CHIMERIC PROTEINS FOR TARGETING dsRNA

Abstract

Described herein are recombinant chimeric proteins comprising a double stranded RNA (dsRNA) binding domain and a cancer-cell targeting domain for targeting of dsRNA to cancer cells. Methods of use of the described chimeric proteins are also provided herein.

Description

FIELD OF THE INVENTION

The present invention relates in general to recombinant chimeric proteins comprising a double stranded RNA (dsRNA) binding domain and a cancer-cell targeting domain for targeting of dsRNA to cancer cells.

Provided herein are recombinant chimeric proteins comprising a double stranded RNA (dsRNA) binding domain and a cancer-cell targeting domain for targeting of dsRNA to cancer cells. Methods of use of the described chimeric proteins are also provided herein.

BACKGROUND OF THE INVENTION

Selective delivery of drugs to tumor cells can improve efficacy and reduce toxicity. Selectivity can be obtained by utilizing a drug vehicle that can distinguish between the targeted malignant cells and untargeted non-malignant cells. High specificity towards cancer can be programmed into recombinant proteins by fusing targeting moieties and drug binding moieties. The targeting moiety must recognize cell surface molecules that are uniquely expressed on cancer cells but not on non-cancerous cells or are over-expressed in cancer cells as compared to their normal counterparts. One appropriate target is the Epidermal Growth Factor Receptor (EGFR), which is over-expressed in multiple types of human cancer and is usually associated with aggressive disease and low survival rate [25]. EGFR over-expression can be utilized to selectively deliver high quantities of polyinosine/polycytosine (polyIC) into tumor cells, while leaving normal cells unaffected, due to the low amounts of polyIC delivered. PolyIC is an attractive anti-tumor agent, as it can induce cancer cell apoptosis by activating Toll-Like Receptor 3 (TLR3) in cancer cells [26-30]. Furthermore, TLR3 activation by polyIC triggers the induction of cytokines, chemokines and other pro-inflammatory mediators [31-34], thus reinstating anti-tumor immunity [35, 36]. However, the use of polyIC is limited by its extreme toxicity and inefficient cellular uptake when delivered systemically [37, 38].

In order to limit toxicity and increase cellular uptake we have been developing vehicles for the targeted delivery of polyIC directly to tumors. In our previous studies, we employed chemical vectors that bind polyIC electrostatically, and utilize EGF or anti-HER2 affibody as homing entities towards EGFR or HER2 [38-42].

Further, prostate cancer is the second most commonly diagnosed cancer worldwide, accounting for over 25% of new cancer cases diagnosed annually among men in the US (1). In the case of metastatic prostate cancer, patients are mostly treated with androgen deprivation therapy (ADT).

While this therapy generally achieves a short-term remission, patients typically develop castration-resistant prostate cancer (CRPC). There is a great demand for novel therapies for CRPC patients, as these patients rarely respond to existing therapies and demonstrate median survival of about 3 years (1-3).

Most targeted cancer therapies today delay but rarely prevent tumor progression. As tumor cells are genomically unstable, they eventually acquire mutations and genetic alterations that allow them to evade the therapy and develop resistance. The rate of killing that is elicited by targeted agents is too slow, providing the tumors with sufficient time to adapt to the constant pressure exerted on them by the therapy. Additionally, tumors are heterogeneous and possess a number of different subpopulations. Targeted therapies usually target only some of these subpopulations and not others, and therefore cannot be expected to eradicate the entire tumor.

Metastatic CRPC typically presents a unique cell surface molecule that can be exploited for targeted therapy: prostate-specific membrane antigen (PSMA). PSMA is over-expressed at levels of up to 1000-fold at all Gleason scores (4), while over-expression increases with tumor progression (5,6). Despite the heterogeneous nature of the disease, primary tumors or metastases that are completely PSMA-negative are rare (7). While the above findings support the notion that PSMA is a highly promising therapeutic target, no PSMA-targeted therapies are currently approved for clinical use. However, few agents are in clinical trials (8-11).

Thus a continuing need exists for targeted therapy for CRPC.

SUMMARY OF THE INVENTION

The present invention is directed to an improved approach to the targeting of dsRNA to cancer cells, namely, the generation of a chimeric protein molecule that can deliver dsRNA to e.g. EGFR over-expressing cells. As a non-limiting example, the chimeric protein, dsRBEC (dsRBD-EGF-Chimera) is composed of the dsRNA-binding domain (dsRBD) of hPKR (residues 1-197) fused via a linker to hEGF (FIG. 7). The dsRBD of hPKR is composed of two copies of a dsRNA binding motif (dsRBM), which are connected through a flexible linker and can interact with dsRNA in a non-sequence specific manner [43, 44]. This dsRBD is the polyIC binding moiety of dsRBEC. EGF is used as a targeting moiety, which selectively binds EGFR and induces endocytosis. As compared with the polymeric chemical vector, the chimeric protein is precisely defined and can be produced simply and inexpensively. Unlike current anti-EGFR therapies, which target the activity of the receptor, our therapy does not inhibit the EGFR pathway but exploits the over-expression of the receptor for selectivity and for cellular entry.

Additionally described herein is an improved approach to the targeting of dsRNA to cancer cells, namely, the generation of a chimeric protein molecule that can deliver dsRNA to PSMA over-expressing cells.

The present disclosure provides a chimeric recombinant protein and encoding nucleic acids thereof which includes a double stranded RNA (dsRNA) binding domain; and a target binding moiety that binds to prostate surface membrane antigen (PSMA).

Additionally described is a complex that includes a described chimeric recombinant protein and dsRNA. Also described are uses of the described complexes in treatment of prostate cancer or inhibition of the development of tumor neovasculature, and corresponding methods of treatment of prostate cancer or inhibition of tumor neovasculature that include administering to a subject in need thereof a therapeutically effective amount of the described complex.

The foregoing and other objects, features, and advantages will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A-1E: GFP-SCP binds and selectively internalizes into PSMA over-expressing cells. FIG. 1A: Schematic representation of GFP-SCP. FIG. 1B: LNCaP, PC3 and MCF7 cells were incubated with 25 nM GFP-SCP for 5 hr. The cells were fixed and stained with anti-GFP antibody (Cy3) and 4, 6-diamidino-2-phenylindole and viewed by laser scanning confocal microscopy. FIG. 1C: LNCaP and MCF7 cells were incubated with GFP-SCP, then subjected to flow cytometric analysis. FIG. 1D: LNCaP cells were monitored by laser confocal imaging, 0 to 72 min after the addition of 200 nM GFP-SCP. Sulforhodamine-B was added to the medium immediately before adding the GFP-SCP, to mark the outside of the cells. FIG. 1E: shows GFP fluorescence inside the cell, as measured using ImageJ.

FIGS. 2A-2C: Design, expression and purification of dsRB-SCP. FIG. 2A: Schematic representation of dsRB-SCP. FIG. 2B: Expression and purification of dsRB-SCP: L: Cleared lysate, M: Molecular weight marker, E1: Eluate following IMAC (nickel sepharose column), E2: Purified dsRB-SCP eluted from IEX (Ion exchange column). Dashed lines indicate where the picture of the gel was cut and reorganized. FIG. 2C: Binding of dsRB-SCP to dsRNA: dsRB-SCP (0.5-3 μg) was preincubated with 500 bp long dsRNA and electrophoresed on a 2% agarose gel. M: 100 bp DNA molecular weight marker.

FIGS. 3A-3C: dsRB-SCP/polyIC selectively induces apoptosis of PSMA over-expressing cells. FIG. 3A: Cells were seeded in triplicate, grown overnight, and treated as indicated for 100 hr. Viability was quantified using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). FIG. 3B: Surviving cells remained permanently arrested. Cells were seeded in triplicate, grown overnight, and treated as indicated. Medium was replaced and viability was quantified after 100/172/344 hr using CellTiter-Glo. (Control cells were unable to proliferate beyond 2.5 doublings because they had reached full confluence). FIG. 3C: LNCaP cells were treated for the indicated times with dsRB-SCP/polyIC or polyIC alone, lysed and subjected to western blot analysis to detect full-length and cleaved Caspase-3 and PARP.

FIGS. 4A-4D: dsRB-SCP/polyIC leads to secretion of pro-inflammatory cytokines and recruitment of PBMCs. FIGS. 4A and 4B: LNCaP cells were treated as indicated for 48 hr, after which medium was collected and IP-10 (FIG. 4B) and RANTES cytokines (FIG. 4A) were measured by ELISA assays. FIG. 4C: LNCaP cells were treated as indicated for 4 h and IFN-β transcription was measured by qRT-PCR. FIG. 4D: dsRB-SCP/polyIC induces chemotaxis of PBMCs. LNCaP cells were grown and treated as indicated. 48 hr after treatment, the cell medium was transferred to the lower chamber of a Transwell chemotaxis plate. PBMCs were added to the upper chamber, and the plates were incubated for 3.5 hr. Then, medium was collected from the lower chamber and lymphocytes that had migrated to the lower chamber were quantified by FACS.

FIGS. 5A-5B: dsRB-SCP/polyIC induces direct and PBMC-mediated bystander effects. FIG. 5A: LNCaP-Luc/GFP cells were treated as indicated. After 24 hr, PBMC were added to the test wells (black bars), and medium was added to control wells (gray bars). Survival of LNCaP-Luc/GFP cells was measured using the Luciferase Assay System (Promega). FIG. 5B: PC3-Luc/GFP+LNCaP: LNCaP cells were treated as indicated. After 24 hr, PC3-Luc/GFPcells were added to the culture. 6 hr later, PBMCs (black bars) or medium were added to the culture (hatched bars). PC3-Luc/GFP: LNCaP growth medium was treated as indicated. After 24 hr, PC3-Luc/GFP cells were added, and 6 hr later either PBMCs (black bars) or medium (hatched bars) was added. Survival of PC3-Luc/GFP cells was measured using the Luciferase Assay System (Promega). T-test indicates high significance (***P<0.001).

FIGS. 6A-6C: dsRB-SCP/polyIC treatment together with PBMCs leads to the destruction of LNCaP spheroids. FIGS. 6A and 6C: Spheroids of R=300-400 μm were treated as follows: (a) Untreated, (b) 400 nM dsRB-SCP, (c) 2.5 μg/ml polyIC, (d) 400 nM dsRB-SCP+2.5 μg/ml polyIC. Spheroids were treated four times, on days 1, 2, 4 and 5, and then cultured for 10 additional days. Spheroid images were captured by a laser scanning confocal microscopy at the indicated times; one representative spheroid is shown per treatment. Note the prominent shedding of cells from the treated spheroid (red arrows). On Day 15, spheroids were labeled with Calcein AM (living cells; green) and Propidium Iodide (dead cells; red). Maximum areas of spheroids, measured using ImageJ, are shown in the graph (FIG. 6C) (Mean and standard deviation). FIG. 6B: Upper panel: LNCaP-Luc/GFP spheroids treated as indicated. After 24 hr, 8*10⁴ PBMCs labeled with CellTracker™ Violet BMQC (Molecular Probes-Life Technologies) were added to the spheroids. Lower panel: PBMC medium without cells was added to the spheroids. Spheroids in both panels were captured by laser scanning confocal microscopy 0, 72, 96, 168 hr after treatment initiation. Living cells were detected by their GFP fluorescence. PI was added to the spheroids in the lower panel, to highlight the dead cells. PI staining of upper panel is not shown, as there is no way to distinguish between dead LNCaP-Luc/GFP cells and dead PBMCs.

FIG. 7: Schematic description of the chimeric protein, dsRBEC. The dsRBD of hPKR enables polyIC binding and is fused via a linker to the homing moiety, hEGF. The His6 tag facilitates purification on Ni Sepharose.

FIG. 8: 125I-EGF Binding in A431 cells. A431 cells were incubated with 0-2,000 pM ¹²⁵I-EGF for 4 hours at 4° C. Total: total binding, NSB: non-specific binding; SB: specific binding. Non-specific binding was measured in the presence of 1 μM unlabeled hEGF. The data were analyzed using GraphPad Prism 5, yielding a Kd value of 138.3±30.63 pM.

FIG. 9A-9E: Purification of dsRBEC. FIG. 9A) dsRBEC was purified on Ni Sepharose under native conditions. Samples of total lysate (T), soluble fraction (S), unbound fraction (UB) and eluate (EL) were electrophoresed by SDS-PAGE. dsRBEC was visualized with Coomassie dye and by western blot analysis using an anti-His antibody. FIG. 9B) Samples of BL electrophoresed on 1% agarose and stained with ethidium bromide. Treatment with 10 μg/ml RNase A eliminated staining. FIG. 9C) dsRBEC was purified on Ni Sepharose under denaturing conditions (4M urea). Samples of total lysate (T), soluble fraction (S), unbound fraction (UB) and eluate (EL) were analyzed as in (A). FIG. 9D) Equal amounts of eluted protein, isolated under native or denaturing conditions, were electrophoresed and stained with ethidium bromide. FIG. 9E) SDS-PAGE analysis of final dsRBEC purification, (15% bis-acrylamide gel stained with Coomassie dye) T, total crude lysate before purification; Ni, eluate from 4 ml Ni Sepharose column; S-75, eluate from final purification on Superdex75 (uncropped gel can be visualized in FIG. 10).

FIG. 10A-10B: Uncropped gels showing dsRBEC purification. FIG. 10A) Ni Sepharose column. Lane 1, insoluble pellet following bacterial lysis; Lane 2, soluble lysate before purification (=T in FIG. 9E); Lane 3, unbound protein; Lane 4, molecular weight markers; Lanes 5-13 and 15 fractions eluted from Ni Sepharose (Lane 8=Ni in FIG. 9E), Lane 14, Pool of fractions represented in 8-11. FIG. 10B) Superdex75 gel filtration. Pooled fractions 8 through 11 were loaded onto 320 ml Superdex 75. Lane 1, same as lane 14 in gel A. Lanes 2-15 eluates collected from the column. The eluates in Lanes 7-11 were pooled, divided into aliquots and used for subsequent analysis. (Lane 8=8-75 in FIG. 9E).

FIG. 11A-11C: Analysis of dsRBEC activity. FIG. 11A) EMSA showing reduced mobility in 2% agarose of polyIC/dsRBEC complexes. Lane 1, polyIC (0.5n); Lanes 2-5, polyIC (0.5n) pre-incubated with dsRBEC (0.5-4 μg). FIG. 11B) Displacement of ¹²⁵I-EGF by dsRBEC (▪) or unlabeled hEGF (▴) in A431 cells. The graph shows means±SD from a representative experiment, performed using duplicate samples. The Kd was calculated as the mean from three independent experiments. FIG. 11C) Western blot analysis of EGFR phosphorylation following treatment of MDA-MB-468 cells with dsRBEC at various concentrations for 15 minutes.

FIG. 12A-12D: dsRBEC selectively introduces polyIC into EGFR over-expressing cells. FIG. 12A) Expression of EGFR in MDA-MB-468 and MCF7 cells was evaluated by FACS or FIG. 12D) by western blot as described in the Materials and Methods. FIG. 12B) Confocal live imaging of Cy3-polyIC internalization in MDA-MB-468 and MCF7 cells. Cy3-polyIC was delivered by dsRBEC (Upper row), or added directly to the cell culture medium (lower row). The figure shows Cy3-polyIC localization at time 0 (before treatment) and after 120 minutes of treatment (scale bar 20 μm). FIG. 12C) Cy3-polyIC/dsRBEC and AlexaFluor647-transferrin were added to MDA-MB-468 cells simultaneously. Endosomal localization of Cy3-polyIC/dsRBEC is indicated by its strong co-localization with the recycling endosomal marker transferrin, 60 minutes after the start of treatment. Cy3-polyIC (red), transferrin (green), merge (yellow). (Scale bar 10 μm).

FIG. 13A-13C: PolyIC/dsRBEC induces apoptosis in MDA-MB-468 but not in MCF7 cells. FIG. 13A) Survival following treatment with dsRBEC alone, polyIC alone or polyIC/dsRBEC for 72 hours was analyzed using methylene blue. Viable cells are presented as percent of vehicle-treated control (0). Upper x-axis shows concentration of dsRBEC; lower x-axis shows concentration of polyIC. For MDA-MB-468 cells, the difference between treatment with PolyIC/dsRBEC vs PolyIC alone, or vs dsRBEC alone, or versus vehicle was significant (P<0.0001) for all concentrations tested, but is shown in the figure only for 1 μg/ml polyIC, for ease of presentation. FIG. 13B) Apoptosis in MDA-MB-468 cells was evaluated by western blot showing cleaved PARP and caspase 3 following treatment with dsRBEC alone, polyIC alone or polyIC/dsRBEC for 4 hours. FIG. 13C) MDA-MB-468 and MCF7 cells were treated with dsRBEC alone, polyIC alone or polyIC/dsRBEC for 8 hours. Annexin V-FITC and PI binding were measured by flow cytometry. The percentage of stained cells is written in the right corner of the relevant quadrant.

FIG. 14A-14H: PolyIC/dsRBEC induces the expression and secretion of pro-inflammatory cytokines in MDA-MB-468 cells. FIG. 14A)-D) qRT-PCR analysis of IFN-beta, CCLS, IP-10 and TNF-alpha, mRNA expression following treatment with dsRBEC alone, polyIC alone or polyIC/dsRBEC for 2 and 4 hours. Data were normalized to GAPDH and are expressed as fold change relative to vehicle-treated samples. A representative experiment out of 3 experiments is shown. Error bars represent RQ max. FIG. 14E)-H) Protein levels of IFN-beta, CCLS, IP-10 and TNF-alpha were measured by ELISA following treatment with dsRBEC alone, polyIC alone or polyIC/dsRBEC for hours. Values are averages of triplicate biological samples from one representative experiment. (***, P<0.0001 for effect of polyIC/dsRBEC vs polyIC alone, for polyIC/dsRBEC vs dsRBEC alone and for polyIC/dsRBEC vs vehicle).

BRIEF DESCRIPTION OF THE DESCRIBED SEQUENCES

The nucleic and/or amino acid sequences provided herewith are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file named SeqList_3152_1_2.txt created Dec. 12, 2016, about 21 KB, which is incorporated by reference herein. In the Sequence Listing:

• • SEQ ID NO: 1 is the amino acid sequence of the GFP-SCP protein.
  • SEQ ID NO: 2 is a nucleic acid sequence encoding the GFP-SCP protein.
  • SEQ ID NO: 3 is the amino acid sequence of the dsRB-SCP protein.
  • SEQ ID NO: 4 is a nucleic acid sequence encoding the dsRB-SCP protein.
  • SEQ ID NO: 5 is amino acid sequence of the the Arg9 linker peptide.
  • SEQ ID NOs 6 and 7 are forward and reverse oligonucleotide primers for IFN-r3 quantification.
  • SEQ ID NOs 8 and 9 are forward and reverse oligonucleotide primers for GAPDH quantification.
  • SEQ ID NO: 10 is the nucleic acid sequence of the SCP-N primer.
  • SEQ ID NO: 11 is the nucleic acid sequence of the SCP-C primer.
  • SEQ ID NO: 12 is the nucleic acid sequence of the GFP-N primer.
  • SEQ ID NO: 13 is the nucleic acid sequence of the GFP-C primer.
  • SEQ ID NO: 14 is the nucleic acid sequence of the dsRB-N primer.
  • SEQ ID NO: 15 is the nucleic acid sequence of the dsRB-C primer.
  • SEQ ID NO: 16 is the nucleic acid sequence of the 9ARG1 primer.
  • SEQ ID NO: 17 is the nucleic acid sequence of the 9ARG2 primer.
  • SEQ ID NO: 18 is the amino acid sequence of PKR dsRNA.
  • SEQ ID NO: 19 is the nucleic acid sequence of PKR dsRNA.
  • SEQ ID NO: 20 is the amino acid sequence of ScFvJ591.
  • SEQ ID NO: 21 is the nucleic acid sequence of ScFvJ591.
  • SEQ ID NO: 22 is the amino acid sequence of GE11.
  • SEQ ID NO: 23 is the amino acid sequence of the spacer peptide.
  • SEQ ID NO: 24 is the nucleic acid sequence of a 3′ sequence of the dsRBD.
  • SEQ ID NOs: 25 and 26 are the nucleic acid sequence and amino acid sequence of the linker.
  • SEQ ID NOs: 27-36 are the nucleic acid sequences of qRT-PCR primer sequences.

DETAILED DESCRIPTION

I. Terms

Unless otherwise noted, technical terms are used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The term “comprises” means “includes.” The abbreviation, “e.g.” is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.”

In case of conflict, the present specification, including explanations of terms, will control. In addition, all the materials, methods, and examples are illustrative and not intended to be limiting.

Administration: The introduction of a composition into a subject by a chosen route. Administration of an active compound or composition can be by any route known to one of skill in the art. Administration can be local or systemic. Examples of local administration include, but are not limited to, topical administration, subcutaneous administration, intramuscular administration, intrathecal administration, In addition, local administration includes routes of administration typically used for systemic administration, for example by directing intravascular administration to the arterial supply for a particular organ. Thus, in particular embodiments, local administration includes intra-arterial administration and intravenous administration when such administration is targeted to the vasculature supplying a particular organ. Local administration also includes the incorporation of active compounds and agents into implantable devices or constructs, such as vascular stents or other reservoirs, which release the active agents and compounds over extended time intervals for sustained treatment effects.

Systemic administration includes any route of administration designed to distribute an active compound or composition widely throughout the body via the circulatory system. Thus, systemic administration includes, but is not limited to intra-arterial and intravenous administration. Systemic administration also includes, but is not limited to, topical administration, subcutaneous administration, intramuscular administration, or administration by inhalation, when such administration is directed at absorption and distribution throughout the body by the circulatory system.

Antibody: A polypeptide ligand comprising at least a light chain or heavy chain immunoglobulin variable region, which specifically recognizes and binds an epitope of an antigen, such as PSMA. Antibodies are composed of a heavy and a light chain, each of which has a variable region, termed the variable heavy (VH) region and the variable light (VL) region. Together, the VH region and the VL region are responsible for binding the antigen recognized by the antibody. As used herein, “antibody” includes intact immunoglobulins and the variants and portions of them well known in the art, such as Fab′ fragments, F(ab)′2 fragments, single chain Fv proteins (“scFv”), and disulfide stabilized Fv proteins (“dsFv”). The term also includes recombinant forms such as chimeric antibodies (for example, humanized murine antibodies), heteroconjugate antibodies (such as, bispecific antibodies).

Chimera: A nucleic acid sequence, amino acid sequence, or protein that comprises nucleic acid sequence, amino acid sequence, or protein from two or more sources, for example amino acid sequence from two or more different species. In general, chimeric sequences are the result of genetic engineering.

Expression Control Sequences: Nucleic acid sequences that regulate the expression of a heterologous nucleic acid sequence to which it is operatively linked, for example the expression of a nucleic acid encoding the chimeric recombinant proteins described herein. Expression control sequences are operatively linked to a nucleic acid sequence when the expression control sequences control and regulate the transcription and, as appropriate, translation of the nucleic acid sequence. Thus expression control sequences can include appropriate promoters, enhancers, transcription terminators, a start codon (ATG) in front of a protein-encoding gene, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons.

Functional fragments and variants of a polypeptide: Included are those fragments and variants that maintain one or more functions of the parent polypeptide. It is recognized that the gene or cDNA encoding a polypeptide can be considerably mutated without materially altering one or more the polypeptide's functions, including variants of 60%-99% sequence identity to the wildtype or parent polypeptide. First, the genetic code is well-known to be degenerate, and thus different codons encode the same amino acids. Second, even where an amino acid substitution is introduced, the mutation can be conservative and have no material impact on the essential functions of a protein. Third, part of a polypeptide chain can be deleted without impairing or eliminating all of its functions. Fourth, insertions or additions can be made in the polypeptide chain for example, adding epitope tags, without impairing or eliminating its functions. Functional fragments and variants can be of varying length. For example, some fragments have at least 10, 25, 50, 75, 100, or 200 amino acid residues. Conservative amino acid substitution tables providing functionally similar amino acids are well known to one of ordinary skill in the art. The following six groups are examples of amino acids that are considered to be conservative substitutions for one another:

1) Alanine (A), Serine (S), Threonine (T);

2) Aspartic acid (D), Glutamic acid (E);

3) Asparagine (N), Glutamine (Q);

4) Arginine (R), Lysine (K);

5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and

6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

Linker: One or more nucleotides or amino acids that serve as a spacer between two molecules, such as between two nucleic acid molecules or two peptides.

Mimetic: A mimetic is a molecule that mimics the activity of another molecule, such as a biologically active molecule. Biologically active molecules can include chemical structures that mimic the biological activities of a compound.

Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.

Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in this disclosure are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the compounds herein disclosed.

In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.

Subject: Living multi-cellular organisms, including vertebrate organisms, a category that includes both human and non-human mammals.

Therapeutically effective amount: A quantity of compound sufficient to achieve a desired effect in a subject being treated. An effective amount of a compound may be administered in a single dose, or in several doses, for example daily, during a course of treatment. However, the effective amount will be dependent on the compound applied, the subject being treated, the severity and type of the affliction, and the manner of administration of the compound.

II. Chimeras of Target-Binding Domain and Double Stranded RNA Binding Domain and their Use in Targeting Double Stranded RNA to Cancer Cells

In one aspect, the present invention provides a recombinant protein comprising a double stranded RNA (dsRNA) binding domain and a target-binding moiety. dsRNA-binding domains may readily be identified in a peptide sequence using methods available to the average person skilled in the art, such as, but not limited to, the method disclosed in U.S. Pat. No. 6,004,749 (incorporated by reference as if fully disclosed herein).

In certain embodiments, the dsRNA binding domain and the target-binding moiety are connected by a spacer peptide. In certain embodiments, the recombinant protein may further comprise a cytolytic peptide.

For purification purposes, the recombinant protein may further comprise a purification tag, such as His6 tag.

The dsRNA binding domain of any one of the recombinant proteins of the invention may comprise one or more double-stranded RNA-binding motif (dsRBM), i.e. an alpha-beta-beta-beta-alpha fold.

In certain embodiments, said one or more dsRBM is selected from a dsRBM of dsRNA dependent protein kinase (PKR), TRBP, PACT, Staufen, NFAR1, NFAR2, SPNR, RHA or NREBP, as taught by Saunders et al., 2003 (incorporated by reference as if fully disclosed herein). In particular, the dsRNA binding domain may comprise two dsRBMs of a PKR, optionally connected by a flexible linker.

In certain embodiments, the dsRNA binding domain is selected from the dsRNA binding domain of human PKR and said two dsRBMs are connected by a flexible linker; or the full length human PKR.

In certain embodiments, the dsRNA binding domain comprises amino acid residues 1-197 of human PKR.

In certain embodiments, the target-binding moiety of any one of the recombinant proteins described above comprises (i) a ligand to a cell surface receptor; (ii) an antibody, such as a humanized antibody; a human antibody; a functional fragment of an antibody; a single-domain antibody, such as a Nanobody; a recombinant antibody; and a single chain variable fragment (ScFv); (ii) an antibody mimetic, such as an affibody molecule; an affilin; an affimer; an affitin; an alphabody; an anticalin; an avimer; a DARPin; a fynomer; a Kunitz domain peptide; and a monobody; or (iii) an aptamer.

In certain embodiments, the target-binding moiety of any one of the recombinant proteins described above binds a tumor-associated antigen, such as, but not limited to, epidermal growth factor receptor (EGFR), human epidermal growth factor receptor 2 (HER2), prostate surface membrane antigen (PSMA), fibroblast growth factor receptor (FGFR), colony stimulating factor 1 receptor (CSF-1R), platelet-derived growth factor receptors (PDGFR), insulin-like growth factor 1 receptor (IGF-1R) and MET.

In certain embodiments, the target-binding moiety is an EGFR ligand, such as an EGF or the peptide GE11 of the sequence YHWYGYTPQNVI (SEQ ID NO:22); an anti-EGFR antibody, such as an anti-EGFR scFv or a humanized or human anti-EGFR antibody; or an anti-EGFR affibody. One example of an anti-EGFR antibody that may be used in accordance with the present invention is Erbitux (The biologic effects of C225, a chimeric monoclonal antibody to the EGFR, on human prostate carcinoma. Prewett M, Rockwell P, Rockwell R F, Giorgio N A, Mendelsohn J, Scher H I, Goldstein N I. J Immunother Emphasis Tumor Immunol. 1996 November;19(6):419-27). Examples of EGF affibodies that may be used in accordance with the present invention may be found in Friedman M, Nordberg E, Hoiden-Guthenberg I, Brismar H, Adams G P, Nilsson F Y, Carlsson J, Stahl S Phage display selection of Affibody molecules with specific binding to the extracellular domain of the epidermal growth factor receptor. Protein Eng Des Sel. 2007 April; 20(4):189-99 (incorporated by reference as if fully disclosed herein).

In certain embodiments, the EGF is human EGF and the EGFR is human EGFR.

In certain embodiments, the target-binding moiety is a human anti-epidermal growth factor receptor 2 (HER2) antibody, such as an anti-HER2 scFv or a humanized or human anti-HER2 antibody; or an anti-HER2 affibody. Example of anti-HER2 affibodies that may be used in accordance with the present invention may be found in Wikman M, Steffen A C, Gunneriusson E, Tolmachev V, Adams G P, Carlsson J, Stahl S. Selection and characterization of HER2/neu-binding affibody ligands. Protein Eng Des Sel. 2004 May; 17(5):455-62 (incorporated by reference as if fully disclosed herein).

In certain embodiments, the target-binding moiety is a prostate surface membrane antigen (PSMA) ligand, such as DUPA or an analog thereof; an anti-P SMA antibody, such as an anti-PSMA scFv or a humanized or human anti-PSMA antibody (e.g. the full length antibody J591; He Liu, Peggy Moy, Sae Kim, Yan Xia, Ayyappan Rajasekaran, Vincent Navarro, Beatrice Knudsen, and Neil H. Bander. Monoclonal Antibodies to the Extracellular Domain of Prostate-specific Membrane Antigen Also React with Tumor Vascular Endothelium); or an anti-PSMA afflbody. Cancer Research Volume. 57, Issue. 17, pp. 3629-3634)

In certain embodiments, the PSMA is human PSMA.

In certain embodiments, a spacer peptide may connect between the dsRNA binding domain and the target-binding moiety of any one of the recombinant proteins described above.

In certain embodiments, the spacer peptide is selected from an oligopeptide comprising a protease recognition sequence; a homo-oligopeptide of a positively charged amino acid (at physiological pH), such as arginine; a peptide of the sequence ACSGSACSGSAGNRVRRSVGSSNG (SEQ ID NO:23) or a homolog thereof a cytolytic peptide; or a combination thereof.

In certain embodiments, the homo-oligopeptide of arginine is Arg8.

In certain embodiments, a cytolytic peptide may be present within the sequence of any one of the recombinant proteins described above.

In certain embodiments, the cytolytic peptide is selected from Melittin or Candidalysin.

In certain embodiments, the cytolytic peptide is positioned in a location where it does not negatively affect the binding affinity of the target-binding moiety to its target or the binding of the dsRNA binding domain with the dsRNA, and may therefore be placed within the spacer peptide or within the N-terminus of the recombinant protein.

In certain embodiments, the recombinant protein of the present invention comprises the dsRNA binding domain of human PKR wherein said two dsRBMs are connected by a flexible linker; and a target-binding moiety selected from an anti-human EGFR antibody, an anti-human HER2 antibody and an anti-PSMA antibody, wherein said dsRNA binding domain and said target-binding moiety are connected by an Arg8 spacer peptide.

In certain embodiments, the recombinant protein of the present invention comprises the dsRNA binding domain of human PKR wherein the two dsRBMs are connected by a flexible linker; and an anti-human EGFR antibody connected by an Arg8 peptide. In certain embodiments, the recombinant protein of the present invention comprises the dsRNA binding domain of human PKR wherein the two dsRBMs are connected by a flexible linker; and an anti-human HER2 antibody connected by an Arg8 peptide.

In certain embodiments, the recombinant protein of the present invention comprises the dsRNA binding domain of human PKR wherein the two dsRBMs are connected by a flexible linker; and an anti-human PSMA antibody connected by an Arg8 peptide.

In certain embodiments, any one of the recombinant proteins described above is essentially free of RNA.

In another aspect, the present invention is directed to a complex comprising any one of the recombinant proteins described above and dsRNA. Preferably, the recombinant protein is essentially free of contaminating dsRNA remaining from the manufacturing process of the recombinant protein.

In certain embodiments, the dsRNA of the complex is PKR-activating dsRNA, such as dsRNA comprising a polyinosinic acid strand and a polycytidylic acid strand (poly IC).

In certain embodiments, the poly IC comprises at least 22 ribonucleotides in each strand, for example, 85-300 ribonucleotides in each strand.

In certain embodiments, the dsRNA of the complex comprises at least on siRNA sequence directed against e.g. a pro-oncogenic protein, such as, but not limited to, Bcl-xl, Bch 2, Mcl-1, Stat3, Pkb/Akt.

In certain embodiments, the complex comprises the dsRNA binding domain of human PKR wherein said two dsRBMs are connected by a flexible linker; and a target-binding moiety selected from an anti-human EGFR antibody, an anti-human HER2 antibody and an anti-PSMA antibody, wherein said dsRNA binding domain and said target-binding moiety are connected by an Arg8 spacer peptide, and said poly IC or siRNA is non-covalently associated with said dsRNA binding domain.

In a further aspect, the present invention provides a pharmaceutical composition comprising any one of the complexes described above and a pharmaceutically acceptable carrier.

In an additional aspect, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding any one of the recombinant proteins described above.

In certain embodiments, the sequence is optimized for expression in a bacterial or plant host cell, preferably a plant host cell.

In yet an additional aspect, the present invention provides a vector comprising at least one control element, such as a promoter and terminator, operably linked to any one of the nucleic acid molecules described above, wherein said at least one control element is optimized for expression in a bacterial or plant host cell, preferably a plant host cell.

In still another aspect, the present invention is directed to a method for manufacturing a recombinant protein comprising a dsRNA binding domain and a target-binding moiety, comprising expressing any one of the nucleic acid molecules or vectors described above in a bacterial or plant cell and extracting said recombinant protein from said cells.

In certain embodiments, the method further comprises a step of removing contaminating host cell RNA from and isolating said recombinant protein, for example by contacting said recombinant protein with urea, e. g. 4M urea, and refolding said recombinant protein.

In certain embodiments, the method comprises expressing the nucleic acid molecule or vector in a plant cell, such as a tobacco or carrot cell, either in suspension or in a whole plant.

In yet a further aspect, the present invention provides a method for treatment of cancer characterized by expression of a tumor-associated antigen, said method comprising systemically administering to a patient in need any one of the complexes or pharmaceutical composition described above.

In certain embodiments, the cancer is selected from a cancer characterized by EGFR-over-expressing cells, a cancer characterized by HER2-overexpressing cells and prostate cancer.

In certain embodiments, the cancer characterized by EGFR-overexpressing cells is selected from non-small-cell-lung-carcinoma, breast cancer, glioblastoma, head and neck squamous cell carcinoma, colorectal cancer, adenocarcinoma, ovary cancer, bladder cancer or prostate cancer, and metastases thereof.

In certain embodiments, the cancer characterized by HER2-overexpressing cells is selected from breast cancer, ovarian cancer, stomach cancer, and aggressive forms of uterine cancer, such as uterine serous endometrial carcinoma.

In certain embodiments, the cancer characterized by HER2-overexpressing cells is Herceptin/trastuzumab resistant cancer.

In certain embodiments, the complex administered to said patient comprises the dsRNA binding domain of human PKR wherein said two dsRBMs are connected by a flexible linker; and a target-binding moiety selected from an anti-human EGFR antibody, an anti-human HER2 antibody and an anti-PSMA antibody, wherein said dsRNA binding domain and said target-binding moiety are connected by an Arg8 spacer peptide, and said poly IC or siRNA is non-covalently associated with said dsRNA binding domain.

In certain embodiments, the method further comprises administering immune cells, such as tumor-infiltrating T-cells (T-TILs), tumor specific engineered T-cells, or peripheral blood mononuclear cells (PBMCs).

III. Overview of Several Embodiments

Described herein is a chimeric recombinant protein which includes a double stranded RNA (dsRNA) binding domain; and a target binding moiety that binds to prostate surface membrane antigen (PSMA).

In particular embodiments, the chimeric recombinant protein further includes a spacer peptide between the dsRNA binding domain and the target binding moiety.

In some embodiments, dsRNA binding domain of the chimeric recombinant protein includes at least one double-stranded RNA-binding motif (dsRBM), such as a dsRBM of dsRNA dependent protein kinase (PKR), TRBP, PACT, Staufen, NFAR1, NFAR2, SPNR, RHA, or NREBP. In one example the at least one dsRBM includes a polypeptide sequence at least 70% identical to amino acids 1-197 of human PKR as set forth as SEQ ID NO: 18.

In particular embodiments of the chimeric recombinant protein, the target binding moiety is a polypeptide, antibody, antibody fragment, or antibody mimetic.

In other particular embodiments of the chimeric recombinant protein, the spacer peptide is selected from an oligopeptide comprising a protease recognition sequence; a homo-oligopeptide of a positively charged amino acids; and a combination thereof. In one examplea, the spacer peptide is a homo-oligopeptide of arginine.

In a particular embodiment of the described chimeric recombinant protein, the double stranded RNA (dsRNA) binding domain is at least one dsRNA binding domain of human PKR as set forth in SEQ ID NO: 18, or a functional variant thereof, the spacer peptide is ARG9 as set forth in SEQ ID NO: 5, or a functional variant thereof, and the target binding moiety is a single chain anti-PSMA antibody as set forth in SEQ ID NO: 20, or a functional variant thereof.

In another particular embodiment, the chimeric recombinant protein includes a polypeptide at least 70% identical to the sequence set forth as SEQ ID NO: 3.

Additionally described herein is a complex which includes the described chimeric recombinant protein and dsRNA, such as a dsDNA including a polyinosinic acid strand and a polycytidylic acid strand (poly IC).

In particular embodiments, the described complexes are used in treatment of prostate cancer or inhibition of the development of tumor neovasculature, such as in methods of treatment for prostate cancer or inhibition of tumor neovasculature which include administering to a subject in need thereof a therapeutically effective amount of the described complex thereby treating the cancer or inhibiting growth of tumor neovasculature.

In some embodiments of the described methods, the complex is administered systemically or locally. In other embodiments, the methods further include administering to the subject a therapeutically effective amount of peripheral blood mononuclear cells (PBMCs).

Further described herein are nucleic acids that encode any of the described chimeric recombinant proteins.

In particular embodiments, the described nucleic acid sequences are optimized for expression in a bacterial or plant host cell.

III. Chimeric Polypeptides for Targeting dsRNA to PSMA-Expressing Cells

Described herein are chimeric recombinant polypeptides that can be used to target dsRNA to a cell expressing prostate-specific membrane antigen (PSMA). The described chimeric recombinant polypeptides include at least a dsRNA binding domain and a domain (also referred to herein as a moiety) that specifically targets PSMA. In particular embodiments, the described polypeptides also include a linker between the dsRNA binding domain and the target binding domain. Functional variants of the chimeric recombinant polypeptides are also described.

dsRNA-binding domains may readily be identified in a peptide sequence using methods available to the average person skilled in the art. The dsRNA binding domain of any one of the described recombinant proteins may include one or more double-stranded RNA-binding motif (dsRBM), such as an alpha-beta-beta-beta-alpha fold.

In certain embodiments said one or more dsRBM is selected from a dsRBM of dsRNA dependent protein kinase (PKR), TRBP, PACT, Staufen, NFAR1, NFAR2, SPNR, RHA or NREBP. In particular, the dsRNA binding domain may comprise two dsRBMs of a PKR, optionally connected by a flexible linker.

In a particular embodiment, the dsRNA binding domain is the dsRNA binding domain of human dsRNA dependent protein kinase (PKR), or a functional variant thereof, including a polypeptide that shares about 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% sequence identity with the amino acid sequence set forth herein as SEQ ID NO: 18.

In certain embodiments, the target-binding moiety of any one of the recombinant proteins described herein includes (i) a ligand to a cell surface receptor; (ii) an antibody, such as a humanized antibody; a human antibody; a functional fragment of an antibody; a single-domain antibody, such as a Nanobody; a recombinant antibody; and a single chain variable fragment (ScFv); or (iii) an antibody mimetic, such as an affibody molecule; an affilin; an affimer; an affitin; an alphabody; an anticalin; an avimer; a DARPin; a fynomer; a Kunitz domain peptide; and a monobody,

In certain embodiments, the target-binding moiety is a prostate surface membrane antigen (PSMA) ligand, such as DUPA or an analog thereof; an anti-PSMA antibody, such as an anti-PSMA scFv or a humanized or human anti-PSMA antibody (e.g. the full length antibody J591); or an anti-PSMA affibody.

In a particular embodiment, the PSMA targeting moiety is a single chain antibody against PSMA, ScFvJ591, or a functional variant thereof, including a polypeptide that shares about 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% sequence identity with the amino acid sequence set forth herein as SEQ ID NO: 19.

The described spacer peptide can be any oligopeptide known in the art for connecting two functional domains of a polypeptide chimera. In certain embodiments, the spacer peptide (linker) includes an oligopeptide comprising a protease recognition sequence; or a homo-oligopeptide of a positively charged amino acid (at physiological pH), such as arginine.

In a particular embodiment, the linker (spacer peptide) between the dsRNA binding domain and the target binding moiety is the ARG9 peptide, or a functional variant thereof, including a polypeptide that shares about 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% sequence identity with the amino acid sequence set forth herein as SEQ ID NO: 5.

In a particular embodiment, the chimeric recombinant polypeptide is the polypeptide having the amino acid sequence set forth herein as SEQ ID NO: 3, or a functional variant thereof, including a peptide that shares about 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% sequence identity with SEQ ID NO: 4.

In other embodiments the variation from the described sequence can be conservative substitutions that one of skill will not expect to significantly alter the shape or charge of the polypeptide. The described polypeptides also include those polypeptides that share 100% sequence identity to those indicated, but which differ in post-translational modifications from the native or natively-produced sequence.

In particular embodiments, the described recombinant polypeptides are provided as a discrete biomolecules. In other embodiments, the described polypeptides are a domain of a larger polypeptide, such as an independently-folded structural domain, or an environment-accessible functional domain.

Additionally described herein is a complex that includes any one of the described recombinant proteins and dsRNA. In certain embodiments, the dsRNA of the complex is PKR-activating dsRNA, such as dsRNA comprising a polyinosinic acid strand and a polycytidylic acid strand (poly IC). In certain embodiments, the poly IC includes at least 22 ribonucleotides in each strand, for example, 85-300 ribonucleotides in each strand. In certain embodiments, the dsRNA of the complex comprises at least one siRNA sequence directed against a pro-oncogenic protein, such as, but not limited to, Bcl-xl, Bcl-2, Mcl-1, Stat3, Pkb/Akt.

In particular embodiments, the described complexes are a component of a pharmaceutical composition that includes a pharmaceutically acceptable carrier as described above.

Also provided herein are nucleic acids encoding the described chimeric recombinant polypeptides, such as the nucleic acid set forth herein as SEQ ID NO: 4.

It will be appreciated that due to degeneracy of the genetic code, the sequences of the described nucleic acids can vary significantly from the sequence set forth herein as SEQ ID NO 4; and without any change in the encoded polypeptide. Other and/or additional mutations in the described polypeptides, such as conservative amino acid mutations, can also be included without an appreciable difference. Accordingly, in some embodiments, the described nucleic acids share between 60%-100% sequence identity with SEQ ID NO 4, such as 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% sequence identity. In a particular example, the nucleic acid sequence is adjusted to account for natural codon bias in a particular organism such as a bacterial or plant cell. Such adjustments are known to the art, and can be found (12)

In particular embodiments, the described nucleic acid sequences are contained within a DNA cloning and/or expression plasmid as are standard in the art. It will be appreciated that any standard expression plasmid can be used to express one or more of the described chimeric polypeptide-encoding nucleic acids. Such plasmids will minimally contain an origin of replication, selection sequence (such as, but not limited to an antibiotic resistance gene), and expression control sequences operably linked to the described nucleic acid. In particular embodiments, the expression plasmids include post-translational sequences (e.g. signal sequences to direct polypeptide processing and export) that are encoded in-frame with the described nucleic acids. In particular embodiments, the expression control sequences are those known to the art for optimized expression control in a bacterial or plant host.

Particular non-limiting examples of bacterial expression plasmids include IPTG-inducible plasmids, arabinose-inducible plasmids and the like. Other non-limiting examples of expression induction include light induction, temperature induction, nutrient-induction, and autoinduction, plant and mammalian-specific DNA expression plasmids. Custom-made expression plasmids are commercially available from suppliers such as New England Biolabs (Ipswich, Mass.) and DNA 2.0 (Menlo Park, Calif.).

In particular embodiments, the described polypeptides can be formulated for immediate release, whereby they are immediately accessible to the surrounding environment, thereby providing an effective amount of the active agent(s), upon administration to a subject, and until the administered dose is metabolized by the subject.

In yet another embodiment, the described polypeptides can be formulated in a sustained release formulation or system. In such formulations, the therapeutic agents are provided for an extended duration of time, such as 1, 2, 3, 4 or more days, including 1-72 hours, 24-48 hours, 16-36 hours, 12-24 hours, and any length of time in between. In particular embodiments, sustained release formulations are immediately available upon administration, and provide an effective dosage of the therapeutic composition, and remain available at an effective dosage over an extended period of time. In other embodiments, the sustained release formulation is not immediately available within the subject and only becomes available, providing a therapeutically effective amount of the active compound(s), after the formulation is metabolized or degraded so as to release the active compound(s) into the surrounding environment.

In one embodiment, a pump may be used. In another embodiment, the sustained released formulations include polymeric materials commonly used in the art, such as in implants, gels, capsules, and the like.

Therapeutic preparations will contain a therapeutically effective amount of at least one active ingredient, preferably in purified form, together with a suitable amount of carrier so as to provide proper administration to the patient. The formulation should suit the mode of administration.

IV. Methods of Treatment of PSMA-Associated Diseases

PSMA expression is associated with cancerous cells, particularly prostate cancer and tumor-associated neovasculature (13). In yet a further aspect, the present disclosure provides a method for treatment of cancer characterized by expression of a PSMA, said method by administering to a subject in need thereof, any one of the complexes or pharmaceutical composition described herein.

In some embodiments, the described complex is administered to the subject in combination with other pharmaceutical agents for treatment of the cancer under treatment. For example, in particular examples of cancer treatment, administration of the described can be combined with surgery, cell therapy, chemotherapy and/or radiation therapy. The one or more therapies in combination with the described polypeptides can be administered to the subject in sequence (prior to or following) or concurrently with the described polypeptides. Where applicable, in particular embodiments, combinations of active ingredients can be administered to a subject in a single or multiple formulations, and by single or multiple routes of administration. In particular embodiments, the methods of treatment include the sequential or concurrent administration of peripheral blood mononuclear cells (PBMCs).

The amount of each therapeutic agent for use in the described methods, and that will be effective, will depend on the nature of the cancer to be treated, as well its stage of the disorder or condition. Therapeutically effective amounts can be determined by standard clinical techniques. The precise dose to be employed in the formulation will also depend on the route of administration, and should be decided according to the judgment of the health care practitioner and each patient's circumstances. The specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors, including the activity of the specific compound, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, and severity of the condition of the host undergoing therapy.

The therapeutic compounds and compositions of the present disclosure can be administered at about the same dose throughout a treatment period, in an escalating dose regimen, or in a loading-dose regime (e.g., in which the loading dose is about two to five times the maintenance dose). In some embodiments, the dose is varied during the course of a treatment based on the condition of the subject being treated, the severity of the disease or condition, the apparent response to the therapy, and/or other factors as judged by one of ordinary skill in the art. In some embodiments long-term treatment with the drug is contemplated.

The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.

EXAMPLES

Example 1: Methods

Cloning of GFP-SCP and dsRB-SCP

Plasmids pGFP-SCP (encoding GFP linked via Arg9 to the single chain antibody, ScFvJ591, against PSMA; 56 kDa) and psRB-SCP (encoding dsRB of human PKR linked via Arg9 to ScFvJ591; 48 kDa) (FIG. 1A) were constructed as follows:

SCP (single chain antibody against PSMA, ScFvJ591) was amplified by PCR from plasmid SFG-Pz1 (14), using primers SCP-N and SCP-C. GFP was amplified by PCR from plasmid pEGFP-N3 (Clontech), using primers GFP-N and GFP-C. dsRB was amplified by PCR from plasmid DRBM-DT-EGF (15) using primers dsRB-N and dsRB-C. To prepare the Arg9 linker (GSRRRRRRRRGRKA; SEQ ID NO: 5), oligonucleotide 9ARG1 was annealed to its complementary oligonucleotide 9ARG2. The oligonucleotides used are listed in Table 1. GFP-SCP was constructed in stages in the bacterial expression vector pET28a (Novagen): GFP was cloned after the His₆ tag of plasmid pET28a, between the Ndel and BamHI restriction sites, SCP was cloned between the HindIII and XhoI sites, and the Arg9 linker was inserted between the BamH1 and HindIII sites, to give the fusion His₆-GFP-Arg9-SCP (FIG. 1A). For the construction of dsRB-SCP, the GFP fragment was replaced with the dsRB sequence using restriction sites Ndel and BamHI to give the fusion His₆-dsRB-Arg9-SCP (FIG. 2A). The expected sequences were confirmed at The Center for Genomic Technologies at The Hebrew University of Jerusalem (Supplementary).

TABLE 1
Oligonucleotides used for the
construction of pGFP-SCP and
psRB-SCP.
Name   Sequence 5′ to 3′
SCP-N  TTTACTCGAGCGGAGGTGCAGCTGCAGC
       (SEQ ID NO: 10)
SCP-C  TTTTGCTCAGCGCCGTTACAGGTCCAGC
       CATG (SEQ ID NO: 11)
GFP-N  TTTTCATATGGTGAGCAAGGGCG
       (SEQ ID NO: 12)
GFP-C  TAAGGATCCGCCACCGCCGCTTTT
       CTTGTACAGC(SEQ ID NO: 13)
dsRB-N TTTCATATGATGGCTGGTGATC
       (SEQ ID NO: 14)
dsRB-C TTAGGATCCGCCACCGCCGCTCTCCGA
       TAAGATCTGCAG
       (SEQ ID NO: 15)
9ARG1  GATCCCGTCGTCGCCGTCGTCGCCGTC
       GCGGCCGCAA
       (SEQ ID NO: 16)
9ARG2  AGCTTTGCGGCCGCGACGGCGACGACG
       GCGACGACGG
       (SEQ ID NO: 17)

Expression of GFP-SCP and dsRB-SCP

The chimeric proteins were expressed in E. coli BL21trxB(DE3) (Novagen) which had been transformed with plasmid pRARE, which encodes tRNAs for rare codons. The bacteria were grown at 37° C., in 2xYT medium, supplemented with 25 μg/ml chloramphenicol, 30 μg/ml kanamycin, 100 μg/ml ampicillin, 1% glucose and 5% NPS buffer (1M KH₂PO₄, 1M Na₂HPO₄, 0.5M (NH₄)₂SO₄). When the culture reached OD₆₀₀˜0.3, 0.1% glycerol and 0.1 mM L-glutamic acid were added, and the culture was moved to 42° C., to induce the expression of E. coli chaperones and enhance protein solubility. When the culture reached O.D₆₀₀˜0.9, it was cooled down on ice and transferred to 14° C. After a 10 min adjustment period, 0.5 mmol/L IPTG was added, followed by incubation for 24 h. The bacteria were harvested and the pellet stored at −80° C. until purification.

Purification of GFP-SCP and dsRB-SCP

GFP-SCP: The pellet obtained from 1.2 L of E. coli BL21trxB(DE3, pRARE, pGFP-SCP) was thawed on ice in 60 ml binding buffer (Buffer A, 30 mM HEPES pH 8.3, 0.5M NaCl, 10% glycerol, 10 mM imidazole) supplemented with a protease inhibitor cocktail, 3 mg/ml lysozyme and DNase, and lysed using a LV1 microfluidizer (Microfluidics). The extract was clarified by centrifugation for 30 min (15,000×g, 4° C.), loaded onto an 8 ml nickel sepharose FF IMAC column (GE Healthcare), and washed with 10 column volumes (CV) of binding buffer, followed by 6 CV of 5% Buffer B (30 mM HEPES pH 8.3, 0.5M NaCl, 10% glycerol, 1M imidazole), 6 CV of 10% Buffer B and 1 CV of 15% Buffer B. The protein was eluted with 60% Buffer B. Fractions containing the chimera (8 ml total) were loaded on a 500 ml sephacryl S-200 gel filtration column (GE Healthcare) pre-equilibrated with GF buffer (30 mM HEPES pH 8.3, 0.5M NaCl, 10% glycerol). The fractions eluted after 0.5 CV were pooled, concentrated using Vivaspin-20 (MWCO: 30000, GE Healthcare) and loaded onto 350 ml superdex-75. The fractions eluted after 0.5 CV were subjected to SDS-PAGE and stained with InstantBlue (Expedeon). The fractions that contained highly purified chimera were pooled, concentrated using Vivaspin-20 (GE Healthcare), and stored in aliquots at −80° C.

dsRB-SCP: The pellet obtained from 6 L of E. coli BL21trxB(DE3, pRARE, pdsRB-SCP) was thawed in 300 ml binding buffer A supplemented with protease inhibitors, lysozyme and DNase, lysed and clarified as above. To release bound host nucleic acids, the cleared lysate was mixed 1:1 (vol:vol) with 8M urea. The mixture was incubated at 4° C. for 1.5 hr and then loaded onto 60 ml nickel sepharose FF column pre-equilibrated with buffer C (Buffer A supplemented with 0.5% Tween 80 and 4M urea), and washed with 12.4 CV Buffer C. To refold the protein, a slow linear gradient of Buffer C to Buffer D (Buffer A supplemented with 0.5% Tween 80), 10 CV, 0.8 ml/min flow was applied. The column was washed with 3 CV of 10% and 3 CV of 25% Buffer E (30 mM HEPES pH 8.3, 0.5M NaCl, 10% glycerol, 500 mM imidazole, 0.5% Tween 80), and the protein was eluted with 100% buffer E. The fractions containing the chimera were pooled and diluted 1:1 with dilution buffer (30 mM MES pH, 10% Glycerol, 0.5% Tween). The diluted protein was clarified by centrifugation for 30 min (15,000×g, 4° C.) and loaded onto a 66 ml Fracto-gel EMD SO3 IEX column (Merck). A manual step gradient (7 CV) of Buffer F (30 mM MES pH, 100 mM NaCl, 10% Glycerol, 0.001% Tween) and 25%, 27%, 30%, 37% and 38% Buffer G (30 mM HEPES pH 8.3, 2M NaCl, 10% glycerol, 0.001% Tween 80) was applied. Samples of the eluted fractions were subjected to SDS-PAGE and stained with InstantBlue (Expedeon). Fractions that contained purified chimera were pooled, concentrated, and stored at −80° C. as above.

Cell Lines

LNCaP cells were cultured in RPMI 1640 medium supplemented with 10 mM HEPES pH 7.4 and 1 mM sodium pyruvate. VCaP cells were cultured in DMEM (Dulbecco's Modified Eagle Medium). PC3 and DU145 cells were cultured in MEM (Minimum Essential Medium) supplemented with 1% non-essential amino acids, 1 mM sodium pyruvate, 10 mM Hepes pH 7.4 and 1% MEM vitamin mixture. MCF7 cells were cultured in RPMI 1640 medium. All tissue culture media were supplemented with penicillin (100 U/ml), streptomycin (100 mg/1) and 10% FBS (fetal bovine serum). All cell lines were purchased from the American Type Culture Collection (ATCC), tested and shown to be mycoplasma-free.

LNCaP-Luc/GFP and PC3-Luc/GFP were generated using lentiviral vectors encoding the fusion gene luciferase-GFP (Luc/GFP) as previously described (16). PBMCs were isolated from fresh human peripheral blood by standard Ficoll density-gradient centrifugation (17). All cells were incubated at 37° C. with 5% CO₂ in a humidified incubator. All cell culture reagents were purchased from Biological Industries, Bet Ha'emek, and Israel.

Flow Cytometry

Cells were plated onto 12-well plates at a density of 1×10⁵ cells per well, grown for 40 hr and incubated with GFP-SCP. After incubation cells were trypsinized, washed in PBS, resuspended in lml cold PBS and subjected to flow cytometry analysis using BD FACS ARIAIII (BD Biosciences, USA) equipped with 488 nm laser. 10,000 cells were acquired for each treatment. The cells were gated to include only live cells and the subpopulation was analyzed for GFP levels. All data was analyzed using FlowJo software (Becton Dickinson).

Immunocytochemistry

LNCaP, PC3 and MCF7 cells were grown for 48 hr and incubated with 25 nM GFP-SCP for 5 hr at 37° C. After incubation cells were fixed with 4% Paraformaldehyde, washed twice with PBS, permeabilized and stained with goat anti-GFP antibody (1:1000, Abcam ab5450), followed by incubation with DyLight 488-conjugated anti-goat secondary antibody (1:300, Jackson ImmunoResearch Laboratories). 4, 6-diamidino-2-phenylindole (DAPI) was used to stain DNA. Stained samples were observed with a confocal microscope (FLUOVIEW FV-1000, Olympus, Japan).

Live Cell Imaging

GFP-SCP localization was observed in live LNCaP cells, using time-lapse confocal microscopy (FLUOVIEW FV-1000, Olympus, Japan). LNCaP cells were grown for 48 hr in 8-well μ-slides (Ibidi, cat no 80826). After changing the medium, 200 nM GFP-SCP was added directly to the chamber, the cells were immediately observed and subsequent images were taken every 6 minutes, for 72 mins. The images were analyzed using FLUOVIEW Viewer software (Ver.4.2).

dsRNA Electrophoretic Mobility Shift Assay (EMSA)

500 bp long dsRNA transcribed from the control template of the MEGAscript® RNAi Kit (AM1626) was labeled using the Label I T® Nucleic Acid Labeling Reagents kit (Mirus). 1 μg of labeled dsRNA was incubated for 30 minutes with increasing amounts of purified dsRB-SCP (0.5-3 μg), and the mixture was electrophoresed on a 2% agarose gel. The gel was visualized by staining with ethidium bromide.

Preparation of dsRB-SCP/polyIC Complex

PolyIC used for all experiments was low molecular weight (LMW) polyIC (InvivoGen). For all experiments, dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone was prepared in binding buffer (30 mM HEPES pH 8.3, 0.5M NaCl, 10% glycerol) at the concentrations indicated in the text, and pre-incubated for 45 minutes at room temperature, before addition to the cells.

Survival Assay

LNCaP, VCaP, PC3 and MCF7 cells were seeded in 96-well plates in triplicate (5000 cells/well) and grown overnight. dsRB-SCP/polyIC, polyIC alone or dsRB-SCP was added to the cells, which were then incubated for additional 100 hr. Survival was measured using the CellTiter-Glo Luminescent Cell Viability Assay (Promega).

For the rescue experiment, LNCaP cells were seeded (5000 cells/well) in three 96-well plates pre-coated with poly-lysine. For each plate, treatments were repeated in triplicate wells and the cells were grown overnight. The cells were then treated with dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone. The first plate was assayed for survival after 100 hr. The medium in the second plate was changed after 100 hr and survival was assayed after 172 hr. The medium in the third plate was changed after 100 hr and again after 172 hr and survival was assayed after 344 hr.

Immunoblots

LNCaP cells were seeded in 6-well plates (1×10⁶ cells/well), grown overnight and treated with dsRB-SCP/polyIC or polyIC alone at the indicated concentrations. After 7, 16 or 24 hr cells were lysed with boiling Laemmli sample buffer (10% glycerol, 50 mmol/L Tris-HCl, pH 6.8, 3% SDS, and 5% 2-mercaptoethanol) and the lysates were then subjected to western blot analysis (18). The cleavage of PARP and caspase-3 was monitored using anti-PARP (cat #95425), anti-caspase3 (cat #96625) and anti-cleaved caspase-3 (cat #96615) (all from Cell Signaling Technology). As an internal control to normalize the amount of protein applied in each lane the blots were also incubated with anti-GAPDH (Santa Cruz, sc-25778).

Detection of Secreted Chemokines (IP-10 and RANTES) by ELISA

LNCaP cells were seeded in 96-well plates in triplicate and grown overnight (10,000 cells/well). Cells were then treated with dsRB-SCP/polyIC or polyIC alone at the indicated concentrations. After 48 hr the medium was collected and the concentrations of IP-10 and RANTES were measured using commercial ELISA kits (PeproTech).

RNA Isolation, cDNA Synthesis and Quantitative Real-Time PCR

LNCaP cells were seeded in 24-well plates (500,000 cells per well) and grown overnight. Cells were then treated for 4 hr with dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone at the indicated concentrations. The cells were lysed and total RNA was extracted using the EZ-10 DNA Away RNA-Miniprep Kit (Bio Basic). Complementary DNA (cDNA) was synthesized using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). IFN-β gene expression levels were compared using quantitative real-time PCR and normalized to GAPDH expression using the ΔΔ CT method. The primers used for IFN-β quantification were: forward: 5′ ATGACCAACAAGTGTCTCCTCC 3′ (SEQ ID NO: 6) and reverse: 5′ GCTCATGGAAAGAGCTGTAGTG 3′ (SEQ ID NO: 7). The primers for GAPDH quantification were forward: 5′ GAGCCACATCGCTCAGAC 3′ (SEQ ID NO: 8) and reverse: 5′ CTTCTCATGGTTCACACCC 3′ (SEQ ID NO: 9).

Chemotaxis of PBMC

LNCaP cells were seeded in 24-well plates pre-coated with poly-lysine (250,000 cells/well) and grown overnight. Then, the medium was replaced by low-serum medium (0.15% FBS) and the cells were treated with dsRB-SCP/polyIC at the indicated concentrations. After 48 hr conditioned medium was collected from the cells and placed in the bottom well of a 24-well Transwell system (microporous polycarbonate membrane (0.5 μm) Corning; Costar). Freshly isolated PBMCs (1×10⁶) in low-serum medium (0.15% FBS) were added to the upper chamber. After 3.5 hr, medium from the lower chamber was collected and the migrated cells were quantified by FACS analysis, scatter-gating on lymphocytes.

Analysis of Bystander Effects in Co-Culture Systems

In order to measure the viability of a single cell line in co-culture with other cells, we generated cells that expressed luciferase (either LNCaP-Luc/GFP or PC3-Luc/GFP).

The immune-cell-mediated bystander effect was analyzed using LNCaP-Luc/GFP cells co-cultured with PBMCs: LNCaP-Luc/GFP cells were seeded in triplicate in 96-well plates pre-coated with poly-lysine (10,000 cells/well) and grown overnight. The cells were then treated with dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone at the indicated concentrations. After 24 hr, freshly isolated PBMCs were added to the culture (1×10⁵ per well). 48 hr later, the survival of LNCaP-Luc/GFP cells was measured based on luciferase activity using the Luciferase Assay System (Promega).

The combined direct and immune-cell-mediated bystander effect was analyzed using LNCaP cells co-cultured with PC3-Luc/GFP and PBMCs: LNCaP cells were seeded in triplicate in 96-well plates pre-coated with poly-lysine (6,000 cells/well) and grown overnight, and the cells were treated with dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone. After 16 hr PC3-Luc/GFP cells (4,000 cells/well) were added to the culture. 24 hr after treatment freshly isolated PBMCs (1×10⁵/well) were added to the culture. 48 hr later survival of the PC3-Luc/GFP cells was measured based on luciferase activity, using the Luciferase Assay system (Promega).

Tumor Spheroid Model

Tumor spheroids were generated using agar-coated plates. 96-well plates were coated with 50 μl/well agar (1.5% (wt/vol) dissolved in RPMI) according to ref (19). LNCaP or LNCaP-Luc/GFP cells were seeded (2000 cells per well) and incubated. After 97 hr, a single spherical spheroid of R=300-400 μm had formed in each well.

To measure LNCaP spheroids following treatment with dsRB-SCP/polyIC, we transferred the spheroids individually to 96-well plate (1 spheroid/well) pre-coated with a very thin, even layer of polyHEMA (120 mg/ml dissolved in 95% ethanol). To transfer the spheroids, we first lifted each spheroid together with its 200 μl of medium into a 96U-well plate (with U-shaped wells). The plate was centrifuged for 10 minutes at 220 g and the medium was replaced with 80 μl of fresh medium. The spheroid was then transferred, together with its 80 μl of medium, to the polyHEMA-coated plate. dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone were added at the indicated concentrations. Treatment continued for 5 days. On days 1, 2, 4 and 5, half of the medium in each well was removed and replaced with fresh medium containing the appropriate treatment. On Day 15, spheroids were stained with calcein AM (1:1000, Molecular Probes c3099) and 0.5 μg/ml propidium iodide. Spheroids were monitored using confocal microscopy and size was measured using ImageJ software.

To analyze the immune-cell-mediated bystander effects on tumor spheroids, we treated LNCaP-Luc/GFP spheroids once, directly on the agar plate, with dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone at the indicated concentrations. After 24 hr fresh PBMCs were labeled using 1 μM CellTracker™ Violet BMC (Molecular Probes-Life Technologies) according to the manufacturer's protocol. 8×10⁴ PBMCs were added to the spheroid culture. The co-culture was monitored using confocal microscopy.

Example 2: Construction and Assay of PSMA-Targeting Chimeric Proteins

ScFvJ591 Selectively Targets PSMA Over-Expressing Prostate Cancer Cells and Efficiently Delivers its Cargo into the Cells

We first tested whether the single chain antibody ScFvJ591 could be used as a homing ligand, as part of a chimeric protein. We generated pGFP-Arg9-ScFvJ591, encoding GFP as a tracking marker fused to the single chain antibody against PSMA, ScFvJ591, via a linker comprising an endosomal escape sequence (FIG. 1A). The 56 kDa recombinant protein, GFP-SCP (GFP-Arg9-ScFvJ591), was expressed in E. coli and purified in a 3-step purification process comprising affinity purification followed by two steps of gel filtration (see Methods).

We tested the selectivity of GFP-SCP using confocal microscopy. We incubated the chimeric protein with LNCaP cells, which over express PSMA, and analyzed binding after 5 hr. PC3 and MCF7 cells, which do not express PSMA, served as negative controls. The confocal images demonstrated that GFP-SCP bound to LNCaP cells and was selectively internalized, while no binding was evident in PC3 or MCF7 cells (FIG. 1B). We next compared uptake of GFP-SCP to LNCaP and MCF7 cells using flow cytometry. We used two doses of GFP-SCP (200 nM, 400 nM) over two time periods (30 min, 60 min). The accumulation of GFP-SCP was measured by the resulting fluorescence shift. As expected, the observed fluorescence levels were correlated with the concentration of GFP-SCP and incubation period (FIG. 1C). These results suggest time-dependent and dose-dependent internalization of GFP-SCP. In contrast, in MCF7 cells, which lack PSMA, no accumulation of GFP-SCP was observed (FIG. 1C). To monitor the localization of GFP-SCP, we incubated LNCaP cells with GFP-SCP and observed them using live-cell confocal microscopy. Initially, GFP-SCP fluorescence was confined to the cell surface and no free diffusion was observed (FIG. 1D, E). Minutes later, GFP-SCP entered the cell via endocytosis, as indicated by the appearance of small intracellular punctate structures (FIG. 1D, E). Over time, these structures increased in number. In addition, increased intracellular diffused powdery fluorescence was observed (FIG. 1D, E), indicating that the GFP had escaped from the endosome and diffused to the cytosol. The accumulation of the GFP inside the cell increased linearly over the first 40 min after binding (FIG. 1D, E).

Design, Expression and Purification of a Chimeric Protein that can Carry and Internalize polyIC Selectively into PSMA Over-Expressing Prostate Cancer Cells

Based on the structure of the GFP-SCP chimera, we designed a chimeric protein that would specifically deliver polyIC into PSMA over-expressing cells. We replaced the GFP moiety with the dsRNA-binding domains of PKR (dsRBDs) (FIG. 2A). The chimeric 48 kDa protein, dsRB-SCP (dsRB-9Arg-ScFvJ591), was expressed in E. coli. and purified using unfolding and refolding steps (FIG. 2B) as described in Example 1. The binding of the purified protein to dsRNA was evaluated. dsRB-SCP was incubated with dsRNA of defined length (500 bp) and the mixture was electrophoresed on an agarose gel (FIG. 2C). The naked dsRNA control ran at the expected position in the gel (FIG. 2C). The electrophoresis of dsRNA that had been incubated with dsRB-SCP was retarded in a dose-dependent manner (FIG. 2C), confirming that the chimeric protein bound the dsRNA.

dsRB-SCP Complexed with polyIC Selectively Kills PSMA Over-Expressing Cells by Inducing Apoptosis

We evaluated the killing effect of the dsRB-SCP/polyIC complex using four cell lines: LNCaP and VCaP, which over-express PSMA, and MCF7 and PC3, which do not express PSMA. dsRB-SCP selectively delivered polyIC into the PSMA-over-expressing cells (LNCaP and VCaP), killing up to 80% of the cells (FIG. 3A). Cells which do not express PSMA (MCF7 and PC3), were not killed by the treatment (FIG. 3A). The remaining 20% of LNCaP cells were deemed permanently arrested, as no regrowth was observed 250 hr after washing out the chimera (350 hr after treatment) (FIG. 3B). dsRB-SCP/polyIC induced cell death by activating apoptotic pathways, as indicated by the cleavage of caspase-3 and PARP (FIG. 3C). In cells treated with polyIC alone no cleavage of caspase-3 or of PARP was detected (FIG. 3C).

dsRB-SCP/polyIC Treatment Induces Cytokine Secretion and Chemotaxis of Immune Cells

The presence of dsRNA inside the cell activates the production of anti-proliferative and pro-apoptotic cytokines and chemokines (20). To determine whether dsRB-SCP/polyIC can trigger similar effects we analyzed the production of three main cytokines in the cell: IP-10 and RANTES, both involved in the chemo-attraction of immune cells and IFN-0, which plays a key role in the differentiation of immune cells (21). The secretion of IP-10 and RANTES into the medium, as measured by ELISA, was partially induced by polyIC alone, as reported previously (22). Treatment with dsRB-SCP/polyIC led to a further 2-fold increase in IP-10 and RANTES secretion (FIG. 4A-B). IFN-β expression was not affected by polyIC or dsRB-SCP alone, but treatment with dsRB-SCP/polyIC led to very strong induction of IFN-β expression, as measured by qRT-PCR (FIG. 4C).

To study whether the secreted cytokines attract immune cells, we examined whether the medium from dsRB-SCP/polyIC-treated LNCaP cells induced the chemotaxis of freshly isolated PBMCs. FIG. 4D shows that an increased number of PBMCs migrated towards conditioned medium from cells that were treated with dsRB-SCP/polyIC compared to medium from untreated cells.

Bystander Effects Induced by dsRB-SCP/polyIC

We next tested whether the recruited immune cells could evoke an immune-cell-mediated bystander effect. We treated LNCaP-Luc/GFP cells, which stably express luciferase, with a low dose of dsRB-SCP/polyIC, followed by co-incubation with PBMCs. We used luciferase activity as a measure for the survival of the LNCaP-Luc/GFP cells. Results showed eradication of the LNCaP-Luc/GFP cells (FIG. 5A). In contrast, in the absence of PBMCs, luciferase level was barely affected. These results suggest that dsRB-SCP/polyIC induces a powerful immune-cell-mediated bystander effect.

To evaluate whether dsRB-SCP/polyIC also induces a direct bystander effect, LNCaP cells were co-incubated with PC3-Luc/GFP cells, which do not express PSMA. dsRB-SCP/polyIC treatment resulted in the killing of up to 60% of the PC3-Luc/GFP cells (FIG. 5B). Since PC3-Luc/GFP cells are not targeted by dsRB-SCP/polyIC (FIG. 5B), we infer that the death of these cells is a result of a direct bystander effect elicited by the dsRB-SCP/polyIC-targeted LNCaP cells. Addition of human PBMCs to this co-culture system led to a significant increase in the killing rate of the PC3-Luc/GFP cells (FIG. 5B), indicating the additional involvement of an immune-cell-mediated bystander effect under these conditions.

dsRB-SCP/polyIC Destroys Tumor Spheroids

We next evaluated the efficacy of dsRB-SCP/polyIC in a 3D tumor spheroid model. In vitro 3D models closely resemble the architecture of human tumors (23) and feature high-resistance to anti-cancer drugs (24). LNCaP spheroids were generated and allowed to reach a diameter of 300-400 μm. The spheroids were then transferred to a polyHEMA plate and treated repeatedly with dsRB-SCP/polyIC (400 nM dsRB-SCP, 2.5 μg/ml polyIC) over the course of 5 days. By day 5, the spheroids that were treated with dsRB-SCP/polyIC began to shrink and shed dead cells, while the untreated spheroids increased in size (FIG. 6A, C). On day 15, the spheroids were stained with calcein AM and propidium iodide to monitor viability (FIG. 6A, C). The dsRB-SCP/polyIC-treated spheroids demonstrated significant structural damage and contained large numbers of dead cells (FIG. 6A, C). In contrast, the untreated spheroids and spheroids treated with only polyIC or only dsRB-SCP, maintained a typical intact structure (11), where the cells at the surface were alive and the cells at the core were necrotic (FIG. 6A, C).

To more closely mimic in vivo conditions and test the immune-cell-mediated bystander effect on the spheroids, we added PBMCs to treated spheroids. LNCaP-Luc/GFP spheroids were treated once with dsRB-SCP/polyIC, and 24 hr later freshly isolated PBMCs were added to the culture. Even at the lowest dose of dsRB-SCP/polyIC, spheroid disassembly was already evident 72 hr after the initiation of the treatment or 48 hr after PBMCs addition (FIG. 6B). At higher doses, complete spheroid destruction was observed 96 hr after the initiation of the treatment. After additional 72 hr, only dead cells were evident with no GFP fluorescence (FIG. 6B). As a control, the same treatment was performed in absence of PBMCs. At the end point (168 hr), the treatment resulted in visible cell death and disassembly of the spheroid (FIG. 6B lower panel) but the effect was weaker compared to the levels observed in the presence of PBMCs. Thus, dsRB-SCP/polyIC has a potent effect on spheroids, and this effect is greatly magnified by the addition of immune cells.

Example 3

3.1 Materials and Methods

Cell Culture

A431 cells were grown in DMEM supplemented with 10% fetal calf serum (FCS), penicillin and streptomycin. MDA-MB-468 and MCF7 cells were grown in RPMI 1640 medium supplemented with 10% FCS, penicillin and streptomycin.

Cloning

The chimeric gene encoding dsRBEC was constructed as follows: The dsRBD of hPKR (nucleotides 558-1057, NM 0027593) was fused to the nucleic acid sequence of hEGF (GenBank: M11936.1). The 3′ sequence of the dsRBD (nucleotides 1028-1057) was changed to GGCCAAACTGGCCTATCTGCAGATCTTATC (SEQ ID NO:24) to optimize codon usage and to introduce new restriction sites, and a linker (GGCGTGTTCGGGATCCGCC GGCAACCGTGTCCGTCGGAGCGTGGGCAGCTCGAATGGA) (SEQ ID NO:25), encoding AC SGSA CSGSAGNRVRRSVGSSNG (SEQ ID NO:26), was introduced before the hEGF moiety. The chimera was cloned into the bacterial expression vector pET28a (Novagen), between restriction sites Ndel and HindIII, thus inserting a Hexa His tag at the N-terminus of the chimera.

dsRBEC Expression

E coli BL21(DE3)/CodonPlus RIL (Stratagene) carrying the pET28a-His6-dsRBEC plasmid was grown in 2xYT [45] supplemented with 1% glucose, 25 μg/ml chloramphenicol, and 30 μg/ml kanamycin at 37° C. to OD600˜0.6. At this point, the bacteria were moved to 23° C. Protein expression was induced by adding 0.5 mM Isopropyl-B-D-thiogalactopyranoside (IPTG), and the culture was incubated at 23° C. for 6 hours longer. The bacterial culture was then centrifuged at 5000×g for 10 minutes and the pellet was stored at −80° C. until further applications.

Small Scale Purification and RNA Contamination Analysis

The pellet from 10 ml bacterial culture was resuspended in 1 ml lysis buffer (20 mM Hepes pH 7.5, 0.5M NaCl, 10% glycerol, 10 mM imidazole) and disrupted using a LV1 microfluidizer (Microfluidics). Following 15 minutes centrifugation at 15,000×g and 4° C., the cleared supernatant was loaded onto 50 μl equilibrated Ni Sepharose High Performance beads (GE Healthcare Life Sciences) and rotated for 1 hour at 4° C. Following two washes with lysis buffer, the bound protein was eluted with 2004 elution buffer (20 mM Hepes pH 7.5, 0.5M NaCl, 10% glycerol, 500 mM imidazole). Samples from each step (total lysate, soluble fraction, unbound fraction and eluate) were subjected to SDS-PAGE (15% polyacrylamide). The gel was stained with InstantBlue Coomassie based gel stain (Expedeon) or transferred to nitrocellulose membranes for western analysis using anti-His tag antibody (LifeTein, #LT0426, 1:1000 dilution). To visualize nucleic acid contamination of the protein, 30 μl of the eluted protein were electrophoresed on a 1% agarose gel. Where relevant, the protein was treated with RNase A (10 ug/ml) for 30 minutes at 37° C. prior to agarose gel electrophoresis. The gel was stained with ethidium bromide following electrophoresis. For purification under denaturing conditions, the bacterial pellet was resuspended with lysis buffer containing 4M urea, and was incubated at 4° C. for 1.5 hours prior to centrifugation.

On-Column Purification and Renaturation

The pellet from 500 ml of bacterial culture was resuspended with 40 ml lysis buffer supplemented with 4M urea and disrupted using a LV1 microfluidizer. The lysate was incubated at 4° C. for 1.5 hours, and cleared by centrifugation for 30 minutes at 15,000×g at 4° C. The clear supernatant was loaded onto 4 ml equilibrated Ni Sepharose beads and incubated for an additional hour at 4° C. in a 50 ml tube. The beads were then loaded onto a 4 ml C 10/10 column (GE Healthcare) and connected to an AKTA Explorer system (GE Healthcare). The protein was refolded by gradually reducing the concentration of urea. A gradient program was used with Buffer A (20 mM Hepes pH 7.5, 0.5M NaCl, 10 mM imidazole, 10% glycerol, 4M urea) and Buffer B (20 mM Hepes pH 7.5, 0.5M NaCl, 10 mM imidazole, 10% glycerol). The gradient was programmed to reach 100% B in 30 column volumes (CV) at 0.2 ml/minute flow. The column was washed with 4 CV of buffer (20 mM Hepes pH 7.5, 0.5M NaCl, 10% glycerol) containing 25 mM imidazole and with another 4 CV of buffer with 50 mM imidazole. The chimera was eluted in the same buffer, to which imidazole had been added to 500 mM. The protein eluted from the Ni Sepharose column was loaded onto a 320 ml column of Superdex 75 (GE Healthcare Life Sciences), which had been pre-equilibrated with buffer containing: 20 mM Hepes pH 7.4, 10% glycerol, 500 mM NaCl, for gel filtration. The purified protein was divided into aliquots and stored at −80° C.

PolyIC Electrophoretic Mobility Shift Assay (EMSA)

Low molecular weight (LMW) polyIC (Invitrogen) was labeled with Cy3 using the Label I T® nucleic acid labeling kit (Mirus) according to the manufacturer's protocol. 0.5 μg of labeled polyIC was incubated for 30 minutes with increasing amounts of purified dsRBEC (0.5-4 μg), followed by electrophoresis of the mixture on a 1.5% TAE-agarose gel. The gel was visualized using the MF-ChemiBlS system (DNR Bio-Imaging Systems).

¹²⁵I-EGF Displacement Assay

A431 cells were harvested by trypsinization and resuspended in PBS supplemented with 1% BSA and plated in 96-well MultiScreen filter plates (Millipore) (5,000 cells per well). Following 30 minutes incubation on ice with gentle shaking, the medium was aspirated using a MultiScreen^HTS vacuum manifold (Millipore) and replaced with ice-cold PBS using a MultiScreenHT supplemented with 0.1% BSA. Increasing concentrations (0-16 nM) of the dsRBEC or hEGF (PeproTech) were added to the wells, in triplicate. Following 30 minutes incubation on ice, the cells were supplemented with ¹²⁵I-EGF (0.1 nM, PerkinElmer) and incubated 4 h longer on ice, with gentle shaking. The medium was then aspirated, and the cells were washed five times with ice-cold PBS supplemented with 0.1% BSA and the plate was left under vacuum for complete drying. The MultiScreen plate was then exposed to a phosphor imager plate (BAS-IP MS 2040 Fuji Photo Film) for 72 hours. An ¹²⁵I-EGF calibration curve (0-10 fmol) was used to convert pixels into absolute concentrations. The plate was scanned using a FujiFilm Fluorescent Image Analyzer FLA-3000. Nonlinear regression (competitive binding one site analysis) was performed on the data using GraphPad Prism™, Version 5.0. Kd values were calculated as the means from three independent binding experiments, each of which comprised triplicate samples. The Kd of ¹²⁵I-EGF, which was required for the analysis of the displacement data, was measured as previously described by Abourbeh et al [46] (FIG. 8).

EGFR Phosphorylation

MDA-MB-468 cells were plated in 6-well plates (500,000 cells per well) in RPMI 1640 medium and 10% FCS. 24 hours after plating, the cells were washed twice with PBS and the medium was replaced with RPMI medium lacking FCS. 16 hours later, the cells were treated with dsRBEC a various concentrations for 15 minutes. The cells were then harvested with hot Laemmli sample buffer. EGFR phosphorylation was evaluated by western blot analysis, using anti-phospho (Y1068)-EGFR antibody (Cell Signaling Technology, #2234, 1:1000 dilution), anti-EGFR antibody (Santa Cruz, sc-03, 1:1000 dilution) and anti-GAPDH antibody (Santa Cruz, sc-25778, 1:2000 dilution).

Confocal Microscopy

MDA-MB-468 (10000 cells/well) and MCF7 (7000 cells/well) cells were plated in a u-Slide 8 Well Glass Bottom plate (Ibidi). 48 hours after plating, the medium was replaced with fresh medium containing 1 μM sulforhodamine G (Biotium Inc.) and the plate was placed in the 37° C. chamber of a confocal microscope (FV-1200 Olympus, Japan). The cells were then treated with 1 μg/ml Cy3-polyIC alone, or 1 μg/ml Cy3-polyIC which had been pre-incubated with dsRBEC (polyIC:dsRBEC, weight:weight ratio of 1:2). PolyIC internalization was monitored for 2 hours. For endosomal localization we treated MDA-MB-468 cells with polyIC/dsRBEC (as described above) and 5 μg/ml AlexaFluor 647-labeled transferrin (Jackson ImmunoResearch Laboratories, Inc) simultaneously.

EGFR Level

The expression of EGFR in MDA-MB-468 and MCF7 cells was analyzed by western blot using anti-EGFR antibody (Santa Cruz, sc-03, 1:1000 dilution). Anti-GAPDH antibody (Santa Cruz, sc-25778, 1:2000 dilution) was used a loading control. Expression of surface EGFR in the two cell lines was assessed by flow cytometry using PE-conjugated anti-human EGFR antibody (BioLegend, #352903).

Survival Assay

MDA-MB-468 and MCF7 cells were plated in 96-well plates (5000 and 2000 cells per well, respectively). The next day the medium was refreshed and the cells were treated with polyIC, dsRBEC or polyIC which had been pre-incubated with dsRBEC (polyIC:dsRBEC weight:weight ratio of 1:2). 72 hours following the treatment, the survival of the cells was measured by the methylene blue colorimetric assay [47].

Apoptosis

FACS

MDA-MB-468 and MCF7 cells were plated in a 24-well plate (150,000 and 100,000 cells per well, respectively). The following day the cells were treated with polyIC (1 μg/ml), dsRBEC (2 μg/ml) or polyIC (1 μg/ml) which had been pre-incubated with dsRBEC (polyIC:dsRBEC weight:weight ratio of 1:2) for 8 hours. Annexin V/Propidium iodide (PI) staining was performed using the MBL MEBCYTO apoptosis kit according to the manufacturer's guidelines and analyzed using flow cytometry, BD FACS ARIAIII (BD Biosciences, USA).

Caspase-3 and PARP Cleavage

MDA-MB-468 cells were plated in 12-well plates (250,000 cells per well). The next day the medium was refreshed and the cells were treated with polyIC (1 μg/ml), dsRBEC (2 μg/ml) or polyIC (1 μg/ml) which had been pre-incubated with dsRBEC (polyIC:dsRBEC weight:weight ratio of 1:2). 4 hours following the treatment, the cells were harvested with hot Laemmli sample buffer and subjected to SDS-PAGE (12% polyacrylamide) and western blotting, using anti-Cleaved Caspase-3 antibody (Cell Signaling Technology, #9661, 1:1000 dilution), anti-PARP antibody (Cell Signaling Technology, #9542, 1:1000 dilution) and anti-GAPDH antibody (Santa Cruz, sc-25 778, 1:2000 dilution).

RNA Isolation and Reverse Transcriptase-Real Time Polymerase Chain Reaction (qRT-PCR)

MDA-MB-468 cells were treated with polyIC (1 μg/ml), dsRBEC (2 μg/ml) or polyIC (1 μg/ml) which had been pre-incubated with dsRBEC (polyIC:dsRBEC weight:weight ratio of 1:2) for 2 and 4 hours. Total RNA was isolated from MDA-MB-468 cell using the EZ-10 DNA away RNA-Mini-prep Kit (Bio Basic) according to the manufacturer's instructions. 1 μg of total RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and the resulting cDNA was used for qRT-PCR analysis (Fast SYBR Green; Applied Biosystems) using the primer pairs listed in Table 2.

Gene expression was normalized to GAPDH gene expression and compared to samples from vehicle-treated cells. Fold change was quantified using the ^ΔΔCT method.

TABLE 2
qRT-PCR primer sequences
Gene      Primer sequence
GAPDH     F:
          5′ GAGCCACATCGCTCAGAC 3′
          (SEQ ID NO: 27)
          R:
          5′ CTTCTCATGGTTCACACCC 3′
          (SEQ ID NO: 28)
IFN-beta  F:
          5′ ATGACCAACAAGTGTCTCCTCC 3′
          (SEQ ID NO: 29)
          R:
          5′ GCTCATGGAAAGAGCTGTAGTG 3′
          (SEQ ID NO: 30)
CCL5      F:
          5′ CGCTGTCATCCTCATTGCTACTG 3′
          (SEQ ID NO: 31)
          R:
          5′ GCAGGGTGTGGTGTCCGAG 3′
          (SEQ ID NO: 32)
IP-10     F:
          5′ GCCAATTTTGTCCACGTGTTG 3′
          (SEQ ID NO: 33)
          R:
          5′ AGCCTCTGTGTGGTCCATCCT 3′
          (SEQ ID NO: 34)
TNF-alpha F:
          5′ GTGCTTGTTCCTCAGCCTCTT 3′
          (SEQ ID NO: 35)
          R:
          5′ GGCCAGAGGGCTGATTAGAGAG 3′
          (SEQ ID NO: 36)

ELISA

MDA-MB-468 and MCF 7 cells were plated in 96-well plates (10,000 and 7,000 cells per well, respectively). The next day the medium was refreshed and the cells were treated with polyIC, dsRBEC or polyIC which had been pre-incubated with dsRBEC (polyIC:dsRBEC weight:weight ratio of 1:2). 24 hours following the treatment, the medium was collected. Interferon gamma-induced protein 10 (IP-10), chemokine (C-C motif) ligand 5 (CCLS) and tumor necrosis factor alpha (TNF-alpha) proteins were quantified using ABTS ELISA Development Kits (PeproTech) according to the manufacturer's protocol. Interferon beta (IFN-beta) protein was quantified using a bioluminescent ELISA kit (LumiKine) according to the manufacturer's protocol.

Statistical Analysis

GraphPad Prism was used for all statistical analysis. One-way ANOVA and Tukey post-test were used to analyze the ELISA experiments. The survival assay was analyzed using two-way ANOVA and Bonferroni post-test analysis.

3.2 Results

Expression and Purification of dsRBEC

We designed a chimeric protein vector, dsRBEC, for the targeted delivery of polyIC to EGFR over-expressing tumor cells. This vector comprised the dsRBD of human PKR fused via a linker to human EGF (see Materials and Methods and FIG. 7).

dsRBEC was in E. coli efficiently expressed as a His6-tagged protein BL21(DE3)/CodonPlus RIL. As a first step, the chimera was purified using Ni Sepharose High Capacity resin. Under native conditions the yield of protein was very low, due to poor solubility and poor binding to the resin (FIG. 9A). Furthermore, the purified dsRBEC was contaminated with nucleic acids, as indicated by the high OD₂₆₀/OD₂₃₀ ratio of 1.92 and by ethidium bromide staining. When we treated the eluted protein with RNase A prior to electrophoresis, ethidium bromide staining was no longer detectable (FIG. 9B). This indicated that the contaminating nucleic acid was host RNA bound to dsRBEC, presumably at its dsRBD.

In order to remove the contaminating RNA under native conditions, we took several approaches, including treatment with RNase A or polyethyleneimine (PEI). However, these treatments resulted in precipitation of our protein. We therefore attempted to purify the chimera under denaturing conditions. We lysed the bacteria and bound the lysates to Ni Sepharose beads in the presence of 4M urea. Under these conditions, the protein was highly soluble and bound the column with increased affinity (FIG. 9C). The amount of contaminating RNA in the eluate was significantly reduced, as detected by the decrease in OD₂₆₀/OD₂₃₀ ratio to 0.7 and by the lack of staining with ethidium bromide (FIG. 9D). Thus, denaturing conditions facilitated the removal of the contaminating RNA, improved the solubility of the chimera and increased its yield.

The next step was to scale up the purification procedure. To process larger amounts of lysate, we decided to use the AKTA Explorer system. This system made it very easy to perform on-column refolding, with a continuous, gradual reduction in urea concentration, while the protein was still bound to the Ni Sepharose resin. The immobilization of a protein on a column prevents protein aggregation caused by intermolecular interactions [48-51]. To remove remaining protein impurities (FIG. 9E, Lane 2), the eluate from the Ni Sepharose column was subjected to a second purification step, Superdex75 gel filtration (FIG. 9E, Lane 3). The total yield of purified protein was 6 mg from 0.5 L of bacterial culture.

dsRBEC Binds polyIC

To evaluate the ability of dsRBEC to bind polyIC, we performed an EMSA test. Incubation of dsRBEC with Cy3-labeled polyIC (Cy3-polyIC) retarded the migration of Cy3-polyIC on a 2% agarose gel in a dose-dependent manner (FIG. 11A), showing that the dsRBD moiety of dsRBEC is competent to bind polyIC.

dsRBEC Binds EGFR with High Affinity

The affinity of the purified dsRBEC to EGFR was measured by competitive binding experiments, using radio-labeled EGF. We measured the decrease in¹²⁵I-EGF binding in the presence of increasing concentrations of unlabeled hEGF or of dsRBEC (FIG. 11B). Kd values of 0.54±0.18 nM for hEGF and 3.38±0.75 nM for dsRBEC were calculated using competitive binding one site analysis (GraphPad Prism 5). dsRBEC retains high affinity to EGFR, suggesting that the N-terminal fusion to the dsRBD moiety did not detract from the affinity of the EGF moiety for EGFR, and that the refolding protocol regenerated the active conformation.

EGF binding to EGFR leads to receptor autophosphorylation, followed by clathrin-coated pit mediated endocytosis [52]. To test for productive binding of dsRBEC to EGFR, we measured the autophosphorylation of tyrosine residue 1068 of EGFR, a characteristic EGFR autophosphorylation site, which is critical for EGFR internalization [52]. Since A431 cells have higher levels of basal EGFR phosphorylation [53], we used MDA-MB-468 cells, which also express high levels of EGFR, but show much less basal phosphorylation [54]. dsRBEC treatment for 15 minutes induced the phosphorylation of tyrosine 1068 in a dose-dependent manner (FIG. 11C). This indicates that dsRBEC binds EGFR correctly and can induce receptor phosphorylation, which is necessary for internalization.

dsRBEC Selectively Induces polyIC Internalization in EGFR Over-Expressing Cells

Next, we tested whether dsRBEC could deliver polyIC selectively into EGFR over-expressing cells. We compared MDA-MB-468 cells, which over-express EGFR, and MCF7 cells, which express low or undetectable levels of the receptor [55] (FIG. 12A, D). Using confocal microscopy we demonstrated that Cy3-polyIC complexed with dsRBEC (Cy3-polyIC/dsRBEC) was internalized into MDA-MB-468 cells, whereas no internalization was observed in MCF7 cells (FIG. 12B). Naked Cy3-polyIC was not internalized by either cell line (FIG. 12B). The punctate fluorescent pattern of Cy3-polyIC when carried by dsRBEC is indicative of endosomal entrapment [56-58]. To verify endosomal localization we treated MDA-MB-468 cells with Cy3-polyIC/dsRBEC in the presence of AlexaFluor647-conjugated transferrin, a recycling endosomal marker. Indeed, we observed strong co-localization of Cy3-polyIC with transferrin (FIG. 12C). These data corroborate our findings that the dual functional chimera, dsRBEC, can bind both EGFR and polyIC. Thus, dsRBEC induces targeted, selective delivery of polyIC into EGFR over-expressing cells, where it accumulates in endosomes.

Targeted Delivery of polyIC by dsRBEC Leads to Apoptosis ofMDA-MB-468 Cells

We next evaluated the survival of MDA-MB-468 cells, following treatment with polyIC/dsRBEC. PolyIC/dsRBEC led to reduced survival of MDA-MB-468 cells, in a dose-dependent manner, whereas MCF7 cells were unaffected by the treatment even at the highest concentration tested (1 μg/ml) (FIG. 13A). A complex of 0.5 μg/ml polyIC with 1 μg/ml dsRBEC led to a 90% decrease in survival of MDA-MB-468 cells (FIG. 13A). The chimera dsRBEC alone had a slight inhibitory effect on MDA-MB-468 cell survival, which is consistent with earlier reports that EGF alone can mediate apoptosis of this cell line [59, 60]. Notably, naked polyIC had a much weaker effect on cell survival than polyIC/dsRBEC (***, P<0.0001 for effect of polyIC/dsRBEC vs polyIC alone, for polyIC/dsRBEC vs dsRBEC alone and for polyIC/dsRBEC vs vehicle at all tested concentrations).

We next tested whether the decreased cell survival upon treatment with PolyIC/dsRBEC was due to apoptosis. In MDA-MB-468 cells treated with polyIC/dsRBEC, cleavage of both PARP and caspase-3 was evident as soon as 4 hours after treatment initiation (FIG. 13B). Furthermore, there was a strong increase in Annexin V-positive cells after 8 hours of treatment with polyIC/dsRBEC (FIG. 13C). In contrast, treatment with naked polyIC or dsRBEC alone had no or little effect on PARP or caspase-3 cleavage (FIG. 13B) or on Annexin V staining (FIG. 13C). MCF7 cells were not affected by the treatment and did not show any sign of apoptosis (FIG. 13C). These results indicate that polyIC/dsRBEC, but not polyIC alone, induces selective apoptosis of EGFR-over-expressing cells.

PolyIC Delivery by dsRBEC Induced the Expression of Pro-Inflammatory Cytokines from MDA MB-468 Cells

PolyIC has been reported to stimulate the secretion of pro-inflammatory cytokines [31-33]. We therefore measured the effect of polyIC/dsRBEC treatment on pro-inflammatory cytokine production. MDA-MB-468 cells were treated with polyIC/dsRBEC for 2 or 4 hours, and the mRNAs of IFN-beta, IP-10, CCLS and TNF-alpha were measured using qRT-PCR (FIG. 14A-D). Treatment with polyIC/dsRBEC led to profound induction of cytokine mRNA expression. In contrast, treatment with naked polyIC led to substantially less mRNA expression. Treatment with dsRBEC alone did not affect the expression of these cytokines.

To verify that polyIC/dsRBEC induces increased cytokine secretion, we measured the protein levels of these cytokines using ELISA. After 24 hours of treatment with polyIC/dsRBEC, significant levels of the four cytokines were detected in the medium (FIG. 14E-H). At the highest concentration of polyIC/dsRBEC tested (1 μg/ml polyIC, 2 μg/ml dsRBEC) TNF-alpha could not be detected, probably because the cells underwent apoptosis before they were able to secrete TNF-alpha. Interestingly, although naked polyIC induced the transcription of all four tested genes (FIG. 14A-D), only IP-10 was detected by ELISA, at substantially lower levels than were induced by polyIC/dsRBEC. In addition, none of the tested cytokines were detected in the medium of MDA-MB-468 cells treated with dsRBEC alone (FIG. 14E-H) or in the medium of MCF7 cells in all sets of treatments (data not shown). Thus, polyIC/dsRBEC induced both the mRNA transcription and protein secretion of pro-inflammatory cytokines in a highly specific manner.

Taken together, our data show that dsRBEC can be efficiently purified from E. coli in an active conformation. dsRBEC is an efficient vector for targeting polyIC into EGFR over-expressing tumor cells, leading to apoptosis and cytokine secretion.

3.3 Discussion

In the present study we present the development of a novel, recombinant protein carrier, dsRBEC, to selectively deliver polyIC into EGFR over-expressing tumors. dsRBEC is a bifunctional protein, with a dsRBD to bind poll and an EGF domain to deliver the polyIC into EGFR over-expressing cells. dsRBEC effectively and selectively induced polyIC internalization into EGFR over-expressing cells, inducing cell death and cytokine secretion. As opposed to current anti-EGFR therapies, which inhibit EGFR activity per se, we exploit EGFR expression and activation as the Achilles' heel of the tumor. We use the over expression of the receptor as a selective entryway into the cell.

Upon purification from E. coli, RNA binding proteins are frequently contaminated by non-specific host nucleic acids, thus complicating the protein purification procedure [61, 62]. One widely used method to remove nucleic acid contaminants is precipitation with PEI [62-64]. This method, however, is time-consuming and requires the titration of PEI concentration and of the ionic strength [62, 65]. In addition, traces of PEI can interfere with the function of the purified protein [64]. Furthermore this method is also difficult to reproduce [62]. RNase and DNase can be used for removal of nucleic acid contamination, but any traces of the nucleases must be removed [61, 66]. Applying these methods to our protein resulted in precipitation of dsRBEC.

Marenchino et al. succeeded in purifying His-tagged HIV-1 Rev by destabilizing the protein-RNA interactions using 8M urea, with subsequent on-column refolding [62]. We found that 4M urea was sufficient for the complete removal of contaminating RNA from dsRBEC. Denaturation using low concentrations of urea preserves the native-like protein structure, minimizing the aggregation of protein molecules during refolding, and facilitating recovery of the protein's biological activity [67]. Furthermore, the lower concentration of urea in our study allowed us to purify the protein at 4° C. This would have been impossible using 8M urea, which crystallizes at cold temperatures. We designed a simple, reproducible on-column refolding procedure, which was easily scaled up using the AKTA Explorer system. This straightforward procedure can be used for other RNA binding proteins. The use of urea to remove RNA contamination also increased dramatically the yield of the purified protein, since it improved the solubility and the binding to nickel resin. Following purification, we confirmed that both domains of the bifunctional chimeric protein were active, by showing that it could bind polyIC efficiently, as well as bind to and activate the EGFR.

In this study, we demonstrate that dsRBEC induces the uptake of polyIC only in cells that over-express the EGFR. Since healthy cells express EGFR at low levels, we expect this treatment to be highly selective, and not to affect non-cancerous cells. Furthermore, naked polyIC has little or no effect on tumor cells at the concentrations that we used. Previous studies have shown the potency of naked polyIC to induce tumor cell apoptosis through the TLR3 pathway. However much higher concentrations (25-50 μg/ml) of polyIC were used in these studies [27, 28, 33]. Although TLR3 is expressed on both the cell surface and the endosomal membrane, it is believed to bind its ligand and undergo proteolytic activation in the endosomal compartment [68-71]. Therefore, we hypothesize that the reason polyIC/dsRBEC is much more potent than naked polyIC, is because polyIC/dsRBEC accumulates in the endosome, where it strongly activates TLR3. Moreover, it has been previously reported that EGFR is essential for TLR3 activation [72], therefore, activation of the receptor by dsRBEC may contribute to the increased potency of polyIC. In addition, we cannot completely exclude the possibility that some of our targeted polyIC reaches the cytoplasm. In the cytoplasm, polyIC can activate other dsRNA-binding proteins, such as PKR, retinoic acid-inducible gene I (RIG-1), and melanoma differentiation-associated gene 5 (MDAS) [73-75], which may contribute to the pro-apoptotic effect caused by the internalized polyIC. Our delivery system could advance the clinical use of polyIC, by allowing the use of lower doses and reducing toxicity. We demonstrated that polyIC/dsRBEC strongly induces the expression of IFN-beta, IP-10, CCLS and TNF-alpha. These cytokines should provide a second line of therapeutic effect, activating and recruiting immune cells to the site of the tumor. Type I IFNs have previously been shown to regulate the activation of innate immune cells, including macrophages, natural killer cells and APCs. Type I IFNs regulate the activation and proliferation of adaptive immune cells, directly via the IFN receptor and indirectly by activation of APCs or by up-regulation of MHC and co-stimulatory molecules [76, 77]. Type I IFNs can also directly affect cancer cells, by promoting cell cycle arrest and apoptosis [78, 79]. Thus, the cytokines produced in response to tumor-targeted polyIC can induce a “bystander” effect, restoring antitumor immune surveillance and eradicating neighboring tumor cells that do not over-express the receptor. Since most tumors are heterogenic, this bystander effect is extremely beneficial.

In conclusion, we have developed a bi-domain recombinant chimeric protein that is capable both of binding polyIC and of delivering it into EGFR over-expressing tumors, inducing tumor cell death. On the basis of this study, we suggest that dsRBEC-delivered polyIC may be a promising therapy for EGFR over-expressing tumors. We have created a platform technology, with dsRBEC as the prototype recombinant protein. By replacing the EGF moiety with targeting moieties for different receptors, this approach can be applied to additional tumor types.

REFERENCES

• 1. Luo, J., Beer, T. M., and Graff, J. N. (2016) Treatment of Nonmetastatic Castration-Resistant Prostate Cancer, Oncology (Williston Park) 30, 336-344,
• 2. Attard, G., Sarker, D., Reid, A., Molife, R., Parker, C., and de Bono, J. S. (2006) Improving the outcome of patients with castration-resistant prostate cancer through rational drug development, British journal of cancer 95, 767-774, 10.1038/sj.bjc.6603223
• 3. Javidan, J., Deitch, A. D., Shi, X. B., and de Vere White, R. W. (2005) The androgen receptor and mechanisms for androgen independence in prostate cancer, Cancer investigation 23, 520-528, 10.1080/07357900500202721
• 4. Akhtar, N. H., Pail, O., Saran, A., Tyrell, L., and Tagawa, S. T. (2012) Prostate-specific membrane antigen-based therapeutics, Advances in urology 2012, 973820, 10.1155/2012/973820
• 5. Sweat, S. D., Pacelli, A., Murphy, G. P., and Bostwick, D. G. (1998) Prostate-specific membrane antigen expression is greatest in prostate adenocarcinoma and lymph node metastases, Urology 52, 637-640,
• 6. Wright, G. L., Jr., Grob, B. M., Haley, C., Grossman, K., Newhall, K., Petrylak, D., Troyer, J., Konchuba, A., Schellhammer, P. F., and Moriarty, R. (1996) Upregulation of prostate-specific membrane antigen after androgen-deprivation therapy, Urology 48, 326-334,
• 7. Mannweiler, S., Amersdorfer, P., Trajanoski, S., Terrett, J. A., King, D., and Mehes, G. (2009) Heterogeneity of prostate-specific membrane antigen (PSMA) expression in prostate carcinoma with distant metastasis, Pathology oncology research: POR 15, 167-172, 10.1007/s12253-008-9104-2
• 8. Tagawa, S. T., Milowsky, M. I., Morris, M., Vallabhajosula, S., Christos, P., Akhtar, N. H., Osborne, J., Goldsmith, S. J., Larson, S., Taskar, N. P., Scher, H. I., Bander, N. H., and Nanus, D. M. (2013) Phase II study of Lutetium-177-labeled anti-prostate-specific membrane antigen monoclonal antibody J591 for metastatic castration-resistant prostate cancer, Clinical cancer research: an official journal of the American Association for Cancer Research 19, 5182-5191, 10.1158/1078-0432.CCR-13-0231
• 9. Galsky, M. D., Eisenberger, M., Moore-Cooper, S., Kelly, W. K., Slovin, S. F., DeLaCruz, A., Lee, Y., Webb, I. J., and Scher, H. I. (2008) Phase I trial of the prostate-specific membrane antigen-directed immunoconjugate MLN2704 in patients with progressive metastatic castration-resistant prostate cancer, Journal of clinical oncology: official journal of the American Society of Clinical Oncology 26, 2147-2154, 10.1200/JCO.2007.15.0532
• 10. van Leeuwen, P. J., Stricker, P., Hruby, G., Kneebone, A., Ting, F., Thompson, B., Nguyen, Q., Ho, B., and Emmett, L. (2016) (68) Ga-PSMA has a high detection rate of prostate cancer recurrence outside the prostatic fossa in patients being considered for salvage radiation treatment, BJU international 117, 732-739, 10.1111/bju.13397
• 11. Phung, Y. T., Barbone, D., Broaddus, V. C., and Ho, M. (2011) Rapid generation of in vitro multicellular spheroids for the study of monoclonal antibody therapy, Journal of Cancer 2, 507-514,
• 12. Puigbo, P., Guzman, E., Romeu, A., and Garcia-Vallve, S. (2007) OPTIMIZER: a web server for optimizing the codon usage of DNA sequences, Nucleic acids research 35, W126-131, 10.1093/nar/gkm219
• 13. Rajasekaran, A. K., Anilkumar, G., and Christiansen, J. J. (2005) Is prostate-specific membrane antigen a multifunctional protein?, American journal of physiology. Cell physiology 288, C975-981, 10.1152/ajpce11.00506.2004
• 14. Gong, M. C., Latouche, J. B., Krause, A., Heston, W. D., Bander, N. H., and Sadelain, M. (1999) Cancer patient T cells genetically targeted to prostate-specific membrane antigen specifically lyse prostate cancer cells and release cytokines in response to prostate-specific membrane antigen, Neoplasia 1, 123-127,
• 15. Edinger, N., Lebendiker, M., Klein, S., Zigler, M., Langut, Y., and Levitzki, A. (2016) Targeting polyIC to EGFR over-expressing cells using a dsRNA binding protein domain tethered to EGF, PloS one 11, e0162321, 10.1371/journal.pone.0162321
• 16. Zigler, M., Shir, A., Joubran, S., Sagalov, A., Klein, S., Edinger, N., Lau, J., Yu, S. F., Mizraji, G., Globerson Levin, A., Sliwkowski, M. X., and Levitzki, A. (2016) HER2-Targeted Polyinosine/Polycytosine Therapy Inhibits Tumor Growth and Modulates the Tumor Immune Microenvironment, Cancer immunology research 10.1158/2326-6066.CIR-15-0203
• 17. Shir, A., Ogris, M., Roedl, W., Wagner, E., and Levitzki, A. (2011) EGFR-homing dsRNA activates cancer-targeted immune response and eliminates disseminated EGFR-overexpressing tumors in mice, Clinical cancer research: an official journal of the American Association for Cancer Research 17, 1033-1043, 10.1158/1078-0432.CCR-10-1140
• 18. Mizrachy-Schwartz, S., Cohen, N., Klein, S., Kravchenko-Balasha, N., and Levitzki, A. (2011) Upregulation of AMP-activated protein kinase in cancer cell lines is mediated through c-Src activation, The Journal of biological chemistry 286, 15268-15277, 10.1074/jbc.M110.211813
• 19. Friedrich, J., Seidel, C., Ebner, R., and Kunz-Schughart, L. A. (2009) Spheroid-based drug screen: considerations and practical approach, Nature protocols 4, 309-324, 10.1038/nprot.2008.226
• 20. Der, S. D., and Lau, A. S. (1995) Involvement of the double-stranded-RNA-dependent kinase PKR in interferon expression and interferon-mediated antiviral activity, Proceedings of the National Academy of Sciences of the United States of America 92, 8841-8845,
• 21. Kumar, A., Zhang, J., and Yu, F. S. (2006) Toll-like receptor 3 agonist poly(I:C)-induced antiviral response in human corneal epithelial cells, Immunology 117, 11-21, 10.1111/j.1365-2567.2005.02258.x
• 22. Galli, R., Starace, D., Busa, R., Angelini, D. F., Paone, A., De Cesaris, P., Filippini, A., Sette, C., Battistini, L., Ziparo, E., and Riccioli, A. (2010) TLR stimulation of prostate tumor cells induces chemokine-mediated recruitment of specific immune cell types, J Immunol 184, 6658-6669, 10.4049/jimmuno1.0902401
• 23. Kim, J. B. (2005) Three-dimensional tissue culture models in cancer biology, Seminars in cancer biology 15, 365-377, 10.1016/j.semcancer.2005.05.002
• 24. Takagi, A., Watanabe, M., Ishii, Y., Morita, J., Hirokawa, Y., Matsuzaki, T., and Shiraishi, T. (2007) Three-dimensional cellular spheroid formation provides human prostate tumor cells with tissue-like features, Anticancer research 27, 45-53,
• 25. Nicholson R., Gee J M., Harper M. EGFR and cancer prognosis. Eur J Cancer. 2001, 37: 9-15. doi:10.1016/S0959-8049(01)00231-3
• 26. Sun R, Zhang Y, Lv Q, Liu B, Jin M, Zhang W, et al. Toll-like receptor 3 (TLR3) induces apoptosis via death receptors and mitochondria by up-regulating the transactivating p63 isoform alpha (TAP63alpha). J Biol Chem. 2011, 286: 15918-28. doi:10.1074/jbc.M110.178798
• 27. Salaun B, Lebecque S, Matikainen S, Rimoldi D, Romero P. Toll-like receptor 3 expressed by melanoma cells as a target for therapy? Clin Cancer Res. 2007, 13: 4565-74. doi:10.1158/1078-0432.CCR-07-0274
• 28. Salaun B, Coste I, Rissoan M-C, Lebecque S J, Renno T. TLR3 Can Directly Trigger Apoptosis in Human Cancer Cells. J Immunol. 2006, 176: 4894-4901. doi: 10.4049/jimmunol.1 76. 8 0.4894
• 29. Gambara G, Desideri M, Stoppacciaro A, Padula F, De Cesaris P, Starace D, et al. TLR3 engagement induces IRF-3-dependent apoptosis in androgen-sensitive prostate cancer cells and inhibits tumour growth in vivo. J Cell Mol Med. 2015, 19: 327-39. doi:10.1111/jcmm.12379
• 30. Jiang Q, Wei H, Tian Z. Poly I:C enhances cycloheximide-induced apoptosis of tumor cells through TLR3 pathway. BMC Cancer. 2008, 8: 12. doi:10.1186/1471-2407-8-12
• 31. Vercammen E, Staal J, Beyaert R. Sensing of viral infection and activation of innate immunity by toll-like receptor 3. Clin Microbiol Rev. 2008, 21: 13-25. doi:10.1128/CMR.00022-07
• 32. Alexopoulou L, Holt A C, Medzhitov R, Flavell R A. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature. 2001, 413: 732-8. doi:10.1038/35099560
• 33. Galli R, Starace D, Busa R, Angelini D F, Paone A, De Cesaris P, et al. TLR stimulation of prostate tumor cells induces chemokine-mediated recruitment of specific immune cell types. J Immunol. 2010, 1 84: 665 8-69. doi: 10.4049/jimmunol.0902401
• 34. Orita T, Kimura K, Nishida T, Sonoda K-H. Cytokine and chemokine secretion induced by poly(I:C) through NF-KB and phosphoinositide 3-kinase signaling pathways in human corneal fibroblasts. Curr Eye Res. 2013, 38: 53-9. doi:10.3109/02713683.2012.721044
• 35. Gatti G, Nufiez N G, Nocera D A, Dejager L, Libert C, Giraudo C, et al. Direct effect of dsRNA mimetics on cancer cells induces endogenous IFN-[S production capable of improving dendritic cell function. Eur J Immunol. 2013, 43: 1849-61. doi:10.1002/eji.201242902
• 36. Matsumoto M, Seya T. TLR3: interferon induction by double-stranded RNA including poly(I:C). Adv Drug Deliv Rev. 2008, 60: 805-12. doi:10.1016/j.addr.2007.11.005
• 37. Krown S E, Kerr D, Stewart W E, Field A K, Oettgen H F. Phase I trials of poly(I,C) complexes in advanced cancer. J Biol Response Mod. 1985, 4: 640-9.
• 38. Homan E R, Zendzian R P, Schott L D, Levy H B A R. Studies on Poly I:C toxicity in experimental animals. Toxicol Appl Pharmacol. 1972, 23: 579-588. doi:10.1016/0041-008X(72)90098-1
• 39. Schaffert D, Kiss M, Rodl W, Shir A, Levitzki A, Ogris M, et al. Poly(I:C)-mediated tumor grt suppression in EGF-receptor overexpressing tumors using EGF-polyethylene glycol-linear polyethylenimine as carrier. Pharm Res. 2011, 28: 731-41. doi:10.1007/s11095-010-0225-4
• 40. Shir A, Ogris M, Roedl W, Wagner E, Levitzki A. EGFR-homing dsRNA activates cancer-targeted immune response and eliminates disseminated EGFR-overexpressing tumors in mice. Clin Cancer Res. 2011, 17: 1033-43. doi:10.1158/1078-0432.CCR-10-1140
• 41. Joubran S, Zigler M, Pessah N, Klein S, Shir A, Edinger N, et al. Optimization of liganded polyethylenimine polyethylene glycol vector for nucleic acid delivery. Bioconjug Chem. 2014, 25: 1644-54. doi:10.1021/bc500252a
• 42. Zigler M, Shir A, Joubran S, Sagalov A, Klein S, Edinger N, et al. HER2-targeted polyinosine/polycytosine therapy inhibits tumor growth and modulates the tumor immune microenvironment. Cancer Immunol Res. 2016,Submitted.
• 43. Zheng X, Bevilacqua P C. Activation of the protein kinase PKR by short double-stranded RNAs with single-stranded tails. RNA. 2004, 10: 1934-45. doi:10.1261/rna.7150804
• 44. Nanduri S, Carpick B W, Yang Y, Williams B R, Qin J. Structure of the double-stranded RNA-binding domain of the protein kinase PKR reveals the molecular basis of its dsRNA-mediated activation. EMBO J. 1998, 17: 5458-65. doi:10.1093/emboj/17.18.5458
• 45. Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor laboratory press. New York. 1989. doi:574.873224 1/1989
• 46. Abourbeh G, Shir A, Mishani E, Ogris M, Rodl W, Wagner E, et al. PolyIC GE11 polyplex inhibits EGFR-overexpressing tumors. IUBMB Life. 2012, 64: 324-30. doi:10.1002/iub.1002
• 47. Pelletier B, Dhainaut F, Pauly A, Zahnd J-P. Evaluation of grt rate in adhering cell cultures using a simple colorimetric method. J Biochem Biophys Methods. 1988, 16: 63-73. doi:10.1016/0165-022X(88)90104-2
• 48. Tsumoto K, Ejima D, Kumagai I, Arakawa T. Practical considerations in refolding proteins from inclusion bodies. Protein Expr Purif. 2003, 28: 1-8.
• 49. Li M, Su Z-G, Janson J-C. In vitro protein refolding by chromatographic procedures. Protein Expr

Purif. 2004, 33: 1-10. doi:10.1016/j.pep.2003.08.023

• 50. Hutchinson M H, Chase H A. Adsorptive refolding of histidine-tagged glutathione S-transferase using metal affinity chromatography. J. Chromatogr A. 2006, 1128: 125-32. doi:10.1016/j.chroma.2006.06.050
• 51. Yamaguchi S, Yamamoto E, Mannen T, Nagamune T. Protein refolding using chemical refolding additives. Biotechnol J. 2013, 8: 17-31. doi:10.1002/biot.201200025
• 52. Jiang X, Huang F, Marusyk A, Sorkin A. Grb2 regulates internalization of EGF receptors through clathrin-coated pits. Mol Biol Cell. 2003, 14: 858-70. doi:10.1091/mbc.E02-08-0532
• 53. Van De Vijver M J, Kumar R, Mendelsohn J. Ligand-induced activation of A431 cell epidermal growth factor receptors occurs primarily by an autocrine pathway that acts upon receptors on the surface rather than intracellularly. J Biol Chem. 1991, 266: 7503-7508.
• 54. Busse D, Doughty R S, Ramsey T T, Russell W E, Price J O, Flanagan W M, et al. Reversible G1 arrest induced by inhibition of the epidermal grt factor receptor tyrosine kinase requires upregulation of p27 (KIP1) independent of MAPK activity. In: Journal of Biological Chemistry. 2000 pp. 6987-6995. doi:10.1074/jbc.275.10.6987
• 55. Moiseeva E P, Heukers R, Manson M M. EGFR and Src are involved in indole-3-carbinol-induced death and cell cycle arrest of human breast cancer cells.Carcinogenesis. 2007, 28: 435-45. doi:10.1093/carcin/bg1171
• 56. Connor J, Huang L. Efficient cytoplasmic delivery of a fluorescent dye by pH-sensitive immunoliposomes. J Cell Biol. 1985, 101: 582-9.
• 57. Caron N J, Quenneville S P, Tremblay J P. Endosome disruption enhances the functional nuclear delivery of Tat-fusion proteins. Biochem Biophys Res Commun. 2004, 319: 12-20. doi:10.1016/j.bbrc.2004.04.180
• 58. Mellert K, Lamla M, Scheffzek K, Wittig R, Kaufmann D. Enhancing endosomal escape of transduced proteins by photochemical internalisation. PLoS One. 2012, 7: e52473. doi:10.1371/joumal.pone.0052473
• 59. Armstrong D K, Kaufmann S H, Ottaviano Y L, Furuya Y, Buckley J A, Isaacs J T, et al. Epidermal growth factor-mediated apoptosis of MDA-MB-468 human breast cancer cells. Cancer Res. 1994, 54: 5280-3.
• 60. Thomas T, Balabhadrapathruni S, Gardner C R, Hong J, Faaland C A, Thomas Ti Effects of epidermal growth factor on MDA-MB-468 breast cancer cells: alterations in polyamine biosynthesis and the expression of p21/CIP1/WAF1. J Cell Physiol. 1999, 179: 257-66. doi:10.1002/(SICI)1097-4652(199906)179:3<257::AID-JCP3>3.0.CO, 2-4
• 61. Kang J, Lee M S, Gorenstein D G. Application of RNase in the purification of RNA-binding proteins. Anal Biochem. 2007, 365: 147-8. doi:10.1016/j.ab.2007.03.003
• 62. Marenchino M, Armbruster D W, Hennig M. Rapid and efficient purification of RNA-binding proteins: application to HIV-1 Rev. Protein Expr Purif. 2009, 63: 112-9. doi:10.1016/j.pep.2008.09.010
• 63. Takahashi H, Yamazaki H, Akanuma S, Kanahara H, Saito T, Chimuro T, et al. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose. PLoS One. 2014, 9: e82624. doi:10.1371/journal.pone.0082624
• 64. Engelke D R, Krikos A, Bruck M E, Ginsburg D. Purification of Thermus aquaticus DNA polymerase expressed in Escherichia coli. Anal Biochem. 1990, 191: 396-400.
• 65. Burgess R R. Use of polyethyleneimine in purification of DNA-binding proteins. Methods

Enzymol. 1991, 208: 3-10.

• 66. Zabriskie D W, Dipaolo M. Removal of nucleic acid contaminants using nuclease enzymes during protein isolation. Biotechnol Bioeng. 1988, 32: 100-4. doi:10.1002/bit.260320114
• 67. Singh A, Upadhyay V, Upadhyay A K, Singh S M, Panda A K. Protein recovery from inclusion bodies of Escherichia coli using mild solubilization process. Microb Cell Fact. 2015, 14: 41. doi:10.1186/s12934-015-0222-8
• 68. Leonard J N, Ghirlando R, Askins J, Bell J K, Margulies D H, Davies D R, et al. The TLR3 signaling complex forms by cooperative receptor dimerization. Proc Natl Acad Sci USA. 2008, 105: 258-63. doi:10.1073/pnas.0710779105
• 69. Tsai S-Y, Segovia J A, Chang T-H, shil N K, Pokharel S M, Kannan T R, et al. Regulation of TLR3 Activation by S100A9. J Immunol. 2015, 195: 4426-37. doi:10.4049/jimmuno1.15003 78
• 70. Garcia-Cattaneo A, Gobert F-X, Miiller M, Toscano F, Flores M, Lescure A, et al. Cleavage of Toll-like receptor 3 by cathepsins B and H is essential for signaling. Proc Natl Acad Sci USA. 2012, 109: 9053-8. doi:10.1073/pnas.1115091109
• 71. Pohar J, Pirher N, Benéina M, Manéek-Keber M, Jerala R. The ectodomain of TLR3 receptor is required for its plasma membrane translocation. PLoS One. 2014, 9: e92391. doi:10.1371/joumal.pone.0092391
• 72. Yamashita M, Chattopadhyay S, Fensterl V, Saikia P, Wetzel J L, Sen G C. Epidermal growth factor receptor is essential for Toll-like receptor 3 signaling. Sci Signal. 2012, 5: ra50.
• 73. Besch R, Poeck H, Hohenauer T, Senft D, Hacker G, Berking C, et al. Proapoptotic signaling induced by RIG-I and MDA-S results in type I interferon-independent apoptosis in human melanoma cells. J Clin Invest. 2009; 119: 2399-411. doi:10.1172/JC137155
• 74. Kalali B N, Kollisch G, Mages J, Muller T, Bauer S, Wagner H, et al. Double-stranded RNA induces an antiviral defense status in epidermal keratinocytes through TLR3-, PKR-, and MDAS/RIG-I-mediated differential signaling. J Immunol. 2008; 181: 2694-704.
• 75. Palchetti S, Starace D, De Cesaris P, Filippini A, Ziparo E, Riccioli A. Transfected poly(I:C) activates different dsRNA receptors, leading to apoptosis or immunoadjuvant response in androgen-independent prostate cancer cells. J Biol Chem. 2015; 290: 5470-83. doi:10.1074/jbc.M114.601625
• 76. Welsh R M, Bahl K, Marshall H D, Urban S L. Type 1 interferons and antiviral CD8 T-cell responses. PLoS Pathog. 2012; 8: e1002352. doi:10.1371/joumal.ppat.1002352
• 77. Hertzog P J. Overview. Type I interferons as primers, activators and inhibitors of innate and adaptive immune responses. Immunol Cell Biol. 2012, 90: 471-3. doi:10.1038/icb.2012.15
• 78. Bekisz J, Baron S, Balinsky C, Morrow A, Zoon K C. Antiproliferative Properties of Type I and Type II Interferon. Pharmaceuticals (Basel). 2010; 3: 994-1015. doi: 10.33 90/ph3040994
• 79. Vitale G, van Eijck C H J, van Koetsveld Ing P M, Erdmann J I, Speel E J M, van der Wansem Ing K, et al. Type I interferons in the treatment of pancreatic cancer: mechanisms of action and role of related receptors. Ann Surg. 2007; 246: 259-68. doi:10.1097/01.sla.0000261460.07110.f2

In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

The following items should be read as preferred embodiments:

• 1. A recombinant protein comprising a double stranded RNA (dsRNA) binding domain and a target-binding moiety.
• 2. The recombinant protein of embodiment 1, wherein said dsRNA binding domain and said target-binding moiety are connected by a spacer peptide.
• 3. The recombinant protein of embodiment 1 or 2, further comprising a cytolytic peptide.
• 4. The recombinant protein of any one of embodiments 1 to 3, wherein said dsRNA binding domain comprises one or more double-stranded RNA-binding motif (dsRBM), i.e. an alpha-beta-beta-beta-alpha fold.
• 5. The recombinant protein of embodiment 4, wherein said one or more dsRBM is selected from a dsRBM of dsRNA dependent protein kinase (PKR), TRBP, PACT, Staufen, NFAR1, NFARZ, SPNR, RHA or NREBP.
• 6. The recombinant protein of embodiment 5, wherein said dsRNA binding domain comprises two dsRBMs of a PKR, optionally connected by a flexible linker.
• 7. The recombinant protein of embodiment 6, wherein said dsRNA binding domain is selected from the dsRNA binding domain of human PKR and said two dsRBMs are connected by a flexible linker; or the full length human PKR.
• 8. The recombinant protein of embodiment 7, wherein said dsRNA binding domain comprises amino acid residues 1-197 of human PKR.
• 9. The recombinant protein any one of embodiments 1 to 3, wherein said target-binding moiety comprises (i) a ligand to a cell surface receptor; (ii) an antibody, such as a humanized antibody; a human antibody; a functional fragment of an antibody; a single-domain antibody, such as a Nanobody; a recombinant antibody; and a single chain variable fragment (scFv); (ii) an antibody mimetic, such as an affibody molecule; an affilin; an affimer; an affitin; an alphabody; an anticalin; an avimer; a DARPin; a fynomer; a Kunitz domain peptide; and a monobody; or (iii) an aptamer.
• 10. The recombinant protein of embodiment 9, wherein said target-binding moiety binds a tumor-associated antigen.
• 11. The recombinant protein of embodiment 10, wherein said tumor-associated antigen is selected from epidermal growth factor receptor (EGFR), human epidermal growth factor receptor 2 (HER2), prostate surface membrane antigen (PSMA), fibroblast growth factor receptor (FGFR), colony stimulating factor 1 receptor (CSF-1R), platelet-derived growth factor receptors (PDGFR), insulin-like growth factor 1 receptor (IGF-1R) and MET.
• 12. The recombinant protein of embodiment 11, wherein said target-binding moiety is an EGFR ligand, such as an EGF or the peptide GE11 of the sequence YHWYGYTPQNVI (SEQ ID NO:22); an anti-EGFR antibody, such as an anti-EGFR scFv or a humanized or human anti-EGFR antibody; or an anti-EGFR affibody.
• 13. The recombinant protein of embodiment 12, wherein said EGF is human EGF and said EGFR is human EGFR.
• 14. The recombinant protein of embodiment 11, wherein said target-binding moiety is a human anti-epidermal growth factor receptor 2 (HER2) antibody, such as an anti-HER2 scFv or a humanized or human anti-HER2 antibody; or an anti-HER2 affibody.
• 15. The recombinant protein of embodiment 11, wherein said target-binding moiety is a prostate surface membrane antigen (PSMA) ligand, such as DUPA or an analog thereof an anti-PSMA antibody, such as an anti-PSMA scFv or a humanized or human anti-PSMA antibody (e. g. the full length antibody J591); or an anti-PSMA affibody.
• 16. The recombinant protein of embodiment 15, wherein said PSMA is human PSMA.
• 17. The recombinant protein of any one of embodiments 1 to 3, wherein said spacer peptide is selected from an oligopeptide comprising a protease recognition sequence; a homo-oligopeptide of a positively charged amino acid (at physiological pH), such as arginine; a peptide of the sequence ACSGSACSGSAGNRVRRSVGSSNG (SEQ ID NO:23) or a homolog thereof a cytolytic peptide; or a combination thereof
• 18. The recombinant protein of embodiment 17, wherein said homo-oligopeptide of arginine is Arg8.
• 19. The recombinant protein of any one of embodiments 1 to 3 or 17, wherein said cytolytic peptide is selected from Melittin or Candidalysin.
• 20. The recombinant protein of embodiment 19, wherein said cytolytic peptide is positioned within the spacer peptide or within the N-terminus of the recombinant protein.
• 21. The recombinant protein of any one of embodiments 1 to 3, comprising the dsRNA binding domain of human PKR wherein said two dsRBMs are connected by a flexible linker; and a target-binding moiety selected from an anti-human EGFR antibody, an anti-human HER2 antibody and an anti-PSMA antibody, wherein said dsRNA binding domain and said target-binding moiety are connected by an Arg8 spacer peptide.
• 22. The recombinant protein of embodiment 21, comprising the dsRNA binding domain of human PKR wherein the two dsRBMs are connected by a flexible linker; and an anti-human EGFR antibody connected by an Arg8 peptide.
• 23. The recombinant protein of embodiment 21, comprising the dsRNA binding domain of human PKR wherein the two dsRBMs are connected by a flexible linker; and an anti-human HER2 antibody connected by an Arg8 peptide.
• 24. The recombinant protein of embodiment 21, comprising the dsRNA binding domain of human PKR wherein the two dsRBMs are connected by a flexible linker; and an anti-human PSMA antibody connected by an Arg8 peptide.
• 25. The recombinant protein of any one of embodiments 1 to 24, which is essentially free of RNA.
• 26. A complex comprising the recombinant protein of any one of embodiments 1 to 24 and dsRNA.
• 27. The complex of embodiment 26, wherein said dsRNA is PKR-activating dsRNA, such as dsRNA comprising a polyinosinic acid strand and a polycytidylic acid strand (poly 1C).
• 28. The complex of embodiment 27, wherein said poly IC comprises at least 22 ribonucleotides in each strand, for example, 85-300 ribonucleotides in each strand.
• 29. The complex of embodiment 26, wherein said dsRNA comprises at least on siRNA sequence directed against e. g. a pro-oncogenic protein.
• 30. The complex of any one of embodiments 26 to 29, comprising the dsRNA binding domain of human PKR wherein said two dsRBMs are connected by a flexible linker; and a target-binding moiety selected from an anti-human EGFR antibody, an anti-human HER2 antibody and an anti-PSMA antibody, wherein said dsRNA binding domain and said target-binding moiety are connected by an Arg8 spacer peptide, and said poly IC or siRNA is non-covalently associated with said dsRNA binding domain.
• 31. A pharmaceutical composition comprising the complex of any one of embodiments 26 to 30 and a pharmaceutically acceptable carrier.
• 32. A nucleic acid molecule comprising a nucleic acid sequence encoding the recombinant protein of any one of embodiments 1 to 24.
• 33. The nucleic acid molecule of embodiment 32, wherein said sequence is optimized for expression in a bacterial or plant host cell, preferably a plant host cell.
• 34. A vector comprising at least one control element, such as a promoter and terminator, operably linked to the nucleic acid molecule of embodiment 32 or 33, wherein said at least one control element is optimized for expression in a bacterial or plant host cell, preferably a plant host cell.
• 35. A method for manufacturing a recombinant protein comprising a dsRNA binding domain and a target-binding moiety, comprising expressing the nucleic acid molecule of embodiment 32 or 33 or the vector of embodiment 34 in a bacterial or plant cell and extracting said recombinant protein from said cells.
• 36. The method of embodiment 35, further comprising removing contaminating host cell RNA from and isolating said recombinant protein.
• 37. The method of embodiment 36, wherein said removing of contaminating host cell RNA from said recombinant protein comprises contacting said recombinant protein with urea, e. g. 4M urea, and refolding said recombinant protein.
• 38. The method of any one of embodiments 35 to 37, comprising expressing the nucleic acid molecule or vector in a plant cell, such as a tobacco or carrot cell, either in suspension or in a whole plant.
• 39. A method for treatment of cancer characterized by expression of a tumor-associated antigen, said method comprising systemically administering to a patient in need the complex of any one of embodiments 26 to 30 or the pharmaceutical composition of embodiment 31.
• 40. The method of embodiment 39, wherein said cancer is selected from a cancer characterized by EGFR-overexpressing cells, a cancer characterized by HER2-overexpressing cells and prostate cancer.
• 41. The method of embodiment 40, wherein said cancer characterized by EGFR-overexpressing cells is selected from non-small-cell-lung-carcinoma, breast cancer, glioblastoma, head and neck squamous cell carcinoma, colorectal cancer, adenocarcinoma, ovary cancer, bladder cancer or prostate cancer, and metastases thereof
• 42. The method of embodiment 40, wherein said cancer characterized by HER2-overexpressing cells is selected from breast cancer, ovarian cancer, stomach cancer, and aggressive forms of uterine cancer, such as uterine serous endometrial carcinoma.
• 43. The method of embodiment 42, wherein said cancer characterized by HER2-overexpressing cells is Herceptin/trastuzumab resistant cancer.
• 44. The method of any one of embodiments 40 to 43, wherein said complex comprises the dsRNA binding domain of human PKR wherein said two dsRBMs are connected by a flexible linker; and a target-binding moiety selected from an anti-human EGFR antibody, an anti-human HER2 antibody and an anti-PSMA antibody, wherein said dsRNA binding domain and said target-binding moiety are connected by an Arg8 spacer peptide, and said polyIC or siRNA is non-covalently associated with said dsRNA binding domain.
• 45. The method of any one of embodiments 40 to 44, further comprising administering immune cells, such as tumor-infiltrating T-cells (T-TILs), tumor specific engineered T-cells, or peripheral blood mononuclear cells (PBMCs).
• 46. A chimeric recombinant protein comprising:

a double stranded RNA (dsRNA) binding domain; and

a target binding moiety that binds to prostate surface membrane antigen (PSMA).

• 47. The chimeric recombinant protein of embodiment 46, further comprising a spacer peptide between the dsRNA binding domain and the target binding moiety.
• 48. The chimeric recombinant protein of embodiment 46 or embodiment 47, wherein the dsRNA binding domain comprises at least one double-stranded RNA-binding motif (dsRBM).
• 49. The chimeric recombinant protein of embodiment 48, wherein the at least one dsRBM is selected from a dsRBM of dsRNA dependent protein kinase (PKR), TRBP, PACT, Staufen, NFAR1, NFAR2, SPNR, RHA, and NREBP.
• 50. The chimeric recombinant protein of embodiment 48, wherein the at least one dsRBM comprises a polypeptide sequence at least 70% identical to amino acids 1-197 of human PKR as set forth as SEQ ID NO: 18.
• 51. The chimeric recombinant protein of any one of embodiments 46-50, wherein the target binding moiety is a polypeptide, antibody, antibody fragment, or antibody mimetic.
• 52. The chimeric recombinant protein of embodiment 47, wherein the spacer peptide is selected from the group consisting of an oligopeptide comprising a protease recognition sequence; a homo-oligopeptide of a positively charged amino acids; and a combination thereof
• 53. The chimeric recombinant protein of embodiment 52, wherein the spacer peptide is a homo-oligopeptide of arginine.
• 54. The chimeric recombinant protein of any one of embodiments 46-53, wherein the double stranded RNA (dsRNA) binding domain is at least one dsRNA binding domain of human PKR as set forth in SEQ ID NO: 18, or a functional variant thereof, wherein the spacer peptide is ARG9 as set forth in SEQ ID NO: 5, or a functional variant thereof, and wherein the target binding moiety is a single chain anti-PSMA antibody as set forth in SEQ ID NO: 20, or a functional variant thereof
• 55. The chimeric recombinant protein of embodiment 54, comprising a polypeptide at least 70% identical to the sequence set forth as SEQ ID NO: 3.
• 56. A complex comprising the chimeric recombinant protein of any one of embodiments 46 to 45 and dsRNA.
• 57. The complex of embodiment 56, wherein the dsRNA comprises a polyinosinic acid strand and a polycytidylic acid strand (poly IC).
• 58. A nucleic acid comprising a nucleic acid sequence encoding the recombinant protein of any one of embodiments 46 to 55.
• 59. The nucleic acid of embodiment 58, wherein the nucleic acid sequence is optimized for expression in a bacterial or plant host cell.
• 60. The chimeric recombinant protein of any one of embodiments 46-55 or the complex of embodiment 56 or embodiment 57 for use in treatment of prostate cancer or inhibition of the development of tumor neovasculature.
• 61. A method for treatment of prostate cancer or inhibition of tumor neovasculature development comprising, administering to a subject in need thereof a therapeutically effective amount of the complex of embodiment 56 or embodiment 57, thereby treating the cancer or inhibiting the development of the tumor neovasculature.
• 62. The method of embodiment 61, wherein the complex is administered systemically or locally.
• 63. The method of embodiment 61 or embodiment 62, further comprising administering to the subject a therapeutically effective amount of peripheral blood mononuclear cells (PBMCs).

Claims

1. A recombinant protein comprising a double stranded RNA (dsRNA) binding domain and a target-binding moiety.

2. The recombinant protein of claim 1, wherein said dsRNA binding domain and said target-binding moiety are connected by a spacer peptide.

3. (canceled)

4. The recombinant protein of claim 1, wherein said dsRNA binding domain comprises one or more double-stranded RNA-binding motif (dsRBM), i.e. an alpha-beta-beta-beta-alpha fold.

5. The recombinant protein of claim 4, wherein said one or more dsRBM is selected from a dsRBM of dsRNA dependent protein kinase (PKR), TRBP, PACT, Staufen, NFAR1, NFARZ, SPNR, RHA or NREBP.

6. The recombinant protein of claim 5, wherein said dsRNA binding domain comprises two dsRBMs of a PKR, optionally connected by a flexible linker.

7. The recombinant protein of claim 6, wherein said dsRNA binding domain is selected from the dsRNA binding domain of human PKR and said two dsRBMs are connected by a flexible linker; or the full length human PKR.

8. The recombinant protein of claim 7, wherein said dsRNA binding domain comprises amino acid residues 1-197 of human PKR.

9. The recombinant protein any one of claim 1, wherein said target-binding moiety comprises (i) a ligand to a cell surface receptor; (ii) an antibody, such as a humanized antibody; a human antibody; a functional fragment of an antibody; a single-domain antibody, such as a Nanobody; a recombinant antibody; and a single chain variable fragment (scFv); (ii) an antibody mimetic, such as an affibody molecule; an affilin; an affimer; an affitin; an alphabody; an anticalin; an avimer; a DARPin; a fynomer; a Kunitz domain peptide; and a monobody; or (iii) an aptamer.

10. The recombinant protein of claim 9, wherein said target-binding moiety binds a tumor-associated antigen.

11. The recombinant protein of claim 10, wherein said tumor-associated antigen is selected from epidermal growth factor receptor (EGFR), human epidermal growth factor receptor 2 (HER2), prostate surface membrane antigen (PSMA), fibroblast growth factor receptor (FGFR), colony stimulating factor 1 receptor (CSF-1R), platelet-derived growth factor receptors (PDGFR), insulin-like growth factor 1 receptor (IGF-1R) and MET.

12. The recombinant protein of claim 11, wherein said target-binding moiety is an EGFR ligand, such as an EGF or the peptide GE11 of the sequence YHWYGYTPQNVI; an anti-EGFR antibody, such as an anti-EGFR scFv or a humanized or human anti-EGFR antibody; or an anti-EGFR affibody.

13. The recombinant protein of claim 12, wherein said EGF is human EGF and said EGFR is human EGFR.

14-25. (canceled)

26. A complex comprising the recombinant protein of claim 1 and dsRNA.

27. The complex of claim 26, wherein said dsRNA is dsRNA comprising a polyinosinic acid strand and a polycytidylic acid strand (poly IC).

28-31. (canceled)

32. A nucleic acid molecule comprising a nucleic acid sequence encoding the recombinant protein of claim 1.

33. The nucleic acid molecule of claim 32, wherein said sequence is optimized for expression in a bacterial or plant host cell, preferably a plant host cell.

34. (canceled)

35. A method for manufacturing a recombinant protein comprising a dsRNA binding domain and a target-binding moiety, comprising expressing the nucleic acid molecule of claim 32 in a bacterial or plant cell and extracting said recombinant protein from said cells.

36-37. (canceled)

38. The method of any one of claim 35, comprising expressing the nucleic acid molecule in a plant cell, such as a tobacco or carrot cell, either in suspension or in a whole plant.

39. A method for treatment of cancer characterized by expression of a tumor-associated antigen, said method comprising systemically administering to a patient in need the complex of claim 26.

40-63. (canceled)