MODULATORS OF IRF5 EXPRESSION

The present embodiments provide methods, compounds, and compositions useful for inhibiting IRF5 expression, which may be useful for treating, preventing, or ameliorating a disease associated with IRF5.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATION

The present application claims priority to U.S. Provisional Patent Application No. 62/767,615, filed Nov. 15, 2018, the disclosure of which is incorporated herein by reference in its entirety.

SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0341USLSEQ_ST25.txt created Nov. 5, 2018, which is 324 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD

The present embodiments provide methods, compounds, and compositions useful for inhibiting Interferon Regulatory Factor 5 (IRF5; Humirf5) expression, and in certain instances, reducing the amount of IRF5 protein in a cell or animal, which can be useful for treating, preventing, or ameliorating a disease associated with IRF5.

BACKGROUND

Interferon Regulatory Factor 5 or IRF5 is an important regulator of inflammation and autoimmunity. There is a large body of evidence that links IRF5 risk alleles, which are associated with high expression, to the risk of autoimmune diseases, such as systemic lupus erythematosus, rheumatoid arthritis, systemic sclerosis, inflammatory bowel disease, and multiple sclerosis (Hedl and Abhaham, J. Immunol., 2012, 188: 5348-5356; Kristjansdottir et al., J. Med. Genet. 2008, 45: 362-369; Graham et al., Nature Genet. 2006, 38: 550-555; Graham et al., PNAS, 2007, 104: 6758-6763).

The current standard of medical care for Crohn's disease and ulcerative colitis, the two major forms of inflammatory bowel disease in humans, involves treatment with anti-inflammatory agents, corticosteroids, immunomodulators, including azathioprine, or its active metabolite 6-mercaptopurine, methotrexate, biologic agents, including tumor necrosis factor antagonist therapies, anti-integrin therapies, and anti-interleukin (IL) 12/23 therapy. It is an object herein to provide compounds and compositions of high efficacy and tolerability for the treatment of diseases disclosed herein.

SUMMARY

Certain embodiments provided herein are compounds and methods for reducing the amount or activity of IRF5 mRNA, and in certain embodiments, reducing the amount of IRF5 protein in a cell or individual. In certain embodiments, the individual has a gastrointestinal disease. In certain embodiments, the individual has an inflammatory bowel disease. In certain embodiments, the disease is Crohn's disease. In certain embodiments, the disease is inflammatory bowel disease (IBD). In certain embodiments, the disease is ulcerative colitis. In certain embodiments, the disease is systemic lupus erythematosus (SLE). In certain embodiments, the disease is rheumatoid arthritis. In certain embodiments, the disease is primary biliary cirrhosis. In certain embodiments, the disease is systemic sclerosis. In certain embodiments, the disease is Sjogren's syndrome. In certain embodiments, the disease is multiple sclerosis. In certain embodiments, the disease is scleroderma. In certain embodiments, the disease is interstitial lung disease (SSc-ILD). In certain embodiments, the disease is polycystic kidney disease (PKD). In certain embodiments, the disease is chronic kidney disease (CKD). In certain embodiments, the disease is NASH. In certain embodiments, the disease is liver fibrosis. In certain embodiments, the disease is asthma. In certain embodiments, the disease is severe asthma. Certain compounds provided herein are directed to compounds and compositions that reduce inflammation in an animal.

Certain embodiments provided herein are directed to potent and tolerable compounds and compositions useful for inhibiting IRF5 expression, which can be useful for treating, preventing, ameliorating, or slowing progression of an inflammatory disease. Certain embodiments provided herein are directed to compounds and compositions that are more potent or have greater therapeutic value than compounds publicly disclosed.

DETAILED DESCRIPTION

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Compounds described by ION number indicate a combination of nucleobase sequence, chemical modification, and motif.

Definitions

Unless otherwise indicated, the following terms have the following meanings:

“2′-deoxyfuranosyl sugar moiety” or “2′-deoxyfuranosyl sugar” means a furanosyl sugar moiety having two hydrogens at the 2′-position. 2′-deoxyfuranosyl sugar moieties may be unmodified or modified and may be substituted at positions other than the 2′-position or unsubstituted. A β-D-2′-deoxyribosyl sugar moiety in the context of an oligonucleotide is an unsubstituted, unmodified 2′-deoxyfuranosyl and is found in naturally occurring deoxyribonucleic acids (DNA).

“2′-deoxynucleoside” means a nucleoside comprising 2′-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

“2′-O-methoxyethyl” (also 2′-MOE) refers to a 2′-O(CH2)2—OCH3) in the place of the 2′-OH group of a ribosyl ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.

“2′-MOE nucleoside” (also 2′-O-methoxyethyl nucleoside) means a nucleoside comprising a 2′-MOE modified sugar moiety.

“2′-substituted nucleoside” or “2-modified nucleoside” means a nucleoside comprising a 2′-substituted or 2′-modified sugar moiety. As used herein, “2′-substituted” or “2-modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

“3′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3′-most nucleotide of a particular compound.

“5′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5′-most nucleotide of a particular compound.

“5-methylcytosine” means a cytosine with a methyl group attached to the 5 position.

“About” means within ±10% of a value. For example, if it is stated, “the compounds affected about 70% inhibition of PNPLA3”, it is implied that PNPLA3 levels are inhibited within a range of 60% and 80%.

“Administration” or “administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

“Administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.

“Amelioration” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

“Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

“Antisense activity” means any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target.

“Antisense compound” means a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

“Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

“Antisense mechanisms” are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.

“Antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide is specifically hybridizable to a target nucleic acid or region or segment thereof.

“Bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. “Bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety. “Branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.

“Cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.

“cEt” or “constrained ethyl” means a ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon, wherein the bridge has the formula: 4′-CH(CH3)—O-2′, and wherein the methyl group of the bridge is in the S configuration.

“cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.

“Chemical modification” in a compound describes the substitutions or changes through chemical reaction, of any of the units in the compound relative to the original state of such unit. “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.

“Chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2′-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2′-O-methoxyethyl modifications.

“Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.

“Cleavable bond” means any chemical bond capable of being split. In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.

“Cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

“Complementary” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

“Conjugate group” means a group of atoms that is attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

“Conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

“Conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

“Contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

“Designing” or “Designed to” refer to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

“Differently modified” means chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2′-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2′-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.

“Dose” means a specified quantity of a compound or pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.

“Dosing regimen” is a combination of doses designed to achieve one or more desired effects.

“Double-stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an oligonucleotide.

“Effective amount” means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

“Efficacy” means the ability to produce a desired effect.

“Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.

“Gapmer” means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”

“Hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.

“Immediately adjacent” means there are no intervening elements between the immediately adjacent elements of the same kind (e.g. no intervening nucleobases between the immediately adjacent nucleobases).

“Individual” means a human or non-human animal selected for treatment or therapy.

“Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

“Internucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. “Modified internucleoside linkage” means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.

“IRF5” means any nucleic acid or protein of IRF5. “IRF5 nucleic acid” means any nucleic acid encoding IRF5. For example, in certain embodiments, an IRF5 nucleic acid includes a DNA sequence encoding IRF5, an RNA sequence transcribed from DNA encoding IRF5 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding IRF5. “IRF5 mRNA” means an mRNA encoding a IRF5 protein. The target may be referred to in either upper or lower case.

“IRF5 specific inhibitor” refers to any agent capable of specifically inhibiting IRF5 RNA and/or IRF5 protein expression or activity at the molecular level. For example, IRF5 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of IRF5 RNA and/or IRF5 protein.

“Lengthened oligonucleotides” are those that have one or more additional nucleosides relative to an oligonucleotide disclosed herein, e.g. a parent oligonucleotide.

“Linked nucleosides” means adjacent nucleosides linked together by an internucleoside linkage.

“Linker-nucleoside” means a nucleoside that links an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of a compound. Linker-nucleosides are not considered part of the oligonucleotide portion of a compound even if they are contiguous with the oligonucleotide.

“Mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nucleobases including but not limited to a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non-complementary nucleobase.

“Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating IRF5 RNA can mean to increase or decrease the level of IRF5 RNA and/or IRF5 protein in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, an IRF5 compound can be a modulator that decreases the amount of IRF5 RNA and/or IRF5 protein in a cell, tissue, organ or organism.

“MOE” means methoxyethyl.

“Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

“Motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

“Natural” or “naturally occurring” means found in nature.

“Non-bicyclic modified sugar” or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase, and is capable of pairing with any nucleobase.

“Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.

“Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

“Oligomeric compound” means a compound comprising a single oligonucleotide and, optionally, one or more additional features, such as a conjugate group or terminal group.

“Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. “Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or internucleoside linkage is modified. “Unmodified oligonucleotide” means an oligonucleotide that does not comprise any sugar, nucleobase, or internucleoside modification.

“Parent oligonucleotide” means an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and/or chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.

“Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

“Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection.

“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

“Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.

“Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.

“Phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.

“Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.

“Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely.

“Prodrug” means a compound in a form outside the body which, when administered to an individual, is metabolized to another form within the body or cells thereof. In certain embodiments, the metabolized form is the active, or more active, form of the compound (e.g., drug). Typically conversion of a prodrug within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical(s) present in cells or tissues, and/or by physiologic conditions.

“Reduce” means to bring down to a smaller extent, size, amount, or number.

“RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene). Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).

“Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

“RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

“Segments” are defined as smaller or sub-portions of regions within a nucleic acid.

“Side effects” means physiological disease and/or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

“Single-stranded” in reference to a compound means the compound has only one oligonucleotide.

“Self-complementary” means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex.

“Sites” are defined as unique nucleobase positions within a target nucleic acid.

“Specifically hybridizable” refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

“Specifically inhibit” with reference to a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids. Reduction does not necessarily indicate a total elimination of the target nucleic acid's expression.

“Standard cell assay” means assay(s) described in the Examples and reasonable variations thereof

“Standard in vivo experiment” means the procedure(s) described in the Example(s) and reasonable variations thereof.

“Stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (5) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

“Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a β-D-ribosyl moiety, as found in naturally occurring RNA, or a β-D-2′-deoxyribosyl sugar moiety as found in naturally occurring DNA. As used herein, “modified sugar moiety” or “modified sugar” means a sugar surrogate or a furanosyl sugar moiety other than a β-D-ribosyl or a β-D-2′-deoxyribosyl. Modified furanosyl sugar moieties may be modified or substituted at a certain position(s) of the sugar moiety, substituted, or unsubstituted, and they may or may not have a stereoconfiguration other than β-D-ribosyl. Modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.

“Sugar surrogate” means a modified sugar moiety that does not comprise a furanosyl or tetrahydrofuranyl ring (is not a “furanosyl sugar moiety”) and that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

“Synergy” or “synergize” refers to an effect of a combination that is greater than additive of the effects of each component alone at the same doses.

“Target gene” refers to a gene encoding a target.

“Targeting” means the specific hybridization of a compound to a target nucleic acid in order to induce a desired effect.

“Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein.

“Target region” means a portion of a target nucleic acid to which one or more compounds is targeted.

“Target segment” means the sequence of nucleotides of a target nucleic acid to which a compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.

“Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

“Therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.

“Treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.

Certain Embodiments

Certain embodiments provide methods, compounds and compositions for inhibiting Interferon Regulatory Factor 5 (IRF5) expression.

Certain embodiments provide compounds targeted to an IRF5 nucleic acid. In certain embodiments, the IRF5 nucleic acid has the sequence set forth in RefSeq or GENBANK Accession No. U51127.1 (incorporated by reference, disclosed herein as SEQ ID NO: 4); GENBANK Accession No. NT_007933.14 truncated from nucleotides 53761170 to U.S. Pat. No. 53,774,065 (incorporated by reference, disclosed herein as SEQ ID NO: 2); GENBANK Accession No. DC427600.1 (incorporated by reference, disclosed herein as SEQ ID NO: 5); GENBANK Accession No. NM_001098627.3 (incorporated by reference, disclosed herein as SEQ ID NO: 1); GENBANK Accession No. NM_001098629.2 (incorporated by reference, disclosed herein as SEQ ID NO: 3); GENBANK Accession No. NM_001098630.2 (incorporated by reference, disclosed herein as SEQ ID NO: 6); GENBANK Accession No. NM_001242452.2 (incorporated by reference, disclosed herein as SEQ ID NO: 7); GENBANK Accession No. NM_032643.4 (incorporated by reference, disclosed herein as SEQ ID NO: 8); and GENBANK Accession No. NC_000007.14 truncated from nucleotides 128935001 to 128953000 (incorporated by reference, disclosed herein as SEQ ID NO: 9). In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

In certain embodiments, the compound comprises a modified oligonucleotide 16 linked nucleosides in length. In certain embodiments, the compound is an antisense compound or oligomeric compound.

Certain embodiments provide a compound comprising a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

Certain embodiments provide a compound comprising a modified oligonucleotide 12 to 30 linked nucleosides in length and complementary within nucleobases 4366-4381, 5141-5156, 5140-5160, 5179-5194, 11544-11559, 11542-11596, 11736-11751, 11737-11752, 11720-11790, or 11794-11809 of SEQ ID NO: 2, wherein said modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, compounds target nucleotides 11737-11752 of an IRF5 nucleic acid. In certain embodiments, compounds target within nucleotides 4366-4381, 5141-5156, 5140-5160, 5179-5194, 11544-11559, 11542-11596, 11736-11751, 11737-11752, 11720-11790, or 11794-11809 of an IRF5 nucleic acid having the nucleobase sequence of SEQ ID NO: 2. In certain embodiments, compounds have at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 4366-4381, 5141-5156, 5140-5160, 5179-5194, 11544-11559, 11542-11596, 11736-11751, 11737-11752, 11720-11790, or 11794-11809 of an IRF5 nucleic acid having the nucleobase sequence of SEQ ID NO: 2. In certain embodiments, these compounds are antisense compounds, oligomeric compounds, or oligonucleotides.

In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion any one of SEQ ID NOs: 168, 228, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294.

In certain embodiments, compounds targeted to IRF5 are ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, and 786548. Out of over 1,320 compounds that were screened as described in the Examples section below, ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, and 786548 emerged as the top lead compounds. In particular, ION 729018 exhibited significant efficacy and tolerability out of over 1,320 compounds.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified sugar. In certain embodiments, at least one modified sugar comprises a 2′-O-methoxyethyl group. In certain embodiments, at least one modified sugar is a bicyclic sugar, such as a 4′-CH(CH3)-O-2′ group, a 4′-CH2-O-2′ group, or a 4′-(CH2)2-O-2′ group.

In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified nucleobase, such as 5-methylcytosine.

In certain embodiments, any of the foregoing modified oligonucleotides comprises:

a gap segment consisting of linked deoxynucleosides;

a 5′ wing segment consisting of linked nucleosides; and

a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 12 to 30 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length having a nucleobase sequence consisting of the sequence recited in any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 228, 168, 1270, 1272, and 1294, wherein the modified oligonucleotide comprises

a gap segment consisting of ten linked deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound consists of a modified oligonucleotide 16 linked nucleobases in length having a nucleobase sequence consists of the sequence recited in SEQ ID NO: 228, wherein the modified oligonucleotide comprises

a gap segment consisting of ten linked deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 717, wherein the modified oligonucleotide comprises

a gap segment consisting of ten linked deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of four linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each of the nucleosides in the 5′ wing segment comprises a cEt sugar (kk); wherein the nucleosides of the 3′ wing segment comprise from 5′ to 3′ direction of a cEt sugar, a 2′-MOE sugar, a cEt sugar, and a 2′-MOE sugar (keke); wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 717 and 1340, wherein the modified oligonucleotide comprises

a gap segment consisting of nine linked deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each of the nucleosides in the 5′ wing segment comprises a cEt sugar (kk); wherein the nucleosides of the 3′ wing segment from 5′ to 3′ direction comprise a 2′-MOE sugar, a 2′-MOE sugar, a 2′-MOE sugar, a cEt sugar and a cEt sugar (eeekk); wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of ION 729018 or salt thereof, having the following chemical structure:

In certain embodiments, a compound comprises or consists of the sodium salt of ION 729018, having the following chemical structure:

In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding IRF5.

In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing embodiments, the compound can be 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides in length. In certain embodiments, the compound comprises or consists of an oligonucleotide.

In certain embodiments, compounds or compositions provided herein comprise a pharmaceutically acceptable salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

In certain embodiments, the compounds or compositions as described herein are active by virtue of having at least one of an in vitro IC50 of less than 2 μM, less than 1.5 μM, less than 1 μM, less than 0.9 μM, less than 0.8 μM, less than 0.7 μM, less than 0.6 μM, less than 0.5 μM, less than 0.4 μM, less than 0.3 μM, less than 0.2 μM, less than 0.1 μM, less than 0.05 μM, less than 0.04 μM, less than 0.03 μM, less than 0.02 μM, or less than 0.01 μM.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase in alanine transaminase (ALT) or aspartate transaminase (AST) value of no more than 4 fold, 3 fold, or 2 fold over control animals, or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over control animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over control animals.

Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or any pharmaceutically acceptable salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity less than about 40 centipoise (cP), less than about 30 centipose (cP), less than about 20 centipose (cP), less than about 15 centipose (cP), or less than about 10 centipose (cP). In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100 mg/mL, about 125 mg/mL, about 150 mg/mL, about 175 mg/mL, about 200 mg/mL, about 225 mg/mL, about 250 mg/mL, about 275 mg/mL, or about 300 mg/mL. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature, or about 20° C., about 21° C., about 22° C., about 23° C., about 24° C., about 25° C., about 26° C., about 27° C., about 28° C., about 29° C., or about 30° C.

Certain Indications

Certain embodiments provided herein relate to methods of inhibiting IRF5 expression, which can be useful for treating, preventing, or ameliorating a disease associated with IRF5 in an individual, by administration of a compound that targets IRF5. In certain embodiments, the compound can be a IRF5 specific inhibitor. In certain embodiments, the compound can be an antisense compound, an oligomeric compound, or an oligonucleotide targeted to IRF5.

Examples of diseases associated with IRF5 treatable, preventable, and/or ameliorable with the methods provided herein include inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren's syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, and severe asthma. Certain compounds provided herein are directed to compounds and compositions that reduce inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an individual. Certain compounds provided herein are directed to compounds and compositions that reduce inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual, comprising administering a compound targeted to IRF5 to the individual, thereby reducing or inhibiting reduces inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual.

In certain embodiments, a method of treating, preventing, or ameliorating a disease associated with IRF5 in an individual comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the individual is identified as having, or at risk of having, a disease associated with IRF5. In certain embodiments, the disease is an inflammatory disease. In certain embodiments, the disease is an gastrointestinal disease. In certain embodiments, the gastrointestinal disease is ulcerative colitis or Crohn's disease. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an animal.

In certain embodiments, a method of treating, preventing, or ameliorating inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an animal comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby treating, preventing, or ameliorating inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production. In certain embodiments, a method of treating, preventing, or ameliorating inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual, comprising administering a compound targeted to IRF5 to the individual, thereby reducing or inhibiting reduces inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production. In certain embodiments, administering the compound improves, preserves, or prevents inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual. In certain embodiments, the individual is identified as having, or at risk of having, a disease associated with IRF5.

In certain embodiments, a method of inhibiting expression of IRF5 in an individual having, or at risk of having, a disease associated with IRF5 comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby inhibiting expression of IRF5 in the individual. In certain embodiments, administering the compound inhibits expression of IRF5 in the gastrointestinal tract. In certain embodiments, administering the compound inhibits expression of IRF5 in the liver. In certain embodiments, administering the compound inhibits expression of IRF5 in the lungs. In certain embodiments, administering the compound inhibits expression of IRF5 in the kidneys. In certain embodiments, administering the compound inhibits expression of IRF5 in the joints. In certain embodiments, the disease is an inflammatory disease. In certain embodiments, the disease is a gastrointestinal disease. In certain embodiments, the gastrointestinal disease is ulcerative colitis or Crohn's disease. In certain embodiments, the individual has, or is at risk of having, inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren's syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the individual has, or is at risk of having, inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production. In certain embodiments, the individual has, or is at risk of having, inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production. In certain embodiments, administering the compound improves, preserves, or prevents inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss.

In certain embodiments, a method of inhibiting expression of IRF5 in a cell comprises contacting the cell with a compound comprising a IRF5 specific inhibitor, thereby inhibiting expression of IRF5 in the cell. In certain embodiments, the cell is a gastrointestinal tract cell. In certain embodiments, the cell is a liver cell. In certain embodiments, the cell is a kidney cell. In certain embodiments, the cell is a lung cell. In certain embodiments, the cell is in the gastrointestinal tract, the lungs, the liver, the kidney, or any other organ. In certain embodiments, the cell is in the gastrointestinal tract of an individual who has, or is at risk of having, inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In certain embodiments, a method of reducing or inhibiting inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an individual having, or at risk of having, a disease associated with IRF5 comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby reducing or inhibiting inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in the individual. In certain embodiments, a method of reducing or inhibiting inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual having, or at risk of having, a disease associated with IRF5 comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby reducing or inhibiting inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in the individual. In certain embodiments, the individual has, or is at risk of having, inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren's syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having, or at risk of having, a disease associated with IRF5.

Certain embodiments are drawn to a compound comprising a IRF5 specific inhibitor for use in treating a disease associated with IRF5. In certain embodiments, the disease is inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren's syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally.

Certain embodiments are drawn to a compound comprising an IRF5 specific inhibitor for use in reducing or inhibiting inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an individual having, or at risk of having, inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren's syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the IRF5 specific inhibitor for use reduces or inhibits inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to the use of a compound comprising a IRF5 specific inhibitor for the manufacture or preparation of a medicament for treating a disease associated with IRF5. Certain embodiments are drawn to the use of a compound comprising a IRF5 specific inhibitor for the preparation of a medicament for treating a disease associated with IRF5. In certain embodiments, the disease is an inflammatory disease. In certain embodiments, the disease is a gastrointestinal disease. In certain embodiments, the gastrointestinal disease is ulcerative colitis or Crohn's disease. In certain embodiments, the disease is inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren's syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to the use of a compound comprising a IRF5 specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an individual having, or at risk of having, a disease associated with IRF5. In certain embodiments, the IRF5 specific inhibitor for the manufacture or preparation of the medicament reduces or inhibits inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual. In certain embodiments, the disease is inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren's syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. Certain embodiments are drawn to use of a compound comprising a IRF5 specific inhibitor for the preparation of a medicament for treating a disease associated with IRF5. In certain embodiments, the disease is inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren's syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing methods or uses, the compound can be targeted to IRF5. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example, a modified oligonucleotide 8 to 80 linked nucleosides in length, 10 to 30 linked nucleosides in length, 12 to 30 linked nucleosides in length, or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 37-1356. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar and/or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2′-O-methoxyethyl modified sugar, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; a 5′ wing segment consisting of linked nucleosides; and a 3′ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing embodiments, the modified oligonucleotide is 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 16 or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 37-1356.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 228, 168, 1270, 1272, and 1294, wherein the modified oligonucleotide comprises

a gap segment consisting of ten linked deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound consists of a modified oligonucleotide 16 linked nucleobases in length having a nucleobase sequence consists of the sequence recited in SEQ ID NO: 228, wherein the modified oligonucleotide comprises

a gap segment consisting of ten linked deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 717, wherein the modified oligonucleotide comprises

a gap segment consisting of ten linked deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of four linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each of the nucleosides in the 5′ wing segment comprises a cEt sugar (kk); wherein the nucleosides of the 3′ wing segment comprise from 5′ to 3′ direction of a cEt sugar, a 2′-MOE sugar, a cEt sugar, and a 2′-MOE sugar (keke); wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 717 and 1340, wherein the modified oligonucleotide comprises

a gap segment consisting of nine linked deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each of the nucleosides in the 5′ wing segment comprises a cEt sugar (kk); wherein the nucleosides of the 3′ wing segment from 5′ to 3′ direction comprise a 2′-MOE sugar, a 2′-MOE sugar, a 2′-MOE sugar, a cEt sugar and a cEt sugar (eeekk); wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of ION 729018 or salt thereof, having the following chemical structure:

In certain embodiments, a compound comprises or consists of the sodium salt of ION 729018, having the following chemical structure:

In any of the foregoing methods or uses, the compound can be administered parenterally. For example, in certain embodiments the compound can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

Certain Compounds

In certain embodiments, compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound or antisense compound is single-stranded. Such a single-stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

In certain embodiments, compounds are double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, compound comprises a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both the modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide is 16-30 linked nucleosides in length and the second modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 37-1356.

In certain embodiments, antisense compounds are double-stranded. Such double-stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of such a double-stranded antisense compound may be modified or unmodified. Either or both oligomeric compounds of a double-stranded antisense compound may comprise a conjugate group. The oligomeric compounds of double-stranded antisense compounds may include non-complementary overhanging nucleosides.

Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 22 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 to 30 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, or 20 to 30 subunits in length, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked subunits in length, or a range defined by any two of the above values. In some embodiments the linked subunits are nucleotides, nucleosides, or nucleobases.

In certain embodiments, the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

In certain embodiments, compounds may be shortened or truncated. For example, a single subunit may be deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated compound targeted to a IRF5 nucleic acid may have two subunits deleted from the 5′ end, or alternatively, may have two subunits deleted from the 3′ end of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.

When a single additional subunit is present in a lengthened compound, the additional subunit may be located at the 5′ or 3′ end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5′ end (5′ addition), or alternatively, to the 3′ end (3′ addition) of the compound. Alternatively, the added subunits may be dispersed throughout the compound.

It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305-7309; Gautschi et al. J. Natl. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry and motif can make large differences in one or more of the many properties required for clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).

In certain embodiments, compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence-specific RNAi, for example, short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term “RNAi” is meant to be equivalent to other terms used to describe sequence-specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to IRF5 described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of any one of SEQ ID NOs: 37-1356 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on IRF5 to which any of SEQ ID NOs: 37-1356 is targeted, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position of the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.

In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length. In certain embodiments, the first or second strand of the compound can comprise a conjugate group.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to IRF5 described herein. In certain embodiments, the compound is single stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on IRF5 to which any of SEQ ID NOs: 37-1356 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugate group.

Certain Mechanisms

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.

In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently “DNA-like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.

Nucleotide sequences that encode IRF5 include, without limitation, the following: RefSeq or GENBANK Accession No. U51127.1 (incorporated by reference, disclosed herein as SEQ ID NO: 4); GENBANK Accession No. NT_007933.14 truncated from nucleotides 53761170 to U.S. Pat. No. 53,774,065 (incorporated by reference, disclosed herein as SEQ ID NO: 2); GENBANK Accession No. DC427600.1 (incorporated by reference, disclosed herein as SEQ ID NO: 5); GENBANK Accession No. NM_001098627.3 (incorporated by reference, disclosed herein as SEQ ID NO: 1); GENBANK Accession No. NM_001098629.2 (incorporated by reference, disclosed herein as SEQ ID NO: 3); GENBANK Accession No. NM_001098630.2 (incorporated by reference, disclosed herein as SEQ ID NO: 6); GENBANK Accession No. NM_001242452.2 (incorporated by reference, disclosed herein as SEQ ID NO: 7); GENBANK Accession No. NM_032643.4 (incorporated by reference, disclosed herein as SEQ ID NO: 8); and GENBANK Accession No. NC_000007.14 truncated from nucleotides 128935001 to 128953000 (incorporated by reference, disclosed herein as SEQ ID NO: 9).

Hybridization

In some embodiments, hybridization occurs between a compound disclosed herein and a IRF5 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with a IRF5 nucleic acid.

Complementarity

An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G), unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. An oligonucleotide is fully complementary or 100% complementary when such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. Non-complementary nucleobases between a compound and a IRF5 nucleic acid may be tolerated provided that the compound remains able to specifically hybridize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of a IRF5 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the compounds provided herein, or a specified portion thereof are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a IRF5 nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a IRF5 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.

For example, a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a compound which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, compounds described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a compound may be fully complementary to a IRF5 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. “Fully complementary” can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

In certain embodiments, compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments, selectivity of the compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the oligonucleotide. In certain such embodiments, the mismatch is at position, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3′-end of the oligonucleotide.

The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a IRF5 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a IRF5 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, the compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof. In certain embodiments, compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, compounds described herein are modified oligonucleotides. As used herein, a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, compounds described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs, or a portion thereof, disclosed herein. In certain embodiments, compounds described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof, in which the compounds comprise an oligonucleotide having one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the oligonucleotide. In certain such embodiments, the mismatch is at position, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3′-end of the oligonucleotide.

In certain embodiments, compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Certain Modified Compounds

In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).

A. Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

1. Modified Sugar Moieties

In certain embodiments, sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including, but not limited, to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH3 (“OMe” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O—C1-C10 alkoxy, O—C1-C10 substituted alkoxy, O—C1-C10 alkyl, O—C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for linearly non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include, but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH═CH2, OCH2CH═CH2, OCH2CH2OCH3, O(CH2)2S CH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(═O)—N(Rm)(Rn)), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(═O)—N(H)CH3 (“NMA”).

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2′-substituted or 2′-modified sugar moieties are referred to as 2′-substituted nucleosides or 2′-modified nucleosides.

Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4′ to 2′ bridging sugar substituents include, but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2—O-2′ (“LNA”), 4′-CH2—S-2′, 4′-(CH2)2—O-2′ (“ENA”), 4′-CH(CH3)—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH2—O—CH2-2′, 4′-CH2—N(R)-2′, 4′-CH(CH2OCH3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH3)(CH3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH2—N(OCH3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH2—O—N(CH3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH2—C(H)(CH3)-2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH2—C(═CH2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(RaRb)—N(R)—O-2′, 4′-C(RaRb)—O—N(R)-2′, 4′-CH2—O—N(R)-2′, and 4′-CH2—N(R)—O-2′, wherein each R, Ra, and Rb is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(Ra)(Rb)]n—, —[C(Ra)(Rb)]n—O—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —C(═NRa)—, —C(═O)—, —C(═S)—, —O—, —Si(Ra)2—, —S(═O)x—, and —N(Ra)—;

wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S. Pat. No. 7,053,207, Imanishi et al., U.S. Pat. No. 6,268,490, Imanishi et al. U.S. Pat. No. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499, Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133, Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

α-L-methyleneoxy (4′-CH2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

(“F-HNA”, see e.g., Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; and Swayze et al., U.S. Pat. No. 9,005,906) F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran, and nucleosides comprising additional modified THP compounds having the formula:

wherein, independently, for each of said modified THP nucleoside:

Bx is a nucleobase moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group; q1, q2, q3, q4, q5, q6 and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of R1 and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2, and CN, wherein X is O, S or NJ1, and each J1, J2, and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

2. Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.

In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that does not comprise a nucleobase, referred to as an abasic nucleoside.

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C≡C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly, 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403, Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., U.S. Pat. No. 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

In certain embodiments, compounds targeted to a IRF5 nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Modified Internucleoside Linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. In certain embodiments, compounds described herein having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

In certain embodiments, compounds targeted to a IRF5 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS—P═S”). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (—CH2—N(CH3)—O—CH2), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2—O—); and N,N′-dimethylhydrazine (—CH2—N(CH3)—N(CH3)—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2—N(CH3)—O-5′), amide-3 (3′-CH2—C(═O)—N(H)-5′), amide-4 (3′-CH2—N(H)—C(═O)-5′), formacetal (3′-O—CH2—O-5′), methoxypropyl, and thioformacetal (3′-S—CH2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See, for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments, the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif and, if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.

In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.

In certain embodiments, oligonucleotides comprise one or more methylphosphonate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.

In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments, it is desirable to decrease the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance.

3. Certain Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

a. Certain Sugar Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or “wings” and a central or internal region or “gap”. The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides, wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleosides having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3-5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified 2′-deoxy nucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2′-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2′-deoxy nucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2′-modification.

b. Certain Nucleobase Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

c. Certain Internucleoside Linkage Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, essentially each internucleoside linking group is a phosphate internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate (P═S). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate internucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

4. Certain Modified Oligonucleotides

In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobases independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications). In such circumstances, it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide will be 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20). Herein, if a description of an oligonucleotide is silent with respect to one or more parameters, such parameter is not limited. Thus, a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

Certain Conjugated Compounds

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a compound has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, oligonucleotides are complementary to a pre-mRNA. In certain embodiments, oligonucleotides are complementary to a sense transcript.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

Compositions and Methods for Formulating Pharmaceutical Compositions

Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

A compound described herein targeted to IRF5 nucleic acid can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to IRF5 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

Certain Selected Compounds

Approximately 1,320 newly designed compounds of various lengths, chemistries, and motifs were tested for their effect on human IRF5 mRNA in vitro in several cell types (Examples 1 and 2). Of 1,320 compounds tested for potency at a single dose in vitro, over 110 selected compounds were tested for dose dependent inhibition in THP-1 cells, as well as in KARPAS-229 cells (Example 3).

These oligonucleotides were then tested for tolerability in preclinical rodent models (Examples 4 and 5). Body weights and organ weights, liver function markers (such as alanine transaminase, aspartate transaminase and bilirubin), hematology markers (such as hemoglobin and hematocrit levels, as well as individual blood cell counts), and kidney function markers (such as BUN and creatinine) were measured. Of the over 110 compounds tested by dose response assays, 53 compounds were further screened for tolerability in a a CD-1 mouse model. Nineteen oligonucleotides were further screened in the Sprague-Dawley rat model.

Twelve compounds were then selected and tested in a mouse xenograft model, where the mice were inoculated with human non-Hodgkin's Large Cell Lymphoma (KARPAS-229) cells and treated with the compounds (Example 6). The efficacy and tolerability of the compounds were then tested. Eight compounds were then selected to be tested for efficacy at two separate doses in an IRF5 transgenic mouse model (Example 7).

IONs 729018, 728958, 785525, 785674, 785675, 786503, 786524, and 786548 were tested for tolerability in cynomolgus monkeys (Example 8). Treatment with the compounds was well tolerated in the monkeys, in particular, treatment with ION 729018. Further analysis was done with these compounds, including measuring for viscosity, evaluation of proinflammatory effects, and dose-dependent inhibition confirmation assays.

Modified oligonucleotides with different chemistry modifications were also designed overlapping the target regions of three compounds, IONs 729018, 786503, and 785675 (Example 13). These newly designed compounds along with the three parent oligonucleotides were tested in a multi-dose assay. Many of the newly designed compounds demonstrated strong efficacy in inhibiting IRF5.

Accordingly, provided herein are compounds with any one or more of the improved properties. In certain embodiments, the compounds as described herein are potent and tolerable.

EXAMPLES

The Examples below describe the screening process to identify lead compounds targeted to IRF5. ION 728958, 729018, 785525, 785674, 785675, 786503, 786524, and 786548 resulted in high potency and tolerability. For instance, ION 729018 exhibited high potency and tolerability.

Non-Limiting Disclosure and Incorporation by Reference

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH for the natural 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).

Accordingly, nucleic acid sequences provided herein, including, but not limited to, those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to, such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position.

Certain compounds described herein (e.g. modified oligonucleotides) have one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or (3, such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Likewise, all tautomeric forms of the compounds provided herein are included unless otherwise indicated. Unless otherwise indicated, oligomeric compounds and modified oligonucleotides described herein are intended to include corresponding salt forms.

Compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of 1H, 13C or 14C in place of 12C, 15N in place of 14N, 17O or 18O in place of 16O, and 33S, 34S, 35S, or 36S in place of 32S.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Antisense Inhibition of Human IRF5 in THP-1 Cells by cEt Gapmers

Modified oligonucleotides were designed to target an IRF5 nucleic acid and were tested for their effect on IRF5 RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted in the human gene sequence. Most of the modified oligonucleotide listed in the Tables below are targeted to either human IRF5 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001098627.3) or to human IRF5 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT_007933.14 truncated from nucleotides 53761170 to 53774065). In addition, a small number of modified oligonucleotides are targeted to IRF5 mRNA designated herein as SEQ ID No: 3 (GENBANK Accession No. NM_001098629.1). ‘N/A’ indicates that the modified oligonucleotide does not target that gene sequence with 100% complementarity.

Cultured THP-1 cells at a density of 30,000 cells per well were transfected using electroporation with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and IRF5 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set HTS4167 (forward sequence GCCAAGGAGACAGGGAAATACA, designated herein as SEQ ID NO: 11; reverse sequence GCAGGTTGGCCTTCCACTT; designated herein as SEQ ID NO: 12; probe sequence CGAAGGCGTGGATGAAGCCGATC, designated herein as SEQ ID NO: 13) was used to measure RNA levels. IRF5 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of IRF5 relative to untreated control cells. As used herein, a value of ‘0’ indicates that treatment with the modified oligonucleotide did not inhibit IRF5 mRNA levels. ‘N.D.’ indicates that the % inhibition is not defined for that modified oligonucleotide in that experiment. Activity of that modified oligonucleotide may be defined in a different experiment.

TABLE 1 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665773 N/A N/A 4534 4549 GGTTCATGGCAGAGGG 46 37 665775 N/A N/A 4545 4560 TGGGATGGACTGGTTC 35 38 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 70 39 728374 N/A N/A 402 417 CCGCCAACCTGCCGGG 3 40 728375 N/A N/A 404 419 GTCCGCCAACCTGCCG 0 41 728376 N/A N/A 408 423 GCCGGTCCGCCAACCT 12 42 728377 N/A N/A 410 425 CCGCCGGTCCGCCAAC 0 43 728378 N/A N/A 412 427 TCCCGCCGGTCCGCCA 7 44 728379 N/A N/A 414 429 CCTCCCGCCGGTCCGC 7 45 728380 N/A N/A 416 431 CGCCTCCCGCCGGTCC 18 46 728381 N/A N/A 418 433 TGCGCCTCCCGCCGGT 9 47 728382 N/A N/A 430 445 CTCTGCCCAGGCTGCG 17 48 728383 N/A N/A 440 455 CCAAGCTGAGCTCTGC 29 49 728384 N/A N/A 442 457 GACCAAGCTGAGCTCT 22 50 728385 N/A N/A 445 460 CGGGACCAAGCTGAGC 17 51 728386 N/A N/A 447 462 GGCGGGACCAAGCTGA 0 52 728387 N/A N/A 450 465 GGCGGCGGGACCAAGC 6 53 728388 N/A N/A 459 474 CACCGGCCGGGCGGCG 0 54 728389 N/A N/A 461 476 AGCACCGGCCGGGCGG 0 55 728390 N/A N/A 463 478 GGAGCACCGGCCGGGC 9 56 728391 N/A N/A 466 481 CAGGGAGCACCGGCCG 15 57 728392 N/A N/A 468 483 GCCAGGGAGCACCGGC 0 58 728393 N/A N/A 470 485 GCGCCAGGGAGCACCG 4 59 728394 N/A N/A 472 487 CTGCGCCAGGGAGCAC 4 60 728395 N/A N/A 474 489 GGCTGCGCCAGGGAGC N.D. 61 728396 N/A N/A 476 491 GTGGCTGCGCCAGGGA 8 62 728397 N/A N/A 492 507 TCTGCGGTGCGCCTGC 25 63 728398 N/A N/A 494 509 TGTCTGCGGTGCGCCT 31 64 728401 210 225 4535 4550 TGGTTCATGGCAGAGG 50 65 728402 211 226 4536 4551 CTGGTTCATGGCAGAG 44 66 728403 213 228 4538 4553 GACTGGTTCATGGCAG 25 67 728404 214 229 4539 4554 GGACTGGTTCATGGCA 32 68 728405 216 231 4541 4556 ATGGACTGGTTCATGG 49 69 728406 217 232 4542 4557 GATGGACTGGTTCATG 42 70 728407 218 233 4543 4558 GGATGGACTGGTTCAT 47 71 728408 219 234 4544 4559 GGGATGGACTGGTTCA 53 72 728409 223 238 4548 4563 CACTGGGATGGACTGG 40 73 728410 225 240 4550 4565 GCCACTGGGATGGACT 16 74 728411 227 242 4552 4567 GAGCCACTGGGATGGA 40 75 728412 253 268 4578 4593 CAGCCGCACGCGGCGG 6 76 728413 255 270 4580 4595 TTCAGCCGCACGCGGC 44 77 728414 257 272 4582 4597 GCTTCAGCCGCACGCG 27 78 728415 259 274 4584 4599 GGGCTTCAGCCGCACG 8 79 728416 284 299 4609 4624 AGCTGTTCACCTGGGC 5 80 728417 286 301 4611 4626 GCAGCTGTTCACCTGG 3 81 728418 288 303 4613 4628 TGGCAGCTGTTCACCT 0 82 728419 290 305 4615 4630 ACTGGCAGCTGTTCAC 5 83 728420 292 307 4617 4632 GTACTGGCAGCTGTTC 0 84 728421 294 309 4619 4634 GGGTACTGGCAGCTGT 9 85 728422 296 311 4621 4636 CTGGGTACTGGCAGCT 0 86 728423 298 313 4623 4638 CCCTGGGTACTGGCAG 24 87 728424 300 315 4625 4640 AGCCCTGGGTACTGGC 0 88 728425 302 317 4627 4642 GAAGCCCTGGGTACTG 0 89 728426 304 319 4629 4644 TTGAAGCCCTGGGTAC 11 90 728427 306 321 4631 4646 CATTGAAGCCCTGGGT 13 91 728428 308 323 4633 4648 CCCATTGAAGCCCTGG 15 92 728429 310 325 4635 4650 GACCCATTGAAGCCCT 14 93 728430 312 327 4637 4652 TTGACCCATTGAAGCC 11 94 728431 314 329 4639 4654 CGTTGACCCATTGAAG 0 95 728432 316 331 4641 4656 CCCGTTGACCCATTGA 25 96 728433 318 333 4643 4658 TCCCCGTTGACCCATT 6 97 728434 320 335 4645 4660 TTTCCCCGTTGACCCA 20 98 728435 322 337 4647 4662 CTTTTCCCCGTTGACC 12 99 728436 324 339 4649 4664 TTCTTTTCCCCGTTGA 13 100 728437 326 341 4651 4666 ATTTCTTTTCCCCGTT 7 101 728438 328 343 4653 4668 TAATTTCTTTTCCCCG 19 102 728439 356 371 4681 4696 TTGTGGCATGCCTCCA 25 103 728440 358 373 4683 4698 CCTTGTGGCATGCCTC 31 104 728441 360 375 4685 4700 TGCCTTGTGGCATGCC 7 105 728442 362 377 4687 4702 CATGCCTTGTGGCATG 5 106 728443 364 379 4689 4704 ACCATGCCTTGTGGCA 5 107 728444 366 381 4691 4706 GGACCATGCCTTGTGG 6 108 728445 368 383 4693 4708 TGGGACCATGCCTTGT 10 109 728446 371 386 4696 4711 GGCTGGGACCATGCCT 0 110 728447 377 392 4702 4717 CGTCCTGGCTGGGACC 2 111 728448 380 395 4705 4720 CTCCGTCCTGGCTGGG 18 112

TABLE 2 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665795 385 400 4710 4725 GTTATCTCCGTCCTGG 58 113 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 75 39 728449 381 396 4706 4721 TCTCCGTCCTGGCTGG 2 114 728450 382 397 4707 4722 ATCTCCGTCCTGGCTG 3 115 728451 383 398 4708 4723 TATCTCCGTCCTGGCT 0 116 728452 384 399 4709 4724 TTATCTCCGTCCTGGC 11 117 728453 386 401 4711 4726 TGTTATCTCCGTCCTG 14 118 728454 387 402 4712 4727 GTGTTATCTCCGTCCT 27 119 728455 388 403 4713 4728 GGTGTTATCTCCGTCC 18 120 728456 389 404 4714 4729 TGGTGTTATCTCCGTC 31 121 728457 390 405 4715 4730 ATGGTGTTATCTCCGT 17 122 728458 392 407 4717 4732 AGATGGTGTTATCTCC 50 123 728459 394 409 4719 4734 GAAGATGGTGTTATCT 14 124 728460 396 411 4721 4736 TTGAAGATGGTGTTAT 15 125 728461 398 413 4723 4738 CCTTGAAGATGGTGTT 29 126 728462 400 415 N/A N/A GGCCTTGAAGATGGTG 4 127 728492 490 505 8383 8398 CTTGTTAAGGGCACAG 26 128 728493 491 506 8384 8399 TCTTGTTAAGGGCACA 30 129 728494 492 507 8385 8400 CTCTTGTTAAGGGCAC 45 130 728495 494 509 8387 8402 GGCTCTTGTTAAGGGC 17 131 728496 496 511 8389 8404 CCGGCTCTTGTTAAGG 5 132 728497 498 513 8391 8406 TCCCGGCTCTTGTTAA 14 133 728498 500 515 8393 8408 AGTCCCGGCTCTTGTT 57 134 728499 502 517 8395 8410 GAAGTCCCGGCTCTTG 45 135 728500 504 519 8397 8412 CGGAAGTCCCGGCTCT 43 136 728501 506 521 8399 8414 GGCGGAAGTCCCGGCT 13 137 728502 508 523 8401 8416 GAGGCGGAAGTCCCGG 35 138 728503 510 525 8403 8418 ATGAGGCGGAAGTCCC 23 139 728504 512 527 8405 8420 AGATGAGGCGGAAGTC 21 140 728505 514 529 8407 8422 GTAGATGAGGCGGAAG 29 141 728506 538 553 8431 8446 AGGTGGCATGTCCCGG 41 142 728507 540 555 8433 8448 TGAGGTGGCATGTCCC 40 143 728508 542 557 8435 8450 GCTGAGGTGGCATGTC 33 144 728509 544 559 8437 8452 GGGCTGAGGTGGCATG 44 145 728510 546 561 8439 8454 TAGGGCTGAGGTGGCA 41 146 728511 552 567 8445 8460 ATCTTGTAGGGCTGAG 29 147 728512 554 569 8447 8462 AGATCTTGTAGGGCTG 45 148 728513 556 571 8449 8464 GTAGATCTTGTAGGGC 36 149 728514 572 587 8465 8480 CATTGGAGCAGACCTC 0 150 728515 574 589 8467 8482 GCCATTGGAGCAGACC 13 151 728516 576 591 8469 8484 GGGCCATTGGAGCAGA 15 152 728517 578 593 8471 8486 CAGGGCCATTGGAGCA 15 153 728518 580 595 8473 8488 AGCAGGGCCATTGGAG 13 154 728519 582 597 8475 8490 GGAGCAGGGCCATTGG 24 155 728520 591 606 N/A N/A GAGTCTGTGGGAGCAG 35 156 728521 614 629 8973 8988 AAGAGTAATCCTCAGG 22 157 728522 616 631 8975 8990 AAAAGAGTAATCCTCA 0 158 728523 618 633 8977 8992 CCAAAAGAGTAATCCT 6 159 728524 620 635 8979 8994 CACCAAAAGAGTAATC 1 160

TABLE 3 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 75 39 665985 1981 1996 11546 11561 CTCCTATACAGCTAGG 49 161 665987 1993 2008 11558 11573 CTTAGGCAATTCCTCC 50 162 666005 2159 2174 11724 11739 CTAAGTGCTCACTCAT 64 163 666007 2183 2198 11748 11763 AGCCTTGAGCATCTGA 63 164 666009 2186 2201 11751 11766 GCCAGCCTTGAGCATC 50 165 728956 1977 1992 11542 11557 TATACAGCTAGGCCCC 32 166 728957 1978 1993 11543 11558 CTATACAGCTAGGCCC 43 167 728958 1979 1994 11544 11559 CCTATACAGCTAGGCC 68 168 728959 1980 1995 11545 11560 TCCTATACAGCTAGGC 39 169 728960 1982 1997 11547 11562 CCTCCTATACAGCTAG 48 170 728961 1983 1998 11548 11563 TCCTCCTATACAGCTA 46 171 728962 1984 1999 11549 11564 TTCCTCCTATACAGCT 60 172 728963 1985 2000 11550 11565 ATTCCTCCTATACAGC 35 173 728964 1986 2001 11551 11566 AATTCCTCCTATACAG 28 174 728965 1988 2003 11553 11568 GCAATTCCTCCTATAC 61 175 728966 1989 2004 11554 11569 GGCAATTCCTCCTATA 60 176 728967 1992 2007 11557 11572 TTAGGCAATTCCTCCT 51 177 728968 1994 2009 11559 11574 CCTTAGGCAATTCCTC 64 178 728969 1995 2010 11560 11575 CCCTTAGGCAATTCCT 68 179 728970 1996 2011 11561 11576 ACCCTTAGGCAATTCC 77 180 728971 1998 2013 11563 11578 CCACCCTTAGGCAATT 46 181 728972 2000 2015 11565 11580 GGCCACCCTTAGGCAA 62 182 728973 2003 2018 11568 11583 GTGGGCCACCCTTAGG 58 183 728974 2006 2021 11571 11586 AGAGTGGGCCACCCTT 33 184 728975 2008 2023 11573 11588 CAAGAGTGGGCCACCC 45 185 728976 2010 2025 11575 11590 CACAAGAGTGGGCCAC 37 186 728977 2012 2027 11577 11592 ATCACAAGAGTGGGCC 52 187 728978 2014 2029 11579 11594 CAATCACAAGAGTGGG 59 188 728979 2016 2031 11581 11596 GGCAATCACAAGAGTG 47 189 728980 2033 2048 11598 11613 GTTGCCAGAGGAAATG 13 190 728981 2035 2050 11600 11615 TTGTTGCCAGAGGAAA 15 191 728982 2037 2052 11602 11617 TTTTGTTGCCAGAGGA 19 192 728983 2040 2055 11605 11620 GGCTTTTGTTGCCAGA 17 193 728984 2047 2062 11612 11627 ACACTCTGGCTTTTGT 11 194 728985 2049 2064 11614 11629 CAACACTCTGGCTTTT 0 195 728986 2051 2066 11616 11631 CACAACACTCTGGCTT 44 196 728987 2059 2074 11624 11639 ACTTGGCCCACAACAC 9 197 728988 2061 2076 11626 11641 GGACTTGGCCCACAAC 29 198 728989 2086 2101 11651 11666 CATGCCCTGCAGAGGC 44 199 728990 2095 2110 11660 11675 AATCAGGGCCATGCCC 0 200 728991 2097 2112 11662 11677 GAAATCAGGGCCATGC 9 201 728992 2106 2121 11671 11686 CAAACCAGGGAAATCA 26 202 728993 2108 2123 11673 11688 CTCAAACCAGGGAAAT 51 203 728994 2110 2125 11675 11690 GTCTCAAACCAGGGAA 63 204 728995 2112 2127 11677 11692 GAGTCTCAAACCAGGG 61 205 728996 2114 2129 11679 11694 GTGAGTCTCAAACCAG 71 206 728997 2117 2132 11682 11697 GAAGTGAGTCTCAAAC 58 207 728998 2119 2134 11684 11699 AGGAAGTGAGTCTCAA 68 208 728999 2121 2136 11686 11701 TGAGGAAGTGAGTCTC 20 209 729000 2141 2156 11706 11721 TATCTCAGAGGACAGG 63 210 729001 2143 2158 11708 11723 ATTATCTCAGAGGACA 67 211 729002 2145 2160 11710 11725 ATATTATCTCAGAGGA 61 212 729003 2148 2163 11713 11728 CTCATATTATCTCAGA 64 213 729004 2152 2167 11717 11732 CTCACTCATATTATCT 50 214 729005 2154 2169 11719 11734 TGCTCACTCATATTAT 20 215 729006 2155 2170 11720 11735 GTGCTCACTCATATTA 53 216 729007 2156 2171 11721 11736 AGTGCTCACTCATATT 38 217 729008 2157 2172 11722 11737 AAGTGCTCACTCATAT 44 218 729009 2158 2173 11723 11738 TAAGTGCTCACTCATA 45 219 729010 2160 2175 11725 11740 CCTAAGTGCTCACTCA 63 220 729011 2161 2176 11726 11741 ACCTAAGTGCTCACTC 64 221 729012 2162 2177 11727 11742 TACCTAAGTGCTCACT 34 222 729013 2163 2178 11728 11743 ATACCTAAGTGCTCAC 56 223 729014 2164 2179 11729 11744 GATACCTAAGTGCTCA 60 224 729015 2166 2181 11731 11746 ATGATACCTAAGTGCT 57 225 729016 2168 2183 11733 11748 ATATGATACCTAAGTG 53 226 729017 2170 2185 11735 11750 TGATATGATACCTAAG 46 227 729018 2172 2187 11737 11752 TCTGATATGATACCTA 71 228 729019 2174 2189 11739 11754 CATCTGATATGATACC 63 229 729020 2176 2191 11741 11756 AGCATCTGATATGATA 65 230 729021 2178 2193 11743 11758 TGAGCATCTGATATGA 60 231 729022 2179 2194 11744 11759 TTGAGCATCTGATATG 37 232 729023 2180 2195 11745 11760 CTTGAGCATCTGATAT 36 233 729024 2181 2196 11746 11761 CCTTGAGCATCTGATA 56 234 729025 2182 2197 11747 11762 GCCTTGAGCATCTGAT 54 235 729026 2185 2200 11750 11765 CCAGCCTTGAGCATCT 51 236 729027 2187 2202 11752 11767 TGCCAGCCTTGAGCAT 14 237

TABLE 4 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665830 680 695 9499 9514 TGAGGCTCAGGCTTGG 65 238 665840 715 730 9755 9770 CGGCTGCAGAGTGGGC 43 239 760 775 9800 9815 665842 717 732 9757 9772 GGCGGCTGCAGAGTGG 43 240 762 777 9802 9817 665843 718 733 9758 9773 GGGCGGCTGCAGAGTG 53 241 763 778 9803 9818 665845 720 735 9760 9775 GTGGGCGGCTGCAGAG 43 242 750 765 9790 9805 665846 721 736 9761 9776 AGTGGGCGGCTGCAGA 28 243 751 766 9791 9806 665847 722 737 9762 9777 GAGTGGGCGGCTGCAG 24 244 752 767 9792 9807 665848 724 739 9764 9779 CAGAGTGGGCGGCTGC 40 245 754 769 9794 9809 665853 725 740 9765 9780 GCAGAGTGGGCGGCTG 11 246 755 770 9795 9810 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 72 39 728525 622 637 8981 8996 TGCACCAAAAGAGTAA 22 247 728526 624 639 8983 8998 CCTGCACCAAAAGAGT 31 248 728527 626 641 8985 9000 CTCCTGCACCAAAAGA 39 249 728528 628 643 8987 9002 CTCTCCTGCACCAAAA 31 250 728529 663 678 9482 9497 AACATCCTCTGCAGCT 29 251 728530 666 681 9485 9500 GGCAACATCCTCTGCA 36 252 728531 668 683 9487 9502 TTGGCAACATCCTCTG 45 253 728532 670 685 9489 9504 GCTTGGCAACATCCTC 53 254 728533 672 687 9491 9506 AGGCTTGGCAACATCC 66 255 728534 675 690 9494 9509 CTCAGGCTTGGCAACA 42 256 728535 678 693 9497 9512 AGGCTCAGGCTTGGCA 60 257 728536 681 696 9500 9515 GTGAGGCTCAGGCTTG 44 258 728537 682 697 9501 9516 TGTGAGGCTCAGGCTT 34 259 728538 684 699 N/A N/A TCTGTGAGGCTCAGGC 41 260 728544 N/A N/A 9690 9705 CAGACTGCACTGCATC 29 261 728545 N/A N/A 9692 9707 GCCAGACTGCACTGCA 8 262 728546 N/A N/A 9694 9709 GGGCCAGACTGCACTG 28 263 728547 N/A N/A 9711 9726 AATAGGGTGTCATGTG 6 264 728548 N/A N/A 9713 9728 AGAATAGGGTGTCATG 0 265 728549 N/A N/A 9715 9730 AAAGAATAGGGTGTCA 17 266 728550 N/A N/A 9717 9732 GTAAAGAATAGGGTGT 14 267 728551 N/A N/A 9719 9734 GAGTAAAGAATAGGGT 24 268 728552 N/A N/A 9721 9736 TTGAGTAAAGAATAGG 12 269 728553 N/A N/A 9723 9738 CTTTGAGTAAAGAATA 8 270 728554 N/A N/A 9725 9740 CTCTTTGAGTAAAGAA 0 271 728555 N/A N/A 9727 9742 TCCTCTTTGAGTAAAG 14 272 728556 N/A N/A 9729 9744 CATCCTCTTTGAGTAA 21 273 728557 N/A N/A 9731 9746 GACATCCTCTTTGAGT 11 274 728558 N/A N/A 9733 9748 TTGACATCCTCTTTGA 32 275 728559 N/A N/A 9735 9750 ACTTGACATCCTCTTT 16 276 728560 699 714 9739 9754 GGCCACTTGACATCCT 6 277 728561 701 716 9741 9756 GCGGCCACTTGACATC 31 278 728562 703 718 9743 9758 GGGCGGCCACTTGACA 13 279 728563 705 720 9745 9760 GTGGGCGGCCACTTGA 40 280 728564 707 722 9747 9762 GAGTGGGCGGCCACTT 12 281 728565 709 724 9749 9764 CAGAGTGGGCGGCCAC 38 282 728566 711 726 9751 9766 TGCAGAGTGGGCGGCC 21 283 728567 726 741 9766 9781 CGCAGAGTGGGCGGCT 18 284 728568 727 742 9767 9782 CCGCAGAGTGGGCGGC 17 285 728569 731 746 9771 9786 GCGGCCGCAGAGTGGG 4 286 728570 733 748 9773 9788 AGGCGGCCGCAGAGTG 20 287 728571 735 750 9775 9790 GTAGGCGGCCGCAGAG 14 288 728572 737 752 9777 9792 GAGTAGGCGGCCGCAG 11 289 728573 739 754 9779 9794 CAGAGTAGGCGGCCGC 25 290 728574 741 756 9781 9796 TGCAGAGTAGGCGGCC 12 291 728575 743 758 9783 9798 GCTGCAGAGTAGGCGG 44 292 728576 745 760 9785 9800 CGGCTGCAGAGTAGGC 37 293 728577 747 762 9787 9802 GGCGGCTGCAGAGTAG 45 294 728578 756 771 9796 9811 TGCAGAGTGGGCGGCT 9 295 728579 764 779 9804 9819 CGGGCGGCTGCAGAGT 61 296 728580 765 780 9805 9820 ACGGGCGGCTGCAGAG 28 297 728581 767 782 9807 9822 CCACGGGCGGCTGCAG 17 298 728582 768 783 9808 9823 ACCACGGGCGGCTGCA 29 299 728583 769 784 9809 9824 CACCACGGGCGGCTGC 26 300 728584 771 786 9811 9826 AGCACCACGGGCGGCT 7 301 728585 773 788 9813 9828 CCAGCACCACGGGCGG 41 302 728586 775 790 9815 9830 ACCCAGCACCACGGGC 19 303 728587 777 792 9817 9832 GGACCCAGCACCACGG 41 304 728588 830 845 9870 9885 AGCCAGCAGGGTTGCC 26 305 728589 832 847 9872 9887 GAAGCCAGCAGGGTTG 16 306 728590 834 849 9874 9889 CTGAAGCCAGCAGGGT 26 307 728591 845 860 9885 9900 AGAGAAGCTCCCTGAA 8 308 728592 849 864 9889 9904 TCAGAGAGAAGCTCCC 3 309

TABLE 5 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 642685 1098 1113 10331 10346 AAGCGCACTTGCTCCA 33 310 665862 913 928 9953 9968 GTCTGGCAGGAGCTGT 51 311 665878 1096 1111 10329 10344 GCGCACTTGCTCCAGG 58 312 665884 1181 1196 10414 10429 GGATGAGCCCGCGGTC 56 313 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 76 39 728593 853 868 9893 9908 GACCTCAGAGAGAAGC 10 314 728594 862 877 9902 9917 AGGCTCCAGGACCTCA 7 315 728595 902 917 9942 9957 GCTGTTCGCCTGCAGG 59 316 728596 904 919 9944 9959 GAGCTGTTCGCCTGCA 14 317 728597 906 921 9946 9961 AGGAGCTGTTCGCCTG 4 318 728598 908 923 9948 9963 GCAGGAGCTGTTCGCC 44 319 728599 909 924 9949 9964 GGCAGGAGCTGTTCGC 30 320 728600 910 925 9950 9965 TGGCAGGAGCTGTTCG 15 321 728601 911 926 9951 9966 CTGGCAGGAGCTGTTC 34 322 728602 912 927 9952 9967 TCTGGCAGGAGCTGTT 33 323 728603 914 929 9954 9969 GGTCTGGCAGGAGCTG 49 324 728604 915 930 9955 9970 AGGTCTGGCAGGAGCT 60 325 728605 916 931 9956 9971 CAGGTCTGGCAGGAGC 53 326 728606 918 933 9958 9973 AGCAGGTCTGGCAGGA 35 327 728607 922 937 9962 9977 GATCAGCAGGTCTGGC 17 328 728608 924 939 9964 9979 CTGATCAGCAGGTCTG 34 329 728609 926 941 9966 9981 GGCTGATCAGCAGGTC 38 330 728610 945 960 N/A N/A GTCAGAGGCAGCATGT 24 331 728611 947 962 N/A N/A CGGTCAGAGGCAGCAT 54 332 728612 949 964 N/A N/A GTCGGTCAGAGGCAGC 44 333 728613 952 967 N/A N/A CAGGTCGGTCAGAGGC 47 334 728614 954 969 N/A N/A TCCAGGTCGGTCAGAG 24 335 728615 1001 1016 10234 10249 TGATGGTGAGGGCCCG 18 336 728616 1003 1018 10236 10251 GCTGATGGTGAGGGCC 14 337 728617 1005 1020 10238 10253 TTGCTGATGGTGAGGG 37 338 728618 1024 1039 10257 10272 GAGCCGGCAGCCATGG 13 339 728619 1032 1047 10265 10280 CTGTAGAAGAGCCGGC 0 340 728620 1034 1049 10267 10282 GGCTGTAGAAGAGCCG 0 341 728621 1036 1051 10269 10284 CTGGCTGTAGAAGAGC 21 342 728622 1038 1053 10271 10286 AGCTGGCTGTAGAAGA 9 343 728623 1040 1055 10273 10288 CCAGCTGGCTGTAGAA 5 344 728624 1067 1082 10300 10315 AGAGTTCCACCTGCTC 23 345 728625 1069 1084 10302 10317 GAAGAGTTCCACCTGC 14 346 728626 1072 1087 10305 10320 GCCGAAGAGTTCCACC 22 347 728627 1074 1089 10307 10322 GGGCCGAAGAGTTCCA 13 348 728628 1091 1106 10324 10339 CTTGCTCCAGGCTTAT 24 349 728629 1093 1108 10326 10341 CACTTGCTCCAGGCTT 46 350 728630 1094 1109 10327 10342 GCACTTGCTCCAGGCT 66 351 728631 1095 1110 10328 10343 CGCACTTGCTCCAGGC 62 352 728632 1097 1112 10330 10345 AGCGCACTTGCTCCAG 55 353 728633 1099 1114 10332 10347 GAAGCGCACTTGCTCC 43 354 728634 1100 1115 10333 10348 GGAAGCGCACTTGCTC 57 355 728635 1101 1116 10334 10349 GGGAAGCGCACTTGCT 59 356 728636 1117 1132 10350 10365 GATGTCCTCAGGGCTG 22 357 728637 1134 1149 10367 10382 CGCTGCTTGTCACTGG 67 358 728638 1161 1176 10394 10409 ACATCCAGCAGCTGGT 0 359 728639 1163 1178 10396 10411 GGACATCCAGCAGCTG 8 360 728640 1170 1185 10403 10418 CGGTCCAGGACATCCA 32 361 728641 1172 1187 10405 10420 CGCGGTCCAGGACATC 47 362 728642 1174 1189 10407 10422 CCCGCGGTCCAGGACA 11 363 728643 1176 1191 10409 10424 AGCCCGCGGTCCAGGA 20 364 728644 1177 1192 10410 10425 GAGCCCGCGGTCCAGG 48 365 728645 1179 1194 10412 10427 ATGAGCCCGCGGTCCA 44 366 728646 1180 1195 10413 10428 GATGAGCCCGCGGTCC 59 367 728647 1182 1197 10415 10430 AGGATGAGCCCGCGGT 49 368 728648 1183 1198 10416 10431 GAGGATGAGCCCGCGG 36 369 728649 1184 1199 10417 10432 GGAGGATGAGCCCGCG 14 370 728650 1185 1200 10418 10433 TGGAGGATGAGCCCGC 27 371 728651 1186 1201 10419 10434 CTGGAGGATGAGCCCG 17 372 728652 1188 1203 10421 10436 AGCTGGAGGATGAGCC 0 373 728653 1190 1205 10423 10438 GTAGCTGGAGGATGAG 13 374 728654 1192 1207 10425 10440 CTGTAGCTGGAGGATG 3 375 728655 1194 1209 10427 10442 CCCTGTAGCTGGAGGA 4 376 728656 1196 1211 10429 10444 GGCCCTGTAGCTGGAG 24 377 728657 1198 1213 10431 10446 CTGGCCCTGTAGCTGG 9 378 728658 1201 1216 10434 10449 GTCCTGGCCCTGTAGC 25 379 728659 1203 1218 10436 10451 AGGTCCTGGCCCTGTA 43 380 728660 1205 1220 10438 10453 AAAGGTCCTGGCCCTG 23 381 728661 1207 1222 10440 10455 ATAAAGGTCCTGGCCC 10 382 728662 1209 1224 10442 10457 GCATAAAGGTCCTGGC 31 383 728663 1211 1226 10444 10459 TGGCATAAAGGTCCTG 46 384 728664 1213 1228 10446 10461 GATGGCATAAAGGTCC 42 385 728665 1215 1230 10448 10463 CGGATGGCATAAAGGT 39 386

TABLE 6 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665892 1227 1242 10460 10475 CACTGACACAGGCGGA 68 387 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 65 39 665894 1229 1244 10462 10477 TGCACTGACACAGGCG 42 388 665895 1242 1257 10475 10490 CTCCAGAACACCTTGC 44 389 665900 1272 1287 10505 10520 CATGAGTCATGGGCTG 54 390 665902 1301 1316 10534 10549 TCTTGACCTCCCGCTG 37 391 665903 1309 1324 10542 10557 AAGCTTGGTCTTGACC 49 392 665908 1363 1378 10684 10699 GGTCTGGCCCTTTTGG 66 393 728666 1217 1232 10450 10465 GGCGGATGGCATAAAG 32 394 728667 1223 1238 10456 10471 GACACAGGCGGATGGC 49 395 728668 1224 1239 10457 10472 TGACACAGGCGGATGG 27 396 728669 1226 1241 10459 10474 ACTGACACAGGCGGAT 51 397 728670 1230 1245 10463 10478 TTGCACTGACACAGGC 68 398 728671 1231 1246 10464 10479 CTTGCACTGACACAGG 42 399 728672 1232 1247 10465 10480 CCTTGCACTGACACAG 56 400 728673 1233 1248 10466 10481 ACCTTGCACTGACACA 60 401 728674 1234 1249 10467 10482 CACCTTGCACTGACAC 57 402 728675 1237 1252 10470 10485 GAACACCTTGCACTGA 34 403 728676 1238 1253 10471 10486 AGAACACCTTGCACTG 39 404 728677 1239 1254 10472 10487 CAGAACACCTTGCACT 25 405 728678 1240 1255 10473 10488 CCAGAACACCTTGCAC 30 406 728679 1241 1256 10474 10489 TCCAGAACACCTTGCA 39 407 728680 1243 1258 10476 10491 GCTCCAGAACACCTTG 39 408 728681 1244 1259 10477 10492 CGCTCCAGAACACCTT 59 409 728682 1245 1260 10478 10493 CCGCTCCAGAACACCT 37 410 728683 1246 1261 10479 10494 CCCGCTCCAGAACACC 41 411 728684 1247 1262 10480 10495 GCCCGCTCCAGAACAC 19 412 728685 1249 1264 10482 10497 AGGCCCGCTCCAGAAC 24 413 728686 1251 1266 10484 10499 CAAGGCCCGCTCCAGA 28 414 728687 1253 1268 10486 10501 CACAAGGCCCGCTCCA 16 415 728688 1255 1270 10488 10503 GGCACAAGGCCCGCTC 12 416 728689 1257 1272 10490 10505 GAGGCACAAGGCCCGC 17 417 728690 1259 1274 10492 10507 CTGAGGCACAAGGCCC 13 418 728691 1264 1279 10497 10512 ATGGGCTGAGGCACAA 42 419 728692 1267 1282 10500 10515 GTCATGGGCTGAGGCA 51 420 728693 1268 1283 10501 10516 AGTCATGGGCTGAGGC 52 421 728694 1269 1284 10502 10517 GAGTCATGGGCTGAGG 59 422 728695 1270 1285 10503 10518 TGAGTCATGGGCTGAG 67 423 728696 1271 1286 10504 10519 ATGAGTCATGGGCTGA 75 424 728697 1273 1288 10506 10521 GCATGAGTCATGGGCT 23 425 728698 1274 1289 10507 10522 GGCATGAGTCATGGGC 47 426 728699 1296 1311 10529 10544 ACCTCCCGCTGGATGG 45 427 728700 1297 1312 10530 10545 GACCTCCCGCTGGATG 38 428 728701 1298 1313 10531 10546 TGACCTCCCGCTGGAT 53 429 728702 1299 1314 10532 10547 TTGACCTCCCGCTGGA 38 430 728703 1300 1315 10533 10548 CTTGACCTCCCGCTGG 33 431 728704 1302 1317 10535 10550 GTCTTGACCTCCCGCT 56 432 728705 1303 1318 10536 10551 GGTCTTGACCTCCCGC 71 433 728706 1306 1321 10539 10554 CTTGGTCTTGACCTCC 73 434 728707 1307 1322 10540 10555 GCTTGGTCTTGACCTC 79 435 728708 1308 1323 10541 10556 AGCTTGGTCTTGACCT 79 436 728709 1310 1325 10543 10558 AAAGCTTGGTCTTGAC 46 437 728710 1311 1326 10544 10559 AAAAGCTTGGTCTTGA 29 438 728711 1312 1327 10545 10560 GAAAAGCTTGGTCTTG 24 439 728712 1313 1328 10546 10561 TGAAAAGCTTGGTCTT 11 440 728713 1314 1329 10547 10562 CTGAAAAGCTTGGTCT 13 441 728714 1316 1331 10549 10564 GGCTGAAAAGCTTGGT 11 442 728715 1318 1333 10551 10566 CAGGCTGAAAAGCTTG 1 443 728716 1320 1335 10553 10568 TCCAGGCTGAAAAGCT 5 444 728717 1340 1355 N/A N/A TGAGCTCATTGAGAAA 10 445 728718 1342 1357 N/A N/A GATGAGCTCATTGAGA 33 446 728719 1344 1359 N/A N/A AGGATGAGCTCATTGA 55 447 728720 1346 1361 N/A N/A ACAGGATGAGCTCATT 41 448 728721 1348 1363 N/A N/A GAACAGGATGAGCTCA 45 449 728722 1350 1365 10671 10686 TGGAACAGGATGAGCT 47 450 728723 1358 1373 10679 10694 GGCCCTTTTGGAACAG 29 451 728724 1359 1374 10680 10695 TGGCCCTTTTGGAACA 34 452 728725 1360 1375 10681 10696 CTGGCCCTTTTGGAAC 20 453 728726 1361 1376 10682 10697 TCTGGCCCTTTTGGAA 14 454 728727 1362 1377 10683 10698 GTCTGGCCCTTTTGGA 33 455 728728 1364 1379 10685 10700 TGGTCTGGCCCTTTTG 56 456 728729 1365 1380 10686 10701 TTGGTCTGGCCCTTTT 54 457 728730 1366 1381 10687 10702 GTTGGTCTGGCCCTTT 53 458 728731 1367 1382 10688 10703 TGTTGGTCTGGCCCTT 50 459 728732 1368 1383 10689 10704 GTGTTGGTCTGGCCCT 47 460 728733 1386 1401 10707 10722 ATCTCGAAGGGTGGTG 40 461 728734 1389 1404 10710 10725 AAGATCTCGAAGGGTG 52 462 728735 1392 1407 10713 10728 AAGAAGATCTCGAAGG 28 463

TABLE 7 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 73  39 665925 1506 1521 11071 11086 GATAGCTCCCCTGAGA 29 464 665926 1512 1527 11077 11092 GACCAAGATAGCTCCC 50 465 665929 1530 1545 11095 11110 AGCCGGATACTATCAG 49 466 665930 1536 1551 11101 11116 ATCTGTAGCCGGATAC 39 467 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 62 468 728736 1394 1409 10715 10730 AGAAGAAGATCTCGAA 13 469 728737 1396 1411 10717 10732 GCAGAAGAAGATCTCG 45 470 728738 1419 1434 10740 10755 CGGTCAGGCCATTCTT 52 471 728739 1421 1436 10742 10757 TGCGGTCAGGCCATTC 68 472 728740 1423 1438 10744 10759 TTTGCGGTCAGGCCAT 37 473 728741 1426 1441 10747 10762 GGGTTTGCGGTCAGGC 71 474 728742 1441 1456 10762 10777 GAGCTTCTTCTCTCGG 22 475 728743 1443 1458 10764 10779 ATGAGCTTCTTCTCTC  0 476 728744 1445 1460 10766 10781 TAATGAGCTTCTTCTC 14 477 728745 1447 1462 10768 10783 AGTAATGAGCTTCTTC 36 478 728746 1449 1464 10770 10785 ACAGTAATGAGCTTCT 30 479 728747 1451 1466 10772 10787 GTACAGTAATGAGCTT 26 480 728748 1453 1468 10774 10789 CTGTACAGTAATGAGC 37 481 728749 1455 1470 10776 10791 ACCTGTACAGTAATGA 28 482 728750 1457 1472 N/A N/A CCACCTGTACAGTAAT 27 483 728751 1459 1474 N/A N/A CACCACCTGTACAGTA 42 484 728752 1461 1476 N/A N/A GGCACCACCTGTACAG 27 485 728753 1463 1478 N/A N/A CAGGCACCACCTGTAC 53 486 728754 1465 1480 N/A N/A TACAGGCACCACCTGT  0 487 728755 1467 1482 11032 11047 GCTACAGGCACCACCT 37 488 728756 1469 1484 11034 11049 CTGCTACAGGCACCAC 53 489 728757 1471 1486 11036 11051 AGCTGCTACAGGCACC 41 490 728758 1473 1488 11038 11053 CGAGCTGCTACAGGCA 54 491 728759 1475 1490 11040 11055 GTCGAGCTGCTACAGG 63 492 728760 1477 1492 11042 11057 CAGTCGAGCTGCTACA 34 493 728761 1479 1494 11044 11059 AGCAGTCGAGCTGCTA  3 494 728762 1481 1496 11046 11061 GCAGCAGTCGAGCTGC 13 495 728763 1483 1498 11048 11063 CAGCAGCAGTCGAGCT 16 496 728764 1485 1500 11050 11065 TCCAGCAGCAGTCGAG 23 497 728765 1487 1502 11052 11067 TCTCCAGCAGCAGTCG 30 498 728766 1489 1504 11054 11069 CATCTCCAGCAGCAGT 31 499 728767 1492 1507 11057 11072 GAACATCTCCAGCAGC 47 500 728768 1495 1510 11060 11075 TGAGAACATCTCCAGC 33 501 728769 1497 1512 11062 11077 CCTGAGAACATCTCCA 60 502 728770 1499 1514 11064 11079 CCCCTGAGAACATCTC 43 503 728771 1501 1516 11066 11081 CTCCCCTGAGAACATC 42 504 728772 1502 1517 11067 11082 GCTCCCCTGAGAACAT 55 505 728773 1503 1518 11068 11083 AGCTCCCCTGAGAACA 54 506 728774 1504 1519 11069 11084 TAGCTCCCCTGAGAAC 29 507 728775 1505 1520 11070 11085 ATAGCTCCCCTGAGAA 15 508 728776 1507 1522 11072 11087 AGATAGCTCCCCTGAG 42 509 728777 1508 1523 11073 11088 AAGATAGCTCCCCTGA 52 510 728778 1509 1524 11074 11089 CAAGATAGCTCCCCTG 64 511 728779 1510 1525 11075 11090 CCAAGATAGCTCCCCT 50 512 728780 1511 1526 11076 11091 ACCAAGATAGCTCCCC 21 513 728781 1513 1528 11078 11093 TGACCAAGATAGCTCC 43 514 728782 1514 1529 11079 11094 CTGACCAAGATAGCTC 51 515 728783 1515 1530 11080 11095 GCTGACCAAGATAGCT 23 516 728784 1516 1531 11081 11096 AGCTGACCAAGATAGC 31 517 728785 1517 1532 11082 11097 CAGCTGACCAAGATAG 34 518 728786 1519 1534 11084 11099 ATCAGCTGACCAAGAT 28 519 728787 1521 1536 11086 11101 CTATCAGCTGACCAAG 48 520 728788 1523 1538 11088 11103 TACTATCAGCTGACCA 49 521 728789 1525 1540 11090 11105 GATACTATCAGCTGAC 58 522 728790 1526 1541 11091 11106 GGATACTATCAGCTGA 51 523 728791 1527 1542 11092 11107 CGGATACTATCAGCTG 55 524 728792 1528 1543 11093 11108 CCGGATACTATCAGCT 41 525 728793 1529 1544 11094 11109 GCCGGATACTATCAGC 68 526 728794 1531 1546 11096 11111 TAGCCGGATACTATCA 40 527 728795 1532 1547 11097 11112 GTAGCCGGATACTATC 48 528 728796 1533 1548 11098 11113 TGTAGCCGGATACTAT 34 529 728797 1534 1549 11099 11114 CTGTAGCCGGATACTA 52 530 728798 1535 1550 11100 11115 TCTGTAGCCGGATACT 53 531 728799 1537 1552 11102 11117 GATCTGTAGCCGGATA 46 532 728800 1538 1553 11103 11118 AGATCTGTAGCCGGAT 67 533 728801 1543 1558 11108 11123 GTTTGAGATCTGTAGC 55 534 728802 1556 1571 11121 11136 CTTTGAGGTCTGGGTT 63 535 728803 1557 1572 11122 11137 TCTTTGAGGTCTGGGT 55 536 728804 1558 1573 11123 11138 GTCTTTGAGGTCTGGG 61 537 728805 1559 1574 11124 11139 GGTCTTTGAGGTCTGG 58 538 728806 1560 1575 11125 11140 CGGTCTTTGAGGTCTG 74 539 728807 1562 1577 11127 11142 TGCGGTCTTTGAGGTC 58 540

TABLE 8 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 72  39 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 62 468 665942 1613 1628 11178 11193 ACCGCTGCTGGGACTG 40 541 728808 1563 1578 11128 11143 ATGCGGTCTTTGAGGT 37 542 728809 1564 1579 11129 11144 CATGCGGTCTTTGAGG 17 543 728810 1565 1580 11130 11145 CCATGCGGTCTTTGAG 43 544 728811 1566 1581 11131 11146 ACCATGCGGTCTTTGA 26 545 728812 1568 1583 11133 11148 CCACCATGCGGTCTTT  9 546 728813 1570 1585 11135 11150 CTCCACCATGCGGTCT 22 547 728814 1572 1587 11137 11152 TGCTCCACCATGCGGT 23 548 728815 1574 1589 11139 11154 ATTGCTCCACCATGCG  0 549 728816 1576 1591 11141 11156 GAATTGCTCCACCATG  0 550 728817 1578 1593 11143 11158 TTGAATTGCTCCACCA  0 551 728818 1580 1595 11145 11160 CCTTGAATTGCTCCAC  0 552 728819 1582 1597 11147 11162 CTCCTTGAATTGCTCC  0 553 728820 1584 1599 11149 11164 AGCTCCTTGAATTGCT  0 554 728821 1586 1601 11151 11166 GGAGCTCCTTGAATTG  0 555 728822 1588 1603 11153 11168 ATGGAGCTCCTTGAAT  2 556 728823 1590 1605 11155 11170 TGATGGAGCTCCTTGA  0 557 728824 1592 1607 11157 11172 TGTGATGGAGCTCCTT  0 558 728825 1594 1609 11159 11174 GATGTGATGGAGCTCC 30 559 728826 1596 1611 11161 11176 CAGATGTGATGGAGCT 27 560 728827 1600 1615 11165 11180 CTGCCAGATGTGATGG  7 561 728828 1602 1617 11167 11182 GACTGCCAGATGTGAT  0 562 728829 1604 1619 11169 11184 GGGACTGCCAGATGTG 31 563 728830 1606 1621 11171 11186 CTGGGACTGCCAGATG 40 564 728831 1608 1623 11173 11188 TGCTGGGACTGCCAGA 24 565 728832 1609 1624 11174 11189 CTGCTGGGACTGCCAG 19 566 728833 1610 1625 11175 11190 GCTGCTGGGACTGCCA 24 567 728834 1612 1627 11177 11192 CCGCTGCTGGGACTGC 37 568 728835 1614 1629 11179 11194 AACCGCTGCTGGGACT 19 569 728836 1616 1631 11181 11196 GCAACCGCTGCTGGGA 38 570 728837 1618 1633 11183 11198 CTGCAACCGCTGCTGG 26 571 728838 1620 1635 11185 11200 GGCTGCAACCGCTGCT  2 572 728839 1624 1639 11189 11204 CACAGGCTGCAACCGC 26 573 728840 1626 1641 11191 11206 GCCACAGGCTGCAACC 21 574 728841 1628 1643 11193 11208 GGGCCACAGGCTGCAA 37 575 728842 1650 1665 11215 11230 AGGCCTGCTCCAGGAG  0 576 728843 1654 1669 11219 11234 ACCAAGGCCTGCTCCA 30 577 728844 1656 1671 11221 11236 ACACCAAGGCCTGCTC 41 578 728845 1659 1674 11224 11239 CCAACACCAAGGCCTG  8 579 728846 1661 1676 11226 11241 GGCCAACACCAAGGCC  0 580 728847 1663 1678 11228 11243 CTGGCCAACACCAAGG 18 581 728848 1666 1681 11231 11246 CCCCTGGCCAACACCA  0 582 728849 1668 1683 11233 11248 GGCCCCTGGCCAACAC  0 583 728850 1670 1685 11235 11250 AGGGCCCCTGGCCAAC 21 584 728851 1676 1691 11241 11256 TAGGCCAGGGCCCCTG  0 585 728852 1678 1693 11243 11258 CATAGGCCAGGGCCCC  0 586 728853 1680 1695 11245 11260 TGCATAGGCCAGGGCC  0 587 728854 1682 1697 11247 11262 GGTGCATAGGCCAGGG  0 588 728855 1684 1699 11249 11264 TGGGTGCATAGGCCAG  0 589 728856 1687 1702 11252 11267 AGCTGGGTGCATAGGC  0 590 728857 1690 1705 11255 11270 GCCAGCTGGGTGCATA 15 591 728858 1693 1708 11258 11273 CATGCCAGCTGGGTGC 28 592 728859 1695 1710 11260 11275 TGCATGCCAGCTGGGT 32 593 728860 1697 1712 11262 11277 ATTGCATGCCAGCTGG 34 594 728861 1699 1714 11264 11279 TTATTGCATGCCAGCT 19 595 728862 1701 1716 11266 11281 TGTTATTGCATGCCAG 35 596 728863 1703 1718 11268 11283 CTTGTTATTGCATGCC 51 597 728864 1705 1720 11270 11285 GCCTTGTTATTGCATG 16 598 728865 1707 1722 11272 11287 CAGCCTTGTTATTGCA  3 599 728866 1709 1724 11274 11289 TGCAGCCTTGTTATTG  0 600 728867 1711 1726 11276 11291 TCTGCAGCCTTGTTAT  0 601 728868 1713 1728 11278 11293 CGTCTGCAGCCTTGTT 43 602 728869 1715 1730 11280 11295 ACCGTCTGCAGCCTTG 51 603 728870 1717 1732 11282 11297 TCACCGTCTGCAGCCT 14 604 728871 1719 1734 11284 11299 AGTCACCGTCTGCAGC 36 605 728872 1721 1736 11286 11301 CCAGTCACCGTCTGCA 57 606 728873 1723 1738 11288 11303 GGCCAGTCACCGTCTG  6 607 728874 1725 1740 11290 11305 AGGGCCAGTCACCGTC 28 608 728875 1727 1742 11292 11307 CCAGGGCCAGTCACCG 30 609 728876 1731 1746 11296 11311 GAAGCCAGGGCCAGTC 30 610 728877 1742 1757 11307 11322 CCGCCACCCAGGAAGC 30 611 728878 1744 1759 11309 11324 CACCGCCACCCAGGAA  9 612 728879 1746 1761 11311 11326 CGCACCGCCACCCAGG 46 613 728880 1748 1763 11313 11328 TCCGCACCGCCACCCA 29 614 728881 1749 1764 11314 11329 GTCCGCACCGCCACCC 30 615 728882 1750 1765 11315 11330 AGTCCGCACCGCCACC 27 616 728883 1751 1766 11316 11331 CAGTCCGCACCGCCAC 56 617

TABLE 9 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 74  39 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 60 468 665962 1753 1768 11318 11333 ATCAGTCCGCACCGCC 53 618 665964 1765 1780 11330 11345 TCACATCTCCACATCA 36 619 665973 1903 1918 11468 11483 AGACCAGAGACAGCCC 30 620 665975 1911 1926 11476 11491 GGCTGACCAGACCAGA 40 621 665981 1951 1966 11516 11531 GAGTTCTTTCCCTGCT 41 622 728884 1752 1767 11317 11332 TCAGTCCGCACCGCCA 46 623 728885 1754 1769 11319 11334 CATCAGTCCGCACCGC 23 624 728886 1755 1770 11320 11335 ACATCAGTCCGCACCG 48 625 728887 1756 1771 11321 11336 CACATCAGTCCGCACC 57 626 728888 1757 1772 11322 11337 CCACATCAGTCCGCAC 37 627 728889 1758 1773 11323 11338 TCCACATCAGTCCGCA 24 628 728890 1760 1775 11325 11340 TCTCCACATCAGTCCG 33 629 728891 1761 1776 11326 11341 ATCTCCACATCAGTCC 56 630 728892 1762 1777 11327 11342 CATCTCCACATCAGTC 37 631 728893 1763 1778 11328 11343 ACATCTCCACATCAGT 56 632 728894 1764 1779 11329 11344 CACATCTCCACATCAG 65 633 728895 1766 1781 11331 11346 GTCACATCTCCACATC 47 634 728896 1767 1782 11332 11347 TGTCACATCTCCACAT 21 635 728897 1768 1783 11333 11348 CTGTCACATCTCCACA 46 636 728898 1769 1784 11334 11349 GCTGTCACATCTCCAC 73 637 728899 1770 1785 11335 11350 GGCTGTCACATCTCCA 64 638 728900 1786 1801 11351 11366 GCCAGGTGCTCATCGG 37 639 728901 1788 1803 11353 11368 CAGCCAGGTGCTCATC 37 640 728902 1790 1805 11355 11370 GCCAGCCAGGTGCTCA 42 641 728903 1803 1818 11368 11383 GTAGGACCCTGCAGCC 31 642 728904 1805 1820 11370 11385 AGGTAGGACCCTGCAG  6 643 728905 1807 1822 11372 11387 AGAGGTAGGACCCTGC 60 644 728906 1810 1825 11375 11390 CCCAGAGGTAGGACCC 42 645 728907 1812 1827 11377 11392 AACCCAGAGGTAGGAC 32 646 728908 1814 1829 11379 11394 GAAACCCAGAGGTAGG 44 647 728909 1825 1840 11390 11405 TCCACTTCCAGGAAAC 25 648 728910 1833 1848 11398 11413 GGCCCAAATCCACTTC 11 649 728911 1835 1850 11400 11415 TTGGCCCAAATCCACT  9 650 728912 1837 1852 11402 11417 TCTTGGCCCAAATCCA 22 651 728913 1839 1854 11404 11419 CTTCTTGGCCCAAATC 15 652 728914 1841 1856 11406 11421 TCCTTCTTGGCCCAAA 31 653 728915 1859 1874 11424 11439 CTCGGGCCTTTCTCCC  2 654 728916 1861 1876 11426 11441 GGCTCGGGCCTTTCTC 10 655 728917 1884 1899 11449 11464 AGAGAAAGGCCCGGGA  0 656 728918 1886 1901 11451 11466 GGAGAGAAAGGCCCGG  0 657 728919 1898 1913 11463 11478 AGAGACAGCCCAGGAG 13 658 728920 1901 1916 11466 11481 ACCAGAGACAGCCCAG 52 659 728921 1902 1917 11467 11482 GACCAGAGACAGCCCA 42 660 728922 1904 1919 11469 11484 CAGACCAGAGACAGCC 38 661 728923 1905 1920 11470 11485 CCAGACCAGAGACAGC 17 662 728924 1906 1921 11471 11486 ACCAGACCAGAGACAG 30 663 728925 1907 1922 11472 11487 GACCAGACCAGAGACA 14 664 728926 1908 1923 11473 11488 TGACCAGACCAGAGAC  7 665 728927 1910 1925 11475 11490 GCTGACCAGACCAGAG 26 666 728928 1912 1927 11477 11492 AGGCTGACCAGACCAG 14 667 728929 1916 1931 11481 11496 AGCCAGGCTGACCAGA 13 668 728930 1919 1934 11484 11499 GAGAGCCAGGCTGACC 26 669 728931 1923 1938 11488 11503 TCCCGAGAGCCAGGCT 26 670 728932 1925 1940 11490 11505 TTTCCCGAGAGCCAGG 26 671 728933 1928 1943 11493 11508 GAATTTCCCGAGAGCC 34 672 728934 1930 1945 11495 11510 CTGAATTTCCCGAGAG 33 673 728935 1932 1947 11497 11512 GGCTGAATTTCCCGAG 39 674 728936 1934 1949 11499 11514 ATGGCTGAATTTCCCG 39 675 728937 1936 1951 11501 11516 TCATGGCTGAATTTCC 36 676 728938 1938 1953 11503 11518 GCTCATGGCTGAATTT 30 677 728939 1940 1955 11505 11520 CTGCTCATGGCTGAAT 40 678 728940 1942 1957 11507 11522 CCCTGCTCATGGCTGA 51 679 728941 1946 1961 11511 11526 CTTTCCCTGCTCATGG 45 680 728942 1947 1962 11512 11527 TCTTTCCCTGCTCATG 54 681 728943 1948 1963 11513 11528 TTCTTTCCCTGCTCAT 16 682 728944 1949 1964 11514 11529 GTTCTTTCCCTGCTCA 56 683 728945 1950 1965 11515 11530 AGTTCTTTCCCTGCTC 56 684 728946 1952 1967 11517 11532 AGAGTTCTTTCCCTGC 56 685 728947 1953 1968 11518 11533 GAGAGTTCTTTCCCTG 54 686 728948 1954 1969 11519 11534 GGAGAGTTCTTTCCCT 32 687 728949 1955 1970 11520 11535 GGGAGAGTTCTTTCCC  1 688 728950 1956 1971 11521 11536 TGGGAGAGTTCTTTCC 24 689 728951 1958 1973 11523 11538 GTTGGGAGAGTTCTTT 29 690 728952 1970 1985 11535 11550 CTAGGCCCCAGGGTTG 35 691 728953 1972 1987 11537 11552 AGCTAGGCCCCAGGGT 23 692 728954 1974 1989 11539 11554 ACAGCTAGGCCCCAGG 64 693 728955 1976 1991 11541 11556 ATACAGCTAGGCCCCA 14 694

TABLE 10 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 73  39 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 69 468 666013 2215 2230 11780 11795 GTTCTTGGACTCTCAA 65 695 666015 2228 2243 11793 11808 ATTTCTGCTCCAGGTT 54 696 729028 2190 2205 11755 11770 AGCTGCCAGCCTTGAG 50 697 729029 2191 2206 11756 11771 TAGCTGCCAGCCTTGA 57 698 729030 2192 2207 11757 11772 GTAGCTGCCAGCCTTG 65 699 729031 2194 2209 11759 11774 GGGTAGCTGCCAGCCT 41 700 729032 2210 2225 11775 11790 TGGACTCTCAAGAAGG 55 701 729033 2211 2226 11776 11791 TTGGACTCTCAAGAAG 37 702 729034 2212 2227 11777 11792 CTTGGACTCTCAAGAA 38 703 729035 2213 2228 11778 11793 TCTTGGACTCTCAAGA  0 704 729036 2214 2229 11779 11794 TTCTTGGACTCTCAAG 55 705 729037 2216 2231 11781 11796 GGTTCTTGGACTCTCA 80 706 729038 2217 2232 11782 11797 AGGTTCTTGGACTCTC 85 707 729039 2218 2233 11783 11798 CAGGTTCTTGGACTCT 74 708 729040 2219 2234 11784 11799 CCAGGTTCTTGGACTC 67 709 729041 2220 2235 11785 11800 TCCAGGTTCTTGGACT 39 710 729042 2222 2237 11787 11802 GCTCCAGGTTCTTGGA 11 711 729043 2223 2238 11788 11803 TGCTCCAGGTTCTTGG 44 712 729044 2224 2239 11789 11804 CTGCTCCAGGTTCTTG 62 713 729045 2225 2240 11790 11805 TCTGCTCCAGGTTCTT 60 714 729046 2226 2241 11791 11806 TTCTGCTCCAGGTTCT 54 715 729047 2227 2242 11792 11807 TTTCTGCTCCAGGTTC 63 716 729048 2229 2244 11794 11809 TATTTCTGCTCCAGGT 63 717 729049 2230 2245 11795 11810 TTATTTCTGCTCCAGG 76 718 729050 2231 2246 11796 11811 ATTATTTCTGCTCCAG 76 719 729051 2232 2247 11797 11812 AATTATTTCTGCTCCA 58 720 729052 2260 2275 11825 11840 AACATTCATTAATCCA 55 721 729053 2278 2293 11843 11858 ACAGCTGAGTCTGTTT 26 722 729055 2300 2315 11865 11880 TGGTAGTAGTAAAAGG 24 723 729060 2310 2325 11875 11890 TGGGAGCAACTGGTAG 33 724 729064 2322 2337 11887 11902 GGTGGAGCAGCATGGG 14 725 729067 2336 2351 11901 11916 CCGAAACAGGGCCTGG 33 726 729072 2346 2361 11911 11926 CAGTTGGCATCCGAAA  8 727 729077 2385 2400 11950 11965 AATGGTCGCAAGCTGG 26 728 729082 2395 2410 11960 11975 TCCCAGTGCCAATGGT  5 729 729086 2417 2432 11982 11997 CATCAGCCCAGAAGCC 12 730 729090 2427 2442 11992 12007 CCAACTGACCCATCAG  8 731 729095 2437 2452 12002 12017 TTATGAAGGCCCAACT  0 732 729100 2447 2462 12012 12027 AGGTGAGTGTTTATGA 33 733 729105 2457 2472 12022 12037 AAAGCCAGCCAGGTGA 30 734 729106 2486 2501 12051 12066 TTGCTTCAGCCAGCTT 15 735 729110 2496 2511 12061 12076 TTCCACACCCTTGCTT 11 736 729112 2515 2530 12080 12095 ACTGTGCACACATTTA 53 737 729116 2525 2540 12090 12105 AGTTTTCCAGACTGTG 28 738 729120 2536 2551 12101 12116 CTGATTCTGACAGTTT  0 739 729123 2547 2562 12112 12127 TTATGGGAAAACTGAT  0 740 729125 2557 2572 12122 12137 GCCCACCCTTTTATGG  0 741 729129 2567 2582 12132 12147 TGCAATGCTAGCCCAC 54 742 729134 2577 2592 12142 12157 CAAATGCAGCTGCAAT 27 743 729139 2588 2603 12153 12168 TTGAATGGTCCCAAAT 22 744 729144 2599 2614 12164 12179 GAGTGACAGATTTGAA 55 745 729146 2620 2635 12185 12200 AGCACAGGAATATACA 36 746 729150 2637 2652 12202 12217 GCCCTGATATATTTAA  0 747 729155 2647 2662 12212 12227 TACATGCACTGCCCTG 31 748 729160 2657 2672 12222 12237 CAGGATGATTTACATG  5 749 729164 2703 2718 12268 12283 ACTGTCCCCACCTCGG 10 750 729165 2720 2735 12285 12300 ACTAAGAGAACTCACT 31 751 729167 2747 2762 12312 12327 GGCTCTTTAACAACCA 20 752 729170 2761 2776 12326 12341 GCGGGTAGGTGCCAGG 40 753 729175 2771 2786 12336 12351 TGAAGTGAGAGCGGGT 45 754 729180 2789 2804 12354 12369 GTGCAGAGATGACACA  0 755 729182 2800 2815 12365 12380 TGGGCTGGAGTGTGCA 30 756 729185 2820 2835 12385 12400 CAATGGCTGAAGGCAG 14 757 729190 2876 2891 12441 12456 GCTGGGCATCAAGATT  7 758 729194 2885 2900 12450 12465 GTTCTGATGGCTGGGC 50 759 729251 N/A N/A   176   191 CTGGAATGGCAAAACT 12 760 729252 N/A N/A   197   212 GCCACTGGCTCTTTTG  0 761 729253 N/A N/A   207   222 CCCTAGACTGGCCACT  1 762 729254 N/A N/A   218   233 ACGGCGCGGTGCCCTA 10 763 729255 N/A N/A   257   272 AGCCTCGGGCCAGGCC 12 764 729256 N/A N/A   267   282 ATCCGGGCTGAGCCTC  8 765 729257 N/A N/A   292   307 CCCCGCACTGACCTGG 43 766 729258 N/A N/A   302   317 CCACTCCGGGCCCCGC  0 767 729259 N/A N/A   312   327 CCCCGCGAATCCACTC  0 768 729260 N/A N/A   364   379 CGCCCCTGGGCAGCTG  0 769 729635 N/A N/A   228   243 GAGATGCCAGACGGCG  0 770 729636 N/A N/A   344   359 TGAGCTCCGGGCGCGG  5 771

TABLE 11 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 74  39 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 57 468 729261 N/A N/A   502   517 GACCCACCTGTCTGCG  7 772 729262 N/A N/A   512   527 CGGCGGCCGGGACCCA 18 773 729263 N/A N/A   532   547 CGGACGCAGAGAGGAG 20 774 729264 N/A N/A   561   576 CTCCCGCCACCCTCGG  9 775 729265 N/A N/A   571   586 GCCGGCACCGCTCCCG  0 776 729266 N/A N/A   594   609 TAGGCCTAGACTTGGG 26 777 729267 N/A N/A   635   650 TCCCGCCGCCCGCAGG 10 778 729268 N/A N/A   645   660 CCAGTCTTCATCCCGC 33 779 729269 N/A N/A   656   671 CCCGCCCTACTCCAGT 26 780 729270 N/A N/A   686   701 CTCGCTTTCCAGGCGC  4 781 729271 N/A N/A   696   711 CCCCCCCGAGCTCGCT  8 782 729272 N/A N/A   706   721 GCTGTAGGCACCCCCC 19 783 729273 N/A N/A   736   751 TGGAAGTCCCAGGCCG 21 784 729274 N/A N/A   767   782 CCCCAAACCGATCGGG  0 785 729275 N/A N/A   801   816 CCGCCTGGGTCACTGG 11 786 729276 N/A N/A   811   826 GCCCACTCCGCCGCCT  0 787 729277 N/A N/A   866   881 CTGGGCGATGGCGAGG 10 788 729278 N/A N/A   876   891 AACCCCCATTCTGGGC  6 789 729279 N/A N/A   886   901 GGCTCCCGGGAACCCC 11 790 729280 N/A N/A   911   926 TGTGGTCCAAGCCAGC 29 791 729281 N/A N/A   931   946 AGGATCGGGCCTCGCT 30 792 729282 N/A N/A   941   956 ATCGAAAGTAAGGATC 17 793 729283 N/A N/A   957   972 GAGCAAGGGCGAGTGC 29 794 729284 N/A N/A   967   982 GGCCCGGTAAGAGCAA  6 795 729285 N/A N/A   986  1001 TTTCCGAAAGGGTGAG 32 796 729286 N/A N/A  1028  1043 GCCTGAAGATCCCGGG 14 797 729287 N/A N/A  1038  1053 CCTGCCATTGGCCTGA 14 798 729288 N/A N/A  1057  1072 CCCAAACTCTTGCACA 25 799 729289 N/A N/A  1074  1089 ACCTGACACCATCTTC  9 800 729290 N/A N/A  1085  1100 ACGCAGCCTCTACCTG  0 801 729291 N/A N/A  1096  1111 CGAGCCCAGGGACGCA 16 802 729292 N/A N/A  1107  1122 ATTCCCGGCCGCGAGC 19 803 729293 N/A N/A  1117  1132 AGAGTCTGCCATTCCC 44 804 729294 N/A N/A  1157  1172 GAACTATTGCGCCCCA 35 805 729295 N/A N/A  1167  1182 ACCAGCCCAGGAACTA 15 806 729296 N/A N/A  1177  1192 ACCTGAGGAAACCAGC 15 807 729297 N/A N/A  1190  1205 GTTCTGGGACAGGACC 19 808 729298 N/A N/A  1213  1228 CCTCTTCATTGTTGCC 42 809 729299 N/A N/A  1244  1259 CATGCTAGCCTCACTT 23 810 729300 N/A N/A  1268  1283 AACCATCTCCCCACGC 21 811 729301 N/A N/A  1278  1293 GTCCGGAGACAACCAT 13 812 729302 N/A N/A  1308  1323 TCCCAGGTACCCGCTC  7 813 729303 N/A N/A  1330  1345 AGTCCCCCACTCCAGC 23 814 729304 N/A N/A  1342  1357 CGAGGCTGGGAAAGTC 18 815 729305 N/A N/A  1370  1385 CCTCGCCCTGCTGTGT 18 816 729306 N/A N/A  1380  1395 GCACCCCGGTCCTCGC 27 817 729307 N/A N/A  1557  1572 ATTCTGGGCCCTCGAG  3 818 729308 N/A N/A  1579  1594 CTGGTTCTGGTCACTT 41 819 729309 N/A N/A  1591  1606 GCCGAGCCCTCTCTGG 13 820 729310 N/A N/A  1601  1616 CATCGATACAGCCGAG 42 821 729311 N/A N/A  1638  1653 CTTGCCAGAGGGCCTC 40 822 729312 N/A N/A  1676  1691 CCCCATAACTACTGGG 20 823 729313 N/A N/A  1702  1717 GAACCCCTCAGCCCCA  8 824 729314 N/A N/A  1712  1727 TTGACTCTTGGAACCC 40 825 729315 N/A N/A  1722  1737 AGTGCTTCCCTTGACT 20 826 729316 N/A N/A  1748  1763 CTTTAGATAAAAAGGG 12 827 729317 N/A N/A  1758  1773 AAAGTAGGGCCTTTAG 27 828 729318 N/A N/A  1833  1848 GCCCAGAAAGAAGCTT  5 829 729319 N/A N/A  1867  1882 GGTCCAGACAGGCTGA 15 830 729320 N/A N/A  1909  1924 CTCCGGGTCAGCTGCC 25 831 729321 N/A N/A  1919  1934 AATCCCACCCCTCCGG  8 832 729322 N/A N/A  1942  1957 CCCTGTACAGGCCCTG  1 833 729323 N/A N/A  1992  2007 ACATGTCTCCTTGCAA  6 834 729324 N/A N/A  2002  2017 GGTCTGGGTCACATGT 33 835 729325 N/A N/A  2036  2051 GCCAGACAGCAGGCGC 11 836 729326 N/A N/A  2047  2062 TAGTAAGAGTGGCCAG 16 837 729327 N/A N/A  2058  2073 CACAGCAGTCCTAGTA  9 838 729328 N/A N/A  2068  2083 GAGGAAGTGCCACAGC 17 839 729329 N/A N/A  2100  2115 TGCAATTCATGGGCAC 18 840 729330 N/A N/A  2110  2125 ACCCAGGAGCTGCAAT  4 841 729331 N/A N/A  2129  2144 AGACAGTGCCCCCACC  5 842 729332 N/A N/A  2170  2185 TAAGCCCACAGCTCAC  0 843 729333 N/A N/A  2187  2202 GACCTGCTGAGGTGGG 15 844 729637 N/A N/A   716   731 GGCGCACCCTGCTGTA 17 845 729638 N/A N/A  1234  1249 TCACTTTTCCTCCACG 38 846 729639 N/A N/A  1452  1467 GGGCCAGCCCGCGGAG 15 847 729640 N/A N/A  1611  1626 CAGTTTCCTACATCGA 22 848

TABLE 12 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 73  39 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 63 468 729195 N/A N/A  3775  3790 TCGGGTAGCACTTAGG 53 849 729334 N/A N/A  2204  2219 AGTGGGCAGCCCTAGA 12 850 729335 N/A N/A  2224  2239 TGTGAGGCAGCGAAGC 32 851 729336 N/A N/A  2234  2249 CCTACAATTGTGTGAG 10 852 729337 N/A N/A  2258  2273 GAAATCCAACAGCCTG 25 853 729338 N/A N/A  2274  2289 AGCCCCGGAAGGTGGG 11 854 729339 N/A N/A  2284  2299 AATGGACCTGAGCCCC 25 855 729340 N/A N/A  2304  2319 TGGAGCCCTAGACCTA 13 856 729341 N/A N/A  2314  2329 GTGAAATGTATGGAGC 20 857 729342 N/A N/A  2324  2339 GAGTCTCTGGGTGAAA 16 858 729343 N/A N/A  2334  2349 CCAGGCTCCGGAGTCT  0 859 729344 N/A N/A  2365  2380 TGGAAGTTCGGTGTCA 27 860 729345 N/A N/A  2376  2391 GCCCATGACTTTGGAA  8 861 729346 N/A N/A  2386  2401 CCCAATCAAGGCCCAT 16 862 729347 N/A N/A  2405  2420 TAGGTCTAATTCAGAC  6 863 729348 N/A N/A  2415  2430 AGAAAAGGGCTAGGTC  0 864 729349 N/A N/A  2444  2459 TCCATCCTCCTAGAAG  0 865 729350 N/A N/A  2454  2469 CCGAACAGCATCCATC  3 866 729351 N/A N/A  2464  2479 GAGCTCTAACCCGAAC  0 867 729352 N/A N/A  2507  2522 AGGGACTCAGCCTCAA 18 868 729353 N/A N/A  2517  2532 ATGCCACAGAAGGGAC 15 869 729354 N/A N/A  2527  2542 TCTGTCCACCATGCCA  6 870 729355 N/A N/A  2538  2553 ATGAGCGAGAGTCTGT 25 871 729356 N/A N/A  2615  2630 GTGTCAGAGGGCCGCG 28 872 729357 N/A N/A  2625  2640 TCCGACCTCAGTGTCA 20 873 729358 N/A N/A  2635  2650 AAATGATAACTCCGAC 27 874 729359 N/A N/A  2658  2673 GTTTAATACAGAGCAA 36 875 729360 N/A N/A  2668  2683 CAACACGGCTGTTTAA  0 876 729361 N/A N/A  2695  2710 CTGTCAGTCCAGCAGT 29 877 729362 N/A N/A  2708  2723 TGCCTGCCCCCTACTG  5 878 729363 N/A N/A  2755  2770 GAGGCCGTGCAGGCGC 23 879 729364 N/A N/A  2768  2783 GACCCCCTGGGCTGAG 17 880 729365 N/A N/A  2778  2793 CTTCCCTAATGACCCC 19 881 729366 N/A N/A  2799  2814 TCTGCACAGAATCGGG 18 882 729367 N/A N/A  2823  2838 CAAGGGTGGACAGAGG 14 883 729368 N/A N/A  2833  2848 TCTGGCCGAGCAAGGG 24 884 729369 N/A N/A  2843  2858 GGCACACAATTCTGGC  3 885 729370 N/A N/A  2874  2889 GCCCTAGAATAGAGGG  9 886 729371 N/A N/A  2884  2899 AGAGGCCTTGGCCCTA  5 887 729372 N/A N/A  2911  2926 ACCCATAGTTGTATCT 13 888 729373 N/A N/A  2935  2950 GGTTTATAACATGGGT 11 889 729374 N/A N/A  2974  2989 GCACCCCAAACTTGCA 11 890 729375 N/A N/A  2984  2999 GCTGTTCCCCGCACCC 17 891 729376 N/A N/A  2995  3010 TCCCACCCAGAGCTGT  7 892 729377 N/A N/A  3016  3031 CCCCAGACCAAATTTC  0 893 729378 N/A N/A  3026  3041 CGAGTGGGTCCCCCAG 17 894 729379 N/A N/A  3052  3067 ACTCACTGTGGGCTGA 22 895 729380 N/A N/A  3080  3095 GGCTAGACCGGGACAA 29 896 729381 N/A N/A  3090  3105 AAACGAAAGTGGCTAG 11 897 729382 N/A N/A  3108  3123 TCCACCCGGCCCCAGG  3 898 729383 N/A N/A  3329  3344 CCCAGTACCTTTTGGG  0 899 729384 N/A N/A  3339  3354 AAATTCCCTGCCCAGT  6 900 729385 N/A N/A  3372  3387 TGGCCTTGCAGCATGG 27 901 729386 N/A N/A  3386  3401 GTCTGGGCCTGCTTTG 23 902 729387 N/A N/A  3396  3411 AACTCCCTGTGTCTGG 18 903 729388 N/A N/A  3447  3462 CATCAGAAGTGAATGT  8 904 729389 N/A N/A  3458  3473 ACAGCACAGCCCATCA 14 905 729390 N/A N/A  3468  3483 GGGTCATTACACAGCA 23 906 729391 N/A N/A  3509  3524 GCCCTTCACTTGAGAC 13 907 729392 N/A N/A  3519  3534 CATGCCCTTGGCCCTT  8 908 729393 N/A N/A  3530  3545 CTCCCCTTACCCATGC  0 909 729394 N/A N/A  3556  3571 GTCCTGAGTCCCCTTC  0 910 729395 N/A N/A  3567  3582 AACTCTCCACAGTCCT 10 911 729396 N/A N/A  3631  3646 AGGCCAGAGGGACCCT  0 912 729397 N/A N/A  3648  3663 ACTGCCTCCCTGGAGT  0 913 729398 N/A N/A  3695  3710 TGCTACCTACCCAGGG  2 914 729399 N/A N/A  3705  3720 CAGCTCTAACTGCTAC  0 915 729400 N/A N/A  3729  3744 GAAGGCTACAGGAAAC  0 916 729401 N/A N/A  3739  3754 AGCCTGTTAGGAAGGC  0 917 729402 N/A N/A  3749  3764 CGCCTGCCGGAGCCTG 18 918 729403 N/A N/A  3762  3777 AGGAAGGCCCTAACGC  0 919 729641 N/A N/A  2214  2229 CGAAGCATCCAGTGGG 20 920 729642 N/A N/A  2474  2489 AGGTCCACACGAGCTC 30 921 729643 N/A N/A  2593  2608 CAGGCAGCTTAGGGAG  1 922 729644 N/A N/A  2945  2960 CATTTAGTGTGGTTTA 28 923 729645 N/A N/A  3362  3377 GCATGGAGCCTCAGTT 33 924 729646 N/A N/A  3499  3514 TGAGACCCCTGGGTGG 21 925

TABLE 13 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 83   39 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 59  468 666150 N/A N/A  3779  3794 GCATTCGGGTAGCACT 46  926 666168 N/A N/A  5286  5301 ATCACCACTGTGTACC 62  927 729196 N/A N/A  3776  3791 TTCGGGTAGCACTTAG 49  928 729197 N/A N/A  3777  3792 ATTCGGGTAGCACTTA 36  929 729198 N/A N/A  3778  3793 CATTCGGGTAGCACTT 33  930 729199 N/A N/A  3780  3795 CGCATTCGGGTAGCAC 46  931 729200 N/A N/A  3781  3796 ACGCATTCGGGTAGCA 40  932 729201 N/A N/A  3782  3797 CACGCATTCGGGTAGC 59  933 729202 N/A N/A  3783  3798 ACACGCATTCGGGTAG 36  934 729203 N/A N/A  3784  3799 GACACGCATTCGGGTA 35  935 729204 N/A N/A  5282  5297 CCACTGTGTACCCCAT 50  936 729205 N/A N/A  5283  5298 ACCACTGTGTACCCCA 72  937 729206 N/A N/A  5284  5299 CACCACTGTGTACCCC 71  938 729207 N/A N/A  5285  5300 TCACCACTGTGTACCC 57  939 729208 N/A N/A  5287  5302 AATCACCACTGTGTAC 20  940 729209 N/A N/A  5288  5303 AAATCACCACTGTGTA 32  941 729210 N/A N/A  5289  5304 CAAATCACCACTGTGT 12  942 729211 N/A N/A  5290  5305 TCAAATCACCACTGTG 44  943 729212 N/A N/A  5291  5306 ATCAAATCACCACTGT 42  944 729404 N/A N/A  3812  3827 CTTGGTCCTCCCCCTT 21  945 729405 N/A N/A  3822  3837 CATCTAGGTTCTTGGT 27  946 729406 N/A N/A  3835  3850 CTCTAGGGCCATTCAT 19  947 729407 N/A N/A  3855  3870 GCACCAAACAGATGTT 19  948 729408 N/A N/A  3885  3900 ACCAACTCAACCCACC 13  949 729409 N/A N/A  3895  3910 AATCCCATCAACCAAC 15  950 729410 N/A N/A  3905  3920 TCTTTAGAGAAATCCC 38  951 729411 N/A N/A  3943  3958 AAGGACACCTGCCCTC  6  952 729412 N/A N/A  3954  3969 CTGGAGCTCCCAAGGA 17  953 729413 N/A N/A  3965  3980 AAGAATCTCATCTGGA  4  954 729414 N/A N/A  3975  3990 TGCCCTCAACAAGAAT  0  955 729415 N/A N/A  3995  4010 CTGAGAGTTCCCTCCG 22  956 729416 N/A N/A  4059  4074 CTCCTGCTCAGTCTAC 21  957 729417 N/A N/A  4100  4115 CTGGGACAGCGAGCGC 47  958 729418 N/A N/A  4120  4135 TCTTGTCTCAAGCTGG 32  959 729419 N/A N/A  4140  4155 TGACACCAAAAGCCCG 37  960 729420 N/A N/A  4150  4165 AGTGACTGCCTGACAC 11  961 729421 N/A N/A  4185  4200 GCCCACCCCTTGCTCT 11  962 729422 N/A N/A  4205  4220 CTACTCACACCACAGG 38  963 729423 N/A N/A  4215  4230 CCGCCTTCCACTACTC 26  964 729424 N/A N/A  4225  4240 GGCCAGAGAACCGCCT 14  965 729425 N/A N/A  4241  4256 CAGCAAGCAGCCCGTT 21  966 729426 N/A N/A  4251  4266 CTGCTAACAGCAGCAA 10  967 729427 N/A N/A  4261  4276 CATTCTCCAACTGCTA 43  968 729428 N/A N/A  4272  4287 GCAGAGGCATCCATTC 19  969 729429 N/A N/A  4292  4307 CCCCAGGTGCCCTTTA  7  970 729430 N/A N/A  4304  4319 CTGCGGGCGCGGCCCC 22  971 729431 N/A N/A  4324  4339 GAGTTACGAGTTAGTG 49  972 729432 N/A N/A  4357  4372 TCATGGAATTTTGTGT 31  973 729433 N/A N/A  4367  4382 TTGTCTAGTGTCATGG 64  974 729434 N/A N/A  4379  4394 GCATCAGCTTTCTTGT 39  975 729435 N/A N/A  4401  4416 TAAGGCCAATTCTCTT 19  976 729436 N/A N/A  4412  4427 ATCTAGGTATTTAAGG 19  977 729437 N/A N/A  4422  4437 TCTCCAGTCCATCTAG 15  978 729438 N/A N/A  4432  4447 AAGGATGGTCTCTCCA 14  979 729439 N/A N/A  4457  4472 CTCAGAGGTCAAGCTA 30  980 729440 N/A N/A  4484  4499 GGTCTGCAGGTGGATG 26  981 729441 N/A N/A  4730  4745 GGGCTTACCTTGAAGA 20  982 729442 N/A N/A  4744  4759 CAACCTCCTCCCCGGG 12  983 729443 N/A N/A  4754  4769 GAGGTCCAGCCAACCT  1  984 729444 N/A N/A  4790  4805 TTATGTGCGCTCCTCT 26  985 729445 N/A N/A  4806  4821 GAGCTGCCTGTGTGCG 31  986 729446 N/A N/A  4817  4832 CCAGCCTCGAGGAGCT  4  987 729447 N/A N/A  4853  4868 CCGGCATCAGCAGCAG 57  988 729448 N/A N/A  4897  4912 AAAGGTGTACCCTGTG 36  989 729449 N/A N/A  5076  5091 AAGATGTGCCCTAGGC 35  990 729450 N/A N/A  5087  5102 GCAGGTTAGAAAAGAT 16  991 729451 N/A N/A  5097  5112 GCTCTAGGGTGCAGGT 49  992 729452 N/A N/A  5107  5122 TCCCCACGATGCTCTA 14  993 729453 N/A N/A  5140  5155 CGAGTTATGGGAAGGC 66  994 729454 N/A N/A  5170  5185 AGGAGTGAGACGAGCA 75  995 729455 N/A N/A  5190  5205 AACAAGTCCTCATGAG 19  996 729456 N/A N/A  5213  5228 TCCTTTAGCATATGCG 67  997 729647 N/A N/A  3845  3860 GATGTTACCTCTCTAG 38  998 729648 N/A N/A  4016  4031 AGTTTTCTCACCCTCC 49  999 729649 N/A N/A  4049  4064 GTCTACACCCCTAGTT 24 1000 729650 N/A N/A  4195  4210 CACAGGTTAGGCCCAC 44 1001 729651 N/A N/A  4467  4482 GGACAGGGTACTCAGA 26 1002

TABLE 14 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 23   39 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 46  468 666178 N/A N/A  6540  6555 GCATTCCATATACACA 51 1003 666184 N/A N/A  6972  6987 TGCCTTTTAATGTTGA 36 1004 666187 N/A N/A  7176  7191 CTAGACAAATATGCAG 29 1005 729213 N/A N/A  6539  6554 CATTCCATATACACAC 71 1006 729214 N/A N/A  6541  6556 TGCATTCCATATACAC 28 1007 729215 N/A N/A  6542  6557 TTGCATTCCATATACA 27 1008 729216 N/A N/A  6543  6558 TTTGCATTCCATATAC  3 1009 729217 N/A N/A  6544  6559 TTTTGCATTCCATATA 19 1010 729218 N/A N/A  6545  6560 ATTTTGCATTCCATAT 20 1011 729219 N/A N/A  6969  6984 CTTTTAATGTTGAATT  0 1012 729220 N/A N/A  6970  6985 CCTTTTAATGTTGAAT  0 1013 729221 N/A N/A  6971  6986 GCCTTTTAATGTTGAA 50 1014 729222 N/A N/A  6973  6988 ATGCCTTTTAATGTTG  0 1015 729223 N/A N/A  6974  6989 TATGCCTTTTAATGTT 10 1016 729224 N/A N/A  6975  6990 CTATGCCTTTTAATGT  0 1017 729225 N/A N/A  6976  6991 TCTATGCCTTTTAATG 13 1018 729226 N/A N/A  7171  7186 CAAATATGCAGATATC  3 1019 729227 N/A N/A  7173  7188 GACAAATATGCAGATA  0 1020 729228 N/A N/A  7174  7189 AGACAAATATGCAGAT  1 1021 729229 N/A N/A  7175  7190 TAGACAAATATGCAGA 27 1022 729230 N/A N/A  7177  7192 TCTAGACAAATATGCA 18 1023 729231 N/A N/A  7178  7193 GTCTAGACAAATATGC  0 1024 729232 N/A N/A  7179  7194 AGTCTAGACAAATATG 12 1025 729233 N/A N/A  7180  7195 AAGTCTAGACAAATAT  0 1026 729234 N/A N/A  7181  7196 TAAGTCTAGACAAATA  0 1027 729457 N/A N/A  5292  5307 TATCAAATCACCACTG  0 1028 729458 N/A N/A  5302  5317 TCACTGTGCTTATCAA 22 1029 729459 N/A N/A  5314  5329 TACCTGATCTGATCAC  0 1030 729460 N/A N/A  5325  5340 GATATGCTAAGTACCT 43 1031 729461 N/A N/A  5368  5383 GTTTGTTCCCAACACA 34 1032 729462 N/A N/A  5393  5408 GTATCTGAATCTTATA 22 1033 729463 N/A N/A  5403  5418 GATTGATGATGTATCT  0 1034 729464 N/A N/A  5413  5428 ACAATTGAAAGATTGA  0 1035 729465 N/A N/A  5464  5479 ATCTGGTCAACAGTGT 21 1036 729466 N/A N/A  5606  5621 CAAGGAGGTTGAGATG  0 1037 729467 N/A N/A  5804  5819 GTAGTACATCAATTAA  0 1038 729468 N/A N/A  5814  5829 ATGTACAGTTGTAGTA  0 1039 729469 N/A N/A  5868  5883 AACACTAGGCAACAGA  0 1040 729470 N/A N/A  5878  5893 CCAATGGTGCAACACT  0 1041 729471 N/A N/A  5888  5903 CCACTGCTCACCAATG  0 1042 729472 N/A N/A  5910  5925 TGGAGGTTGTGCTATG  0 1043 729473 N/A N/A  5921  5936 TTGAGCTGAGTTGGAG  0 1044 729474 N/A N/A  6478  6493 ACATCCTAGCATTAAG  0 1045 729475 N/A N/A  6495  6510 AAACTATTATGCGAGG 55 1046 729476 N/A N/A  6549  6564 TCCAATTTTGCATTCC 64 1047 729477 N/A N/A  6559  6574 TTCACTTGATTCCAAT 14 1048 729478 N/A N/A  6614  6629 AAGGAAAGCTGATCCT  0 1049 729479 N/A N/A  6624  6639 GTATGTTGGAAAGGAA 19 1050 729480 N/A N/A  6639  6654 AAAAGTGATGTGGACG 23 1051 729481 N/A N/A  6666  6681 CATTCCAGTGGAAATT  2 1052 729482 N/A N/A  6679  6694 AATTGTGCTAAACCAT 10 1053 729483 N/A N/A  6689  6704 TCAGTGACCAAATTGT 30 1054 729484 N/A N/A  6710  6725 CAAGTATCTAAAAACC  0 1055 729485 N/A N/A  6752  6767 CATGACAATGTGGTTT 37 1056 729486 N/A N/A  6762  6777 AGACAGCCTACATGAC 23 1057 729487 N/A N/A  6772  6787 GGAAGCATTAAGACAG  6 1058 729488 N/A N/A  6799  6814 CCCAAAATAATTGAGG  0 1059 729489 N/A N/A  6810  6825 GGAAATCAACCCCCAA 21 1060 729490 N/A N/A  6840  6855 TTGCCTTTGACCCAGC 34 1061 729491 N/A N/A  6887  6902 GCCCAAAAACTAAGAA  0 1062 729492 N/A N/A  6897  6912 TAAGGATCAAGCCCAA 26 1063 729493 N/A N/A  6947  6962 CTGTATTACCTATACA  0 1064 729494 N/A N/A  6958  6973 GAATTTTGTGACTGTA 56 1065 729495 N/A N/A  6981  6996 ACCATTCTATGCCTTT 53 1066 729496 N/A N/A  6998  7013 GAGACTTTTTGCTCTA  0 1067 729497 N/A N/A  7019  7034 GTGATGAACCAGGGAA 44 1068 729498 N/A N/A  7045  7060 GGAAAGGCTAGGGAGG  1 1069 729499 N/A N/A  7059  7074 ACGGCTGCCTCTAGGG  9 1070 729500 N/A N/A  7128  7143 AGGATAGTTCCATATT 15 1071 729501 N/A N/A  7145  7160 TATGAAAAGTAGAGGA  0 1072 729502 N/A N/A  7156  7171 CTAGCATTTCTTATGA  2 1073 729503 N/A N/A  7184  7199 TATTAAGTCTAGACAA  0 1074 729504 N/A N/A  7194  7209 CGTCAAGAAGTATTAA  0 1075 729505 N/A N/A  7208  7223 TGACATGTAGCAATCG 28 1076 729652 N/A N/A  6458  6473 TTGGAGAGAGCACAGT 11 1077 729653 N/A N/A  6654  6669 AATTCTACAGTCACGA 26 1078 729654 N/A N/A  7106  7121 CATGTGCATAAAAATC  0 1079

TABLE 15 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 78   39 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 58  468 666188 N/A N/A  7391  7406 AGAAGCATTCACACAA 41 1080 729235 N/A N/A  7387  7402 GCATTCACACAAAATA 52 1081 729236 N/A N/A  7388  7403 AGCATTCACACAAAAT 54 1082 729237 N/A N/A  7389  7404 AAGCATTCACACAAAA 27 1083 729238 N/A N/A  7390  7405 GAAGCATTCACACAAA 39 1084 729239 N/A N/A  7392  7407 TAGAAGCATTCACACA 41 1085 729240 N/A N/A  7393  7408 ATAGAAGCATTCACAC 22 1086 729241 N/A N/A  7394  7409 CATAGAAGCATTCACA 46 1087 729242 N/A N/A  7395  7410 TCATAGAAGCATTCAC 50 1088 729243 N/A N/A  7396  7411 ATCATAGAAGCATTCA 59 1089 729506 N/A N/A  7218  7233 GTTTATAAGCTGACAT 39 1090 729507 N/A N/A  7228  7243 GCAGGAAACTGTTTAT 55 1091 729508 N/A N/A  7253  7268 ACTGGGCAGCACAAAA 25 1092 729509 N/A N/A  7271  7286 ACCCATTGAATGAAAA 23 1093 729510 N/A N/A  7281  7296 ATTACGGCCAACCCAT  0 1094 729511 N/A N/A  7291  7306 GGCTGGTGAAATTACG 10 1095 729512 N/A N/A  7306  7321 CATCCATCAATGAGGG 51 1096 729513 N/A N/A  7316  7331 CCCAATGCAACATCCA 69 1097 729514 N/A N/A  7328  7343 TGACCCAAAATACCCA 44 1098 729515 N/A N/A  7338  7353 GTGTAAAAGATGACCC 37 1099 729516 N/A N/A  7349  7364 AGCAGTGCTGTGTGTA 48 1100 729517 N/A N/A  7372  7387 ATTGCACACACAAAGT 10 1101 729518 N/A N/A  7397  7412 TATCATAGAAGCATTC 24 1102 729519 N/A N/A  7426  7441 CTATTTGATTTCTAGG 18 1103 729520 N/A N/A  7437  7452 TTTTAACCCAGCTATT  6 1104 729521 N/A N/A  7460  7475 GGTTACCAACATTTCT 42 1105 729522 N/A N/A  7470  7485 GTGAGGTGAGGGTTAC 38 1106 729523 N/A N/A  7508  7523 ACACTGGAGCTGTTGG 51 1107 729524 N/A N/A  7519  7534 ACAGGCTCGAGACACT 31 1108 729525 N/A N/A  7529  7544 TGCACATAGGACAGGC 22 1109 729526 N/A N/A  7550  7565 TAAAGCACTCAGAGCT 16 1110 729527 N/A N/A  7560  7575 TTGATGTCCGTAAAGC 53 1111 729528 N/A N/A  7876  7891 AGCGAAGACTCAAGGG 48 1112 729529 N/A N/A  7887  7902 CATGGAGTGGCAGCGA 42 1113 729530 N/A N/A  7899  7914 AGTTGCCCACCTCATG 22 1114 729531 N/A N/A  7909  7924 ATCTCCTCACAGTTGC 28 1115 729532 N/A N/A  7920  7935 CCTTTGTCTTGATCTC 48 1116 729533 N/A N/A  7936  7951 GCCATGTCACTGCCTC 30 1117 729534 N/A N/A  7953  7968 CGCCAGCTGTGTGCCA 28 1118 729535 N/A N/A  7966  7981 TGGAAGTGCCCCCCGC 34 1119 729536 N/A N/A  7976  7991 GGTTTGAATCTGGAAG 31 1120 729537 N/A N/A  8000  8015 GGTGAGCACCCTGGAG 30 1121 729538 N/A N/A  8027  8042 TCTAAGGAGGACAGCG 35 1122 729539 N/A N/A  8043  8058 GTGAAACAGTGTGATC 40 1123 729540 N/A N/A  8064  8079 ATAGTCCCTGCTCCTG 49 1124 729541 N/A N/A  8144  8159 GTGGGAGTCTGCCACA  6 1125 729542 N/A N/A  8159  8174 GACCTGGTTTGCAGCG 34 1126 729543 N/A N/A  8171  8186 CGCTGAGCCCCAGACC  0 1127 729544 N/A N/A  8181  8196 GGCTGAGCCTCGCTGA 22 1128 729545 N/A N/A  8194  8209 AACTTCGGCTACAGGC 39 1129 729546 N/A N/A  8213  8228 GACTCTACTGTGTGGG 38 1130 729547 N/A N/A  8266  8281 CACAGAGAACCTCATC 11 1131 729548 N/A N/A  8276  8291 AATAGCCGACCACAGA 10 1132 729549 N/A N/A  8489  8504 GCCTGATACCTGTGGG  3 1133 729550 N/A N/A  8525  8540 ATTGCACAGCCTCCCA  8 1134 729551 N/A N/A  8555  8570 ACCCAAGAGCTCATGG  6 1135 729552 N/A N/A  8569  8584 CTTGGCCTGCCTGCAC 10 1136 729553 N/A N/A  8598  8613 TTCCTGGACCACTGCC 15 1137 729554 N/A N/A  8617  8632 GCGGGAGCCCCCGCAT 22 1138 729555 N/A N/A  8637  8652 GCCCTGGGTGTCATGA 17 1139 729556 N/A N/A  8648  8663 CACTCCTGGAAGCCCT  0 1140 729557 N/A N/A  8661  8676 GACCCATCCCAGCCAC  7 1141 729558 N/A N/A  8671  8686 ATATGCCAGTGACCCA 15 1142 729559 N/A N/A  8681  8696 GCCATTCCTGATATGC 28 1143 729560 N/A N/A  8691  8706 TGCACGCCAAGCCATT 28 1144 729561 N/A N/A  8711  8726 GAAGCACCCAGGTCCC 24 1145 729562 N/A N/A  8722  8737 ATGGTAAGGAAGAAGC 18 1146 729563 N/A N/A  8732  8747 AACGAGGGCAATGGTA 11 1147 729564 N/A N/A  8763  8778 CCATGAGACCTAGGCT  3 1148 729565 N/A N/A  8773  8788 ACTCCATGGGCCATGA  3 1149 729566 N/A N/A  8794  8809 GGATTGGGAAAGACCT 15 1150 729567 N/A N/A  8817  8832 CGAGGTGGAGGGCACA 11 1151 729568 N/A N/A  8827  8842 CAACACAGGGCGAGGT  8 1152 729569 N/A N/A  8859  8874 TATGCAGCTTCTGCCT  3 1153 729655 N/A N/A  7480  7495 TGGCAATTAGGTGAGG 48 1154 729656 N/A N/A  8101  8116 CAAGCTACATGAAATC 11 1155 729657 N/A N/A  8627  8642 TCATGACCTAGCGGGA 11 1156

TABLE 16 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop IRF5 (% ID Number Site Site Site Site Sequence (5′ to 3′) Inhibition) NO 665893 1228 1243 10461 10476 GCACTGACACAGGCGG 83   39 665933 1561 1576 11126 11141 GCGGTCTTTGAGGTCT 64  468 666208 N/A N/A  9349  9364 CAGTTTAGCTCAGGCA 69 1157 729244 N/A N/A  9344  9359 TAGCTCAGGCAAGACC 32 1158 729245 N/A N/A  9345  9360 TTAGCTCAGGCAAGAC 17 1159 729246 N/A N/A  9346  9361 TTTAGCTCAGGCAAGA 23 1160 729247 N/A N/A  9347  9362 GTTTAGCTCAGGCAAG 24 1161 729248 N/A N/A  9348  9363 AGTTTAGCTCAGGCAA 47 1162 729249 N/A N/A  9353  9368 GCCTCAGTTTAGCTCA 23 1163 729250 N/A N/A  9354  9369 AGCCTCAGTTTAGCTC  9 1164 729570 N/A N/A  8869  8884 CTGTAGCTCCTATGCA 14 1165 729571 N/A N/A  8895  8910 AGAAGCAAGATCCCCT  2 1166 729572 N/A N/A  8905  8920 ATGTCGGAGGAGAAGC  0 1167 729573 N/A N/A  8915  8930 AAAGGAGTCAATGTCG  0 1168 729574 N/A N/A  8925  8940 GCAGGGCAGTAAAGGA 12 1169 729575 N/A N/A  8948  8963 GTCTGCACAGCAGGGA 24 1170 729576 N/A N/A  9021  9036 AACCCACACTCACCTC 25 1171 729577 N/A N/A  9046  9061 CGTCCAGGGCTCCACC 13 1172 729578 N/A N/A  9060  9075 GACAGCAGAGAGCTCG  9 1173 729579 N/A N/A  9082  9097 GCGGAAACCTAAGGCC 12 1174 729580 N/A N/A  9118  9133 ATTGAGAGGGCCACGG 27 1175 729581 N/A N/A  9133  9148 GAAACAAGGAGAACTA 29 1176 729582 N/A N/A  9151  9166 TTCAGAATCCCAGGAG 21 1177 729583 N/A N/A  9167  9182 GACTGTGCTCCTATCG 27 1178 729584 N/A N/A  9195  9210 GACAATGCCCTGGGAA 55 1179 729585 N/A N/A  9205  9220 ACAGGGTAATGACAAT 28 1180 729586 N/A N/A  9219  9234 CGTGGGTCACACACAC 39 1181 729587 N/A N/A  9233  9248 AGCCCCAACTGCTGCG 25 1182 729588 N/A N/A  9249  9264 GGAGTCAGACCTACCA 18 1183 729589 N/A N/A  9259  9274 CCTTCTGCAGGGAGTC 73 1184 729590 N/A N/A  9285  9300 GCCCTTTGCCTCACTT 17 1185 729591 N/A N/A  9324  9339 CTCCGGTCCCAGCTCG  6 1186 729592 N/A N/A  9334  9349 AAGACCCTGCCTCCGG 23 1187 729593 N/A N/A  9355  9370 TAGCCTCAGTTTAGCT  0 1188 729594 N/A N/A  9375  9390 GAACTATGAGGCAACT 10 1189 729595 N/A N/A  9385  9400 TAACAGGCGAGAACTA  9 1190 729596 N/A N/A  9427  9442 GAAAGGAGGACAGGTT  0 1191 729597 N/A N/A  9467  9482 TGAAGGGACACCACCA 31 1192 729598 N/A N/A  9533  9548 TAGACCCCCAACCACC  5 1193 729599 N/A N/A  9553  9568 CCTATAGCTTCTCTGT 51 1194 729600 N/A N/A  9567  9582 AGGTACCTATGGTACC  9 1195 729601 N/A N/A  9578  9593 AGCCCCCTTCCAGGTA 28 1196 729602 N/A N/A  9590  9605 TAGCCTCCCATCAGCC 11 1197 729603 N/A N/A  9602  9617 CCTGGGCCACCCTAGC 11 1198 729604 N/A N/A  9634  9649 CGAACTGCCTCCCAGG  7 1199 729605 N/A N/A  9645  9660 TGCCACCTCCACGAAC 39 1200 729606 N/A N/A  9655  9670 CGGCTGTCAGTGCCAC 17 1201 729607 N/A N/A  9683  9698 CACTGCATCTACAGAG 17 1202 729608 N/A N/A  9998 10013 CAGCCATGGGTCCTTA 18 1203 729609 N/A N/A 10009 10024 TTCCCCGTGCCCAGCC  0 1204 729610 N/A N/A 10025 10040 AATCCCCCAGCACTGC 22 1205 729611 N/A N/A 10041 10056 TTGCCAATCCTACCCC 31 1206 729612 N/A N/A 10073 10088 CACCCAAGGGAGTCCA 22 1207 729613 N/A N/A 10099 10114 AGCCCCATCCGCCCTC  3 1208 729614 N/A N/A 10157 10172 GGCCCATCCCGTCCTT  0 1209 729615 N/A N/A 10183 10198 GGTCGGTCACTGTGGG  8 1210 729616 N/A N/A 10581 10596 CTTTGGGCCCTCACCA  0 1211 729617 N/A N/A 10591 10606 AGGATCACAGCTTTGG 12 1212 729618 N/A N/A 10616 10631 ATGCCCTGGGCAAGAG  8 1213 729619 N/A N/A 10627 10642 AGGCTGGAACCATGCC  0 1214 729620 N/A N/A 10637 10652 CCCTAGTCAGAGGCTG 11 1215 729621 N/A N/A 10647 10662 AAATCAAGGTCCCTAG  2 1216 729622 N/A N/A 10658 10673 GCTCTGCATCAAAATC  7 1217 729623 N/A N/A 10780 10795 ATGTACCTGTACAGTA 14 1218 729624 N/A N/A 10800 10815 CCGACTTTGGGATAGG 15 1219 729625 N/A N/A 10810 10825 CAAGCCAAGGCCGACT 36 1220 729626 N/A N/A 10820 10835 CCCCAGTTTTCAAGCC 13 1221 729627 N/A N/A 10833 10848 TAGCCCCAGGATTCCC  5 1222 729628 N/A N/A 10883 10898 AAGTTCACACTGCTCA 38 1223 729629 N/A N/A 10914 10929 CGGCTCTGAGCCTTGA  0 1224 729630 N/A N/A 10933 10948 AGTAATAGACCGCATT 21 1225 729631 N/A N/A 10952 10967 AGGACAGCCATCAGGG  8 1226 729632 N/A N/A 10962 10977 GCTGTGCATGAGGACA 17 1227 729633 N/A N/A 10972 10987 GCCAGATCCAGCTGTG  0 1228 729634 N/A N/A 11023 11038 ACCACCTGGGAGGCAA 16 1229 729658 N/A N/A  8885  8900 TCCCCTGAGAGGCTGC 20 1230 729659 N/A N/A  9543  9558 CTCTGTATACTAGACC 64 1231 729660 N/A N/A 10134 10149 ACGCCTCCCCATTCTG  6 1232 729661 N/A N/A 10894 10909 CTCTGGCCGCCAAGTT  5 1233

TABLE 17 Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 3 SEQ SEQ ID ID NO: 3 NO: 3 SEQ Compound Start Stop IRF5 (% ID Number Site Site Sequence (5′ to 3′) Inhibition) NO 728399  96 111 TCTGTCTGCGGTGCGC 26 1234 728400  98 113 GGTCTGTCTGCGGTGC 23 1235 728539 591 606 GCATCTGTGAGGCTCA 21 1236 728540 593 608 CTGCATCTGTGAGGCT 30 1237 728541 595 610 CACTGCATCTGTGAGG  8 1238 728542 597 612 TGCACTGCATCTGTGA 20 1239 728543 599 614 ACTGCACTGCATCTGT 12 1240

Example 2: Antisense Inhibition of Human IRF5 in KARPAS-229 Cells by Modified Oligonucleotides

In the second stage of the screening, modified oligonucleotides were designed to sites adjacent to the most active leads/sites from the first stage of screening described above. Briefly, active leads from the first phase of the screening were microwalked until previously tested or rejected sites were approximately reached. Several different chemistry modifications were tested, which are specified in the Chemistry Notation column of the tables below, wherein the notation “d” refers to a 2′-deoxyribose sugar, the notation “s” refers to a phosphorothioate internucleoside linkage, the notation “k” refers to a cEt modified sugar, and the notation “mC” refers to a 5-methyl cytosine.

Cultured KARPAS-229 cells at a density of 10,000 cells per well were treated using free uptake with 4,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and IRF5 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4524 (forward sequence TTCGAGATCTTCTTCTGCTTTGG, designated herein as SEQ ID NO: 14; reverse sequence GCACCACCTGTACAGTAATGAGCTT; designated herein as SEQ ID NO: 15; probe sequence CCTGACCGCAAACCCCGAGAGAA, designated herein as SEQ ID NO: 16) was used to measure mRNA levels. IRF5 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of IRF5 relative to untreated control cells. As used herein, a value of ‘0’ indicates that treatment with the modified oligonucleotide did not inhibit IRF5 mRNA levels. ‘N/A’ indicates that the modified oligonucleotide does not target that gene sequence with 100% complementarity.

TABLE 18 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop Sequence Chemistry (% ID Number Site Site Site Site (5′ to 3′) Notation Inhibition) NO 666178 N/A N/A  6540  6555 GCATTCCATAT GksmCksAksTdsTdsmCds 21 1003 ACACA mCdsAdsTdsAdsTdsAds mCdsAksmCksAk 728708 1308 1323 10541 10556 AGCTTGGTCTT AksGksmCksTdsTdsGds 48  436 GACCT GdsTdsmCdsTdsTdsGds AdsmCksmCksTk 728894 1764 1779 11329 11344 CACATCTCCAC mCksAksmCksAdsTdsm 45  633 ATCAG CdsTdsmCdsmCdsAdsm CdsAdsTdsmCksAksGk 729213 N/A N/A  6539  6554 CATTCCATATA mCksAksTksTdsmCdsm 28 1006 CACAC CdsAdsTdsAdsTdsAdsm CdsAdsmCksAksmCk 729476 N/A N/A  6549  6564 TCCAATTTTGC TksmCksmCksAdsAdsTds 79 1047 ATTCC TdsTdsTdsGdsmCdsAds TdsTksmCksmCk 785370 1762 1777 11327 11342 CATCTCCACAT mCksAdsTdsmCdsTdsm 25  631 CAGTC CdsmCdsAdsmCdsAdsTds mCksAesGksTesmCk 785371 1764 1779 11329 11344 CACATCTCCAC mCksAdsmCdsAdsTdsm 15  633 ATCAG CdsTdsmCdsmCdsAdsm CdsAksTesmCksAesGk 785392 N/A N/A  6539  6554 CATTCCATATA mCksAdsTdsTdsmCdsm 31 1006 CACAC CdsAdsTdsAdsTdsAdsm CksAesmCksAesmCk 785393 N/A N/A  6540  6555 GCATTCCATAT GksmCdsAdsTdsTdsmCds 39 1003 ACACA mCdsAdsTdsAdsTdsAks mCesAksmCesAk 785394 N/A N/A  6547  6562 CAATTTTGCAT mCksAdsAdsTdsTdsTds 21 1241 TCCAT TdsGdsmCdsAdsTdsTks mCesmCksAesTk 785395 N/A N/A  6549  6564 TCCAATTTTGC TksmCdsmCdsAdsAdsTds 37 1047 ATTCC TdsTdsTdsGdsmCdsAks TesTksmCesmCk 785425 1762 1777 11327 11342 CATCTCCACAT mCksAdsTdsmCdsTdsm 32  631 CAGTC CdsmCdsAdsmCdsAdsTks mCesAksGesTksmCe 785426 1764 1779 11329 11344 CACATCTCCAC mCksAdsmCdsAdsTdsm  2  633 ATCAG CdsTdsmCdsmCdsAdsm CksAesTksmCesAksGe 785447 N/A N/A  6539  6554 CATTCCATATA mCksAdsTdsTdsmCdsm  7 1006 CACAC CdsAdsTdsAdsTdsAksm CesAksmCesAksmCe 785448 N/A N/A  6540  6555 GCATTCCATAT GksmCdsAdsTdsTdsmCds 34 1003 ACACA mCdsAdsTdsAdsTksAes mCksAesmCksAe 785449 N/A N/A  6547  6562 CAATTTTGCAT mCksAdsAdsTdsTdsTds 19 1241 TCCAT TdsGdsmCdsAdsTksTes mCksmCesAksTe 785450 N/A N/A  6549  6564 TCCAATTTTGC TksmCdsmCdsAdsAdsTds  6 1047 ATTCC TdsTdsTdsGdsmCksAes TksTesmCksmCe 785471 1764 1779 11329 11344 CACATCTCCAC mCksAesmCksAdsTdsm 26  633 ATCAG CdsTdsmCdsmCdsAdsm CdsAdsTesmCesAksGk 785483 N/A N/A  6539  6554 CATTCCATATA mCksAesTksTdsmCdsm 24 1006 CACAC CdsAdsTdsAdsTdsAdsm CdsAesmCesAksmCk 785484 N/A N/A  6540  6555 GCATTCCATAT GksmCesAksTdsTdsmCds 48 1003 ACACA mCdsAdsTdsAdsTdsAds mCesAesmCksAk 785485 N/A N/A  6549  6564 TCCAATTTTGC TksmCesmCksAdsAdsTds 76 1047 ATTCC TdsTdsTdsGdsmCdsAds TesTesmCksmCk 785513 1763 1778 11328 11343 ACATCTCCAC AksmCksAdsTdsmCdsTds 36  632 ATCAGT mCdsCdsAdsmCdsAds TdsmCksAesGksTe 785514 1764 1779 11329 11344 CACATCTCCAC mCksAksmCdsAdsTdsm 23  633 ATCAG CdsTdsmCdsmCdsAdsm CdsAdsTksmCesAksGe 785535 N/A N/A  6539  6554 CATTCCATATA mCksAksTdsTdsmCdsm 30 1006 CACAC CdsAdsTdsAdsTdsAdsm CdsAksmCesAksmCe 785536 N/A N/A  6540  6555 GCATTCCATAT GksmCksAdsTdsTdsmCds 37 1003 ACACA mCdsAdsTdsAdsTdsAds mCksAesmCksAe 785537 N/A N/A  6548  6563 CCAATTTTGCA mCksmCksAdsAdsTdsTds 57 1242 TTCCA TdsTdsGdsmCdsAdsTds TksmCesmCksAe 785538 N/A N/A  6549  6564 TCCAATTTTGC TksmCksmCdsAdsAdsTds 40 1047 ATTCC TdsTdsTdsGdsmCdsAds TksTesmCksmCe 785558 1763 1778 11328 11343 ACATCTCCAC AksmCksAdsTdsmCdsTds 24  632 ATCAGT mCdsmCdsAdsCdsAes TesmCesAesGksTk 785570 N/A N/A  6539  6554 CATTCCATATA mCksAksTdsTdsmCdsm 21 1006 CACAC CdsAdsTdsAdsTdsAesm CesAesmCesAksmCk 785571 N/A N/A  6548  6563 CCAATTTTGCA mCksmCksAdsAdsTdsTds 48 1242 TTCCA TdsTdsGdsmCdsAesTes TesmCesmCksAk 785609 1762 1777 11327 11342 CATCTCCACAT mCksAksTdsmCdsTdsm 23  631 CAGTC CdsmCdsAdsmCdsAdsTks mCesAksGesTksmCk 785610 1763 1778 11328 11343 ACATCTCCAC AksmCksAdsTdsmCdsTds 15  632 ATCAGT mCdsmCdsAdsCdsAks TesmCksAesGksTk 785611 1764 1779 11329 11344 CACATCTCCAC mCksAksmCdsAdsTdsm 17  633 ATCAG CdsTdsmCdsmCdsAdsm CksAesTksmCesAksGk 785640 N/A N/A  6539  6554 CATTCCATATA mCksAksTdsTdsmCdsm 17 1006 CACAC CdsAdsTdsAdsTdsAksm CesAksmCesAksmCk 785641 N/A N/A  6540  6555 GCATTCCATAT GksmCksAdsTdsTdsmCds  0 1003 ACACA mCdsAdsTdsAdsTksAes mCksAesmCksAk 785642 N/A N/A  6547  6562 CAATTTTGCAT mCksAksAdsTdsTdsTds 32 1241 TCCAT TdsGdsmCdsAdsTksTes mCksmCesAksTk 785643 N/A N/A  6548  6563 CCAATTTTGCA mCksmCksAdsAdsTdsTds 39 1242 TTCCA TdsTdsGdsmCdsAksTes TksmCesmCksAk 785644 N/A N/A  6549  6564 TCCAATTTTGC TksmCksmCdsAdsAdsTds 15 1047 ATTCC TdsTdsTdsGdsmCksAes TksTesmCksmCk 785667 1763 1778 11328 11343 ACATCTCCAC AksmCksAdsTdsmCdsTds 41  632 ATCAGT mCdsmCdsAdsmCdsAds TesmCesAesGksTk 785679 N/A N/A  6539  6554 CATTCCATATA mCksAksTdsTdsmCdsm 21 1006 CACAC CdsAdsTdsAdsTdsAdsm CesAesmCesAksmCk 785680 N/A N/A  6548  6563 CCAATTTTGCA mCksmCksAdsAdsTdsTds 30 1242 TTCCA TdsTdsGdsmCdsAdsTes TesmCesmCksAk 785697 1763 1778 11328 11343 ACATCTCCAC AksmCksAdsTdsmCdsTds 28  632 ATCAGT mCdsmCdsAdsmCdsAds TksmCdsAksGdsTk 785709 N/A N/A  6539  6554 CATTCCATATA mCksAksTdsTdsmCdsm 25 1006 CACAC CdsAdsTdsAdsTdsAdsm CksAdsmCksAdsmCk 785710 N/A N/A  6548  6563 CCAATTTTGCA mCksmCksAdsAdsTdsTds 42 1242 TTCCA TdsTdsGdsmCdsAdsTks TdsmCksmCdsAk 785738 1763 1778 11328 11343 ACATCTCCAC AksmCksAdsTdsmCdsTds 16  632 ATCAGT mCdsmCdsAdsmCdsAds TksmCesAksGesTk 785739 1764 1779 11329 11344 CACATCTCCAC mCksAksmCdsAdsTdsm 22  633 ATCAG CdsTdsmCdsmCdsAdsm CdsAksTesmCksAesGk 785760 N/A N/A  6539  6554 CATTCCATATA mCksAksTdsTdsmCdsm 54 1006 CACAC CdsAdsTdsAdsTdsAdsm CksAesmCksAesmCk 785761 N/A N/A  6540  6555 GCATTCCATAT GksmCksAdsTdsTdsmCds  2 1003 ACACA mCdsAdsTdsAdsTdsAks mCesAksmCesAk 785762 N/A N/A  6548  6563 CCAATTTTGCA mCksmCksAdsAdsTdsTds 11 1242 TTCCA TdsTdsGdsmCdsAdsT ksTesmCksmCesAk 785763 N/A N/A  6549  6564 TCCAATTTTGC TksmCksmCdsAdsAdsTds 29 1047 ATTCC TdsTdsTdsGdsmCdsAks TesTksmCesmCk 785784 1764 1779 11329 11344 CACATCTCCAC mCksAksmCksAdsTdsm 39  633 ATCAG CdsTdsmCdsmCdsAdsm CdsAksTdsmCksAdsGk 785796 N/A N/A  6539  6554 CATTCCATATA mCksAksTksTdsmCdsm 40 1006 CACAC CdsAdsTdsAdsTdsAdsm CksAdsmCksAdsmCk 785797 N/A N/A  6540  6555 GCATTCCATAT GksmCksAksTdsTdsmCds  0 1003 ACACA mCdsAdsTdsAdsTdsAks mcdsAksmCdsAk 785798 N/A N/A  6549  6564 TCCAATTTTGC TksmCksmCksAdsAdsTds 32 1047 ATTCC TdsTdsTdsGdsmCdsAks TdsTksmCdsmCk 785826 1763 1778 11328 11343 ACATCTCCAC AksmCksAksTdsmCdsTds 14  632 ATCAGT mCdsmCdsAdsmCdsAds TksmCesAksGesTk 785827 1764 1779 11329 11344 CACATCTCCAC mCksAksmCksAdsTdsm 43  633 ATCAG CdsTdsmCdsmCdsAdsm CdsAksTesmCksAesGk 785848 N/A N/A  6539  6554 CATTCCATATA mCksAksTksTdsmCdsm 32 1006 CACAC CdsAdsTdsAdsTdsAdsm CksAesmCksAesmCk 785849 N/A N/A  6540  6555 GCATTCCATAT GksmCksAksTdsTdsmCds  0 1003 ACACA mCdsAdsTdsAdsTdsAks mCesAksmCesAk 785850 N/A N/A  6548  6563 CCAATTTTGCA mCksmCksAksAdsTdsTds 42 1242 TTCCA TdsTdsGdsmCdsAdsTks TesmCksmCesAk 785851 N/A N/A  6549  6564 TCCAATTTTGC TksmCksmCksAdsAdsTds 51 1047 ATTCC TdsTdsTdsGdsmCdsAks TesTksmCesmCk 785872 1764 1779 11329 11344 CACATCTCCAC mCksAksmCksAdsTdsm 38  633 ATCAG CdsTdsmCdsmCdsAdsm CdsAdsTksmCesAksGe 785884 N/A N/A  6539  6554 CATTCCATATA mCksAksTksTdsmCdsm 28 1006 CACAC CdsAdsTdsAdsTdsAdsm CdsAksmCesAksmCe 785885 N/A N/A  6540  6555 GCATTCCATAT GksmCksAksTdsTdsmCds 45 1003 ACACA mCdsAdsTdsAdsTdsAds mCksAesmCksAe 785886 N/A N/A  6549  6564 TCCAATTTTGC TksmCksmCksAdsAdsTds 14 1047 ATTCC TdsTdsTdsGdsmCdsAds TksTesmCksmCe 785914 1763 1778 11328 11343 ACATCTCCAC AksmCksAksTdsmCdsTds 11  632 ATCAGT mCdsmCdsAdsmCdsAds TdsmCksAksGksTe 785915 1764 1779 11329 11344 CACATCTCCAC mCksAksmCksAdsTdsm 25  633 ATCAG CdsTdsmCdsmCdsAdsm CdsAdsTksmCksAksGe 785936 N/A N/A  6539  6554 CATTCCATATA mCksAksTksTdsmCdsm 39 1006 CACAC CdsAdsTdsAdsTdsAdsm CdsAksmCksAksmCe 785937 N/A N/A  6540  6555 GCATTCCATAT GksmCksAksTdsTdsmCds 25 1003 ACACA mCdsAdsTdsAdsTdsAds mCksAksmCksAe 785938 N/A N/A  6548  6563 CCAATTTTGCA mCksmCksAksAdsTdsTds 80 1242 TTCCA TdsTdsGdsmCdsAdsTds TksmCksmCksAe 785939 N/A N/A  6549  6564 TCCAATTTTGC TksmCksmCksAdsAdsTds  7 1047 ATTCC TdsTdsTdsGdsmCdsAds TksTksmCksmCe 786505 N/A N/A  6546  6561 AATTTTGCATT AksAksTksTdsTdsTdsGds 41 1243 CCATA mCdsAdsTdsTdsmCds mCdsAksTksAk 786506 N/A N/A  6547  6562 CAATTTTGCAT mCksAksAksTdsTdsTds 52 1241 TCCAT TdsGdsmCdsAdsTdsTds mCdsmCksAksTk 786507 N/A N/A  6548  6563 CCAATTTTGCA mCksmCksAksAdsTdsTds 78 1242 TTCCA TdsTdsGdsmCdsAdsTds TdsmCksmCksAk 786508 N/A N/A  6550  6565 TTCCAATTTTG TksTksmCksmCdsAdsAds 39 1244 CATTC TdsTdsTdsTdsGdsmCds AdsTksTksmCk 786509 N/A N/A  6551  6566 ATTCCAATTTT AksTksTksmCdsmCdsAds 21 1245 GCATT AdsTdsTdsTdsTdsGds mCdsAksTksTk 786510 N/A N/A  6553  6568 TGATTCCAATT TksGksAksTdsTdsmCds 17 1246 TTGCA mCdsAdsAdsTdsTdsTds TdsGksmCksAk 786511 N/A N/A  6555  6570 CTTGATTCCAA mCksTksTksGdsAdsTds 20 1247 TTTTG TdsmCdsmCdsAdsAdsTds TdsTksTksGk 786512 N/A N/A  6557  6572 CACTTGATTCC mCksAksmCksTdsTdsGds 36 1248 AATTT AdsTdsTdsmCdsmCds AdsAdsTksTksTk

TABLE 19 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop Sequence Chemistry (% ID Number Site Site Site Site (5′ to 3′) Notation Inhibition) NO 665795  385  400  4710  4725 GTTATCTCCGT GksTksTksAdsTdsmCds 31  113 CCTGG TdsmCdsmCdsGdsTdsm CdsmCdsTksGksGk 728489  484  499  8377  8392 AAGGGCACAGA AksAksGksGdsGdsmCds  0 1249 CGCAGG AdsmCdsAdsGdsmCds GdsmCdsAksGksGk 728695 1270 1285 10503 10518 TGAGTCATGG TksGksAksGdsTdsmCds  0  423 GCTGAG AdsTdsGdsGdsGdsmCds TdsGksAksGk 728696 1271 1286 10504 10519 ATGAGTCATG AksTksGksAdsGdsTds 21  424 GGCTGA mCdsAdsTdsGdsGdsGds mCdsTksGksAk 728708 1308 1323 10541 10556 AGCTTGGTCT AksGksmCksTdsTdsGds 38  436 TGACCT GdsTdsmCdsTdsTdsGds AdsmCksmCksTk 785345  383  398  4708  4723 TATCTCCGTCC TksAdsTdsmCdsTdsmCds  0  116 TGGCT mCdsGdsTdsmCdsmCds TksGesGksmCesTk 785346  385  400  4710  4725 GTTATCTCCGTT GksTdsTdsAdsTdsmCds  0  113 CCTGG TdsmCdsmCdsGdsTdsm CksmCesTksGesGk 785350  482  497  8375  8390 GGGCACAGCGC GksGdsGdsmCdsAdsm 37 1250 CAGGTT CdsAdsGdsmCdsGdsm CdsAksGesGksTesTk 785351  484  499  8377  8392 AAGGGCACAG AksAdsGdsGdsGdsmCds  0 1249 CGCAGG AdsmCdsAdsGdsmCds GksmCesAksGesGk 785355 1268 1283 10501 10516 AGTCATGGGC AksGdsTdsmCdsAdsTds 25  421 TGAGGC GdsGdsGdsmCdsTdsGks AesGksGesmCk 785356 1269 1284 10502 10517 GAGTCATGGG GksAdsGdsTdsmCdsAds  0  422 CTGAGG TdsGdsGdsGdsmCdsTks GesAksGesGk 785357 1270 1285 10503 10518 TGAGTCATGG TksGdsAdsGasTasmCds  0  423 GCTGAG AdsTdsGdsGdsGdsmCks TesGksAesGk 785358 1271 1286 10504 10519 ATGAGTCATG AksTdsGdsAdsGdsTds  0  424 GGCTGA mCdsAdsTdsGdsGdsGks mCesTksGesAk 785405  482  497  8375  8390 GGGCACAGCG GksGdsGdsmCdsAdsm 33 1250 CAGGTT CdsAdsGdsmCdsGdsm CksAesGksGesTksTe 785406  484  499  8377  8392 AAGGGCACAGA AksAdsGdsGdsGdsmCds  0 1249 CGCAGG AdsmCdsAdsGdsmCks GesmCksAesGksGe 785410 1268 1283 10501 10516 AGTCATGGGCG AksGdsTdsmCdsAdsTds 17  421 TGAGGC GdsGdsGdsmCdsTksGes AksGesGksmCe 785411 1269 1284 10502 10517 GAGTCATGGG GksAdsGdsTdsmCdsAds  0  422 CTGAGG TdsGdsGdsGdsmCksTes GksAesGksGe 785412 1270 1285 10503 10518 TGAGTCATGGA TksGdsAdsGdsTdsmCds  0  423 GCTGAG AdsTdsGdsGdsGksmCes TksGesAksGe 785413 1271 1286 10504 10519 ATGAGTCATG AksTdsGdsAdsGdsTds  7  424 GGCTGA mCdsAdsTdsGdsGksGes mCksTesGksAe 785457  385  400  4710  4725 GTTATCTCCGT GksTesTksAdsTdsmCds 13  113 CCTGG TdsmCdsmCdsGdsTdsm CdsmCesTesGksGk 785460  484  499  8377  8392 AAGGGCACAG AksAesGksGdsGdsmCds  0 1249 CGCAGG AdsmCdsAdsGdsmCds GdsmCesAesGksGk 785462 1270 1285 10503 10518 TGAGTCATGG TksGesAksGdsTdsmCds 12  423 GCTGAG AdsTdsGdsGdsGdsmCds TesGesAksGk 785463 1271 1286 10504 10519 ATGAGTCATG AksTesGksAdsGdsTds  0  424 GGCTGA mCdsAdsTdsGdsGdsGks mCesTesGksAk 785489  384  399  4709  4724 TTATCTCCGTC TksTksAdsTdsmCdsTds  0  117 CTGGC mCdsmCdsGdsTdsmCds mCdsTksGesGksmCe 785490  385  400  4710  4725 GTTATCTCCGT GksTksTdsAdsTdsmCds  0  113 CCTGG TdsmCdsmCdsGdsTdsm CdsmCksTesGksGe 785495  484  499  8377  8392 AAGGGCACAG AksAksGdsGdsGdsmCds  0 1249 CGCAGG AdsmCdsAdsGdsmCds GdsmCksAesGksGe 785499 1269 1284 10502 10517 GAGTCATGGG GksAksGdsTdsmCdsAds 40  422 CTGAGG TdsGdsGdsGdsmCdsTds GksAesGksGe 785500 1270 1285 10503 10518 TGAGTCATGG TksGksAdsGdsTdsmCds  0  423 GCTGAG AdsTdsGdsGdsGdsmCds TksGesAksGe 785501 1271 1286 10504 10519 ATGAGTCATG AksTksGdsAdsGdsTds  0  424 GGCTGA mCdsAdsTdsGdsGdsGds mCksTesGksAe 785545  384  399  4709  4724 TTATCTCCGTC TksTksAdsTdsmCdsTds  0  117 CTGGC mCdsmCdsGdsTdsmCes mCesTesGesGksmCk 785550 1269 1284 10502 10517 GAGTCATGGG  TksAksGdsTdsmCdsAds  5  422 CTGAGG TdsGdsGdsGdsmCesTes GesAesGksGk 785551 1270 1285 10503 10518 TGAGTCATGG TksGksAdsGdsTdsmCds 15  423 GCTGAG AdsTdsGdsGdsGesmCes TesGesAksGk 785575  383  398  4708  4723 TATCTCCGTCC TksAksTdsmCdsTdsmCds  6  116 TGGCT mCdsGdsTdsmCdsmCks TesGksGesmCksTk 785576  384  399  4709  4724  TTATCTCCGTC TksTksAdsTdsmCdsTds  0  117 CTGGC mCdsmCdsGdsTdsmCks mCesTksGesGksmCk 785577  385  400  4710  4725 GTTATCTCCGT GksTksTdsAdsTdsmCds  0  113 CCTGG TdsmCdsmCdsGdsTksm CesmCksTesGksGk 785583  482  497  8375  8390 GGGCACAGCG GksGksGdsmCdsAdsm 61 1250 CAGGTT CdsAdsGdsmCdsGdsm CksAesGksGesTksTk 785584  484  499  8377  8392 AAGGGCACAG AksAksGdsGdsGdsmCds  0 1249 CGCAGG AdsmCdsAdsGdsmCks GesmCksAesGksGk 785590 1268 1283 10501 10516 AGTCATGGGCG AksGksTdsmCdsAdsTds 17  421 TGAGGC GdsGdsGdsmCdsTksGes AksGesGksmCk 785591 1269 1284 10502 10517 GAGTCATGGG GksAksGdsTdsmCdsAds  0  422 CTGAGG TdsGdsGdsGdsmCksTes GksAesGksGk 785592 1270 1285 10503 10518 TGAGTCATGG TksGksAdsGdsTdsmCds  0  423 GCTGAG AdsTdsGdsGdsGksmCes TksGesAksGk 785593 1271 1286 10504 10519 ATGAGTCATG AksTksGdsAdsGdsTds  0  424 GGCTGA mCdsAdsTdsGdsGksGes mCksTesGksAk 785654  384  399  4709  4724 TTATCTCCGTC TksTksAdsTdsmCdsTds  5  117 CTGGC mCdsmCdsGdsTdsmCds mCesTesGesGksmCk 785659 1269 1284 10502 10517 GAGTCATGGG GksAksGdsTdsmCdsAds 30  422 CTGAGG TdsGdsGdsGdsmCdsTes GesAesGksGk 785660 1270 1285 10503 10518 TGAGTCATGGA TksGksAdsGdsTdsmCds 16  423 GCTGAG AdsTdsGdsGdsGdsmCes TesGesAksGk 785684  384  399  4709  4724 TTATCTCCGTC TksTksAdsTdsmCdsTds 14  117 CTGGC mCdsmCdsGdsTdsmCds mCksTdsGksGdsmCk 785689 1269 1284 10502 10517 GAGTCATGGG GksAksGdsTdsmCdsAds 31  422 CTGAGG TdsGdsGdsGdsmCdsTks GdsAksGdsGk 785690 1270 1285 10503 10518 TGAGTCATGG TksGksAdsGdsTdsmCds 12  423 GCTGAG AdsTdsGdsGdsGdsmCks TdsGksAdsGk 785714  384  399  4709  4724 TTATCTCCGTC TksTksAdsTdsmCdsTds  0  117 CTGGC mCdsmCdsGdsTdsmCds mCksTesGksGesmCk 785715  385  400  4710  4725 GTTATCTCCGT GksTksTdsAdsTdsmCds  0  113 CCTGG TdsmCdsmCdsGdsTdsm CksmCesTksGesGk 785720  484  499  8377  8392 AAGGGCACAG AksAksGdsGdsGdsmCds  0 1249 CGCAGG AdsmCdsAdsGdsmCds GksmCesAksGesGk 785724 1269 1284 10502 10517 GAGTCATGGG GksAksGdsTdsmCdsAds 15  422 CTGAGG TdsGdsGdsGdsmCdsTks GesAksGesGk 785725 1270 1285 10503 10518 TGAGTCATGG TksGksAdsGdsTdsmCds  0  423 GCTGAG AdsTdsGdsGdsGdsmCks TesGksAesGk 785726 1271 1286 10504 10519 ATGAGTCATG AksTksGdsAdsGdsTds  0  424 GGCTGA mCdsAdsTdsGdsGdsGks mCesTksGesAk 785770  385  400  4710  4725 GTTATCTCCGTT GksTksTksAdsTdsmCds 27  113 CCTGG TdsmCdsmCdsGdsTdsm CksmCdsTksGdsGk 785773  484  499  8377  8392 AAGGGCACAG AksAksGksGdsGdsmCds 12 1249 CGCAGG AdsmCdsAdsGdsmCds GksmCdsAksGdsGk 785775 1270 1285 10503 10518 TGAGTCATGG TksGksAksGdsTdsmCds  3  423 GCTGAG AdsTdsGdsGdsGdsmCks TdsGksAdsGk 785776 1271 1286 10504 10519 ATGAGTCATG AksTksGksAdsGdsTds  0  424 GGCTGA mCdsAdsTdsGdsGdsGks mCdsTksGdsAk 785802  384  399  4709  4724 TTATCTCCGTC TksTksAksTdsmCdsTds  0  117 CTGGC mCdsmCdsGdsTdsmCds mCksTesGksGesmCk 785803  385  400  4710  4725 GTTATCTCCGTT GksTksTksAdsTdsmCds  0  113 CCTGG TdsmCdsmCdsGdsTdsm CksmCesTksGesGk 785808  484  499  8377  8392 AAGGGCACAG AksAksGksGdsGdsmCds  0 1249 CGCAGG AdsmCdsAdsGdsmCds GksmCesAksGesGk 785812 1269 1284 10502 10517 GAGTCATGGG GksAksGksTdsmCdsAds  0  422 CTGAGG TdsGdsGdsGdsmCdsTks GesAksGesGk 785813 1270 1285 10503 10518 TGAGTCATGG TksGksAksGdsTdsmCds  0  423 GCTGAG AdsTdsGdsGdsGdsmCks TesGksAesGk 785814 1271 1286 10504 10519 ATGAGTCATG AksTksGksAdsGdsTds  0  424 GGCTGA mCdsAdsTdsGdsGdsGks mCesTksGesAk 785858  385  400  4710  4725 GTTATCTCCGTT GksTksTksAdsTdsmCds  0  113 CCTGG TdsmCdsmCdsGdsTdsm CdsmCksTesGksGe 785861  484  499  8377  8392 AAGGGCACAG AksAksGksGdsGdsmCds  0 1249 CGCAGG AdsmCdsAdsGdsmCds GdsmCksAesGksGe 785863 1270 1285 10503 10518 TGAGTCATGG TksGksAksGdsTdsmCds 17  423 GCTGAG AdsTdsGdsGdsGdsmCds TksGesAksGe 785864 1271 1286 10504 10519 ATGAGTCATG AksTksGksAdsGdsTds  9  424 GGCTGA mCdsAdsTdsGdsGdsGds mCksTesGksAe 785890  384  399  4709  4724 TTATCTCCGTC TksTksAksTdsmCdsTds  0  117 CTGGC mCdsmCdsGdsTdsmCds mCdsTksGksGksmCe 785891  385  400  4710  4725 GTTATCTCCGT GksTksTksAdsTdsmCds 33  113 CCTGG TdsmCdsmCdsGdsTdsm CdsmCksTksGksGe 785896  484  499  8377  8392 AAGGGCACAG AksAksGksGdsGdsmCds  3 1249 CGCAGG AdsmCdsAdsGdsmCds GdsmCksAksGksGe 785900 1269 1284 10502 10517 GAGTCATGGG GksAksGksTdsmCdsAds  0  422 CTGAGG TdsGdsGdsGdsmCdsTds GksAksGksGe 785901 1270 1285 10503 10518 TGAGTCATGG TksGksAksGdsTdsmCds 11  423 GCTGAG AdsTdsGdsGdsGdsmCds TksGksAksGe 785902 1271 1286 10504 10519 ATGAGTCATG AksTksGksAdsGdsTds 20  424 GGCTGA mCdsAdsTdsGdsGdsGds mCksTksGksAe 785938 N/A N/A  6548  6563 CCAATTTTGC mCksmCksAksAdsTdsTds 71 1242 ATTCCA TdsTdsGdsmCdsAdsTds TksmCksmCksAe 786473  385  400  4710  4725 GTTATCTCCGT GksTdsTdsAdsTdsmCds  0  113 CCTGG TdsmCdsmCdsGdsTksm CesmCksTesGksGe 786474  383  398  4708  4723 TATCTCCGTCC TksAdsTdsmCdsTdsmCds  0  116 TGGCT mCdsGdsTdsmCdsmCks TesGksGesmCksTe 786495  483  498  8376  8391 AGGGCACAGC AksGksGksGdsmCdsAds  2 1251 GCAGGT mCdsAdsGdsmCdsGds mCdsAdsGksGksTk 786496  485  500  8378  8393 TAAGGGCACA TksAksAksGdsGdsGds  0 1252 GCGCAG mCdsAdsmCdsAdsGdsm CdsGdsmCksAksGk 786497  486  501  8379  8394 TTAAGGGCAC TksTksAksAdsGdsGds  0 1253 AGCGCA GdsmCdsAdsmCdsAds GdsmCdsGksmCksAk

TABLE 20 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop Sequence Chemistry (% ID Number Site Site Site Site (5′ to 3′) Notation Inhibition) NO 665892 1227 1242 10460 10475 CACTGACACA mCksAksmCksTdsGdsAds  1  387 GGCGGA mCdsAdsmCdsAdsGdsGds mCdsGksGksAk 665893 1228 1243 10461 10476 GCACTGACAC GksmCksAksmCdsTdsGds 14   39 AGGCGG AdsmCdsAdsmCdsAdsGds GdsmCksGksGk 728466  427  442  8320  8335 GGTGTATTTC GksGksTksGdsTdsAdsTds 10 1254 CCTGTC TdsTdsmCdsmCdsmCdsT dsGksTksmCk 728489  484  499  8377  8392 AAGGGCACA AksAksGksGdsGdsmCds 48 1249 GCGCAGG AdsmCdsAdsGdsmCdsGds mCdsAksGksGk 728670 1230 1245 10463 10478 TTGCACTGAC TksTksGksmCdsAdsmCds 18  398 ACAGGC TdsGdsAdsmCdsAdsmCds AdsGksGksmCk 728705 1303 1318 10536 10551 GGTCTTGACC GksGksTksmCdsTdsTds 33  433 TCCCGC GdsAdsmCdsmCdsTdsmCds mCdsmCksGksmCk 728706 1306 1321 10539 10554 CTTGGTCTTG mCksTksTksGdsGdsTdsm 41  434 ACCTCC CdsTdsTdsGdsAdsmCdsm CdsTksmCksmCk 728707 1307 1322 10540 10555 GCTTGGTCTT GksmCksTksTdsGdsGds 43  435 GACCTC TdsmCdsTdsTdsGdsAdsm CdsmCksTksmCk 728708 1308 1323 10541 10556 AGCTTGGTCT AksGksmCksTdsTdsGds 14  436 TGACCT GdsTdsmCdsTdsTdsGds AdsmCksmCksTk 729037 2216 2231 11781 11796 GGTTCTTGGA GksGksTksTdsmCdsTds 68  706 CTCTCA TdsGdsGdsAdsmCdsTdsm CdsTksmCksAk 785354 1228 1243 10461 10476 GCACTGACAC GksmCdsAdsmCdsTdsGds  0   39 AGGCGG AdsmCdsAdsmCdsAdsGks GesmCksGesGk 785359 1301 1316 10534 10549 TCTTGACCTC TksmCdsTdsTdsGdsAdsm 46  391 CCGCTG CdsmCdsTdsmCdsmCdsm CksGesmCksTesGk 785360 1303 1318 10536 10551 GGTCTTGACC GksGdsTdsmCdsTdsTds 37  433 TCCCGC GdsAdsmCdsmCdsTdsmCks mCesmCksGesmCk 785361 1306 1321 10539 10554 CTTGGTCTTG mCksTdsTdsGdsGdsTdsm  0  434 ACCTCC CdsTdsTdsGdsAdsmCksm CesTksmCesmCk 785362 1307 1322 10540 10555 GCTTGGTCTT GksmCdsTdsTdsGdsGds 18  435 GACCTC TdsmCdsTdsTdsGdsAksm CesmCksTesmCk 785363 1308 1323 10541 10556 AGCTTGGTCT AksGdsmCdsTdsTdsGds  0  436 TGACCT GdsTdsmCdsTdsTdsGks AesmCksmCesTk 785409 1228 1243 10461 10476 GCACTGACAC GksmCdsAdsmCdsTdsGds  0   39 AGGCGG AdsmCdsAdsmCdsAksGes GksmCesGksGe 785414 1301 1316 10534 10549 TCTTGACCTC TksmCdsTdsTdsGdsAdsm 40  391 CCGCTG CdsmCdsTdsmCdsmCksm CesGksmCesTksGe 785415 1303 1318 10536 10551 GGTCTTGACC GksGdsTdsmCdsTdsTds 35  433 TCCCGC GdsAdsmCdsmCdsTksmCes mCksmCesGksmCe 785416 1306 1321 10539 10554 CTTGGTCTTG mCksTdsTdsGdsGdsTdsm  0  434 ACCTCC CdsTdsTdsGdsAksmCesm CksTesmCksmCe 785417 1307 1322 10540 10555 GCTTGGTCTT GksmCdsTdsTdsGdsGds 17  435 GACCTC TdsmCdsTdsTdsGksAesm CksmCesTksmCe 785418 1308 1323 10541 10556 AGCTTGGTCT AksGdsmCdsTdsTdsGds 14  436 TGACCT GdsTdsmCdsTdsTksGes AksmCesmCksTe 785464 1303 1318 10536 10551 GGTCTTGACC GksGesTksmCdsTdsTds 33  433 TCCCGC GdsAdsmCdsmCdsTdsm CdsmCesmCesGksmCk 785465 1306 1321 10539 10554 CTTGGTCTTG mCksTesTksGdsGdsTdsm 36  434 ACCTCC CdsTdsTdsGdsAdsmCdsm CesTesmCksmCk 785466 1307 1322 10540 10555 GCTTGGTCTT GksmCesTksTdsGdsGds 46  435 GACCTC TdsmCdsTdsTdsGdsAdsm CesmCesTksmCk 785467 1308 1323 10541 10556 AGCTTGGTCT AksGesmCksTdsTdsGds 38  436 TGACCT GdsTdsmCdsTdsTdsGds AesmCesmCksTk 785498 1229 1244 10462 10477 TGCACTGACA TksGksmCdsAdsmCdsTds 16  388 CAGGCG GdsAdsmCdsAdsmCdsAds GksGesmCksGe 785502 1302 1317 10535 10550 GTCTTGACCT GksTksmCdsTdsTdsGds 65  432 CCCGCT AdsmCdsmCdsTdsmCdsm CdsmCksGesmCksTe 785503 1303 1318 10536 10551 GGTCTTGACC GksGksTdsmCdsTdsTds  0  433 TCCCGC GdsAdsmCdsmCdsTdsmCds mCksmCesGksmCe 785504 1306 1321 10539 10554 CTTGGTCTTG mCksTksTdsGdsGdsTdsm 39  434 ACCTCC CdsTdsTdsGdsAdsmCdsm CksTesmCksmCe 785505 1307 1322 10540 10555 GCTTGGTCTT GksmCksTdsTdsGdsGds  9  435 GACCTC TdsmCdsTdsTdsGdsAdsm CksmCesTksmCe 785506 1308 1323 10541 10556 AGCTTGGTCT AksGksmCdsTdsTdsGds  0  436 TGACCT GdsTdsmCdsTdsTdsGds AksmCesmCksTe 785549 1229 1244 10462 10477 TGCACTGACA TksGksmCdsAdsmCdsTds  0  388 CAGGCG GdsAdsmCdsAdsmCesAes GesGesmCksGk 785552 1302 1317 10535 10550 GTCTTGACCT GksTksmCdsTdsTdsGds 34  432 CCCGCT AdsmCdsmCdsTdsmCesm CesmCesGesmCksTk 785553 1306 1321 10539 10554 CTTGGTCTTG mCksTksTdsGdsGdsTdsm 20  434 ACCTCC CdsTdsTdsGdsAesmCesm CesTesmCksmCk 785554 1307 1322 10540 10555 GCTTGGTCTT GksmCksTdsTdsGdsGds 19  435 GACCTC TdsmCdsTdsTdsGesAesm CesmCesTksmCk 785588 1228 1243 10461 10476 GCACTGACAC GksmCksAdsmCdsTdsGds  0   39 AGGCGG AdsmCdsAdsmCdsAksGes GksmCesGksGk 785589 1229 1244 10462 10477 TGCACTGACA TksGksmCdsAdsmCdsTds  0  388 CAGGCG GdsAdsmCdsAdsmCksAes GksGesmCksGk 785594 1301 1316 10534 10549 TCTTGACCTC TksmCksTdsTdsGdsAdsm 19  391 CCGCTG CdsmCdsTdsmCdsmCksm CesGksmCesTksGk 785595 1302 1317 10535 10550 GTCTTGACCT GksTksmCdsTdsTdsGds 26  432 CCCGCT AdsmCdsmCdsTdsmCksm CesmCksGesmCksTk 785596 1303 1318 10536 10551 GGTCTTGACC GksGksTdsmCdsTdsTds 44  433 TCCCGC GdsAdsmCdsmCdsTksmCes mCksmCesGksmCk 785597 1306 1321 10539 10554 CTTGGTCTTG mCksTksTdsGdsGdsTdsm  0  434 ACCTCC CdsTdsTdsGdsAksmCesm CksTesmCksmCk 785598 1307 1322 10540 10555 GCTTGGTCTT GksmCksTdsTdsGdsGds 21  435 GACCTC TdsmCdsTdsTdsGksAesm CksmCesTksmCk 785599 1308 1323 10541 10556 AGCTTGGTCT AksGksmCdsTdsTdsGds  0  436 TGACCT GdsTdsmCdsTdsTksGes AksmCesmCksTk 785658 1229 1244 10462 10477 TGCACTGACA TksGksmCdsAdsmCdsTds 18  388 CAGGCG GdsAdsmCdsAdsmCdsAes GesGesmCksGk 785661 1302 1317 10535 10550 GTCTTGACCT GksTksmCdsTdsTdsGds 54  432 CCCGCT AdsmCdsmCdsTdsmCdsm CesmCesGesmCksTk 785662 1306 1321 10539 10554 CTTGGTCTTG mCksTksTdsGdsGdsTdsm 11  434 ACCTCC CdsTdsTdsGdsAdsmCesm CesTesmCksmCk 785663 1307 1322 10540 10555 GCTTGGTCTT GksmCksTdsTdsGdsGds 10  435 GACCTC TdsmCdsTdsTdsGdsAes CesmCesTksmCk 785688 1229 1244 10462 10477 TGCACTGACA TksGksmCdsAdsmCdsTds  0  388 CAGGCG GdsAdsmCdsAdsmCdsAks GdsGksmCdsGk 785691 1302 1317 10535 10550 GTCTTGACCT GksTksmCdsTdsTdsGds 46  432 CCCGCT AdsmCdsmCdsTdsmCdsm CksmCdsGksmCdsTk 785692 1306 1321 10539 10554 CTTGGTCTTG mCksTksTdsGdsGdsTdsm 13  434 ACCTCC CdsTdsTdsGdsAdsmCksm CdsTksmCdsmCk 785693 1307 1322 10540 10555 GCTTGGTCTT GksmCksTdsTdsGdsGds 11  435 GACCTC TdsmCdsTdsTdsGdsAksm CdsmCksTdsmCk 785723 1229 1244 10462 10477 TGCACTGACA TksGksmCdsAdsmCdsTds  0  388 CAGGCG GdsAdsmCdsAdsmCdsAks GesGksmCesGk 785727 1302 1317 10535 10550 GTCTTGACCT GksTksmCdsTdsTdsGds 40  432 CCCGCT AdsmCdsmCdsTdsmCdsm CksmCesGksmCesTk 785728 1303 1318 10536 10551 GGTCTTGACC GksGksTdsmCdsTdsTds  7  433 TCCCGC GdsAdsmCdsmCdsTdsm CksmCesmCksGesmCk 785729 1306 1321 10539 10554 CTTGGTCTTG mCksTksTdsGdsGdsTdsm  3  434 ACCTCC CdsTdsTdsGdsAdsmCksm CesTksmCesmCk 785730 1307 1322 10540 10555 GCTTGGTCTT GksmCksTdsTdsGdsGds 33  435 GACCTC TdsmCdsTdsTdsGdsAksm CesmCksTesmCk 785731 1308 1323 10541 10556 AGCTTGGTCT AksGksmCdsTdsTdsGds  8  436 TGACCT GdsTdsmCdsTdsTdsGks AesmCksmCesTk 785777 1303 1318 10536 10551 GGTCTTGACC GksGksTksmCdsTdsTds  4  433 TCCCGC GdsAdsmCdsmCdsTdsm CksmCdsmCksGdsmCk 785778 1306 1321 10539 10554 CTTGGTCTTG mCksTksTksGdsGdsTdsm 19  434 ACCTCC CdsTdsTdsGdsAdsmCksm CdsTksmCdsmCk 785779 1307 1322 10540 10555 GCTTGGTCTT GksmCksTksTdsGdsGds 30  435 GACCTC TdsmCdsTdsTdsGdsAksm CdsmCksTdsmCk 785780 1308 1323 10541 10556 AGCTTGGTCT AksGksmCksTdsTdsGds 12  436 TGACCT GdsTdsmCdsTdsTdsGks AdsmCksmCdsTk 785811 1229 1244 10462 10477 TGCACTGACA TksGksmCksAdsmCdsTds  0  388 CAGGCG GdsAdsmCdsAdsmCdsAks GesGksmCesGk 785815 1302 1317 10535 10550 GTCTTGACCT GksTksmCksTdsTdsGds 23  432 CCCGCT AdsmCdsmCdsTdsmCdsm CksmCesGksmCesTk 785816 1303 1318 10536 10551 GGTCTTGACC GksGksTksmCdsTdsTds 29  433 TCCCGC GdsAdsmCdsmCdsTdsm CksmCesmCksGesmCk 785817 1306 1321 10539 10554 CTTGGTCTTG mCksTksTksGdsGdsTdsm  1  434 ACCTCC CdsTdsTdsGdsAdsmCksm CesTksmCesmCk 785818 1307 1322 10540 10555 GCTTGGTCTT GksmCksTksTdsGdsGds  0  435 GACCTC TdsmCdsTdsTdsGdsAksm CesmCksTesmCk 785819 1308 1323 10541 10556 AGCTTGGTCT AksGksmCksTdsTdsGds  3  436 TGACCT GdsTdsmCdsTdsTdsGks AesmCksmCesTk 785865 1303 1318 10536 10551 GGTCTTGACC GksGksTksmCdsTdsTds  7  433 TCCCGC GdsAdsmCdsmCdsTdsm CdsmCksmCesGksmCe 785866 1306 1321 10539 10554 CTTGGTCTTG mCksTksTksGdsGdsTdsm 15  434 ACCTCC CdsTdsTdsGdsAdsmCds CksTesmCksmCe 785867 1307 1322 10540 10555 GCTTGGTCTT GksmCksTksTdsGdsGds 35  435 GACCTC TdsmCdsTdsTdsGdsAdsm CksmCesTksmCe 785868 1308 1323 10541 10556 AGCTTGGTCT AksGksmCksTdsTdsGds 26  436 TGACCT GdsTdsmCdsTdsTdsGds AksmCesmCksTe 785899 1229 1244 10462 10477 TGCACTGACA TksGksmCksAdsmCdsTds  0  388 CAGGCG GdsAdsmCdsAdsmCdsAds GksGksmCksGe 785903 1302 1317 10535 10550 GTCTTGACCT GksmTksmCksTdsTdsGds 51  432 CCCGCT AdsmCdsmCdsTdsmCdsm CdsmCksGksmCksTe 785904 1303 1318 10536 10551 GGTCTTGACC GksGksTksmCdsTdsTds 22  433 TCCCGC GdsAdsmCdsmCdsTdsm CdsmCksmCksGksmCe 785905 1306 1321 10539 10554 CTTGGTCTTG mCksTksTksGdsGdsTdsm  6  434 ACCTCC CdsTdsTdsGdsAdsmCdsm CksTksmCksmCe 785906 1307 1322 10540 10555 GCTTGGTCTT GksmCksTksTdsGdsGds 29  435 GACCTC TdsmCdsTdsTdsGdsAdsm CksmCksTksmCe 785907 1308 1323 10541 10556 AGCTTGGTCT AksGksmCksTdsTdsGds 10  436 TGACCT GdsTdsmCdsTdsTdsGds AksmCksmCksTe 785938 N/A N/A  6548  6563 CCAATTTTGC mCksmCksAksAdsTdsTds 30 1242 ATTCCA TdsTdsGdsmCdsAdsTds TksmCksmCksAe

TABLE 21 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop Sequence Chemistry (% ID Number Site Site Site Site (5′ to 3′) Notation Inhibition) NO 665908 1363 1378 10684 10699 GGTCTGGCCC GksGksTksmCdsTdsGds 16  393 TTTTGG GdsmCdsmCdsmCdsTdsTds TdsTksGksGk 728466  427  442  8320  8335 GGTGTATTTC GksGksTksGdsTdsAdsTds 50 1254 CCTGTC TdsTdsmCdsmCdsmCdsTds GksTksmCk 728670 1230 1245 10463 10478 TTGCACTGAC TksTksGksmCdsAdsmCds  8  398 ACAGGC TdsGdsAdsmCdsAdsmCds AdsGksGksmCk 728707 1307 1322 10540 10555 GCTTGGTCTT GksmCksTksTdsGdsGds  0  435 GACCTC TdsmCdsTdsTdsGdsAdsm CdsmCksTksmCk 728708 1308 1323 10541 10556 AGCTTGGTCT AksGksmCksTdsTdsGds 16  436 TGACCT GdsTdsmCdsTdsTdsGds AdsmCksmCksTk 729037 2216 2231 11781 11796 GGTTCTTGGA GksGksTksTdsmCdsTdsTds  0  706 CTCTCA GdsGdsAdsmCdsTdsmCds TksmCksAk 729038 2217 2232 11782 11797 AGGTTCTTGG AksGksGksTdsTdsmCds  0  707 ACTCTC TdsTdsGdsGdsAdsmCds TdsmCksTksmCk 729039 2218 2233 11783 11798 CAGGTTCTTG mCksAksGksGdsTdsTdsm  0  708 GACTCT CdsTdsTdsGdsGdsAdsm CdsTksmCksTk 785364 1361 1376 10682 10697 TCTGGCCCTT TksmCdsTdsGdsGdsmCds  0  454 TTGGAA mCdsmCdsTdsTdsTdsTks GesGksAesAk 785365 1363 1378 10684 10699 GGTCTGGCCC GksGdsTdsmCdsTdsGds  0  393 TTTTGG GdsmCdsmCdsmCdsTdsTks TesTksGesGk 785378 2214 2229 11779 11794 TTCTTGGACT TksTdsmCdsTdsTdsGds  0  705 CTCAAG GdsAdsmCdsTdsmCdsTksm CesAksAesGk 785379 2215 2230 11780 11795 GTTCTTGGAC GksTdsTdsmCdsTdsTds 35  695 TCTCAA GdsGdsAdsmCdsTdsmCks TesmCksAesAk 785380 2216 2231 11781 11796 GGTTCTTGGA GksGdsTdsTdsmCdsTds  9  706 CTCTCA TdsGdsGdsAdsmCdsTksm CesTksmCesAk 785381 2217 2232 11782 11797 AGGTTCTTGG AksGdsGdsTdsTdsmCds 34  707 ACTCTC TdsTdsGdsGdsAdsmCks TesmCksTesmCk 785382 2218 2233 11783 11798 CAGGTTCTTG mCksAdsGdsGdsTdsTdsm  0  708 GACTCT CdsTdsTdsGdsGdsAks CesTksmCesTk 785419 1361 1376 10682 10697 TCTGGCCCTT TksmCdsTdsGdsGdsmCds  0  454 TTGGAA mCdsmCdsTdsTdsTksTes GksGesAksAe 785420 1363 1378 10684 10699 GGTCTGGCCC GksGdsTdsmCdsTdsGds  0  393 TTTTGG GdsmCdsmCdsmCdsTksTes TksTesGksGe 785433 2214 2229 11779 11794 TTCTTGGACT TksTdsmCdsTdsTdsGds  0  705 CTCAAG GdsAdsmCdsTdsmCksTesm CksAesAksGe 785434 2215 2230 11780 11795 GTTCTTGGAC GksTdsTdsmCdsTdsTds  0  695 TCTCAA GdsGdsAdsmCdsTksmCes TksmCesAksAe 785435 2216 2231 11781 11796 GGTTCTTGGA GksGdsTdsTdsmCdsTds  0  706 CTCTCA TdsGdsGdsAdsmCksTesm CksTesmCksAe 785436 2217 2232 11782 11797 AGGTTCTTGG AksGdsGdsTdsTdsmCds  0  707 ACTCTC TdsTdsGdsGdsAksmCes TksmCesTksmCe 785437 2218 2233 11783 11798 CAGGTTCTTG mCksAdsGdsGdsTdsTdsm  0  708 GACTCT CdsTdsTdsGdsGksAesm CksTesmCksTe 785468 1363 1378 10684 10699 GGTCTGGCCC GksGesTksmCdsTdsGds 13  393 TTTTGG GdsmCdsmCdsmCdsTdsTds TesTesGksGk 785475 2216 2231 11781 11796 GGTTCTTGGA GksGesTksTdsmCdsTds 60  706 CTCTCA TdsGdsGdsAdsmCdsTdsm CesTesmCksAk 785476 2217 2232 11782 11797 AGGTTCTTGG AksGesGksTdsTdsmCds  0  707 ACTCTC TdsTdsGdsGdsAdsmCds TesmCesTksmCk 785477 2218 2233 11783 11798 CAGGTTCTTG mCksAesGksGdsTdsTdsm 48  708 GACTCT CdsTdsTdsGdsGdsAdsm CesTesmCksTk 785507 1362 1377 10683 10698 GTCTGGCCCT GksTksmCdsTdsGdsGdsm  0  455 TTTGGA CdsmCdsmCdsTdsTdsTds TksGesGksAe 785508 1363 1378 10684 10699 GGTCTGGCCC GksGksTdsmCdsTdsGds  0  393 TTTTGG GdsmCdsmCdsmCdsTdsTds TksTesGksGe 785521 2215 2230 11780 11795 GTTCTTGGAC GksTksTdsmCdsTdsTdsGds 27  695 TCTCAA GdsAdsmCdsTdsmCdsTks mCesAksAe 785522 2216 2231 11781 11796 GGTTCTTGGA GksGksTdsTdsmCdsTds 51  706 CTCTCA TdsGdsGdsAdsmCdsTdsm CksTesmCksAe 785523 2217 2232 11782 11797 AGGTTCTTGG AksGksGdsTdsTdsmCds 41  707 ACTCTC TdsTdsGdsGdsAdsmCds TksmCesTksmCe 785524 2218 2233 11783 11798 CAGGTTCTTG mCksAksGdsGdsTdsTdsm 28  708 GACTCT CdsTdsTdsGdsGdsAdsm CksTesmCksTe 785555 1362 1377 10683 10698 GTCTGGCCCT GksTksmCdsTdsGdsGdsm  0  455 TTTGGA CdsmCdsmCdsTdsTesTes TesGesGksAk 785562 2215 2230 11780 11795 GTTCTTGGAC GksTksTdsmCdsTdsTds  8  695 TCTCAA GdsGdsAdsmCdsTesmCes TesmCesAksAk 785563 2216 2231 11781 11796 GGTTCTTGGA GksGksTdsTdsmCdsTds 54  706 CTCTCA TdsGdsGdsAdsmCesTesm CesTesmCksAk 785564 2217 2232 11782 11797 AGGTTCTTGG AksGksGdsTdsTdsmCds 17  707 ACTCTC TdsTdsGdsGdsAesmCes TesmCesTksmCk 785600 1361 1376 10682 10697 TCTGGCCCTT TksmCksTdsGdsGdsmCds  0  454 TTGGAA mCdsmCdsTdsTdsTksTes GksGesAksAk 785601 1362 1377 10683 10698 GTCTGGCCCT GksTksmCdsTdsGdsGdsm  0  455 TTTGGA CdsmCdsmCdsTdsTksTes TksGesGksAk 785602 1363 1378 10684 10699 GGTCTGGCCC GksGksTdsmCdsTdsGds  0  393 TTTTGG GdsmCdsmCdsmCdsTksTes TksTesGksGk 785621 2214 2229 11779 11794 TTCTTGGACT TksTksmCdsTdsTdsGds  0  705 CTCAAG GdsAdsCdsTdsCksTesm CksAesAksGk 785622 2215 2230 11780 11795 GTTCTTGGAC GksTksTdsmCdsTdsTds  0  695 TCTCAA GdsGdsAdsmCdsTksmCes TksmCesAksAk 785623 2216 2231 11781 11796 GGTTCTTGGA GksGksTdsTdsmCdsTdsm  0  706 CTCTCA TdsGdsGdsAdsmCksTesm CksTesmCksAk 785624 2217 2232 11782 11797 AGGTTCTTGG AksGksGdsTdsTdsmCds  0  707 ACTCTC TdsTdsGdsGdsAksmCes TksmCesTksmCk 785625 2218 2233 11783 11798 CAGGTTCTTG mCksAksGdsGdsTdsTdsm  0  708 GACTCT CdsTdsTdsGdsGksAesm CksTesmCksTk 785664 1362 1377 10683 10698 GTCTGGCCCT GksTksmCdsTdsGdsGdsm  0  455 TTTGGA CdsmCdsmCdsTdsTdsTes TesGesGksAk 785671 2215 2230 11780 11795 GTTCTTGGAC GksTksTdsmCdsTdsTds 22  695 TCTCAA GdsGdsAdsmCdsTdsmCes TesmCesAksAk 785672 2216 2231 11781 11796 GGTTCTTGGA GksGksTdsTdsmCdsTds 48  706 CTCTCA TdsGdsGdsAdsmCdsTesm CesTesmCksAk 785673 2217 2232 11782 11797 AGGTTCTTGG AksGksGdsTdsTdsmCds  0  707 ACTCTC TdsTdsGdsGdsAdsmCes TesmCesTksmCk 785694 1362 1377 10683 10698 GTCTGGCCCT GksTksmCdsTdsGdsGdsm  0  455 TTTGGA CdsmCdsmCdsTdsTdsTks TdsGksGdsAk 785701 2215 2230 11780 11795 GTTCTTGGAC GksTksTdsmCdsTdsTds 20  695 TCTCAA GdsGdsAdsCdsTdsCksTds mCksAdsAk 785702 2216 2231 11781 11796 GGTTCTTGGA GksGksTdsTdsmCdsTds 29  706 CTCTCA TdsGdsGdsAdsmCdsTksm CdsTksmCdsAk 785703 2217 2232 11782 11797 AGGTTCTTGG AksGksGdsTdsTdsmCds 36  707 ACTCTC TdsTdsGdsGdsAdsmCks TdsmCksTdsmCk 785732 1362 1377 10683 10698 GTCTGGCCCT GksTksmCdsTdsGdsGdsm  0  455 TTTGGA CdsmCdsmCdsTdsTdsTks TesGksGesAk 785733 1363 1378 10684 10699 GGTCTGGCCC GksGksTdsmCdsTdsGds  3  393 TTTTGG GdsmCdsmCdsmCdsTdsTks TesTksGesGk 785746 2215 2230 11780 11795 GTTCTTGGAC GksTksTdsmCdsTdsTds 31  695 TCTCAA GdsGdsAdsmCdsTdsmCks TesmCksAesAk 785747 2216 2231 11781 11796 GGTTCTTGGA GksGksTdsTdsmCdsTds  0  706 CTCTCA TdsGdsGdsAdsmCdsTksm CesTksmCesAk 785748 2217 2232 11782 11797 AGGTTCTTGG AksGksGdsTdsTdsmCds 38  707 ACTCTC TdsTdsGdsGdsAdsmCks TesmCksTesmCk 785749 2218 2233 11783 11798 CAGGTTCTTG mCksAksGdsGdsTdsTdsm  0  708 GACTCT CdsTdsTdsGdsGdsAksm CesTksmCesTk 785781 1363 1378 10684 10699 GGTCTGGCCC GksGksTksmCdsTdsGds  0  393 TTTTGG GdsmCdsmCdsmCdsTdsTks TdsTksGdsGk 785788 2216 2231 11781 11796 GGTTCTTGGA GksGksTksTdsmCdsTds 28  706 CTCTCA TdsGdsGdsAdsmCdsTksm CdsTksmCdsAk 785789 2217 2232 11782 11797 AGGTTCTTGG AksGksGksTdsTdsmCds  0  707 ACTCTC TdsTdsGdsGdsAdsmCks TdsmCksTdsmCk 785790 2218 2233 11783 11798 CAGGTTCTTG mCksAksGksGdsTdsTdsm  0  708 GACTCT CdsTdsTdsGdsGdsAksm CdsTksmCdsTk 785820 1362 1377 10683 10698 GTCTGGCCCT GksTksmCksTdsGdsGdsm  0  455 TTTGGA CdsmCdsmCdsTdsTdsTks TesGksGesAk 785821 1363 1378 10684 10699 GGTCTGGCCC GksGksTksmCdsTdsGds  2  393 TTTTGG GdsmCdsmCdsmCdsTdsTks TesTksGesGk 785834 2215 2230 11780 11795 GTTCTTGGAC GksTksTksmCdsTdsTdsGds  0  695 TCTCAA GdsAdsmCdsTdsmCksTes mCksAesAk 785835 2216 2231 11781 11796 GGTTCTTGGA GksGksTksTdsmCdsTds 25  706 CTCTCA TdsGdsGdsAdsmCdsTksm CesTksmCesAk 785836 2217 2232 11782 11797 AGGTTCTTGG AksGksGksTdsTdsmCds  8  707 ACTCTC TdsTdsGdsGdsAdsmCks TesmCksTesmCk 785837 2218 2233 11783 11798 CAGGTTCTTG mCksAksGksGdsTdsTdsm  0  708 GACTCT CdsTdsTdsGdsGdsAksm CesTksmCesTk 785869 1363 1378 10684 10699 GGTCTGGCCC GksGksTksmCdsTdsGds 17  393 TTTTGG GdsmCdsmCdsmCdsTdsTds TksTesGksGe 785876 2216 2231 11781 11796 GGTTCTTGGA GksGksTksTdsmCdsTds 48  706 CTCTCA TdsGdsGdsAdsmCdsTdsm CksTesmCksAe 785877 2217 2232 11782 11797 AGGTTCTTGG AksGksGksTdsTdsmCds  0  707 ACTCTC TdsTdsGdsGdsAdsmCds TksmCesTksmCe 785878 2218 2233 11783 11798 CAGGTTCTTG mCksAksGksGdsTdsTdsm  1  708 GACTCT CdsTdsTdsGdsGdsAdsm CksTesmCksTe 785908 1362 1377 10683 10698 GTCTGGCCCT GksTksmCksTdsGdsGdsm  0  455 TTTGGA CdsmCdsmCdsTdsTdsTds TksGksGksAe 785909 1363 1378 10684 10699 GGTCTGGCCC GksGksTksmCdsTdsGds  0  393 TTTTGG GdsmCdsmCdsmCdsTdsTds TksTksGksGe 785922 2215 2230 11780 11795 GTTCTTGGAC GksTksTksmCdsTdsTds 37  695 TCTCAA GdsGdsAdsmCdsTdsmCds TksmCksAksAe 785923 2216 2231 11781 11796 GGTTCTTGGA GksGksTksTdsmCdsTds  0  706 CTCTCA TdsGdsGdsAdsmCdsTdsm CksTksmCksAe 785924 2217 2232 11782 11797 AGGTTCTTGG AksGksGksTdsTdsmCds 19  707 ACTCTC TdsTdsGdsGdsAdsmCds TksmCksTksmCe 785925 2218 2233 11783 11798 CAGGTTCTTG mCksAksGksGdsTdsTdsm  0  708 GACTCT CdsTdsTdsGdsGdsAdsm CksTksmCksTe 785938 N/A N/A  6548  6563 CCAATTTTGC mCksmCksAksAdsTdsTds 71 1242 ATTCCA TdsTdsGdsmCdsAdsTds TksmCksmCkse

TABLE 22 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop Sequence Chemistry (% ID Number Site Site Site Site (5′ to 3′) Notation Inhibition) NO 728708 1308 1323 10541 10556 AGCTTGGTCT AksGksmCksTdsTdsGds 12  436 TGACCT GdsTdsmCdsTdsTdsGds AdsmCksmCksTk 728898 1769 1784 11334 11349 GCTGTCACAT GksmCksTksGdsTdsmCds 33  637 CTCCAC AdsmCdsAdsTdsmCdsTds mCdsmCksAksmCk 729049 2230 2245 11795 11810 TTATTTCTGCT TksTksAksTdsTdsTdsmCds 55  718 CCAGG TdsGdsmCdsTdsmCdsm CdsAksGksGk 729589 N/A N/A  9259  9274 CCTTCTGCAG mCksmCksTksTdsmCdsTds  0 1184 GGAGTC GdsmCdsAdsGdsGdsGds AdsGksTksmCk 785372 1767 1782 11332 11347 TGTCACATCT TksGdsTdsmCdsAdsmCds 16  635 CCACAT AdsTdsmCdsTdsmCdsmCks AesmCksAesTk 785373 1769 1784 11334 11349 GCTGTCACAT GksmCdsTdsGdsTdsmCds 17  637 CTCCAC AdsmCdsAdsTdsmCdsTks mCesmCksAesmCk 785383 2228 2243 11793 11808 ATTTCTGCTCC AksTdsTdsTdsmCdsTdsGds 39  696 AGGTT mCdsTdsmCdsmCdsAks GesGksTesTk 785384 2230 2245 11795 11810 TTATTTCTGCT TksTdsAdsTdsTdsTdsmCds  0  718 CCAGG TdsGdsmCdsTdsmCksm CesAksGesGk 785400 N/A N/A  9257  9272 TTCTGCAGGG TksTdsmCdsTdsGdsmCds  4 1255 AGTCAG AdsGdsGdsGdsAdsGksTes mCksAesGk 785401 N/A N/A  9259  9274 CCTTCTGCAG mCksmCdsTdsTdsmCdsTds  0 1184 GGAGTC GdsmCdsAdsGdsGdsGks AesGksTesmCk 785427 1767 1782 11332 11347 TGTCACATCT TksGdsTdsmCdsAdsmCds  0  635 CCACAT AdsTdsmCdsTdsmCksmCes AksmCesAksTe 785428 1769 1784 11334 11349 GCTGTCACAT GksmCdsTdsGdsTdsmCds  0  637 CTCCAC AdsmCdsAdsTdsmCksTes mCksmCesAksmCe 785438 2228 2243 11793 11808 ATTTCTGCTCC AksTdsTdsTdsmCdsTdsGds 13  696 AGGTT mCdsTdsmCdsmCksAes GksGesTksTe 785439 2230 2245 11795 11810 TTATTTCTGCT TksTdsAdsTdsTdsTdsmCds  0  718 CCAGG TdsGdsmCdsTksmCesm CksAesGksGe 785455 N/A N/A  9257  9272 TTCTGCAGGG TksTdsmCdsTdsGdsmCds  0 1255 AGTCAG AdsGdsGdsGdsAksGesTks mCesAksGe 785456 N/A N/A  9259  9274 CCTTCTGCAG mCksmCdsTdsTdsmCdsTds  0 1184 GGAGTC GdsmCdsAdsGdsGksGes AksGesTksmCe 785472 1769 1784 11334 11349 GCTGTCACAT GksmCesTksGdsTdsmCds  0  637 CTCCAC AdsmCdsAdsTdsmCdsTds mCesmCesAksmCk 785478 2230 2245 11795 11810 TTATTTCTGCT TksTesAksTdsTdsTdsmCds 56  718 CCAGG TdsGdsmCdsTdsmCdsm CesAesGksGk 785488 N/A N/A  9259  9274 CCTTCTGCAG mCksmCesTksTdsmCdsTds 14 1184 GGAGTC GdsmCdsAdsGdsGdsGds AesGesTksmCk 785515 1768 1783 11333 11348 CTGTCACATC mCksTksGdsTdsmCdsAds 19  636 TCCACA mCdsAdsTdsmCdsTdsmCds mCksAesmCksAe 785516 1769 1784 11334 11349 GCTGTCACAT GksmCksTdsGdsTdsmCds  8  637 CTCCAC AdsmCdsAdsTdsmCdsTds mCksmCesAksmCe 785525 2229 2244 11794 11809 TATTTCTGCTC TksAksTdsTdsTdsmCdsTds 49  717 CAGGT GdsmCdsTdsmCdsmCds AksGesGksTe 785526 2230 2245 11795 11810 TTATTTCTGCT TksTksAdsTdsTdsTdsmCds 26  718 CCAGG TdsGdsmCdsTdsmCdsm CksAesGksGe 785543 N/A N/A  9258  9273 CTTCTGCAGG mCksTksTdsmCdsTdsGds  8 1256 GAGTCA mCdsAdsGdsGdsGdsAds GksTesmCksAe 785544 N/A N/A  9259  9274 CCTTCTGCAG mCksmCksTdsTdsmCdsTds  0 1184 GGAGTC GdsmCdsAdsGdsGdsGds AksGesTksmCe 785559 1768 1783 11333 11348 CTGTCACATC mCksTksGdsTdsmCdsAds 11  636 TCCACA mCdsAdsTdsmCdsTesmCes mCesAesmCksAk 785565 2229 2244 11794 11809 TATTTCTGCTC TksAksTdsTdsTdsmCdsTds 43  717 CAGGT GdsmCdsTdsmCesmCes AesGesGksTk 785574 N/A N/A  9258  9273 CTTCTGCAGG mCksTksTdsmCdsTdsGds  0 1256 GAGTCA mCdsAdsGdsGdsGesAes GesTesmCksAk 785612 1767 1782 11332 11347 TGTCACATCT TksGksTdsmCdsAdsmCds  0  635 CCACAT AdsTdsmCdsTdsmCksmCes AksmCesAksTk 785613 1768 1783 11333 11348 CTGTCACATC mCksTksGdsTdsmCdsAds  0  636 TCCACA mCdsAdsTdsmCdsTksmCes mCksAesmCksAk 785614 1769 1784 11334 11349 GCTGTCACAT GksmCksTdsGdsTdsmCds 29  637 CTCCAC AdsmCdsAdsTdsmCksTes mCksmCesAksmCk 785626 2228 2243 11793 11808 ATTTCTGCTCC AksTksTdsTdsmCdsTdsGds  6  696 AGGTT mCdsTdsmCdsmCksAes GksGesTksTk 785627 2229 2244 11794 11809 TATTTCTGCTC TksAksTdsTdsTdsmCdsTds  0  717 CAGGT GdsmCdsTdsmCksmCes AksGesGksTk 785628 2230 2245 11795 11810 TTATTTCTGCT TksTksAdsTdsTdsTdsmCds  0  718 CCAGG TdsGdsmCdsTksmCes CksAesGksGk 785651 N/A N/A  9257  9272 TTCTGCAGGG TksTksmCdsTdsGdsmCds  0 1255 AGTCAG AdsGdsGdsGdsAksGesTks mCesAksGk 785652 N/A N/A  9258  9273 CTTCTGCAGG mCksTksTdsmCdsTdsGds  0 1256 GAGTCA mCdsAdsGdsGdsGksAes GksTesmCksAk 785653 N/A N/A  9259  9274 CCTTCTGCAG mCksmCksTdsTdsmCdsTds  0 1184 GGAGTC GdsmCdsAdsGdsGksGes AksGesTksmCk 785668 1768 1783 11333 11348 CTGTCACATC mCksTksGdsTdsmCdsAds 10  636 TCCACA mCdsAdsTdsmCdsTdsmCes mCesAesmCksAk 785674 2229 2244 11794 11809 TATTTCTGCTC TksAksTdsTdsTdsmCdsTds 44  717 CAGGT GdsmCdsTdsmCdsmCes AesGesGksTk 785683 N/A N/A  9258  9273 CTTCTGCAGG mCksTksTdsmCdsTdsGds  0 1256 GAGTCA mCcisAdsGdsGdsGdsAes GesTesmCksAk 785698 1768 1783 11333 11348 CTGTCACATC mCksTksGdsTdsmCdsAds  6  636 TCCACA mCdsAdsTdsmCdsTdsmCks mCdsAksmCdsAk 785704 2229 2244 11794 11809 TATTTCTGCTC TksAksTdsTdsTdsmCdsTds 27  717 CAGGT GdsmCdsTdsmCdsmCks AdsGksGdsTk 785713 N/A N/A  9258  9273 CTTCTGCAGG mCksTksTdsmCdsTdsGds  0 1256 GAGTCA mCdsAdsGdsGdsGdsAks GdsTksmCdsAk 785740 1768 1783 11333 11348 CTGTCACATC mCksTksGdsTdsmCdsAds 23  636 TCCACA mCdsAdsTdsmCdsTdsmCks mCesAksmCesAk 785741 1769 1784 11334 11349 GCTGTCACAT GksmCksTdsGdsTdsmCds  5  637 CTCCAC AdsmCdsAdsTdsmCdsTks mCesmCksAesmCk 785750 2229 2244 11794 11809 TATTTCTGCTC TksAksTdsTdsTdsmCdsTds  5  717 CAGGT GdsmCdsTdsmCdsmCks AesGksGesTk 785751 2230 2245 11795 11810 TTATTTCTGCT TksTksAdsTdsTdsTdsmCds  9  718 CCAGG TdsGdsmCdsTdsmCksm CesAksGesGk 785768 N/A N/A  9258  9273 CTTCTGCAGG mCksTksTdsmCdsTdsGds  0 1256 GAGTCA mCdsAdsGdsGdsGdsAks GesTksmCesAk 785769 N/A N/A  9259  9274 CCTTCTGCAG mCksmCksTdsTdsmCdsTds  0 1184 GGAGTC GdsmCdsAdsGdsGdsGks AesGksTesmCk 785785 1769 1784 11334 11349 GCTGTCACAT GksmCksTksGdsTdsmCds 35  637 CTCCAC AdsmCdsAdsTdsmCdsTks mCdsmCksAdsmCk 785791 2230 2245 11795 11810 TTATTTCTGCT TksTksAksTdsTdsTdsmCds 57  718 CCAGG TdsGdsmCdsTdsmCks CdsAksGdsGk 785801 N/A N/A  9259  9274 CCTTCTGCAG mCksmCksTksTdsmCdsTds  0 1184 GGAGTC GdsmCdsAdsGdsGdsGks AdsGksTdsmCk 785828 1768 1783 11333 11348 CTGTCACATC mCksTksGksTdsmCdsAds  0  636 TCCACA mCdsAdsTdsmCdsTdsmCks mCesAksmCesAk 785829 1769 1784 11334 11349 GCTGTCACAT GksmCksTksGdsTdsmCds  0  637 CTCCAC AdsmCdsAdsTdsmCdsTks mCesmCksAesmCk 785838 2229 2244 11794 11809 TATTTCTGCTC TksAksTksTdsTdsmCdsTds 24  717 CAGGT GdsmCdsTdsmCdsmCks AesGksGesTk 785839 2230 2245 11795 11810 TTATTTCTGCT TksTksAksTdsTdsTdsmCds 23  718 CCAGG TdsGdsmCdsTdsmCksm CesAksGesGk 785856 N/A N/A  9258  9273 CTTCTGCAGG mCksTksTksmCdsTdsGds  0 1256 GAGTCA mCdsAdsGdsGdsGdsAks GesTksmCesAk 785857 N/A N/A  9259  9274 CCTTCTGCAG mCksmCksTksTdsmCdsTds  0 1184 GGAGTC GdsmCdsAdsGdsGdsGks AesGksTesmCk 785873 1769 1784 11334 11349 GCTGTCACAT GksmCksTksGdsTdsmCds  3  637 CTCCAC AdsmCdsAdsTdsmCdsTds mCksmCesAksmCe 785879 2230 2245 11795 11810 TTATTTCTGCT TksTksAksTdsTdsTdsmCds 43  718 CCAGG TdsGdsmCdsTdsmCdsm CksAesGksGe 785889 N/A N/A  9259  9274 CCTTCTGCAG mCksmCksTksTdsmCdsTds  1 1184 GGAGTC GdsmCdsAdsGdsGdsGds AksGesTksmCe 785916 1768 1783 11333 11348 CTGTCACATC mCksTksGksTdsmCdsAds 28  636 TCCACA mCdsAdsTdsmCdsTdsmCds mCksAksmCksAe 785917 1769 1784 11334 11349 GCTGTCACAT GksmCksTksGdsTdsmCds 23  637 CTCCAC AdsmCdsAdsTdsmCdsTds mCksmCksAksmCe 785926 2229 2244 11794 11809 TATTTCTGCTC TksAksTksTdsTdsmCdsTds 45  717 CAGGT GdsmCdsTdsmCdsmCds AksGksGksTe 785927 2230 2245 11795 11810 TTATTTCTGCT TksTksAksTdsTdsTdsmCds 28  718 CCAGG TdsGdsmCdsTdsmCdsm CksAksGksGe 785938 N/A N/A  6548  6563 CCAATTTTGC mCksmCksAksAdsTdsTds 75 1242 ATTCCA TdsTdsGdsmCdsAdsTdsTks mCksmCksAe 785944 N/A N/A  9258  9273 CTTCTGCAGG mCksTksTksmCdsTdsGds  0 1256 GAGTCA mCdsAdsGdsGdsGdsAds GksTksmCksAe 785945 N/A N/A  9259  9274 CCTTCTGCAG mCksmCksTksTdsmCdsTds  0 1184 GGAGTC GdsmCdsAdsGdsGdsGds AksGksTksmCe 786513 N/A N/A  9250  9265 GGGAGTCAGA GksGksGksAdsGdsTdsm  0 1257 CCTACC CdsAdsGdsAdsmCdsmCds TdsAksmCksmCk 786514 N/A N/A  9252  9267 CAGGGAGTCA mCksAksGksGdsGdsAds  0 1258 GACCTA GdsTdsmCdsAdsGdsAds mCdsmCksTksAk 786515 N/A N/A  9254  9269 TGCAGGGAGT TksGksmCksAdsGdsGds  0 1259 CAGACC GdsAdsGdsTdsmCdsAds GdsAksmCksmCk 786516 N/A N/A  9256  9271 TCTGCAGGGA TksmCksTksGdsmCdsAds  0 1260 GTCAGA GdsGdsGdsAdsGdsTdsm CdsAksGksAk 786517 N/A N/A  9257  9272 TTCTGCAGGG TksTksmCksTdsGdsmCds  0 1255 AGTCAG AdsGdsGdsGdsAdsGdsTds mCksAksGk 786518 N/A N/A  9258  9273 CTTCTGCAGG mCksTksTksmCdsTdsGds  0 1256 GAGTCA mCdsAdsGdsGdsGdsAds GdsTksmCksAk 786519 N/A N/A  9260  9275 GCCTTCTGCA GksmCksmCksTdsTdsmCds  0 1261 GGGAGT TdsGdsmCdsAdsGdsGds GdsAksGksTk 786520 N/A N/A  9261  9276 TGCCTTCTGC TksGksmCksmCdsTdsTds  0 1262 AGGGAG mCdsTdsGdsmCdsAdsGds GdsGksAksGk 786521 N/A N/A  9262  9277 TTGCCTTCTGC TksTksGksmCdsmCdsTds  0 1263 AGGGA TdsmCdsTdsGdsmCdsAds GdsGksGksAk 786522 N/A N/A  9264  9279 ATTTGCCTTCT AksTksTksTdsGdsmCdsm  0 1264 GCAGG CdsTdsTdsmCdsTdsGdsm CdsAksGksGk 786523 N/A N/A  9266  9281 TCATTTGCCTT TksmCksAksTdsTdsTdsGds  6 1265 CTGCA mCdsmCdsTdsTdsmCds TdsGksmCksAk

TABLE 23 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Compound Start Stop Start Stop Sequence Chemistry (% ID Number Site Site Site Site (5′ to 3′) Notation Inhibition) NO 728466  427  442  8320  8335 GGTGTATTT GksGksTksGdsTdsAdsTds 37 1254 CCCTGTC TdsTdsmCdsmCdsmCdsTds GksTksmCk 728708 1308 1323 10541 10556 AGCTTGGTC AksGksmCksTdsTdsGds 37  436 TTGACCT GdsTdsmCdsTdsTdsGds AdsmCksmCksTk 728998 2119 2134 11684 11699 AGGAAGTG AksGksGksAdsAdsGdsTds 42  208 AGTCTCAA GdsAdsGdsTdsmCdsTds mCksAksAk 729018 2172 2187 11737 11752 TCTGATATG TksmCksTksGdsAdsTds 63  228 ATACCTA AdsTdsGdsAdsTdsAdsm CdsmCksTksAk 729454 N/A N/A 5170 5185 AGGAGTGA AksGksGksAdsGdsTdsGds 56  995 GACGAGCA AdsGdsAdsmCdsGdsAds GksmCksAk 785376 2117 2132 11682 11697 GAAGTGAGT GksAdsAdsGdsTdsGdsAds 44  207 CTCAAAC GdsTdsmCdsTdsmCksAes AksAesmCk 785377 2119 2134 11684 11699 AGGAAGTG AksGdsGdsAdsAdsGdsTds 11  208 AGTCTCAA GdsAdsGdsTdsmCksTes mCksAesAk 785387 N/A N/A  5168  5183 GAGTGAGA GksAdsGdsTdsGdsAdsGds 18 1266 CGAGCAAA AdsmCdsGdsAdsGksm CesAksAesAk 785388 N/A N/A  5170  5185 AGGAGTGA AksGdsGdsAdsGdsTdsGds 37  995 GACGAGCA AdsGdsAdsmCdsGksAes GksmCesAk 785431 2117 2132 11682 11697 GAAGTGAGT GksAdsAdsGdsTdsGdsAds 11  207 CTCAAAC GdsTdsmCdsTksmCesAks AesAksmCe 785432 2119 2134 11684 11699 AGGAAGTG AksGdsGdsAdsAdsGdsTds 23  208 AGTCTCAA GdsAdsGdsTksmCesTks mCesAksAe 785442 N/A N/A  5168  5183 GAGTGAGA GksAdsGdsTdsGdsAdsGds  6 1266 CGAGCAAA AdsmCdsGdsAksGesm CksAesAksAe 785443 N/A N/A  5170  5185 AGGAGTGA AksGdsGdsAdsGdsTdsGds  0  995 GACGAGCA AdsGdsAdsmCksGesAks GesmCksAe 785474 2119 2134 11684 11699 AGGAAGTG AksGesGksAdsAdsGdsTds 43  208 AGTCTCAA GdsAdsGdsTdsmCdsTes mCesAksAkmCesAksAk 785480 N/A N/A  5170  5185 AGGAGTGA AksGesGksAdsGdsTdsGds 22  995 GACGAGCA AdsGdsAdsmCdsGdsAes GesmCksAk 785519 2118 2133 11683 11698 GGAAGTGA GksGksAdsAdsGdsTdsGds 55 1267 GTCTCAAA AdsGdsTdsmCdsTdsmCks AesAksAe 785520 2119 2134 11684 11699 AGGAAGTG AksGksGdsAdsAdsGdsTds 39  208 AGTCTCAA GdsAdsGdsTdsmCdsTks mCesAksAe 785529 N/A N/A  5169  5184 GGAGTGAG GksGksAdsGdsTdsGdsAds 33 1268 ACGAGCAA GdsAdsmCdsGdsAdsGks mCesAksAe 785530 N/A N/A  5170  5185 AGGAGTGA AksGksGdsAdsGdsTdsGds 28  995 GACGAGCA AdsGdsAdsmCdsGdsAks GesmCksAe 785561 2118 2133 11683 11698 GGAAGTGA GksGksAdsAdsGdsTdsGds 34 1267 GTCTCAAA AdsGdsTdsmCesTesmCes AesAksAk 785567 N/A N/A  5169  5184 GGAGTGAG GksGksAdsGdsTdsGdsAds 17 1268 ACGAGCAA GdsAdsmCdsGesAesGes mCesAksAk 785618 2117 2132 11682 11697 GAAGTGAGT GksAksAdsGdsTdsGdsAds 27  207 CTCAAAC GdsTdsmCdsTksmCesAks AesAksmCk 785619 2118 2133 11683 11698 GGAAGTGA GksGksAdsAdsGdsTdsGds 36 1267 GTCTCAAA AdsGdsTdsmCksTesmCks AesAksAk 785620 2119 2134 11684 11699 AGGAAGTG aksGksGdsAdsAdsGdsTds 20  208 AGTCTCAA GdsAdsGdsTksmCesTks mCesAksAk 785632 N/A N/A  5168  5183 GAGTGAGA GksAksGdsTdsGdsAdsGds 17 1266 CGAGCAAA AdsmCdsGdsAksGesm CksAesAksAk 785633 N/A N/A  5169  5184 GGAGTGAG GksGksAdsGdsTdsGdsAds 38 1268 ACGAGCAA GdsAdsmCdsGksAesGks mCesAksAk 785634 N/A N/A  5170  5185 AGGAGTGA AksGksGdsAdsGdsTdsGds 35  995 GACGAGCA AdsGdsAdsmCksGesAks GesmCksAk 785670 2118 2133 11683 11698 GGAAGTGA GksGksAdsAdsGdsTdsGds 32 1267 GTCTCAAA AdsGdsTdsmCdsTesmCes AesAksAk 785676 N/A N/A  5169  5184 GGAGTGAG GksGksAdsGdsTdsGdsAds 25 1268 ACGAGCAA GdsAdsmCdsGdsAesGes mCesAksAk 785700 2118 2133 11683 11698 GGAAGTGA GksGksAdsAdsGdsTdsGds 12 1267 GTCTCAAA AdsGdsTdsmCdsTksmCds AksAdsAk 785706 N/A N/A  5169  5184 GGAGTGAG GksGksAdsGdsTdsGdsAds 16 1268 ACGAGCAA GdsAdsmCdsGdsAksGds mCksAdsAk 785744 2118 2133 11683 11698 GGAAGTGA GksgksAdsAdsGdsTdsGds 25 1267 GTCTCAAA AdsGdsTdsmCdsTksmCes AksAesAk 785745 2119 2134 11684 11699 AGGAAGTG AksGksGdsAdsAdsGdsTds 42  208 AGTCTCAA GdsAdsGdsTdsmCksTes mCksAesAk 785754 N/A N/A  5169  5184 GGAGTGAG GksGksAdsGdsTdsGdsAds 27 1268 ACGAGCAA GdsAdsmCdsGdsAksGes mCksAesAk 785755 N/A N/A  5170  5185 AGGAGTGA AksGksGdsAdsGdsTdsGds 36  995 GACGAGCA AdsGdsAdsmCdsGksAes GksmCesAk 785787 2119 2134 11684 11699 AGGAAGTG AksGksGksAdsAdsGdsTds 40  208 AGTCTCAA GdsAdsGdsTdsmCksTds mCksAdsAk 785793 N/A N/A  5170  5185 AGGAGTGA AksGksGksAdsGdsTdsGds 37  995 GACGAGCA AdsGdsAdsmCdsGksAds GksmCdsAk 785832 2118 2133 11683 11698 GGAAGTGA GksGksAksAdsGdsTdsGds 45 1267 GTCTCAAA AdsGdsTdsmCdsTksmCes AksAesAk 785833 2119 2134 11684 11699 AGGAAGTG AksGksGksAdsAdsGdsTds 24  208 AGTCTCAA GdsAdsGdsTdsmCksTes mCksAesAk 785842 N/A N/A  5169  5184 GGAGTGAG GksGksAksGdsTdsGdsAds  5 1268 ACGAGCAA GdsAdsmCdsGdsAksGes mCksAesAk 785843 N/A N/A  5170  5185 AGGAGTGA AksGksGksAdsGdsTdsGds 24  995 GACGAGCA AdsGdsAdsmCdsGksAes GksmCesAk 785875 2119 2134 11684 11699 AGGAAGTG AksGksGksAdsAdsGdsTds 21  208 AGTCTCAA GdsAdsGdsTdsmCdsTks mCesAksAe 785881 N/A N/A  5170  5185 AGGAGTGA AksGksGksAdsGdsTdsGds 42  995 GACGAGCA AdsGdsAdsmCdsGdsAks GesmCksAe 785920 2118 2133 11683 11698 GGAAGTGA GksGksAksAdsGdsTdsGds 49 1267 GTCTCAAA AdsGdsTdsmCdsTdsmCks AksAksAe 785921 2119 2134 11684 11699 AGGAAGTG AksGksGksAdsAdsGdsTds 47  208 AGTCTCAA GdsAdsGdsTdsmCdsTks mCksAksAe 785930 N/A N/A  5169  5184 GGAGTGAG GksGksAksGdsTdsTdsAds 33 1268 ACGAGCAA GdsAdsmCdsGdsAdsGks mCksAksAe 785931 N/A N/A  5170  5185 AGGAGTGA AksGksGksAdsGdsTdsGds 37  995 GACGAGCA AdsGdsAdsmCdsGdsAks GksmCksAe 785938 N/A N/A  6548  6563 CCAATTTTG mCksmCksAksAdsTdsTds 10 1242 CATTCCA TdsTdsGdsmCdsAdsTdsTks mCksmCksAe 786501 2118 2133 11683 11698 GGAAGTGA GksGksAksAdsGdsTdsGds 51 1267 GTCTCAAA AdsGdsTdsmCdsTdsmCds AksAksAk 786502 2120 2135 11685 11700 GAGGAAGT GksAksGksGdsAdsAdsGds  0 1269 GAGTCTCA TdsGdsAdsGdsTdsmCds TksmCksAk 786503 2171 2186 11736 11751 CTGATATGA mCksTksGksAdsTdsAds 59 1270 TACCTAA TdsGdsAdsTdsAdsmCdsm CdsTksAksAk 786504 2173 2188 11738 11753 ATCTGATAT AksTksmCksTdsGdsAds 36 1271 GATACCT TdsAdsTdsGdsAdsTdsAds mCksmCksTk 786524 N/A N/A  5141  5156 ACGAGTTAT AksmCksGksAdsGdsTds 74 1272 GGGAAGG TdsAdsTdsGdsGdsGdsAds AksGksGk 786525 N/A N/A  5143  5158 GGACGAGTT GksGksAksmCdsGdsAds 37 1273 ATGGGAA GdsTdsTdsAdsTdsGdsGds GksAksAk 786526 N/A N/A  5145  5160 TAGGACGA TksAksGksGdsAdsmCds 25 1274 GTTATGGG GdsAdsGdsTdsTdsAdsTds GksGksGk 786527 N/A N/A  5147  5162 AGTAGGAC AksGksTksAdsGdsGdsAds  0 1275 GAGTTATG mCdsGdsAdsGdsTdsTds AksTksGk 786528 N/A N/A  5149  5164 TGAGTAGGA TksGksAksGdsTdsAdsGds 18 1276 CGAGTTA GdsAdsmCdsGdsAdsGds TksTksAk 786529 N/A N/A  5151  5166 GGTGAGTAG GksGksTksGdsAdsGdsTds 48 1277 GACGAGT AdsGdsGdsAdsmCdsGds AksGksTk 786530 N/A N/A  5153 5 168 AGGGTGAGT AksGksGksGdsTdsGdsAds 19 1278 AGGACGA GdsTdsAdsGdsGdsAds mCksGksAk 786531 N/A N/A  5155  5170 AAAGGGTG AksAksAksGdsGdsGdsTds 24 1279 AGTAGGAC GdsAdsGdsTdsAdsGds GksAksmCk 786532 N/A N/A  5157  5172 GCAAAGGG GksmCksAksAdsAdsGds 24 1280 TGAGTAGG GdsGdsTdsGdsAdsGdsTds AksGksGk 786533 N/A N/A  5159  5174 GAGCAAAG GksAksGksmCdsAdsAds  0 1281 GGTGAGTA AdsGdsGdsGdsTdsGdsAds GksTksAk 786534 N/A N/A  5161  5176 ACGAGCAA AksmCksGksAdsGdsmCds 47 1282 AGGGTGAG AdsAdsAdsGdsGdsGds TdsGksAksGk 786535 N/A N/A  5163  5178 AGACGAGC AksGksAksmCdsGdsAds 35 1283 AAAGGGTG GdsmCdsAdsAdsAdsGds GdsGksTksGk 786536 N/A N/A  5164  5179 GAGACGAG GksAksGksAdsmCdsGds 40 1284 CAAAGGGT AdsGdsmCdsAdsAdsAds GdsGksGksTk 786537 N/A N/A  5165  5180 TGAGACGA TksGksAksGdsAdsmCds 22 1285 GCAAAGGG GdsAdsGdsmCdsAdsAds AdsGksGksGk 786538 N/A N/A  5166  5181 GTGAGACG GksTksGksAdsGdsAdsm 49 1286 AGCAAAGG CdsGdsAdsGdsmCdsAds AdsAksGksGk 786539 N/A N/A  5167  5182 AGTGAGAC AksGksTksGdsAdsGdsAds 16 1287 GAGCAAAG mCdsGdsAdsGdsmCds AdsAksAksGk 786540 N/A N/A  5168  5183 GAGTGAGA GksAksGksTdsGdsAdsGds 27 1266 CGAGCAAA AdsmCdsGdsAdsGdsm CdsAksAksAk 786541 N/A N/A  5169  5184 GGAGTGAG GksGksAksGdsTdsGdsAds 37 1268 ACGAGCAA GdsAdsmCdsGdsAdsGds mCksAksAk 786542 N/A N/A  5171  5186 TAGGAGTGA TksAksGksGdsAdsGdsTds  1 1288 GACGAGC GdsAdsGdsAdsmCdsGds AksGksmCk 786543 N/A N/A  5172  5187 ATAGGAGTG AksTksAksGdsGdsAdsGds 16 1289 AGACGAG TdsGdsAdsGdsAdsmCds GksAksGk 786544 N/A N/A  5173  5188 AATAGGAGT AksAksTksAdsGdsGdsAds 25 1290 GAGACGA GdsTdsGdsAdsGdsAds mCksGksAk 786545 N/A N/A  5174  5189 TAATAGGAG TksAksAksTdsAdsGdsGds 12 1291 TGAGACG AdsGdsTdsGdsAdsGds AksmCksGk 786546 N/A N/A  5175  5190 GTAATAGGA GksTksAksAdsTdsAdsGds 11 1292 GTGAGAC GdsAdsGdsTdsGdsAds GksAksmCk 786547 N/A N/A  5177  5192 GAGTAATAG GksAksGksTdsAdsAdsTds 33 1293 GAGTGAG AdsGdsGdsAdsGdsTds GksAksGk 786548 N/A N/A  5179  5194 ATGAGTAAT AksTksGksAdsGdsTdsAds 56 1294 AGGAGTG AdsTdsAdsGdsGdsAds GksTksGk 786549 N/A N/A  5181  5196 TCATGAGTA TksmCksAksTdsGdsAds 11 1295 ATAGGAG GdsTdsAdsAdsTdsAdsGds GksAksGk 786550 N/A N/A  5183  5198 CCTCATGAG mCksmCksTksmCdsAdsTds  0 1296 TAATAGG GdsAdsGdsTdsAdsAds TdsAksGksGk

TABLE 24 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 Compound Start Stop Start Stop % SEQ Number Site Site Site Site Sequence (5′ to 3′) Chemistry Notation Inhibition ID NO 665892 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAksmCksTdsGdsAdsmCdsAdsm  0  387 CdsAdsGdsGdsmCdsGksGksAk 665893 1228 1243 10461 10476 GCACTGACACAGGCGG GksmCksAksmCdsTdsGdsAdsmCds  0   39 AdsmCdsAdsGdsGdsmCksGksGk 728466  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTksGdsTdsAdsTdsTdsTdsm 27 1254 CdsmCdsmCdsTdsGksTksmCk 728489  484  499  8277  8392 AAGGGCACAGCGCAGG AksAksGksGdsGdsmCdsAdsmCds 42 1249 AdsGdsmCdsGdsmCdsAksGksGk 728670 1230 1245 10463 10478 TTGCACTGACACAGGC TksTksGksmCdsAdsmCdsTdsGds 21  398 AdsmCdsAdsmCdsAdsGksGksmCk 728707 1307 1322 10540 10555 GCTTGGTCTTGACCTC GksmCksTksTdsGdsGdsTdsmCds 52  435 TdsTdsGdsAdsmCdsmCksTksmCk 728708 1308 1323 10541 10556 AGCTTGGTCTTGACCT AksGksmCksTdsTdsGdsGdsTdsm 40  436 CdsTdsTdsGdsAdsmCksmCksTk 728958 1979 1994 11544 11559 CCTATACAGCTAGGCC mCksmCksTksAdsTdsAdsmCdsAds  0  168 GdsmCdsTdsAdsGdsGksmCksmCk 729037 2216 2231 11781 11796 GGTTCTTGGACTCTCA GksGksTksTdsmCdsTdsTdsGdsGds 68  706 AdsmCdsTdsmCdsTksmCksAk 729494 N/A N/A  6958  6973 GAATTTTGTGACTGTA GksAksAksTdsTdsTdsTdsGdsTds 57 1065 GdsAdsmCdsTdsGksTksAk 729495 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCksmCksAdsTdsTdsmCdsTds 70 1066 AdsTdsGdsmCdsmCdsTksTksTk 785352 1225 1240 10458 10473 CTGACACAGGCGGATG mCksTdsGdsAdsmCdsAdsmCdsAds  0 1297 GdsGdsmCdsGksGesAksTesGk 785353 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAdsmCdsTdsGdsAdsmCdsAdsm  0  387 CdsAdsGdsGdsmCesGksGesAk 785396 N/A N/A  6979  6994 CATTCTATGCCTTTTA mCksAdsTdsTdsmCdsTdsAdsTds 37 1298 GdsmCdsmCdsTksTesTksTesAk 785397 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCdsmCdsAdsTdsTdsmCdsTds  0 1066 AdsTdsGdsmCksmCesTksTesTk 785407 1225 1240 10458 10473 CTGACACAGGCGGATG mCksTdsGdsAdsmCdsAdsmCdsAds  0 1297 GdsGdsmCksGesGksAesTksGe 785408 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAdsmCdsTdsGdsAdsmCdsAdsm  0  387 CdsAdsGksGesmCksGesGksAe 785451 N/A N/A  6979  6994 CATTCTATGCCTTTTA mCksAdsTdsTdsmCdsTdsAdsTds 13 1298 GdsmCdsmCksTesTksTesTksAe 785452 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCdsmCdsAdsTdsTdsmCdsTds 10 1066 AdsTdsGksmCesmCksTesTksTe 785461 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAesmCksTdsGdsAdsmCdsAdsm  0  387 CdsAdsGdsGdsmCesGesGksAk 785486 N/A N/A  6981 6996 ACCATTCTATGCCTTT AksmCesmCksAdsTdsTdsmCdsTds 51 1066 AdsTdsGdsmCdsmCesTesTksTk 785496 1226 1242 10459 10474 ACTGACACAGGCGGAT AksmCksTdsGdsAdsmCdsAdsmCds  0  397 AdsGdsGdsmCdsGksGesAksTe 785497 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAksmCdsTdsGdsAdsmCdsAdsm  0  387 CdsAdsGdsGdsmCksGesGksAe 785539 N/A N/A  6980  6995 CCATTCTATGCCTTTT mCksmCksAdsTdsTdsmCdsTdsAds 61 1299 TdsGdsmCdsmCdsTksTesTksTe 785504 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCksmCdsAdsTdsTdsmCdsTds 51 1066 AdsTdsGdsmCdsmCksTesTksTe 785548 1226 1241 10459 10474 ACTGACACAGGCGGAT AksmCksTdsGdsAdsmCdsAdsmCds  0  397 AdsGdsGesmCesGesGesAksTk 785572 N/A N/A  6980  6995 CCATTCTATGCCTTTT mCksmCksAdsTdsTdsmCdsTdsAds 17 1299 TdsGdsmCesmCesTesTesTksTk 785585 1225 1240 10458 10473 CTGACACAGGCGGATG mCksTksGdsAdsmCdsAdsmCdsAds  0 1297 GdsGdsmCksGesGksAesTksGk 785586 1226 1241 10459 10474 ACTGACACAGGCGGAT AksmCksTdsGdsAdsmCdsAdsmCds  0  397 AdsGdsGksmCesGksGesAksTk 785587 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAksmCdsTdsGdsAdsmCdsAdsm  0  387 CdsAdsGksGesmCksGesGksAk 785645 N/A N/A  6979  6994 CATTCTATGCCTTTTA mCksAksTdsTdsmCdsTdsAdsTds 56 1298 GdsmCdsmCksTesTksTesTksAk 785646 N/A N/A  6980  6995 CCATTCTATGCCTTTT mCksmCksAdsTdsTdsmCdsTdsAds  3 1299 TdsGdsmCksmCesTksTesTksTk 785647 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCksmCdsAdsTdsTdsmCdsTds  0 1066 AdsTdsGksmCesmCksTesTksTk 785657 1226 1241 10459 10474 ACTGACACAGGCGGAT AksmCksTdsGdsAdsmCdsAdsmCds  0  397 AdsGdsGdsmCesGesGesAksTk 785681 N/A N/A  6980  6995 CCATTCTATGCCTTTT mCksmCksAdsTdsTdsmCdsTdsAds 50 1299 TdsGdsmCdsmCesTesTesTksTk 785687 1226 1241 10459 10474 ACTGACACAGGCGGAT AksmCksTdsGdsAdsmCdsAdsmCds  6  397 AdsGdsGdsmCksGdsGksAdsTk 785711 N/A N/A  6980  6995 CCATTCTATGCCTTTT mCksmCksAdsTdsTdsmCdsTdsAds 46 1299 TdsGdsmCdsmCksTdsTksTdsTk 785721 1226 1241 10459 10474 ACTGACACAGGCGGAT AksmCksTdsGdsAdsmCdsAdsmCds  0  397 AdsGdsGdsmCksGesGksAesTk 785722 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAksmCdsTdsGdsAdsmCdsAdsm  0  387 CdsAdsGdsGksmCesGksGesAk 785764 N/A N/A  6980  6995 CCATTCTATGCCTTTT mCksmCksAdsTdsTdsmCdsTdsAds 62 1299 TdsGdsmCdsmCksTesTksTesTk 785765 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCksmCdsAdsTdsTdsmCdsTds 40 1066 AdsTdsGdsmCksmCesTksTesTk 785774 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAksmCksTdsGdsAdsmCdsAdsm  0  387 CdsAdsGdsGksmCdsGksGdsAk 785799 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCksmCksAdsTdsTdsmCdsTds 11 1066 AdsTdsGdsmCksmCdsTksTdsTk 785809 1226 1241 10459 10474 ACTGACACAGGCGGAT AksmCksTksGdsAdsmCdsAdsmCds  0  397 AdsGdsGdsmCksGesGksAesTk 785810 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAksmCksTdsGdsAdsmCdsAdsm  0  387 CdsAdsGdsGksmCesGksGesAk 785852 N/A N/A  6980  6995 CCATTCTATGCCTTTT mCksmCksAksTdsTdsmCdsTdsAds 44 1299 TdsGdsmCdsmCksTesTksTesTk 785853 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCksmCksAdsTdsTdsmCdsTds 15 1066 AdsTdsGdsmCksmCesTksTesTk 785862 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAksmCksTdsGdsAdsmCdsAdsm  0  387 CdsAdsGdsGdsmCksGesGksAe 785887 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCksmCksAdsTdsTdsmCdsTds 49 1066 AdsTdsGdsmCdsmCksTesTksTe 785897 1226 1241 10459 10474 ACTGACACAGGCGGAT AksmCksTksGdsAdsmCdsAdsmCds  0  397 AdsGdsGdsmCdsGksGksAksTe 785898 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAksmCksTdsGdsAdsmCdsAdsm  0  387 CdsAdsGdsGdsmCksGksGksAe 785938 N/A N/A  6548  6563 CCAATTTTGCATTCCA mCksmCksAksAdsTdsTdsTdsTds  0 1242 GdsmCdsAdsTdsTksmCksmCksAe 785940 N/A N/A  6980  6995 CCATTCTATGCCTTTT mCksmCksAksTdsTdsmCdsTdsAds 58 1299 TdsGdsmCdsmCdsTksTksTksTe 785941 N/A N/A  6981  6996 ACCATTCTATGCCTTT AksmCksmCksAdsTdsTdsmCdsTds 59 1066 AdsTdsGdsmCdsmCksTksTksTe 786551 N/A N/A  6979  6994 CATTCTATGCCTTTTA mCksAksTksTdsmCdsTdsAdsTds 24 1298 GdsmCdsmCdsTdsTdsTksTksAk 786552 N/A N/A  6980  6995 CCATTCTATGCCTTTT mCksmCksAksTdsTdsmCdsTdsAds 43 1299 TdsGdsmCdsmCdsTdsTksTksTk 785663 N/A N/A  6982  6997 AACCATTCTATGCCTT AksAksmCksmCdsAdsTdsTdsmCds 33 1300 TdsAdsTdsGdsmCdsmCksTksTk 786554 N/A N/A  6983  6998 AAACCATTCTATGCCT AksAksAksmCdsmCdsAdsTdsTdsm  0 1301 CdsTdsAdsTdsGdsmCksmCksTk 786555 N/A N/A  6984  6999 TAAACCATTCTATGCC TksAksAksAdsmCdsmCdsAdsTds  9 1302 TdsmCdsTdsAdsTdsGksmCksmCk 786556 N/A N/A  6985  7000 CTAAACCATTCTATGC mCksTksAksAdsAdsmCdsmCdsAds  0 1303 TdsTdsmCdsTdsAdsTksGksmCk 786557 N/A N/A  6987  7002 CTCTAAACCATTCTAT mCksTksmCksTdsAdsAdsAdsmCdsm  0 1304 CdsAdsTdsTdsmCdsTksAksTk 786558 N/A N/A  6989  7004 TGCTCTAAACCATTCT TksGksmCksTdsmCdsTdsAdsAds  0 1305 AdsmCdsmCdsAdsTdsTksmCksTk 786559 N/A N/A  6991  7006 TTTGCTCTAAACCATT TksTksTksGdsmCdsTdsmCdsTds  2 1306 AdsAdsAdsmCdsmCdsAksTksTk 786560 N/A N/A  6994  7009 CTTTTTGCTCTAAACC mCksTksTksTdsTdsTdsGdsmCds  0 1307 TdsmCdsTdsAdsAdsAksmCksmCk 786561 N/A N/A  6997  7012 AGACTTTTTGCTCTAA AksGksAksmCdsTdsTdsTdsTdsTds  0 1308 GdsmCdsTdsmCdsTksAksAk 786587 N/A N/A  6948  6963 ACTGTATTACCTATAC AksmCksTksGdsTdsAdsTdsTds 22 1309 AdsmCdsmCdsTdsAdsTksAksmCk 786588 N/A N/A  6949  6964 GACTGTATTACCTATA GksAksmCksTdsGdsTdsAdsTdsTds 41 1310 AdsmCdsmCdsTdsAksTksAk 786589 N/A N/A  6950  6965 TGACTGTATTACCTAT TksGksAksmCdsTdsGdsTdsAdsTds 18 1311 TdsAdsmCdsmCdsTksAksTk 786590 N/A N/A  6951  6966 GTGACTGTATTACCTA GksTksGksAdsmCdsTdsGdsTdsAds 62 1312 TdsTdsAdsmCdsmCksTksAk 786591 N/A N/A  6952  6967 TGTGACTGTATTACCT TksGksTksGdsAdsmCdsTdsGdsTds 81 1313 AdsTdsTdsAdsmCksmCksTk 786592 N/A N/A  6953 6968 TTGTGACTGTATTACC TksTksGksTdsGdsAdsmCdsTdsGds 56 1314 TdsAdsTdsTdsAksmCksmCk 786593 N/A N/A  6954  6969 TTTGTGACTGTATTAC TksTksTksGdsTdsGdsAdsmCdsTds 50 1315 GdsTdsAdsTdsTksAksmCk 786594 N/A N/A  6955  6970 TTTTGTGACTGTATTA TksTksTksTdsGdsTdsGdsAdsmCds  2 1316 TdsGdsTdsAdsTksTksAk 786595 N/A N/A  6956  6971 ATTTTGTGACTGTATT AksTksTksTdsTdsGdsTdsGdsAdsm  4 1317 CdsTdsGdsTdsAksTksTk 786596 N/A N/A  6957  6972 AATTTTGTGACTGTAT AksAksTksTdsTdsTdsGdsTdsGds  0 1318 AdsmCdsTdsGdsTksAksTk 786597 N/A N/A  6959  6974 TGAATTTTGTGACTGT TksGksAksAdsTdsTdsTdsTdsGds 64 1319 TdsGdsAdsmCdsTksGksTk 786598 N/A N/A  6960  6975 TTGAATTTTGTGACTG TksTksGksAdsAdsTdsTdsTdsTds 45 1320 GdsTdsGdsAdsmCksTksGk 786599 N/A N/A  6961  6976 GTTGAATTTTGTGACT GksTksTksGdsAdsAdsTdsTdsTds  0 1321 GdsTdsGdsAksmCksTk 786600 N/A N/A  6962  6977 TGTTGAATTTTGTGAC TksGksTksTdsGdsAdsAdsTdsTds 26 1322 TdsTdsGdsTdsGksAksmCk

TABLE 25 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 Compound Start Stop Start Stop % SEQ Number Site Site Site Site Sequence (5′ to 3′) Chemistry Notation Inhibition ID NO 728466  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTksGdsTdsAdsTdsTds 12 1254 TdsmCdsmCdsmCdsTdsGksTksm Ck 728489  484  499  8377  8392 AAGGGCACAGCGCAGG AksAksGdsGdsGdsmCdsAdsmCds  0 1249 AdsGdsmCdsGdsmCdsAksGksGk 728670 1230 1245 10463 10478 TTGCACTGACACAGGC TksTksGksmCdsAdsmCdsTdsGds  6  398 AdsmCdsAdsmCdsAdsGksGksmCk 728708 1308 1323 10541 10556 AGCTTGGTCTTGACCT AksGksmCksTdsTdsGdsGdsTdsm 11  436 CdsTdsTdsGdsAdsmCksmCksTk 729513 N/A N/A 7316 7331 CCCAATGCAACATCCA mCksmCksmCksAdsAdsTdsGdsm 12 1097 CdsAdsAdsmCdsAdsTdsmCksmCks Ak 785349  427  442  8320  8335 GGTGTATTTCCCTGTC GksGdsTdsGdsTdsAdsTdsTds  0 1254 TdsmCdsmCdsmCksTesGksTesmCk 785398 N/A N/A  7314  7329 CAATGCAACATCCATC mCksAdsAdsTdsGdsmCdsAdsAdsm  0 1323 CdsAdsTdsmCksmCesAksTesmCk 785399 N/A N/A  7316  7331 CCCAATGCAACATCCA mCksmCdsmCdsAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCdsAksTesmCksmCes Ak 785404  427  442  8320  8335 GGTGTATTTCCCTGTC GksGdsTdsGdsTdsAdsTdsTds  0 1254 TdsmCdsmCksmCesTksGesTksmCe 785453 N/A N/A  7314  7329 CAATGCAACATCCATC mCksAdsAdsTdsGdsmCdsAdsAdsm  0 1323 CdsAdsTksmCesmCksAesTksmCe 785454 N/A N/A  7316  7331 CCCAATGCAACATCCA mCksmCdsmCdsAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCksAesTksmCesmCks Ae 785459  427  442  8320  8335 GGTGTATTTCCCTGTC GksGesTksGdsTdsAdsTdsTds  5 1254 TdsmCdsmCdsmCdsTesGesTksmCk 785487 N/A N/A 7316 7331 CCCAATGCAACATCCA mCksmCesmCksAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCdsAdsTesmCesmCks Ak 785493  426  441  8319  8334 GTGTATTTCCCTGTCT GksTksGdsTdsAdsTdsTdsTdsm  0 1324 CdsmCdsmCdsTdsGksTesmCksTe 785494  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTdsGdsTdsAdsTdsTds 21 1254 TdsmCdsmCdsmCdsTksGesTksmCe 785541 N/A N/A  7315  7330 CCAATGCAACATCCAT mCksmCksAdsAdsTdsGdsmCds  0 1325 AdsAdsmCdsAdsTdsmCksmCesAks Te 785542 N/A N/A  7316  7331 CCCAATGCAACATCCA mCksmCksmCdsAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCdsAdsTksmCesmCks Ae 785547  426  441  8319  8334 GTGTATTTCCCTGTCT GksTksGdsTdsAdsTdsTdsTdsm  0 1324 CdsmCdsmCesTesGesTesmCksTk 785573 N/A N/A  7315  7330 CCAATGCAACATCCAT mCksmCksAdsAdsTdsGdsmCds  0 1325 AdsAdsmCdsAesTesmCesmCesAks Tk 785581  426  441  8319  8334 GTGTATTTCCCTGTCT GksTksGdsTdsAdsTdsTdsTdsm  0 1324 CdsmCdsmCksTesGksTesmCksTk 785582  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTdsGdsTdsAdsTdsTds  0 1254 TdsmCdsmCksmCesTksGesGksmCk 785648 N/A N/A  7314  7329 CAATGCAACATCCATC mCksAksAdsTdsGdsmCdsAdsAdsm  0 1323 CdsAdsTksmCesmCksAesTksm Ck 785649 N/A N/A  7315  7330 CCAATGCAACATCCAT mCksmCksAdsAdsTdsGdsmCdsAds  0 1325 AdsmCdsAksTesmCksmCesAksTk 785650 N/A N/A  7316  7331 CCCAATGCAACATCCA mCksmCksmCdsAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCksAesTksmCesmCks Ak 785656  426  441  8319  8334 GTGTATTTCCCTGTCT GksTksGdsTdsAdsTdsTdsTdsm 16 1324 CdsmCdsmCdsTesGesTesmCksTk 785682 N/A N/A  7315  7330 CCAATGCAACATCCAT mCksmCksAdsAdsTdsGdsmCds  0 1325 AdsAdsmCdsAdsTesmCesmCesAks Tk 785686  426  441  8319  8334 GTGTATTTCCCTGTCT GksTksGdsTdsAdsTdsTdsTdsm  0 1324 CdsmCdsmCdsTksGdsTksmCdsTk 785712 N/A N/A  7315  7330 CCAATGCAACATCCAT mCksmCksAdsAdsTdsGdsmCds  0 1325 AdsAdsmCdsAdsTksmCdsmCksAds Tk 785718  426  441  8319  8334 GTGTATTTCCCTGTCT GksTksGdsTdsAdsTdsTdsTdsm  0 1324 CdsmCdsmCdsTksGesTksmCesTk 785719  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTdsGdsTdsAdsTdsTds 26 1254 TdsmCdsmCdsmCksTesGksTesmCk 785766 N/A N/A  7315  7330 CCAATGCAACATCCAT mCksmCksAdsAdsTdsGdsmCds  0 1325 AdsAdsmCdsAdsTksmCesmCksAes Tk 785767 N/A N/A  7316  7331 CCCAATGCAACATCCA mCksmCksmCdsAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCdsAksTesmCksmCes Ak 785772  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTksGdsTdsAdsTdsTds  1 1254 TdsmCdsmCdsmCksTdsGksTdsmCk 785800 N/A N/A  7316  7331 CCCAATGCAACATCCA mCksmCksmCksAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCdsAksTdsmCksmCds Ak 785806  426  441  8319  8334 GTGTATTTCCCTGTCT GksTksGksTdsAdsTdsTdsTdsm  0 1324 CdsmCdsmCdsTksGesTksmCesTk 785807  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTksGdsTdsAdsTdsTds  0 1254 TdsmCdsmCdsmCksTesGksTesmCk 785854 N/A N/A  7315  7330 CCAATGCAACATCCAT mCksmCksAksAdsTdsGdsmCds  0 1325 AdsAdsmCdsAdsTksmCesmCksAes Tk 785855 N/A N/A  7316  7331 CCCAATGCAACATCCA mCksmCksmCksAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCdsAksTesmCksmCes Ak 785860  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTksGdsTdsAdsTdsTds  0 1254 TdsmCdsmCdsmCdsTksGesTksmCe 785888 N/A N/A  7316  7331 CCCAATGCAACATCCA mCksmCksmCksAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCdsAdsTksmCesmCks Ae 785894  426  441  8319  8334 GTGTATTTCCCTGTCT GksTksGksTdsAdsTdsTdsTdsm 30 1324 CdsmCdsmCdsTdsGksTksmCksTe 785895  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTksGdsTdsAdsTdsTds  0 1254 TdsmCdsmCdsmCdsTksGksTksmCe 785938 N/A N/A  6548  6563 CCAATTTTGCATTCCA mCksmCksAksAdsTdsTdsTdsTds 61 1242 GdsmCdsAdsTdsTksmCksmCksAe 785942 N/A N/A  7315  7330 CCAATGCAACATCCAT mCksmCksAksAdsTdsGdsmCds 16 1325 AdsAdsmCdsAdsTdsmCksmCksAks Te 785943 N/A N/A  7316  7331 CCCAATGCAACATCCA mCksmCksmCksAdsAdsTdsGdsm  0 1097 CdsAdsAdsmCdsAdsTksmCksmCks Ae 786494  428  443  8321  8336 CGGTGTATTTCCCTGT mCksGksGksTdsGdsTdsAdsTds  0 1326 TdsTdsmCdsCdsmCdsTksGksTk 786562 N/A N/A  7307  7322 ACATCCATCAATGAGG AksmCksAksTdsmCdsmCdsAds  0 1327 TdsmCdsAdsAdsTdsGdsAksGks Gk 786563 N/A N/A  7309  7324 CAACATCCATCAATGA mCksAksAksmCdsAdsTdsmCdsm  0 1328 CdsAdsTdsmCdsAdsAdsTksGks Ak 786564 N/A N/A  7311  7326 TGCAACATCCATCAAT TksGksmCksAdsAdsmCdsAdsTdsm  0 1329 CdsmCdsAdsTdsmCdsAksAks 786565 N/A N/A  7312  7327 ATGCAACATCCATCAA AksTksGksmCdsAdsAdsmCdsAds  0 1330 TdsmCdsmCdsAdsTdsmCksAksAk 786566 N/A N/A  7313  7328 AATGCAACATCCATCA AksAksTksGdsmCdsAdsAdsmCds  0 1331 AdsTdsmCdsmCdsAdsTksmCksAk 786567 N/A N/A  7314  7329 CAATGCAACATCCATC mCksAksAksTdsGdsmdsAdsAdsm  0 1323 CdsAdsTdsmCdsmCdsAksTksmCk 786568 N/A N/A  7315  7330 CCAATGCAACATCCAT mCksmCksAksAdsTdsGdsmCds  0 1325 AdsAdsmCdsAdsTdsmCdsmCksAks Tk 786569 N/A N/A  7317  7332 ACCCAATGCAACATCC AksmCksmCksmCdsAdsAdsTds 33 1332 GdsmCdsAdsAdsmCdsAdsTksm CksmCk 786570 N/A N/A  7318  7333 TACCCAATGCAACATC TksAksmCksmCdsmCdsAdsAdsTds  0 1333 GdsmCdsAdsAdsmCdsAksTksmTk 786571 N/A N/A  7319  7334 ATACCCAATGCAACAT AksTksAksmCdsmCdsmCdsAdsAds  1 1334 TdsGdsmCdsAdsAdsmCksAksTk

TABLE 26 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 Compound Start Stop Start Stop % SEQ Number Site Site Site Site Sequence (5′ to 3′) Chemistry Notation Inhibition ID NO 665892 1227 1242 10460 10475 CACTGACACAGGCGGA mCksAksmCksTdsGdsAdsmCds  0  387 AdsmCdsAdsGdsGdsmCdsGksGksAk 665893  128 1243 10461 10476 GCACTGACACAGGCGG GksmCksAksmCdsTdsGdsAdsm  0   39 CdsAdsmCdsAdsGdsGdsmCksGksGk 666168 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTksmCksAdsmCdsmCdsAdsm 11  927 CdsTdsGdsTdsGdsTdsAksmCksmCk 728458  392  407  4717  4732 AGATGGTGTTATCTCC AksGksAksTdsGdsGdsTdsGds  0  123 TdsTdsAdsTdsmCdsTksmCksmCk 728466  427  442  8320  8335 GGTGTATTTCCCTGTC GksGksTksGdsTdsAdsTdsTds 37 1254 TdsmCdsmCdsmCdsTdsGksTksmCk 728489  484  499  8377  8392 AAGGGCACAGCGCAGG AksAksGdsGdsGdsmCdsAdsmCds  2 1249 AdsGdsmCdsGdsmCdsAksGksGk 728670 1230 1245 10463 10478 TTGCACTGACACAGGC TksTksGksmCdsAdsmCdsTdsGds  0  398 AdsmCdsAdsmCdsAdsGksGksmCk 728707 1307 1322 10540 10555 GCTTGGTCTTGACCTC GksmCksTksTdsGdsGdsTdsmCds  0  435 TdsdTdsGdsAdsmCdsmCksTksmCk 728708 1308 1322 10541 10556 AGCTTGGTCTTGACCT AksGksmCksTdsTdsGdsGdsTdsm 41  436 CdsTdsTdsGdsAdsmCksmCksTk 728958 1979 1994 11544 11559 CCTATACAGCTAGGCC mCksmCksTksAdsTdsAdsmCdsAds  0  168 GdsmCdsTdsAdsGdsGksmCksmCk 728996 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTksGksAdsGdsTdsmCdsTdsm  9  206 CdsAdsAdsAdsmCdsmCksAksGk 729037 2216 2231 11781 11796 GGTTCTTGGACTCTCA GksGksTdsTdsmCdsTdsTdsGds 47  706 GdsAdsmCdsTdsmCdsTksmCksAk 785347  390  405  4715  4730 ATGGTGTTATCTCCGT AksTdsGdsGdsTdsGdsTdsTds  0  122 AdsTdsmCdsTksmCesmCksGesTk 785348  392  107  4717  4732 AGATGGTGTTATCTCC AksGdsAdsTdsGdsGdsTdsGdsTds  0  123 TdsAdsTksmCesTksmCesmCk 785374 2112 2127 11677 11692 GAGTCTCAAACCAGGG GksAdsGdsTdsmCdsTdsmCdsAds  0  205 AdsAdsmCdsmCksAesGksGesGk 785375 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTdsGdsAdsGdsTdsmCdsTdsm  0  206 CdsAdsAdsAksmCesmCksAesGk 785390 N/A N/A  5284  5299 CACCACTGTGTACCCC mCksAdsmCdsmCdsAdsmCdsTdsGds  0  938 TdsGdsTdsAksmCesmCksmCesmCk 785391 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTdsmCdsAdsmCdsmCdsAdsm  0  927 CdsTdsGdsTdsGksTesAksmCesmCk 785402  390  405  4715  4730 ATGGTGTTATCTCCGT AksTdsGdsGdsTdsGdsTdsTdsAds  0  122 TdsmCksTesmCksmCesGksTe 785403  392  407  4717  4732 AGATGGTGTTATCTCC AksGdsAdsTdsGdsGdsTdsGds  0  123 TdsTdsAksTesmCksTesmCksmCe 785429 2112 2127 11677 11692 GAGTCTCAAACCAGGG GksAdsGdsTdsmCdsTdsmCdsAds  6  205 AdsAdsmCksmCesAksGesGksGe 785430 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTdsGdsAdsGdsTdsmCdsTdsm  0  206 CdsAdsAksAesmCksmCesAksGe 785445 N/A N/A  5284  5299 CACCACTGTGTACCCC mCksAdsmCdsmCdsAdsmCdsTdsGds  0  938 TdsGdsTksAesmCksmCesmCksmCe 785446 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTdsmCdsAdsmCdsmCdsAdsm  0  927 CdsTdsGdsTksGesTksAesmCksmCe 785458  392  407  4717  4732 AGATGGTGTTATCTCC AksGesAksTdsGdsGdsTdsGdsTds  0  123 TdsAdsTdsmCesTesmCksmCk 785473 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTesGksAdsGdsTdsmCdsTdsm 22  206 CdsAdsAdsAdsmCesmCesAksGk 785482 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTesmCksAdsmCdsmCdsAdsm  0  927 CdsTdsGdsTdsGdsTesAesmCksmCk 785491  391  406  4716  4731 GATGGTGTTATCTCCG GksAksTdsGdsGdsTdsGdsTdsTds  0 1335 AdsTdsmCdsTksmCesmCksGe 785492  392  407  4717  4732 AGATGGTGTTATCTCC AksGksAdsTdsGdsGdsTdsGdsTds  0  123 TdsAdsTdsmCksTesmCksmCe 785517 2113 2128 11678 11693 TGAGTCTCAAACCAGG TksGksAdsGdsTdsmCdsTdsmCds  7 1336 AdsAdsAdsmCdsmCksAesGksGe 785518 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTksGdsAdsGdsTdsmCdsTdsm 31  206 CdsAdsAdsAdsmCksmCesAksGe 785533 N/A N/A  5285  5300 TCACCACTGTGTACCC TksmCksAdsmCdsmCdsAdsmCds  0  939 TdsGdsTdsGdsTdsAksmCesmCksmCe 785534 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTksmCdsAdsmCdsmCdsAdsm  0  927 CdsTdsGdsTdsGdsTksAesmCksmCe 785546  391  406 4716  4731 GATGGTGTTATCTCCG GksAksTdsGdsGdsTdsGdsTds  0 1335 TdsAdsTesmCesTesmCesmCksGk 785560 2113 2128 11678 11693 TGAGTCTCAAACCAGG TksGksAdsGdsTdsmCdsTdsmCds  0 1336 AdsAdsAesmCesmCesAesGksGk 785569 N/A N/A  5285  5300 TCACCACTGTGTACCC TksmCksAdsmCdsmCdsAdsmCdsTds  0  939 GdsTdsGesTesAesmCesmCksmCk 785578  390  405  4715  4730 ATGGTGTTATCTCCGT AksTksGdsGdsTdsGdsTdsTds  0  122 AdsTdsmCksTesmCksmCesGksTk 785579  391  406  4716  4731 GATGGTGTTATCTCCG GksAksTdsGdsGdsTdsGdsTds  0 1335 TdsdAdsTksmCesTksmCesmCksGk 785580  392  407  4717  4732 AGATGGTGTTATCTCC AksGksAdsTdsGdsGdsTdsGds  0  123 TdsTdsAksTesmCksTesmCksmCk 785615 2112 2127 11677 11692 GAGTCTCAAACCAGGG GksAksGdsTdsmCdsTdsmCdsAds  0  205 AdsAdsmCksmCesAksGesGksGk 785616 2113 2128 11678 11693 TGAGTCTCAAACCAGG TksGksAdsGdsTdsmCksTdsmCds  0 1336 AdsAdsAksmCesmCksAesGksGk 785617 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTksGdsAdsGdsTdsmCdsTdsm  9  206 CdsAdsAksAesmCksmCesAksGk 785637 N/A N/A  5284  5299 CACCACTGTGTACCCC mCksAksmCdsmCdsAdsmCdsTdsGds  0  938 TdsGdsTksAesmCksmCesmCksmCk 785638 N/A N/A  5285  5300 TCACCACTGTGTACCC TksmCksAdsmCdsmCdsAdsmCds  0  939 TdsGdsTdsGksTesAksmCesmCksmCk 785639 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTksmCdsAdsmCdsmCdsAdsm  0  927 CdsTdsGdsTksGesTksAesmCksmCk 785655  391  406  4716  4731 GATGGTGTTATCTCCG GksAksTdsGdsTdsTdsGdsTdsTds  0 1335 AdsTdsmCesTesmCesmCksGk 785669 2113 2128 11678 11693 TGAGTCTCAAACCAGG TksGksAdsGdsTdsmCdsTdsmCds  0 1336 AdsAdsAdsmCesmCesAesGksGk 785678 N/A N/A  5285  5300 TCACCACTGTGTACCC TksmCksAdsmCdsmCdsAdsmCdsTds  0  939 GdsTdsGdsTesAesmCesmCksmCk 785685  391  406  4716  4731 GATGGTGTTATCTCCG GksAksTdsGdsGdsTdsGdsTdsTds  0 1335 AdsTdsmCksTdsmCksmCdsGk 785699 2113 2128 11678 11693 TGAGTCTCAAACCAGG TksGksAdsGdsTdsmCdsTdsmCds  0 1336 AdsAdsAdsmCksmCdsAksGdsGk 785708 N/A N/A  5285  5300 TCACCACTGTGTACCC TksmCksAdsmCdsmCdsAdsmCdsTds  0  939 GdsTdsGdsTksAdsmCksmCdsmCk 785716  391  406  4716  4731 GATGGTGTTATCTCCG GksAksTdsGdsGdsTdsGdsTdsTds  0 1335 AdsTdsmCksTesmCksmCesGk 785717  392  407  4717  4732 AGATGGTGTTATCTCC AksGksAdsTdsGdsGdsTdsGds  0  123 TdsTdsAdsTksmCesTksmCesmCk 785742 2113 2128 11678 11693 TGAGTCTCAAACCAGG TksGksAdsGdsTdsmCdstddsmCds  0 1336 AdsAdsAdsmCksmCesAksGesGk 785743 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTksGdsAdsGdsTdsmCdsTdsm  0  206 CdsAdsAdsAksmCesmCksAesGk 785758 N/A N/A  5285  5300 TCACCACTGTGTACCC TksmCksAdsmCdsmCdsAdsmCdsTds  0  939 GdsTdsGdsTksAesmCksmCesmCk 785759 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTksmCdsAdsmCdsmCdsAdsm  0  927 CdsTdsGdsTdsGksTesAksmCesmCk 785771  392  407  4717  4732 AGATGGTGTTATCTCC AksGksAksTdsGdsGdsTdsGdsTds  0  123 TdsAdsTksmCdsTksmCdsmCk 785786 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTksGksAdsGdsTdsmCdsTdsm  0  206 CdsAdsAdsAksmCdsmCksAdsGk 785795 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTksmCksAdsmCdsmCdsAdsm  0  927 CdsTdsGdsTdsGksTdsAksmCdsmCk 785804  391  406  4716  4731 GATGGTGTTATCTCCG GksAksTksGdsGdsTdsGdsTds  0 1335 TdsAdsTdsmCksTesmCksmCesGk 785805  392  407  4717  4732 AGATGGTGTTATCTCC AksGksAksTdsGdsGdsTdsGds  0  123 TdsTdsAdsTksmCesTksmCesmCk 785830 2113 2128 11678 11693 TGAGTCTCAAACCAGG TksGksAksGdsTdsmCdsTdsmCds  0 1336 AdsAdsAdsmCksmCesAksGesGk 785831 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTksGksAdsGdsTdsmCdsTdsm  0  206 CdsAdsAdsAksmCesmCksAesGk 785846 N/A N/A  5285  5300 TCACCACTGTGTACCC TksmCksAksmCdsmCdsAdsdmCdsTds  0  939 GdsTdsGdsTksAesmCksmCesmCk 785847 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTksmCksAdsmCdsmCdsAdsmCds  0  927 TdsGdsTdsGksTesAkdsmCesmCk 785859  392  407  4717  4732 AGATGGTGTTATCTCC AksGksAksTdsGdsGdsTdsGdsTds  8  123 TdsAdsTdsmCksTesmCksmCe 785874 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTksGksAdsGdsTdsmCdsTdsm  0  206 CdsAdsAdsAdsmCksmCesAksGe 785883 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTksmCksAdsmCdsmCdsAdsmCds  0  927 TdsGdsTdsGdsTksAesmCksmCe 785892  391  406  4716  4731 GATGGTGTTATCTCCG GksAksgTksGdsGdsTdsGdsTds  0 1335 TdsAdsTdsmCdsTksmCksmCksGe 785893  392  407  4717  4732 AGATGGTGTTATCTCC AksGksAksTdsGdsGdsTdsGds  0  123 TdsTdsAdsTdsmCksTksmCksmCe 785918 2113 2128 11678 11693 TGAGTCTCAAACCAGG TksGksAksGdsTdsmCdsTdsmCds  0 1336 AdsAdsAdsmCdsmCksAksGksGe 785919 2114 2129 11679 11694 GTGAGTCTCAAACCAG GksTksGksAdsGdsTdsmCdsTdsm 44  206 CdsAdsAdsAdsmCksmCksAksGe 785934 N/A N/A  5285  5300 TCACCACTGTGTACCC TksmCksAksmCdsmCdsAdsmCdsTds 21  939 GdsTdsGdsTdsAksmCksmCksmCe 785935 N/A N/A  5286  5301 ATCACCACTGTGTACC AksTksmCksAdsmCdsmCdsAdsmCds 19  927 TdsGdsTdsGdsTksAksmCksmCe 785938 N/A N/A  6548  6563 CCAATTTTGCATTCCA mCksmCksAksAdsTdsTdsTdsTds 68 1242 GdsmCdsAdsTdsTksmCksmCksAe 786493  393  408  4718  4733 AAGATGGTGTTATCTC AksAksGksAdsTdsGdsGdsTds  0 1337 GdsTdsTdsAdsTdsmCksTksmCk 786499 2113 2128 11678 11693 TGAGTCTCAAACCAGG TksGksAksGdsTdsmCdsTdsmCds 16 1336 AdsAdsAdsmCdsmCdsAksGksGk 786500 2115 2130 11680 11695 AGTGAGTCTCAAACCA AksGksTksGdsAdsGdsTdsmCds  0 1338 TdsmCdsAdsAdsAdsmCksmCksAk

TABLE 27 Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 Compound Start Stop Start Stop % SEQ Number Site Site Site Site Sequence (5′ to 3′) Chemistry Notation Inhibition ID NO 728806 1560 1575 11125 11140 CGGTCTTTGAGGTCTGCks mCksGksGksTdsmCdsTdsTdsTds 32  539 GdsAdsGdsGdsTdsmCksTksGk 729205 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCksmCksAdsmCdsTdsGdsTds 75  937 GdsTdsAdsmCdsmCdsmCksmCksAk 729433 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTksGksTdsmCdsTdsAdsGds 60  974 TdsGdsTdsmCdsAdsTksGksGk 785368 1558 1573 11123 11138 GTCTTTGAGGTCTGGG GksTdsmCdsTdsTdsTdsGdsAds  0  537 GdsGdsTdsmCksTesGksGesGk 785369 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGdsGdsTdsmCdsTdsTdsTds 68  539 GdsaddsGdsGksTesmCksTesGk 785385 N/A N/A  4365  4380 GTCTAGTGTCATGGAA GksTdsmCdsTdsAdsGdsTdsGds 42 1339 TdsmCdsAdsTksGesGksAesAk 785386 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTdsGdsTdsmCdsTdsAdsGds 44  974 TdsGdsTdsmCksAesTksGesGk 785389 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCdsmCdsaddsmCdsTdsGdsTds 43  937 GdsTdsAdsmCksmCesmCksmCesAk 785423 1558 1573 11123 11138 GTCTTTGAGGTCTGGG GksTdsmCdsTdsTdsTdsGdsAds 33  537 GdsGdsTksmCesTksGesGksGe 785424 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGdsGdsTdsmCdsTdsTdsTds 40  539 GdsAdsGksGesTksmCesTksGe 785440 N/A N/A  4365  4380 GTCTAGTGTCATGGAA GksTdsmCdsTdsAdsGdsTdsGds 35 1339 TdsmCdsAksTesGksGesAksAe 785441 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTdsGdsTdsmCdsTdsAdsGds  8  974 TdsGdsTksmCesAksTesGksGe 785444 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCdsmCdsAdsmCdsTdsGdsTds 40  937 GdsTdsAksmCesmCksmCesmCksAe 785470 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGesGkstddsmCdsTdsTdsTds 49  539 GdsAdsGdsGdsTesmCesTksGk 785479 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTesGksTdsmCdsTdsAdsGdsTds 55  974 GdsTdsmCdsAesTesGksGk 785481 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCesmCksAdsmCdsTdsGdsTds 63  937 GdsTdsAdsmCdsmCesmCesmCksAk 785511 1559 1574 11124 11139 GGTCTTTGAGGTCTGG GksGksTdsmCdsTdsTdsTdsGdsAds 67  538 GdsGdsTdsmCksTesGksGe 785512 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGksGdsTdsmCdsTdsTdsTds 43  539 GdsaddsGdsGdsTksmCesTksGe 785527 N/A N/A  4366  4381 TGTCTAGTGTCATGGA TksGksTdsmCdsTdsAdsGdsTds 44 1340 GdsTdsmCdsAdsTksGesGksAe 785528 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTksGdsTdsmCdsTdsAdsGds 38  974 TdsGdsTdsmCdsAksTesGksGe 785531 N/A N/A  5282  5297 CCACTGTGTACCCCAT mCksmCksAdsmCdsTdsGdsTdsGds 19  936 TdsAdsmCdsmCdsmCksmCesAksTe 785532 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCksmCdsAdsmCdsTdsGdsTds 66  937 GdsTdsAdsmCdsmCksmCesmCksAe 785557 1559 1574 11124 11139 GGTCTTTGAGGTCTGG GksGksTdsmCdsTdsTdsTdsGds 56  538 AdsGdsGesTesmCesTesGksGk 785566 N/A N/A  4366  4381 TGTCTAGTGTCATGGA TksGksTdsmCdsTdsAdsGdsTds 54 1340 GdstddsmCesAesTesGesGksAk 785568 N/A N/A  5282  5297 CCACTGTGTACCCCAT mCksmCksAdsmCdsTdsGdsTdsGds 44  936 TdsAdsmCesmCesmCesmCesAksTk 785606 1558 1573 11123 11138 GTCTTTGAGGTCTGGG GksTksmCdsTdsTdsTdsGdsAds 34  537 GdsGdsTksmCesTksGesGksGk 785607 1559 1574 11124 11139 GGTCTTTGAGGTCTGG GksGksTdsmCdsTdsTdsTdsGdsAds 52  538 GdsGksTesmCksTesGksGk 785608 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGksGdsTdsmCdsTdsTdsTds 33  539 GdsAdsGksGesTksmCesTksGk 785629 N/A N/A  4365  4380 GTCTAGTGTCATGGAA GksTksmCdsTdsAdsGdsTdsGds  9 1339 TdsmCdsAksTesGksGesAksAk 785630 N/A N/A  4366  4381 TGTCTAGTGTCATGGA TksGksTdsdmCdsTdsAdsGdsTds 10 1340 GdsTdsmCksAesTksGesGksAk 785631 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTksGdsTdsmCdsTdsAdsGdsTds  0  974 GdsTksmCesAksTesGksGk 785635 N/A N/A  5282  5297 CCACTGTGTACCCCAT mCksmCksAdsmCdsTdsGdsTdsGds  0  936 TdsAdsmCksmCesmCksmCesAksTk 785636 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCksmCdsAdsmCdsTdsGdsTds 15  937 GdsTdsAksmCesmCksmCesmCksAk 785666 1559 1574 11124 11139 GGTCTTTGAGGTCTGG GksGksTdsmCdsTdsTdsTdsGds 74  538 AdsGdsGdsTesmCesTesGksGk 785675 N/A N/A  4366  4381 TGTCTAGTGTCATGGA TksGksTdsmCdsTdsAdsGdsTds 60 1340 GdsTdsmCdsAesTesGesGksAk 755677 N/A N/A  5282  5297 CCACTGTGTACCCCAT mCksmCksAdsmCdsTdsGdsTdsGds 64  936 TdsAdsmCdsmCesmCesmCesAksTk 785696 1559 1574 11124 11139 GGTCTTTGAGGTCTGG GksGksTdsmCdsTdsTdsTdsGds 56  538 AdsGdsGdsTksmCdsTksGdsGk 785705 N/A N/A  4366  4381 TGTCTAGTGTCATGGA TksGksTdsmCdsTdsAdsdGdsTds 40 1340 GdsTdsmCdsAksTdsGksdsAk 785707 N/A N/A  5282  5297 CCACTGTGTACCCCAT mCksmCksAdsmCdsTdsGdsTdsGds 54  936 TdsAdsmCdsmCksmCdsmCksAdsTk 785736 1559 1574 11124 11139 GGTCTTTGAGGTCTGG GksGksTdsmCdsTdsTdsTdsGds 54  538 AdsGdsGdsTksmCesTksGesGk 785737 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGksGdsTdsmCdsTdsTdsTds 44  539 GdsAdsGdsGksTesmCksTesGk 785752 N/A N/A  4366  4381 TGTCTAGTGTCATGGA TksGksTdsmCdsTdsAdsGdsTds 44 1340 GdsTdsmCdsAksTesGksGesAk 785753 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTksGdsTdsmCdsTdsAdsGds 24  974 TdsGdsTdsmCksAesTksGesGk 785756 N/A N/A  5282  5297 CCACTGTGTACCCCAT mCksmCksAdsmCdsTdsGdsTdsGds 42  936 TdsAdsmCdsmCksmCesmCksAesTk 785757 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCksmCdsAdsmCdsTdsGdsTds 17  937 GdsTdsAdsmCksmCesmCksmCesAk 785783 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGksGksTdsmCdsTdsTdsTds 57  539 GdsAdsGdsGksTdsmCksTdsGk 785792 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTksGksTdsmCdsTdsAdsGds 36  974 TdsGdsTdsmCksAdsTksGdsGk 785794 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCksmCksAdsmCdsTdsGdsTds 40  937 GdsTdsAdsmCksmCdsmCksmCdsAk 785824 1559 1574 11124 11139 GGTCTTTGAGGTCTGG GksGksTksmCdsTdsTdsTdsGds 46  538 AdsGdsGdsTksmCesTksGesGk 785825 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGksGksTdsmCdsTdsTdsTds 56  539 GdsAdsGdsGksTesmCksTesGk 785840 N/A N/A  4366  4381 TGTCTAGTGTCATGGA TksGksTksmCdsTdsAdsGdsTds 57 1340 GdsTdsmCdsAksTesGksGesAk 785841 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTksGksTdsmCdsTdsAdsGdsTds 16  974 GdsTdsmCksAesTksGesGk 785844 N/A N/A  5282  5297 CCACTGTGTACCCCAT mCksmCksAdsmCdsTdsGdsTdsGds 10  936 TdsAdsmCdsmCksmCesmCksAesTk 785845 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCksmCksAdsmCdsTdsGdsTds  6  937 GdsTdsAdsmCksmCesmCksmCesAk 785871 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGksGksTdsmCdsTdsTdsTds 38  539 GdsAdsGdsGdsTksmCesTksGe 785880 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTksGksTdsmCdsTdsqAdsGds 39  974 TdsGdsTdsmCdsAksTesGksGe 785882 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCksmCksAdsmCdsTdsGdsTds 39  937 GdsTdsAdsmCdsmCksmCesmCksAe 785912 1559 1574 11124 11139 GGTCTTTGAGGTCTGG GksGksTksmCdsTdsTdsTdsGds 33  538 AdsGdsGdsTdsmCksTksGksGe 785913 1560 1575 11125 11140 CGGTCTTTGAGGTCTG mCksGksGksTdsmCdsTdsTdsTds 32  539 GdsAdsGdsGdsTksmCksTksGe 785928 N/A N/A  4366  4381 TGTCTAGTGTCATGGA TksGksTksmCdsTdsAdsGdsTds 39 1340 GdsTdsmCdsAdsTksGksGksAe 785929 N/A N/A  4367  4382 TTGTCTAGTGTCATGG TksTksGksTdsmCdsTdsAdsGds 20  974 TdsGdsTdsmCdsAksTksGksGe 785935 N/A N/A  5282  5297 CCACTGTGTACCCCAT mCksmCksAksmCdsTdsGdsTdsGds 57  936 TdsAdsmCdsmCdsmCksmCksAksTe 785933 N/A N/A  5283  5298 ACCACTGTGTACCCCA AksmCksmCksAdsmCdsTdsGdsTds 47  937 GdsTdsAdsmCdsmCksmCksmCksAe 785938 N/A N/A  6548  6563 CCAATTTTGCATTCCA mCksmCksAksAdsTdsTdsTdsTds 75 1242 GdsmCdsAdsTdsTksmCksmCksAe 786572 N/A N/A  4358  4373 GTCATGGAATTTTGTG GksTksmCksAdsTdsGdsGdsAds 54 1341 AdsTdsTdsTdsTdsGksTksGk 786573 N/A N/A  4360  4375 GTGTCATGGAATTTTG GksTksGksTdsmCdsAdsTdsGds 58 1342 GdsAdsAdsTdsTdsTksTksGk 786574 N/A N/A  4362  4377 TAGTGTCATGGAATTT TksAksGksTdsGdsTdsmCdsAds 38 1343 TdsGdsGdsAdsAdsTksTksTk 786575 N/A N/A  4363  4378 CTAGTGTCATGGAATT mCksTksAksGdsTdsGdsTdsmCds 34 1344 AdsTdsGdsGdsaddsAksTksTk 786576 N/A N/A  4364  4379 TCTAGTGTCATGGAAT TksmCksTksAdsGdsTdsGdsTdsm 14 1345 CdsAdsTdsGdsGdsAksAksTk 76577 N/A N/A  4365  4380 GTCTAGTGTCATGGAA GksTksmCksTdsAdsGdsTdsGds 38 1339 TdsmCdsAdsTdsGdsGksAksAk 786578 N/A N/A  4366  4381 TGTCTAGTGTCATGGA TksGksTksmCdsTdsAdsGdsTds 61 1340 GdsTdsmCdsAdsTdsGksGksAk 786579 N/A N/A  4368  4383 CTTGTCTAGTGTCATG mCksTksTksGdsTdsmCdsTdsAds 58 1346 GdsTdsGdsTdsmCdsAksTksGk 786580 N/A N/A  4369  4384 TCTTGTCTAGTGTCAT TksmCksTksTdsGdsTdsmCdsTds  0 1347 AdsGdsTdsGdsTdsmCksAksTk 786581 N/A N/A  4370  4385 TTCTTGTCTAGTGTCA TksTksmCksTdsTdsgddsTdsmCds 49 1348 TdsAdsGdsTdsGdsTksmCksAk