ZIKA VIRUS RNA VACCINES
Provided herein, in some embodiments, are Zika virus RNA vaccines and methods of producing an antigen-specific immune response in a subject.
Latest ModernaTX, Inc. Patents:
This application is a division of U.S. application Ser. No. 16/131,793, filed Sep. 14, 2018, which claims the benefit under 35 U.S.C. § 119(e) of U.S. provisional application No. 62/558,746, filed Sep. 14, 2017, each of which is incorporated by reference herein in its entirety.
BACKGROUNDZika virus (ZIKV) was identified in 1947 from a sentinel Rhesus monkey in the Zika Forest of Uganda. Historically, ZIKV circulated between Aedes species mosquitoes, non-human primates in the jungle, and episodically spilled into human populations in Africa and parts of Southeast Asia. Infection was associated with a mild, self-limiting febrile illness characterized by headache, rash, conjunctivitis, myalgia, and arthralgia. Since 2010, and especially in the context of its spread and dissemination to countries of the Western Hemisphere, more severe clinical consequences have been observed. Infection of fetuses in utero during pregnancy, particularly during the first and second trimesters, has been associated with placental insufficiency and congenital malformations including cerebral calcifications, microcephaly, and miscarriage. In adults, ZIKV infection is linked to an increased incidence of Guillain-Barré syndrome (GBS), an autoimmune disease characterized by paralysis and polyneuropathy. In addition to mosquito and in utero transmission, sexual transmission of ZIKV has been described from men-to-women, men-to-men, and women-to-men. Persistent ZIKV infection can occur, as viral RNA has been detected in semen, sperm, and vaginal secretions up to 6 months following infection. Thus, ZIKV is now a global disease with locally-acquired and travel-associated transmission through multiple routes in the Americas, Africa, and Asia. The emergence of ZIKV infection has prompted a global effort to develop safe and effective vaccines.
SUMMARYExperimental results provided herein demonstrate an unexpected improvement in efficacy with Zika virus (ZIKV) RNA vaccines encoding a Japanese encephalitis virus (JEV) signal peptide fused to a ZIKV prME protein. As shown in the Examples, the ZIKV mRNA vaccine encoding a JEV signal peptide fused to prME unexpectedly provided sterilizing immunity in non-human primates at a 20-fold lower dose relative to a ZIKV mRNA vaccine encoding a IgE signal peptide fused to prME.
Thus, in some aspects, provided herein are RNA vaccines that comprise a 5′ UTR, an ORF encoding a JEV signal peptide fused to a ZIKV prME protein, and a 3′ UTR. In some embodiments, the 5′ UTR is selected from SEQ ID NO:13 and SEQ ID NO:14. In some embodiments, the ORF comprises a sequence selected from SEQ ID NOs:1-6. In some embodiments, the 3′ UTR is selected from SEQ ID NO:15 and SEQ ID NO:16. In some embodiments, the JEV signal peptide comprises the following sequence: MWLVSLAIVTACAGA (SEQ ID NO:18). In some embodiments, the JEV signal peptide is encoded by the following sequence: AUGUGGCUGGUGUCCCUGGCCAUCGUGACA GCCUGUGCUGGCGCC (SEQ ID NO:19).
Also provided herein are methods comprising administering to a subject a RNA vaccine comprising an open reading frame (ORF) encoding a JEV signal peptide fused to a ZIKV prME protein in an effective amount to induce in the subject a ZIKV prME-specific immune response, wherein the effective amount is sufficient to provide sterilizing immunity in the subject at an at least 10-fold lower dose relative to a ZIKV mRNA vaccine encoding a IgE signal peptide fused to prME. In some embodiments, the effective amount is sufficient to provide sterilizing immunity in the subject at an at least 20-fold lower dose relative to a ZIKV mRNA vaccine encoding a IgE signal peptide fused to prME.
In some aspects, the methods comprise administering to a subject a RNA vaccine comprising an ORF encoding a JEV signal peptide fused to a ZIKV prME protein in an effective amount to reduce viral load in the subject by at least 80%, relative to a control, at 3-7 days following exposure to ZIKV, wherein the control is the viral load in a subject administered a ZIKV RNA vaccine lacking the JEV signal sequence.
In other aspects, the methods comprise administering to a subject a RNA vaccine comprising an ORF encoding a JEV signal peptide fused to a ZIKV prME protein in an effective amount to induce in the subject a ZIKV prME-specific immune response, wherein efficacy of the RNA vaccine is at least 80% relative to unvaccinated control subjects.
Zika virus (ZIKV) is a member of the Flaviviridae virus family and the flavivirus genus. In humans, it causes a disease known as Zika fever. It is related to dengue, yellow fever, West Nile and Japanese encephalitis, viruses that are also members of the virus family Flaviviridae. ZIKV is spread to people through mosquito bites. The most common symptoms of ZIKV disease (Zika) are fever, rash, joint pain, and red eye. The illness is usually mild with symptoms lasting from several days to a week. There is no vaccine to prevent, or medicine to treat ZIKV.
Provided herein, in some embodiments, are ZIKV ribonucleic acid (RNA) vaccines (e.g., mRNA vaccines) comprising a 5′ untranslated region (UTR), an open reading frame (ORF) encoding a JEV signal peptide fused to a ZIKV prME protein, and a 3′ UTR. In some embodiments, the ZIKV RNA vaccines comprise a polyA tail.
A 5′ UTR is region of an mRNA that is directly upstream (5′) from the start codon (the first codon of an mRNA transcript translated by a ribosome). A 5′ UTR does not encode a polypeptide (is non-coding). In some embodiments, a 5′ UTR of the present disclosure comprises a sequence selected from SEQ ID NO:13 and SEQ ID NO:14.
A 3′ UTR is region of an mRNA that is directly downstream (3′) from the stop codon (the codon of an mRNA transcript that signals a termination of translation) A 3′ UTR does not encode a polypeptide (is non-coding). In some embodiments, a 3′ UTR of the present disclosure comprises a sequence selected from SEQ ID NO:15 and SEQ ID NO:16.
A polyA tail is a region of mRNA that is downstream, e.g., directly downstream, from the 3′ UTR and contains multiple, consecutive adenosine monophosphates. In a relevant biological setting (e.g., in cells, in vivo), the polyA tail functions to protect mRNA from enzymatic degradation, e.g., in the cytoplasm, and aids in transcription termination, export of the mRNA from the nucleus, and translation. A polyA tail may comprise, for example, 10 to 300 adenosine monophosphates. For example, a polyA tail may comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 adenosine monophosphates. In some embodiments, a polyA tail comprises 50 to 250 adenosine monophosphates. In some embodiments, a polyA tail comprises 100 adenosine monophosphates.
In some embodiments, the ZIKV RNA vaccine comprises 5′ terminal cap, for example, 7mG(5′)ppp(5′)NlmpNp.
An open reading frame is a continuous stretch of DNA or RNA beginning with a start codon (e.g., methionine (ATG or AUG)) and ending with a stop codon (e.g., TAA, TAG or TGA, or UAA, UAG or UGA). In some embodiments, an ORF of the present disclosure is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In some embodiments, the ORF comprises the sequence of SEQ ID NO:1. In some embodiments, the ORF comprises the sequence of SEQ ID NO:2. In some embodiments, the ORF comprises the sequence of SEQ ID NO:3. In some embodiments, the ORF comprises the sequence of SEQ ID NO:4. In some embodiments, the ORF comprises the sequence of SEQ ID NO:5. In some embodiments, the ORF comprises the sequence of SEQ ID NO:6.
The ZIKV RNA vaccines (e.g., mRNA vaccines) of the present disclosure encode a JEV signal peptide (e.g., SEQ ID NO:18) fused (in frame) to a ZIKV prME protein. The particular prME sequence may be from any ZIKV strain, for example those strains as are known in the art or as otherwise described herein, such as a Brazilian strain, a Micronesian strain, or an African strain. Within the Zika family, there is a high level of homology within the prME sequence (>90%) across all strains so far isolated. The high degree of homology is also preserved when comparing the original isolates from 1947 to the more contemporary strains circulating in Brazil in 2015, suggesting that there is “drift” occurring from the original isolates. Furthermore, attenuated virus preparations have provided cross-immunization to all other strains tested, including Latin American/Asian, and African. Overall, this data suggests that cross-protection of all Zika strains is possible with a vaccine based on prME. In fact, the prM/M and E proteins of ZIKV have a very high level (99%) of sequence conservation between the currently circulating Asiatic and Brazilian viral strains.
The M and E proteins are on the surface of the viral particle. Neutralizing antibodies predominantly bind to the E protein, the preM/M protein functions as a chaperone for proper folding of E protein and prevent premature fusion of E protein within acidic compartments along the cellular secretory pathway.
In some embodiments, the ZIKV prME protein comprises a sequence selected from SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12. In some embodiments, the ZIKV prME protein comprises the sequence of SEQ ID NO:7. In some embodiments, the ZIKV prME protein comprises the sequence of SEQ ID NO:8. In some embodiments, the ZIKV prME protein comprises the sequence of SEQ ID NO:9. In some embodiments, the ZIKV prME protein comprises the sequence of SEQ ID NO:10. In some embodiments, the ZIKV prME protein comprises the sequence of SEQ ID NO:11. In some embodiments, the ZIKV prME protein comprises the sequence of SEQ ID NO:12.
ZIKV RNA vaccines (e.g., mRNA vaccines) of the present disclosure encode a JEV signal peptide fused to a prME protein. Signal peptides, comprising the N-terminal 15-60 amino acids of proteins, are typically needed for the translocation across the membrane on the secretory pathway and, thus, universally control the entry of most proteins both in eukaryotes and prokaryotes to the secretory pathway. In eukaryotes, the signal peptide of a nascent precursor protein (pre-protein) directs the ribosome to the rough endoplasmic reticulum (ER) membrane and initiates the transport of the growing peptide chain across it for processing. ER processing produces mature proteins, wherein the signal peptide is cleaved from precursor proteins, typically by a ER-resident signal peptidase of the host cell, or they remain uncleaved and function as a membrane anchor. A signal peptide may also facilitate the targeting of the protein to the cell membrane. In some embodiments, the JEV signal peptide of the present disclosure comprises the sequence of SEQ ID NO:18.
In some embodiments, a RNA (e.g., mRNA) of a ZIKV RNA vaccine of the present disclosure is chemically modified. For example, at least 80% of the uracil in the ORF may have a chemical modification selected from N1-methyl-pseudouridine and N1-ethyl-pseudouridine. In some embodiments, at least 85%, at least 90%, at least 95% or 100% of the uracil in the ORF have a chemical modification. In some embodiments, the chemical modification is in the 5-position of the uracil.
In some embodiments, at least one RNA (e.g., mRNA) of the ZIKV RNA vaccines of the present disclosure are not chemically modified, and comprise the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine.
ZIKV RNA vaccines (e.g., mRNA vaccines) of the present disclosure are typically formulated in lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises at least one ionizable cationic lipid, at least one non-cationic lipid, at least one sterol, and/or at least one polyethylene glycol (PEG)-modified lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 20-60% ionizable cationic lipid, 5-25% non-cationic lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid. In some embodiments, the ionizable cationic lipid comprises the following compound:
Data provided herein demonstrates that ZIKV mRNA vaccines encoding a JEV signal peptide fused to prME provide sterilizing immunity in non-human primates at a 20-fold lower dose relative to a ZIKV mRNA vaccine encoding a IgE signal peptide fused to prME. Thus, provided herein, in some embodiments, are methods comprising administering to a subject a RNA vaccine comprising an ORF encoding a JEV signal peptide fused to a ZIKV prME protein in an effective amount to induce in the subject a ZIKV prME-specific immune response, wherein the effective amount is sufficient to provide sterilizing immunity in the subject at an at least 5-fold lower dose relative to a ZIKV mRNA vaccine encoding a IgE signal peptide fused to prME. In some embodiments, the effective amount is sufficient to provide sterilizing immunity in the subject at an at least 10-fold lower dose relative to a ZIKV mRNA vaccine encoding a IgE signal peptide fused to prME. the effective amount is sufficient to provide sterilizing immunity in the subject at an at least 15-fold lower dose relative to a ZIKV mRNA vaccine encoding a IgE signal peptide fused to prME. the effective amount is sufficient to provide sterilizing immunity in the subject at an at least 20-fold lower dose relative to a ZIKV mRNA vaccine encoding a IgE signal peptide fused to prME.
A subject may be any mammal, including non-human primate and human subjects. Typically, a subject is a human subject.
In some embodiments, methods of the present disclosure comprise administering to a subject a RNA vaccine comprising an ORF encoding a JEV signal peptide fused to a ZIKV prME protein in an effective amount to reduce viral load in the subject by at least 80%, relative to a control (e.g., at 3-7 days following exposure to ZIKV), wherein the control is the viral load in a subject administered a ZIKV RNA vaccine lacking the JEV signal sequence. In some embodiments, the amount of ZIKV RNA vaccine administered is effective to reduce viral load in the subject by at least 85%, at least 90%, at least 95%, at least 98% or 100%. In some embodiments, the control is the viral load in a subject administered a ZIKV RNA vaccine containing an IgE signal sequence. In some embodiments, the control is the viral load in an unvaccinated subject.
In some embodiments, the methods comprise administering to a subject ZIKV vaccine comprising an ORF encoding a JEV signal peptide fused to a ZIKV prME protein in an effective amount to induce in the subject a ZIKV prME-specific immune response, wherein efficacy of the RNA vaccine is at least 60% relative to unvaccinated control subjects. For example, the efficacy of the ZIKV RNA vaccine may be at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 98%, relative to unvaccinated control subjects. In some embodiments, the efficacy of the RNA vaccine is at least 80% relative to unvaccinated control subjects. In some embodiments, the efficacy of the RNA vaccine is at least 95% relative to unvaccinated control subjects.
Vaccine efficacy may be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun. 1; 201(11):1607-10). For example, vaccine efficacy may be measured by double-blind, randomized, clinical controlled trials. Vaccine efficacy may be expressed as a proportionate reduction in disease attack rate (AR) between the unvaccinated (ARU) and vaccinated (ARV) study cohorts and can be calculated from the relative risk (RR) of disease among the vaccinated group with use of the following formulas:
Efficacy=(ARU−ARV)/ARU×100; and
Efficacy=(1−RR)×100.
Likewise, vaccine effectiveness may be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun. 1; 201(11):1607-10). Vaccine effectiveness is an assessment of how a vaccine (which may have already proven to have high vaccine efficacy) reduces disease in a population. This measure can assess the net balance of benefits and adverse effects of a vaccination program, not just the vaccine itself, under natural field conditions rather than in a controlled clinical trial. Vaccine effectiveness is proportional to vaccine efficacy (potency) but is also affected by how well target groups in the population are immunized, as well as by other non-vaccine-related factors that influence the ‘real-world’ outcomes of hospitalizations, ambulatory visits, or costs. For example, a retrospective case control analysis may be used, in which the rates of vaccination among a set of infected cases and appropriate controls are compared. Vaccine effectiveness may be expressed as a rate difference, with use of the odds ratio (OR) for developing infection despite vaccination:
Effectiveness=(1−OR)×100.
In some embodiments, the effective amount of a ZIKV RNA vaccine is sufficient to produce detectable levels of ZIKV prME protein as measured in serum of the subject at 1-72 hours post administration.
In some embodiments, the effective amount of a ZIKV RNA vaccine amount is sufficient to produce a 1,000-10,000 neutralization titer produced by neutralizing antibody against the ZIKV prME protein as measured in serum of the subject at 1-72 hours post administration. In some embodiments, the effective amount of a ZIKV RNA vaccine amount is sufficient to produce a 1,000-5,000 neutralization titer produced by neutralizing antibody against the ZIKV prME protein as measured in serum of the subject at 1-72 hours post administration. In some embodiments, the effective amount of a ZIKV RNA vaccine amount is sufficient to produce a 5,000-10,000 neutralization titer produced by neutralizing antibody against the ZIKV prME protein as measured in serum of the subject at 1-72 hours post administration.
In some embodiments, an anti-ZIKV prME protein antibody titer produced in a subject administered a ZIKV RNA vaccine is increased by at least 1 log relative to a control, wherein the control is an anti-ZIKV prME protein antibody titer produced in a subject who has not been administered a vaccine against ZIKV. In some embodiments, an anti-ZIKV prME protein antibody titer produced in a subject administered a ZIKV RNA vaccine is increased by at least 2 log relative to the control. In some embodiments, an anti-ZIKV prME protein antibody titer produced in a subject administered a ZIKV RNA vaccine is increased by at least 5 log relative to the control. In some embodiments, an anti-ZIKV prME protein antibody titer produced in a subject administered a ZIKV RNA vaccine is increased by at least 10 log relative to the control.
In some embodiments, an anti-ZIKV prME protein antibody titer produced in a subject is increased at least 2 times relative to a control, wherein the control is an anti-ZIKV prME protein antibody titer produced in a subject who has not been administered a vaccine against ZIKV. In some embodiments, an anti-ZIKV prME protein antibody titer produced in a subject is increased at least 5 times relative to a control. In some embodiments, an anti-ZIKV prME protein antibody titer produced in a subject is increased at least 10 times relative to a control.
The effective amount of a ZIKV RNA vaccine (e.g., mRNA vaccine), as provided herein, surprisingly may be as low as 20 μg, administered for example as a single dose or as two 10 μg doses. In some embodiments, the effective amount is 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg or 200 μg. In some embodiments, the effective amount is a total dose of 25 μg-200 μg.
Table 1 below provides examples of ZIKV mRNA vaccine sequences and corresponding protein sequences encoded by the vaccines.
Any of the open reading frames (ORFs) provided in Table 1 may include any of the following 5′ UTR sequences or other 5′ UTR sequence (e.g., wild-type 5′ UTR sequence):
Likewise, any of the ORFs provided in Table 1 may include any of the following 3′ UTR sequences or other 3′ UTR sequence (e.g., wild-type 3′ UTR sequence):
Further, any of the ORFs provided in Table 1 may include a polyA tail (e.g., 100 nucleotides).
In some embodiments, a ZIKV mRNA vaccine (mRNA-1893) comprises the following sequence, including a 5′ UTR, 3′ UTR and polyA tail:
Non-human primates (n=5) were immunized intramuscularly (IM) with a vaccine composition comprising mRNA encoding either an IgE signal peptide fused to a ZIKV prME antigen (mRNA-1325, SEQ ID NO:17) (a single 200 μg dose, or a 10 μg, 50 μg or 200 μg dose followed by an equivalent boost at week 4, or a JEV signal peptide fused to a ZIKV prME antigen (mRNA-1893, SEQ ID NO:7) (a 10 μg followed by an equivalent boost at week 4). Animals were challenged at week 8 with 1000 focus-forming units (FFU) of Zika virus. Serum was collected 3, 4, 5, 6 and 7 days post challenge. The data in
All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.
Claims
1. A method comprising administering to a subject a messenger ribonucleic acid (mRNA) comprising an open reading frame (ORF) encoding a Japanese encephalitis virus (JEV) signal peptide fused to a Zika virus (ZIKV) prME protein comprising a sequence having at least 90% identity to SEQ ID NO: 7, wherein the mRNA is in a composition comprising a lipid nanoparticle.
2-38. (canceled)
39. The method of claim 1, wherein 20 μg-200 μg of the mRNA is administered to the subject.
40. The method of claim 39, wherein 20 μg-60 μg of the mRNA is administered to the subject.
41. The method of claim 1, wherein a first dose and a second dose of the mRNA is administered to the subject.
42. The method of claim 1, wherein the ZIKV prME protein comprises a sequence having at least 95% identity to SEQ ID NO: 7.
43. The method of claim 42, wherein the ZIKV prME protein comprises the sequence of SEQ ID NO: 7.
44. The method of claim 1, wherein the mRNA vaccine comprises at least one modified nucleotide.
45. The method of claim 44, wherein at least 80% of uracil nucleotides in the ORF of the mRNA have a 1-methyl-pseudouridine modification.
46. The method of claim 45, wherein 100% of uracil nucleotides in the ORF of the mRNA have a 1-methyl-pseudouridine modification.
47. The method of claim 1, wherein the lipid nanoparticle comprises 20-60 mol % ionizable cationic lipid, 5-25 mol % non-cationic lipid, 25-55 mol % sterol, and 0.5-15 mol % PEG-modified lipid.
48. The method of claim 47, wherein the ionizable cationic lipid comprises the following compound:
49. A method comprising:
- administering to a subject a first dose and a second dose of a messenger ribonucleic acid (mRNA) comprising an open reading frame (ORF) encoding a Japanese encephalitis virus (JEV) signal peptide fused to a Zika virus (ZIKV) prME protein comprising a sequence having at least 95% identity to SEQ ID NO: 7, wherein the mRNA is in a composition comprising a lipid nanoparticle.
50. The method of claim 49, wherein 20 μg-60 μg of the mRNA is administered to the subject.
51. The method of claim 49, wherein at least 80% of uracil nucleotides in the ORF of the mRNA have a 1-methyl-pseudouridine modification.
52. The method of claim 51, wherein 100% of uracil nucleotides in the ORF of mRNA have a 1-methyl-pseudouridine modification.
53. The method of claim 49, wherein the lipid nanoparticle comprises 20-60 mol % ionizable cationic lipid, 5-25 mol % non-cationic lipid, 25-55 mol % sterol, and 0.5-15 mol % PEG-modified lipid.
54. The method of claim 53, wherein the ionizable cationic lipid comprises the following compound:
55. A method comprising:
- administering to a subject a first dose and a second dose of a messenger ribonucleic acid (mRNA) comprising an open reading frame (ORF) encoding a Japanese encephalitis virus (JEV) signal peptide fused to a Zika virus (ZIKV) prME protein comprising a sequence having at least 95% identity to SEQ ID NO: 7, wherein 100% of uracil nucleotides in the ORF of mRNA have a 1-methyl-pseudouridine modification, and wherein the mRNA is in a composition comprising a lipid nanoparticle, and wherein 20 μg-60 μg of the mRNA is administered to the subject.
56. The method of claim 55, wherein the lipid nanoparticle comprises 20-60 mol % ionizable cationic lipid, 5-25 mol % non-cationic lipid, 25-55 mol % sterol, and 0.5-15 mol % PEG-modified lipid.
57. The method of claim 56, wherein the ionizable cationic lipid comprises the following compound:
Type: Application
Filed: Nov 19, 2021
Publication Date: Jun 9, 2022
Applicant: ModernaTX, Inc. (Cambridge, MA)
Inventors: Giuseppe Ciaramella (Sudbury, MA), Sunny Himansu (Winchester, MA)
Application Number: 17/531,211