C. NOVYI FOR THE TREATMENT OF SOLID TUMORS IN HUMANS
The present invention provides, inter alia, methods for treating or ameliorating an effect of a solid tumor present in a human. These methods include administering intratumorally to the human a unit dose of C. novyi, preferably C. novyi NT, colony forming units (CFUs), which contains about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution. Methods for debulking a solid tumor present in a human, methods for ablating a solid tumor present in a human, a method for microscopically precise excision of tumor cells in a human, methods for treating or ameliorating an effect of a solid tumor that has metastasized to one or more sites in a human, unit doses of C. novyi, preferably C. novyi NT, CFUs, and kits for treating or ameliorating an effect of a solid tumor present in a human are also provided.
This application is a continuation application of U.S. application Ser. No. 16/836,003, filed Mar. 31, 2020, which is a continuation application of U.S. application Ser. No. 14/781,273, filed Sep. 29, 2015, now U.S. Pat. No. 10,617,723, which is a U.S. National Stage Application of International Application No. PCT/US2014/032196, filed Mar. 28, 2014, which claims benefit to U.S. Provisional Application No. 61/806,497 filed Mar. 29, 2013. The entire contents of the above applications are incorporated by reference as if recited in full herein.
GOVERNMENT FUNDINGThis invention was made with government support under CA062924 awarded by the National Institutes of Health. The government has certain rights in the invention.
FIELD OF INVENTIONThe present invention provides, inter alia, methods for treating or ameliorating an effect of a solid tumor present in a human, for debulking a solid tumor present in a human, for microscopically precise excising of tumor cells in a human, and for ablating a solid tumor present in a human. Unit doses of C. novyi CFUs and kits are also provided.
INCORPORATION BY REFERENCE OF SEQUENCE LISTINGThis application contains references to amino acids and/or nucleic acid sequences that have been filed concurrently herewith as sequence listing XML file “1065272-000591-CON-seq.xml”, file size of 271 KB, created on Jul. 20, 2022. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5).
BACKGROUND OF THE INVENTIONStrategies that successfully target and destroy human cancers recognize differences between normal and malignant tissues (Dang et al., 2001). Such differences can be found at the molecular level, as is the case with genetic aberrations, or more holistically, as with the physiological aberrations in a tumor.
It is known that malignant solid tumors are usually composed of a necrotic core and a viable rim. Therapeutic interventions to date have focused on the well-vascularized outer shell of the tumor, but few have targeted the inner hypoxic core (Jain et al., 2001). The inner core of a tumor has unique characteristics that differentiate it from normal tissues. The core has a poor vascular supply and is therefore deficient in nutrients and oxygen. As a site of active cellular necrosis, the lack of a functional vascular supply limits the clearance of noxious cell breakdown and results in a low pH. Such an environment is not suitable for growth of most human cells but is a rich environment for the growth of certain anaerobic bacteria. More than sixty-years ago, this concept led investigators to inject spores of Clostridium histolyticus into tumor-bearing animals (Parker et al., 1947). Remarkably, the bacteria germinated only in the necrotic core of the tumor and liquefied the tumors. In the 1950s and 1960s, spores from Clostridium butyricum were injected into patients with a variety of very advanced solid tumor malignancies (Mose, 1967; Mose, 1972). Many patients had significant germination and destruction of large portions of their tumors, but the very poor health and advanced stage of these patients made their clinical management difficult and the absence of complete clinical responses subdued further pursuit of this approach.
Successful treatment of solid tumors remains an unfulfilled medical goal. Accordingly, there is a need to find treatments for solid tumors. The present invention is directed to meeting this and other needs.
SUMMARY OF THE INVENTIONOne embodiment of the present invention is a method for treating or ameliorating an effect of a solid tumor present in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi colony forming units (CFUs) comprising about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution.
Another embodiment of the present invention is a method for debulking a solid tumor present in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi CFUs comprising about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution.
An additional embodiment of the present invention is a method for debulking a solid tumor present in a human. This method comprises administering intratumorally to the human one to four cycles of a unit dose of C. novyi NT spores comprising about 1×104 spores per cycle, each unit dose of C. novyi NT being suspended in a pharmaceutically acceptable carrier or solution.
A further embodiment of the present invention is a method for treating or ameliorating an effect of a solid tumor present in a human. This method comprises administering intratumorally to the human one to four cycles of a unit dose of C. novyi NT spores comprising about 1×104 spores per cycle, each unit dose of C. novyi NT spores being suspended in a pharmaceutically acceptable carrier or solution.
Another embodiment of the present invention is method for ablating a solid tumor present in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi CFUs comprising about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution, wherein the tumor is ablated leaving a margin of normal tissue.
A further embodiment of the present invention is a unit dose of C. novyi CFUs. This unit dose comprises about 1×103-1×107 CFUs in a pharmaceutically acceptable carrier or solution, which is effective for treating or ameliorating an effect of a solid tumor present in a human.
An additional embodiment of the present invention is a kit for treating or ameliorating an effect of a solid tumor present in a human. This kit comprises a unit dose of C. novyi CFUs comprising about 1×103-1×107 CFUs in a pharmaceutically acceptable carrier or solution and instructions for use of the kit.
Another embodiment of the present invention is a method for microscopically precise excision of tumor cells in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi NT colony forming units (CFUs) comprising about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution.
A further embodiment of the present invention is a method for treating or ameliorating an effect of a solid tumor that has metastasized to one or more sites in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi NT colony forming units (CFUs) comprising at least about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution.
One embodiment of the present invention is a method for treating or ameliorating an effect of a solid tumor present in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi colony forming units (CFUs) comprising about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution.
As used herein, the terms “treat,” “treating,” “treatment” and grammatical variations thereof mean subjecting an individual subject (e.g., a human patient) to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject, e.g., a patient. In particular, the methods and compositions of the present invention may be used to slow the development of disease symptoms or delay the onset of the disease or condition, or halt the progression of disease development. However, because every treated subject may not respond to a particular treatment protocol, regimen, process or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject, e.g., patient, population. Accordingly, a given subject or subject, e.g., patient, population may fail to respond or respond inadequately to treatment.
As used herein, the terms “ameliorate”, “ameliorating” and grammatical variations thereof mean to decrease the severity of the symptoms of a disease in a subject.
As used herein, a “solid tumor” means an abnormal mass of cell growth. Solid tumors may occur anywhere in the body. Solid tumors may be cancerous (malignant) or noncancerous (benign). Examples of solid tumors according to the present invention include adrenocortical carcinoma, anal tumor/cancer, bladder tumor/cancer, bone tumor/cancer (such as osteosarcoma), brain tumor, breast tumor/cancer, carcinoid tumor, carcinoma, cervical tumor/cancer, colon tumor/cancer, endometrial tumor/cancer, esophageal tumor/cancer, extrahepatic bile duct tumor/cancer, Ewing family of tumors, extracranial germ cell tumor, eye tumor/cancer, gallbladder tumor/cancer, gastric tumor/cancer, germ cell tumor, gestational trophoblastic tumor, head and neck tumor/cancer, hypopharyngeal tumor/cancer, islet cell carcinoma, kidney tumor/cancer, laryngeal tumor/cancer, leiomyosarcoma, leukemia, lip and oral cavity tumor/cancer, liver tumor/cancer (such as hepatocellular carcinoma), lung tumor/cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome, myeloproliferative disorders, nasopharyngeal tumor/cancer, neuroblastoma, oral tumor/cancer, oropharyngeal tumor/cancer, osteosarcoma, ovarian epithelial tumor/cancer, ovarian germ cell tumor, pancreatic tumor/cancer, paranasal sinus and nasal cavity tumor/cancer, parathyroid tumor/cancer, penile tumor/cancer, pituitary tumor/cancer, plasma cell neoplasm, prostate tumor/cancer, rhabdomyosarcoma, rectal tumor/cancer, renal cell tumor/cancer, transitional cell tumor/cancer of the renal pelvis and ureter, salivary gland tumor/cancer, Sezary syndrome, skin tumors (such as cutaneous t-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine tumor/cancer, soft tissue sarcoma, stomach tumor/cancer, testicular tumor/cancer, thymoma, thyroid tumor/cancer, urethral tumor/cancer, uterine tumor/cancer, vaginal tumor/cancer, vulvar tumor/cancer, and Wilms' tumor. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, and melanoma. More preferably, the solid tumor is a leiomyosarcoma, such as a retroperitoneal leiomyosarcoma.
As used herein, a “unit dose” means the amount of a medication administered to a subject, e.g., a human, in a single dose.
As used herein, “C. novyi” means a bacteria belonging to species of Clostridium novyi or a bacteria derived therefrom. Clostridium novyi, which may be obtained commercially from, e.g., the ATCC (#19402), is a gram-positive anaerobic bacterium. A bacterium derived from Clostridium novyi may be made by, e.g., screening native Clostridium novyi for clones that possess specific characteristics. Preferred C. novyi bacteria are those which are non-toxic or minimally toxic to a subject such as a mammal, e.g., a human. For example, a preferred C. novyi, C. novyi NT, is a bacteria derived from native Clostridium novyi that has lost its single systemic toxin (a-toxin) gene by, e.g., a genetic engineering process or through a selection procedure. C. novyi NT may be made, for example, using the procedure disclosed in Dang et al., 2001 and U.S. Pat. No. 7,344,710. Thus, the present invention includes C. novyi as well as C. novyi NT bacteria.
Pharmacokinetic studies indicate that C. novyi NT spores, if injected intravenously, are rapidly cleared from the circulation (greater than 99% spores are cleared within 1 hour) and sequestered within the reticulo-endothelial system. Long-term distribution studies reveal that these spores are eventually eliminated from all tissues within one year. Delivered in spore form (dormant stage), C. novyi NT germinates (transitions from the spore to the vegetative state) when exposed to the hypoxic regions of tumors. Thus, the toxicities of C. novyi NT are expected to be greater in tumor-bearing than in healthy patients.
Healthy mice and rabbits showed no apparent clinical signs (morbidity, mortality, or clinical appearance) of toxicity regardless of treatment dose when injected with C. novyi NT intravenously. However, examination of tissues at necropsy revealed both gross and microscopic inflammatory changes that appeared to be treatment-dose dependent. These findings, primarily in the liver, spleen and adrenals, were noted at doses of 5×108 spores/kg or greater. Healthy animals receiving lower doses showed no gross or microscopic abnormalities at necropsy. In animals that received high doses, resolution of inflammation was already evident on day 28 and all signs of inflammation were absent in all animals by one year following administration. To determine if C. novyi NT spores would germinate in non-tumor hypoxic tissue, studies in elderly mice with atherosclerotic plaques and experimental myocardial infarctions were treated with C. novyi NT. There was no evidence of spore localization or germination within these vascular lesions. At the conclusion of the study, no clinical or pathologic abnormalities (other than the pre-existing cardiovascular lesions) were noted in these mice. These studies demonstrated that C. novyi NT caused no apparent clinical and minimal pathological toxicity in healthy animals.
Intravenous (IV) injection of spores into immune-competent tumor-bearing mice leads to lysis of the tumor and an intense inflammatory response. In mice, one of three outcomes is typically observed: One subset (25-35%) of mice are cured (no tumor recurrence after one year of observation) and develop long-term immunity to the original tumor (Agrawal et al., 2004). Another subset (65-75%) experience complete clinical responses, but undergo a recurrence with re-growth of the original tumor. Finally, the remaining subset (0 to 20%, depending on the experiment) undergoes tumor destruction, but develop significant clinical toxicity 2-5 days after the initiation of therapy. Relatively simple measures, such as hydration, are adequate to reduce this toxicity, often entirely eliminating these signs. Studies in larger animals (rabbits) show the same cure and recurrence rates with C. novyi NT therapy, but do not show the life-threatening clinical toxicity observed in a subset of mice. Treatment-related death was observed in tumor-bearing mice, but not in rabbits, treated with C. novyi NT spores (Diaz et al., 2005). In these studies toxicity was related to both spore dose and tumor size. In moribund mice, no specific clinical laboratory or pathologic end-organ damage was noted and the only significant finding was hepatosplenomegaly. Cured mice had rare remnant inflammatory changes in the liver and spleen, but were otherwise no different than untreated animals. These studies show that toxicity in tumor-bearing animals can be pronounced (death) in mice with large tumors, but was minimal in larger animals (rabbits), and was manageable in mice with hydration or antibiotics.
Previous work using C. novyi NT spores injected intravenously (1×109 spores/m2) as a single agent in tumor bearing dogs produced no life threatening toxicities. The dogs were maintained on fluid therapy (2-4 ml/kg/hr) for several days post treatment which may have decreased the toxicity. Unfortunately, there were no measurable tumor responses to the treatment.
As used herein, “colony forming units” (“CFUs”) mean viable forms of the bacteria which will give rise to an aggregate of cells (or colonies). Such viable forms include vegetative and spore forms, and the present invention includes both forms used separately and in combination. Colony forming unit assays are known in the art. See, e.g., Breed et al., 1916. Media for supporting the growth of C. novyi are commercially available, such as Reinforced Clostridial Medium (RCM) from Difco (BD, Franklin Lakes, N.J.). As set forth above, the unit dose comprises from about 1×103-1×107, such as about 1×103-1×104, about 1×104-1×105, about 1×105-1×106, or about 1×106-1×107, C. novyi CFUs.
In one aspect of this embodiment, the unit dose comprises from about 1×106-1×107 C. novyi CFUs. In another aspect of this embodiment, the unit dose comprises about 1×104 C. novyi CFUs. Surprisingly, the doses disclosed herein for human treatment are unexpectedly lower than would be expected from simply extrapolating from our non-rodent models using ⅙ of the non-rodent highest non-severely toxic does (HNSTD), as is typical for a starting dose therapeutic for oncology indications. See, e.g., Senderowicz, A. M., “Information needed to conduct first-in human oncology trials in the United States: a view from a former FDA medical reviewer.” Clin. Canc. Res., 2010, 16:1719-25.
Preferably, in the present invention the C. novyi is C. novyi NT.
In another aspect of this embodiment, the unit dose comprises about 1×106-1×107 C. novyi NT spores. In a further aspect of this embodiment, the unit dose comprises about 1×104 C. novyi NT spores.
In an additional aspect of this embodiment, the administering step comprises injecting the unit dose at a single location into the tumor. In another aspect of this embodiment, the administering step comprises injecting the unit dose at multiple unique locations, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 unique locations, into the tumor. Preferably, the administering step comprises injecting the unit dose at 1-5 unique locations into the tumor, such as in the configurations shown in
In another aspect of this embodiment, the method further comprises administering a plurality of treatment cycles, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, or more than 30 cycles, to the human, each treatment cycle comprising injecting one unit dose of the C. novyi CFUs, such as one unit dose of the C. novyi NT spores, into the solid tumor. Preferably, 1-10 treatment cycles are administered. More preferably, 2-4 treatment cycles are administered. The interval between each treatment cycle may be variable. In one preferred embodiment, the interval between each treatment cycle is about 5-100 days. In another preferred embodiment, the interval between each treatment cycle is about 7 days.
In an additional aspect of this embodiment, the method further comprises administering intravenous (IV) fluids to the human before, during, and/or after each administration of the C. novyi CFUs, such as the C. novyi NT spores. IV fluids for hydrating the patients are disclosed herein and are well known in the art. Such fluids may be fluids that are isotonic with blood, such as, e.g., a 0.9% sodium chloride solution, or Lactated Ringer's solution.
In another aspect of this embodiment, the method further comprises providing the human with a first course of antibiotics for a period of time and at a dosage that is effective to treat or alleviate an adverse side effect caused by the C. novyi CFUs, such as the C. novyi NT spores. In the present invention an adverse side effect (or adverse event, which is used interchangeably with adverse side effect) may include but is not limited to infections (such as those caused by open wounds), vomiting, hematochezia, and fever.
In one preferred embodiment, the antibiotics are administered for two weeks post C. novyi administration. Non-limiting examples of such antibiotics include amoxicillin, clavulanate, metronidazole, and combinations thereof.
In another preferred embodiment, the method further comprises providing the human with a second course of antibiotics for a period of time and at a dosage that is effective to treat or alleviate an adverse side effect caused by the C. novyi. The second course of antibiotics may be initiated after completion of the first course of antibiotics and is carried out for 1-6 months, such as 3 months. Preferably, the antibiotic used in the second course is doxycycline, but any antibiotic approved by a medical professional may be used.
In a further aspect of this embodiment, the method further comprises, using a co-treatment protocol by, e.g., administering to the human a therapy selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, and combinations thereof.
The C. novyi, e.g., the C. novyi NT spores, and the anti-cancer agent(s) used in the co-treatment therapy may be administered to the human, either simultaneously or at different times, as deemed most appropriate by a physician. If the C. novyi, e.g., the C. novyi NT spores, and the other anti-cancer agent(s) are administered at different times, for example, by serial administration, then the C. novyi, e.g., the C. novyi NT spores, may be administered to the human before the other anti-cancer agent. Alternatively, the other anti-cancer agent(s) may be administered to the human before the C. novyi, e.g., the C. novyi NT spores.
As used herein, “chemotherapy” means any therapeutic regimen that is compatible with the C. novyi, e.g., C. novyi NT, treatment of the present invention and that uses cytotoxic and/or cytostatic agents against cancer cells or cells that are associated with or support cancer cells. In a preferred embodiment, the chemotherapy comprises administering to the human an agent selected from the group consisting of an anti-metabolite, a microtubule inhibitor, a DNA damaging agent, an antibiotic, an anti-angiogenesis agent, a vascular disrupting agent, a molecularly targeted agent, and combinations thereof.
As used herein, an “anti-metabolite” is a substance that reduces or inhibits a cell's use of a chemical that is part of normal metabolism. Non-limiting examples of anti-metabolite agents or analogs thereof according to the present invention include antifolates, purine inhibitors, pyrimidine inhibitors, and combinations thereof.
As used herein, an “antifolate” is a substance that alters, reduces, or inhibits the use of folic acid (vitamin B9) by cells. Non-limiting examples of antifolates include methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), pralatrexate (Spectrum Pharmaceuticals), aminopterin (Sigma Aldrich), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, a “purine” is a compound that contains a fused six-membered and a five-membered nitrogen-containing ring. Non-limiting examples of purines that are important for cellular metabolism include adenine, guanine, hypoxanthine, and xanthine. A “purine inhibitor” is a substance that alters, reduces or suppresses the production of a purine or the use of a purine by a cell. Non-limiting examples of purine inhibitors include methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), clofarabine (Genzyme Corp.), nelarabine (GlaxoSmithKline), pralatrexate (Spectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), forodesine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), aminopterin (Sigma Aldrich), azathioprine (GlaxoSmithKline), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, a “pyrimidine” is a compound that contains a six-membered nitrogen-containing ring. Non-limiting examples of pyrimidines that are important for cellular metabolism include uracil, thymine, cytosine, and orotic acid. A “pyrimidine inhibitor” is a substance that alters, reduces, or suppresses the production of a pyrimidine or the use of a pyrimidine by the a cell. Non-limiting examples of pyrimidine inhibitors include 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), gemcitabine (Eli Lilly), cytarabine (Bedford Laboratories), decitabine (Eisai Inc.), floxuridine (Bedford Laboratories), 5-azacytidine (Pharmion Pharmaceuticals), doxifluridine (Cayman Chemicals), thiarabine (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), carmofur (Santa Cruz Biotechnology, Inc.), 6-azauracil (MP Biomedicals, LLC), pharmaceutically acceptable salts thereof, and combinations thereof.
In a preferred aspect of the present invention, the anti-metabolite agent is selected from the group consisting of 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), gemcitabine (Eli Lilly), clofarabine (Genzyme Corp.), cytarabine (Bedford Laboratories), decitabine (Eisai Inc.), floxuridine (Bedford Laboratories), nelarabine (GlaxoSmithKline), pralatrexate (Spectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), 5-azacytidine (Pharmion Pharmaceuticals), doxifluridine (Cayman Chemicals), forodesine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), thiarabine (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), aminopterin (Sigma Aldrich), carmofur (Santa Cruz Biotechnology, Inc.), azathioprine (GlaxoSmithKline), 6-azauracil (MP Biomedicals, LLC), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, a “microtubule inhibitor” is a substance that disrupts the functioning of a microtubule, such as the polymerization or the depolymerization of individual microtubule units. In one aspect of the present invention, the microtubule inhibitor may be selected from the group consisting of a microtubule-destabilizing agent, a microtubule-stabilizing agent, and combinations thereof. A microtubule inhibitor of the present invention may also be selected from the group consisting of a taxane, a vinca alkaloid, an epothilone, and combinations thereof. Non-limiting examples of microtubule inhibitors according to the present invention include BT-062 (Biotest), HMN-214 (D. Western Therapeutics), eribulin mesylate (Eisai), vindesine (Eli Lilly), EC-1069 (Endocyte), EC-1456 (Endocyte), EC-531 (Endocyte), vintafolide (Endocyte), 2-methoxyestradiol (EntreMed), GTx-230 (GTx), trastuzumab emtansine (Hoffmann-La Roche), crolibulin (Immune Pharmaceuticals), D1302A-maytansinoid conjugates (ImmunoGen), IMGN-529 (ImmunoGen), lorvotuzumab mertansine (ImmunoGen), SAR-3419 (ImmunoGen), SAR-566658 (ImmunoGen), IMP-03138 (Impact Therapeutics), topotecan/vincristine combinations (LipoCure), BPH-8 (Molecular Discovery Systems), fosbretabulin tromethamine (OXiGENE), estramustine phosphate sodium (Pfizer), vincristine (Pierre Fabre), vinflunine (Pierre Fabre), vinorelbine (Pierre Fabre), RX-21101 (Rexahn), cabazitaxel (Sanofi), STA-9584 (Synta Pharmaceuticals), vinblastine, epothilone A, patupilone (Novartis), ixabepilone (Bristol-Myers Squibb), Epothilone D (Kosan Biosciences), paclitaxel (Bristol-Myers Squibb), docetaxel (Sanofi-Aventis), HAI abraxane, DJ-927 (Daiichi Sankyo), discodermolide (CAS No: 127943-53-7), eleutherobin (CAS No: 174545-76-7), pharmaceutically acceptable salts thereof, and combinations thereof.
DNA damaging agents of the present invention include, but are not limited to, alkylating agents, platinum-based agents, intercalating agents, and inhibitors of DNA replication.
As used herein, an “alkylating agent” is a substance that adds one or more alkyl groups (CnHm, where n and m are integers) to a nucleic acid. In the present invention, an alkylating agent is selected from the group consisting of nitrogen mustards, nitrosoureas, alkyl sulfonates, triazines, ethylenimines, and combinations thereof. Non-limiting examples of nitrogen mustards include mechlorethamine (Lundbeck), chlorambucil (GlaxoSmithKline), cyclophosphamide (Mead Johnson Co.), bendamustine (Astellas), ifosfamide (Baxter International), melphalan (Ligand), melphalan flufenamide (Oncopeptides), and pharmaceutically acceptable salts thereof. Non-limiting examples of nitrosoureas include streptozocin (Teva), carmustine (Eisai), lomustine (Sanofi), and pharmaceutically acceptable salts thereof. Non-limiting examples of alkyl sulfonates include busulfan (Jazz Pharmaceuticals) and pharmaceutically acceptable salts thereof. Non-limiting examples of triazines include dacarbazine (Bayer), temozolomide (Cancer Research Technology), and pharmaceutically acceptable salts thereof. Non-limiting examples of ethylenimines include thiotepa (Bedford Laboratories), altretamine (MGI Pharma), and pharmaceutically acceptable salts thereof. Other alkylating agents include ProLindac (Access), Ac-225 BC-8 (Actinium Pharmaceuticals), ALF-2111 (Alfact Innovation), trofosfamide (Baxter International), MDX-1203 (Bristol-Myers Squibb), thioureidobutyronitrile (CellCeutix), mitobronitol (Chinoin), mitolactol (Chinoin), nimustine (Daiichi Sankyo), glufosfamide (Eleison Pharmaceuticals), HuMax-TAC and PBD ADC combinations (Genmab), BP-C1 (Meabco), treosulfan (Medac), nifurtimox (Metronomx), improsulfan tosilate (Mitsubishi tanabe Pharma), ranimustine (Mitsubishi tanabe Pharma), ND-01 (NanoCarrier), HH-1 (Nordic Nanovector), 22P1G cells and ifosfamide combinations (Nuvilex), estramustine phosphate (Pfizer), prednimustine (Pfizer), lurbinectedin (PharmaMar), trabectedin (PharmaMar), altreatamine (Sanofi), SGN-CD33A (Seattle Genetics), fotemustine (Servier), nedaplatin (Shionogi), heptaplatin (Sk Holdings), apaziquone (Spectrum Pharmaceuticals), SG-2000 (Spirogen), TLK-58747 (Telik), laromustine (Vion Pharmaceuticals), procarbazine (Alkem Laboratories Ltd.), and pharmaceutically acceptable salts thereof.
As used herein, a “platinum-based agent” is an anti-cancer substance that contains the metal platinum and analogs of such substances. The platinum may be in any oxidation state. Platinum-based agents of the present invention include, but are not limited to, 1,2-diaminocyclohexane (DACH) derivatives, phenanthroimidazole Pt(II) complexes, platiunum IV compounds, bi- and tri-nuclear platinum compounds, demethylcantharidin-integrated platinum complexes, platinum-conjugated compounds, cisplatin nanoparticles and polymer micelles, sterically hindered platinum complexes, oxaliplatin (Debiopharm), satraplatin (Johnson Matthey), BBR3464 (Novuspharma S.p.A.), ZD0473 (Astra Zeneca), cisplatin (Nippon Kayaku), JM-11 (Johnson Matthey), PAD (cis-dichlorobiscyclopentylamine platinum (II)), MBA ((trans-1,2-diaminocyclohexane) bisbromoacetato platinum (II)), PHM ((1,2-Cyclohexanediamine) malonato platinum (II)), SHP ((1,2-Cyclohexanediamine) sulphato platinum (II)), neo-PHM ((trans-R,R-1,2-Cyclohexanediamine) malonato platinum (II)), neo-SHP ((trans-R,R-1,2-Cyclohexanediamine)sulphato platinum (II)), JM-82(Johnson Matthey), PYP ((1,2-Cyclohexanediamine) bispyruvato platinum (II)), PHIC ((1,2-Cyclohexanediamine) isocitrato platinum (II)), TRK-710 ((trans-R,R-1,2-cyclohexanediamine) [3-Acetyl-5-methyl-2,4(3H,5H)-furandionato] platinum (II)), BOP ((1,2-Cyclooctanediamine) bisbromoacetato platinum (II)), JM-40 (Johnson Matthey), enloplatin (UnionPharma), zeniplatin (LGM Pharma), CI-973 (Parke-Davis), lobaplatin (Zentaris AG/Hainan Tianwang International Pharmaceutical), cycloplatam (LGM Pharma), WA2114R (miboplatin/lobaplatin) (Chembest Research Laboratories, Ltd.), heptaplatin (SKI2053R) (SK Chemicals), TNO-6 (spiroplatin) (Haihang Industry Co., Ltd.), ormaplatin (tetraplatin) (LGM Pharma), JM-9 (iproplatin) (Johnson Matthey), BBR3610 (Novuspharma S.p.A.), BBR3005 (Novuspharma S.p.A.), BBR3571 (Novuspharma S.p.A.), BBR3537 (Novuspharma S.p.A.), aroplatin (L-NDDP) (BOC Sciences), Pt-ACRAMTU ({[Pt(en) CI(ACRAMTU-S)](NO3)2 (en=ethane-1,2-diamine, ACRAMTU=1-[2-(acridin-9-ylamino)ethyl]-1,3-dimethylthiourea)}), cisplatin-loaded liposomes (LiPlasomes), SPI-077 (Alza), lipoplatin (Regulon), lipoxal (Regulon), carboplatin (Johnson Matthey), nedaplatin (Shionogi Seiyaku), miriplatin hydrate (Dainippon Sumitomo Pharma), ormaplatin (LGM Pharma), enloplatin (Lederle Laboratories), CI973 (Parke-Davis), PEGylated cisplatin, PEGylated carboplatin, PEGylated oxaliplatin, transplatin (trans-diamminedichloroplatinum(II); mixedZ:trans-[PtCl2{Z—HN═C(OMe)Me}(NH3)]), CD-37 (estradiol-platinum(II) hybrid molecule), picoplatin (Poniard Pharmaceuticals),
AH44 (Komeda et al., 2006; Harris et al., 2005; Qu et al., 2004), triplatinNC (Harris et al., 2005; Qu et al., 2004), ProLindac (Access), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, an “intercalating agent” includes, but is not limited to, doxorubicin (Adriamycin), daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
Non-limiting examples of inhibitors of DNA replication include, but are not limited to topoisomerase inhibitors. As used herein, a “topoisomerase inhibitor” is a substance that decreases the expression or the activity of a topoisomerase. The topoisomerase inhibitors according to the present invention may inhibit topoisomerase I, topoisomerase II, or both topoisomerase I and topoisomerase II. Non-limiting examples of topoisomerase I inhibitors according to the present invention include irinotecan (Alchemia), APH-0804 (Aphios), camptothecin (Aphios), cositecan (BioNumerik), topotecan (GlaxoSmithKline), belotecan hydrochloride (Chon Kun Dang), firtecan pegol (Enzon), HN-30181A (Hanmi), hRS7-SN-38 (Immunomedics), labetuzumab-SN-38 (Immunomedics), etirinotecan pegol (Nektar Therapeutics), NK-012 (Nippon Kayaku), SER-203 (Serina Therapeutics), simmitecan hydrochloride prodrug (Shanghai HaiHe Pharmaceuticals), gimatecan (Sigma-Tau), namitecan (Sigma-Tau), SN-38 (Supratek Pharma), TLC-388 hydrochloride (Taiwan Liposome Company), lamellarin D (PharmaMar), pharmaceutically acceptable salts thereof, and combinations thereof. Non-limiting examples of inhibitors of topoisomerase type II according to the present invention include Adva-27a (Advanomics), zoptarelin doxorubicin (Aeterna Zentaris), valrubicin (Anthra Pharmaceuticals), razoxane (AstraZeneca), doxorubicin (Avena Therapeutics), amsacrine (Bristol-Myers Squibb), etoposide phosphate (Bristol-Myers Squibb), etoposide (Novartis), dexrazoxane (Cancer Research Technology), cytarabine/daunorubicin combination (Celator Pharmaceuticals), CAP7.1 (CellAct Pharma), aldoxorubicin (CytRx), amrubicin hydrochloride (Dainippon Sumitomo Pharma), vosaroxin (Dainippon Sumitomo Pharma), daunorubicin (Gilead Sciences), milatuzumab/doxorubicin combination (Immunomedics), aclarubicin (Kyowa Hakko Kirin), mitoxantrone (Meda), pirarubicin (Meiji), epirubicin (Pfizer), teniposide (Novartis), F-14512 (Pierre Fabre), elliptinium acetate (Sanofi), zorubicin (Sanofi), dexrazoxane (TopoTarget), sobuzoxane (Zenyaku Kogyo), idarubicin (Pfizer), HU-331 (Cayman Chemical), aurintricarboxylic acid (Sigma Aldrich), pharmaceutically acceptable salts thereof, and combinations thereof.
Chemotherapeutic antibiotics according to the present invention include, but are not limited to, actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
As used herein, the term “anti-angiogenesis agent” means any compound that prevents or delays nascent blood vessel formation from existing vessels. In the present invention, examples of anti-angiogenesis agents include, but are not limited to, pegaptanib, ranibizumab, bevacizumab (avastin), carboxyamidotriazole, TNP-470, CM101, IFN-α, IL-12, platelet factor 4, suramin, SU5416, thrombospondin, VEGFR antagonists, angiostatic steroids and heparin, cartilage-derived angiogenesis inhibitory factor, matrix metalloproteinase inhibitors, angiostatin, endostatin, 2-methoxyestradiol, tecogalan, prolactin, αvβ3 inhibitors, linomide, VEGF-Trap, aminosterols, cortisone, tyrosine kinase inhibitors, anti-angiogenic siRNA, inhibitors of the complement system, vascular disrupting agents, and combinations thereof. Preferably, the anti-angiogenesis agent is bevacizumab.
VEGFR antagonists of the present invention include, but are not limited to, pazopanib, regorafenib, lenvatinib, sorafenib, sunitinib, axitinib, vandetanib, cabozantinib, vatalanib, semaxanib, ZD6474, SU6668, AG-013736, AZD2171, AEE788, MF1/MC-18F1, DC101/IMC-1011, ramucirumab, and motesanib. VEGFR antagonists may also include, VEGF inhibitors such as bevacizumab, aflibercept, 203, r84, VEGF-Trap, and ranibizumab.
Angiostatic steroids of the present invention include any steroid that inhibits, attenuates, prevents angiogenesis or neovascularization, or causes regression of pathological vascularization. Angiostatic steroids of the present invention include those disclosed in European Patent Application Serial No. EP1236471 A2, as well as those 20-substituted steroids disclosed in U.S. Pat. No. 4,599,331, those 21-hydroxy steroids disclosed in U.S. Pat. No. 4,771,042, those C11-functionalized steroids disclosed in International Application Serial No. WO 1987/02672, 6α-fluoro17α,21-dihydroxy-16α-methylpregna-4,9(11)-diene-3,20-dione 21-acetate, 6α-fluoro-17α,21-dihydroxy-16β-methylpregna-4,9(11)-diene-3,20-dione, 6α-fluoro-17α,21-dihydroxy-16β-methylpregna-4,9(11)-diene-3,20-dione 21-phosphonooxy and pharmaceutically acceptable salts thereof, hydrocortisone, tetrahydrocortisol, 17α-hydroxy-progesterone, 11α-epihydrocortisone, cortexolone, corticosterone, desoxycorticosterone, dexamethasone, cortisone 21-acetate, hydrocortisone 21-phosphate, 17α-hydroxy-6α-methylpregn-4-ene-3,20-dione 17-acetate, 6α-fluoro-17α,21-dihydroxy-16α-methylpregna-4,9(11)-diene-3,20-dione, and Δ9(11)-etianic esters, all disclosed in International Application Serial No. WO 1990/015816 A1.
Cartilage-derived angiogenesis inhibitor factors include, but are not limited to, peptide troponin and chondromodulin I.
Matrix metalloproteinase inhibitors of the present invention include, but are not limited to, succinyl hydroxamates such as marimastat and SC903, sulphonamide hydroxamates such as CGS27023A, phosphinamide hydroxamates, carboxylate inhibitors such as BAY12-9566, thiol inhibitors such as Compound B, aminomethyl benzimidazole analogues, peptides such as regasepin, and tetracyclines such as minocycline.
αvβ3 inhibitors include, but are not limited to, IS20I, P11 peptide, EMD 85189, and 66203, RGD peptide, RGD mimetics such as S 36578-2, echistatin, antibodies or antibody fragments against αvβ3 integrin such as Vitaxin, which targets the extracellular domain of the dimer, cilengitide, and peptidomimetics such as S247.
Anti-angiogenic siRNAs include, but are not limited to, siRNAs targeting mRNAs that are upregulated during angiogenesis, optionally PEGylated siRNAs targeting VEGF or VEGFR mRNAs, and siRNAs targeting UPR (unfolded protein response)-IRE1α, XBP-1, and ATF6 mRNAs. Additionally, it has been shown that siRNAs that are, at minimum, 21 nucleotides in length, regardless of targeting sequence, suppress neovascularization (Kleinman, et al., 2008) and may be included in the anti-angiogenic siRNAs of the present invention.
Inhibitors of the complement system include, but are not limited to, modified native complement components such as soluble complement receptor type 1, soluble complement receptor type 1 lacking long homologous repeat-A, soluble Complement Receptor Type 1-Sialyl Lewisx, complement receptor type 2, soluble decay accelerating factor, soluble membrane cofactor protein, soluble CD59, decay accelerating factor-CD59 hybrid, membrane cofactor protein-decay accelerating factor hybrid, C1 inhibitor, and C1q receptor, complement-inhibitory antibodies such as anti-C5 monoclonal antibody and anti-C5 single chain Fv, synthetic inhibitors of complement activation such as antagonistic peptides and analogs targeting C5a receptor, and naturally occurring compounds that block complement activation such as heparin and related glycosaminoglycan compounds. Additional inhibitors of the complement system are disclosed by Makrides (Makrides, 1998).
As used herein, the term “vascular disrupting agent” means any compound that targets existing vasculature, e.g. tumor vasculature, damages or destroys said vasculature, and/or causes central tumor necrosis. In the present invention, examples of vascular disrupting agents include, but are not limited to, ABT-751 (Abbott), AVE8062 (Aventis), BCN105 (Bionomics), BMXAA (Antisoma), CA-4-P (OxiGene), CA-1-P (OxiGene), CYT997 (Cytopia), MPC-6827 (Myriad Pharmaceuticals), MN-029 (MediciNova), NPI-2358 (Nereus), Oxi4503 (Oxigene), TZT-1027 (Daichi Pharmaceuticals), ZD6126 (AstraZeneca and Angiogene), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, a “molecularly targeted agent” is a substance that interferes with the function of a single molecule or group of molecules, preferably those that are involved in tumor growth and progression, when administered to a subject. Non-limiting examples of molecularly targeted agents of the present invention include signal transduction inhibitors, modulators of gene expression and other cellular functions, immune system modulators, antibody-drug conjugates (ADCs), and combinations thereof.
As used herein, a “signal transduction inhibitor” is a substance that disrupts communication between cells, such as when an extracellular signaling molecule activates a cell surface receptor. Non-limiting examples of signal transduction inhibitors of the present invention include anaplastic lymphoma kinase (ALK) inhibitors, B-Raf inhibitors, epidermal growth factor inhibitors (EGFRi), ERK inhibitors, Janus kinase inhibitors, MEK inhibitors, mammalian target of rapamycin (mTor) inhibitors, phosphoinositide 3-kinase inhibitors (PI3Ki), and Ras inhibitors.
As used herein, an “anaplastic lymphoma kinase (ALK) inhibitor” is a substance that (i) directly interacts with ALK, e.g., by binding to ALK and (ii) decreases the expression or the activity of ALK. Non-limiting examples of anaplastic lymphoma kinase (ALK) inhibitors of the present invention include crizotinib (Pfizer, New York, N.Y.), CH5424802 (Chugai Pharmaceutical Co., Tokyo, Japan), GSK1838705 (GlaxoSmithKline, United Kingdom), Chugai 13d (Chugai Pharmaceutical Co., Tokyo, Japan), CEP28122 (Teva Pharmaceutical Industries, Ltd., Israel), AP26113 (Ariad Pharmaceuticals, Cambridge, Mass.), Cephalon 30 (Teva Pharmaceutical Industries, Ltd., Israel), X-396 (Xcovery, Inc., West Palm Beach, Fla.), Amgen 36 (Amgen Pharmaceuticals, Thousand Oaks, Calif.), ASP3026 (Astellas Pharma US, Inc., Northbrook, Ill.), and Amgen 49 (Amgen Pharmaceuticals, Thousand Oaks, Calif.), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, a “B-Raf inhibitor” of the present invention is a substance that (i) directly interacts with B-Raf, e.g., by binding to B-Raf and (ii) decreases the expression or the activity of B-Raf. B-Raf inhibitors may be classified into two types by their respective binding modes. As used herein, “Type 1” B-Raf inhibitors are those inhibitors that target the ATP binding sites of the kinase in its active conformation. “Type 2” B-Raf inhibitors are those inhibitors that preferentially bind to an inactive conformation of the kinase. Non-limiting examples of Type 1 B-Raf inhibitors of the present invention include:
dabrafenib (GlaxoSmithKline), GDC-0879 (Genentech), L-779450 B-Raf (Merck), PLX3202 (Plexxikon), PLX4720 (Plexxikon), SB-590885 (GlaxoSmithKline), SB-699393 (GlaxoSmithKline), vemurafenib (Plexxikon), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 1 RAF inhibitor is dabrafenib or a pharmaceutically acceptable salt thereof.
Non-limiting examples of Type 2 B-Raf inhibitors of the present invention include:
Sorafenib (Onyx Pharmaceuticals), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof
Other B-Raf inhibitors include, without limitation, AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 253 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Institute of Cancer Research), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GW 5074 (Sigma Aldrich), ISIS 5132 (Novartis), LErafAON (NeoPharm, Inc.), LBT613 (Novartis), LGX 818 (Novartis), pazopanib (GlaxoSmithKline), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), TAK 632 (Takeda), TL-241 (Teligene), XL-281 (Exelixis), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, an “EGFR inhibitor” is a substance that (i) directly interacts with EGFR, e.g. by binding to EGFR and (ii) decreases the expression or the activity of EGFR. Non-limiting examples of EGFR inhibitors according to the present invention include (+)-Aeroplysinin-1 (CAS #28656-91-9), 3-(4-Isopropylbenzylidenyl)-indolin-2-one, ABT-806 (Life Science Pharmaceuticals), AC-480 (Bristol-Myers Squibb), afatinib (Boehringer Ingelheim), AG 1478 (CAS #153436-53-4), AG 494 (CAS #133550-35-3), AG 555 (CAS #133550-34-2), AG 556 (CAS #133550-41-1), AG 825 (CAS #149092-50-2), AG-490 (CAS #134036-52-5), antroquinonol (Golden Biotechnology), AP-26113 (Ariad), ARRY334543 (CAS #845272-21-1), AST 1306 (CAS #897383-62-9), AVL-301 (Celgene), AZD8931 (CAS #848942-61-0), BIBU 1361 (CAS #793726-84-8), BIBX 1382 (CAS #196612-93-8), BMS-690514 (Bristol-Myers Squibb), BPIQ-I (CAS #174709-30-9), Canertinib (Pfizer), cetuximab (Actavis), cipatinib (Jiangsu Hengrui Medicine), CL-387,785 (Santa Cruz Biotech), compound 56 (CAS #171745-13-4), CTX-023 (CytomX Therapeutics), CUDC-101 (Curis), dacomitinib (Pfizer), DAPH (CAS #145915-58-8), daphnetin (Santa Cruz Biotech), dovitinib lactate (Novartis), EGFR Inhibitor (CAS #879127-07-8), epitinib (Hutchison China MediTech), erbstatin Analog (CAS #63177-57-1), erlotinib (Astellas), gefitinib (AstraZeneca), GT-MAB 5.2-GEX (Glycotope), GW 583340 (CAS #388082-81-3), GW2974 (CAS #202272-68-2), HDS 029 (CAS #881001-19-0), Hypericin (Santa Cruz Biotech), icotinib hydrochloride (Betapharma), JNJ-26483327 (Johnson & Johnson), JNJ-28871063 (Johnson & Johnson), KD-020 (Kadmon Pharmaceuticals), lapatinib ditosylate (GlaxoSmithKline), Lavendustin A (Sigma), Lavendustin C (Sigma), LY-3016859 (Eli Lilly), MEHD-7945A (Hoffmann-La Roche), MM-151 (Merrimack), MT-062 (Medisyn Technologies), necitumumab (Eli Lilly), neratinib (Pfizer), nimotuzumab (Center of Molecular Immunology), NT-004 (NewGen Therapeutics), pantiumumab (Amgen), PD 153035 (CAS #153436-54-5), PD 161570 (CAS #192705-80-9), PD 168393, PD 174265 (CAS #216163-53-0), pirotinib (Sihuan Pharmaceutical), poziotinib (Hanmi), PP 3 (CAS #5334-30-5), PR-610 (Proacta), pyrotinib (Jiangsu Hengrui Medicine), RG-13022 (CAS #136831-48-6), rindopepimut (Celldex Therapeutics), RPI-1 (CAS #269730-03-2), S-222611 (Shionogi), TAK 285 (CAS #871026-44-7), TAS-2913 (Taiho), theliatinib (Hutchison China MediTech), Tyrphostin 47 (RG-50864, AG-213) (CAS #118409-60-2), Tyrphostin 51 (CAS #122520-90-5), Tyrphostin AG 1478 (CAS #175178-82-2), Tyrphostin AG 183 (CAS #126433-07-6), Tyrphostin AG 528 (CAS #133550-49-9), Tyrphostin AG 99 (CAS #118409-59-9), Tyrphostin B42 (Santa Cruz Biotech), Tyrphostin B44 (Santa Cruz Biotech), Tyrphostin RG 14620 (CAS #136831-49-7), vandetanib (AstraZeneca), varlitinib (Array BioPharma), vatalanib (Novartis), WZ 3146 (CAS #1214265-56-1), WZ 4002 (CAS #1213269-23-8), WZ8040 (CAS #1214265-57-2), XL-647 (Exelixis), Z-650 (HEC Pharm), ZM 323881 (CAS #324077-30-7), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the EGFR inhibitor is selected from the group consisting of panitumumab, erlotinib, pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, an “ERK inhibitor” is a substance that (i) directly interacts with ERK, including ERK1 and ERK2, e.g., by binding to ERK and (ii) decreases the expression or the activity of an ERK protein kinase. Therefore, inhibitors that act upstream of ERK, such as MEK inhibitors and RAF inhibitors, are not ERK inhibitors according to the present invention. Non-limiting examples of ERK inhibitors of the present invention include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, a “Janus kinase inhibitor” is a substance that (i) directly interacts with a Janus kinase, e.g., by binding to a Janus kinase and (ii) decreases the expression or the activity of a Janus kinase. Janus kinases of the present invention include Tyk2, Jak1, Jak2, and Jak3. Non-limiting examples of Janus kinase inhibitors of the present invention include ruxolitinib (Incyte Corporation, Wilmington, Del.), baricitinib (Incyte Corporation, Wilmington, Del.), tofacitinib (Pfizer, New York, N.Y.), VX-509 (Vertex Pharmaceuticals, Inc., Boston, Mass.), GLPG0634 (Galapagos Nev., Belgium), CEP-33779 (Teva Pharmaceuticals, Israel), pharmaceutically acceptable salts thereof, and combinations thereof
As used herein, a “MEK inhibitor” is a substance that (i) directly interacts with MEK, e.g., by binding to MEK and (ii) decreases the expression or the activity of MEK. Therefore, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEK inhibitors according to the present invention. MEK inhibitors may be classified into two types depending on whether the inhibitor competes with ATP. As used herein, a “Type 1” MEK inhibitor is an inhibitor that competes with ATP for binding to MEK. A “Type 2” MEK inhibitor is an inhibitor that does not compete with ATP for binding to MEK. Non-limiting examples of type 1 MEK inhibitors according to the present invention include bentamapimod (Merck KGaA), L783277 (Merck), R0092210 (Roche), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 1 MEK inhibitor is R0092210 (Roche) or a pharmaceutically acceptable salt thereof. Non-limiting examples of type 2 MEK inhibitors according to the present invention include anthrax toxin, lethal factor portion of anthrax toxin, ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzoimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), MEK162 (Array BioPharma), PD 098059 (2-(2′-amino-3′-methoxyphenyl)-oxanaphthalen-4-one), PD 184352 (CI-1040), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), refametinib (AstraZeneca), selumetinib (AZD6244) (AstraZeneca), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), RDEA119 (Ardea Biosciences/Bayer), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 2 MEK inhibitor is trametinib or a pharmaceutically acceptable salt thereof. Other MEK inhibitors include, without limitation, antroquinonol (Golden Biotechnology), AS-1940477 (Astellas), AS-703988 (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973, RG422, 804987655, 805126766, SL327, WX-554 (Wilex), YopJ polypeptide, pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, an “mTOR inhibitor” is a substance that (i) directly interacts with mTOR, e.g. by binding to mTOR and (ii) decreases the expression or the activity of mTOR. Non-limiting examples of mTOR inhibitors according to the present invention include zotarolimus (AbbVie), umirolimus (Biosensors), temsirolimus (Pfizer), sirolimus (Pfizer), sirolimus NanoCrystal (Elan Pharmaceutical Technologies), sirolimus TransDerm (TransDerm), sirolimus-PNP (Samyang), everolimus (Novartis), biolimus A9 (Biosensors), ridaforolimus (Ariad), rapamycin, TCD-10023 (Terumo), DE-109 (MacuSight), MS-R001 (MacuSight), MS-R002 (MacuSight), MS-R003 (MacuSight), Perceiva (MacuSight), XL-765 (Exelixis), quinacrine (Cleveland BioLabs), PKI-587 (Pfizer), PF-04691502 (Pfizer), GDC-0980 (Genentech and Piramed), dactolisib (Novartis), CC-223 (Celgene), PWT-33597 (Pathway Therapeutics), P-7170 (Piramal Life Sciences), LY-3023414 (Eli Lilly), INK-128 (Takeda), GDC-0084 (Genentech), DS-7423 (Daiichi Sankyo), DS-3078 (Daiichi Sankyo), CC-115 (Celgene), CBLC-137 (Cleveland BioLabs), AZD-2014 (AstraZeneca), X-480 (Xcovery), X-414 (Xcovery), EC-0371 (Endocyte), VS-5584 (Verastem), PQR-401 (Piqur), PQR-316 (Piqur), PQR-311 (Piqur), PQR-309 (Piqur), PF-06465603 (Pfizer), NV-128 (Novogen), nPT-MTOR (Biotica Technology), BC-210 (Biotica Technology), WAY-600 (Biotica Technology), WYE-354 (Biotica Technology), WYE-687 (Biotica Technology), LOR-220 (Lorus Therapeutics), HMPL-518 (Hutchison China MediTech), GNE-317 (Genentech), EC-0565 (Endocyte), CC-214 (Celgene), and ABTL-0812 (Ability Pharmaceuticals).
As used herein, a “PI3K inhibitor” is a substance that decreases the expression or the activity of phosphatidylinositol-3 kinases (PI3Ks) or downstream proteins, such as Akt. PI3Ks, when activated, phosphorylate the inositol ring 3′-OH group in inositol phospholipids to generate the second messenger phosphatidylinositol-3,4,5-trisphosphate (PI-3,4,5-P(3)). Akt interacts with a phospholipid, causing it to translocate to the inner membrane, where it is phosphorylated and activated. Activated Akt modulates the function of numerous substrates involved in the regulation of cell survival, cell cycle progression and cellular growth.
Non-limiting examples of PI3K inhibitors according to the present invention include A-674563 (CAS #552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, Calif.), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS #857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, Calif.), BML-257 (CAS #32387-96-5), CAL-120 (Gilead Sciences, Foster City, Calif.), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS #612847-09-3, CAS #681281-88-9, CAS #75747-14-7, CAS #925681-41-0, CAS #98510-80-6, CCT128930 (CAS #885499-61-6), CH5132799 (CAS #1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS #902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS #937174-76-0), H-89 (CAS #127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS #108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS #1032350-13-2), ML-9 (CAS #105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, Mass.), perifosine, PHT-427 (CAS #1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, N.J.), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, Calif.), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, Calif.), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (GDC-0941) (Roche Holdings Inc.), PIK-90 (CAS #677338-12-4), SC-103980 (Pfizer, New York, N.Y.), SF-1126 (Semafore Pharmaceuticals, Indianapolis, Ind.), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, Calif.), Triciribine, X-339 (Xcovery, West Palm Beach, Fla.), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the inhibitor of the PI3K/Akt pathway is pictilisib (GDC-0941) or a pharmaceutically acceptable salt thereof.
As used herein, a “RAS inhibitor” is a substance that (i) directly interacts with RAS, e.g., by binding to RAS and (ii) decreases the expression or the activity of RAS. Non-limiting examples of RAS inhibitors according to the present invention include farnesyl transferase inhibitors (such as, e.g., tipifarnib and lonafarnib), farnesyl group-containing small molecules (such as, e.g., salirasib and TLN-4601), DCAI, as described by Maurer (Maurer, et al., 2012), Kobe0065 and Kobe2602, as described by Shima (Shima, et al., 2013), and HBS 3 (Patgiri, et al., 2011), and AIK-4 (Allinky), pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, “gene expression” is a process by which the information from DNA is used in the formation of a polypeptide. A “modulator of gene expression and other cellular functions” is a substance that affects gene expression and other works of a cell. Non-limiting examples of such modulators include hormones, histone deacetylase inhibitors (HDACi), and cyclin-dependent kinase inhibitors (CDKi), and poly ADP ribose polymerase (PARP) inhibitors.
In the present invention, a “hormone” is a substance released by cells in one part of a body that affects cells in another part of the body. Non-limiting examples of hormones according to the present invention include prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, antimullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcidiol.
Some compounds interfere with the activity of certain hormones or stop the production of certain hormones. Non-limiting examples of hormone-interfering compounds according to the present invention include tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds are also within the meaning of hormone in the present invention.
As used herein, an “HDAC inhibitor” is a substance that (i) directly interacts with HDAC, e.g., by binding to HDAC and (ii) decreases the expression or the activity of HDAC. Non-limiting examples of HDAC inhibitors according to the present invention include 4SC-201 (4SC AG), 4SC-202 (Takeda), abexinostat (Celera), AN-1 (Titan Pharmaceuticals, Inc.), Apicidine (Merck & Co., Inc.), AR-42 (Arno Therapeutics), ARQ-700RP (ArQule), Avugane (TopoTarget AS), azelaic-1-hydroxamate-9-anilide (AAHA), belinostat (TopoTarget), butyrate (Enzo Life Sciences, Inc.), CG-1255 (Errant Gene Therapeutics, LLC), CG-1521 (Errant Gene Therapeutics, LLC), CG-200745 (CrystalGenomics, Inc.), chidamide (Shenzhen Chipscreen Biosciences), CHR-3996 (Chroma Therapeutics), CRA-024781 (Pharmacyclics), CS-3158 (Shenzhen Chipscreen Biosciences), CU-903 (Curis), DAC-60 (Genextra), entinostat (Bayer), hyaluronic acid butyric acid ester (HA-But), IKH-02 (IkerChem), IKH-35 (IkerChem), ITF-2357 (Italfarmaco), ITF-A (Italfarmaco), JNJ-16241199 (Johnson & Johnson), KA-001 (Karus Therapeutics), KAR-3000 (Karus Therapeutics), KD-5150 (Kalypsys), KD-5170 (Kalypsys), KLYP-278 (Kalypsys), KLYP-298 (Kalypsys), KLYP-319 (Kalypsys), KLYP-722 (Kalypsys), m-carboxycinnamic acid bis-hydroxamide (CBHA), MG-2856 (MethylGene), MG-3290 (MethylGene), MG-4230 (MethylGene), MG-4915 (MethylGene), MG-5026 (MethylGene), MGCD-0103 (MethylGene Inc.), mocetinostat (MethylGene), MS-27-275 (Schering AG), NBM-HD-1 (NatureWise), NVP-LAQ824 (Novartis), OCID-4681-S-01 (Orchid Pharmaceuticals), oxamflatin ((2E)-5-[3-[(phenylsufonyl) aminol phenyl]-pent-2-en-4-ynohydroxamic acid), panobinostat (Novartis), PCI-34051 (Pharmacyclics), phenylbutyrate (Enzo Life Sciences, Inc.), pivaloyloxymethyl butyrate (AN-9, Titan Pharmaceuticals, Inc.), pivanex (Titan Pharmaceuticals, Inc.), pracinostat (SBIO), PX-117794 (TopoTarget AS), PXD-118490 (LEO-80140) (TopoTarget AS), pyroxamide (suberoyl-3-aminopyridineamide hydroxamic acid), resminostat (Takeda), RG-2833 (RepliGen), ricolinostat (Acetylon), romidepsin (Astellas), SB-1304 (S*BIO), SB-1354 (S*BIO), SB-623 (Merrion Research I Limited), SB-624 (Merrion Research I Limited), SB-639 (Merrion Research I Limited), SB-939 (S*BIO), Scriptaid (N-Hydroxy-1,3-dioxo-1H-benz[de]isoquinoline-2(3H)-hexan amide), SK-7041 (In2Gen/SK Chemical Co.), SK-7068 (In2Gen/SK Chemical Co.), suberoylanilide hydroxamic acid (SAHA), sulfonamide hydroxamic acid, tributyrin (Sigma Aldrich), trichostatin A (TSA) (Sigma Aldrich), valporic acid (VPA) (Sigma Aldrich), vorinostat (Zolinza), WF-27082B (Fujisawa Pharmaceutical Company, Ltd.), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the HDAC inhibitor is romidepsin, pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, “CDK” is a family of protein kinases that regulate the cell cycle. Known CDKs include cdk1, cdk2, ckd3, ckd4, cdk5, cdk6, cdk7, cdk8, cdk9, cdk10, and cdk11. A “CDK inhibitor” is a substance that (i) directly interacts with CDK, e.g. by binding to CDK and (ii) decreases the expression or the activity of CDK. Non-limiting examples of CDK inhibitors according to the present invention include 2-Hydroxybohemine, 3-ATA, 5-Iodo-Indirubin-3′-monoxime, 9-Cyanopaullone, Aloisine A, Alsterpaullone 2-Cyanoethyl, alvocidib (Sanofi), AM-5992 (Amgen), Aminopurvalanol A, Arcyriaflavin A, AT-7519 (Astex Pharmaceuticals), AZD 5438 (CAS #602306-29-6), BMS-265246 (CAS #582315-72-8), BS-181 (CAS #1092443-52-1), Butyrolactone I (CAS #87414-49-1), Cdk/Crk Inhibitor (CAS #784211-09-2), Cdk1/5 Inhibitor (CAS #40254-90-8), Cdk2 Inhibitor II (CAS #222035-13-4), Cdk2 Inhibitor IV, NU6140 (CAS #444723-13-1), Cdk4 Inhibitor (CAS #546102-60-7), Cdk4 Inhibitor III (CAS #265312-55-8), Cdk4/6 Inhibitor IV (CAS #359886-84-3), Cdk9 Inhibitor II (CAS #140651-18-9), CGP 74514A, CR8, CYC-065 (Cyclacel), dinaciclib (Ligand), (R)-DRF053 dihydrochloride (CAS #1056016-06-8), Fascaplysin, Flavopiridol, Hygrolidin, Indirubin, LEE-011 (Astex Pharmaceuticals), LY-2835219 (Eli Lilly), milciclib maleate (Nerviano Medical Sciences), MM-D37K (Maxwell Biotech), N9-Isopropyl-olomoucine, NSC 625987 (CAS #141992-47-4), NU2058 (CAS #161058-83-9), NU6102 (CAS #444722-95-6), Olomoucine, ON-108600 (Onconova), ON-123300 (Onconova), Oxindole I, P-1446-05 (Piramal), P-276-00 (Piramal), palbociclib (Pfizer), PHA-767491 (CAS #845714-00-3), PHA-793887 (CAS #718630-59-2), PHA-848125 (CAS #802539-81-7), Purvalanol A, Purvalanol B, R547 (CAS #741713-40-6), RO-3306 (CAS #872573-93-8), Roscovitine, SB-1317 (SBIO), SCH 900776 (CAS #891494-63-6), SEL-120 (Selvita), seliciclib (Cyclacel), SNS-032 (CAS #345627-80-7), SU9516 (CAS #377090-84-1), WHI-P180 (CAS #211555-08-7), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the CDK inhibitor is selected from the group consisting of dinaciclib, palbociclib, pharmaceutically acceptable salts thereof, and combinations thereof.
As used herein, a “poly ADP ribose polymerase (PARP) inhibitor” is a substance that decreases the expression or activity of poly ADP ribose polymerases (PARPs) or downstream proteins. Non-limiting examples of poly ADP ribose polymerase (PARP) inhibitors of the present invention include PF01367338 (Pfizer, New York, N.Y.), olaparib (AstraZeneca, United Kingdom), iniparib (Sanofi-Aventis, Paris, France), veliparib (Abbott Laboratories, Abbott Park, Ill.), MK 4827 (Merck, White House Station, N.J.), CEP 9722 (Teva Pharmaceuticals, Israel), LT-673 (Biomarin, San Rafael, Calif.), and BSI 401 (Sanofi-Aventis, Paris, France), pharmaceutically acceptable salts thereof, and combinations thereof.
In a preferred embodiment, the chemotherapy comprises administering to the human an agent selected from the group consisting of gemcitabine, taxol, adriamycin, ifosfamide, trabectedin, pazopanib, abraxane, avastin, everolimus, and combinations thereof.
As used herein, “radiotherapy” means any therapeutic regimen, that is compatible with the C. novyi, e.g., C. novyi NT, treatment of the present invention and in which radiation is delivered to a subject, e.g., a human, for the treatment of cancer. Radiotherapy can be delivered to, e.g., a human subject, by, for example, a machine outside the body (external-beam radiation therapy) or a radioactive material inside the body (brachytherapy, systemic radiation therapy).
External-beam radiation therapy includes, but is not limited to, 3-dimensional conformal radiation therapy, intensity-modulated radiation therapy, image-guided radiation therapy, tomotherapy, stereotactic radiosurgery, stereotactic body radiation therapy, proton therapy, and other charged particle beam therapies, such as electron beam therapy. External-beam radiation therapies are widely used in cancer treatment and are well known to those of skill in the art.
Brachytherapy means radiotherapy delivered by being implanted in, or placed on, a subject's body. Brachytherapy includes, but is not limited to, interstitial brachytherapy, intracavitary brachytherapy, and episcleral brachytherapy. Brachytherapy techniques are also widely used in cancer treatment and are well known to those of skill in the art.
Systemic radiation therapy means radiotherapy delivered by injection to or ingestion by a subject. One example of systemic radiation therapy is radioiodine therapy. Radioiodine is a radiolabeled iodine molecule that is safe and effective for use in a subject, such as, e.g., a human. Non-limiting examples of radioiodine according to the present invention may be selected from the group consisting of 123I, 124I, 125I, 131I, and combinations thereof. Preferably, the radioiodine is 131I.
As used herein, “immunotherapy” means any anti-cancer therapeutic regimen that is compatible with the C. novyi, e.g., C. novyi NT, treatment of the present invention and that uses a substance that alters the immune response by augmenting or reducing the ability of the immune system to produce antibodies or sensitized cells that recognize and react with the antigen that initiated their production. Immunotherapies may be recombinant, synthetic, or natural preparations and include cytokines, corticosteroids, cytotoxic agents, thymosin, and immunoglobulins. Some immunotherapies are naturally present in the body, and certain of these are available in pharmacologic preparations. Examples of immunotherapies include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), interferons, imiquimod and cellular membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, and synthetic cytosine phosphate-guanosine (CpG).
In one preferred embodiment, the immunotherapy comprises administering to the human an immune checkpoint inhibitor. As used herein, an “immune checkpoint inhibitor” means a substance that blocks the activity of molecules involved in attenuating the immune response. Such molecules include, for example, cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) and programmed cell death protein 1 (PD-1). Immune checkpoint inhibitors of the present invention include, but are not limited to, ipilimumab (Bristol-Myers Squibb), tremelimumab (Pfizer), MDX-1106 (Medarex, Inc.), MK3475 (Merck), CT-011 (CureTech, Ltd.), AMP-224 (Amplmmune), MDX-1105 (Medarex, Inc.), IMP321 (Immutep S.A.), and MGA271 (Macrogenics).
In an additional aspect of this embodiment, the C. novyi, e.g., C. novyi NT, therapy of the present invention is effective against, e.g., solid tumors that are resistant to a therapy selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, and combinations thereof.
In another aspect of this embodiment, the solid tumor is refractory to standard therapy or the solid tumor is without an available standard therapy, yet the C. novyi, e.g., C. novyi NT, therapy of the present invention is effective against such a tumor.
As used herein, “resistant” and “refractory” are used interchangeably. Being “refractory” to a therapy means that the prior therapy or therapies has/have reduced efficacy in, e.g., treating cancer or killing cancer cells, compared to the same subject prior to becoming resistant to the therapy.
As used herein, the term “standard therapy” means those therapies generally accepted by medical professionals as appropriate for treatment of a particular cancer, preferably a particular solid tumor. Standard therapies may be the same or different for different tumor types. Standard therapies are typically approved by various regulatory agencies, such as, for example, the U.S. Food and Drug Administration.
In a further aspect of this embodiment, the method induces a potent localized inflammatory response and an adaptive immune response in the human.
As used herein, an “inflammatory response” is a local response to cellular damage, pathogens, or irritants that may include, but is not limited to, capillary dilation, leukocytic infiltration, swelling, redness, heat, itching, pain, loss of function, and combinations thereof.
As used herein, an “adaptive immune response” involves B and T cells of a subject's immune system. Upon exposure to a pathogenic substance, for example, a cancer cell, B cells may produce antibodies against pathogenic antigens on the pathogenic substance, and T cells may become able to target pathogens for eventual destruction. Certain populations of B and T cells, specific for a given antigen, are retained by the immune system and are called upon in the event of subsequent exposure to the pathogenic antigen. An adaptive immune response is thus durable, and provides a host subject's immune system with the continual ability to recognize and destroy a given pathogenic antigen-presenting pathogen.
Another embodiment of the present invention is a method for debulking a solid tumor present in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi, preferably C. novyi NT, CFUs comprising about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution.
As used herein, “debulking” a solid tumor means to reduce the size of or the number of cancer in a solid tumor. Such a procedure is palliative and may be used to enhance the effectiveness of the treatments, including radiation therapy, chemotherapy, or amputation. In this embodiment, solid tumors are as set forth above. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, and melanoma. More preferably, the solid tumor is a leiomyosarcoma, such as a retroperitoneal leiomyosarcoma.
An additional embodiment of the present invention is a method for debulking a solid tumor present in a human. This method comprises administering intratumorally to the human one to four cycles of a unit dose of C. novyi NT spores comprising about 1×104 spores per cycle, each unit dose of C. novyi NT being suspended in a pharmaceutically acceptable carrier or solution. In this embodiment, the types of solid tumors are as set forth above. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, and melanoma.
A further embodiment of the present invention is a method for treating or ameliorating an effect of a solid tumor present in a human. This method comprises administering intratumorally to the human one to four cycles of a unit dose of C. novyi NT spores comprising about 1×104 spores per cycle, each unit dose of C. novyi NT spores being suspended in a pharmaceutically acceptable carrier or solution. Various types of solid tumors are as set forth above. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, and melanoma.
Another embodiment of the present invention is method for ablating a solid tumor present in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi, preferably C. novyi NT, CFUs comprising about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution, wherein the tumor is ablated leaving a margin of normal tissue.
As used herein, “ablating” a solid tumor means that the process removes all of the solid tumor. In this process, after carrying out the treatment, a margin of normal tissue is left surrounding the area where the tumor once resided. In this embodiment, the types of solid tumors are as set forth above. Preferably, the solid tumor is a sarcoma. More preferably, the solid tumor is a leiomyosarcoma, such as a retroperitoneal leiomyosarcoma.
A further embodiment of the present invention is a unit dose of C. novyi CFUs. This unit dose comprises about 1×103-1×107 CFUs in a pharmaceutically acceptable carrier or solution, which is effective for treating or ameliorating an effect of a solid tumor present in a human. As set forth above, the C. novyi CFUs may be in vegetative and spore forms.
In one aspect of this embodiment, the C. novyi is C. novyi NT. Preferably, the unit dose comprises about 1×104-1×107 C. novyi NT spores, such as about 1×106-1×107 C. novyi NT spores, in a pharmaceutically acceptable carrier or solution. Preferably, the unit dose comprises about 1×104 C. novyi NT spores in a pharmaceutically acceptable carrier or solution.
An additional embodiment of the present invention is a kit for treating or ameliorating an effect of a solid tumor present in a human. This kit comprises a unit dose of C. novyi CFUs comprising about 1×103-1×107 CFUs in a pharmaceutically acceptable carrier or solution and instructions for use of the kit. The kit may be divided into one or more compartments and may have one or more containers for the various reagents. The kit may be further adapted to support storage and shipment of each component.
In one aspect of this embodiment, the kit further comprises one or more antibiotics, which are effective to treat or alleviate an adverse side effect caused by the C. novyi CFUs. The CFUs may be in vegetative or spore forms. Suitable antibiotics are as set forth above. Preferably, the kit further comprises 1˜4 unit doses of the C. novyi for carrying out 1-4 treatment cycles.
In another aspect of this embodiment, the C. novyi is C. novyi NT. Preferably, the unit dose comprises about 1×104-1×107 C. novyi NT spores, such as about 1×106-1×107 C. novyi NT spores, or about 1×104 C. novyi NT spores, in a pharmaceutically acceptable carrier or solution. Also preferably, the kit further comprises 1˜4 unit doses of the C. novyi NT spores for carrying out 1-4 treatment cycles.
Another embodiment of the present invention is a method for microscopically precise excision of tumor cells in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi NT colony forming units (CFUs) comprising about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution.
As used herein, “microscopically precise excision” means elimination of a target tissue in a subject, for example, a pathogenic tissue, said elimination being essentially specific, at the cellular level, for the pathogenic tissue while causing minimal or no harm to nearby “healthy” tissue. Elimination of a target tissue may be, but is not limited to, apoptosis, necrosis, and cell lysis. This embodiment may be accomplished by precision delivery of, e.g., the C. novyi NT spores of the invention via CT-guided intratumoral injection using, e.g., a multi-pronged delivery device, such as a multi-pronged needle.
In the present invention, the C. novyi spores, such as the C. novyi NT spores, are delivered to the subject, e.g., human patient, intratumorally in any medically appropriate manner. For example, C. novyi NT spores may be delivered via a single needle used at one or more sites on a tumor. Alternatively, a multi-tined delivery vehicle, such as a multi-tined needle, may be used to deliver, e.g., C. novyi NT spores, to a tumor. Delivery of, e.g., the spores may be to the same or multiple depths at one or more sites of the tumor. The selected delivery vehicles may be operated manually or controlled electronically. The delivery vehicles may be positioned and/or repositioned on or within a tumor manually or via a remote controlled device and visualization of the injection site may be augmented using various imaging techniques known in the art, such as CT imaging. Multi-tined delivery vehicles that may be used in the present invention include those disclosed in, e.g., McGuckin, Jr. et al., U.S. Pat. Nos. 6,905,480 and 7,331,947, which are incorporated herein by reference.
A further embodiment of the present invention is a method for treating or ameliorating an effect of a solid tumor that has metastasized to one or more sites in a human. This method comprises administering intratumorally to the human a unit dose of C. novyi NT colony forming units (CFUs) comprising at least about 1×103-1×107 CFUs suspended in a pharmaceutically acceptable carrier or solution. Preferably, at least one site of metastasis is distal to the original solid tumor.
As used herein, “metastasis” and grammatical variations thereof mean the spread of pathogenic cells, i.e. tumor cells, from an original, primary region of the body, to a secondary region of the body. Metastasis may be regional or distal, depending on the distance from the original primary tumor site. Whether a metastasis is regional or distal may be determined by a physician. For example, a breast cancer that has spread to the brain is distal, whereas the spread of breast cancer cells to under arm lymph nodes is regional.
In the present invention, an “effective amount” or a “therapeutically effective amount” of a compound or composition disclosed herein is an amount of such compound or composition that is sufficient to effect beneficial or desired results as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts are as disclosed herein or as modified by a medical professional. It is understood by those skilled in the art that the dosage amount will vary with the route of administration, the rate of excretion, the duration of the treatment, the identity of any other drugs being administered, the age and size of the patient, and like factors well known in the arts of medicine. In general, a suitable dose of a composition according to the invention will be that amount of the composition, which is the lowest dose effective to produce the desired effect. The effective dose of a composition of the present invention is described above. Further, a composition of the present invention may be administered in conjunction with other treatments.
The compositions of the invention comprise one or more active ingredients in admixture with one or more pharmaceutically-acceptable carriers and, optionally, one or more other compounds, drugs, ingredients and/or materials. Regardless of the route of administration selected, the agents/compounds of the present invention are formulated into pharmaceutically-acceptable unit dosage forms by conventional methods known to those of skill in the art. See, e.g., Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, Pa.).
Pharmaceutically acceptable carriers or solutions are well known in the art (see, e.g., Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, Pa.) and The National Formulary (American Pharmaceutical Association, Washington, D.C.)) and include sugars (e.g., lactose, sucrose, mannitol, and sorbitol), starches, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (e.g., ethyl alcohol, propyl alcohol, and benzyl alcohol), polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and tryglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoesters), and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (e.g., corn, germ, olive, castor, sesame, cottonseed, and groundnut), cocoa butter, waxes (e.g., suppository waxes), paraffins, silicones, talc, silicylate, etc. Each pharmaceutically acceptable carrier or solution used in a unit dose according to the present invention must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Carriers or solutions suitable for a selected dosage form and intended route of administration, e.g., IT, are well known in the art, and acceptable carriers or solutions for a chosen dosage form and method of administration can be determined using ordinary skill in the art.
The unit doses of the invention may, optionally, contain additional ingredients and/or materials commonly used in pharmaceutical compositions. These ingredients and materials are well known in the art and include (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, hydroxypropylmethyl cellulose, sucrose and acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethyl cellulose and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, and sodium lauryl sulfate; (10) suspending agents, such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth; (11) buffering agents; (12) excipients, such as lactose, milk sugars, polyethylene glycols, animal and vegetable fats, oils, waxes, paraffins, cocoa butter, starches, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonites, silicic acid, talc, salicylate, zinc oxide, aluminum hydroxide, calcium silicates, and polyamide powder; (13) inert diluents, such as water or other solvents; (14) preservatives; (15) surface-active agents; (16) dispersing agents; (17) control-release or absorption-delaying agents, such as hydroxypropylmethyl cellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin, and waxes; (18) opacifying agents; (19) adjuvants; (20) wetting agents; (21) emulsifying and suspending agents; (22), solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan; (23) propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane; (24) antioxidants; (25) agents which render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickening agents; (27) coating materials, such as lecithin; and (28) sweetening, flavoring, coloring, perfuming and preservative agents. Each such ingredient or material must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for a chosen dosage form and method of administration may be determined using ordinary skill in the art.
Liquid dosage forms include pharmaceutically-acceptable emulsions, microemulsions, liquids, and suspensions. The liquid dosage forms may contain suitable inert diluents commonly used in the art. Besides inert diluents, the oral compositions may also include adjuvants, such as wetting agents, emulsifying and suspending agents, coloring, and preservative agents. Suspensions may contain suspending agents.
Dosage forms for the intratumoral administration include solutions, dispersions, suspensions or emulsions, or sterile powders. The active agent(s)/compound(s) may be mixed under sterile conditions with a suitable pharmaceutically-acceptable carrier.
Unit doses of the present invention may alternatively comprise one or more active agents, e.g., C. novyi CFUs or C. novyi NT spores in combination with sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain suitable antioxidants, buffers, solutes which render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Proper fluidity can be maintained, for example, by the use of coating materials, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. These compositions may also contain suitable adjuvants, such as wetting agents, emulsifying agents and dispersing agents. It may also be desirable to include isotonic agents. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption.
Intratumorally injectable depot forms may be made by forming microencapsulated matrices of the active ingredient in biodegradable polymers. Depending on the ratio of the active ingredient to polymer, and the nature of the particular polymer employed, the rate of active ingredient release can be controlled. Depot injectable formulations are also prepared by entrapping the active agent in liposomes or microemulsions which are compatible with body tissue.
As noted above, the formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampules and vials, and may be stored in a lyophilized condition requiring only the addition of the sterile liquid carrier, for example water for injection, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the type described above.
The following examples are provided to further illustrate the methods of the present invention. These examples are illustrative only and are not intended to limit the scope of the invention in any way.
EXAMPLES Example 1 Combined Intravenous (IV) Dosing of C. novyi NT with RadiationA study of a single IV dose of C. novyi NT spores in dogs with spontaneous tumors following treatment with external beam radiation was performed.
The manufacturing and final formulation of C. novyi NT spores was performed by the Johns Hopkins Development laboratory according to the following process. C. novyi NT spores generated according to Dang et al., 2001. were inoculated into a rich sporulation medium and incubated in an anaerobic chamber for 17-19 days at 37° C. Spores were purified by sequential continuous Percoll gradient centrifugation followed by extensive phosphate buffered saline washing. Spores were stored at 2-8° C. Spores were prepared prior to shipment, suspended in sterile phosphate buffered saline and diluted in 50 ml of 0.9% sodium chloride.
C. novyi NT spores were reconstituted in a 50 ml saline bag and delivered overnight to the test site. The radiation dose was approximately 54 gy delivered over 20 fractions: 11 before C. novyi NT IV injection and 9 after injection. C. novyi NT spores were administered as a single injection at a dose of 1×109 spores/m2, based on body surface area. The transfer of the spores to a syringe occurred on an absorbent pad with an impervious backing. A 22 gauge needle with a 3-way stopcock attached was inserted into the bag. A male portion of a closed chemotherapy system (ONGUARD™, TEVA Medical Ltd.) was attached to a port on the stopcock. The complete contents were withdrawn from the bag into a 60 cubic centimeter (cc) syringe to which was attached a female portion of the closed system. The spores were injected into each subject over 15 minutes through an IV catheter to which was attached the male end of the chemotherapy closed system. The infusion was followed by a 10 cc saline flush. The subject was monitored closely for 6 hours post-infusion as follows: vital signs, blood pressure, and oxygen saturation monitoring every 15 minutes for the first 60 minutes, followed by monitoring every 30 minutes for the next 60 minutes, then every 60 minutes for the next 120 minutes. Subsequent checks were performed every 60 minutes for a total of 6 hours.
Test subjects were hospitalized for the initial 3 weeks of treatment: 2 weeks for radiation treatments and 1 week following C. novyi NT IV treatment. Subsequent follow-up visits occurred up to 6 months post-treatment at month 1, 2, 3, and 6. See Tables 1 and 2 for sample treatment schedules.
As of Sep. 10, 2012, five dogs were treated in this manner. Of the five, 2 developed an abscess, 1 maintained stable disease, and 2 died or were euthanized. The two test subjects that developed an abscess were photographed throughout treatment as shown in
The other subjects, Chipper, Bailey, and Ruskin, exhibited varying results. Chipper presented with a squamous cell carcinoma of the left mandible. Over the course of treatment, Chipper had swelling at the tumor site and received 20 of 20 radiation treatments. As of Sep. 10, 2012, Chipper had stable disease.
Another subject, Bailey, presented with a soft tissue sarcoma of the left axillary region. During treatment, Bailey died, having experienced sepsis, acute renal failure, potential disseminated intravascular coagulation, and cardiac arrest. However, necropsy showed all dead tissue inside the tumor, with no tumor cells.
The remaining subject, Ruskin, presented with an osteosarcoma of the right proximal humerus. During treatment, Ruskin had swelling of the tumor site and completed 20/20 radiation treatments. However, on day 30, the tumor site was producing large amounts of purulent material and Ruskin was experiencing renal failure. The owner decided to euthanize when renal status did not improve. As of Sep. 10, 2012, necropsy results were still pending.
Example 2 IT-Injected C. novyi-NT Spores Specifically Target Tumor Tissue and Prolong Survival in Rats—Methods Cell Lines and Tissue CultureA rat F98 glioma cell line transfected with a luciferase construct via lentivirus was maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin.
Rat Experiments6 week old female F344 Fisher rats (weight 100-150 grams) were purchased from the National Cancer Institute. For the implantation procedure, female F344 Fisher rats were anesthetized via intraperitoneal (IP) injection of ketamine hydrochloride (75 mg/kg; 100 mg/mL ketamine HCl; Abbot Laboratories), xylazine (7.5 mg/kg; 100 mg/mL Xyla-ject; Phoenix Pharmaceutical, Burlingame, Calif.), and ethanol (14.25%) in a sterile NaCl (0.9%) solution. F98 glioma cells (2×104) were stereotactically implanted through a burr hole into the right frontal lobe located 3 mm lateral and 2 mm anterior to the bregma, as described before (Bai, et al., 2011). Tumor size was assessed via a Xenogen instrument with IP injection of 8 mg/rat D-luciferin potassium salt at day 12 after implantation of the tumor cells. Subsequently, 3 million C. novyi-NT spores, produced as previously described (Dang, et al., 2001, Bettegowda, et al., 2006), were stereotactically injected into the intracranial tumor using the same coordinates as described above and the rats were treated with 10 mg/kg/day of IP dexamethasone for the first 2 days. Animals were observed daily for any signs of deterioration, lethargy, neurotoxicity, or pain in accordance with the Johns Hopkins Animal Care and Use Guidelines. If symptoms of distress were present, supportive therapy with hydration and doxycycline (loading dose of 15 mg/kg IP followed by 10 mg/kg every 12 hours as maintenance) was initiated and continued for a 7 day period. If symptoms persisted and/or resulted in debilitation, moribund animals were euthanized. The effectiveness of IT injected C. novyi-NT spores was evaluated by Kaplan-Meyer survival curves, as well as remaining tumor burden on brain sections. For the latter, brains were collected postmortem, placed in formaldehyde, and embedded in paraffin for additional pathological studies. Gram-stained slides, counter-stained with safranin, and H&E-slides were obtained according to standard procedure guidelines.
Statistical AnalysesKaplan-Meier survival curves were created and analyzed with a Mantel-Cox test using GraphPad Prism v.5.00 (GraphPad Software, San Diego, Calif.).
Example 3 IT-Injected C. novyi-NT Spores Specifically Target Tumor Tissue and Prolong Survival in Rats—ResultsComplete surgical excision of advanced gliomas is nearly always impossible and these tumors inexorably recur. Though this tumor type generally does not metastasize, there are no highly effective medical therapies available to treat it. Gliomas therefore seemed to represent a tumor type for which local injection of C. novyi-NT spores could be therapeutically useful. To evaluate this possibility, F98 rat glioma cells were orthotopically implanted into 6-week old F433 Fisher rats, resulting in locally invasive tumors that were rapidly fatal (
Genomic DNA from dogs participating in the comparative study of IT C. novyi-NT spores was extracted from peripheral blood lymphocytes (PBLs) and formalin-fixed, paraffin-embedded tumor tissue using the QIAamp DNA mini kit (QIAGEN, Valencia, Calif.) according to the manufacturer's protocol.
Sequencing and Bioinformatic AnalysisGenomic purification, library construction, exome capture, next generation sequencing, and bioinformatics analyses of tumor and normal samples were performed at Personal Genome Diagnostics (PGDx, Baltimore, Md.). In brief, genomic DNA from tumor and normal samples were fragmented and used for Illumina TruSeq library construction (Illumina, San Diego, Calif.). The exonic regions were captured in solution using the Agilent Canine All Exon kit according to the manufacturer's instructions (Agilent, Santa Clara, Calif.). Paired-end sequencing, resulting in 100 bases from each end of the fragments, was performed using a HiSeq 2000 Genome Analyzer (Illumina, San Diego, Calif.). The tags were aligned to the canine reference sequence (CanFam2.0) using the Eland algorithm of CASAVA 1.7 software (Illumina, San Diego, Calif.). The chastity filter of the BaseCall software of Illumina was used to select sequence reads for subsequent analysis. The ELAND algorithm of CASAVA 1.7 software (Illumina, San Diego, Calif.) was then applied to identify point mutations and small insertions and deletions. Known polymorphisms recorded in dbSNP131 (CanFam2.0) were removed from the analysis. Potential somatic mutations were filtered and visually inspected as described previously (Jones, et al., 2010).
Example 5 Canine Soft Tissue Sarcomas Resemble Human Tumors—ResultsPreclinical animal studies of anticancer agents often do not recapitulate the observed effects in people. In dogs, however, clinically used therapeutic agents induce similar toxicities and effects to people (Paoloni, et al., 2008). Studies of investigational therapies in dogs can represent a crucial bridge between preclinical animal studies and human clinical studies. In particular, canine soft tissue sarcomas are an excellent model as they are common in many breeds of dogs and have clinical and histopathologic features remarkably close to those of human soft tissue sarcomas (Paoloni, et al., 2008, Vail, et al., 2000). However, while recent advances in genomics have significantly expanded our knowledge of cancer genetics in people, comparatively little is known about the genetic landscape of canine cancers. Therefore, to determine whether canine tumors were genetically similar to those of humans, the exome of tumor and matched normal DNA from 11 dogs participating in the comparative study was sequenced (
Using stringent analysis criteria, 156 somatic mutations and 28 somatic copy number alterations among the 10 soft tissue sarcomas were identified (Table 3 and
Amplifications and deletions were less common, with an average of three per tumor (range: of 0-17) (
Single base substitutions were identified in four tumor suppressor genes that are frequently mutated in human tumors (NF1, MLL3, TP53, and PTCH1). Additionally, MDM4, an oncogene that has been shown to be amplified but not point-mutated in human cancers was found to be amplified (but not point-mutated) in one canine tumor (Lee, et al., 2012, Barretina, et al., 2010, Chmielecki, et al., 2013, Vogelstein, et al., 2013). The only genes mutated in more than one tumor were ATP7B (missense mutations in two tumors) and AIG1 (amplified in two tumors). Interestingly, mutations in ATP7B were also found in a human liposarcomas (Joseph, et al., 2013). Twenty-two of the 184 somatic mutations in canine tumors occurred in genes previously shown to be mutated in human soft tissue sarcomas (Table 5).
Larger studies of soft tissue sarcomas in both species will be required to determine whether these represent driver mutations that signify important, conserved tumorigenic pathways. Regardless, the genetic landscapes of canine tumors were similar to those of humans in terms of the numbers of genetic alterations and spectrum of mutations. Specifically, they exclude the possibility that the canine tumors have a very large number of mutations which might make them more likely to mount an immune response than analogous tumor types in humans.
To investigate the safety and efficacy of the method of the present invention, a comparative study in 16 dogs with spontaneously occurring solid tumors was performed (Table 6).
Dogs were enrolled at multiple sites participating in the Animal Clinical Investigation oncology network (ACI, Wash., DC) and written informed consent was obtained from owner(s) prior to enrollment. Treatment, management, and study evaluations were overseen by board-certified veterinary oncologists. Enrollment was offered to client-owned dogs with spontaneous solid tumors, with a preference for soft-tissue sarcomas that had failed standard therapy or whose owner(s) had declined such therapy. Participation was restricted to tumor bearing dogs with a target lesion having a longest diameter between 1 and 7 centimeters. Dogs with tumors located in areas where abscess development would be catastrophic (e.g., nasal tumors that extended into the brain or significant pulmonary metastatic disease) were excluded from the study.
Dogs with evidence of an active bacterial infection requiring systemic antibiotic therapy within seven days or cancer therapy (chemotherapy, radiation therapy, and immunotherapy) within 21 days of C. novyi-NT spore treatment were ineligible. Dogs were required to have a performance score of 0 or 1 (Table 7) and to be available for the full duration of the study for enrollment. Concurrent use of anticancer agents and participation in other clinical trials were prohibited. Dogs that were pregnant or likely to become pregnant were not included in the study. Also, dogs that may have been unavailable for the entire study duration, and dogs that were considered unsuitable for study enrollment by the Investigator or Medical Director were not included in the study.
During a screening visit, each dog was assigned a unique study dog identification number consisting of a 5-digit numeric code (which may not have been sequentially in order of the screening dog number). The first 2 digits indicated the study site (01 to 99), the middle digit indicated the study ‘R’, and the last 2 digits described the study dog number within a study site (01 to 99). For example the 11th dog enrolled at Site 9 was assigned study dog number 09-R11. Study dog numbers were assigned chronologically in the order that dogs were enrolled at a given study site. A dog was considered enrolled in the study when it satisfied the inclusion and exclusion criteria.
Gross pathology and histopathology was performed in accordance with Food and Drug Administration's CVM Guidance for Industry 185. At necropsy, the following tissues (Table 8) were assessed for gross pathology and for histopathology and described in the necropsy report. Samples of brain, heart, lung, liver, spleen, kidney, muscle, bone, small intestine, large intestine and any tissue with gross abnormality were collected for microbiology.
All dogs were hospitalized from day 0 (D0) to day 4 (D4), and then optionally (at the Investigator's discretion) for 24 to 48 hours after each subsequent treatment for clinical observation. Fluids were administered to all study dogs during hospitalization following C. novyi NT treatment. On dosing days all dogs were administered intravenous (IV) crystalloids at 4 ml/kg/h for 2 hours. Dogs were closely monitored for six hours after each IT injection of C. novyi-NT spores. At the next visit (4 days later) all dogs were administered subcutaneous (SQ) crystalloids at 20 ml/kg. If a dog was hospitalized and receiving IV crystalloids on the day that SQ crystalloids were to be administered, it was not necessary to give the SQ dose.
Study visits and events are summarized in Table 9 as an example of a 4-dose treatment regimen. The dosing interval was suggested to be on a weekly basis, if the dog was to be treated with repeated dosing. Treatment delays for repeated dosing occurred during the course of the study due to adverse events or the decision of the investigator.
Sixteen dogs, 9 neutered males, 1 entire (intact) male, and 6 neutered females, were enrolled in the study. (Table 6). Their demographics and tumor characteristics are given in Table 6. Enrolled cases exhibited diverse breeds, weights and ages. Cases were previously diagnosed with naturally occurring cancers representing a variety of histological origins: 13 dogs had a diagnosis of soft tissue sarcoma (81.3%), 1 osteosarcoma (6.3%), 1 melanoma (6.3%) and 1 mast cell tumor (6.3%). Of the 13 soft tissue sarcomas, histologic subtype was available for 11 and included: 4 hemangiopericytomas (30.8%), 3 peripheral nerve sheath tumors (23.1%), 1 synovial cell sarcoma (7.7%), 1 myxosarcoma (7.7%), 1 rhabdosarcoma (7.7%) and 1 fibrosarcoma (7.7%). The mean weight of dogs in the trial was 29.4 kg (range 8.1-44.3 kg) and their mean age was 10.9 years (range: 7.2-14.3 years). Thirteen dogs had a diagnosis of soft tissue sarcoma, and one each had a diagnosis of osteosarcoma, malignant melanoma, and mast cell tumor. Of the 13 soft tissue sarcomas, six were available for immunohistochemistry (IHC). All six were positive for S100 and negative for smooth muscle actin, suggesting the diagnosis of a sarcoma subtype called peripheral nerve sheath tumors. Seven of the tumors were grade I, five were grade II, and four were grade III. Eight dogs had previous surgical therapy for their cancers.
Preparation and IT Injection of C. novyi-NT Spores in Spontaneous Canine Tumors
C. novyi-NT spores for use in the comparative canine study were produced as previously described (Dang, et al., 2001, Bettegowda, et al., 2006). In brief, bacteria were cultured in sporulation medium for at least two weeks to ensure maximum yield of mature spores. Mature spores were purified through two consecutive, continuous Percoll gradients followed by four washes and re-suspensions in PBS. Sterility testing of the final product was performed by culturing product in Soybean-Casein Digest Medium and Thioglycollate Medium in accordance with FDA 21CFR610.12 guidelines (Nelson Laboratories, Salt Lake City, Utah). Germination efficiency assays were performed under anaerobic conditions on Brucella agar with 5% horse blood to ensure the spores meet preset viability criteria. Spores were packaged in sterile 1.8 mL cryovials with O-ring sealed screw caps (Simport, Beloeil, Canada) at a volume of 1000 μL and a concentration of 1×109 spores/mL. C. novyi-NT cryovials were stored at 2-8° C. For dosing, a 0.4 mL aliquot of the stock spore solution was packaged into 0.5 mL cryovials. After dosing, the cryovials and unused C. novyi-NT spores were discarded according to applicable regulations for disposal of Biosafety Level 2 material. Prior to IT injection, spores were re-suspended with a vortex, mixing at maximum speed for 10 seconds for a total of three times before being withdrawn into a 1 mL syringe. The injection site was aseptically prepared. If available, ultrasound or computed tomography (CT) was used to identify a necrotic region of the tumor. If a necrotic region was not identified, the injection was directed to the center of the tumor. The needle was inserted once into the pre-defined region and 100 μL of spore suspension (1×108 C. novyi-NT spores) were dispensed with even pressure. The injection needle was removed slowly and the injection site sterilized. All dogs received at least 1 cycle of an IT dose of 1×108 spores in 100 μL saline (biosurgery): 3 dogs received a single treatment cycle, 13 dogs received more than 1 and up to 4 treatment cycles. Dogs could receive up to 4 cycles of biosurgery with a one-week interval between cycles. Treated dogs were followed for at least 90 days after the first IT injection. Extended follow-up for disease progression and survival were warranted when available. Early withdrawal from the study was allowed for toxicity or progressive disease.
Study evaluations were undertaken as described in Table 9. Pre-screening evaluations were conducted 1 to 14 days before the first cycle of biosurgery. Dogs were monitored periodically on both an inpatient and outpatient basis during the study. Laboratory samples were taken as defined in Table 9 and included a complete blood count, serum biochemistry, prothrombin time, partial thromboplastin time, and urinalysis. Imaging was performed at screening and included regional CT, thoracic radiography, and abdominal ultrasonography. Additional imaging may be conducted during the study at the investigator's discretion.
Adverse events were evaluated, where possible, using the Veterinary Co-operative Oncology Group—Common Terminology Criteria for Adverse Events (VCOG-CTCAE) v1.0 (Veterinary Co-operative Oncology Group, 2004), with terminology from the Veterinary Dictionary for Drug Related Affairs (VeDDRA) rev.4 (European Medicines Agency, 2012). Terminologies for adverse events related to C. novyi-NT germination (target lesion reactions) are defined in Table 10. Clinical observations without appropriate VeDDRA or target lesion reaction terminology were classified separately as uncoded signs (Table 11). Relationship to C. novyi-NT therapy was determined by the reporting investigator.
Longest diameter tumor measurements of the target (injected) lesion were made on day 0, day 7, day 14, day 21, day 60 and day 90 post-treatment (Table 9). Non-target and new lesions were recorded but not measured. The best overall target response was evaluated on or after the day 21 study visit: complete response (CR) was defined as the complete disappearance of the target lesion; partial response (PR) was defined as at least a 30% decrease in the longest diameter of the target lesion; and progressive target disease (PD) was defined as at least a 20% increase in the longest diameter of the target lesion or the appearance of new nontarget lesions. Stable disease (SD) was defined as insufficient decrease or increase in the longest diameter of the target lesion to qualify as CR, PR, or PD. In the case of C. novyi-NT related abscesses, medical, or surgical debridement of necrotic tissue was at the discretion of the investigator.
Evaluation of surgical samples and necropsies were conducted by board certified veterinary pathologists. Tissue specimens were fixed in 10% neutral buffered formalin and embedded in paraffin. Slides stained with H&E and or gram stained slides were prepared for evaluation according to standard procedure guidelines. For immunohistochemistry (IHC), formalin-fixed, paraffin-embedded tumor tissue was sectioned at 5 μm, deparaffinized in xylene, and rehydrated through graded alcohols. Antigen retrieval was done using unmasking solution (Vector Laboratories, Burlingame, Calif.). Primary antibodies S100 (DAKO, Carpinteria, Calif.) and anti-smooth muscle actin (DAKO, Carpinteria, Calif.) were used at 1:100. Secondary antibodies (Vector Laboratories, Burlingame, Calif.) labeled with DAB were used at 1:500. Sections were incubated with ABC reagent (Vector Laboratories, Burlingame, Calif.) and counterstained with hematoxylin. Tumor grades were assigned to each based on published criteria (Dennis, et al., 2011, Patnaik, et al., 1984, Smedley, et al., 2011, Sabattini, et al., 2014).
Example 7 Intratumoral (IT) Administration of C. novyi-NT—Study 1 ResultsAll dogs received at least one cycle of biosurgery, with 53 cycles given of a maximum of 64 planned. The majority of dogs, 10 of 16, received the intended four cycles. Cycles of biosurgery were typically one week apart. No placebo control or masking was used.
For dogs showing early tumor responses, toxicity, or progressive disease after the first cycle, subsequent cycles were stopped. The most common adverse events were consistent with local infection at the C. novyi-NT spore injection site, including: fever (17 incidents), tumor inflammation (12 incidents), tumor abscess (10 incidents), anorexia (nine incidents), and lethargy (six incidents) (Table 12). Clinical signs of an inflammatory response at the injected target lesion site was observed in 14 of 16 dogs (87.5%), including: tumor inflammation (12/14), tumor abscess (7/14), tumor pain (5/14), and tumor discharge (4/14) (Table 13).
Early-onset adverse events refer to the events occurring within the first 7 days following the first treatment cycle (13 dogs) or a single treatment cycle (3 dogs). A variety of adverse (AE) event findings were noted across multiple cases. The early-onset adverse events that occurred within 7 days either after the 1st treatment cycle (13 dogs that have received multiple cycles) or after the single treatment cycle (3 dogs that have received only one cycle) are summarized in Table 14.
Common early onset adverse event findings included: target tumor lesion reactions, alterations in general signs and symptoms, and blood and lymphatic system abnormalities. The majority of early onset adverse events were mild to moderate (Grade I-II), with tumor inflammation, anorexia, tumor edema, and fever being the most commonly observed events. Grade III tumor abscess and Grade III tumor inflammation were noted in two cases (10-R02 and 16-R03). Early onset adverse event findings appear consistent with the anticipated tumor inflammatory reactions resulting from the mechanism of action of the C. novyi-NT therapeutic.
Late-Onset Adverse EventsA subset of 3 dogs received only a single treatment cycle (as of Dec. 2, 2012). Late-onset adverse events refer to the events occurring after 7 days following the single treatment cycle and are summarized in Table 15 for the 3 dogs (04-R04, 10-R02, and 11-R01). The majority of late-onset adverse events were mild to moderate (Grade I-II) and 11 of the 12 later onset findings were noted in a single subject 04-R04. This dog presented with chondroblastic osteosarcoma of the right forelimb with a LD measurement of 94.5 mm at baseline (CT measurement not available). Amputation was pursued 20 days after C. novyi-NT spore injection due to progressive disease. The other two subjects have well tolerated the single treatment cycle. Their late-onset AE was exclusively limited to a mild fever (Grade I).
In summary, the safety profile observed following one treatment cycle of C. novyi-NT IT administration of 1×108 spores suggested suitable tolerability. The early-onset and late-onset adverse events were consistent with the anticipated tumor inflammatory reactions resulting from the mechanism of action of C. novyi-NT. The adverse events have been monitored and managed effectively as disclosed herein.
The adverse events noted when dogs were given multiple treatment cycles of C. novyi-NT by IT administration are summarized in Table 9 for adverse events (AEs) of any Grades and in Table 10 for AEs of Grade III and above.
The variety and incidence of adverse event findings following multiple cycles of treatment was broadly similar to that observed following a single treatment cycle. Likewise, the onset of events appeared to be largely consistent with what was observed following a single treatment cycle: of 169 findings across all cases, only 30 were noted more than seven days following a prior dose. Similarly, tumor inflammation, anorexia, and fever were the most commonly observed events. Adverse events that occurred in more than one case included: target lesion reactions, alterations in general signs and symptoms, blood and lymphatic system abnormalities, lameness, hypertension, lymphadenopathy, diarrhea, and new masses. The majority (about 95%) of findings were mild to moderate in intensity (Grade I to II).
Severe Adverse EventsSevere adverse events (Grade III and greater) were noted in 5 cases (Table 16). Subject 04-R05 experienced a Grade III increase in neutrophil count. Subject 10-R01 experienced Grade III anemia, lethargy, muscle weakness, myositis, pain and recumbency. Extensive metastatic disease, while not observed at baseline, was diagnosed following necropsy of case 10-R01 at Day 60; progressive disease may have influenced adverse event findings in this case. Subject 10-R02 experienced a Grade III tumor abscess. Subject 11-R01 experienced a Grade IV decreased thrombocyte count 93 days after first treatment cycle which resolved without intervention. Symptoms resolved 21 days after the Day 93 visit without any medical treatment. Notably, this subject also exhibited Grade I and Grade III symptoms of thrombocytopenia at screening and baseline, respectively. Subject 16-R03 experienced Grade III diarrhea, lameness and tumor inflammation that resolved within one week.
Two dogs had documented new masses during the study. A rectal mass was identified in subject 04-R04 on Day 82 and a lytic vertebral lesion of T1 in subject 10-R01 on Day 9. These findings may represent a metastasis or a second distinct pathology. In both cases, the relationship to C. novyi-NT therapy was unclear.
Response from C. novyi-NT Therapy
In summary, C. novyi-NT IT treatment in companion dogs at a dose of 1×108 spores per cycle of therapy for up to 4 cycles is well tolerated. Most adverse events possibly or probably related to drug that were greater than Grade III resolved within one week. Expected adverse events have been largely associated with local inflammatory changes following intratumoral therapy and generally resolved within one week. The adverse events and serious adverse events have been monitored and managed effectively as disclosed herein.
Given that C. novyi-NT IT administration was accompanied by broad evidence of biological activity, a preliminary assessment of primary tumor response using RECIST 1.1 was made and is summarized in Table 17 below.
Dogs were evaluated for best response on or after day 21 of the study. Three had a complete response (CR) to therapy, three had partial responses (PR), five had stable disease (SD), three had progressive disease (PD), and two dogs (04-R04 and 04-R08) were not evaluable for response because the injected tumor was surgically resected before day 21. The objective response rate for biosurgery was 37.5% (6 of 16 dogs; 95 percent confidence interval: 15.2-64.6%). Tumor abscesses and responses occurred after one to four cycles of biosurgery. Dog 11-R01 experienced a PR after a single cycle, 04-R03 had a CR after three cycles, dogs 04-R02 and 04-R05 had PRs after four cycles, while 04-R01 and 04-R06 had CRs after four cycles.
Individual subjects are discussed in more detail below:
Andy (11-R01,
Molly (11-R02), a 12 year-old, neutered female, Labrador Retriever, presented with a grade II soft tissue sarcoma on the left stifle. She had no treatment history prior to enrollment. She received 3 cycles of IT C. novyi-NT spores, followed by 1 IV dose of 1×108 C. novyi-NT spores, 7 days after the 3rd IT dose. Her 1st, 2nd and 3rd IT doses on Jul. 11, 2012, Jul. 18, 2012, and Jul. 25, 2012, respectively. The single IV dose of C. novyi-NT spores was given on Aug. 1, 2012 due to lack of biological activity seen with the prior IT doses. The only adverse event noted was Grade I hypertension after the 3rd IT dose. Hypertension was transient and self-limiting, resolving within 1 hour. Molly's tumor was surgically removed on Day 30 (Aug. 10, 2012) for histologic analysis. The mass was confirmed to be a soft tissue sarcoma with areas of necrosis and inflammation. Bacteria were not present on gram stains, supporting lack of biological activity in this case.
Ricky (10-R01), a 13 year-old, male neutered, Golden retriever, presented with oral melanoma. His treatment history included surgery prior to enrollment. He received 2 cycles of IT C. novyi-NT spores. C. novyi-NT IT treatments were administered on Aug. 2, 2012 and Aug. 9, 2012. On Day 9 (Aug. 11, 2012), Ricky developed sudden onset of cervical pain and rear leg neurological deficits 2 days after the 2nd treatment cycle. Grade III anemia was also noted. An MRI was performed and revealed probable cervical steatitis and cervical spinal cord compression. Corticosteroids and gastrointestinal protectants were administered and Ricky recovered after 3 days. No changes in the oral melanoma were noted and no additional C. novyi-NT treatments were administered. On Day 21 (Aug. 23, 2012), an MRI was performed and showed improvement in the previously described steatitis; however, metastatic pulmonary nodules were noted on CT of the thorax. Excision of the oral melanoma was performed. A human tyrosinase melanoma vaccine was started on Aug. 30, 2012. On Day 42 (Sep. 13, 2012), Ricky presented with recurrent cervical pain and forelimb pain (2 weeks after discontinuation of corticosteroids) and 2 weeks after receiving the melanoma vaccine. Medical management with pain medication did not result in improvement after 4 days so corticosteroids were restarted. On Day 46, Grade III anemia and elevated BUN were noted. A presumptive gastrointestinal bleed was treated with gastrointestinal protectants. On Day 60, Ricky collapsed and developed hematemesis. Humane euthanasia was performed. A necropsy revealed disseminated metastatic melanoma including submandibular lymph node, mediastinal lymph node, mesenteric lymph node, kidney, and perispinal fat in the region of the cervical spine. No evidence of gastric or intestinal ulceration was found. The presumed cause for the two episodes of spinal pain is metastatic melanoma. The relationship to C. novyi-NT is uncertain.
Finnegan (04-R02), an 11 year-old, entire male, Golden Retriever, presented with a soft tissue sarcoma (hemangiopericytoma) on the right lateral metacarpus. His treatment history included surgery prior to enrollment. He received 4 cycles of IT C. novyi-NT spores. Adverse events were mild and well tolerated. Complete ablation of the tumor occurred after 4 cycles of treatment, leaving a margin of normal tissue about the site of the tumor. Finnegan received his 1st, 2nd, 3rd and 4th treatment cycles on Aug. 3, 2012, Aug. 10, 2012, Aug. 17, 2012 and Aug. 24, 2012, respectively. Administration of C. novyi-NT was associated with only Grade I adverse events reported after the 1st, 2nd and 3rd cycles. Grade I and II adverse events were noted 48 hours after the 4th dose. Tumor infection was noted and consisted of fever, leukocytosis, neutrophilia and tumor-associated pain and abscess formation. Infection progressed to abscess formation and ablation of the entire tumor with minimal debridement occurring 96 hours after the 4th dose. Tumor measurements at this visit were recorded in the morning prior to complete ablation of gross tumor later that day. Amputation of the limb was pursued instead of open-wound management on Day 25 (Aug. 28, 2012) and antibiotics were given. Finnegan recovered uneventfully from surgery and remains grossly tumor free 94 days (Nov. 5, 2012) after his first treatment.
Drake (04-R01,
Baxter (04-R03,
Harley (26-R01), a 7 year-old, neutered male, Labrador Retriever, presented with a grade II soft tissue sarcoma (hemangiopericytoma) on the right paw. He had no treatment history prior to enrollment. He received 4 cycles of IT C. novyi-NT spores. The 1st, 2nd, 3rd and 4th doses were given on Aug. 20, 2012, Aug. 27, 2012, Sep. 4, 2012 and Sep. 10, 2012. The interval between doses was 6-8 days. A baseline elevation of temperature was noted at the time of the 1st and 2nd doses. IT treatment of C. novyi-NT spores was well tolerated with no adverse events reported. There was no response to therapy.
Ursula (04-R-04), an 11 year old, female spayed, Saint Bernard mix, presented with chondroblastic osteosarcoma of the right forelimb. Her treatment history included surgery prior to enrollment. She received a single IT dose of C. novyi-NT spores. No metastatic disease was present at enrollment. Following the first treatment on Aug. 31, 2012, tumor abscess formation and peritumoral inflammation was evident within the first 24 hours and medically managed with pain medication, warm compresses and intravenous crystalloids. After no improvement, the tumor/abscess was lanced on Day 2 (Sep. 2, 2012). Moderate serosanguineous fluid was present. An anaerobic culture isolated C. novyi. Antibiotics were administered starting on Day 4 (Sep. 4, 2012). The incision was managed as an open wound until Day 20 (Sep. 20, 2012) when amputation was pursued for progressive disease. Histopathology revealed severe necrosis and hemorrhage along with persisting chondroblastic osteosarcoma. Following amputation, an incision site infection was noted. Cultures did not reveal C. novyi. No adjuvant therapy was pursued following amputation. On Day 81 (Nov. 21, 2012), Ursula presented for rectal prolapse and was found to have rectal polyps. Thoracic radiographs performed at the time of this evaluation revealed pulmonary metastasis.
Gabriel (16-R02), a 9 year-old, neutered male, Labrador Retriever, presented with a grade I soft tissue sarcoma on the left lateral thigh. His treatment history included surgery prior to enrollment. He received 4 cycles of IT C. novyi-NT spores. IT administration of C. novyi-NT was generally well tolerated with a 1 week delay between the 1st and 2nd doses due to Grade II diarrhea that responded to medical management. Gabriel received his 1st, 2nd, 3rd and 4th doses on Sep. 12, 2012, Sep. 26, 2012, Oct. 3, 2012 and Oct. 10, 2012 respectively. Toxicity was mild and consisted mainly of diarrhea and constitutive symptoms. Grade II diarrhea was noted after each dose and responded well to medical management. After the 1st dose, a 1-week dose delay was implemented resulting in a 14 day interval between the 1st and 2nd doses. Dose delays were not implemented for further doses for Grade II diarrhea. Additionally, Grade II tumor swelling was observed on Day 4 (Sep. 16, 2012). Tumor size remained stable from D0 (Sep. 12, 2012) to D63 (Nov. 14, 2012), the most recent study visit.
Buddy (04-R05), a 13 year-old, neutered male, Shetland sheepdog, presented with soft tissue sarcoma (rhabdomyosarcoma) on the right antebrachium. His treatment history included surgery, chemotherapy, and a previous C. novyi-NT clinical trial prior to enrollment. No metastatic disease was noted at the time of study entry. He received 4 cycles of IT C. novyi-NT spores. Clinically significant adverse events contemporaneous with C. novyi-NT were isolated to a Grade III neutropenia and fever following the 3rd cycle of therapy. This event resolved within 48 hours of medical management with intravenous antibiotics and fluid therapy. Buddy received his 1st, 2nd, 3rd and 4th treatment cycles on Sep. 20, 2012, Sep. 27, 2012, Oct. 5, 2012, and Oct. 12, 2012. Mild tumor inflammation (erythema, warmth, swelling) was noted associated with 2 of the 4 cycles. A transient decrease in tumor size was noted at Day 4 (Sep. 24, 2012). A new non-target lesion was noted near the primary tumor site on Day 21 (Oct. 12, 2012). The primary target tumor was stable at Day 61.
Amber (16-R03), a 10 year-old, neutered female, Shepherd, presented with a grade I soft tissue sarcoma on the left paw, palmar and dorsal surfaces. Her treatment history included surgery prior to enrollment. She received 4 cycles of IT C. novyi-NT spores. The 1st, 2nd, 3rd and 4th doses were given on Sep. 26, 2012, Oct. 3, 2012, Oct. 15, 2012, and Oct. 24, 2012. The interval between doses was 7-12 days. Amber experienced Grade II tumor swelling and pain after her 1st and 2nd doses. Grade I inappetence was noted on Day 2 (Sep. 28, 2012). On Day 8 (Oct. 4, 2012, 1 day after 2nd dose), a Grade I fever, Grade II tumor warmth and Grade III lameness was noted. Her tumor was lanced and analgesics were given. A Grade III diarrhea was noted on Day 11 (Oct. 7, 2012) and managed medically. Due to the tumor associated adverse events and diarrhea, the 3rd dose was delayed until Day 19 (Oct. 15, 2012). Grade II tumor swelling was again observed on Day 19, after the 3rd dose of C. novyi-NT and this was managed with analgesics. No adverse events were noted after the 4th dose.
Six (11-R04), a 9 year-old, neutered male, Husky, presented with a grade I soft tissue sarcoma on the right paw. She had no treatment history prior to enrollment. She received 4 cycles of IT C. novyi-NT spores. Six received the 1st, 2nd, 3rd and 4th doses on Oct. 1, 2012, Oct. 8, 2012, Oct. 15, 2012, and Oct. 22, 2012, respectively. Administration of C. novyi-NT spores was well tolerated with only mild adverse events observed. After the 1st dose, Grade I hypertension and fever were noted. Fever and hypertension were self-limiting and resolved within 1 and 2 hours of dosing respectively. On Day 4 (Oct. 5, 2012), the tumor was subjectively softer and a small area of ulceration (Grade I) was observed at the site of a previous biopsy. Ulceration continued to Day 31 (Nov. 1, 2012), the most current study visit. This ulceration may be associated with either the study agent or a complication of the biopsy required for study enrollment.
Belle (04-R06), an 11 year-old, female spayed, Labrador retriever, presented with a mast cell tumor (originally aspirated as a soft tissue sarcoma) on the right rear digit 3 with metastasis to the popliteal lymph node. She had no treatment history prior to enrollment. She received 4 cycles of IT C. novyi-NT spores. Adverse events were mild and limited to Grade I fever and Grade I tumor inflammation. Belle received the 1st, 2nd, 3rd and 4th treatment cycles on Oct. 19, 2012, Oct. 26, 2012, Nov. 2, 2012, and Nov. 9, 2012. Grade I fever contemporaneous with C. novyi-NT treatment and tumor inflammation. Fever and inflammation were self-resolving without the need for medical management other than protocol required subcutaneous fluids administered on scheduled study visits. Ulceration of the tumor was noted on Day 21 (Nov. 9, 2012). Photographs of the tumor sent to the investigator by the dog owner showed resolution of the ulceration and marked regression in the mass. An unscheduled visit was performed on Day 46 (Dec. 4, 2012) to capture tumor response assessment. Complete regression of the tumor was noted.
Frida (11-R01), a 7 year-old, female spayed, German shepherd mix, presented with a soft tissue sarcoma (hemangiopericytoma) on the right rear paw with possible lymph node metastasis (based on CT). Her treatment history included surgery prior to enrollment. She traveled with her owner from Mexico to participate in this clinical trial. She received 3 cycles of IT C. novyi-NT spores. Adverse events were limited to a waxing and waning fever for 48 hours, which resolved with intravenous fluids and NSAIDs. Frida received the 1st, 2nd, and 3rd cycles of therapy on Nov. 6, 2012, Nov. 14, 2012, and Nov. 21, 2012. The only significant adverse events included Grade I fever requiring hospitalization and fluids starting on Day 4 (Nov. 10, 2012) and progressing to Grade II fever on Day 5 (Nov. 11, 2012). The fever resolved after 48 hours. A Grade I fever was also noted after the 3rd cycle of therapy on Day 18 (Nov. 24, 2012). Tumor progression prompted amputation on Day 21 (Nov. 27, 2012).
Mhija (01-R02), a 7 year-old, neutered male, Border Collie, presented with soft tissue sarcoma (peripheral nerve sheath tumor) on the left thoracic flank. She had no treatment history prior to enrollment. She has received 3 cycles of IT C. novyi-NT spores. Adverse events were mild and well tolerated. Tumor inflammation, heat and serosanguineous to mucopurulent discharge are probably related to C. novyi-NT activity. A 4th cycle of C. novyi-NT spores is planned. Mhija received the 1st, 2nd and 3rd doses on Nov. 12, 2012, Nov. 20, 2012, and Nov. 27, 2012, respectively. The interval between 1st and 2nd doses was 8 days; while the interval between 2nd and 3rd doses was 7 days. Administration of C. novyi-NT was associated with mild, Grade I-II toxicity. Grade I nausea and regurgitation was noted after the 1st dose, with Grade I inappetence and lethargy noted after the 3rd dose. Toxicities resolved shortly with medical management. Most toxicities were localized to the tumor site, Grade I or II in severity (heat, inflammation, pruritis, serosanguineous to mucopurulent discharge and erythema) and occurring within 2 days of an administration of C. novyi-NT. Additionally, Grade I-II ventral edema was observed 2 days after the 1st and 3rd doses.
Tank (10-R02), a 10 year-old, male neutered, mixbreed, presented with soft tissue sarcoma (hemangiopericytoma) on the right flank. His treatment history included surgery prior to enrollment. He received 1 cycle of IT C. novyi-NT spores on Nov. 12, 2012. Grade I fever, decreased appetite, Grade II edema surrounding the tumor, and Grade III tumor abscess were noted on Day 4 (Nov. 16, 2012) following treatment. Medical management including pain medication, IV fluids, and broad-spectrum antibiotics were used to manage the abscess. Tumor inflammation and surrounding edema resolved on Day 11 (Nov. 23, 2012). Tank received a 2nd treatment cycle on Dec. 3, 2012. The interval between cycles was 21 days. The 2nd dose was delayed due to the antibiotics washout period.
Time courses of tumor measurements from eight of the dogs are shown in
In summary, C. novyi-NT administered by IT injection at a dose of 1×108 spores per cycle with up to 4 cycles of treatment exhibits meaningful biological and anti-tumor activities and appears to be well-tolerated in companion dogs with naturally occurring solid tumors. Tumor responses are rapid, with significant tumor necrosis and notable disease regression occurring within days of C. novyi-NT administration. Most adverse events are limited to Grade 1 and Grade 2, and are consistent with the mechanism-based tumor inflammatory reactions expected from the C. novyi-NT therapeutic. Several cases are currently under long-term follow-up for assessment of progression and survival.
Example 8 Intratumoral (IT) Administration of C. novyi-NT—Study 2 MethodsA study characterizing dose and volume of C. novyi-NT administration by IT injection for the treatment of dogs with solid tumors (excluding osteosarcoma or mast cell tumor) is being performed.
Dogs with solid tumors (except osteosarcoma or mast cell tumor) of any weight, breed, sex, or age were screened for enrollment. Inclusion criteria was similar to that presented in Example 6, with the exception that each dog had a cytologic or histologic diagnosis of any cancer excluding osteosarcoma or mast cell tumor, and that each dog had at least 1 measurable tumor lesion with a longest diameter 1 cm.
During the initial screening visit each dog was assigned a unique study dog identification number consisting of a 5-digit numeric code (which may not be sequentially in order of the screening dog number). The first 2 digits indicated the study site (01 to 99), the middle digit indicated the study ‘5’, and the last 2 digits described the study dog number within a study site (01 to 99). For example the 11th dog enrolled at Site 9 was assigned study dog number 09-511. Study dog numbers were assigned chronologically in the order that dogs were enrolled at a given study site. A dog was considered enrolled in the study when it satisfied the inclusion and exclusion criteria.
Gross pathology, histopathology, and necropsy were performed as described in Example 6.
C. novyi-NT spores were prepared as set forth above prior to shipment at a concentration of 1×108 spores/mL and suspended in sterile saline in 2 mL cryovials. Each cycle of C. novyi treatment was composed of up to 5 injections of 1 mL spore suspension (1×108 spores) for each injection into a single target lesion. The spore suspension containing 1×108 spores was packed in individual cryovials for each 1 mL injection, and the vial, syringe, and needle were discarded after each injection.
The scheme for injection is shown in
All dogs were hospitalized from D0 to D2, and then at the Investigator's discretion for 24 to 48 hours after each subsequent treatment for clinical observation. Fluids were administered to all study dogs during hospitalization following C. novyi-NT treatment. On dosing days all dogs were administered IV crystalloids at 4 ml/hg/h for 2 hours post-treatment with C. novyi-NT.
Study visits and events are summarized in Table 18, as an example of an 8-cycle treatment regimen. The dosing interval was suggested to be weekly if the intent was to treat the dog with multiple cycles of therapy.
As of Dec. 2, 2012, two companion dogs have been treated in the study. Both animals received a dose level of 5×108 spores administered at 5 unique IT injection sites per treatment cycle. The first dog, Buddy (04-503), a 9 year-old, male neutered, Belgian malinois, presented with soft tissue sarcoma on the left carpus with a LD measurement of 69 mm at baseline (4.4×3.3×0.7 cm by CT). His treatment history included surgery prior to enrollment. He received 2 cycles of IT C. novyi-NT spores. Adverse events were mild and limited to Grade I fever and Grade I tumor inflammation. Buddy received the 1st and 2nd treatment cycles on Nov. 21, 2012 and Nov. 28, 2012. Grade I fever and tumor redness, swelling and increased pain were noted within 6 hours of the first injection. The fever resolved within 6 hours following treatment with the NSAID carprofen. Mild tumor ulceration was noted on Day 2 (Nov. 23, 2012) following treatment. At Day 7 (Nov. 28, 2012), a slight decrease in the size of the mass was noted (−12.0%). Each cycle of treatment was well tolerated with no adverse events greater than Grade I.
The second dog, Guinness (04-502), a 9 year-old, male neutered, Wheaton terrier, presented with squamous cell carcinoma on the left shoulder with a LD measurement of 122 mm at baseline (9.1×9.3×14.5 cm by CT), a low-grade hemangiosarcoma on the rear leg, and evidence of pulmonary metastasis (based on CT). His treatment history included surgery prior to enrollment. Preexisting mitral valve disease was evident based on echocardiography performed prior to enrollment. He received a single dose of IT C. novyi-NT spores on Nov. 28, 2012. Grade III fever was noted within 6 hours of treatment and medically managed with IV fluids. On Day 1 (Nov. 29, 2012), abscess of the mass, purulent discharge, and neutrophilia were appreciated. IV fluids were continued and pain medications (including NSAIDs) were started. On Day 2 (Nov. 30, 2012), progressive tumor swelling and evidence of sepsis (fever, neutropenia, hypoglycemia, hypoalbuminemia) prompted lancing of the tumor and irrigation. Broad-spectrum antibiotics, hetastarch and human albumin were administered. On Day 3 (Dec. 1, 2012), progressive decline in status was noted resulting in respiratory distress. Euthanasia solution was administered. A necropsy was performed. Gross clinically significant findings included vegetative endocarditis, suppurative lung nodules, and whole-body subcutaneous hemorrhage and edema. Postmortem aerobic cultures from various tissues and organs (lung, liver, heart, kidney, spleen, GI, stomach) revealed polymicrobial bacterial growth (Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, Streptococcus species); anaerobic cultures from all organs and tissues were negative for C. novyi-NT growth except in the tumor tissue and urinary bladder. Histopathology of affected tissues are pending. Septic toxemia shock is considered the most likely cause of death and relationship to C. novyi-NT therapy is unknown at this time.
Example 10 Intratumoral (IT) Administration of C. novyi-NT in Humans—MethodsPhase I Human Clinical Trial of IT Injected C. novyi-NT Spores
An open-label, non-randomized, multi-center phase I safety study of a single IT injection of C. novyi-NT spores is currently ongoing in patients with treatment-refractory solid tumors. The clinical study protocol was reviewed and approved by the Institutional Review Board (IRB) of each participating institution, and all regulatory steps were performed under the guidance of the Food and Drug Administration (FDA) (number NCT01924689). All patients were required to sign a written Informed Consent Form (ICF) before inclusion in the study.
The primary objectives of this phase I study were to determine the safety profile, dose limiting toxicities (DLT), and maximum tolerated dose (MTD) of IT injected C. novyi-NT. In addition, the anti-tumor activity of the therapeutic was explored.
Preparation and IT Injection of C. novyi-NT Spores in Phase I Study
The clinical supply of C. novyi-NT spores was packaged in a single-use 2 mL sterile and pyrogen-free, Type I borosilicate glass vial with a rubber stopper and aluminum seal with a tamper resistant cap at a concentration of 8.52×108 spores/mL suspended in sterile phosphate buffered saline (PBS) with a 1.0 mL fill volume. The vials were stored between 2-8° C. in controlled temperature environment under constant temperature monitoring. The GMP product was manufactured and formulated by Omnia Biologics, Inc. (Rockville, Md.).
After a patient was enrolled in the trial, one vial was shipped to the study site. Further preparation of C. novyi-NT was required and occurred on the same day of the IT injection. Dilution of the concentrated spore suspension was performed in a designated biological safety cabinet using sterile saline (0.9%) infusion bags of appropriate size to achieve the required dose based on the assigned cohort. The injection volume (3 mL) was then withdrawn from the saline bag and injected under radiographic guidance. C. novyi-NT spores were injected with an 18-gauge multi-prong needle (Quadra-Fuse®, Rex-Medical, Conshohocken, Pa.).
Design and Conduct of Human Clinical TrialThe study was conducted with a standard 3+3 dose-escalation design. Patients must have been diagnosed as having an advanced solid tumor malignancy with a target tumor that was measureable, palpable or clearly identifiable under ultrasound or radiographic guidance and amenable to percutaneous injection of C. novyi-NT spores. The targeted lesion must have a longest diameter 1 cm and be measurable as defined by RECIST 1.1 criteria. The main eligibility criteria included history of a treatment refractory malignancy; age of at least 18 years; Eastern Cooperative Oncology Group (ECOG) performance status 2; able to stay within 45 minutes driving time of an emergency room and having a caregiver for 28 days after IT injection. The main exclusion criteria were pregnancy; primary brain malignancy or brain metastases; clinically significant ascites or clinical evidence or history of portosystemic hypertension or cirrhosis; Glasgow Coma Score (GCS)<15; serum creatinine level>1.5× the upper limit of normal (ULN), chronic renal failure requiring hemodialysis or peritoneal dialysis; oxygen saturation (Sp02)<95% (room air); mean arterial blood pressure (BP)<70 mmHg; platelet count 100,000/mm3; hemoglobin<9.0 g/dL; absolute neutrophil count (ANC)<1,000/mm3; clinically significant pleural effusion, pericardial effusion, circumferential pericardial effusion, or any effusion greater than 1.0 cm at any location around the heart; need to ongoing treatment with an immunosuppressive agent; history of solid organ transplantation; systemic or localized infection.
Eligible patients were admitted and enrolled into a dose cohort. Under the protocol, patients remain hospitalized after spore administration and observed for 8 days, and patients return to the clinical site for routinely scheduled follow-up visits for 12 months, during which time assessments of safety and efficacy were performed.
Clinical response and progression were evaluated using the RECIST version 1.1. Objective responses were measured by serial CT or MRI scans of the injected tumor, as well as distant metastases (up to 5 target lesions). Safety monitoring for infectious complications or other treatment-emergent adverse events were continuously conducted for 12 months.
Example 11 Intratumoral (IT) Administration of C. novyi-NT in Humans—ResultsC. novyi-NT Causes Rapid Local Tumor Destruction in the First Human Patient
The promising outcomes and favorable risk/benefit profiles of biosurgery in the comparative canine trial, in conjunction with the results observed in rats, provided a rationale for attempting biosurgery in humans. Accordingly, a Phase I investigational study in human patients with solid tumors that were either refractory to standard therapy or without an available standard therapy was initiated (NCT01924689). The first patient enrolled in this trial is reported herein: a 53-year-old female diagnosed with a retroperitoneal leiomyosarcoma in August 2006. The patient underwent several surgical resections and received multiple chemotherapy and radiotherapy treatments, including a right radical nephrectomy and radiation therapy in March 2007, chemotherapy with gemcitabine, taxol, adriamycin, and ifosfamide, resection of liver metastasis in November 2008, multiple wedge resections of right-sided pulmonary metastases in December 2009, trabectedin treatment from March 2010 to April 2011, multiple wedge resection of left-sided pulmonary metastases in December 2010, pazopanib treatment in April 2011, left lower lobectomy in October 2011, HAI abraxane, gemcitabine, and avastin from February 2012 to January 2013, everolimus and pazopanib from February 2013 to July 2013, and bland arterial hepatic embolization in August 2013 and September 2013. However, the patient progressed, with metastatic disease present in her liver, lungs, peritoneum, and soft tissue in the right shoulder and adjacent right humerus.
Biosurgery was performed with the planned starting dose of 1×104 C. novyi-NT spores injected into her metastatic right shoulder tumor with an 18-gauge multi-prong needle (day 0, Nov. 19, 2013).
CT-Guided Intratumoral Injection Using a Three-Pronged NeedleThe subject was placed under moderate sedation with fentanyl and versed for 35 minutes. An 18-gauge Quadra-Fuse device (Rex Medical) (
On day 1, the patient experienced mild right shoulder pain extending to the scapula, which responded to tramadol and acetaminophen. On day 2, her pain required IV patient controlled analgesia with hydromorphone, her leukocyte count increased to 18,300 per μL, and she developed fever with a maximum temperature of 39.2° C. On day 3, the pain in the patient's right shoulder and scapula was difficult to control. Her maximum temperature was 37.8° C. The CT scan of the right upper extremity demonstrated extensive tumor destruction with gas in the soft tissue and bony component of the tumor (
- AGRAWAL, N. et al. Bacteriolytic therapy can generate a potent immune response against experimental tumors. Proc Natl Acad Sci USA 101, 15172-7 (2004).
- BAI, R. Y., et al. V. Antiparasitic mebendazole shows survival benefit in 2 preclinical models of glioblastoma multiforme. Neuro-oncology 13, 974-982 (2011).
- BARRETINA, J., et al. Subtype-specific genomic alterations define new targets for soft-tissue sarcoma therapy. Nature genetics 42, 715-721 (2010).
- BETTEGOWDA, C., et al. The genome and transcriptomes of the anti-tumor agent Clostridium novyi-NT. Nature biotechnology 24, 1573-1580 (2006).
- BREED, R. S., et al. The Number of Colonies Allowable on Satisfactory Agar Plates. Journal of Bacteriology 1 (3): 321-331 (1916).
- CAREY, R. W., et al. Clostridial oncolysis in man. Eur. J. Cancer 3, 37-46 (1967).
- CHMIELECKI, J., et al. Whole-exome sequencing identifies a recurrent NAB2-STAT6 fusion in solitary fibrous tumors. Nature genetics 45, 131-132 (2013).
- DANG, L. H. et al. Targeting Vascular and Avascular Compartments of Tumors with C. novyi-NT and Anti-Microtubule Agents. Cancer Biol Ther 3, 326-37 (2004).
- DANG, L. H., et al. Combination bacteriolytic therapy for the treatment of experimental tumors. PNAS. Vol. 98, pages 15155-15160 (2001).
- DANG, L. H., et al. U.S. Pat. No. 7,344,710.
- DENNIS, M. M., et al. Prognostic factors for cutaneous and subcutaneous soft tissue sarcomas in dogs. Veterinary pathology 48, 73-84 (2011).
- DIAZ, L. A., Jr. et al. Pharmacologic and toxicologic evaluation of C. novyi-NT spores. Toxicol Sci 88, 562-75 (2005).
- EUROPEAN MEDICINES AGENCY. Combined VeDDRA list of clinical terms for reporting suspected adverse reactions in animals and humans to veterinary medicinal products (2012).
- GAVHANE, Y. N. et al. Solid Tumors: Facts, Challenges and Solutions. International J. of Pharma Science and Research, Vol. 2, pages 1-12 (2011).
- JAIN, R. K., et al. Can engineered bacteria help control cancer? Proc Natl Acad Sci USA 98, 14748-50 (2001).
- JONES, S., et al. Frequent mutations of chromatin remodeling gene ARID1A in ovarian clear cell carcinoma. Science 330, 228-231 (2010).
- JOSEPH, C., et al. Exomic Analysis of myxoid liposarcomas, synovial sarcomas and osteosarcomas. Submitted, (2013).
- LEE, R. S., et al. A remarkably simple genome underlies highly malignant pediatric rhabdoid cancers. The Journal of clinical investigation 122, 2983-2988 (2012).
- MOSE, J. R. Clostridium Strain M55 and its effect on Malignant Tumors. in Bactéries anaérobies 1st edn (ed. Fredette, V.) 229-247 (Montreal: Institut de Microbiologie et l'Hygiène de Université de Montreal, 1967).
- MOSE, J. R. Onkolyse durch Clostridien. in 3rd International Congress of Chemotherapy (ed. Thieme, G.) 1972 (Stuttgart, Germany, 1963).
- PAOLONI, M., et al. Translation of new cancer treatments from pet dogs to humans. Nature Reviews Cancer 8, 147-156 (2008).
- PARKER, R. C., et al. Effect of histolyticus infection and toxin on transplantable mouse tumors. Proc. Soc. Exp. Biol. Med. 66, 461 (1947).
- PATNAIK, A. K., et al. Canine cutaneous mast cell tumor: morphologic grading and survival time in 83 dogs. Veterinary pathology 21, 469-474 (1984).
- SABATTINI, S., et al. Histologic Grading of Canine Mast Cell Tumor: Is 2 Better Than 3? Veterinary pathology, published online Feb. 10, 2014.
- SMEDLEY, R. C., et al. Prognostic markers for canine melanocytic neoplasms: a comparative review of the literature and goals for future investigation. Veterinary pathology 48, 54-72 (2011).
- VAIL, D. M., et al. Spontaneously occurring tumors of companion animals as models for human cancer. Cancer investigation 18, 781-792 (2000).
- VETERINARY CO-OPERATIVE ONCOLOGY GROUP. Veterinary Co-operative Oncology Group—Common Terminology Criteria for Adverse Events (VCOG-CTCAE) following chemotherapy or biological antineoplastic therapy in dogs and cats v1.0. Veterinary and comparative oncology 2, 195-213 (2004).
- VOGELSTEIN, B., et al. Cancer genome landscapes. Science 339, 1546-1558 (2013).
All documents cited in this application are hereby incorporated by reference as if recited in full herein.
Although illustrative embodiments of the present invention have been described herein, it should be understood that the invention is not limited to those described, and that various other changes or modifications may be made by one skilled in the art without departing from the scope or spirit of the invention.
Claims
1. A unit dose of C. novyi colony forming units (CFUs) for debulking or abalating a solid tumor present in a human, comprising about 1×103-1×106 CFUs in a pharmaceutically acceptable carrier or solution.
2. The unit dose of claim 1, wherein the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, and melanoma.
3. The unit dose of claim 1, wherein the solid tumor is leiomyosarcoma.
4. The unit dose of claim 3, wherein the solid tumor is retroperitoneal leiomyosarcoma.
5. The unit dose of claim 1, wherein the C. novyi CFUs are selected from the group consisting of vegetative and spore forms.
6. The unit dose of claim 1, wherein the C. novyi is C. novyi NT.
7. The unit dose of claim 6, wherein the unit dose comprises about 1×104 C. novyi NT spores in a pharmaceutically acceptable carrier or solution.
8. The unit dose of claim 1, wherein the unit dose is formulated for intratumoral administration.
9. The unit dose of claim 1, wherein the unit dose is effective to debulk or ablate the solid tumor without administration of additional anti-cancer agents.
10. The unit dose of claim 1, wherein the unit dose is effective to debulk or ablate the solid tumor by a single treatment.
11. A unit dose of C. novyi colony forming units (CFUs) for microscopically precise excision of tumor cells in a human, comprising about 1×103-1×106 CFUs in a pharmaceutically acceptable carrier or solution.
12. The unit dose of claim 11, wherein the unit dose is effective for microscopically precise excision of tumor cells without administration of additional anti-cancer agents.
13. A kit for debulking or abalating a solid tumor present in a human, comprising a unit dose according to claim 1 and instructions for use of the kit.
14. The kit of claim 13, further comprising one or more antibiotics, which are effective to treat or alleviate an adverse side effect caused by the C. novyi CFUs.
15. The kit of claim 13, wherein the C. novyi CFUs are selected from the group consisting of vegetative and spore forms.
16. The kit of claim 13, wherein the C. novyi is C. novyi NT.
17. The kit of claim 16, wherein the unit dose comprises about 1×104 C. novyi NT spores in a pharmaceutically acceptable carrier or solution.
18. The kit of 13, further comprising 1-4 unit doses of the C. novyi CFUs for carrying out 1-4 treatment cycles.
19. The kit of claim 17, further comprising 1-4 unit doses of the C. novyi NT spores for carrying out 1-4 treatment cycles.
Type: Application
Filed: Aug 2, 2022
Publication Date: Dec 1, 2022
Inventors: Saurabh SAHA (Wellesley Hills, MA), Shibin Zhou (Owings Mills, MD), Bert Vogelstein (Baltimore, MD), Kenneth W. Kinzler (Bel Air, MD)
Application Number: 17/816,924
