POLYNUCLEOTIDES FOR THE AMPLIFICATION AND DETECTION OF HUMAN BETA ACTIN

Disclosed herein are primers and probes related to the detection of beta actin [Homo sapiens (human)] via nucleic acid amplification testing (NAAT), for example to amplify and determine the presence of β-actin present in test samples. Specifically, the present disclosure describes primers and probes that bind to the beta actin gene for detection via loop mediated isothermal amplification (LAMP) and molecular beacon hybridization.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. application Ser. No. 16/700,824, filed Dec. 2, 2019, the disclosure of which is incorporated by reference herein in its entirety.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Dec. 1, 2020, is named TSM-047WO_SL.txt and is 42,596 bytes in size.

FIELD OF THE INVENTION

The present invention relates to the fields of molecular biology and nucleic acid chemistry. The invention provides methods and reagents for detecting mammalian, specifically human, gene for beta actin and also relates to the fields of medical diagnostics and prognostics. In particular, the invention relates to polynucleotides and methods for amplifying and detecting beta actin, hereinafter referred to as “β-actin”.

BACKGROUND

Housekeeping genes are required for the maintenance of basal cellular functions essential for the existence of a cell, regardless of its specific role in the tissue or organism. Thus, such genes are expected to be expressed in all cells of an organism under normal and patho-physiological conditions, irrespective of tissue type, developmental stage, cell cycle state, or external signal. Since these genes represent the minimal set of genes necessary for sustaining life, they can provide value to researchers and professionals conducting experimental studies and molecular testing by frequently using them as a control. Controls are assessed in parallel with target analytes of interest to establish a factor of confidence in the final results obtained. When the expected presence of the control is determined, one or more aspects of the experiment or assay are confirmed to be properly functioning. However, when the expected presence of the control is absent, the final results in question do not meet performance standards and indicate an error.

In one specific example, nucleic acid amplification tests (NAATs) for molecular diagnostic testing require the use of one or more controls to be tested and detected in parallel with one or more target analytes of interest. The embodiments disclosed herein provide primers and probes relate to the detection of the housekeeping gene encoding β-actin using loop-mediated isothermal amplification.

SUMMARY OF THE INVENTION

The present invention encompasses, in some embodiments, a composition comprising a set of polynucleotides selected from the group consisting of Set-1 through Set-29. In some embodiments, the composition further comprises a probe. In some embodiments, the probe comprises a label. In some embodiments, the probe is a labeled polynucleotide. In a preferred implementation, the label is a fluorophore, which preferably is covalently attached to a terminus of the polynucleotide. In a particularly preferred embodiment, the probe or polynucleotide is a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide. In one embodiment, the fluorophore is FAM and the quencher is BHQ1. In an alternate implementation, the fluorophore is ATTO 565 or Alexa 594 and the quencher is BHQ1 or BHQ2.

In some implementations, composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184. In further implementations, the labeled polynucleotide can comprise a sequence elected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184. In certain implementations, the sequence of the labeled polynucleotide is selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

In some embodiments, the set of polynucleotides is selected from the group consisting of Sets 9-12, Set-17, and Sets 22-29, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184. In some implementations, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 183, and SEQ ID NO: 184. In some implementations, the sequence of the labeled polynucleotide is SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 183, and SEQ ID NO: 184. In a preferred implementation, the sequence of the labeled polynucleotide is SEQ ID NO: 184, and the set of polynucleotides is Set-29.

In yet another embodiment, the set of polynucleotides is selected from the group consisting of Sets 9-11, Set-17, and Sets 23-29, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, and nucleotides 1-23 of SEQ ID NO: 154. More particularly, the labeled polynucleotide can comprise a sequence selected from the group consisting of SEQ ID NO: 152, SEQ ID NO: 153, and SEQ ID NO: 154. In certain implementations, the sequence of the labeled polynucleotide is selected from the group SEQ ID NO: 152, SEQ ID NO: 153, and SEQ ID NO: 154.

In one implementation, the set of polynucleotides is selected from the group consisting of Set-4, Sets 9-12, Set-17, and Sets 22-26, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, and nucleotides 8-30 of SEQ ID NO: 146. In certain implementations, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 144, SEQ ID NO: 145, and SEQ ID NO: 146. In some embodiments, the sequence of the labeled polynucleotide is selected from the group SEQ ID NO: 144, SEQ ID NO: 145, and SEQ ID NO: 146.

In another implementation, the set of polynucleotides is selected from the group consisting of Set-5, Set-12, Set-17, and Sets 22-25, and the composition comprises a labeled polynucleotide comprising nucleotides 3-22 of SEQ ID NO: 170. In some implementations, the labeled polynucleotide comprises SEQ ID NO: 170. In other embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 170.

In one embodiment, the set of polynucleotides is selected from the group consisting of Sets 6-8, Set-15, and Set-16, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 2-27 of SEQ ID NO: 180 and nucleotides 3-30 of SEQ ID NO: 182. In some implementations, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 180 and SEQ ID NO: 182. In other embodiments the sequence of the labeled polynucleotide is SEQ ID NO: 180 or SEQ ID NO: 182.

In yet another embodiment, the set of polynucleotides is selected from the group consisting of Sets 6-11, Set-28, and Set-29, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 4-34 of SEQ ID NO: 178 and nucleotides 5-33 of SEQ ID NO: 181. In some embodiments, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 178 and SEQ ID NO: 181. In other embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 178 or SEQ ID NO: 181.

In certain implementations, the set of polynucleotides is selected from the group consisting of Sets 6-9 and Set-11, and the composition comprises a labeled polynucleotide comprising nucleotides 3-27 of SEQ ID NO: 179. In other implementations, the labeled polynucleotide comprises SEQ ID NO: 179. In yet another implementation, the sequence of the labeled polynucleotide is SEQ ID NO: 179.

In one embodiment, the set of polynucleotides is selected from the group consisting of Sets 6-9, Set-11, and Set-28, and the composition comprises a labeled polynucleotide comprising nucleotides 4-23 of SEQ ID NO: 177. In some embodiments, the labeled polynucleotide comprises SEQ ID NO: 177. In other embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 177.

In one implementation, the set of polynucleotides is selected from the group consisting of Sets 13-15, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 7-25 of SEQ ID NO: 159 and nucleotides 8-22 of SEQ ID NO: 160. In another implementation, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 159 and SEQ ID NO: 160. In other implementations, the sequence of the labeled polynucleotide is SEQ ID NO: 159 or SEQ ID NO: 160.

In one embodiment, the set of polynucleotides is selected from the group consisting of Sets 13-16, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 6-22 of SEQ ID NO: 161, and nucleotides 3-22 of SEQ ID NO: 162. In such an embodiment, the labeled polynucleotide can comprise a sequence selected from the group consisting of SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 161, and SEQ ID NO: 162. In yet another embodiment, the sequence of the labeled polynucleotide is selected from the group consisting of SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 161, and SEQ ID NO: 162.

In another implementation, the set of polynucleotides is Set-3, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 151, and nucleotides 4-24 of SEQ ID NO: 153. In certain implementations, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 151, and SEQ ID NO: 153. In a further implementation, the sequence of the labeled polynucleotide is selected from the group consisting of SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 151, and SEQ ID NO: 153.

In some embodiments, the set of polynucleotides is selected from the group consisting Set-1, Set-2, and Sets 18-20, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-28 of SEQ ID NO: 163 and nucleotides 3-28 of SEQ ID NO: 164. In some implementations, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 163 and SEQ ID NO: 164. In other embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 163 or SEQ ID NO: 164.

In yet another implementation, the set of polynucleotides is selected from the group consisting of Set-1, Set-2 and Sets 18-21, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135 and nucleotides 6-30 of SEQ ID NO: 136. In some embodiments, the labeled polynucleotide comprises a sequence from the group consisting of SEQ ID NO: 135 and SEQ ID NO: 136. In other embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 135 or SEQ ID NO: 136.

Another aspect of the invention provides molecular beacons comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184.

Yet another aspect of the invention provides method of detecting β-actin in a test sample, the method comprising (a) extracting nucleic acid from the test sample, (b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand displacement DNA polymerase and a sequence specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 through Set-29, and (c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of β-actin in the test sample. In one embodiment, the amplification in step (b) of the target sequence is performed between about 60° C. and about 67° C. for less than 30 minutes. Preferably, the amplification step is performed for less than fifteen minutes. In some implementations, the reaction mixture further comprises a reverse transcriptase.

In certain embodiments, detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a probe comprising a polynucleotide attached to a label. In a preferred implementation, the label is a fluorophore, which is preferably attached to a terminus of the polynucleotide. In a particularly preferred embodiment, the probe or polynucleotide is a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide. In one embodiment, the fluorophore is FAM and the quencher is BHQ1. In an alternate implementation, the fluorophore is ATTO 565 or Alexa 594 and the quencher is BHQ1 or BHQ2.

Yet another aspect of the invention provides kits comprising the compositions comprising a set of polynucleotides selected from the group consisting Set-1 through Set-29. In some embodiments, the kit further comprises a strand displacement polymerase and, optionally, a reverse transcriptase. In certain embodiments, the kit comprises a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184. The polynucleotide sequence of the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184. In some embodiments, the polynucleotide sequence of the molecular beacon consists of a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184. In one embodiment, the polynucleotide sequence of the molecular beacon consists of SEQ ID NO: 184 and the set of polynucleotides is Set-29.

Another aspect of the invention provides methods of detecting β-actin in a test sample, the method comprising (a) extracting nucleic acid from the test sample, (b) amplifying a target sequence by reacting nucleic acid extracted in step (a) for less than ten minutes with a reaction mixture comprising a strand displacement DNA polymerase and a sequence specific LAMP primer set, and (c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of β-actin in the test sample. In some implementations, the amplifying step comprises reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 through Set-29. In such implementations, detecting the presence or absence of the amplification product can comprise hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184. In such implementations, detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 183, and SEQ ID NO: 184.

DETAILED DESCRIPTION

The present invention encompasses, in some embodiments, a composition comprising a set of polynucleotides for priming a nucleic acid amplification reaction and methods of using such. In some embodiments, the composition further comprises a probe.

As used herein, “nucleic acid” includes both DNA and RNA, including DNA and RNA containing non-standard nucleotides. A “nucleic acid” contains at least one polynucleotide (a “nucleic acid strand”). A “nucleic acid” may be single-stranded or double-stranded. The term “nucleic acid” refers to nucleotides and nucleosides which make up, for example, deoxyribonucleic acid (DNA) macromolecules and ribonucleic acid (RNA) macromolecules. The most common nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). It should be further understood that the present invention can be used for biological sequences containing artificial nucleotides such as peptide nucleic acid (PNA), morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid (TNA), among others. Preferably, the artificial nucleotides are locked nucleic acid molecules, including [alpha]-L-LNAs. LNAs comprise ribonucleic acid analogues wherein the ribose ring is “locked” by a methylene bridge between the 2′-oxygen and the 4′-carbon—i.e., oligonucleotides, containing at least one LNA monomer, that is, one 2′-O,4′-C-methylene-β-D-ribofuranosyl nucleotide. LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the basepairing reaction (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)).

As used herein, a “polynucleotide” refers to a polymeric chain containing two or more nucleotides, which contain deoxyribonucleotides, ribonucleotides, and/or their analog, such as those containing modified backbones (e.g. peptide nucleic acids (PNAs) or phosphorothioates) or modified bases. “Polynucleotides” includes primers, oligonucleotides, nucleic acid strands, etc. A polynucleotide may contain standard or non-standard nucleotides. Thus the term includes mRNA, tRNA, rRNA, ribozymes, DNA, cDNA, recombinant nucleic acids, branched nucleic acids, plasmids, vectors, probes, primers, etc. Typically, a polynucleotide contains a 5′ phosphate at one terminus (“5′ terminus”) and a 3′ hydroxyl group at the other terminus (“3′ terminus”) of the chain. The most 5′ nucleotide of a polynucleotide may be referred to herein as the “5′ terminal nucleotide” of the polynucleotide. The most 3′ nucleotide of a polynucleotide may be referred to herein as the “3′ terminal nucleotide” of the polynucleotide. Where nucleic acid of the invention takes the form of RNA, it may or may not have a 5′ cap.

LAMP is a nucleic acid amplification method that relies on auto-cycle strand-displacement DNA synthesis performed by Bst DNA polymerase, or other strand displacement polymerases. The amplified products are stem-loop structures with several repeated sequences of the target, and have multiple loops. The principal merit of this method is that denaturation of the DNA template is not required, and thus the LAMP reaction can be conducted under isothermal conditions (ranging from 60 to 67° C.). LAMP requires only one enzyme and four types of primers that recognize six distinct hybridization sites in the target sequence. The reaction can be accelerated by the addition of two additional primers. The method produces a large amount of amplified product, resulting in easier detection, such as detection by visual judgment of the turbidity or fluorescence of the reaction mixture.

In brief, the reaction is initiated by annealing and extension of a pair of ‘loop-forming’ primers (forward and backward inner primers, FIP and BIP, respectively), followed by annealing and extension of a pair of flanking primers (F3 and B3). Extension of these primers results in strand-displacement of the loop-forming elements, which fold up to form terminal hairpin-loop structures. Once these key structures have appeared, the amplification process becomes self-sustaining, and proceeds at constant temperature in a continuous and exponential manner (rather than a cyclic manner, like PCR) until all of the nucleotides (dATP, dTTP, dCTP & dGTP) in the reaction mixture have been incorporated into the amplified DNA. Optionally, an additional pair of primers can be included to accelerate the reaction. These primers, termed Loop primers, hybridize to non-inner primer bound terminal loops of the inner primer dumbbell shaped products.

The term “primer” as used herein refers to an oligonucleotide, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand (template) is induced, i.e., in the presence of nucleotides and an agent for polymerization, such as DNA polymerase, and at a suitable temperature and pH.

Applications for LAMP have been further extended to include detection of RNA molecules by addition of Reverse Transcriptase enzyme (RT). By including RNA detection, the types of targets for which LAMP can be applied are also expanded and add the ability to additionally target RNA based viruses, important regulatory non-coding RNA (sRNA, miRNA), and RNA molecules that have been associated with particular disease or physiological states. The ability to detect RNA also has the potential to increase assay sensitivity, for instance in choosing highly expressed, stable, and/or abundant messenger RNA (mRNA) or ribosomal RNA (rRNA) targets. This preliminary phase of amplification involves the reverse transcription of RNA molecules to complementary DNA (cDNA). The cDNA then serves as template for the strand displacing DNA polymerase. Use of a thermostable RT enzyme (i.e., NEB RTx) enables the reaction to be completed at a single temperature and in a one step, single mix reaction.

A “target sequence,” as used herein, means a nucleic acid sequence of Neisseria gonorrhoeae, or complement thereof, that is amplified, detected, or both amplified and detected using one or more of the polynucleotides herein provided. Additionally, while the term target sequence sometimes refers to a double stranded nucleic acid sequence, those skilled in the art will recognize that the target sequence can also be single stranded, e.g., RNA. A target sequence may be selected that is more or less specific for a particular organism. For example, the target sequence may be specific to an entire genus, to more than one genus, to a species or subspecies, serogroup, auxotype, serotype, strain, isolate or other subset of organisms.

The speed, specificity and sensitivity of the primers/probe compositions and method described herein result from several aspects. Exemplary primers for use in the compositions and methods according to the present invention include those provided in Table 1.

TABLE 1 Primer Sequences Sequence ID Sequence (5′ to 3′) SEQ ID NO: 1 GAGCTACGAGCTGCCTGA SEQ ID NO: 2 TCTGCATCCTGTCGGCAA SEQ ID NO: 3 CCAGGAAGGAAGGCTGGAAGAGTCGGCCAGGTCATCACCAT SEQ ID NO: 4 CTGTGGCATCCACGAAACTACCTTCTGTGTTGGCGTACAGGTCT SEQ ID NO: 5 CGGAACCGCTCATTGCCA SEQ ID NO: 6 TCATGAAGTGTGACGTGGACATC SEQ ID NO: 7 AAGAGATGGCCACGGCTG SEQ ID NO: 8 ATGAAGTGTGACGTGGACATG SEQ ID NO: 9 GCGGAACCGCTCATTGCCAAGCTCCTCCCTGGAGAAGA SEQ ID NO: 10 ACTCTTCCAGCCTTCCTTCCTGGATGGAGTTGAAGGTAGTTTCGTG SEQ ID NO: 11 GTGATGACCTGGCCGTCAG SEQ ID NO: 12 GCATGGAGTCCTGTGGCATC SEQ ID NO: 13 CAGGATGCAGAAGGAGAT SEQ ID NO: 14 GTGTAACGCAACTAAGTCAT SEQ ID NO: 15 CCACACGGAGTACTTGCGCCAGCACAATGAAGATCAA SEQ ID NO: 16 CCAGCAGATGTGGATCAGCCTAGAAGCATTTGCGGTG SEQ ID NO: 17 CTCAGGAGGAGCAATGATC SEQ ID NO: 18 GACGAGT SEQ ID NO: 19 ACCCAGATCATGTTTGAGA SEQ ID NO: 20 ATCTCTTGCTCGAAGTCC SEQ ID NO: 21 CATCACGATGCCAGTGGTACCATGTACGTTGCTATCCAG SEQ ID NO: 22 CATGAAGATCCTCACCGAGCCTCCTTAATGTCACGCAC SEQ ID NO: 23 CAGAGGCGTACAGGGATA SEQ ID NO: 24 CTACAGCTTCACCACCAC SEQ ID NO: 25 ATCCACGAAACTACCTTCA SEQ ID NO: 26 GATCCACACGGAGTACTT SEQ ID NO: 27 CCAGACAGCACTGTGTTGGCCATCATGAAGTGTGACG SEQ ID NO: 28 ACAGGATGCAGAAGGAGATCACAGGAGGAGCAATGATCT SEQ ID NO: 29 CAGGTCTTTGCGGATGTC SEQ ID NO: 30 CACCCAGCACAATGAAGAT SEQ ID NO: 31 GTGATGGTGGGCATGG SEQ ID NO: 32 TGGGTCATCTTCTCGC SEQ ID NO: 33 GTGACGATGCCGTGCTCTCAGAAGGATTCCTATGTGG SEQ ID NO: 34 AACTGGGACGACATGGAGACACACGCAGCTCATTG SEQ ID NO: 35 GGTGAGGATGCCTCTC SEQ ID NO: 36 TCTGGCACCACACCTT SEQ ID NO: 37 CTTCCCCTCCATCGTG SEQ ID NO: 38 CACACGCAGCTCATTG SEQ ID NO: 39 TGAGGATGCCTCTCTTGCTCGTGATGGTGGGCAT SEQ ID NO: 40 CCATCGAGCACGGCATCGAAGGTGTGGTGCCA SEQ ID NO: 41 CACATAGGAATCCTTCTGACC SEQ ID NO: 42 CTGGGACGACATGGAGA SEQ ID NO: 43 CGTGATGGTGGGCAT SEQ ID NO: 44 GGGTACTTCAGGGTGAGGATCAGAAGGATTCCTATGTGG SEQ ID NO: 45 GAGCACGGCATCGTCACGAAGGTGTGGTGCCA SEQ Id NO: 46 TGCCTCTCTTGCTCTGG SEQ ID NO: 47 GAGAGGCATCCTCACC SEQ ID NO: 48 GTAGATGGGCACAGTGT SEQ ID NO: 49 CCACACGCAGCTCATTGTAATCGAGCACGGCATC SEQ ID NO: 50 TGCTATCCAGGCTGTGCTAAGTCCATCACGATGCC SEQ ID NO: 51 AAGGTGTGGTGCCAGA SEQ ID NO: 52 CTCTGGCCGTACCACT SEQ ID NO: 53 ATCGAGCACGGCATC SEQ ID NO: 54 CCACACGCAGCTCATTGTGGGACGACATGGAGAAA SEQ ID NO: 55 TCAGAAGGATTCCTATGTGG SEQ ID NO: 56 TCTCCATGTCGTCCCAGTTGAGAGGCATCCTCACC SEQ ID NO: 57 TGACGATGCCGTGCT SEQ ID NO: 58 ACCGCGAGAAGATGAC SEQ ID NO: 59 GACGCAGGATGGCAT SEQ ID NO: 60 CCAGAGGCGTACAGGGATTCATGTTTGAGACCTTCAAC SEQ ID NO: 61 CGTACCACTGGCATCGTGGTAGATGGGCACAGTGT SEQ ID NO: 62 CACAGCCTGGATAGCAAC SEQ ID NO: 63 ATGGACTCCGGTGACG SEQ ID NO: 64 TCGCCTTTGCCGATC SEQ ID NO: 65 GGAATCCTTCTGACCCAT SEQ ID NO: 66 CATGCCGGAGCCGTTGCGCCAGCTCACCATG SEQ ID NO: 67 TTCGCGGGCGACGATCATCACGCCCTGGTG SEQ ID NO: 68 GCGCGGCGATATCATC SEQ ID NO: 69 GTCTTCCCCTCCATCGT SEQ ID NO: 70 CGAGCACAGAGCCTC SEQ ID NO: 71 CGAGCGCGGCGATATCGCCTTTGCCGATCCG SEQ ID NO: 72 CATCCATGGTGAGCTGG SEQ ID NO: 73 GATGCCGTGCTCGAT SEQ ID NO: 74 CCGGCCTTGCACATGCCGCCAGCTCACCATG SEQ ID NO: 75 CGTGATGGTGGGCATGGGGTGAGGATGCCTCTC SEQ ID NO: 76 TGTCGACGACGAGCG SEQ ID NO: 77 GTCAGAAGGATTCCTATGTGG SEQ ID NO: 78 CGCCAGCTCACCATG SEQ ID NO: 79 CATCACGCCCTGGTGCTCGTCGTCGACAACG SEQ ID NO: 80 GGTCAGAAGGATTCCTATGTGGGGTGAGGATGCCTCTC SEQ ID NO: 81 CCGGCCTTGCACATG SEQ ID NO: 82 CGAGGCCCAGAGCAA SEQ ID NO: 83 ATGAGCTGCGTGTGGCTCCC SEQ ID NO: 84 GGGCATACCCCTCGTAGATGGG SEQ ID NO: 85 AGCACAGCCTGGATAGCAACGTACACCAAGGCCAACCGCGAGAAG SEQ ID NO: 86 ATCCCTGTACGCCTCTGGCCGTACCAGTGTGGGTGACCCCGTCA SEQ ID NO: 87 TGGCTGGGGTGTTGAAGGTCTCA SEQ ID NO: 88 CACTGGCATCGTGATGGACTCCG SEQ ID NO: 89 CTGGACTTCGAGCAAGAGATGGC SEQ ID NO: 90 TGTTGGCGTACAGGTCTTTGCG SEQ ID NO: 91 AAGAGTGCCTCAGGGCAGCGGAAGGAGAAGAGCTACGAGCTGCCT SEQ ID NO: 92 CCAGCCTTCCTTCCTGGGCATGGACCACGTCACACTTCATGATGGAGTT SEQ ID NO: 93 GCTCATTGCCAATGGTGATGACCTG SEQ ID NO: 94 CCTGTGGCATCCACGAAACTACCTT SEQ ID NO: 95 ACGGCTGCTTCCAGCTCCTC SEQ ID NO: 96 GACAGCACTGTGTTGGCGTACA SEQ ID NO: 97 AAGAGTGCCTCAGGGCAGCGGAAAGCTACGAGCTGCCTGACGG SEQ ID NO: 98 AGCCTTCCTTCCTGGGCATGGAGTCCCACGTCACACTTCATGATGGAGT SEQ ID NO: 99 TGTGGCATCCACGAAACTACCTTCA SEQ ID NO: 100 GCGGATGTCCACGTCACACTTC SEQ ID NO: 101 CCAATGGTGATGACCTGGCCGTCAGACGGCTGCTTCCAGCTCCTC SEQ ID NO: 102 ATGAGCGGTTCCGCTGCCCTGATCGTGGATGCCACAGGACTCC SEQ ID NO: 103 GCAGCTCGTAGCTCTTCTCCAGG SEQ ID NO: 104 GCACTCTTCCAGCCTTCCTTCCTG SEQ ID NO: 105 ATGAGCGGTTCCGCTGCCCTGAGATGCCACAGGACTCCATGCC SEQ ID NO: 106 CCAGAGGCGTACAGGGATCCAGATCATGTTTGAGACC SEQ ID NO: 107 CCAACCGCGAGAAGAT SEQ ID NO: 108 AGAGGCGTACAGGGATAGCACCCAGATCATGTTTGAGA SEQ ID NO: 109 ATAGCAACGTACATGGCTG SEQ ID NO: 110 AGAGGCGTACAGGGATAGCGACCCAGATCATGTTTGAG SEQ ID NO: 111 CCAACCGCGAGAAGA SEQ ID NO: 112 GAGGCGTACAGGGATAGCATGACCCAGATCATGTTTGA SEQ ID NO: 113 TTCTACAATGAGCTGCGTGT SEQ ID NO: 114 CGGAGTCCATCACGATGC SEQ ID NO: 115 AAGGTCTCAAACATGATCTGGGTCACGTGCTGCTGACCGAG SEQ ID NO: 116 CCAGCCATGTACGTTGCTATCCAAGTGGTACGGCCAGAGG SEQ ID NO: 117 TCGCGGTTGGCCTTGG SEQ ID NO: 118 GGCTGTGCTATCCCTGTACG SEQ ID NO: 119 AATCTGGCACCACACCTTC SEQ ID NO: 120 AGGCGTACAGGGATAGCA SEQ ID NO: 121 TTGGCCTTGGGGTTCAGGGGAGCTGCGTGTGGCTC SEQ ID NO: 122 GCGAGAAGATGACCCAGATCATGTGCCTGGATAGCAACGTACAT SEQ ID NO: 123 GCCTCGGTCAGCAGCA SEQ ID NO: 124 AGACCTTCAACACCCCAGC SEQ ID NO: 125 GCACGGCATCGTCACC SEQ ID NO: 126 GCCTGGATAGCAACGTACAT SEQ ID NO: 127 AGCCACACGCAGCTCATTGTAACTGGGACGACATGGAGA SEQ ID NO: 128 TGAACCCCAAGGCCAACCGCTGGGGTGTTGAAGGTCTC SEQ ID NO: 129 AGAAGGTGTGGTGCCAGATT SEQ ID NO: 130 CGAGAAGATGACCCAGATCATGT SEQ ID NO: 131 ACGGCATCGTCACCAAC SEQ ID NO: 132 TGCTCCTCGGGAGCCACAGACATGGAGAAAATCTGGCAC SEQ ID NO: 133 TGAACCCCAAGGCCAACCGTGGGGTGTTGAAGGTCTCA SEQ ID NO: 134 GCAGCTCATTGTAGAAGGTGTG

Detection of the LAMP amplified products can be achieved via a variety of methods. In a preferred embodiment, detection of product is conducted by adding a fluorescently-labeled probe to the primer mix. The term used herein “probe” refers to a single-stranded nucleic acid molecule comprising a portion or portions that are complementary, or substantially complementary, to a target sequence. In certain implementations, the fluorescently-labeled probe is a molecular beacon.

As used herein, “molecular beacon” refers to a single stranded hairpin-shaped oligonucleotide probe designed to report the presence of specific nucleic acids in a solution. A molecular beacon consists of four components; a stem, hairpin loop, end labelled fluorophore and opposite end-labelled quencher (Tyagi et al., (1998) Nature Biotechnology 16:49-53). When the hairpin-like beacon is not bound to a target, the fluorophore and quencher lie close together and fluorescence is suppressed. In the presence of a complementary target nucleotide sequence, the stem of the beacon opens to hybridize to the target. This separates the fluorophore and quencher, allowing the fluorophore to fluoresce. Alternatively, molecular beacons also include fluorophores that emit in the proximity of an end-labelled donor. “Wavelength-shifting Molecular Beacons” incorporate an additional harvester fluorophore enabling the fluorophore to emit more strongly. Current reviews of molecular beacons include Wang et al., 2009, Angew Chem Int Ed Engl, 48(5):856-870; Cissell et al., 2009, Anal Bioanal Chem 393(1):125-35; Li et al., 2008, Biochem Biophys Res Comm 373(4):457-61; and Cady, 2009, Methods Mol Biol 554:367-79.

In one implementation, the molecular beacon comprises a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184. In one embodiment, the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184. In another embodiment, the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

The molecular beacon is preferably used in a composition also comprising a set of sequence-specific LAMP primers. In one implementation, the molecular beacon comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184. In such an implementation, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184. More preferably, polynucleotide sequence of the molecular beacon consists of a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184. In a particularly preferred implementation, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 184.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Sets-9-12, Set-17, and Sets-22-29, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 9-46 of SEQ ID NO: 183, and nucleotides 8-40 of SEQ ID NO: 184. More particularly, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 183, and SEQ ID NO: 184. In certain implementations, the sequence of the molecular beacon is selected from the group consisting of SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 183, and SEQ ID NO: 184.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Sets 9-11, Set-17, and Sets 23-29, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, and nucleotides 1-23 of SEQ ID NO: 154. In certain implementations, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 152, SEQ ID NO: 153, and SEQ ID NO: 154. In some embodiments, the sequence of the molecular beacon is selected from the group consisting of SEQ ID NO: 152, SEQ ID NO: 153, and SEQ ID NO: 154.

When used in combination with a set of polynucleotides selected from the group consisting of Set-4, Sets 9-12, Set-17, and Sets 22-26, the molecular beacon preferably comprises a sequence selected from the group consisting of 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, and nucleotides 8-30 of SEQ ID NO: 146. In some embodiments, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 144, SEQ ID NO: 145, and SEQ ID NO: 146. In other embodiments, the sequence of the molecular beacon is selected from the group consisting of SEQ ID NO: 144, SEQ ID NO: 145, and SEQ ID NO: 146.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Set-5, Set-12, Set-17, and Sets 22-25, the molecular beacon preferably comprises nucleotides 3-22 of SEQ ID NO: 170. In some implementations, the molecular beacon comprises SEQ ID NO: 170. In other embodiments, the sequence of the molecular beacon is SEQ ID NO: 170.

When used in combination with a set of polynucleotides selected from the group consisting of Sets 6-8, Set-15, and Set-16, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 2-27 of SEQ ID NO: 180 and nucleotides 3-30 of SEQ ID NO: 182. In such an embodiment, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 180 and SEQ ID NO: 182. In another embodiment, the sequence of the molecular beacon is SEQ ID NO: 180 or SEQ ID NO: 182.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Sets 6-11, Set-28, and Set-29, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 4-34 of SEQ ID NO: 178 and nucleotides 5-33 of SEQ ID NO: 181. In some embodiments, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 178 and SEQ ID NO: 181. In other embodiments, the sequence of the molecular beacon is SEQ ID NO: 178 or SEQ ID NO: 181.

When used in combination with a set of polynucleotides selected from the group consisting of Sets 6-9 and Set-11, the molecular beacon preferably comprises nucleotides 3-27 of SEQ ID NO: 179. In some implementations, the molecular beacon comprises SEQ ID NO: 179. In other embodiments, the sequence of the molecular beacon is SEQ ID NO: 179.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Sets 6-9, Set-11, and Set-28, the molecular beacon preferably comprises nucleotides 4-23 of SEQ ID NO: 177. In some embodiments, the molecular beacon comprises SEQ ID NO: 177. In other embodiments, the sequence of the molecular beacon is SEQ ID NO: 177.

When used in combination with a set of polynucleotides selected from the group consisting of Sets 13-15, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 7-25 of SEQ ID NO: 159 and nucleotides 8-22 of SEQ ID NO: 160. In such an embodiment, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 159 and SEQ ID NO: 160. In other embodiments, the sequence of the molecular beacon is SEQ ID NO: 159 or SEQ ID NO: 160.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Sets 13-16, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 6-22 of SEQ ID NO: 161, and nucleotides 3-22 of SEQ ID NO: 162. More particularly, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 161, and SEQ ID NO: 162. In certain implementations, the sequence of the molecular beacon is selected from the group consisting of SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 161, and SEQ ID NO: 162.

When used in combination with a set of polynucleotides consisting of Set-3, the molecular beacon preferably comprises a sequence selected from the group consisting nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 151, and nucleotides 4-24 of SEQ ID NO: 153. In certain implementations, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 151, and SEQ ID NO: 153. In some embodiments, the sequence of the molecular beacon is selected from the group consisting of SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 151, and SEQ ID NO: 153.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Set-1, Set-2, and Sets 18-20, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 8-28 of SEQ ID NO: 163 and nucleotides 3-28 of SEQ ID NO: 164. In certain implementations, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 163 and SEQ ID NO: 164. In some embodiments, the sequence of the molecular beacon is SEQ ID NO: 163 or SEQ ID NO: 164.

When included in a composition comprising a set of polynucleotides selected from the group consisting of Set-1, Set-2 and Sets 18-21, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135 and nucleotides 6-30 of SEQ ID NO: 136. In some implementations, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 135 and SEQ ID NO: 136. In other embodiments, the sequence of the molecular beacon is SEQ ID NO: 135 or SEQ ID NO: 136. The polynucleotides having the sequences described above can include one or more non-natural nucleosides or linkages, such as peptide nucleic acid (PNA), morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid (TNA), among others. In some embodiments, the polynucleotide of the molecular beacon comprises one to six locked nucleic acids. In a preferred embodiment, the polynucleotide of the molecular beacon comprises three or four locked nucleic acids.

The term “label” as used herein means a molecule or moiety having a property or characteristic which is capable of detection and, optionally, of quantitation. A label can be directly detectable, as with, for example (and without limitation), radioisotopes, fluorophores, chemiluminophores, enzymes, colloidal particles, fluorescent microparticles and the like; or a label may be indirectly detectable, as with, for example, specific binding members. It will be understood that directly detectable labels may require additional components such as, for example, substrates, triggering reagents, quenching moieties, light, and the like to enable detection and/or quantitation of the label. When indirectly detectable labels are used, they are typically used in combination with a “conjugate”. A conjugate is typically a specific binding member that has been attached or coupled to a directly detectable label. Coupling chemistries for synthesizing a conjugate are well known in the art and can include, for example, any chemical means and/or physical means that does not destroy the specific binding property of the specific binding member or the detectable property of the label. As used herein, “specific binding member” means a member of a binding pair, i.e., two different molecules where one of the molecules through, for example, chemical or physical means specifically binds to the other molecule. In addition to antigen and antibody specific binding pairs, other specific binding pairs include, but are not intended to be limited to, avidin and biotin; haptens and antibodies specific for haptens; complementary nucleotide sequences; enzyme cofactors or substrates and enzymes; and the like.

The molecular beacon can be composed of nucleic acid only such as DNA or RNA, or it can be composed of a peptide nucleic acid (PNA) conjugate. The fluorophore can be any fluorescent organic dye or a single quantum dot. The quenching moiety desirably quenches the luminescence of the fluorophore. Any suitable quenching moiety that quenches the luminescence of the fluorophore can be used. A fluorophore can be any fluorescent marker/dye known in the art. Examples of suitable fluorescent markers include, but are not limited to, Fam, Hex, Tet, Joe, Rox, Tamra, Max, Edans, Cy dyes such as Cy5, Fluorescein, Coumarin, Eosine, Rhodamine, Bodipy, Alexa, Cascade Blue, Yakima Yellow, Lucifer Yellow, Texas Red, and the family of ATTO dyes. A quencher can be any quencher known in the art. Examples of quenchers include, but are not limited to, Dabcyl, Dark Quencher, Eclipse Dark Quencher, ElleQuencher, Tamra, BHQ and QSY (all of them are Trade-Marks). The skilled person would know which combinations of dye/quencher are suitable when designing a probe. In an exemplary embodiment, fluorescein (FAM) is used in conjunction with Blackhole Quencher™ (BHQ™) (Novato, Calif.). Binding of the molecular beacon to amplified product can then be directly, visually assessed. Alternatively, the fluorescence level can be measured by spectroscopy in order to improve sensitivity.

A variety of commercial suppliers produce standard and custom molecular beacons, including Abingdon Health (UK; www.abingdonhealth.com), Attostar (US, MN; www.attostar.com), Biolegio (NLD; www.biolegio.com), Biomers.net (DEU; www.biomers.net), Biosearch Technologies (US, CA; www.biosearchtech.com), Eurogentec (BEL; www.eurogentec.com), Gene Link (US, NY; www.genelink.com) Integrated DNA Technologies (US, IA; www.idtdna.com), Isogen Life Science (NLD; www.isogen-lifescience.com), Midland Certified Reagent (US, TX; www.oligos.com), Eurofins (DEU; www.eurofinsgenomics.eu), Sigma-Aldrich (US, TX; www.sigmaaldrich.com), Thermo Scientific (US, MA; www.thermoscientific.com), TIB MOLBIOL (DEU; www.tib-molbiol.de), TriLink Bio Technologies (US, CA; www.trilinkbiotech.com). A variety of kits, which utilize molecular beacons are also commercially available, such as the Sentinel™ Molecular Beacon Allelic Discrimination Kits from Stratagene (La Jolla, Calif.) and various kits from Eurogentec SA (Belgium, eurogentec.com) and Isogen Bioscience BV (The Netherlands, isogen.com).

The oligonucleotide probes and primers of the invention are optionally prepared using essentially any technique known in the art. In certain embodiments, for example, the oligonucleotide probes and primers described herein are synthesized chemically using essentially any nucleic acid synthesis method, including, e.g., according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981), Tetrahedron Letts. 22(20):1859-1862, which is incorporated by reference, or another synthesis technique known in the art, e.g., using an automated synthesizer, as described in Needham-VanDevanter et al. (1984) Nucleic Acids Res. 12:6159-6168, which is incorporated by reference. A wide variety of equipment is commercially available for automated oligonucleotide synthesis. Multi-nucleotide synthesis approaches (e.g., tri-nucleotide synthesis, etc.) are also optionally utilized. Moreover, the primer nucleic acids described herein optionally include various modifications. To further illustrate, primers are also optionally modified to improve the specificity of amplification reactions as described in, e.g., U.S. Pat. No. 6,001,611, issued Dec. 14, 1999, which is incorporated by reference. Primers and probes can also be synthesized with various other modifications as described herein or as otherwise known in the art.

In addition, essentially any nucleic acid (and virtually any labeled nucleic acid, whether standard or non-standard) can be custom or standard ordered from any of a variety of commercial sources, such as Integrated DNA Technologies, the Midland Certified Reagent Company, Eurofins, Biosearch Technologies, Sigma Aldrich and many others.

The term “test sample” as used herein, means a sample taken from an organism or biological fluid that is suspected of containing or potentially contains a target sequence. The test sample can be taken from any biological source, such as for example, tissue, blood, saliva, sputa, mucus, sweat, urine, urethral swabs, cervical swabs, vaginal swabs, urogenital or anal swabs, conjunctival swabs, ocular lens fluid, cerebral spinal fluid, milk, ascites fluid, synovial fluid, peritoneal fluid, amniotic fluid, fermentation broths, cell cultures, chemical reaction mixtures and the like. The test sample can be used (i) directly as obtained from the source or (ii) following a pre-treatment to modify the character of the sample. Thus, the test sample can be pre-treated prior to use by, for example, preparing plasma or serum from blood, disrupting cells or viral particles, preparing liquids from solid materials, diluting viscous fluids, filtering liquids, distilling liquids, concentrating liquids, inactivating interfering components, adding reagents, purifying nucleic acids, and the like.

Advantageously, the invention enables reliable rapid detection of β-actin in a clinical sample, such as a urine sample.

To further illustrate, prior to analyzing the target nucleic acids described herein, those nucleic acids may be purified or isolated from samples that typically include complex mixtures of different components. Cells in collected samples are typically lysed to release the cell contents, including target nucleic acids. For example, a test sample suspected of containing a sexually transmitted infection (STI), including, but not limited to, Chlamydia trachomatis (CT), Neisseria gonorrhea (NG) and Trichomonas vaginalis (TV), can be lysed by contacting cells with various enzymes, chemicals, and/or lysed by other approaches known in the art, which degrade, e.g., bacterial cell walls. In some embodiments, nucleic acids are analyzed directly in the cell lysate. In other embodiments, nucleic acids are further purified or extracted from cell lysates prior to detection. Essentially any nucleic acid extraction methods can be used to purify nucleic acids in the samples utilized in the methods of the present invention. Exemplary techniques that can be used to purifying nucleic acids include, e.g., affinity chromatography, hybridization to probes immobilized on solid supports, liquid-liquid extraction (e.g., phenol-chloroform extraction, etc.), precipitation (e.g., using ethanol, etc.), extraction with filter paper, extraction with micelle-forming reagents (e.g., cetyl-trimethyl-ammonium-bromide, etc.), binding to immobilized intercalating dyes (e.g., ethidium bromide, acridine, etc.), adsorption to silica gel or diatomic earths, adsorption to magnetic glass particles or organo silane particles under chaotropic conditions, and/or the like. Sample processing is also described in, e.g., U.S. Pat. Nos. 5,155,018, 6,383,393, and 5,234,809, which are each incorporated by reference.

A test sample may optionally have been treated and/or purified according to any technique known by the skilled person, to improve the amplification efficiency and/or qualitative accuracy and/or quantitative accuracy. The sample may thus exclusively, or essentially, consist of nucleic acid(s), whether obtained by purification, isolation, or by chemical synthesis. Means are available to the skilled person, who would like to isolate or purify nucleic acids, such as DNA, from a test sample, for example to isolate or purify DNA from cervical scrapes (e.g., QIAamp-DNA Mini-Kit; Qiagen, Hilden, Germany).

Equivalents and Scope

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims.

In the claims, articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

It is also noted that the term “comprising” is intended to be open and permits but does not require the inclusion of additional elements or steps. When the term “comprising” is used herein, the term “consisting of” is thus also encompassed and disclosed.

Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

All cited sources, for example, references, publications, databases, database entries, and art cited herein, are incorporated into this application by reference, even if not expressly stated in the citation. In case of conflicting statements of a cited source and the instant application, the statement in the instant application shall control.

Section and table headings are not intended to be limiting.

EXAMPLES

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.

Example 1: Target Selection and Primer Probe Design

Primer/probe based detection assays were designed to utilize isothermal loop mediated amplification (LAMP) targeting RNA through the addition of a Reverse transcriptase (RT-LAMP) to the reaction. A molecular beacon probe with 5′ fluorophore/3′ quencher modifications (6-Carboxyfluorescein and Black Hole Quencher 1 was included to provide target-specific fluorescent detection. β-actin RT-LAMP primer sets (Table 1 and Table 2) were designed using a combination of software programs including Premier Biosoft's LAMP Designer, Beacon Designer, an in-house script and manual designs. Designed primer sets and beacons were further analyzed for specificity using BLAST against the human genome and the NCBI nucleotide database. Various primer sets and probes were designed and screened for reaction speed.

The inventive primer sets are summarized in Table 2, which include, at a minimum, a forward inner primer (FIP) and backward inner primer (BIP). Additionally, the primer sets typically also include at least two additional primers selected from the forward outer primer (F3), backward outer primer (B3), forward loop primer (LF) and backward loop primer (LB).

TABLE 2 LAMP Primer Sets Set F3 B3 FIP BIP LF LB Set-1 SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4 SEQ ID NO: 5 SEQ ID NO: 6 Set-2 SEQ ID NO: 7 SEQ ID NO: 8 SEQ ID NO: 9 SEQ ID NO: 10 SEQ ID NO: 11 SEQ ID NO: 12 Set-3 SEQ ID NO: 13 SEQ ID NO: 14 SEQ ID NO: 15 SEQ ID NO: 16 SEQ ID NO: 17 SEQ ID NO: 18 Set-4 SEQ ID NO: 19 SEQ ID NO: 20 SEQ ID NO: 21 SEQ ID NO: 22 SEQ ID NO: 23 SEQ ID NO: 24 Set-5 SEQ ID NO: 25 SEQ ID NO: 26 SEQ ID NO: 27 SEQ ID NO: 28 SEQ ID NO: 29 SEQ ID NO: 30 Set-6 SEQ ID NO: 31 SEQ ID NO: 32 SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 Set-7 SEQ ID NO: 37 SEQ ID NO: 38 SEQ ID NO: 39 SEQ ID NO: 40 SEQ ID NO: 41 SEQ ID NO: 42 Set-8 SEQ ID NO: 43 SEQ ID NO: 38 SEQ ID NO: 44 SEQ ID NO: 45 SEQ ID NO: 46 SEQ ID NO: 42 Set-9 SEQ ID NO: 47 SEQ ID NO: 48 SEQ ID NO: 49 SEQ ID NO: 50 SEQ ID NO: 51 SEQ ID NO: 52 Set-10 SEQ ID NO: 53 SEQ ID NO: 48 SEQ ID NO: 54 SEQ ID NO: 50 SEQ ID NO: 51 SEQ ID NO: 52 Set-11 SEQ ID NO: 55 SEQ ID NO: 48 SEQ ID NO: 56 SEQ ID NO: 50 SEQ ID NO: 57 SEQ ID NO: 52 Set-12 SEQ ID NO: 58 SEQ ID NO: 59 SEQ ID NO: 60 SEQ ID NO: 61 SEQ ID NO: 62 SEQ ID NO: 63 Set-13 SEQ ID NO: 64 SEQ ID NO: 65 SEQ ID NO: 66 SEQ ID NO: 67 SEQ ID NO: 68 SEQ ID NO: 69 Set-14 SEQ ID NO: 70 SEQ ID NO: 65 SEQ ID NO: 71 SEQ ID NO: 67 SEQ ID NO: 72 SEQ ID NO: 69 Set-15 SEQ ID NO: 70 SEQ ID NO: 73 SEQ ID NO: 74 SEQ ID NO: 75 SEQ ID NO: 76 SEQ ID NO: 77 Set-16 SEQ ID NO: 78 SEQ ID NO: 73 SEQ ID NO: 79 SEQ ID NO: 80 SEQ ID NO: 81 SEQ ID NO: 82 Set-17 SEQ ID NO: 83 SEQ ID NO: 84 SEQ ID NO: 85 SEQ ID NO: 86 SEQ ID NO: 87 SEQ ID NO: 88 Set-18 SEQ ID NO: 89 SEQ ID NO: 90 SEQ ID NO: 91 SEQ ID NO: 92 SEQ ID NO: 93 SEQ ID NO: 94 Set-19 SEQ ID NO: 95 SEQ ID NO: 96 SEQ ID NO: 97 SEQ ID NO: 98 SEQ ID NO: 93 SEQ ID NO: 99 Set-20 SEQ ID NO: 89 SEQ ID NO: 100 SEQ ID NO: 101 SEQ ID NO: 102 SEQ ID NO: 103 SEQ ID NO: 104 Set-21 SEQ ID NO: 89 SEQ ID NO: 100 SEQ ID NO: 101 SEQ ID NO: 105 SEQ ID NO: 103 SEQ ID NO: 104 Set-22 SEQ ID NO: 58 SEQ ID NO: 59 SEQ ID NO: 106 SEQ ID NO: 61 SEQ ID NO: 62 SEQ ID NO: 63 Set-23 SEQ ID NO: 107 SEQ ID NO: 59 SEQ ID NO: 108 SEQ ID NO: 61 SEQ ID NO: 109 SEQ ID NO: 63 Set-24 SEQ ID NO: 107 SEQ ID NO: 59 SEQ ID NO: 110 SEQ ID NO: 61 SEQ ID NO: 109 SEQ ID NO: 63 Set-25 SEQ ID NO: 111 SEQ ID NO: 59 SEQ ID NO 112 SEQ ID NO: 61 SEQ ID NO: 109 SEQ ID NO: 63 Set-26 SEQ ID NO: 113 SEQ ID NO: 114 SEQ ID NO: 115 SEQ ID NO: 116 SEQ ID NO: 117 SEQ ID NO: 118 Set-27 SEQ ID NO: 119 SEQ ID NO: 120 SEQ ID NO: 121 SEQ ID NO: 122 SEQ ID NO: 123 SEQ ID NO: 124 Set-28 SEQ ID NO: 125 SEQ ID NO: 126 SEQ ID NO: 127 SEQ ID NO: 128 SEQ ID NO: 129 SEQ ID NO: 130 Set-29 SEQ ID NO: 131 SEQ ID NO: 126 SEQ ID NO: 132 SEQ ID NO: 133 SEQ ID NO: 134 SEQ ID NO: 130

Typically, 3 to 5 μL of nucleic acid extracted from a human urine sample or from buffer spiked with in-house in vitro transcribed HsActB RNA or negative controls (NTC=nuclease free water or Tris buffer, no template control) served as template for RTLAMP reactions. 10-25 μl total volume reactions were prepared on ice as mixes containing formulations including 1× amplification buffer comprising 10-40 mM Tris-HCl, 0-0.5% Tween 20, 0-300 mM Trehalose, 5-70 mM KCl, 4-41 mM MgSO4, 10-20 mM (NH4)2SO4, 0-2 mM TCEP and 1.6-2 mM each dCTP, dGTP, dATP and dTTP. NEB Bst2 polymerase (NEB CN #M0537L) and RTx Warmstart reverse transcriptase (NEB CN #M0380S) enzymes. Primers (2 μM inner primers, 0.2 μM outer primers, and 0.8 μM Loop primers) were added to individual reactions or directly to master mixes as required per experimental design. Molecular beacons (0.2 μM) or 200 nM Yo-Pro-1, Yo-Pro-3 or To-Pro dye was also added to the master mix, as indicated in the examples below. Amplification reactions were prepared with the standard 6-primer. Master mixes were distributed to individual sample templates, vortexed and centrifuged briefly and each reaction loaded into individual wells of a 96 or 384 well plate (Roche CN #4729692001 or BioRad CNhsI9605). Reactions were carried out at temperatures ranging from 60-67° C. and fluorescence monitored on either a Roche LightCycler 96 Real-Time PCR instrument or a BioRad CFX96 real time cycler. Target amplification was monitored via intercalating dye or molecular beacon probe binding to target resulting in release of molecular beacon fluorescence intramolecular quenching.

Example 2: LAMP with Dye Detection

A negative urine matrix that naturally contains endogenous human B-actin was extracted using standard extraction methods and the sample was amplified using LAMP primers (as described in Table 2). YoPro™ dye or a compatible wavelength version within the same dye set family (Life Technologies; green fluorescent carbocyanine nucleic acid stain) was used for the detection of the amplified product. The master mix was prepared as described in Example 1. Results are summarized in Table 3, in which the Time to Positive (Tp) was calculated using an in house developed algorithm.

TABLE 3 Time to Positive Dye Detection Primer Set Urine NTC Set-1  7.95 16.3 Set-2  5.41 negative Set-3  7.95 19.6 Set-4  7.81 negative Set-5  negative negative Set-6  4.51 negative Set-7  7.25 negative Set-8  4.43 negative Set-9  13.04 negative Set-10 11.9 negative Set-11 13.32 negative Set-12 5.42 negative Set-13 9.79 negative Set-14 11.9 negative Set-15 11.91 negative Set-16 15.87 negative Set-17 negative negative Set-18 8.8 negative Set-19 negative negative Set-20 negative negative Set-21 11.86 negative Set-22 6.54 27.88 Set-23 6.47 24.16 Set-24 6.435 28.82 Set-25 5.28 25.63 Set-26 13.31 negative Set-27 negative negative Set-28 7.25 negative Set-29 6.05 negative

Example 3: Molecular Beacon Detection

To provide an additional level of direct sequence based detection of amplified product (as opposed to indirect dye detection), molecular beacons (MB1-50) targeting unique nucleotides within the β-actin amplicon of primer sets with promising Tp's combined with sensitivity, were designed (SEQ ID NOs: 135-184) and utilized for detection of amplification from nucleic acid extracted from live bacteria (Table 4). The molecular beacon probe was designed with 5′ fluorophore/3′ quencher modifications (6-Carboxyfluorescein (FAM)) and Black Hole Quencher 1 (BHQ1) included to provide target-specific fluorescent detection. Molecular Beacons MB49 and MB50 (SEQ ID NOs: 183 & 184) include LNA nucleotides as indicated by “[+X]”, where X indicates the identity of the nucleobase.

TABLE 4 Probe Sequences ID Fluor Quench Sequence (5' to 3') Sequence ID MB1 FAM BHQ1 CGCGTGCACTCTTCCAGCCTTCCTTCCTGGGCACGCG SEQ ID NO: 135 MB2 FAM BHQ1 CGCGTGGCATGGAGTCCTGTGGCATCCACGCG SEQ ID NO: 136 MB3 FAM BHQ1 CGCGATCGATCGGCGGCTCCATCCTGGATCGCG SEQ ID NO: 137 MB4 FAM BHQ1 CGACCAGGATCGGCGGCTCCATCCTGCTGGTCG SEQ ID NO: 138 MB5 FAM BHQ1 CCGTGTGGATCGGCGGCTCCATCCTGCACACGG SEQ ID NO: 139 MB6 FAM BHQ1 CCGATGGGATCGGCGGCTCCATCCTGCCATCGG SEQ ID NO: 140 MB7 FAM BHQ1 CGCGATCAGATGTGGATCAGCAAGCAGGAGGATCGCG SEQ ID NO: 141 MB8 FAM BHQ1 CGTACGCAGATGTGGATCAGCAAGCAGGAGGCGTACG SEQ ID NO: 142 MB9 FAM BHQ1 CGGCCTAAGATGTGGATCAGCAAGCAGGAGTAGGCCG SEQ ID NO: 143 MB10 FAM BHQ1 CGCGATCTACCACTGGCATCGTGATGGACTGATCGCG SEQ ID NO: 144 MB11 FAM BHQ1 CCGCTCGTACCACTGGCATCGTGATGGACTCGAGCGG SEQ ID NO: 145 MB12 FAM BHQ1 CCGCGGATACCACTGGCATCGTGATGGACTTCCGCGG SEQ ID NO: 146 MB13 FAM BHQ1 CGTCCAGCCAGATCATGTTTGACTGGACG SEQ ID NO: 147 MB14 FAM BHQ1 CGTCCAGAGATCATGTTTGAGACCCTGGACG SEQ ID NO: 148 MB15 FAM BHQ1 CGAGGTCCCAGATCATGTTTGAGACCTCG SEQ ID NO: 149 MB16 FAM BHQ1 CGCTGAGTCATGTTTGAGACCCTCAGCG SEQ ID NO: 150 MB17 FAM BHQ1 CGCGATCGTCCACCTTCCAGCAGATGTGGATCGCG SEQ ID NO: 151 MB18 FAM BHQ1 CCGCGAGAAGATGACCCAGATCATCTCGCGG SEQ ID NO: 152 MB19 FAM BHQ1 CCTCGAGAAGATGACCCAGATCATCTCGAGG SEQ ID NO: 153 MB20 FAM BHQ1 CCGCGAGAAGATGACCCAGATCACTCGCGG SEQ ID NO: 154 MB21 FAM BHQ1 CGCGATCGACCCAGATCATGTTTGAGGATCGCG SEQ ID NO: 155 MB22 FAM BHQ1 CGTCGGTGACCCAGATCATGTTTGAGACCGACG SEQ ID NO: 156 MB23 FAM BHQ1 CGCGATCACATGCCGGAGCCGTTGTCGAGATCGCG SEQ ID NO: 157 MB24 FAM BHQ1 CCGATGGACATGCCGGAGCCGTTGTCGACCATCGG SEQ ID NO: 158 MB25 FAM BHQ1 CGCGATCCGCCAGCTCACCATGGATCGCG SEQ ID NO: 159 MB26 FAM BHQ1 CAGGTCTCGCCAGCTCACCATGAGACCTG SEQ ID NO: 160 MB27 FAM BHQ1 CGCGATCTTCCCCTCCATCGTGATCGCG SEQ ID NO: 161 MB28 FAM BHQ1 CACCGTCTTCCCCTCCATCGTGACGGTG SEQ ID NO: 162 MB29 FAM BHQ1 CGCGATCCCTGTGGCATCCACGAAACTAGATCGCG SEQ ID NO: 163 MB30 FAM BHQ1 CCGGAGTCCTGTGGCATCCACGAAACTAACTCCGG SEQ ID NO: 164 MB31 FAM BHQ1 CCGCGAAGATGACCCAGATCATGTTCGCGG SEQ ID NO: 165 MB32 FAM BHQ1 CCGCGAAGATGACCCAGATCATGTTTCGCGG SEQ ID NO: 166 MB33 FAM BHQ1 CGGCGATGACCCAGATCATGATCGCCG SEQ ID NO: 167 MB34 FAM BHQ1 CGCGAAGATGACCCAGATCATGCTTCGCG SEQ ID NO: 168 MB35 FAM BHQ1 CAAGCCGATGACCCAGATCATGCGGCTTG SEQ ID NO: 169 MB36 FAM BHQ1 CCGATGGACTCCGGTGACGGGGCCATCGG SEQ ID NO: 170 MB37 FAM BHQ1 CGTCGGTGACCCAGATCATGTTTGAGACACCGACG SEQ ID NO: 171 MB38 FAM BHQ1 CGGCCTGACCCAGATCATGTTTGAGACAGGCCG SEQ ID NO: 172 MB39 FAM BHQ1 CGGCGGTGACCCAGATCATGTTTGAGACCGCCG SEQ ID NO: 173 MB40 FAM BHQ1 CGGCGATGACCCAGATCATGTTTGAGATCGCCG SEQ ID NO: 174 MB41 FAM BHQ1 CAGCGGTGACCCAGATCATGTTTGAGACCGCTG SEQ ID NO: 175 MB42 FAM BHQ1 CGCGGTGACCCAGATCATGTTTGAGACCCACCGCG SEQ ID NO: 176 MB43 FAM BHQ1 CGGCACCAACTGGGACGACATGGGGTGCCG SEQ ID NO: 177 MB44 FAM BHQ1 CGGCACCAACTGGGACGACATGGAGAAAATCTGGTGCCG SEQ ID NO: 178 MB45 FAM BHQ1 CGACCCCATCGAGCACGGCATCGTCACGGGGTCG SEQ ID NO: 179 MB46 FAM BHQ1 CCATGGGTCAGAAGGATTCCTATGTGGCCCATGG SEQ ID NO: 180 MB47 FAM BHQ1 CGGCCGACATGGAGAAAATCTGGCACCACACCTCGGCCG SEQ ID NO: 181 MB48 FAM BHQ1 CCGGGTCAGAAGGATTCCTATGTGGGCGACCCGG SEQ ID NO: 182 MB49 FAM BHQ1 CACGGGTCGACC[+C]AGA[+T]CA[+T]GTT[+T] SEQ ID NO: 183 GAGACCCGTG MB50 FAM BHQ1 CACGCGTGACC[+C]AGA[+T]CA[+T]GTT[+T] SEQ ID NO: 184 GAGACGCGTG

10-25 μL total volume reactions were evaluated utilizing eluate from a negative urine matrix that contains naturally occurring endogenous human β-actin as template input according to the methods described in Examples 1 and 2. While use of a Molecular Beacon for detection resulted in a slight increase in reaction Tp, the ability to directly detect amplification products based on sequence, and thereby distinguish closely related species, provides a reasonable tradeoff.

TABLE 5 Time to Positive (Probe Detection) Primers Beacon Tp w/ beacon Tp for NTC Set-1  SEQ ID NO: 136 10.03 Set-2  SEQ ID NO: 135 10.42 Set-3  SEQ ID NO: 137 15.16 Set-3  SEQ ID NO: 138 14.70 Set-3  SEQ ID NO: 139 12.79 Set-3  SEQ ID NO: 140 10.91 Set-3  SEQ ID NO: 141 12.57 Set-3  SEQ ID NO: 142 13.38 Set-3  SEQ ID NO: 143 13.95 Set-3  SEQ ID NO: 151 11.13 Set-6  SEQ ID NO: 181 8.78 Set-6  SEQ ID NO: 182 8.90 Set-8  SEQ ID NO: 177 7.94 Set-8  SEQ ID NO: 178 7.68 Set-8  SEQ ID NO: 179 7.12 Set-8  SEQ ID NO: 180 8.47 Set-12 SEQ ID NO: 144 10.59 Set-12 SEQ ID NO: 145 8.34 Set-12 SEQ ID NO: 146 9.80 Set-12 SEQ ID NO: 147 13.00 Set-12 SEQ ID NO: 148 11.80 Set-12 SEQ ID NO: 149 11.16 Set-12 SEQ ID NO: 150 11.51 Set-13 SEQ ID NO: 157 11.25 50.07 Set-13 SEQ ID NO: 158 11.86 Set-13 SEQ ID NO: 159 16.05 Set-13 SEQ ID NO: 160 18.66 Set-13 SEQ ID NO: 161 17.28 27.26 Set-13 SEQ ID NO: 162 14.92 Set-18 SEQ ID NO: 163 10.62 42.32 Set-18 SEQ ID NO: 164 11.27 Set-22 SEQ ID NO: 144 10.45 36.48 Set-22 SEQ ID NO: 145 8.75 40.97 Set-22 SEQ ID NO: 146 9.81 Set-22 SEQ ID NO: 148 11.74 42.13 Set-22 SEQ ID NO: 152 11.78 Set-22 SEQ ID NO: 153 13.77 14.72 Set-22 SEQ ID NO: 154 13.68 47.92 Set-22 SEQ ID NO: 155 12.14 45.17 Set-22 SEQ ID NO: 156 12.19 Set-22 SEQ ID NO: 170 9.45 Set-25 SEQ ID NO: 144 11.55 42.02 Set-25 SEQ ID NO: 145 9.77 41.11 Set-25 SEQ ID NO: 146 10.34 Set-25 SEQ ID NO: 148 12.82 24.08 Set-25 SEQ ID NO: 152 12.18 Set-25 SEQ ID NO: 153 14.80 16.33 Set-25 SEQ ID NO: 154 14.39 Set-25 SEQ ID NO: 155 13.64 Set-25 SEQ ID NO: 156 8.99 Set-29 SEQ ID NO: 145 14.77 Set-29 SEQ ID NO: 152 10.48 17.81 Set-29 SEQ ID NO: 153 10.69 Set-29 SEQ ID NO: 154 10.02 Set-29 SEQ ID NO: 155 12.99 Set-29 SEQ ID NO: 156 7.69 Set-29 SEQ ID NO: 165 12.98 20.93 Set-29 SEQ ID NO: 166 9.76 Set-29 SEQ ID NO: 167 13.98 Set-29 SEQ ID NO: 168 14.26 Set-29 SEQ ID NO: 169 13.72 Set-29 SEQ ID NO: 171 8.63 25.44 Set-29 SEQ ID NO: 172 8.41 Set-29 SEQ ID NO: 173 7.37 Set-29 SEQ ID NO: 174 7.68 25.79 Set-29 SEQ ID NO: 175 7.80 Set-29 SEQ ID NO: 176 8.31 Set-29 SEQ ID NO: 183 9.89 Set-29 SEQ ID NO: 184 9.17

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications can be made thereto without departing from the spirit or scope of the appended claims. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims.

Claims

1. A composition comprising a set of polynucleotides selected from the group consisting of Set-1 through Set-29.

2. The composition of claim 1, further comprising a probe.

3. The composition of claim 2, wherein the probe comprises a label.

4. The composition of claim 3, wherein the probe is a labeled polynucleotide.

5. The composition of claim 4, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184.

6. The composition of claim 4, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

7. The composition of claim 4, wherein the label is a fluorophore.

8. The composition of claim 7, wherein the fluorophore is covalently attached to a terminus of the polynucleotide.

9. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184, and wherein the set of polynucleotides is selected from the group consisting of Sets 9-12, Set-17, and Sets 22-29.

10. The composition of claim 9, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 183, and SEQ ID NO: 184.

11. The composition of claim 10, wherein the sequence of the labeled polynucleotides is SEQ ID NO: 184, and the set of polynucleotides is Set-29.

12. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, and nucleotides 1-23 of SEQ ID NO: 154, and wherein the set of polynucleotides is selected from the group consisting of Sets 9-11, Set-17, and Sets 23-29.

13. The composition of claim 12, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 152, SEQ ID NO: 153, and SEQ ID NO: 154.

14. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, and nucleotides 8-30 of SEQ ID NO: 146, and wherein the set of polynucleotides is selected from the group consisting of Set-4, Sets 9-12, Set-17, and Sets 22-26.

15. The composition of claim 14, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 144, SEQ ID NO: 145, and SEQ ID NO: 146.

16. The composition of claim 1, further comprising a labeled polynucleotide comprising nucleotides 3-22 of SEQ ID NO: 170, and wherein the set of polynucleotides is selected from the group consisting of Set-5, Set-12, Set-17, and Sets 22-25.

17. The composition of claim 16, wherein the labeled polynucleotide comprises SEQ ID NO: 170.

18. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 2-27 of SEQ ID NO: 180 and nucleotides 3-30 of SEQ ID NO: 182, and wherein the set of polynucleotides is selected from the group consisting of Sets 6-8, Set-15, and Set-16.

19. The composition of claim 18, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 180 and SEQ ID NO: 182.

20. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 4-34 of SEQ ID NO: 178 and nucleotides 5-33 of SEQ ID NO: 181, and wherein the set of polynucleotides is selected from the group consisting of Sets 6-11 and Sets 28-29.

21. The composition of claim 20, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 178 and SEQ ID NO: 181.

22. The composition of claim 1, further comprising a labeled polynucleotide comprising nucleotides 3-27 of SEQ ID NO: 179, and wherein the set of polynucleotides is selected from the group consisting of Sets 6-9 and Set-11.

23. The composition of claim 22, wherein the labeled polynucleotide comprises SEQ ID NO: 179.

24. The composition of claim 1, further comprising a labeled polynucleotide comprising nucleotides 4-23 of SEQ ID NO: 177, and wherein the set of polynucleotides is selected from the group consisting of Sets 6-9, Set-11, and Set-28.

25. The composition of claim 24, wherein the labeled polynucleotide comprises SEQ ID NO: 177.

26. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 7-25 of SEQ ID NO: 159 and nucleotides 8-22 of SEQ ID NO: 160, and wherein the set of polynucleotides is selected from the group consisting of Sets 13-15.

27. The composition of claim 26, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 159 and SEQ ID NO: 160.

28. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 6-22 of SEQ ID NO: 161, and nucleotides 3-22 of SEQ ID NO: 162, and wherein the set of polynucleotides is selected from the group consisting of Sets 13-16.

29. The composition of claim 28, wherein the labeled polynucleotide comprises a sequence from the group consisting of SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 161, and SEQ ID NO: 162.

30. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group of nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 151, and nucleotides 4-24 of SEQ ID NO: 153, and wherein the set of polynucleotides is Set-3.

31. The composition of claim 30, wherein the labeled polynucleotide comprises a sequence from the group consisting of SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 151, and SEQ ID NO: 153.

32. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-28 of SEQ ID NO: 163 and nucleotides 3-28 of SEQ ID NO: 164, and wherein the set of polynucleotides is selected from the group consisting of Set-1, Set-2, and Sets 18-20.

33. The composition of claim 32, wherein the labeled polynucleotide comprises a sequence from the group consisting of SEQ ID NO: 163 and SEQ ID NO: 164.

34. The composition of claim 1, further comprising a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135 and nucleotides 6-30 of SEQ ID NO: 136, and wherein the set of polynucleotides is selected from the group consisting of Set-1, Set-2 and Sets 18-21.

35. The composition of claim 34, wherein the labeled polynucleotide comprises a sequence from the group consisting of SEQ ID NO: 135 and SEQ ID NO: 136.

36. The composition of claim 2, wherein the probe is a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide.

37. The composition of claim 36, wherein the molecular beacon comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184.

38. The composition of claim 37, wherein the molecular beacon comprises a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

39. The composition of claim 38, wherein the polynucleotide sequence consists of SEQ ID NO: 184.

40. A molecular beacon comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184.

41. The molecular beacon of claim 40, wherein the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

42. The molecular beacon of claim 41, wherein the polynucleotide consists a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

43. The molecular beacon of claim 40, wherein the fluorophore is FAM and the quencher is BHQ1.

44. The molecular beacon of claim 40, wherein the fluorophore is ATTO 565 or Alexa 594 and the quencher is BHQ1 or BHQ2.

45. A method of detecting β-actin in a test sample, the method comprising:

(a) extracting nucleic acid from the test sample;
(b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand displacement DNA polymerase and a sequence specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 through Set-29; and
(c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of β-actin in the test sample.

46. The method of claim 45, wherein the amplification in step (b) of the target sequence is performed between about 60° C. and about 67° C. for less than 30 minutes.

47. The method of claim 46, wherein the amplification step is performed for less than fifteen minutes.

48. The method of claim 47, wherein the amplification step is performed for less than twelve minutes.

49. The method of claim 48, wherein the amplification step is performed for less than nine minutes.

50. The method of claim 45, wherein the reaction mixture further comprises a reverse transcriptase.

51. The method of claim 45, wherein detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a probe comprising a polynucleotide attached to a label.

52. The method of claim 51, wherein the label is a fluorophore.

53. The method of claim 52, wherein the fluorophore is covalently attached to a terminus of the polynucleotide.

54. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184.

55. The method of claim 54, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

56. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184, and wherein the sequence specific primer set is selected from the group consisting of Sets 9-12, Set-17, and Sets 22-29.

57. The method of claim 56, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 183, SEQ ID NO: 184.

58. The method of claim 57, wherein the sequence of the labeled polynucleotide is SEQ ID NO: 184, and the sequence-specific primer set is Set-29.

59. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, and wherein the sequence-specific primer set is selected from the group consisting of Sets 9-11, Set-17, and Sets 23-29.

60. The method of claim 59, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 152, SEQ ID NO: 153, and SEQ ID NO: 154.

61. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, and nucleotides 8-30 of SEQ ID NO: 146, and wherein the sequence-specific primer set is selected from the group consisting of Set-4, Sets 9-12, Set-17, and Sets 22-26.

62. The method of claim 61, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 144, SEQ ID NO: 145, and SEQ ID NO: 146.

63. The method of claim 51, wherein the labeled polynucleotide comprises nucleotides 3-22 of SEQ ID NO: 170, and wherein the sequence-specific primer set is selected from the group consisting of Set-5, Set-12, Set-17, and Sets 22-25.

64. The method of claim 63, wherein the labeled polynucleotide comprises SEQ ID NO: 170.

65. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 2-27 of SEQ ID NO: 180 and nucleotides 3-30 of SEQ ID NO: 182, and wherein the sequence-specific set is selected from the group consisting of Sets 6-8, Set-15, and Set-16.

66. The method of claim 65, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 180 and SEQ ID NO: 182.

67. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 4-34 of SEQ ID NO: 178 and nucleotides 5-33 of SEQ ID NO: 181, and wherein the sequence-specific primer set is selected from the group consisting of Sets 6-11 and Sets 28-29.

68. The method of claim 67, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 178 and SEQ ID NO: 181.

69. The method of claim 51, wherein the labeled polynucleotide comprises nucleotides 3-27 of SEQ ID NO: 179, and wherein the sequence-specific primer set is selected from the group consisting of Sets 6-9 and Set-11.

70. The method of claim 69, wherein the labeled polynucleotide comprises SEQ ID NO: 179.

71. The method of claim 51, wherein the labeled polynucleotide comprises nucleotides 4-23 of SEQ ID NO: 177, and wherein the sequence-specific primer set is selected from the group consisting of Sets 6-9, Set-11, and Set-28.

72. The method of claim 71, wherein the labeled polynucleotide comprises SEQ ID NO: 177.

73. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 7-25 of SEQ ID NO: 159 and nucleotides 8-22 of SEQ ID NO: 160, and wherein the sequence-specific primer set is selected from the group consisting of Sets 13-15.

74. The method of claim 73, wherein the labeled polynucleotide comprises a sequence from the group consisting of SEQ ID NO: 159 and SEQ ID NO: 160.

75. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 6-22 of SEQ ID NO: 161, and nucleotides 3-22 of SEQ ID NO: 162, and wherein the sequence-specific primer set is selected from the group consisting of Sets 13-16.

76. The method of claim 75, wherein the labeled polynucleotide comprises a sequence from the group consisting of SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 161, and SEQ ID NO: 162.

77. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 151, and nucleotides 4-24 of SEQ ID NO: 153, and wherein the sequence-specific primer set is Set-3.

78. The method of claim 77, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 151, and SEQ ID NO: 153.

79. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 8-28 of SEQ ID NO: 163 and nucleotides 3-28 of SEQ ID NO: 164, and wherein the sequence-specific primer set is selected from the group consisting of Set-1, Set-2, and Sets 18-20.

80. The method of claim 79, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 163 and SEQ ID NO: 164.

81. The method of claim 51, wherein the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135 and nucleotides 6-30 of SEQ ID NO: 136, and wherein the sequence-specific primer set is selected from the group consisting of Sets 1-2 and Sets 18-21.

82. The method of claim 81, wherein the labeled polynucleotide comprises a sequence from the group consisting of SEQ ID NO: 135 and SEQ ID NO: 136.

83. A kit comprising a composition according to claim 1.

84. The kit of claim 83, further comprising a strand displacement polymerase.

85. The kit of claim 84, further comprising a molecular beacon comprising a fluorophore, a quencher, and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-33 of SEQ ID NO: 135, nucleotides 6-30 of SEQ ID NO: 136, nucleotides 7-27 of SEQ ID NO: 137, nucleotides 7-26 of SEQ ID NO: 138, nucleotides 1-26 of SEQ ID NO: 139, nucleotides 7-26 of SEQ ID NO: 140, nucleotides 7-30 of SEQ ID NO: 141, nucleotides 6-30 of SEQ ID NO: 142, nucleotides 8-32 of SEQ ID NO: 143, nucleotides 8-30 of SEQ ID NO: 144, nucleotides 6-31 of SEQ ID NO: 145, nucleotides 8-30 of SEQ ID NO: 146, 8-22 of SEQ ID NO: 147, nucleotides 8-24 of SEQ ID NO: 148, nucleotides 7-27 of SEQ ID NO: 149, nucleotides 8-21 of SEQ ID NO: 150, nucleotides 8-32 of SEQ ID NO: 151, nucleotides 1-24 of SEQ ID NO: 152, nucleotides 4-24 of SEQ ID NO: 153, nucleotides 1-23 of SEQ ID NO: 154, nucleotides 8-26 of SEQ ID NO: 155, nucleotides 7-29 of SEQ ID NO: 156, nucleotides 8-28 of SEQ ID NO: 157, nucleotides 8-29 of SEQ ID NO: 158, nucleotides 7-25 of SEQ ID NO: 159, nucleotides 8-22 of SEQ ID NO: 160, nucleotides 6-22 of SEQ ID NO: 161, nucleotides 3-22 of SEQ ID NO: 162, nucleotides 8-28 of SEQ ID NO: 163, nucleotides 3-28 of SEQ ID NO: 164, nucleotides 5-25 of SEQ ID NO: 165, nucleotides 5-26 of SEQ ID NO: 166, nucleotides 5-20 of SEQ ID NO: 167, nucleotides 4-22 of SEQ ID NO: 168, nucleotides 7-22 of SEQ ID NO: 169, nucleotides 3-22 of SEQ ID NO: 170, nucleotides 7-28 of SEQ ID NO: 171, nucleotides 6-27 of SEQ ID NO: 172, nucleotides 7-29 of SEQ ID NO: 173, nucleotides 5-27 of SEQ ID NO: 174, nucleotides 7-29 of SEQ ID NO: 175, nucleotides 6-28 of SEQ ID NO: 176, nucleotides 4-23 of SEQ ID NO: 177, nucleotides 4-34 of SEQ ID NO: 178, nucleotides 3-27 of SEQ ID NO: 179, nucleotides 2-27 of SEQ ID NO: 180, nucleotides 5-33 of SEQ ID NO: 181, nucleotides 3-30 of SEQ ID NO: 182, nucleotides 9-34 of SEQ ID NO: 183, and nucleotides 8-28 of SEQ ID NO: 184.

86. The kit of claim 85, wherein the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

87. The kit of claim 86, wherein the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

88. The kit of claim 87, wherein the polynucleotide consists of SEQ ID NO: 184 and the set of polynucleotides is Set-29.

89. A method of detecting β-actin in a test sample, the method comprising:

(a) extracting nucleic acid from the test sample;
(b) amplifying a target sequence by reacting nucleic acid extracted in step (a) for less than ten minutes with a reaction mixture comprising a strand displacement DNA polymerase and a sequence specific LAMP primer set; and
(c) detecting the presence or absence of an amplified product of step (b); wherein the presence of said amplification product is indicative of the presence of β-actin in the test sample.

90. The method of claim 89, wherein the amplifying step comprises reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 through Set-29.

91. The method of claim 90, wherein detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 135 through SEQ ID NO: 184.

92. The method of claim 90, wherein detecting the presence or absence of the amplification product comprises hybridizing the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 183, and SEQ ID NO: 184.

Patent History
Publication number: 20230002826
Type: Application
Filed: Dec 1, 2020
Publication Date: Jan 5, 2023
Applicant: TALIS BIOMEDICAL CORPORATION (Menlo Park, CA)
Inventors: Jason M. CASOLARI (Menlo Park, CA), Xuewen JIANG (Menlo Park, CA), Hedia MAAMAR (El Dorado Hills, CA)
Application Number: 17/778,486
Classifications
International Classification: C12Q 1/6876 (20060101); C12Q 1/6816 (20060101); C12Q 1/6806 (20060101);