of claim 1, wherein agonist is administered prior to allo-HSCT.
9. The method of claim 1, wherein agonist is administered from 72 hours prior to transplantation until immediately prior to transplantation.
10. The method of claim 1, wherein agonist is administered from 48 hours prior to transplantation until immediately prior to transplantation.
11. The method of claim 1, wherein agonist is administered from 24 hours prior to transplantation until immediately prior to transplantation.
12. The method of claim 1, wherein agonist is administered from 12 hours prior to transplantation until immediately prior to transplantation.
13. A use of the RIG-I agonist of claim 16, wherein the use is to inhibit intestinal tissue damage induced by radiation or chemotherapeutic conditioning for allo-HSCT.
14. A use of the RIG-I agonist of claim 16, wherein the use is to inhibit GVHD following allo-HSCT.
15. The use of claim 14, wherein GVHD results from pre-transplant conditioning for allo-HSCT.
16. A RIG-I agonist for use in reducing GVHD following allo-HSCT, inhibiting intestinal tissue damage induced by radiation or chemotherapeutic conditioning for allo-HSCT, or both.
17. The method of claim 1, wherein the administering is for inhibiting treatment-associated inflammation and graft versus host disease (GVHD).
18. The method of claim 6, wherein agonist is administered from 48 hours prior to transplantation until immediately prior to transplantation.
19. The method of claim 6, wherein agonist is administered from 24 hours prior to transplantation until immediately prior to transplantation.
20. The method of any claim 6, wherein agonist is administered from 12 hours prior to transplantation until immediately prior to transplantation.
Type: Application
Filed: Apr 17, 2018
Publication Date: Apr 9, 2020
Applicants: MEMORIAL SLOAN-KETTERING CANCER CENTER (New York, NY), KLINIKUM RECHTS DER ISAR DER TECHNISCHEN UNIVERSITÄT MÜNCHEN (München)
Inventors: Marcel VAN DEN BRINK (New York, NY), Hendrik POECK (München)
Application Number: 16/605,883
