SPLICE MODULATING OLIGONUCLEOTIDES AND METHODS OF USE THEREOF

- LifeSplice Pharma LLC

A splice modulating oligonucleotide (SMO), is provided having a sequence designed to modulate the splicing of a SCN8A pre-mRNA, wherein the SMO sequence specifically binds to a sequence in the SCN8A pre-mRNA. Certain embodiments of the invention provide methods of using the SMOs described herein, including methods of treating or preventing epilepsy or a Dravet Spectrum disorder in subject (e.g., a mammal, e.g., a human), including the administration of an SMO or composition described herein to the subject. A method of using the SMOs is described herein to treat spinal cord injury, cancer, amyotrophic lateral sclerosis, Alzheimer's disease, traumatic brain injury, autism, hemiplegic migraine, multiple sclerosis, CNS infections, Parkinson's and Huntington's disease, or other neurological diseases or disorders in which excitotoxicity or hyperexcitability contributes to the pathology.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
RELATED APPLICATIONS

This application claims priority benefit of U.S. Provisional Application Ser. No. 62/039,819 filed Aug. 20, 2014; the contents of which are hereby incorporated by reference.

FIELD OF THE INVENTION

The present invention in general relates in general to therapeutic compositions, and in particular to a sequence designed to modulate the splicing of a SCN8A pre-mRNA.

BACKGROUND

A unified “loss-of-function hypothesis” for the spectrum of pediatric epilepsies caused by SCN1A mutations has recently been proposed (Catterall et. al., 2010). These Dravet Spectrum disorders resulting from SCN1A loss-of-function mutations include febrile seizures, generalized epilepsy with febrile seizure plus (GEFS+), and Dravet syndrome (severe myoclonic epilepsy of infancy or SMEI), in order of increasing severity (Meisler and Kearney 2005). GEFS+ patients typically exhibit febrile seizures and mild cognitive impairment in childhood; seizures can either spontaneously resolve or progress to generalized epilepsy over time (Singh et. al., 1999). SMEI is a relatively rare but catastrophic form of childhood epilepsy characterized by the development of seizures in previously healthy infants that advance to include multiple seizure types such as myoclonus, partial seizures, febrile induced, and the absence episodes by age 2. Progressive developmental and behavioral impairments manifest along with the recurrent and varied seizure episodes that are typically unresponsive to currently available antiepileptic drugs (Dravet et. al., 2005). Additionally, motor abnormalities occur in 20-60% SMEI children (Dravet et. al., 2005). Greater availability of genetic testing and advances in mutational screening now allow for better detection and earlier diagnosis of this severe childhood epilepsy, making early intervention and cure a possibility. Thus, there is a significant and urgent need for the development of novel therapeutic approaches in these patients.

De novo loss-of-function mutations in various sites within the SCN1A gene account for about 70% of SMEI (De 2011) and 10% of GEFS+ (Catterall et. al., 2010). The SCN1gene encodes the a subunit for a voltage-gated sodium (VGS or Nav) channel (Nav1.1), one of a family of 10 paralogous pore-forming alpha subunits (SCN) expressed in the human central nervous system (CNS)), peripheral nerves, and other areas of the body such as the heart. The alpha subunits; SCN1A (Nav1.1), SCN2A (Nav1.2), SCN3A (Nav1.3), SCN4A (Nav1.4), SCN5A (Nav1.5), SCN6/7A, SCN8A (Nav1.6), SCN9A (Nav1.7), SCN10A (Nav1.8), and SCN11/12A (Nav 1.9) as a component of their respective VSG channels, which are critical regulators of neuronal excitability. SCN8A is a VGS channel subunit which functionally opposes the currents produced by SCN1A containing channels. SCN8A-containing (Nav1.6) channels are highly expressed in excitatory neurons (including hippocampal and purkinje neurons), and function to drive excitatory neuron repetitive firing (Chen et. al., 2008; Raman et. al., 1997). Conversely, the majority of SCN1A-containing sodium channels are expressed in GABAergic inhibitory neurons, particularly in hippocampal (Yu et. al., 2006) and purkinje interneurons (Raman et. al., 1997). In SCN1A R168H mutant mice, a GEFS+ model, sodium channel activity in interneurons is impaired, leading to decreased GABAergic inhibition, and the overall effect of the mutation is hyperexcitability and increased seizure susceptibility (Martin et. al., 2010; Tang et. al., 2009). Similarly, SCN1A knockout (KO) SMEI mice exhibit significantly reduced firing and sodium current density in cortical and hippocampal interneurons, with no change in excitatory pyramidal neurons (Ogiwara et. al., 2007; Yu et. al., 2006), suggesting a common lack of inhibitory balance as the cause of SMEI and GEFS+. Interestingly, reducing SCN8A function can “rescue” pro-seizure phenotypes in both SCN1A R168H and SCN1A knockout mice (Hawkins et. al., 2011; Martin et. al., 2007; Meister et. al., 2010). SCN8A partial loss-of-function mutations alone cause ataxia and neuromuscular degeneration, but increased kainate- and flurothyl-induced seizure thresholds in mice (Martin et. al., 2007). However, crossing either SCN1A knockouts or SCN1A R168H mutant mice with an SCN8A partial loss-of-function mutant mouse, normalized flurothyl-induced seizure thresholds and extended lifespan in both lines (Hawkins et. al., 2011; Martin et. al., 2007; Meisler et. al., 2010). Thus, it appears from these studies that reducing SCN8A levels to diminish SCN8A-mediated excitation therapeutically rebalances inhibitory deficits caused by loss-of-function SCN1A mutations.

The VGS channel a subunits undergo several alternative pre-mRNA splicing events, some of these splicing events regulate the inhibitory and excitatory balance of sodium currents in the CNS. Importantly, SCN8A pre-mRNA undergoes mutually exclusive alternative splicing at both exon 5 and exon 18 during development to form 5N (neonatal), or 5A (adult) and 18N (neonatal), or 18A (adult) isoforms, respectively. Inclusion of the 18N exon introduces a premature stop codon into the transcript to yield a nonfunctional truncated SCN8A 18N isoform (Plummer et. al., 1997), whereas inclusion of 5N leads to lower gain SCNA channels and reduced neuronal excitability (Fletcher et. al., 2011; Gazina et. al., 2010; Xu et. al., 2007). Evaluation in a heterologous expression system, revealed that channels formed from SCN2A 5N isoforms are less excitable than those containing the 5A isoform leading to the hypothesis that exon 5A/N alternative splicing across VGS channels subunits (particularly SCN1A, SCN2A, SCN3A and SCN8A) determines neuronal excitability and seizure susceptibility in human infants (Xu et. al., 2007). Such splicing has been proposed as one mechanism that counters the normally high excitability of neonatal neurons and helps to reduce seizure susceptibility in normal human infants. A single nucleotide polymorphism (SNP) in the exon 5N splice site donor region (IVS5N+5 G>A) is responsible for the wide variation of the proportion of SCN1A 5N expression in the adult human brain (Heinzen et. al., 2007). In samples from human temporal cortex, it was demonstrated that the “A” SNP disrupts exon 5N splicing, such that individuals with the “AA” genotype are reduced to 0.7% of total SCN1A mRNA expression in the 5N isoform, in contrast to the “GG” genotype which averages 41% 5N expression (Heinzen et. al., 2007). Importantly, the SCN1A IVS5N+ 5 G>A polymorphism “AA” genotype which reduces 5N and increases 5A isoform expression also confers a 3-fold greater risk of febrile seizures in childhood (as occurs in Dravet Spectrum epilepsies) over the “GG” genotype providing functional evidence that exon 5 splicing confers changes in neuronal excitability (Schlachter et. al., 2009).

For the four major voltage-gated sodium channel alpha subunits in the CNS (SCN1A, SCN2A, SCN3A and SCN8A) it has been shown that 18A levels begin to rise between P7.5-P10 and that expression levels of both the 18A and 18N isoforms near adult levels and complete the developmental switch between P20-P30 in mice (Bender et. al., 2012; Plummer et. al., 1997). The change from predominantly 5N to 5A isoform expression for SCN8A is also developmentally regulated. The 5A/5N expression ratio in fetal cynolomous monkey was demonstrated to be only 1.44, while the expression ration in adult cynolomous monkey brain was 8.52 (Raymond et. al., 2004), indicating that there is a significant reversal in the expression pattern over the neonatal period to decrease 5N expression in favor of 5A isoform expression. These developmental switches in SCN8A and SCN1A isoform expression in rodents coincides with the reduced survival and increased susceptibility to seizures seen in GEFS+/SMEI mice (Martin et. al., 2010; Oakley et. al., 2009; Yu et. al., 2006) and correspond well with both the peak in human SCN1A expression at 7-9 months of age (Wang et. al., 2011) and the onset of seizures in GEFS+/SMEI patients (Bender et. al., 2012).

SCN1A is a member of a family of voltage gated Na+ (VGS) channel a, subunits, and is expressed largely in inhibitory GABAergic interneurons of the central nervous system (CNS). SCN8 channels, conversely, are expressed on excitatory neurons, and thus these two VGS channel subunits reciprocally regulate network excitation. Accordingly, partial loss of

SCN8A function can “rescue” pro-febrile seizure phenotypes in both SCN1A R168H mutant mice and SCN1A knockout mice (Hawkins et. al., 2011; Martin et. al., 2007; Meisler et. al., 2010).

In spite of the advances in understanding clinical manifestations of SCN channel pathways and variants, there exists a need for compositions and treatments based on those compositions for treating of diseases and disorders associated with SCN channels, such as neurological disorders or cancer In particular, there is a need for treatments for Dravet Spectrum disorders.

SUMMARY

Accordingly, certain embodiments of the invention provide a splice modulating oligonucleotide (SMO), comprising a sequence designed to modulate the splicing of a SCN8A pre-mRNA, wherein the SMO sequence specifically binds to a sequence in the SCN8A pre-mRNA.

Certain embodiments of the invention provide a composition comprising an SMO described herein.

Certain embodiments of the invention provide a pharmaceutical composition comprising an SMO described herein and a pharmaceutically acceptable carrier.

Certain embodiments of the invention provide a method of modulating splicing of an SCN8A pre-mRNA comprising contacting a cell with an effective amount of an SMO or a composition described herein.

Certain embodiments of the invention provide a method of treating or preventing a disease, disorder or condition in subject (e.g., a mammal, e.g., a human), comprising administering an SMO or composition as described herein to the subject.

Certain embodiments of the invention provide an SMO or a composition as described herein for the prophylactic or therapeutic treatment of a disease, disorder or condition in a subject.

Certain embodiments of the invention provide the use of an SMO or a composition as described herein to prepare a medicament for treating disease, disorder or condition in a subject.

Certain embodiments of the invention provide an SMO or a composition as described herein for use in medical therapy.

Certain embodiments of the invention provide an SMO or a composition as described herein for use in treating a disease, disorder or condition.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A. Bilateral ICV injections of GR1 and GR3 (2 μg per ventricle) in separate groups of mice (n=5 mice per group) produced nearly 100% reduction in GluA1-flip and GluA3-flip transcripts, respectively, without significant effect on other GluA flip or flop transcript (dotted line shows saline control in all panels). For each subset, LSP-GR1 is shown on the left as a dark grey bar and LSP-GR3 is shown on the right as a light grey bar.

FIG. 1B. A single bilateral ICV injection of LSP-GR1 in 10 d old mice (2 μg per ventricle) produced a 60-80% reduction in GluA1-flip transcripts that was sustained for 2 months after the injection (n=4-5 mice per group; p<0.001). For each subset, the bar representing the cortex is shown on the left as a light grey bar and the bar representing the hippocampus is shown on the right as a dark grey bar.

FIG. 1C. Initial evaluation of 2 candidate SCN8A-18A targeting SMOs: E18A-1 (5′ g uuu cca cug gca ugc aga agg 3′: SEQ ID #878 with n =3 cortex only (dark grey bar); and E18A-2 (5′ AGGGUCUCAAAGCUCUUAGGGUC 3′: SEQ ID #1324), cortex and hippocampus, n =6 (light grey bars) in P10 pups after P3, P5, and P7 ICV injection (4 μg/ventricle) showed significant reduction in 18A isoform levels. (* denotes p<0.05).

FIGS. 1D-F. ICV injection of LSP-GR1 (GR1) protected neonatal mice from KA-induced seizures, and prevented status epilepticus (SE)-induced increase in AMPA-R (a)EPSCs. FIG. 1D. Fewer mice progressed to severe seizure stages after a single KA dose (3 mg/kg) at P10 when pre-treated with 2 μg of LSP-GR1 at P1, P3, and P5 (n=11 per group; p <0.001). FIG. 1E. “Second hit” KA dose required to reach SE at P12 in mice given 4 ng of LSP-GR1 2hr post-SE at P10, was 40% greater than for saline (p<0.05), and 20% greater than in naïve (no SE) mice (p<0.05; n=7 per group). FIG. 2 C. Whole-cell patch-clamp recordings of aEPSCs from CA1 pyramidal neurons in P12 mice. SE induction at P10, followed 2 hr later by ICV injection of saline, produced a large increase in aEPSC amplitude compared to naïve (no SE) mice (p<0.001). SE-induced potentiation of aEPSCs was completely prevented by injection of 4 μg of LSP-GR1 at 2 hrs post-SE (n=5-7 mice per group), suggesting that LSP-GR1 treatment could prevent epileptogenesis. Asterisks in FIG. 1E and FIG. IF indicate significance compared to saline-treated SE-experienced group.

FIGS. 2A-D. Comparison of top candidate SCN8A exon 18A skipping SMOs. FIG. 2A. Ten SMOs were tested in vivo for ability to direct SCN8A exon 18A skipping via paradigms involving 1, 2, or 3 bilateral ICV injections at doses of 2 or 4 μg per ventricle in neonatal pups between the ages of P3-7. Several SMOs demonstrated statistically significant exon 18A skipping; 18A-2 (SEQ ID: 1324), 18A-3 (SEQ ID: 1327), 18A-4 (SEQ ID: 1317), 18A-5 (SEQ ID: 1306), 18A-8 (SEQ ID: 1307), 18A-9 (SEQ ID: 1422), and 18A-10 (SEQ ID: 1541), at the doses tested.

FIG. 2B. A single submaximal dose (2 μg bilateral-4 μg total) was given by ICV injection in P3-5 neonatal mouse pups for each candidate compound to examine small differences in splicing efficiency for the most potent of the compounds during initial screening, relative to saline (negative control, dotted line at 1.0) and compared to LSP-GR1 (positive control). The 18A-5 (SEQ ID: 1306), 18A-8 (SEQ ID: 1307), 18A-9 (SEQ ID: 1422), and 18A-10 (SEQ ID: 1541) SMOs all showed similar on target splicing efficacy. While 18A-5 (SEQ ID: 1306), seemed to produce greatest splicing in the hippocampus, there was proportionally less splicing in the cortex. Thus, the 18A-5 (SEQ ID: 1306), 18A-8 (SEQ ID: 1307), 18A-9 (SEQ ID: 1422), and 18A-10 (SEQ ID: 1541) SMOs all showed similar on target splicing efficacy at a low dose, providing several SMO options to select from as therapeutics. FIG. 2C. Dose-response comparison after high dose (50 μg) intrathecal delivery in adult mice shows that 18A-9 (SEQ ID: 1422), and 18A-10 (SEQ ID: 1541) produce equivalent or slightly better splicing than LSP-GR1 in the cervical and lumbar spinal cord.

Target transcript mRNA is SCN8A exon 18A of 18A SMO and GluA1-flip for LSP-GR1. Duration of action of high single dose SCN8A-18A-9 SMO. FIG. 2D. C57BL/6 mice were harvested at P6, P15, P28, and P42 after a single 4μg bilateral ICV injection of SCN8A-18A-9 ((SEQ ID: 1422, 8μg total) at P3-5. The 18A-9 (SEQ ID: 1422) SMO splicing effect was maintained out to 28 days without decrement though significant exon 18A skipping is still present at P42. SCN8A-18A transcript expression is normalized to saline controls (line=1.0)

FIGS. 2E-F. Comparison of candidate SCN8A exon 5A skipping SMOs. FIG. 2E. Seven SMOs were tested in vivo for ability to direct SCN8A exon 5A skipping via paradigms involving 1 or 2 bilateral ICV injections at doses of 2 or 4 μg per ventricle in neonatal pups between the ages of P3-5. Only SCN8A-5A-2 (SEQ ID: 33), and 5A-7 (SEQ ID: 26) showed statistically significant exon 5A skipping at the doses tested. FIG. 2F. Dose-response of the candidate exon 5A splicing SMO, SCN8A-5A-2 (SEQ ID: 33), was measured after bilateral ICV injection (n =4 - 6 per dose); single 2 μg/ventricle dose (4 μg total), 2×4 μg/ventricle dose (16 μg total), and 3×4 μg/ventricle dose (24 μg total) between ages P3-P10 in neonatal mouse pups. SCN8A-5A transcript expression is normalized to saline controls (line=1.0). Significance determined by students t-test with * p<0.05, ** p<0.005 after Bonferoni correction for multiple measures.

FIGS. 3A-K. SCN8A E5A Splicing SMOs. FIG. 3A. Human SCN8A target sequences for ESA splicing: 7nt of the Intron 5′ to Exon 5A + entire 92 nt of Exon 5A+5nt of Intron 5. FIG. 3B. SCN8A E5A 24 mer SMO sequences. FIG. 3C. SCN8A ESA 23 mer SMO sequences. FIG. 3 D. SCN8A E5A 22 mer SMO sequences. FIG. 3E. SCN8A E5A 21 mer SMO sequences. FIG. 3F. SCN8A ESA 20 mer SMO sequences. FIG. 3G. SCN8A E5A 19 mer SMO sequences. FIG. 3H. SCN8A ESA 18 mer SMO sequences. FIG. 3I. SCN8A ESA 17 mer SMO sequences. FIG. 3J. SCN8A E5A 16 mer SMO sequences. FIG. 3K. SCN8A ESA 15 mer SMO sequences.

FIGS. 4A-D. SCN8A E18A Splicing SMOs. FIG. 4A. Human SCN8A target sequences internal to Intron 18 near the 5′ splice site, and corresponding preferred SCN8AN SMO sequences for skipping Exon 18A. FIG. 4B. Human SCN8A target sequences at the 5′ splice site, and corresponding preferred SCN8AN SMO sequences for skipping Exon 18A. The entire target sequence covers 5′ splice site, and is 100% conserved between mouse and human. It is noted that the 5′ splice site cannot be targeted while being specific for SCN8A because of too much identity with SCN1A. FIG. 4C. Human SCN8A target sequences within Exon 18A, and corresponding preferred SCN8AN SMO sequences for skipping Exon 18A. The entire target sequence is exonic, and is 100% conserved between mouse and human. FIG. 4D. SCN8A target sequences from human and SMO sequences for skipping Exon 18A, at 3′ ss.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention has utility as a medical treatment of seizure disorders, neurological disorders, and cancers; as well as novel compositions for the detection of susceptibility thereto. SCN1A loss-of-function mutations are the major cause of Dravet spectrum pediatric epilepsies, including generalized epilepsy with febrile seizure plus (GEFS+) and severe myoclonic epilepsy of infancy (SMEI) or Dravet syndrome (Claes et. al., 2001). The major therapeutic indication for modulating the splicing of SCN8A is to correct the excitatory/inhibitory imbalance in the brain caused by loss-of-function mutations in SCN1A. The relationship of SCN1A and SCN8A can to be thought of as opposing aspects that must balance exactly for normal brain function. If the amount of normal SCN1A function is reduced due to a mutation, then the present invention serves to reduce SCN8A function, to rebalance the scale. An inventive process to control SCN8A function is by controlling the mRNA splicing to code for an alpha subunit protein that either doesn't allow the resulting VGS channel to function as a sodium channel or exhibits reduced sodium channel kinetics.

Based on SCN1A knock out mouse studies, reducing SCN8 mediated excitation is a logical strategy for rebalancing the reduced inhibitory input caused by SCN1A mutations. However, general sodium channel blockers are largely ineffective at treating Dravet Syndrome due to non-specific effects on Nav sodium channel function, thus there is a need to develop compounds which can specifically and precisely modulate the contributions of the SCN8A subunit to sodium channel function. A novel approach to achieving the needed target specificity is through the development of splice modulating oligonucleotides (SMOs). SCN8A subunits are naturally alternatively spliced at two specific sites of interest. Exon 18 is alternatively spliced to form 18N (neonatal) and 18A (adult) isoforms. Inclusion of the 18N exon yields a truncated nonfunctional SCN8A-18N (Plummer et. al., 1997). Directing splicing to exclude (skip) exon 18A of SCN8A will result in inclusion of the desired 18N isoform. Similarly, there are two alternate exons (5N/5A) which are present in SCN8A pre-mRNA. This splicing event also occurs in related SCN genes and is known to control sodium channel kinetics. Based on similarities in amino acid composition to other SCN genes, the SCN8A 5N-containing mRNA is predicted to yield a lower gain sodium channel and the 5A isoform a higher gain sodium channel (Gazina et. al., 2010; Xu et. al., 2007). Thus, as described herein, reduction of the 18A isoform to favor production of the 18N isoform could be used as a strategy to ameliorate the effects of SCN1A mutations. Similarly, reducing expression of the SCN8A 5A isoform will decrease sodium currents, with a milder and more controlled modulation of channel properties versus creating non-functional isoforms. SMOs are designed to overcome several barriers to successful drug development. In contrast to classic antisense compounds and siRNAs, SMOs do not recruit degradation enzymes (RNAseH, dicer) and therefore do not cause off-target degradation of transcripts. SMOs bind to their targets with exceptional potency, specificity, and negligible off-target effects (Eckstein 2007).

As a major advantage, our proposed SMOs will be designed for complete selectivity in targeting SCN8A isoform expression without affecting any other highly related VGS channel subunits. Additionally, regulation of SCN8A exon 18A splicing is differentially controlled in non-neuronal cells, thus SMOs can be designed specifically to modulate splicing in the CNS such that release from the CNS during normal metabolism is unlikely to have on-target effects outside of the CNS (Zubovic et. al., 2012), and vice versa. Moreover, the SCN8A gene is nearly 100% conserved between mouse and human surrounding the SMO target sites, such that SMOs validated in the mouse model will be directly applicable to the clinic. The strategy of specifically reducing function only of the Na+ channel subunit that counterbalances SCN1A input (SCN8A) should be more effective with fewer adverse effects than non-selective VGS channel blockers. Further, by changing alternative splicing, an SMO directed against exon 5A will specifically reduce excitatory channel properties, rather than simply decreasing overall Nav1.6 channel function. In addition to treating Dravet spectrum epilepsies, the modulation of SCN8A pre-mRNA splicing may also be used to treat a variety of diseases and disorders. Specifically, the SMOs described herein, which target SCN8A pre-mRNA, may also be used to treat certain neurological disorders and cancer as described below.

Accordingly, the present invention encompasses a class of compounds known as splice modulating oligonucleotides (SMOs) that modulate pre-mRNA splicing, thereby affecting expression and functionality of a specific protein in a cell; where the pre-mRNA is SCN8A and the protein is Nav1.6. An SMO specifically binds to a complementary sequence on a pre-mRNA at an exon or intron splice suppressor or splice enhancer site, or at an intron-exon splice site, or at a variety of sites on the pre-mRNA containing various other motifs that are predicted to affect splicing. For example, when an SMO specifically binds to a splice enhancer site, or an intron-exon splice site, the adjacent exon is excluded from the resulting mRNA. Additionally, an SMO may specifically bind to a splice suppressor site or an intron-exon site and the adjacent exon is included in the resulting mRNA. Finally, an SMO may specifically bind to a splice enhancer site or an intron-exon splice site and shift the reading frame of the pre-mRNA so that the resulting protein is truncated. In some cases, the resulting protein is a limited-function, or non-functional protein relative to the native protein. The location of an exonic or intronic splice enhancer or suppressor motif may be found anywhere within the exon and the flanking introns. Similarly, an SMO may either fully or partially overlap a predicted exonic or intronic splice enhancer or suppressor site in proximity to an intron-exon boundary and/or be complementary to the predicted 3′ or 5′ splice Sites.

Splice Modulating Oligonucleotides and Compositions Thereof

The present invention is directed, in specific embodiments to oligonucleotides referred to herein as splice modulating oligonucleotides (SMOs), suitable for use in modulating splicing of a target transcript pre-mRNA. Here, SCN8A pre-mRNA splicing is modulated to correct the excitatory/inhibitory imbalance in the brain caused by loss-of-function mutations in SCN1A. Further SCN8A pre-mRNA splicing is modulated to treat any disease or disorder to which reducing or increasing input from SCN8A containing voltage gated sodium channels is therapeutic. SCN8A pre-mRNA splicing is also modulated as a tool for studying SCN8A both in vitro and in vivo.

It is appreciated that such SMOs are operative as therapeutics, gene therapy, genotyping a subject, and as part of a business method in which any of the aforementioned tasks are accomplished in exchange for financial remuneration. For example, certain embodiments of the invention provide an SMO based on the consensus sequence of sodium channel, voltage-gated, type VIII (Nav1.6), alpha subunit (SCN8A) (OMIM: 600702; Genbank AB027567.1), including upstream and downstream nucleotides (see, e.g., FIGS. 3A-K. and 4A-D). The present invention also includes a pharmaceutical composition including an SMO suitable for modulating splicing of a target pre-mRNA both in vitro and in vivo (e.g., SCN8A pre-mRNA). For example, these SMOs are used according to the methods of the invention to modulate splicing of SCN8A pre-mRNA. In one embodiment, these SMOs are used according to the methods of the invention to modulate splicing of SCN8A pre-mRNA to exclude exon 5A or exon 18A or a combination thereof. In vivo methodologies are useful for both general splice site modulatory purposes, as well as in therapeutic applications in which modulating splicing of a target pre-mRNA is desirable (e.g., to modulate the splicing of SCN8A to treat a disorder such as Dravet spectrum epilepsy).

(FIGS. 3A-K and 4A-D) depict exemplary SMOs useful for modulating splicing of SCN8A pre-mRNA (e.g., to exclude exon 5A or exon 18A).

Accordingly, certain embodiments of the invention provide a splice modulating oligonucleotide (SMO) that specifically binds to a SCN8A pre-mRNA (i.e., a pre-mRNA that undergoes splicing to form an mRNA encoding a SCN8A protein).

In certain embodiments, the inventive SMO specifically binds a complementary sequence of the SCN8A pre-mRNA.

In certain embodiments, the SMO includes a sequence designed to modulate the splicing of an SCN8A pre-mRNA. In certain embodiments, the SMO includes a sequence that specifically binds to an exon, an intron, a 5′ untranslated region (UTR), a 3′ UTR, a splice junction, an exon:exon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), an intronic splicing silencer (ISS), an intronic splicing enhancer (ISE), or a combination of any of the aforementioned in the SCN8A pre-mRNA. In certain embodiments, the SMO includes a sequence that specifically binds to exon 5A, exon 5N, exon 18A, exon 18N, intron 4, intron 5, intron 4A, intron 4N, intron 5A, intron 5N, intron 17, intron 18, intron 17A, intron 17N, intron 18A , intron 18N or a combination of any of the aforementioned of the SCN8A pre-mRNA (see, e.g., Example 1 and FIGS. 3A-K. and 4A-D).

With respect to an inventive SMO, the term “hybridizing” refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art. In particular, the term refers to hybridization of an SMO with a substantially complementary sequence contained within a complementary sequence of a target complementary sequence of the SCN8A pre-mRNA molecule, to the substantial exclusion of hybridization of the SMO with a pre-mRNA that has a non-complementary sequence. Appropriate conditions enabling specific hybridization of single stranded nucleic acid molecules of varying complementarity are well known in the art. It is appreciated that these conditions are largely dictated by cellular conditions for in vivo applications.

With respect to the inventive SMO, the term “complementary” or “complementarity” refers to a degree of antiparallel relationship between a strand of SMO and a pre-mRNA molecule In some instances, the complementarity between an inventive SMO and a pre-mRNA is between 80 and 99.9%., while in other instance, the complementarity to a pre-mRNA by an inventive SMO is 100%.

The SMO of the invention may be defined generally as a nucleotide sequence (or oligonucleotide) a portion of which is capable of hybridizing with the target nucleic acid to exact an antisense activity on the target nucleic acid.

Alternatively, the inventive SMO may be defined functionally as a nucleotide sequence (or oligonucleotide) a portion of which is complementary to and capable of hybridizing with the target nucleic acid sequence to exact a splice modulation in the target RNA of at least 10% for a given subject as measured by target RNA levels. In a preferred embodiment, the target nucleic acid an SCN8A pre-mRNA.

With respect to the inventive SMO, the term “splice modulation” refers to molecular manipulation of pre-mRNA splicing to direct the final composition of the mRNA transcript. It is appreciated that complementarity to the target pre-mRNA alone is not sufficient to produce an inventive SMO. The location of SMO binding (ie blocking splicing motifs in the pre-mRNA, and thermodynamics of binding at that site, as well as secondary structure of the pre-mRNA are among the factors that determine whether splice modulation occurs and the magnitude thereof.

For instance, one common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is set forth below (Sambrook et al., Molecular Cloning Manual #1, 1989):


Tm=81.5° C.+16.6 Log [Na+]+0.41(% G+C)−0.63(% formamide)−600/#bp in duplex

As an illustration of the above formula, using [Na+]=[0.368] and 50% formamide, with GC content of 42% and an, average probe size of 200 bases, the Tm is 57° C. The Tm of a DNA duplex decreases by 1-1.5° C. with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42° C. Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, et al., 2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference.

The stringency of the ex vivo hybridization and wash depend primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the SMO with a target therefor, the hybridization is usually carried out at salt and temperature conditions that are 20-25° C. below the calculated Tm of the hybrid. Wash conditions should be as stringent as possible for the degree of identity of the probe for the target. In general, wash conditions are selected to be approximately 12-20° C. below the Tm of the hybrid. In regards to the nucleic acids of the current invention, a moderate stringency hybridization is defined as hybridization in 6×SSC, 5×Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42° C., and washed in 2×SSC and 0.5% SDS at 55° C. for 15 minutes. A high stringency hybridization is defined as hybridization in 6×SSC, 5×.Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42° C., and washed in 1.times.SSC and 0.5% SDS at 65° C. for 15 minutes. A very high stringency hybridization is defined as hybridization in 6×SSC, 5×.Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42° C., and washed in 0.1×SSC and 0.5% SDS at 65° C. for 15 minutes.

Examples of additional conditions under which a nucleotide sequence (or oligonucleotide or SMO sequence) is capable of hybridizing with the target RNA, include 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing) and hybridization at 70° C. in 1×SSC or 50° C. in 1×SSC, 50% formamide followed by washing at 70° C. in 0.3×SSC or hybridization at 70° C. in 4×SSC or 50° C. in 4×SSC, 50% formamide followed by washing at 67° C. in 1×SSC. The hybridization temperature for hybrids less than 50 base pairs in length should be 5-10° C. less than the melting temperature (Tm) of the hybrid, as determined according to the following equations. At less than 18 base pairs in length, Tm (° C.)=2 (number of A+T bases)+4 (number of G+C bases). Between 18 and 49 base pairs in length, Tm (° C.)=81.5+16.6 (log 10 [Na+])+0.41 (% G+C)−(600/N), where N is the number of bases in the hybrid, and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] for 1×SSC=0.165 M).

In certain inventive embodiments, the SMO includes a sequence designed to modulate the splicing of an SCN8A pre-mRNA (e.g., to exclude exon 5A or exon 18A), wherein the SMO has at least about 60% (e.g., about 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%) complementarity to an SCN8A pre-mRNA, and wherein the SMO sequence is 14 to 26 nucleotides long (e.g., about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides long).

In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and modulate the splicing of exon 5A/5N in the SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and exclude exon 5A from a resulting SCN8A mRNA. In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and include exon 5N in a resulting SCN8A mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to a 3′ or 5′ splice site of SCN8A exon 5A. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 5A exonic splice enhancer (ESE) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 5A intronic splice enhancer (ISE) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 5N intronic splice silencer (ISS) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 5N exonic splice silencer (ESS) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to exon 5A of the SCN8A pre-mRNA (e.g., binds to a complementary sequence in exon 5A (either partially or wholly within exon 5A)).

In certain inventive embodiments, the SMO includes a sequence designed to modulate the splicing of exon 18A/18N in the SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and exclude exon 18A from the resulting SCN8A mRNA. In certain inventive embodiments, the SMO includes a sequence designed to bind with complementarity to an SCN8A pre-mRNA and include exon 18N in a resulting SCN8A mRNA. In certain inventive embodiments, the nucleic acid includes a sequence that specifically binds to a 3′ or 5′ splice site of SCN8A exon 18A. In certain inventive embodiments, the nucleic acid includes a sequence that specifically binds to an exon 18A exonic splice enhancer (ESE) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the nucleic acid includes a sequence that specifically binds to an exon 18A intronic splice enhancer (ISE) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon 18N intronic splice silencer (ISS) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to an exon. 18N exonic splice silencer (ESS) sequence within an SCN8A pre-mRNA. In certain inventive embodiments, the SMO includes a sequence that specifically binds to exon 18A of the SCN8A pre-mRNA (e.g., binds to a complementary sequence in exon 18A (either partially or wholly within exon 18A)).

In certain inventive embodiments, the SMO includes a sequence that has at least about 60% complementarity with a SCN8A pre-mRNA sequence. In certain inventive embodiments, the sequence has at least about 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity with a SCN8A pre-mRNA sequence.

In certain inventive embodiments, the SMO includes a sequence that has at least about 60% complementarity with SEQ ID NO:1, 858, 965, 1252, or 1859. In certain inventive embodiments, the sequence has at least about 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity with SEQ ID NO:1, 858, 965, 1252, or 1859.

In certain inventive embodiments, the SMO includes a sequence that has at least about 60% sequence identity with SEQ ID NOs:2, 859, 966, 1253, or 1860. In certain inventive embodiments, the sequence has at least about 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with SEQ ID NOs: 2, 859, 966, 1253, or 1860.

In certain inventive embodiments, the SMO sequence is about 14 to about 26 nucleotides long (e.g., about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides long). In certain inventive embodiments, the SMO is about 15 to about 24 nucleotides long.

In certain inventive embodiments, the SMO is about 14 to about 26 nucleotides and includes between about 6 and 24 contiguous nucleotides (i.e., about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 contiguous nucleotides) of any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the SMO includes between about 10 to about 24 contiguous nucleotides of any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the SMO includes about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 contiguous nucleotides of any one of SEQ ID NOs: 3-857.

In certain inventive embodiments, the SMO is about 14 to about 26 nucleotides and includes between about 6 and 24 contiguous nucleotides (i.e., about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 contiguous nucleotides) of any one of SEQ ID NOs:860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the SMO includes between about 10 to 24 contiguous nucleotides of any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the SMO includes about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 contiguous nucleotides of any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140.

In certain inventive embodiments, the SMO includes a sequence that has at least 60% sequence identity with any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the sequence has at least 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 3-857.

In certain inventive embodiments, the SMO is a sequence that has at least 60% sequence identity with any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the sequence has at least 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity with any one of SEQ ID NOs: 3-857. In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 3-857.

In certain inventive embodiments, the SMO includes a sequence that has at least 60% sequence identity with any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the sequence has at least 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with any one of SEQ ID NOs:860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140.

In certain inventive embodiments, the SMO has a sequence that has at least 60% sequence identity with any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the sequence has at least 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity with any one of SEQ ID NOs:860-964, 967-1251, 1254-1858 and 1861-2140. In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 860-964, 967-1251, 1254-1858 and 1861-2140.

In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 860-964.

In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 967-1251.

In certain inventive embodiments, the sequence is selected from any one of SEQ ID NOs: 1254-1858. In certain inventive embodiments, the sequence is SEQ ID NO: 1324.

In certain inventive embodiments, the sequence is selected from any one of SEQ ID

NOs: 1861-2140.

Certain inventive embodiments of the invention provide a composition including an SMO described herein. In certain inventive embodiments, the composition is a pharmaceutical composition. In certain inventive embodiments, the pharmaceutical composition includes a pharmaceutically acceptable carrier.

The route of SMO administration is oral, rectal, intraventricular, intracranial, intratumoral, intrathecal, intracisternal, epidural, intravaginal, parenteral, intravenous, intramuscular, subcutaneous, local, intraperitoneal, transdermal, by inhalation or as a buccal or nasal spray. The exact amount of SMO required will vary from subject to subject, depending on the age, weight and general condition of the subject, the severity of the disease that is being treated, the mode of administration, and the like. An appropriate amount may be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.

Depending on the intended mode of administration or delivery, the SMO can be in pharmaceutical compositions in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, or suspensions, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions will include an effective amount of the selected SMO in combination with a pharmaceutically acceptable carrier and, in addition, may include other medicinal agents, pharmaceutical agents, carriers, or diluents. By “pharmaceutically acceptable” is meant a material that is not biologically, or otherwise undesirable, which can be administered to a subject along with the selected SMO without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.

Compositions suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols, suitable mixtures thereof, vegetable oils and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

These compositions may also contain adjuvants such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, for example sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is admixed with at least one inert customary excipient such as sodium citrate or dicalcium phosphate or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (e) solution retarders, as for example paraffin, (f) absorption accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants; as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents.

Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols, and the like.

Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others well known in the art. They may contain opacifying agents, and can also be of such composition that they release the SMO in a certain part of the intestinal tract in a delayed manner. Examples of embedding compositions which can be used are polymeric substances and waxes. The active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, as for example, ethyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3-butyleneglycol, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol, tetrahydrofiirfuryl alcohol, polyethyleneglycols and fatty acid esters of sorbitan or mixtures of these substances, and the like.

Besides such inert diluents, the compositions can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

Suspensions, in addition to the active compounds, may contain suspending agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances, and the like.

Compositions for rectal administrations are preferably suppositories which can be prepared by mixing the compounds of the present invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax, which are solid at ordinary temperatures but liquid at body temperature and therefore, melt in the rectum or vaginal cavity and release the active component.

Dosage forms for topical administration of a compound of this invention include ointments, powders, sprays, and inhalants. The active component is admixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants as may be required. Ophthalmic formulations, eye ointments, powders, and solutions are also contemplated as being within the scope of this invention.

Synthesis of SMOs

An oligonucleotide of the invention, i.e. the SMO, can be synthesized using any procedure known in the art, including chemical synthesis, enzymatic ligation, organic synthesis, and biological synthesis.

In one embodiment, an RNA molecule, e.g., an SMO, is prepared chemically. Methods of synthesizing RNA and DNA molecules are known in the art, in particular, the chemical synthesis methods as described in Verma and Eckstein (1998) Annul Rev. Biochem. 67:99-134. RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof.

Alternatively, the RNA may be used with no or a minimum of purification to avoid losses due to sample processing.

Modifications of SMOs

In certain inventive embodiments, the oligonucleotides of the present invention (i.e. SMOs) are modified to improve stability in serum or growth medium for cell cultures, or otherwise to enhance stability during delivery to subjects and/or cell cultures. In order to enhance the stability, the 3′-residues may be stabilized against degradation, e.g., they may be selected such that they include only purine nucleotides, particularly adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine by 2′-deoxythymidine, or cytosine by 5′-methylcytosine, can be tolerated without affecting the efficiency of oligonucleotide reagent-induced modulation of splice site selection. For example, the absence of a 2′ hydroxyl may significantly enhance the nuclease resistance of the oligonucleotides in tissue culture medium.

In an embodiment of the present invention, the oligonucleotides, e.g., SMOs, may contain at least one modified nucleotide analogue at any position within the sequence, including the entirety of the SMO sequence. The nucleotide analogues may be located at positions where the target-specific activity, e.g., the splice modulating activity is not substantially effected, e.g., in a region at the 5′-end and/or the 3′-end of the oligonucleotide molecule, or a combination of such sites to increase stability against enzymatic degradation while preserving functionality compared to a base SMO containing only nucleotides naturally occurring in the host. Particularly, the ends may be stabilized by incorporating modified nucleotide analogues.

Specific nucleotide analogues operative herein include sugar- and/or backbone-modified ribonucleotides (i.e., include modifications to the phosphate-sugar backbone). For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. In preferred backbone-modified ribonucleotides, the phosphodiester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g., of phosphorothioate group. In preferred sugar-modified ribonucleotides, the 2′ OH-group is replaced by a group of CH3, H, OR, R, halo, SH, SR, NH2, NHR, NR2 or ON, where R is C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl and halo is F, Cl, Br or I. In a preferred embodiment, the 2′ OH-group is replaced by O—CH3 also known as 2′O-methyl modification

Other specific nucleotide analogues include nucleobase-modified ribonucleotides, i.e., ribonucleotides, containing at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase. Exemplary modified nucleobases include, but are not limited to phosphorothioate derivatives and acridine substituted nucleotides, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluraci I5 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine, uridine and/or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and/or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl adenosine. It should be noted that the above modifications may be combined. Oligonucleotides of the invention also may be modified with chemical moieties (e.g., cholesterol) that improve the in vivo pharmacological properties of the oligonucleotides. Within the oligonucleotides (e.g., oligoribonucleotides) of the invention, as few as one and as many as all nucleotides of the oligonucleotide can be modified. For example, a 20-mer oligonucleotide (e.g., oligoribonucleotide) of the invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 modified nucleotides. In preferred embodiments, the modified oligonucleotides (e.g., oligoribonucleotides) of the invention will contain as few modified nucleotides as are necessary to achieve a desired level of in vivo stability and/or bio-accessibility while maintaining cost effectiveness. SMOs of the invention include oligonucleotides synthesized to include any combination of modified bases disclosed herein in order to optimize function. In one embodiment, an SMO of the invention includes at least two different modified bases. In another embodiment, an SMO of the invention may include alternating 2′ O-methyl substitutions and LNA bases or constrained ethyl nucleic acid (cEt) bases.

An oligonucleotide of the invention can be an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual a-units, the strands run parallel to each other (Gaultier et al., 1987, Nucleic Acids Res. 15:6625-6641). The oligonucleotide can also include a 2′-O-methylribonucleotide (Inoue et al., 1987, Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).

In various embodiments, the oligonucleotides of the invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acid molecules (see Hyrup et al., 1996, Bioorganic & Medicinal Chemistry 4(1): 5-23). As used herein, the terms “peptide nucleic acids” or “PNAs” refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996), supra; Perry-O'Keefe et al.

(1996) Proc. Natl. Acad. Sci. USA 93:14670-675. In another embodiment, PNAs can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras can be generated which can combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g., RNase H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup, 1996, supra). The synthesis of PNA-DNA chimeras can be performed as described in Hyrup (1996), supra, and Finn et al. (1996) Nucleic Acids Res. 24(17):3357-63. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs. Compounds such as 5′-(4-methoxytrityl)amino-5′-deoxy-thymidine phosphoramidite can be used as a link between the PNA and the 5′ end of DNA (Mag et al, 1989, Nucleic Acids Res. 17:5973-88). PNA monomers are then coupled in a step-wise manner to produce a chimeric molecule with a 5′ PNA segment and a 3′ DNA segment (Finn et al., 1996, Nucleic Acids Res. 24(17): 3357-63). Alternatively, chimeric molecules can be synthesized with a 5′ DNA segment and a 3′ PNA segment (Peterser et al., 1975, Bioorganic Med. Chem. Lett. 5: 1119-11124).

The oligonucleotides of the invention can also be formulated as morpholino oligonucleotides. In such embodiments, the riboside moiety of each subunit of an oligonucleotide of the oligonucleotide is converted to a morpholine moiety (morpholine C4H9NO; refer to Heasman, J. 2002 Developmental Biology 243, 209-214, the entire contents of which are incorporated herein by reference).

In certain inventive embodiments, an operative SMO has an oligonucleotide modification that includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (˜CH2˜)n group (such as an ethyl or methoxymethyl group) bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226, the entire contents of which arc incorporated by reference herein. In other embodiments, the oligonucleotide can include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. USA 84:648-652; PCT Publication No. WO 88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al., 1988, Bio/Techniques 6:958-976) or intercalating agents (see, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide can be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.

The invention also includes molecular beacon nucleic acid molecules having at least one region which is complementary to a nucleic acid molecule of the invention, such that the molecular beacon is useful for quantitating the presence of the nucleic acid molecule of the invention in a sample. A “molecular beacon” nucleic acid is a nucleic acid molecule including a pair of complementary regions and having a fluorophore and a fluorescent quencher associated therewith. The fluorophore and quencher are associated with different portions of the nucleic acid in such an orientation that when the complementary regions arc annealed with one another, fluorescence of the fluorophore is quenched by the quencher. When the complementary regions of the nucleic acid molecules are not annealed with one another, fluorescence of the fluorophore is quenched to a lesser degree. Molecular beacon nucleic acid molecules are described, for example, in U.S. Pat. No. 5,876,930.

In certain inventive embodiments, the SMO includes at least one nucleotide that contains a non-naturally occurring modification including at least one of a chemical composition of phosphorothioate 2′-O-methyl, phosphorothioate 2′-MOE, locked nucleic acid (LNA) peptide nucleic acid (PNA), phosphorodiamidate morpholino, or any combination thereof.

In certain inventive embodiments, the SMO includes at least one 2′-O-methyl nucleotide. In certain inventive embodiments, the SMO includes at least two 2′-O-methyl nucleotides. In certain inventive embodiments, the SMO includes at least three 2′-O-methyl nucleotides. In certain inventive embodiments, at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% of the SMO nucleotides are 2′-O-methyl modified.

In certain inventive embodiments, the SMO includes at least one nucleotide with a phosphorothioate linkage. In certain inventive embodiments, the SMO includes at least two nucleotides with phosphorothioate linkages. In certain inventive embodiments, the SMO includes at least three nucleotides with phosphorothioate linkages. In certain inventive embodiments, at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% of the SMO nucleotides include phosphorothioate linkages.

In certain inventive embodiments, the SMO includes at least one phosphorothioate 2′-O-methyl modified nucleotide. In certain inventive embodiments, the SMO includes at least two phosphorothioate 2′-O-methyl modified nucleotides. In certain inventive embodiments, the SMO includes at least three phosphorothioate 2′-O-methyl modified nucleotides. In certain inventive embodiments, at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% of the SMO nucleotides are phosphorothioate 2′-O-methyl modified.

In certain inventive embodiments, modifications include a bicyclic sugar moiety similar to the LNA has also been described (see U.S. Pat. No. 6,043,060) where the bridge is a single methylene group which connect the 3′-hydroxyl group to the 4′ carbon atom of the sugar ring thereby forming a 3′-C,4′-C-oxymethylene linkage. In certain inventive embodiments oligonucleotide modifications include cyclohexene nucleic acids (CeNA), in which the furanose ring of a DNA or RNA molecule is replaced with a cyclohexenyl ring to increase stability of the resulting complexes with RNA and DNA complements (Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602). In certain inventive embodiments other bicyclic and tricyclic nucleoside analogs are included in the SMO.

The target RNA (e.g., pre-mRNA, e.g., SCN8A pre-mRNA) splice-modifying interaction guided by oligonucleotides of the invention is highly sequence specific. In general, oligonucleotides containing nucleotide sequences perfectly complementary, having 100% complementarity to a portion of the target RNA are exposed to target RNA for blocking of sequence elements within the target RNA. However, it is appreciated that 100% sequence complementarity between the oligonucleotide and the target RNA is not required to practice the present invention. Thus, the invention may tolerate sequence variations that might be expected due to genetic mutation, wobble base pairing, strain polymorphism, or evolutionary divergence. In wobble base pairing non-Watson-Crick nucleotide pairing occurs in which U can pair with both A and G, so A can be substituted with G, and inosine (I) can pair with any base. For example, oligonucleotide sequences with insertions, deletions, and single point mutations relative to the target sequence may also be effective for SMO-mediated splice modulation. Alternatively, oligonucleotide sequences with nucleotide analog substitutions or insertions can be effective for splice modulation. Greater than 70% sequence identity (or complementarity), e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% sequence identity, and any and all whole or partial increments there between the oligonucleotide and the target RNA, e.g., target pre-mRNA, is preferred.

It is further understood in the art that incorporation of nucleotide affinity modifications may allow for a greater number of mismatches compared to an unmodified compound. Certain oligonucleotide (SMO) sequences may be more tolerant to mismatches than other oligonucleotide sequences. One of ordinary skill in the art is capable of determining an appropriate number of mismatches between oligonucleotides, between an SMO and a target nucleic acid, such as by determining melting temperature (Tm) and evaluating the effect of chemical modifications on the Tm and hybridization stringency. Tm can be calculated by techniques that are familiar to one of ordinary skill in the art.

Techniques and calculations as described in Freier et at (Nucleic Acids Research, 1997, 25, 22: 4429-4443) allow one of ordinary skill in the art to evaluate nucleotide modifications for their ability to increase the Tm of an RNA: RNA or an RNA: DNA duplex.

In certain inventive embodiments, “sequence identity” or “identity” in the context of two nucleic acid sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned by sequence comparison algorithms or by visual inspection. For example, sequence identity may be used to reference a specified percentage of residues that are the same across the entirety of the two sequences when aligned.

In certain inventive embodiments, the term “substantial identity” of polynucleotide sequences means that a polynucleotide includes a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%; at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%; at least 90%, 91%, 92%, 93%, or 94%; or even at least 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters.

Sequence identity, including determination of sequence complementarity or homology for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or of two amino acid sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology =number of identical positions/total number of positions×100), optionally penalizing the score for the number of gaps introduced and/or length of gaps introduced. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the alignment generated over a certain portion of the sequence aligned having sufficient identity but not over portions having low degree of identity (i.e., a local alignment). A preferred, non-limiting example of a local alignment algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.

In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the length of the aligned sequences (i.e., a gapped alignment). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the entire length of the sequences aligned (i.e., a global alignment). A preferred, non-limiting example of a mathematical algorithm utilized for the global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[NL: This is not the definition of sequence identity that we want to use because it is too narrow, but my understanding from our discussions is

that we should not remove it? As long as we describe sequence identity more broadly below, does that still cover us?] In another embodiment, the sequence identity for two sequences is based on the greatest number of consecutive identical, nucleotides between the two sequences (without inserting gaps). For example, the percent sequence identity between Sequence A and B below would be 87.5% (Sequence B is 14/16 identical to Sequence A), whereas the percent sequence identity between Sequence A and C would be 25% (Sequence C is 4/16 identical to Sequence A).

Example Sequence A: GCATGCATGCATGCAT Example Sequence B: GCATGCATGCATGC Example Sequence C: GCATTTGCAGCAGC

In yet another embodiment, nucleic acids, oligonucleotides, SMOs, or a portion thereof, may have a defined percent identity to a SEQ ID NO, or a another LifeSplice compound. As used herein, a sequence is identical to the SMO sequence disclosed herein if it has the same nucleobase pairing ability. This identity may be over the entire length of the nucleotide sequence, or in a portion of the nucleotide sequence e.g., nucleobases 1-20 of a 300-mer may be compared to a 20-mer to determine percent identity of the nucleic acid to the SEQ ID NO described herein. Percent identity is calculated according to the number of nucleotide bases that have identical base pairing corresponding to the SEQ ID NO or SMO compound to which it is being compared. The non-identical bases may be adjacent to each other, dispersed throughout the nucleotide sequence, or both. For example, a 18-mer having the same sequence as nucleobases 3-20 of a 24-mer SMO is 75% identical to the 24-mer SMO. Alternatively, a 24-mer containing six nucleobases not identical to another 24-mer is also 75% identical to the 24-mer. Similarly a 15-mer having the same sequence as nucleobases 1-15 of a 100-mer is 15% identical to the 100-mer. Such calculations are well within the ability of those skilled in the art.

It is further understood by those skilled in the art that a nucleic acid sequence need not have an identical sequence to those described herein to function similarly to the SMO compound described herein. Shortened versions of SMO compounds taught herein, or non-identical versions of the SMO compounds taught herein, are also provided. Non-identical versions can include at least one base replaced with a different base with different pairing activity (e.g., G can be replaced by C, A, or T), wobble base pairing, or sequences are those wherein each base does not have the same pairing activity (e.g. by the nucleic acid sequence being shorter or having at least one abasic site) as the SMOs disclosed herein.

Alternatively, the oligonucleotide may be defined functionally as a nucleotide sequence (or oligonucleotide sequence) a portion of which is capable of hybridizing with the target RNA (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing). Additional preferred hybridization conditions include hybridization at 70° C. in IX SSC or 50° C. in IX SSC, 50% formamide followed by washing at 70° C. in 0.3×SSC or hybridization at 70° C. in 4×SSC or 50° C. in 4X SSC, 50% formamide followed by washing at 67° C. in IX SSC. The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10° C. less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 1 8 base pairs in length, Tm(° C).=2(number of A+T bases)+4(number of G+ C bases). For hybrids between 18 and 49 base pairs in length, Tm(° C)=81.5+16.6(log 10[Na+])+0.41(% G+C)−(600/N), where N is the number of bases in the hybrid, and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] for IX SSC=0.165 M). Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, et al., 2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., chapters 9 and 1 1, and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference. The length of the identical nucleotide sequences may be at least about 10, 12, 15, 17, 20, 22, 25, 27, 30, 32, 35, 37, 40, 42, 45, 47 or 50 bases.

Methods of Use

Methods of Modulating SCN8A pre-mRNA Splicing

The present invention provides compositions and methods for modulating SCN8A pre-mRNA splicing using an SMO of the invention (e.g., to abrogate disease-causing mutations in a protein, such as SCN1A). For example, an SMO may modulate pre-mRNA splicing by removing an exon (e.g., exon 5A or exon 18A) or including an exon (e.g., exon 5N or exon 18N) in order to alter protein isoform expression (e.g., to enhance expression of isoforms with reduced excitatory function). For example, an SMO as described herein may modulate SCN8A pre-mRNA by excluding exon 5A in the resulting SCN8A mRNA. These

SMOs may be used to modify SCN8A channel properties, i.e., to reduce sodium currents. In other embodiments, an SMO described herein may modulate SCN8A pre-mRNA by excluding exon 18A in the resulting SCN8A mRNA. These SMOs may be used to generate a truncated SCN8A protein that is non-functional as a sodium channel, or that is not even translated into a SCN8 protein.

Accordingly, certain inventive embodiments of the invention provide a method of modulating splicing of an SCN8A pre-mRNA, either in vitro or in vivo including contacting a cell with an effective amount of an SMO or composition described herein. In certain inventive embodiments, the SMO specifically binds to a SCN8A pre-mRNA sequence (e.g., at an intron/exon splice site, ESE and/or ISE), thereby excluding exon 5A or exon 18A from a resulting SCN8A mRNA.

Certain inventive embodiments of the invention provide a method of modulating splicing of an SCN8A pre-mRNA including contacting a cell with an effective amount of an SMO that specifically binds to a complementary sequence on the pre-mRNA at a intron-exon splice site, ESE and/or ISE, wherein when the SMO specifically binds to the complementary sequence, exon-18A or exon-5A is excluded from the resulting mRNA, and wherein the resulting mRNA encodes an SCN8A protein.

Certain inventive embodiments of the invention provide a method of modulating splicing of an SCN8A pre-mRNA including contacting a cell with an effective amount of an SMO that specifically binds to a complementary sequence on the pre-mRNA at a intron-exon splice site, ESE and/or ISE, wherein when the SMO specifically binds to the complementary sequence, exon-18N or exon-5N is included in the resulting mRNA, and wherein the resulting mRNA encodes an SCN8A protein.

Certain inventive embodiments of the invention provide a method of reducing neuronal excitability including contacting a cell with an effective amount of an SMO or composition described herein.

Methods of Treating Diseases and Disorders

The relationship between SCN8A pre-mRNA splicing and the Dravet spectrum epilepsies is described above; however, SCN8A dysregulation or dysfunction is also associated with other diseases and disorders as described below.

Hyperexcitability Including other Epilepsies. SCN8A loss-of function mutation or knockout results in increased seizure threshold to chemoconvulsant induced seizures (Martin et. al., 2007), thus the SMOs that modulate SCN8A isoform expression (e.g., decrease E5A or E18A; FIGS. 3A-K. and 4A-D) are viable therapeutics for other types of refractory pediatric and adult epilepsies; some that have dysfunctional SCN1A and others that do not. More broadly, these SMOs have the potential be treat various diseases or disorders in which CNS hyperexcitability and/or excitotoxicity have been implicated as having a significant contribution to disease pathology through dysfunction of SCN1A or SCN8A. Additionally, there are hundreds of SCN1A and SCN8A mutations attributed to a variety of epilepsy syndromes aside from the Dravet spectrum epilepsies (Oliva et. al., 2012).

Further it has recently been demonstrated that selective reduction of, SCN8A expression in the hippocampus is responsible for the anti-seizure effect of SCN8A reduction (Makinson et. al., 2014) and is a strategy that could be accomplished in humans with intractable epilepsies. While complete SCN8A KO causes a severe phenotype in mice including motor system degeneration and early lethality (Martin et. al., 2007; Meisler et. al., 2004), loss of function mutations have been found in humans with only mild impact on cognition (Trudeau et. al., 2006).

Additionally, pathogenic SCN8A gain-of-function mutations have been found in patients with epileptic encephalopathy (Estacion et. al., 2014; Ohba et. al., 2014; Vaher et. al., 2013; Veeramah et. al., 2012). Epileptic encephalopathy is characterized by onset of variable types of seizures in infancy including generalized tonic-clonic, atypical absence, partial, apneic attack, febrile convulsion, and loss of tone and consciousness, which are refractory to typical anti-seizure drugs (Ohba et. al., 2014) and (SUDEP) sudden unexplained death of epilepsy (Oliva et. al., 2012; Veeramah et. al., 2012). Patients may also exhibit developmental delay or regression in infancy, resulting in severe intellectual disability, cerebellar and cerebral atrophy (Ohba et. al., 2014) and movement disorders (Vaher et. al., 2013). Thus, the use of SMOs to reduce expression of either the SCN8A 18A or 5A isoforms could mitigate the disease causing effects of SCN8A gain-of-function mutations. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection as infrequently as every 1-6 months or by continuous infusion via pump (ie Omaya Reservoir) directly into the hippocampus. Dosing for peripheral indications (ie SUDEP from cardiac arrythmia) can be achieved through subcutaneous or intravenous injections as infrequently as every 1-6 months, or a multiple loading dose strategy could also be used.

Spinal Cord Injury. Blockade of continuous post-traumatic SCN channel activation in general prevents the neuronal acidosis, swelling, and Ca2+ excitotoxicity that contributes to spinal cord injury (Wilson and Fehlings 2014). Thus, SMOs in the present invention that mediate splice modulation of SCN8A channel alpha subunits to reduce functional channel expression (E18A) or modulate channel properties (ESA) are strong therapeutic candidates. SMO dosing for spinal cord injury can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months, or as otherwise necessary.

Cancer. Voltage-gated sodium channels are also expressed in non-excitable cells such as macrophages and neoplastic cells. A functional splice variant containing E18A of SCN8A, is required for podosome and invadopodia formation in macrophages. SCN8A is as the alpha subunit of NaV1.6. Absence of functional NaV1.6 through a naturally occurring mutation (med) in mouse peritoneal macrophages inhibited podosome formation (Carrithers et. al., 2009). Invasion of the extracellular matrix by differentiated THP-1 cells, an invasive melanoma cell line, also was inhibited by knockdown of SCN8A, thus SCN8A and by extension, NaV1.6,participates in the control of podosome and invadopodia formation (Carrithers et. al., 2009). Similarly, reduction in SCN8A 18A isoform expression via an SMO-mediated splice modulation should help prevent metastatic ability of even non-neuronal cancer cells. Depending on the location of said cancer, SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months, continuous ICV infusion via pump (ie Omaya Reservoir), or bolus delivery (ie Omaya Reservoir) directly into the tumor vasculature. Dosing for peripheral indications can be achieved through monthly subcutaneous injections.

Amyotrophic Lateral Sclerosis (ALS). Riluzole, the only drug approved to treat ALS (albeit with very modest efficacy), is thought to work in part by antagonizing SCN channel alpha subunits, particularly SCN8A (Nutini et. al., 2011; Sierra et. al., 2012). Thus, the specific modulation of SCN8A properties conferred by the SMOs in the instant invention is expected to provide neuroprotection to a-motor neurons that are selectively lost is this fatal neurodegenerative disease. Importantly, the SMOs recited herein that reduce SCN8A 5A and 18A isoforms also are expected to provide a potent anti-inflammatory response in the CNS (see Section 10 below), and therefore are expected to provide therapeutic benefit to ALS patients via a dual mechanism. SMO dosing for ALS can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months, or as otherwise necessary for efficacy and patient compliance.

Alzheimer's disease (AD). Reduced SCN1A (the alpha subunit of Nav1.1) expression in inhibitory interneurons and parvalbumin cells are found both in mouse models of AD and AD patients (Verret et. al., 2012). Similarly, restoring normal levels of SCN1A in the brain of AD mice reduced epileptiform discharges, memory deficits, and increased survival. Thus, among the serious maladies in AD, neuronal network excitatory imbalance produces debilitating brain pathology. An innovative SMO-based therapeutic approach to rebalance the net inhibitory plus excitatory synaptic drive from reduced SCN1A expression in AD, is to reduce the counterbalancing SCN8A synaptic drive using optimal SMOs that reduce either SCN8A E18A (FIGS. 4A-D) or the SCN8A E5A (FIG. 3A-K) isoform expression, reducing overall synaptic input from the SCN8A-containing VGS channels. There is strong literature-based rationale from Dravet syndrome mouse models that reduced inhibitory drive as a result of diminished SCN1A-containing VGS channels may be mitigated by concurrently reducing SCN8A excitatory drive with minimal adverse effects. In the case of the present invention, this strategy may feasibly be accomplished via reducing SCN8A E5A- or E18A-containing isoforms of SCN8A. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

Traumatic Brain injury (TBI). Depolarization of voltage-gated sodium (VGS) channels and the resultant increased neuronal Na+ influx are critical early events in the initiation of deleterious cellular changes after TBI (Mao et. al., 2010). In particular NaV1.6 (SCN8A) expression is upregulated within hours of percussive TBI insult (Mao et. al., 2010). Thus, a rational and innovative strategy to prevent subsequent cellular damage in the acute post-injury period is to reduce the excessive Na+ influx through SCN8A-containing VGS channels by SMO-mediated skipping of exon 5A (FIG. 3A-K) or 18A (FIG. 4A-D). SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

Autism. Autism has been linked to de novo SCN1A mutations (O'Roak et. al., 2011; O'Roak et. al., 2012). Not surprisingly, patients with Dravet spectrum epilepsies may also exhibit austistic behaviors due to SCN1A mutations (Han et. al., 2012), thus rebalancing the excitatory and inhibitory inputs in the brain can be accomplished through reducing SCN8A E18A or ESA expression which could provide therapeutic benefit to autistic patients. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

Hemiplegic migraine. Familial Hemiplegic Migraine (FHM) has been linked in some families to missense mutations in the SCN1A gene, leading to alterations in SCN1A-containing VGS channel function (Gargus and Toumay 2007; Silberstein and Dodick 2013), which may be corrected by reducing Na+ currents through the counterbalancing SCN8A-containing VGS channels. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

Multiple Sclerosis. SCN8A-containing VGS channels in demyelinated axons (a hallmark of multiple sclerosis; MS) activates a Na+-Ca2+ exchanger that imports Ca2+ into the axon, leading to axonal injury and eventually axonal degeneration (Waxman 2006). SCN8A is upregulated in microglia of MS patients and in animal models of MS (Black and Waxman 2012). Thus, reducing SCN8A function with SMOs (see, e.g., FIG. 3A-K. and 4A-D), would both reduce microglial activation and axonal injury/degeneration; providing therapeutic benefit to MS patients via two distinct mechanisms. SMO dosing for CNS manifestations can be accomplished by direct bolus intrathecal injection at a frequency of every 1-6 months or continuous infusion via pump (ie Omaya Reservoir) directly into the lateral ventricles, or as otherwise necessary for efficacy and patient compliance.

Peripheral neuropathic pain (including post-herpetic neuralgia and diabetic neuropathy): There is indirect evidence of increased persistent Na+ currents at nodes of Ranvier due to changes in expression of Nav1.6 in diabetic neuropathy (Morris et. al., 2012).

Development of neuropathic pain depends on axonal hyperexcitability due to increased nodal Na+ currents, which is potentiated by lack of glycemic control, and this cascade is suggested to be responsible for neuropathic pain/paresthesia in diabetic neuropathy (Misawa et. al., 2009). Post-herpetic neuralgia (PHN) results from reactivation of the dormant varicella zoster (chickenpox) virus in the dorsal root ganglion (DRG) years after initial infection, and is often unresponsive to current to analgesics and current anti-virals (Garry et. al., 2005). Varicella zoster virus infection is associated with a significant increase in Nav 1.6 mRNA, which significantly increased Na+ current amplitude (Kennedy et. al., 2013). Therefore, reduction of sodium current through Nav 1.6 channels and corresponding SCN8A subunit via SMO-mediated splice direction specifically to reduce expression of 18A and 5A containing isoforms could be therapeutic for peripheral neuropathic pain. Dosing for peripheral indications can be achieved through monthly subcutaneous injections. SMO dosing may also be accomplished by direct bolus intrathecal injection or epidural injection at the affected spinal level at a frequency of every 1-6 months, or as otherwise necessary for efficacy and patient compliance.

Carpal tunnel: In carpal tunnel syndrome, persistent Na+ current becomes altered across the carpal tunnel region leading to injury, inflammation, and ectopic impulse generation (Kuwabara et. al., 2006). Nav1.6 (and SCN8A) is highly expressed in the peripheral nodes of Ranvier (Morris et. al., 2012). Sodium channel blockers such as Mexiletine, have been sown to be useful, thus SMO treatment to alter splicing of SCN8A, specifically to reduce expression of 18A or 5A containing isoforms individually or in combination may produce long term relief of symptoms or prevent need for surgery. Dosing for peripheral indications can be achieved through monthly local subcutaneous, intramuscular, or intracapsular injections. SMO dosing may also be accomplished by epidural injection at the affected spinal level at a frequency of every 1-6 months, or as otherwise necessary for efficacy and patient compliance.

Cardiovascular disease or disorder (e.g., hypertension, congestive heart failure, ischemia/reperfusion, arrhythmias): Arrhythmia and Ischemia and reperfusion injury: It is thought that ventricular and atrial expression of Nav1.6, in part, allows for a slow persistent Na+ current based Nav channel leak leading to arrhythmia or contributing to ischemia and reperfusion injury (Morris et. al., 2012). However, current sodium channel blocking strategies to ameliorate cardiac ischemic and reperfusion damage, including block of the Na+/H+ exchanger, have so far been therapeutically ineffective (Weiss et. al., 2010) necessitating novel therapeutic approaches. Riluzole, through preferential block of persistent Na+ current, was shown to provide dose-dependent protection against cardiac ischemia and reperfusion injury in animal models, suggesting block of the SCN8A/Nav 1.6 mediate persistent sodium current would be a viable method of ameliorating cardiac ischemic/reperfusion damage (Weiss et. al., 2010). Through inhibition of Na+ current in the ventricles even in patients with structurally compromised hearts, Ranolazine, an FDA-approved anti-anginal agent, can suppress arrhythmias associated with acute coronary syndrome, long QT syndrome heart failure, ischemia/reperfusion in the ventricles and also suppress atrial tachyarrhythmias and atrial fibrillation (Antzclevitch et. al., 2011).Thus, reducing persistent or late Na+ current specifically in cardiomyocytes through splice-modulation of SCN8A E18A/N or ESA/N, could allow for greater Na+ channel modulation and provide long-term antiarrhythmic therapy for intractable cases, and acutely prevent ischemia-reperfusion injury after heart attack. SMO dosing for cardiac indications can be achieved through monthly subcutaneous injections, or as otherwise necessary for efficacy and patient compliance.

Other diseases with a neuroinflammatory component. SCN8A expression is upregulated in activated microglia, and blocking SCN8A activity with nonselective Na+ channel blockers prevents microglia activation (Black and Waxman 2012). Thus, many neurological diseases/disorders with a neuroinflammatory component, including but not limited to CNS infections, stroke, ALS, Alzheimer's disease, Parkinson's disease, Huntington's disease (Fernandes et. al., 2014), and aging and age-related disorders (Norden and Godbout 2013) may be treatable using the highly selective SCN8A SMOs (FIGS. 3A-K. and 4A-D) of the present invention.

Accordingly, the present invention also provides compositions and methods of treating a subject at risk of, susceptible to, or having a disease, disorder, or condition associated with SCN8A pre-mRNA expression or SCN8A protein expression or function. In one embodiment, a SCN8A pre-mRNA may be an alternatively spliced, aberrantly spliced, overexpressed or unwanted pre-mRNA (e.g., a SCN8A pre-mRNA including exon 5A or exon 18A) that encodes a protein that results in, causes, produces, or pre-disposes a subject to a disease or disorder. In another embodiment, splicing of a SCN8A pre-mRNA is not a cause of a disease or disorder, but modulation of the splicing of the SCN8A pre-mRNA reduces at least one symptom of the disease or disorder.

In another embodiment, the invention provides a method of preventing in a subject, a disease, disorder, or condition associated with SCN8A pre-mRNA splicing, the method including administering to the subject an SMO or composition described, or vector, or transgene encoding same.

Accordingly, certain inventive embodiments of the invention provide a method of treating or preventing a disease, disorder or condition in subject (e.g., a mammal, e.g., a human), including administering an SMO or composition described herein to the subject.

In certain inventive embodiments, the disease, disorder or condition is a neurological disease, disorder or condition. For example, in certain inventive embodiments, the neurological disease, disorder or condition is epilepsy (e.g., a Dravet spectrum epilepsy), a disease or disorder associated with CNS hyperexcitability and/or excitotoxicity, a spinal cord injury, amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), traumatic brain injury (TBI), autism, hemiplegic migraine, multiple sclerosis or a neuroinflammatory associated disease or disorder. In certain inventive embodiments, the neuroinflammatory associated disease or disorder is a CNS infection, stroke, ALS, AD, Parkinson's disease, Huntington's disease, aging or aging related disorders.

In certain inventive embodiments, the disease, disorder or condition is pain mediated by SCN8A regulation. For example, in certain inventive embodiments the pain mediated disease, disorder or condition is peripheral neuropathic pain or carpal tunnel syndrome.

In certain inventive embodiments, the disease, disorder or condition is cardiovascular mediated by SCN8A regulation. For example, in certain inventive embodiments the cardiovascular mediated disease, disorder or condition is hypertension, congestive heart failure, ischemia/reperfusion, or arrhythmia.

In certain inventive embodiments, the disease, disorder or condition is cancer mediated by SCN8A regulation. In certain inventive embodiments, the cancer is brain cancer mediated by SCN8A regulation.

Certain inventive embodiments of the invention provide a method of treating or preventing epilepsy or a Dravet Spectrum disorder in subject (e.g., a mammal, e.g., a human), including administering an SMO or composition described herein to the subject.

In certain inventive embodiments, the Dravet Spectrum disorder is caused by a SCN1A mutation. In certain inventive embodiments, the Dravet Spectrum disorder is febrile seizures, generalized epilepsy with febrile seizure plus (GEFS+) or Dravet syndrome (severe myoclonic epilepsy of infancy or SMEI).

In certain inventive embodiments, the administration reduces SCN8A excitatory function.

In certain inventive embodiments, the SMO specifically binds to a SCN8A pre-mRNA sequence, wherein when the SMO specifically binds to the SCN8A pre-mRNA sequence, exon 5A is excluded in the resulting SCN8A mRNA, and wherein the resulting mRNA encodes a SCN8A protein.

In certain inventive embodiments, the SMO specifically binds to a SCN8A pre-mRNA sequence, wherein when the SMO specifically binds to the SCN8A pre-mRNA sequence, exon 18A is excluded in the resulting SCN8A mRNA, and wherein the resulting mRNA encodes a SCN8A protein.

In certain inventive embodiments, the SCN8A protein has reduced excitatory function.

Certain inventive embodiments of the invention provide an SMO as described herein for the prophylactic or therapeutic treatment of a disease or disorder in a subject mediated by SCN8A regulation.

Certain inventive embodiments of the invention provide the use of an SMO as described herein to prepare a medicament for treating a disease or disorder in a subject mediated by SCN8A regulation.

Certain inventive embodiments of the invention provide an SMO as described herein for use in medical therapy.

Certain inventive embodiments of the invention provide an SMO as described herein for use in treating a disease or disorder mediated by SCN8A regulation.

Methods of Administration

Examples of methods for introducing oligonucleotides into cells encompass in vivo and ex vivo methods. The oligonucleotides of the invention, i.e. SMOs, are typically administered to a subject or generated in situ such that they hybridize with or bind to SCN8A pre-mRNA. In one embodiment, the SMO enhances exclusion of exon 5A or enhances inclusion of exon 5N during splicing of a SCN8A pre-mRNA. In still other embodiments, the SMO enhances exclusion of exon 5N or enhances inclusion of exon 5A during splicing of a SCN8A pre-mRNA. .In another embodiment, the SMO enhances exclusion of exon 18A or enhances inclusion of exon 18A during splicing of a SCN8A pre-mRNA. In still other embodiments, the SMO enhances exclusion of exon 18N or enhances inclusion of exon18A during splicing of a SCN8A pre-mRNA.

The hybridization can be by conventional Watson-Crick base pairing by nucleotide complementarity and/or wobble pairing of U-G nucleic acids to form a stable duplex. Wobble base pairing can also be accomplished with Inosine (I-A, I-U, I-C, I-G), where I is inosine. Hybridization can also occur, for example, in the case of an oligonucleotide which binds to DNA duplexes, through specific interactions in the major groove of the double helix.

Conjugation of an SMO to anthraquinones, acridines, biotin carbohydrates, chitosans, cholesterol, phospholipids, dendrimers, or other lipid and liposomal moieties, colloidal polymeric particles, coumarins, dyes (such as fluoresceins and rhodamines), folate, peptides, phenanthridine, and phenazines, as well as other means known in the art may be used to deliver the oligonucleotides to a cell. The method of delivery selected will depend at least on the cells to be treated and the location of the cells and will be known to those skilled in the art. Localization can be achieved by liposomes, having specific markers on the surface for directing the liposome, by having injection directly into the tissue containing the target cells, by having depot associated in spatial proximity with the target cells, specific receptor mediated uptake, or the like.

As described elsewhere herein and in the art, oligonucleotides may be delivered using, e.g., methods involving liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle-mediated uptake, and receptor-mediated endocytosis, as well as additional non-endocytic modes of delivery, such as microinjection, permeabilization (e.g., streptolysin-O permeabilization, anionic peptide permeabilization), electroporation, and various non-invasive non-endocytic methods of delivery that are known in the art (refer to Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44, 35-49, incorporated in its entirety herein by reference). Methods of delivery may also include the following.

Cationic Lipids: Naked nucleic acids (e.g., DNA/RNA) can be introduced into cells in vivo by complexing the nucleic acid with cationic lipids or encapsulating the nucleic acid in cationic liposomes. Examples of suitable cationic lipid formulations include N-[-1-(2,3-dioleoyloxy)propyl]N,N,N-triethylarnmonium chloride (DOTMA) and a 1:1 molar ratio of 1,2-dimyristyloxy-propyl-3-dimethylhydroxyethylammonium bromide (DMRIE) and dioleoyl phosphatidylethanolamine (DOPE) (see e.g., Logan, J. J. et al. (1995) Gene Therapy 2:38-49; San, H. et al. (1993) Human Gene Therapy 4:781-788).

Receptor-Mediated DNA Uptake: Naked nucleic acids can also be introduced into cells in vivo by complexing the nucleic acid to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor (see for example Wu, G. and Wu, C. H. (1988) J. Biol. Chem. 263:14621; Wilson et al. (1992) J. Biol. Chem. 267:963-967; and U.S. Pat. No. 5,166,320). Binding of the nucleic acid-ligand complex to the receptor facilitates uptake of the nucleic acid by receptor-mediated endocytosis. A nucleic acid-ligand complex linked to adenovirus capsids which naturally disrupt endosomes, thereby releasing material into the cytoplasm can be used to avoid degradation of the complex by intracellular lysosomes (see for example Curiel et al. (1991) Proc. Natl. Acad. Sci. USA 88:8850; Cristiano et al. (1993) Proc. Natl. Acad. Sci. USA 90:2122-2126). Carrier mediated SMO delivery may also involve the use of lipid-based compounds which are not liposomes. For example, lipofectins and cytofectins are lipid-based positive ions that bind to negatively charged nucleic acids and form a complex that can ferry the nucleic acid across a cell membrane. Another method of carrier mediated transfer involves receptor-based endocytosis. In this method, a ligand (specific to a cell surface receptor) is made to form a complex with a nucleic acid or SMO of interest and then delivered to the bodyTarget cells that have the cell surface receptor will specifically bind the ligand and transport the ligand-DNA complex into the cell.

Oligonucleotides may be directly introduced into the cell (i.e., intracellularly); or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, or may be introduced by bathing a cell or organism in a solution containing the RNA using methods known in the art for introducing nucleic acid (e.g., DNA) into cells in vivo. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are sites where the RNA may be introduced.

The oligonucleotides of the invention can be delivered to a subject by any art-recognized method. For example, peripheral blood injection of the oligonucleotides of the invention can be used to deliver the reagents via diffusive and/or active means. Alternatively, the oligonucleotides of the invention can be modified to promote crossing of the blood-brain-barrier (BBB) to achieve delivery of said reagents to neuronal cells of the central nervous system (CNS). Specific recent advancements in oligonucleotide technology and delivery strategies have broadened the scope of oligonucleotide usage for neuronal disorders (Forte, A., et al. 2005. Curr. Drug Targets 6:21-29; Jaeger, L. B., and W. A. Banks. 2005. Methods Mol. Med. 106:237-251 ; Vinogradov, S. V., et al. 2004. Bioconjug. Chem. 5:50-60; the preceding are incorporated herein in their entirety by reference).

In certain inventive embodiments, the oligonucleotides of the invention can be delivered by transdermal methods (e.g., via incorporation of the oligonucleotide reagent(s) of the invention into, e.g., emulsions, with such oligonucleotides optionally packaged into liposomes). Such transdermal and emulsion/liposome-mediated methods of delivery are described for delivery of antisense oligonucleotides in the art, e.g., in U.S. Pat. No. 6,965,025, the contents of which are incorporated in their entirety by reference herein.

The oligonucleotides of the invention may also be delivered via an implantable device (e.g., an infusion pump or other such implantable device). Design of such a device is an art-recognized process.

In another embodiment the SMO is delivered parenterally, for example by intravenous or subcutaneous injections.

In one embodiment, an SMO is delivered directly into the cerebral spinal fluid (CSF) of a subject. Delivery of an SMO into the CSF of a subject may be accomplished by any means known in the art, including, but not limited to, epidural injection or intrathecal injection or intrathecal injection using an infusion pump, or direct brain delivery with a pump or other device.

In one embodiment, SMOs are conjugated to a peptide to facilitate delivery of the SMO across the blood brain barrier (BBB) following parenteral administration to a subject.

The SMO may be either directly conjugated to the peptide or indirectly conjugated to the peptide via a linker molecule such as a poly amino acid linker, or by electrostatic interaction. Peptides useful in delivering SMOs across the BBB include, but are not limited to, peptides derived from the rabies virus glycoprotein (RVG) that specifically bind to the nicotinic acetylcholine receptor (AchR) present on neurons and the vascular endothelium of the BBB thereby allowing transvascular delivery, probably by receptor-mediated transcytosis (Kumar et al., 2007, Nature 448:39-43, encompassed by reference in its entirety); Kunitz domain-derived peptides called angiopeps (Demeule et al., 2008, J. Neurochem. 106: 1534-1544; Demeule et al., 2008, J. Pharmacol. Exp. Ther. 324: 1064-1072). Recombinant methods known in the art can also be used to achieve oligonucleotide reagent-induced modulation of splicing in a target nucleic acid. For example, vectors containing oligonucleotides can be employed to express, e.g., an antisense oligonucleotide to modulate splicing of an exon of a targeted pre-mRNA.

For oligonucleotide reagent-mediated modulation of an RNA in a cell line or whole organism, gene expression may be assayed by use of a reporter or drug resistance gene whose protein product is easily assayed. Such reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin. Depending on the assay, quantitation of the amount of gene expression allows one to determine a degree of modulation which is greater than 10%, 33%, 50%, 90%, 95% or 99% as compared to a cell not treated according to the present invention. Lower doses of injected material and longer times after administration of oligonucleotides may result in modulation in a smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of targeted cells). Quantitation of gene expression in a cell may show similar amounts of modulation at the level of accumulation of target mRNA or translation of target protein. As an example, the efficiency of modulation may be determined by assessing the amount of gene product in the cell; pre-mRNA or mRNA may be detected with a hybridization probe having a nucleotide sequence outside the region used for the oligonucleotide reagent, or translated polypeptide may be detected with an antibody raised against the polypeptide sequence of that region.

Pharmaceutical Compositions and Therapies

An SMO of the invention may be administered to a subject in a pharmaceutical composition. As used herein the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. Pharmaceutical compositions can be prepared as described below. Depending on the particular target SCN8A RNA sequence and the dose of oligonucleotide material delivered, this process may modulate SCN8A splicing and the expression or function of resulting SCN8A protein. In one embodiment of the instant invention, exon 5N-containing SCN8A protein production is enhanced in a treated cell, cell extract, organism or patient, with an enhancement of exon 5N-containing SCN8A protein levels of at least about 1.1-, 1.2-, 1.5-, 2-, 3-, 4-, 5-, 7-, 10-, 20-, 100-fold and higher values being exemplary. In another embodiment of the invention, exon 18N-containing SCN8A protein production is enhanced in a treated cell, cell extract, organism or patient, with an enhancement of exon 18N-containing SCN8A protein levels of at least about 1.1-, 1.2-, 1.5-, 2-, 3-, 4-, 5-, 7-, 10-, 20-, 100-fold and higher values being exemplary. Enhancement of gene expression refers to the presence (or observable increase) in the level of protein and/or mRNA product from a target RNA. Specificity refers to the ability to act on the target RNA without manifest effects on other genes of the cell. The consequences of modulation of the target RNA can be confirmed by examination of the outward properties of the cell or organism (see, e.g., Example 1) or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (FACS).

The oligonucleotide, i.e. the SMO, may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of material may yield more effective modulation; lower doses may also be useful for specific applications.

Although the description of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as non-human primates, cattle, pigs, horses, sheep, cats, and dogs.

Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for ophthalmic, oral, parenteral, intranasal, buccal, or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.

A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition including a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may include between 0.1% and 100% (w/w) active ingredient.

In addition to the active ingredient, a pharmaceutical composition of the invention may further include one or more additional pharmaceutically active agents.

Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology. As used herein, “parenteral administration” of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, intratumoral, and kidney dialytic infusion techniques. Formulations of a pharmaceutical composition suitable for parenteral administration include the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further include one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.

The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may include, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides.

Other parentally-administrable formulations which are useful include those which include the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems. Compositions for sustained release or implantation may include pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.

Formulations suitable for nasal administration may, for example, include from about as little as 0.1% (w/w) and as much as 100% (w/w) of the active ingredient, and may further include one or more of the additional ingredients described herein. A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, 0.1 to 20% (w/w) active ingredient, the balance including an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein. Alternately, formulations suitable for buccal administration may include a powder or an aerosolized or atomized solution or suspension including the active ingredient. Such powdered, aerosolized, or aerosolized formulations, when dispersed, preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further include one or more of the additional ingredients described herein. As used herein, “additional ingredients” include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents;

lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. Other “additional ingredients” which may be included in the pharmaceutical compositions of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co., Easton, Pa.), which is incorporated herein by reference.

The therapeutic and prophylactic methods of the invention thus encompass the use of pharmaceutical compositions including a splice modifying oligonucleotide of the invention to practice the methods of the invention. The precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of animal and type of disease state being treated, the age of the animal and the route of administration.

The compound may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, etc. The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.

Kits

Kits for practicing the methods of the invention are further provided. By “kit” is intended any manufacture (e.g., a package or a container) including at least one reagent, e.g., at least one SMO for specifically enhancing inclusion of exon 5N in SCN8A protein (i.e., for enhancing the exclusion of exon 5A), for the treatment of a disease, disorder or condition, e.g., a Dravet Spectrum Epilepsy. In one embodiment of the invention, the kit includes at least one SMO for specifically enhancing the inclusion of exon 18N in SCN8A protein (i.e., for enhancing the exclusion of exon 18A), for the treatment of a disease, disorder or condition, e.g., a Dravet Spectrum Epilepsy. The kit may be promoted, distributed, or sold as a unit for performing the methods of the present invention. Additionally, the kits may contain a package insert describing the kit and including instructional material for its use.

Positive, negative, and/or comparator controls may be included in the kits to validate the activity and correct usage of reagents employed in accordance with the invention. Controls may include samples, such as tissue sections, cells fixed on glass slides, etc., known to be either positive or negative for the presence of the biomarker of interest. The design and use of controls is standard and well within the routine capabilities of those of ordinary skill in the art.

General Terminology

Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization are well known and commonly employed in the art.

Standard techniques are used for nucleic acid and peptide synthesis. The techniques and procedures are generally performed according to conventional methods in the art and various general references (e.g., Sambrook and Russell, 2001 , Molecular Cloning, A Laboratory Approach, Cold Spring Harbor Press, Cold Spring Harbor, NY, and Ausubel et al., 2002, Current Protocols in Molecular Biology, John Wiley & Sons, NY), which are provided throughout this document.

The nomenclature used herein and the laboratory procedures used in analytical chemistry and organic syntheses described below are well known and commonly employed in the art. Standard techniques or modifications thereof, are used for chemical syntheses and chemical analyses.

As used herein, each of the following terms has the meaning associated with it in this section.

The articles “a” and “an” are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

The term “about” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which it is used.

“Antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a change in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

“Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, SMOs, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds. Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy/steric block based mechanisms, including, without limitation uniform modified oligonucleotides. Certain antisense compounds may act through more than one such mechanism and/or through additional mechanisms.

“Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.

A “disease” is a state of health of subject wherein the subject cannot maintain homeostasis, and wherein if the disease is not ameliorated then the subject's health continues to deteriorate. In contrast, a “disorder” in an subject is a state of health in which the subject is able to maintain homeostasis, but in which the subject's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the subject's state of health. In preferred embodiments, the subject is an animal. In more preferred embodiments, the subject is a mammal. In most preferred embodiments, the subject is a human.

A disease or disorder is “alleviated” if the severity of a symptom of the disease or disorder, or the frequency with which such a symptom is experienced by a subject, or both, is reduced.

The terms “effective amount” and “pharmaceutically effective amount” refer to a nontoxic but sufficient amount of an agent to provide the desired biological result. That result can be reduction and/or alleviation of the signs, symptoms, or causes of a disease or disorder, or any other desired alteration of a biological system. An appropriate effective amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.

As used herein “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.

As used herein, the term “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.

The term “expression” as used herein is defined as the transcription and/or translation of a particular nucleotide sequence. The term “exonic regulatory elements” as used herein refers to sequences present on pre-mRNA that enhance or suppress splicing of an exon. An exonic regulatory element that enhances splicing of an exon is an exonic splicing enhancer (ESE). An exonic regulatory element that suppresses splicing of an exon is an exonic splicing suppressor (ESS). An intronic regulatory element that enhances splicing of an exon is an intronic splicing enhancer (ISE). An intronic regulatory element that suppresses splicing of an exon is called an intronic splicing suppressor (ISS).

“Instructional material,” as that term is used herein, includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition and/or compound of the invention in a kit. The instructional material of the kit may, for example, be affixed to a container that contains the compound and/or composition of the invention or be shipped together with a container which contains the compound and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the recipient uses the instructional material and the compound cooperatively. Delivery of the instructional material may be, for example, by physical delivery of the publication or other medium of expression communicating the usefulness of the kit, or may alternatively be achieved by electronic transmission, for example by means of a computer, such as by electronic mail, or download from a website.

By “nucleic acid” is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term also includes other modified nucleic acids as described herein. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil). The term “nucleic acid” typically refers to large polynucleotides.

Deoxyribonucleic acid (DNA) in the majority of organisms is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins. The term “nucleotide sequence” refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.

The terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid fragment,” “nucleic acid sequence or segment,” or “polynucleotide” may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene, e.g., genomic DNA, and even synthetic DNA sequences. The term also includes sequences that include any of the known base analogs of DNA and RNA.

“Messenger RNA” or “mRNA” is any RNA that specifies the order of amino acids in a protein. It is produced by transcription of DNA by RNA polymerase. In eukaryotes, the initial RNA product (primary transcript, including introns and exons) undergoes processing to yield a functional mRNA (i.e., a mature mRNA), which is then transported to the cytoplasm for translation. “Precursor mRNA” or “pre-mRNA” includes the primary transcript and RNA processing intermediates; the spliceosome assembles on a pre-mRNA and carries out RNA splicing.

By “fragment” or “portion” is meant a full length or less than full length of the nucleotide sequence.

A “variant” of a molecule is a sequence that is substantially similar to the sequence of the native molecule. For nucleotide sequences, variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis that encode the native protein, as well as those that encode a polypeptide having amino acid substitutions. The terms splice variant and splice isoform may be used interchangeably to denote different mRNAs which are a product of which may or may not encode the same protein, but are a result of differential splicing from the same initial pre-mRNA sequence. Specifically SCN8A exon 18A inclusion generates the SCN8A 18A mRNA transcript variant, while SCN8A exon 18N inclusion generates the SCN8A 18N mRNA transcript variant. Similarly, SCN8A exon 5A inclusion generates the SCN8A 5A mRNA transcript variant, while SCN8A exon 5N inclusion generates the SCN8A 5N mRNA transcript variant. Generally, nucleotide sequence variants of the invention will have in at least one embodiment 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98%, sequence identity to the native (endogenous) nucleotide sequence.

The terms “isolated and/or purified” refer to in vitro isolation of a nucleic acid, e.g., a DNA or RNA molecule from its natural cellular environment, and from association with other components of the cell or test solution (e.g. RNA pool), such as nucleic acid or polypeptide, so that it can be sequenced, replicated, and/or expressed. Thus, the RNA or DNA is “isolated” in that it is free from at least one contaminating nucleic acid with which it is normally associated in the natural source of the RNA or DNA and is preferably substantially free of any other mammalian RNA or DNA. The phrase “free from at least one contaminating source nucleic acid with which it is normally associated” includes the case where the nucleic acid is reintroduced into the source or natural cell but is in a different chromosomal location or is otherwise flanked by nucleic acid sequences not normally found in the source cell, e.g., in a vector or plasmid.

Nucleic acid molecules having base substitutions (i.e., variants) are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of the nucleic acid molecule.

“As used herein, the term “derived” or “directed to” with respect to a nucleotide molecule means that the molecule has complementary sequence identity to a particular molecule of interest.

Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5′-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5′-direction.

The direction of 5′ to 3′ addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the “coding strand”; sequences on the DNA strand which are located 5′ to a reference point on the DNA are referred to as “upstream sequences”; sequences on the DNA strand which are 3′ to a reference point on the DNA are referred to as “downstream sequences.”

The terms “protein,” “peptide” and “polypeptide” are used interchangeably herein.

By “variant” polypeptide is intended a polypeptide derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein. Such variants may results form, for example, genetic polymorphism or from human manipulation. Methods for such manipulations are generally known in the art.

“Polypeptide” refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer. The term “protein” typically refers to large polypeptides.

The term “peptide” typically refers to short polypeptides. Conventional notation is used herein to portray polypeptide sequences: the left-hand end of a polypeptide sequence is the amino-terminus; the right-hand end of a polypeptide sequence is the carboxyl-terminus. A “polynucleotide” means a single strand or parallel and anti-parallel strands of a nucleic acid.

Thus, a polynucleotide may be either a single-stranded or a double-stranded nucleic acid. In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytidine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.

The term “oligonucleotide” typically refers to short polynucleotides, generally no greater than about 60 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which “U” replaces “T.” The term “recombinant DNA” as used herein is defined as DNA produced by joining pieces of DNA from different sources.

The term “recombinant polypeptide” as used herein is defined as a polypeptide produced by using recombinant DNA methods.

By the term “specifically binds,” as used herein, is meant a molecule, such as an SMO, which recognizes and binds to another molecule or feature (i.e., the target pre-mRNA), but does not substantially recognize or bind other molecules or features in a sample (i.e.., other non-target pre-mRNAs). Two nucleic acids substantially recognize or bind to each other when at least about 50%, preferably at least about 60% and more preferably at least about 80% of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T, A:U and G:C nucleotide pairs). Most preferably, two nucleic acids substantially recognize or bind to each other when at least about 90%-100% of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T, A:U and G:C nucleotide pairs). In another embodiment, the molecule may be an antibody. Chemical modification of the nucleic acid in part determines hybridization energy and thus how many base pairs are required for specific binding of the SMO nucleic acid sequence and a target nucleic acid sequences. Such calculations are well within the ability ofthose skilled in the art.

By the term “splice defect of a protein”, as used herein, is meant a defective protein resulting from a defect in the splicing of an RNA encoding a protein.

The term “treatment,” as used herein, refers to reversing, alleviating, delaying the onset of, inhibiting the progress of and/or preventing a disease or disorder, or one or more symptoms thereof, to which the term is applied in a subject. In some embodiments, treatment may be applied after one or more symptoms have developed. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be administered prior to symptoms (e.g., in light of a history of symptoms and/or one or more

Other susceptibility factors), or after symptoms have resolved, for example to prevent or delay their reoccurrence.

Throughout this disclosure, various aspects of this invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual and partial numbers within that range, for example, 1, 2, 3, 4, 5, 5.5 and 6. This applies regardless of the breadth of the range.

The invention will now be illustrated by the following non-limiting Example(s).

EXAMPLE 1

As described herein, novel SMOs were designed to specifically and potently skip selected alternatively spliced exons in SCN8A and the efficacy of these SMOs was subsequently validated in mouse models of epilepsy.

Previously, novel SMOs were developed to modulate alternative splicing of the flip/flop cassette exons of AMPA receptor (AMPA-R) subunits GluA1 and GluA3 as drug candidates for treating intractable epilepsies and amyotrophic lateral sclerosis (ALS). AMPA-Rs are the major excitatory neurotransmitter receptors in the CNS. The well-validated mechanism for reducing network hyperexcitability and excitotoxicity is that reducing GluA-flip exon expression produce AMPA-Rs with much lower sensitivity to glutamate, greatly increased desensitization, and reduced Ca2+ permeability. Using the SMO design strategy outlined below, two novel phosphorothioate 2′-O-methyl SMOs, LSP-GR1 and LSP-GR3 (GR1 and GR3) were developed, which potently and very specifically reduced expression of GluA1-flip and GluA3-flip, respectively. The efficacy and specificity of these SMOs was determined by real-time PCR (QPCR) after ICV bolus delivery in neonatal mice. Both GR1 and GR3 showed extraordinary specificity and potency in reducing the expression of their targeted GluA-flip isoforms, without significantly altering other closely related GluA-flip or GluA-flop isoforms (FIG. 1A).

Extraordinary longevity of SMO activity was shown after one bilateral ICV bolus injection of the GR1 at P10 (FIG. 1B). Potent reduction of G1uA1-flip expression was observed in the brains of mice 60 d after a single ICV injection. Importantly, mice tested 20 days after P10 injection (at P30), showed no motor deficits or impairment in the Y-maze, a GluA1-dependent working memory task (Sanderson et. al., 2008)(not shown). Remarkably, GR1 activity was demonstrated out to 24 weeks after a single 50 μg spinal intrathecal injection (not shown). Thus drug dosing in humans should be much less frequent than for short-lived small molecules. LSP-GR1 effects on seizure thresholds were examined and it was found that GR1-treated neonatal mice exhibited significantly less severe seizures in response to the convulsant kainate (KA), and none of the GR1-treated mice progressed to status epilepticus (SE) (FIG. 1D). Mice treated with GR1 required 77% more KA to reach SE at P10 (not shown). Injection of GR1 90 min post-seizure at P10 prevented the SE-induced reduction in seizure thresholds at P12 whereas naïve and GR1-treated mice required significantly more KA respectively to reach SE than saline control SE-experienced mice (FIG. 1E). Whole-cell patch-clamp studies confirmed that GR1 greatly reduced AMPA excitatory post-synaptic currents (aEPSCs) (FIG. 1F). Thus GR1 is a highly potent, specific, and long lasting modulator of GluA1 alternative splicing that provides robust neonatal anti-seizure activity.

SMOs for Targeting SCN8A

Preliminary in vivo analysis of two candidate SMOs for targeting SCN8A exon 18A, showed that ICV injection of the 18A-2 SMO achieved ˜55% exon 18A skipping which is already greater than the 50% reduction expected to be therapeutic (FIG. 1C). SMOs have a significant therapeutic advantage over traditional small molecule inhibitors in that they can precisely target SCN8A splicing, allowing for a highly specific mechanism of action. The strategy of specifically reducing only the Na+ channel that counterbalances SCN1A input (SCN8A) should be a far more effective strategy and cause fewer adverse effects than using sodium channel blockers which antagonize multiple VGS channels. Further, by regulating alternative splicing, an SMO directed against exon 5A specifically reduces excitatory channel properties, rather than simply downregulating overall expression. Additionally, splice regulation of 18A is known to be differentially controlled in non-neuronal cells, thus SMO that escapes from the CNS in active form during normal metabolism is unlikely to affect splicing, or have on-target effects outside of the CNS (Zubovic et. al., 2012). In contrast to classic antisense compounds and siRNAs, SMOs do not recruit degradation enzymes (RNAseH, dicer) and therefore do not cause off-target degradation of transcripts. SMOs bind to their targets with exceptional potency, specificity, and negligible off-target effects (Eckstein 2007). Two SMOs are showing great promise in clinical trials for treating Duchene muscular dystrophy and Spinal muscular atrophy (Disterer et. al., 2014; Porensky and Burghes 2013).

Currently, there are no drugs in clinical use that specifically modulate SCN8 channel/SCN8A subunit properties or expression. The SMOs described herein can be used to treat, e.g., Dravet spectrum epilepsies refractory to current therapies. SMOs are designed for complete selectivity in targeting SCN8A isoform expression without affecting any other highly related VGS channel subunits. Moreover, the SCN8A gene is nearly 100% conserved between mouse and human surrounding the SMO target sites, such that SMOs validated in the mouse model is directly applicable to humans. It has been clearly documented that SMOs are widely distributed and biologically active throughout the CNS after direct delivery to CSF without the necessity of a carrier (Smith et. al., 2006; Williams et. al., 2009) (also see FIG. 1B). However, SMOs alone do not cross the blood-brain barrier when taken orally or parenterally. Clinically, SMOs are administered intrathecally, intracerebroventricularly (ICV), or potentially intranasally (via aerosolized nose spray). Intrathecal osmotic pumps are currently used in over 500,000 patients to treat chronic pain and spasticity, and are well-tolerated. SMOs delivered via spinal intrathecal injections have been shown to reach the brain in rodents and non-human primates (Hua et. al., 2010; Kordasiewicz et. al., 2012; Smith et. al., 2006; Williams et. al., 2009) and have been shown to be well-tolerated in clinical trials in infants and children with SMA. Additionally, implantation of the Omaya reservoir for direct brain/CNS delivery has been used in children as young as 9 months of age (Stephan et. al., 1992). Thus, no further formulation of SMOs is necessary to enable their clinical usage. The highly negative prognosis of uncontrolled seizures in SMEI patients warrants the more invasive delivery system currently necessary for SMO therapy. However, brain delivery of SMOs and other antisense technologies via non-invasive intranasal administration is preferential (Hashizume et. al., 2008; Lee et. al., 2012).

The studies described herein provide the first evidence that SMO-mediated direction of alternative splicing of SCN8A is therapeutic for pediatric seizure disorders, specifically Dravet and related syndromes, in addition to other forms of epilepsy.

Novel drug candidates called Splice Modulating Oligonucleotides (SMOs) will specifically and potently decrease splicing of 1) the SCN8A 18A isoform, resulting in less fully-functional SCN8A and 2) the 5A isoform, modulating channel kinetics to reduce sodium currents. SMOs are developed that decrease expression of SCN8A 5A and 18A isoforms. Also, the dose-response profiles of the top 5A and 18AN SMOs will be determined for increasing seizure threshold to flurothyl in 5-6 week old wild type mice. Further, the efficacy of the top 5A and 18AN SMOs will be evaluated in decreasing susceptibility to febrile seizures and increasing survival in a mutant SCN1A mouse model. Together, these experiments are expected to establish 5A and/or an 18AN SMO as potential drugs for the treatment of children with Dravet Spectrum epilepsies for which there is a significant unmet need. An SMO is currently in clinical trials to treat spinal muscular atrophy (SMA), a devastating neurological disorder of infancy, and thus far, is showing efficacy, safety, and tolerability when delivered by intrathecal injection directly into the CNS (Disterer et. al., 2014).

Design of Splice Modulating Oligonucleotides (SMOs) [Splice modulating oligonucleotides (SMOs) are designed and validated that specifically and potently modulate SCN8A pre-mRNA splicing to decrease expression of the 18A and 5A isoforms and determine the dose-response profile of the top 2 SMOs (one each for 18A and 5A skipping) in normal mice. Candidate SMOs are developed that target splicing of both human and mouse SCN8A pre-mRNA to reduce expression of the 18A and 5A isoforms. A proven set of molecular engineering tools are used to identify ranked panels of SMOs that decrease the expression of the SCN8 exon 18A and 5A isoforms. The process is refined iteratively to select the most potent SMO candidates for further testing.

SMOs are developed to facilitate specific skipping of exons 5A and 18A, resulting in significantly reduced excitatory function of SCN8 channels. 2′OMe steric block oligomers modulate pre-mRNA splicing through high affinity binding to complementary sequences containing specific splicing elements, resulting in potent and efficient skipping of the targeted exon (Aartsma-Rus et. al., 2005; Aartsma-Rus et. al., 2006; Buvoli et. al., 2007; Wheeler et. al., 2007) (see, FIG. 1C). Pre-mRNA splicing is controlled by the spliceosome, a large ribonucleoprotein (RNP) complex with many auxiliary proteins and small non-coding RNAs. These factors bind to specific splice enhancer and suppressor sequences (motifs) on pre-mRNAs near intron-exon boundaries and coordinate the splicing of pre-mRNA to mRNA. Exons 18A/18N and exons 5A/5N are mutually exclusive cassette exons. Steric blocking of intronic/exonic splice enhancers (ISE/ESEs) and/or 3′ and 5′ splice sites, while avoiding intronic/exonic splice silencer (ISS/ESS) motifs, prevents spliceosomal recognition of the exon. Thus, when critical splice recognition sequences of an exon are masked by an SMO, the entire intron-exon-intron sequence is treated as a single intron, and the targeted exon is excluded from the resultant mRNA.

To minimize the number of SCN1A knock-in mice needed, the dosing strategy is optimized in normal mice. C57/BL6 mice are used as they are the background strain of the SCN1A mutant GEFS+ mice to be tested below. While complete SCN8A KO causes a severe phenotype in mice including motor system degeneration and early lethality (Martin et. al., 2007; Meisler et. al., 2004) and haplosinsufficient SCN8A mice exhibit spike wave discharges characteristic of absence seizures (Papale et. al., 2009), similar mutations have been found in humans with only mild impact on cognition (Trudeau et. al., 2006). SCN8A haploinsufficiency is adequate to modify the Dravet's phenotype of SCN1A mutant mice, without causing an adverse phenotype (Hawkins et. al., 2011; Martin et. al., 2007; Meisler et. al., 2010), however adverse effects may limit SMO dosing in WT mice. All mice are monitored daily for gross signs of toxicity including weight loss, paralysis, and tremor. For all studies described herein, groups are weight, sex, and litter-matched to reduce phenotypic variability.

Design of phosphorothioate 2′-O-methyl modified SMOs which targets splicing of both human and mouse SCN8A pre-mRNA to reduce expression of the 18A and 5A isoforms. This process first requires in silico prediction of critical splicing motifs, which encompasses the use of the most advanced RNA and oligo analysis tools. SMOs targeting SCN8A alternative splicing is designed to target either the 3′ or 5′ splice sites and/or sequences corresponding to predicted ESE/ISE clusters near the splice junctions of exons 5A and 18A. The following summarizes the SMO design process:

Step 1. Identification of conservation between human and mouse SCN8A sequences. Alignments of the highly conserved SCN1-11A gene sequences have been performed to ensure specificity of SMO sites targeting SCN8A splicing, and complete conservation between mouse and human. Thus, SMOs developed and tested in mice can be translated directly to human use.

Sten 2. Identification of ESE/ESS/ISE motifs surrounding the 3′ and 5′ splice sites of alternatively spliced exons in SCN8A pre-mRNA. Splice modulation sites for SCN8A exons 5A and 18A have completely conserved regulatory motifs between mouse and human. ESE motifs were defined using ESE Finder (Cartegni et. al., 2003) RESCUE-ESE (Dravet et. al., 2011; Fairbrother et. al., 2002) and PESX (Zhang and Chasin 2004). ESS elements were predicted by PESX, and the two hexamer data set analysis by FAS-ESS (Wang et. al., 2004) tool. Finally, ISE motifs are predicted using the ACESCAN2 application (Yeo et. al., 2005; Yeo et. al., 2007).

Step 3. RNA Structure and Thermodynamics of SCN8A target sequences. The RNA Structure program (Mathews et. al., 2004) predicts secondary structure of target sequences and thermodynamic properties of all potential SMOs targeting SCN8A. Additionally, sequence motifs and structures known or predicted to cause immune stimulation or other toxicities, are screened for, and avoided.

Step 4. BLAST analysis of potential off-target hybridization. All candidate SMOs are screened using BLASTN analysis for potential hybridization to off-target sites in the human/mouse genomes. SMOs with greater than 85% off-target hybridization to any other known gene product are not considered.

Step 5. Prioritization of SMOs based on combined properties. Thermodynamic properties between SMOs and their target, and self-self binding energies of SMOs, splice site strength, and splicing motifs are combined to establish top candidate SMOs for empirical evaluation of splicing specificity and efficiency. These parameters used to predict top candidate SMOs are all contained in the above referenced oligonucleotide and RNA structure predictive software.

In vivo Splicing Efficacy

In vivo splicing efficacy of top candidate SMOs are tested in neonatal pups. Splicing efficacy of the top ranked SMOs determined above are validated using well-established in vivo screening protocol in neonatal mice by ICV delivery, and measuring transcript levels with real-time PCR. This testing determines the most effective SMOs (one each targeting SCN8A 5A and 18A exons). Dose-response and dose-timing profile of lead SMOs in reducing SCN8A 5A and 18A expression, respectively, are performed in normal mice and examined at P15, and P42 (6 weeks of age). Dose-response measures both mRNA expression by QPCR and protein expression by Western blot.

Test of in vivo splicing efficacy of top candidate SMOs in neonatal pups. The in silico splice prediction technology allows bypassing costly and time consuming high through-put oligonucleotide screening. SMO development requires an iterative process of SMO evaluation and optimization, where splicing efficacy of the top 2 ranked SMOs is evaluated, and the results used to strategically select the next top candidate SMOs. For example, 10 SMOs may be used to fully optimize splicing efficiency (see, e.g., Table 1).

TABLE 1 Testing candidate SMOs Groups Treatment Dose (pg) 1-10 18A SMOs #1-10 4 μg bilateral 11 Saline N/A 2-21  5A SMOs #1-10 4 μg bilateral 22 Saline N/A

Although complete reduction of 18A expression is not desirable, increased SMO potency increases the therapeutic index. Specificity of SMOs that pass the initial screen for potency are confirmed against other highly conserved SCN subunits using QPCR (as done for GR1; FIG. 1A). For all in vivo studies, treated and control animals are litter-matched to reduce variability. FVBs are the preferred strain for SMO screening because of their large litter size, and good maternal care. FVB neonatal mice are given free-hand bilateral injections of SMO on post-natal (P)1, P3, and P5 into the lateral ventricles and brain tissues are harvested at P10 as previously described (Williams et. al., 2009). Cortex and hippocampus are rapidly dissected; RNA isolated, converted cDNA using Multiscribe with random hexamer primers. Custom TaqMan QPCR assays have been designed to specifically detect 5A and 18A isoforms and validated for efficiency over 5 logs of cDNA concentration (not shown). Expression of 5A and 18A transcripts are evaluated by the ΔΔCT method (Livak and Schmittgen 2001) relative to endogenous control (β-Actin). Saline mice are used as controls for multiple SMOs within litter (n=3 mice per SMO; up to 30 SMO-treated or saline mice for 18A and 5A).

We designed and validated splice modulating oligonucleotides (SMOs) that specifically and potently modulate SCN8A pre-mRNA splicing to decrease expression of either the 18A and 5A isoforms. Ten candidate SMO sequences selected by iterative in silico analysis were tested in vivo with bilateral ICV injection in neonatal mouse pups for the ability to direct skipping of SCN8A exon 18A at various doses and dose frequencies. Based on this initial screening, change in splicing for the highest dose tested for each candidate SMO are shown (FIG. 2A) The most potent candidate SMOs after a single 4μg/bilateral ICV dose were compared to LSP-GR1 for relative efficacy at directing targeted exon skipping (FIG. 2B). Preliminary CNS distribution and assessment of the adverse effects profile of the top 4

SMOs (SCN8A-18A-5-SEQ ID: 1306, 18A-8-SEQ ID: 1307, 18A-9- SEQ ID: 1422, and 18A-10-SEQ ID: 1541) at a maximal intrathecal (IT) dose of 50 μg/5 μL/3 min in adult mice was used to further screen the candidate SMOs the top candidate SMOs (FIG. 2C). SCN8A-18A-9 (18A-9-SEQ ID: 1422) was initially selected for additional testing.

Seven candidate SMO sequences selected by iterative in silico analysis were tested in vivo with bilateral ICV injection in neonatal mouse pups for the ability to direct skipping of SCN8A exon 5A at various doses and dose frequencies. Based on this initial screening, change in splicing for the highest dose tested for each candidate SMO are shown (FIG. 2E). However, SCN8A-5A-2 (5A-2-SEQ ID: 33) produced the most potent splicing response thus far, an effect which is statistically significant at all measures and dose-responsive, such that exon 5A skipping continues to increase with increasing total SMO dose from 4-24 μg (FIG. 2F).

Dose-response and Timing Profile

Dose-response and timing profile of two lead SMOs in reducing SCN8A 5A and 18A expression. A similar injection regimen and QPCR analysis protocol as described above are used, with harvest at two time points, P15 and P42 (6 weeks), to find dosing paradigms that give 25, 50, and 75% knockdown at P15 and last out to 6 weeks. These paradigms are used test lead 5A and 18A SMOs in normal and SCN1ARH/RH mice seizure and longevity studies. Based on the real-time PCR results SMO-mediated reduction of the 18A and 5A isoforms as our index of splicing efficacy is calculated at the various doses. Additionally for 18A SMO treatment, western blot is used to determine correlation between mRNA production and protein expression, as described previously (Martin et. al., 2010). Antibodies are not available to distinguish between SCN8A 5A and 5N isoforms. The experimental groups are defined in Table 2.

TABLE 2 Dose-response profile of lead SMOs Groups Treatment Dose (μg) Total mice 1 18A SMO 6, 4, 2 60 2  5A SMO 6, 4, 2 60 3 saline N/A Up to 60

Freehand ICV injections may be performed as frequently as every other day from P1-P12, however based on previous experiments, only 1-2 doses are likely necessary to achieve optimal splicing efficacy (see, FIG. 1B). As expected, a single 4μg 18A-9 (SEQ ID: 1422) SMO dose in neonatal (P3-5) C57BL/6 mice produced lasting exon 18A skipping out to P28 without any decrement in splicing activity (FIG. 2A). Although significant SCN8A exon 18A splicing remains at P42, the effect is not as robust as seen at earlier time points, suggesting multiple doses or a different dosing timing may be necessary to maintain effect out to 6 weeks (see, FIG. 2D).

Determination of Efficacy of SMOs

The threshold to flurothyl-induced seizures in normal mice after optimized dosing of the SMOs is determined, as SCN8A loss-of-function mutations increase seizure thresholds to flurothyl (Martin et. al., 2007). Also, the efficacy of SMOs is determined (skipping SCN8A 5A and 18A exons) at extending lifespan and reducing spontaneous seizures in a mouse model of GEFS+ (SCN1A R1648H).

The effect of SMO treatment on seizure threshold in normal mice is determined. Based on the dose-response data determined above, three SMO doses (25, 50, 75% splicing) are selected for testing in P15 and 5-6 week old mice to examine seizure threshold responses to flurothyl induced seizures. SMO potency and efficacy determines dosing for further experimentation.

The two top SMOs (18A and 5A) are assessed for efficacy in reducing the number of spontaneous seizures in SCN1ARH/RH mice (Martin et. al., 2010), as a correlative measure to survival.

The efficacy of the two top SMOs (18A and 5A) are evaluated for ability to extend lifespan in SCN1ARH/RH mice, which die by P16-26 without treatment (Martin et. al., 2010).

Directing splicing of SCN8A to skip the 18A or 5A exon (favoring production of the 18N or 5N containing isoforms) diminishes SCN8A-mediated excitation and ameliorates the effects of SCN1A mutations, as when SCN1A and SCN8A loss-of-function mutations occur together (Hawkins et. al., 2011; Martin et. al., 2007; Meisler et. al., 2010).

To accomplish this novel targeting strategy, alternative splicing of the SCN8A channel is directed in order to control channel properties by developing compounds called splice modulating oligonucleotides (SMOs). SMOs are a class of synthetic RNA based compounds that bind directly to a complementary sequence on pre-mRNA and function by sterically blocking or weakening interactions between elements of the splice machinery and the pre-mRNA. The 18A and 18N exons are mutually exclusive cassette exons such that when one exon is excluded the other exon is included. Thus, directing splicing to exclude (skip) the SCN8A exon 18A results in inclusion of exon 18N (truncated isoform) and thereby effectively reduces expression of the full length functional 18A isoform. Similarly, the 5A/5N exons are also mutually exclusive cassette exons, and directing splicing to skip SCN8A exon 5A result in inclusion of exon 5N (decreased gain isoform) and to reduce expression of the undesirable increased gain 5A isoform.

Mice with the SCN8Amed/+ mutation (resulting in partial SCN8A loss of function) exhibit resistance to flurothyl induced seizure by 5-6 weeks of age (Martin et. al., 2007). The SMO-mediated reduction of SCN8A 18A or 5A isoform expression modulates SCN8A-mediated sodium current in a similar manner to the SCN8A “med” mutation. Thus, the optimal injection frequency as determined above to maintain effect from P15 to 6 weeks in WT mice is used for testing a range of SMO doses in increasing flurothyl seizure threshold in P15 and 5-6 week old WT mice, as physiological validation of our SMO strategy. The most effective dose and injection paradigm that causes seizure resistance in normal mice is used to determine if reducing SCN8A 18A or 5A isoforms can increase lifespan and ameliorate seizure susceptibility in SCN1A R1648H knock-in mice. Similar to SCN1A KO mice, homozygous R1648H (SCN1ARH/RH) mice exhibit weight loss, spontaneous seizures, and susceptibility to febrile seizures starting at P14-16 and lethality by P16-26 (Martin et. al., 2010). However, heterozygous SCN1ARH/+ mutant mice show a less severe phenotype than SCN1A+/− knockout mice with only ˜15% exhibiting spontaneous seizures in adulthood, but do have increased susceptibility to flurothyl and hyperthermia induced seizures by 5-6 weeks of age (Martin et. al., 2010). SCN1A R1648H mutant mice are raised in-house on a C57BL/6 background with care, husbandry, and genotyping performed as described previously (Martin et. al., 2010).

Effect of SMO treatment on seizure threshold in normal mice. The effect of optimized SMO treatment on flurothyl-induced seizure threshold is determined first in P15 and then in 5-6 week old WT mice. The dose-response data (Table 2) is used to select 3 doses with ˜25, 50, and 75% efficacy at reducing 18A and 5A expression for functional studies at each time point. C57/BL6 mice are given ICV injection with SMO or saline (Table 3, 18A SMO or 5A SMO for both the P15 and 5-6 week time points).

TABLE 3 Pre-seizure treatment with two lead SMOs Group Treatment SMO Doses (μg) Total Mice 1 18A SMO TBD* 25, 50, 75% 24 2  5A SMO TBD* 25, 50, 75% 24 3 Saline N/A 48 Injection schedule is modified to achieve the indicated level of splicing. 8 mice/group.

Flurothyl seizures are performed as previously described, and outcome measures include latency to initial myoclonic jerk (MJ) and generalized tonic-clonic seizure (GTCS) (Martin et. al., 2007).

SMO efficacy in reducing in spontaneous seizures in SCN1ARH/RH mice. Starting at P15, SCN1ARH/RH mice are evaluated for 4hrs daily on 3 consecutive days with number of observed behavioral seizures recorded. Efficacy of the two top SMOs (18A and 5A SMOs) are determined by reduction in number of spontaneous seizures in the SCN1ARH/RH mice (Martin et. al., 2010) as compared to saline littermate controls (Table 4).

TABLE 4 SCN1A mutant mouse seizure studies Group Treatment SMO Dose (μg) Total Mice 1 18A SMO TBD* 12 2  5A SMO TBD* 12 3 Saline Control N/A 12 *TBD: dose which showed maximal efficacy and overt tolerability in normal mice in Aim 1 Experiment 3. 12 mice/dose/group, each for Aim 2 Experiments 2 and 3.

This assesses whether any increased in survival seen with SMO treatment is mediated by decreasing seizure activity.

Efficacy of treatment with the two top SMOs (18A and 5A) is evaluated by survival in SCN1ARH/RH mice. SCN1ARH/RH mice exhibit weight-loss starting at ˜P15 corresponding to the onset of spontaneous seizures, and die at ˜P18.5 without treatment (Martin et. al., 2010). The SCN1ARH/RH mice treated with 18A or 5A SMO are also assessed daily for righting reflex, body weight, and survival compared to litter matched saline controls (Table 4).

Reduction of full length functional SCN8A (18A SMO) or reduction of “high gain” SCN8A (5A SMO) produces increased resistance to fluorothyl-induced seizures in P15 and 5-6 week old normal mice.

Reduction of sodium current through SCN8 channels, either by reducing full length functional channels (18A SMO) or by altering channel kinetics to a lower gain (5A SMO), reduces seizure frequency and increases survival in mutant SCN1ARH/RH mice. The SCN1ARH/RH mouse model was chosen in this application, rather than SCN1A mouse model, due to lack of success in transferring the highly fragile SCN1A knockout breeders from their home colony. Although SCN1ARH/+ mice are a model of GEFS+, a less severe Dravet spectrum epilepsy, homozygous SCN1ARH/RH mice present a severe, Dravet-like phenotype.

Statistical Analysis: General statistical measures are performed using GraphPad or StatistiXL. Overall seizure scoring and real-time PCR results are evaluated by student's t-test with Bonferoni correction for multiple comparisons when appropriate. Longevity is analyzed using the Kaplan-Meier survival test. For all data analysis, statistical significance isset at (p<0.05).

Reference List

Aartsma-Rus, A. et.al., “Functional analysis of 114 exon-internal AONs for targeted DMD exon skipping: indication for steric hindrance of SR protein binding sites”, Oligonucleotides., 15 (4), 284-297 (2005).

Aartsma-Rus, A. et.al., “Therapeutic modulation of DMD splicing by blocking exonic splicing enhancer sites with antisense oligonucleotides”, Ann.N.Y.Acad.Sci., 1082 74-76 (2006).

Antzelevitch, C. et.al., “Electrophysiologic basis for the antiarrhythmic actions of ranolazine”, Heart Rhythm., 8 (8), 1281-1290 (2011).

Bender, A. C. et.al., “SCN1A mutations in Dravet syndrome: Impact of interneuron dysfunction on neural networks and cognitive outcome”, Epilepsy Behay., (2012).

Black, J. A. and Waxman, S. G. “Sodium channels and microglial function”, Exp.Neurol., 234 (2), 302-315 (2012).

Buvoli, M. et.al., “Interplay between exonic splicing enhancers, mRNA processing, and mRNA surveillance in the dystrophic Mdx mouse”, PLoS.ONE., 2 (5), e427-(2007).

Carrithers, M. D. et.al., “Regulation of podosome formation in macrophages by a splice variant of the sodium channel SCN8A”, J.Biol.Chem., 284 (12), 8114-8126 (2009).

Cartegni, L. et.al., “ESEfinder: A web resource to identify exonic splicing enhancers”, Nucleic Acids Res., 31 (13), 3568-3571 (2003).

Catterall, W. A. et.al., “NaV1.1 channels and epilepsy”, J.Physiol, 588 (Pt 11), 1849-1859 (2010).

Chen, Y. et.al., “Functional properties and differential neuromodulation of Na(v)1.6 channels”, Mol.Cell Neurosci., 38 (4), 607-615 (2008).

Claes, L. et.al., “De novo mutations in the sodium-channel gene SCN1A cause severe myoclonic epilepsy of infancy”, Am.J.Hum.Genet., 68 (6), 1327-1332 (2001).

De, Jonghe P. “Molecular genetics of Dravet syndrome”, Dev.Med.Child Neurol., 53 Suppl 2 7-10 (2011).

Disterer, P. et.al., “Development of therapeutic splice-switching oligonucleotides”, Hum.Gene Ther., 25 (7), 587-598 (2014).

Dravet, C. et.al., “Severe myoclonic epilepsy in infancy (Dravet syndrome) 30 years later”, Epilepsia, 52 Suppl 2 1-2 (2011).

Dravet, C. et.al., “Severe myoclonic epilepsy in infancy Dravet syndrome”, Adv.Neurol., 95 71-102 (2005).

Eckstein, F. “The versatility of oligonucleotides as potential therapeutics”, Expert.Opin.Biol.Ther., 7 (7), 1021-1034 (2007).

Estacion, M. et.al., “A novel de novo mutation of SCN8A (Nav1.6) with enhanced channel activation in a child with epileptic encephalopathy”, Neurobiol.Dis., 69 117-123 (2014).

Fairbrother, W. G. et.al., “Predictive identification of exonic splicing enhancers in human genes”, Science, 297 (5583), 1007-1013 (2002).

Fernandes, A. et.al., “Microglia and inflammation: conspiracy, controversy or control?”, Cell Mol.Life Sci., (2014).

Fletcher, E. V. et.al., “Alternative splicing modulates inactivation of type 1 voltage-gated sodium channels by toggling an amino acid in the first S3-S4 linker”, J.Biol.Chem., 286 (42), 36700-36708 (2011).

Gargus, J. J. and Tournay, A. “Novel mutation confirms seizure locus SCN1A is also familial hemiplegic migraine locus FHA/13”, Pediatr.Neurol., 37 (6), 407-410 (2007).

Garry, E. M. et.al., “Varicella zoster virus induces neuropathic changes in rat dorsal root ganglia and behavioral reflex sensitisation that is attenuated by gabapentin or sodium channel blocking drugs”, Pain, 118 (1-2), 97-111 (2005).

Gazina, E. V. et.al., “Differential expression of exon 5 splice variants of sodium channel alpha subunit mRNAs in the developing mouse brain”, Neuroscience, 166 (1), 195-200 (2010).

Han, S. et.al., “Autistic-like behaviour in Scn1a+/− mice and rescue by enhanced GABA-mediated neurotransmission”, Nature, 489 (7416), 385-390 (2012).

Hashizume, R. et.al., “New therapeutic approach for brain tumors: Intranasal delivery of telomerase inhibitor GRN163”, Neuro.Oncol., 10 (2), 112-120 (2008).

Hawkins, N. A. et.al., “Neuronal voltage-gated ion channels are genetic modifiers of generalized epilepsy with febrile seizures plus”, Neurobiol.Dis., 41 (3), 655-660 (2011).

Heinzen, E. L. et.al., “Nova2 interacts with a cis-acting polymorphism to influence the proportions of drug-responsive splice variants of SCN1A”, Am.J.Hum.Genet., 80 (5), 876-883 (2007).

Hua, Y. et.al., “Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model”, Genes Dev., 24 (15), 1634-1644 (2010).

Kennedy, P. G. et.al., “Varicella-zoster viruses associated with post-herpetic neuralgia induce sodium current density increases in the ND7-23 Nav-1.8 neuroblastoma cell line”, PLoS.ONE., 8 (1), e51570-(2013).

Kordasiewicz, H. B. et.al., “Sustained therapeutic reversal of Huntington's disease by transient repression of huntingtin synthesis”, Neuron, 74 (6), 1031-1044 (2012).

Kuwabara, S. et.al., “Latent addition in human motor and sensory axons: different site-dependent changes across the carpal tunnel related to persistent Na+ currents”, Clin.Neurophysiol., 117 (4), 810-814 (2006).

Lee, S. T. et.al., “miR-206 regulates brain-derived neurotrophic factor in Alzheimer disease model”, Ann.Neurol., 72 (2), 269-277 (2012).

Licatalosi, D. D. et.al., “HITS-CLIP yields genome-wide insights into brain alternative RNA processing”, Nature, 456 (7221), 464-469 (2008).

Livak, K. J. and Schmittgen, T. D. “Analysis of relative gene expression data using real-time quantitative PCR and the 2-[Delta][Delta] CT method”, Methods, 25 402-408 (2001).

Makinson, C. D. et.al., “Role of the hippocampus in Nav1.6 (Scn8a) mediated seizure resistance”, Neurobiol.Dis., 68 16-25 (2014).

Mao, Q. et.al., “The up-regulation of voltage-gated sodium channel Nav1.6 expression following fluid percussion traumatic brain injury in rats”, Neurosurgery, 66 (6), 1134-1139 (2010).

Martin, M. S. et.al., “Altered function of the SCN1A voltage-gated sodium channel leads to gamma-aminobutyric acid-ergic (GABAergic) interneuron abnormalities”, J.Biol.Chem., 285 (13), 9823-9834 (2010).

Martin, M. S. et.al., “The voltage-gated sodium channel Scn8a is a genetic modifier of severe myoclonic epilepsy of infancy”, Hum.Mol.Genet., 16 (23), 2892-2899 (2007).

Mathews, D. H. et.al., “Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure”, Proc.Natl.Acad.Sci.U.S.A, 101 (19), 7287-7292 (2004).

Meister, M. H. and Kearney, J. A. “Sodium channel mutations in epilepsy and other neurological disorders”, J.Clin.Invest, 115 (8), 2010-2017 (2005).

Meister, M. H. et.al., “Sodium channel gene family: epilepsy mutations, gene interactions and modifier effects”, J.Physiol, 588 (Pt 11), 1841-1848 (2010)

Meisler, M. H. et.al., “Allelic mutations of the sodium channel SCN8A reveal multiple cellular and physiological functions”, Genetica, 122 (1), 37-45 (2004).

Norden, D. M. and Godbout, J. P. “Review: microglia of the aged brain: primed to be activated and resistant to regulation”, Neuropathol.Appl.Neurobiol., 39 (1), 19-34 (2013).

Nutini, M. et.al., “Increased expression of the beta3 subunit of voltage-gated Na+ channels in the spinal cord of the SOD1G93A mouse”, Mol.Cell Neurosci., 47 (2), 108-118 (2011).

O'Roak, B. J. et.al., “Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations”, Nat.Genet., 43 (6), 585-589 (2011).

O'Roak, B. J. et.al., “Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations”, Nature, 485 (7397), 246-250 (2012).

Oakley, J. C. et.al., “Temperature- and age-dependent seizures in a mouse model of severe myoclonic epilepsy in infancy”, Proc.Natl.Acad.Sci.U.S.A, 106 (10), 3994-3999 (2009).

Ogiwara, I. et. al., “Nav1.1 localizes to axons of parvalbumin-positive inhibitory interneurons: a circuit basis for epileptic seizures in mice carrying an Scnla gene mutation”, J.Neurosci., 27 (22), 5903-5914 (2007).

Ohba, C. et.al., “Early onset epileptic encephalopathy caused by de novo SCN8A mutations”, Epilepsia, 55 (7), 994-1000 (2014).

Oliva, M. et.al., “Sodium channels and the neurobiology of epilepsy”, Epilepsia, 53 (11), 1849-1859 (2012).

Papale, L. A. et.al., “Heterozygous mutations of the voltage-gated sodium channel SCN8A are associated with spike-wave discharges and absence epilepsy in mice”, Hum.Mol.Genet., 18 (9), 1633-1641 (2009).

Plummer, N. W. et.al., “Alternative splicing of the sodium channel SCN8A predicts a truncated two-domain protein in fetal brain and non-neuronal cells”, J.Biol.Chem., 272 (38), 24008-24015 (1997).

Porensky, P. N. and Burghes, A. H. “Antisense oligonucleotides for the treatment of spinal muscular atrophy”, Hum.Gene Ther., 24 (5), 489-498 (2013).

Raman, I. M. et.al., “Altered subthreshold sodium currents and disrupted firing patterns in Purkinje neurons of Scn8a mutant mice”, Neuron, 19 (4), 881-891 (1997).

Raymond, C. K. et.al., “Expression of alternatively spliced sodium channel alpha-subunit genes. Unique splicing patterns are observed in dorsal root ganglia”, J.Biol.Chem., 279 (44), 46234-46241 (2004).

Sanderson, D. J. et.al., “The role of the GluR-A (GluR1) AMPA receptor subunit in learning and memory”, Prog.Brain Res., 169 159-178 (2008).

Schlachter, K. et.al., “A splice site variant in the sodium channel gene SCN1A confers risk of febrile seizures”, Neurology, 72 (11), 974-978 (2009).

Sierra, Bello O. et.al., “In silico docking reveals possible Riluzole binding sites on Nav1.6 sodium channel: implications for amyotrophic lateral sclerosis therapy”, J.Theor.Biol., 315 53-63 (2012).

Silberstein, S. D. and Dodick, D. W. “Migraine genetics: Part II”, Headache, 53 (8), 1218-1229 (2013).

Singh, R. et.al., “Generalized epilepsy with febrile seizures plus: a common childhood-onset genetic epilepsy syndrome”, Ann.Neurol., 45 (1), 75-81 (1999).

Smith, R. A. et.al., “Antisense oligonucleotide therapy for neurodegenerative disease”, J.Clin.Invest, 116 (8), 2290-2296 (2006).

Stephan, J. L. et.al., “Treatment of central nervous system B lymphoproliferative syndrome by local infusion of a B cell-specific monoclonal antibody”, Transplantation, 54 (2), 246-249 (1992).

Tang, B. et.al., “A BAC transgenic mouse model reveals neuron subtype-specific effects of a Generalized Epilepsy with Febrile Seizures Plus (GEFS+) mutation”, Neurobiol.Dis., 35 (1), 91-102 (2009).

Trudeau, M. M. et.al., “Heterozygosity for a protein truncation mutation of sodium channel SCN8A in a patient with cerebellar atrophy, ataxia, and mental retardation”, J.Med.Genet., 43 (6), 527-530 (2006).

Vaher, U. et.al., “De Novo SCN8A Mutation Identified by Whole-Exome Sequencing in a Boy With Neonatal Epileptic Encephalopathy, Multiple Congenital Anomalies, and Movement Disorders”, J.Child Neurol., (2013).

Veeramah, K. R. et.al., “De Novo Pathogenic SCN8A Mutation Identified by Whole-Genome Sequencing of a Family Quartet Affected by Infantile Epileptic Encephalopathy and SUDEP”, Am.J.Hum.Genet., 90 (3), 502-510 (2012).

Verret, L. et.al., “Inhibitory interneuron deficit links altered network activity and cognitive dysfunction in Alzheimer model”, Cell, 149 (3), 708-721 (2012).

Wang, W. et.al., “The developmental changes of Na(v)1.1 and Na(v)1.2 expression in the human hippocampus and temporal lobe”, Brain Res., 1389 61-70 (2011).

Wang, Z. et.al., “Systematic identification and analysis of exonic splicing silencers”, Cell, 119 (6), 831-845 (2004).

Waxman, S. G. “Axonal conduction and injury in multiple sclerosis: the role of sodium channels”, Nat.Rev.Neurosci., 7 (12), 932-941 (2006).

Weiss, S. et.al., “Riluzole protects against cardiac ischaemia and reperfusion damage via block of the persistent sodium current”, Br.J.Pharmacol., 160 (5), 1072-1082 (2010).

Wheeler, T. M. et.al., “Correction of CIC-1 splicing eliminates chloride channelopathy and myotonia in mouse models of myotonic dystrophy”, J.Clin.Invest, 117 (12), 3952-3957 (2007).

Williams, J. H. et.al., “Oligonucleotide-mediated survival of motor neuron protein expression in CNS improves phenotype in a mouse model of spinal muscular atrophy”, J.Neurosci., 29 (24), 7633-7638 (2009).

Wilson, J. R. and Fehlings, M. G. “Riluzole for acute traumatic spinal cord injury: a promising neuroprotective treatment strategy”, World Neurosurg., 81 (5-6), 825-829 (2014).

Xu, R. et.al., “A childhood epilepsy mutation reveals a role for developmentally regulated splicing of a sodium channel”, Mol.Cell Neurosci., 35 (2), 292-301 (2007).

Yeo, G. W. et.al., “Discovery and analysis of evolutionarily conserved intronic splicing regulatory elements”, PLoS.Genet., 3 (5), e85-(2007).

Yeo, G. W. et.al., “Identification and analysis of alternative splicing events conserved in human and mouse”, Proc.Natl.Acad.Sci.U.S.A, 102 (8), 2850-2855 (2005).

Yu, F. H. et.al., “Reduced sodium current in GABAergic interneurons in a mouse model of severe myoclonic epilepsy in infancy”, Nat.Neurosci., 9 (9), 1142-1149 (2006).

Zhang, X. H. and Chasin, L. A. “Computational definition of sequence motifs governing constitutive exon splicing”, Genes Dev., 18 (11), 1241-1250 (2004).

Zubovic, L. et.al., “Mutually exclusive splicing regulates the Nav 1.6 sodium channel function through a combinatorial mechanism that involves three distinct splicing regulatory elements and their ligands”, Nucleic Acids Res., 40 (13), 6255-6269 (2012).

All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.

The use of the terms “a” and “an” and “the” and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “including,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.

All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

1. A method of modulating splicing of an SCN8A pre-mRNA comprising:

contacting a plurality of cells with splice modulating oligonucleotide (SMO) that specifically binds a complementary sequence of a pre-mRNA that undergoes splicing to form an mRNA encoding the voltage gated sodium channel subunit SCN8A
, wherein the SMO sequence directs exclusion of exon 5A or exon 18A in the SCN8A pre-mRNA;
in the plurality of cells expressing SCN8A pre-mRNA.

2. The method of claim 1 wherein the plurality of cells are in vitro.

3. The method of claim 1 wherein the plurality of cells are in vivo.

4. The method of claim 1 wherein the SMO specifically binds to a complementary sequence on a pre-mRNA in at least one of the group consisting of an intron-exon splice site, an exonic splice enhancer (ESE) site, and an intronic splice enhancer (ISE) site, in the plurality of cells to produce at least a 5 percent decrease in exon 18A inclusion in an SCN8A RNA compared to baseline untreated cells and alters expression of SCN8A or one or more isoforms thereof.

5. The method of claim 1 wherein the SMO specifically binds to a complementary sequence on a pre-mRNA in at least one of the group consisting of an intron-exon splice site, an exonic splice enhancer (ESE) site, and an intronic splice enhancer (ISE) site, in the plurality of cells to produce at least a 5 percent decrease in exon 5A inclusion in an SCN8A RNA compared to baseline untreated cells and alters expression of SCN8A or one or more isoforms thereof.

6. The method of claim 1 wherein the plurality of cells are in vivo and the SMO sequence is administered into a subject and into contact with the plurality of cells through a route of oral, rectal, intracerebroventricular, intracranial, intratumoral, intrathecal, intracisternal, epidural, intravaginal, parenteral, intravenous, intramuscular, subcutaneous, local, intraperitoneal, transdermal, or by inhalation or as a buccal or nasal spray.

7. The method of claim 6 wherein the subject has a disorder with symptoms, the symptoms being reduced by reduced excitation functionality of an SCN8A protein encoded by the SCN8A RNA.

8. The method of any one of claims 1 to 5 wherein the splice modulating oligonucleotide (SMO) sequence is completely selective towards the SCN8A pre-mRNA relative to highly related voltage gated sodium channel subunits.

9. The method of any one of claims 1 to 5 wherein the plurality of cells are human cells.

10. The method of any one of claims 1 to 5 wherein the plurality of cells are mouse cells.

11. The method of any one of claims 1 to 5 wherein the plurality of cells are rat cells.

12. The method of any one of claims 1 to 5 wherein the plurality of cells are non-human primate cells.

13. A composition for performing the method of claim 1 comprising:

a splice modulating oligonucleotide (SMO) sequence consisting of 15 to 24 nucleotides that are complementary to an exonic or intronic sequence within intron 4, exon 5A, exon 5N, intron 5A, or intron 5N, intron 17, exon 18A, exon 18N, intron 18A, or intron 18N an SCN8A pre-mRNA and an optional one or two additional nucleotides; and
a carrier for delivery of the SMO sequence to a plurality of cells.

14. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos.: 26, 33, or 40.

15. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos.: 1306, 1307, 1324, 1327, 1422, or 1541.

16. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos.:

4-39, 86-120, 169-202, 253-285, 338-369, 424-454, 511-540, 599-627, 688-715, or 778-804.

17. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos: 295-1309, 1352-1356, 1410-1424, 1469-1483, 1529-1543, 1590-1604, 1652-1666, 1715-1729, 1779-1793, 1844-1858, 1861-1869, 1889-1896, 1917-1923, 1945-1950, 1973-1977, 2001-2004, 2029-2031, 2057-2058, or 2085.

18. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos: 4-60, 86-142, 169-225, 253-309, 338-394, 424-480, 511-567, 599-655, 688-744, or 778-834.

19. The composition of claim 11 wherein the SMO sequence comprises one of SEQ ID. Nos: 860-964, 1261-1275, 1295-1309, 1317-1332, 1352-1356, 1374-1390, 1410-1424, 1432-1449, 1469-1483, 1491-1509, 1529-1543, 1551-1570, 1590-1604, 1612-1632, 1652-1666, 1674-1695, 1715-1729, 1737-1759, 1779-1793, 1801-1824, 1844-1858 1861-1869, 1889-1896, 1917-1923, 1945-1950, 1973-1977, 2001-2004, 2029-2031, 2057-2058, or 2085.

20. The composition of claims 13 to 19 wherein at least one nucleotide in said SMO contains a non-naturally occurring modification comprising at least one of a chemical composition of phosphorothioate 2′-O-methyl, phosphorothioate 2′-MOE, locked nucleic acid (LNA) including a constrained ethyl nucleic acid (cEt), peptide nucleic acid (PNA), phosphorodiamidate morpholino, cholesterol modified or any combination thereof.

21. The composition of any one of claims 13 to 19 wherein at least one of the 15 to 24 nucleotides is a phosphorothioate 2′-O-methyl modified nucleotide.

Patent History
Publication number: 20220098596
Type: Application
Filed: Dec 13, 2021
Publication Date: Mar 31, 2022
Applicants: LifeSplice Pharma LLC (Malvern, PA), LifeSplice Pharma LLC (Malvern, PA)
Inventors: Melanie TALLENT (Malvern, PA), Nicole LYKENS (Malvern, PA), Gordon LUTZ (Malvern, PA)
Application Number: 17/549,098
Classifications
International Classification: C12N 15/113 (20060101); A61K 31/7105 (20060101); C12N 15/85 (20060101); A61K 48/00 (20060101);