Methods for Detecting the Presence of a Hypervirulent Clostridium Difficile Strain

- Mobidiag Ltd

The present invention provides a nucleic acid amplification based method for detecting a hypervirulent Clostridium difficile strain in a biological sample. The present invention is based on the use of oligonucleotide primers and probes specific to negative and positive markers in hypervirulent Clostridium difficile genome.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS REFERENCE TO RELATED APPLICATIONS

This application is a divisional application of U.S. patent application Ser. No. 15/532,132 is a filed Jun. 1, 2017, which is a national phase entry pursuant to 35 U.S.C. § 371 of International Application No. PCT/FI2015/050911, filed Dec. 18, 2015, which claims the benefit of priority of Finland Provisional Application No. 20146124, filed Dec. 19, 2014, each of which is incorporated by reference herein in its entirety for any purpose.

SEQUENCE LISTING

The present application contains a Sequence Listing which has been submitted electronically in ST26 format. Said ST26 copy, created on Jun. 23, 2023, is named “2023-06-23_01159-0046-01US_ST26” and is 15,275 bytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

The present invention relates to the field of nucleic acid amplification based diagnostic assays. More specifically, the present invention provides a PCR based method for detecting a hypervirulent Clostridium difficile strain, preferably toxin producing Clostridium difficile strain 027, in a biological sample, such as a stool sample. The present invention is based on the use of oligonucleotide primers and probes specific to negative and positive markers for hypervirulent Clostridium difficile strains.

BACKGROUND OF THE INVENTION

C. difficile infection (CDI) is a toxin-mediated intestinal disease. The clinical outcomes of CDI can range from asymptomatic colonization to more severe disease syndromes, including severe diarrhoea, abdominal pain, fever and leukocytosis. C. difficile is recognized as the main cause of infectious diarrhoea that develops in patients after hospitalization and antibiotic treatment. Therefore, CDI is now considered to be one of the most important of health care-associated infections. Further, non-hospital-associated reservoirs of C. difficile are also emerging, and C. difficile is capable of spreading in animal hosts (Denéve et al., 2009; Rupnik et al, 2009).

C. difficile testing methods currently include cytotoxigenic culture methods, cytotoxin assays (CYT) detecting the toxins A and B produced by C. difficile, PCR based assays for detection of the tcdB gene of C. difficile, and assays for detection of C. difficile-specific glutamate dehydrogenase (GDH) (Eastwood et al., 2009).

In the prior art, the PCR based test have been found to be reliable, sensitive, and specific diagnostic tools for rapid screening and identification of samples containing C. difficile (Eastwood et al., 2009, Hirvonen et al., 2013; Houser et al., 2010 and WO2012087135). In commercial use is a method disclosed by WO2010116290 (Philips) relating to a multiplex PCR assay for the detection of a toxigenic C. difficile strain by analysing the presence or absence of the cytotoxin tcdB gene and deletions in the tcdC gene.

Although a number of PCR based assays for detecting toxin producing Clostridium difficile strain are already disclosed, there is still a need in the field for a PCR assay which is able to provide high specificity and reliability for the detection of those C. difficile strains which are hypervirulent. The present inventors have now located DNA sequence regions in Clostridium difficile genome that are surprisingly well-suited for specific and sensitive amplification of negative and positive markers relating to hypervirulent Clostridium difficile strains.

The sample matrix, which in diarrhoea diagnostics is commonly a stool or food sample, is likely to contain a host of PCR inhibitors. This reduces amplification efficiency of the PCR reaction and thus even more careful optimization is expected from the amplicon design step to verify that all templates and copy numbers are amplified equally but also efficiently enough. Hence, oligonucleotide design enabling high PCR efficiency (optimally as close to 100% as possible) is required. The detection method used may also affect amplification efficiency and/or bias.

The present inventors have now located DNA sequence regions that are well suited for specific and sensitive amplification and quantification of diarrhoea causing hypervirulent Clostridium difficile strains. The amplicons have been designed to be so specific that they can be combined into any multiplex sets with each other. Naturally a prerequisite to this is that all the disclosed amplicons have also been designed to amplify in the same reaction and cycling conditions. The aim of the invention is to replace antigen testing and culturing as a screening test for hypervirulent Clostridium difficile, and thus provide process improvements for the laboratory and clinical benefits in improved patient management by providing rapidly a rich set of information. Further, infection control could benefit if clinical microbiology laboratories could readily differentiate between non-toxigenic C. difficile and hypervirulent C. difficile.

SUMMARY OF THE INVENTION

One object of the present invention is to provide a method of detecting the presence of a hypervirulent Clostridium difficile strain in a biological sample, the method comprising: performing a nucleic acid amplification reaction comprising DNA extracted from the biological sample as a template, a first oligonucleotide primer set specific for amplifying a target sequence in the C. difficile hydR gene in the reaction, wherein said hydR gene comprises a sequence corresponding to SEQ ID NO: 1, and a second oligonucleotide primer set specific for amplifying at least part of the target sequence corresponding to C. difficile sequence set forth in SEQ ID NO:2 in the reaction.

Another object of the present invention is to provide an oligonucleotide primer set comprising an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO:3 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO 4, wherein the oligonucleotide primer set amplifies a target sequence in the C. difficile hydR gene.

Another object of the present invention is to provide an oligonucleotide primer set comprising an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 6, wherein the oligonucleotide primer set amplifies a specific target sequence in C. difficile genome.

Another object of the present invention is to provide an oligonucleotide primer set comprising an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 12, wherein the oligonucleotide primer set amplifies a target sequence in the C. difficile tcdB gene.

Another object of the present invention is to provide a kit for detecting a hypervirulent Clostridium difficile strain in a biological sample, the kit comprising: an oligonucleotide primer set as defined above; and a reagent for performing amplification of a nucleic acid in a nucleic acid amplification reaction.

DETAILED DESCRIPTION OF THE INVENTION

The purpose of the method of the present invention is to serve as a primary microbiological screening test for the qualitative identification of hypervirulent C. difficile, and a recurrent disease associated ribotype 027 The method is preferably performed from DNA extracted directly from a biological sample, such as a stool sample, without the use of an enrichment culture. Preferably, the method of the invention is a PCR-based C. difficile assay: such as a qPCR assay, or a qualitative multiplexed nucleic acid-based in vitro diagnostic test intended for detecting of nucleic acid markers corresponding to the detection and identification of hypervirulent Clostridium difficile and toxin producing 027 ribotype selective markers.

As used herein, a “target sequence” present in a nucleic acid sample is a strand of C. difficile DNA to be primed and extended by a “primer”. A target sequence may be either single-stranded or in a duplex with its complementary sequence. Target sequence as defined in the present invention is preferably purified to some degree prior to the amplification reactions described herein.

As used herein, the term “oligonucleotide” refers to any polymer of two or more of nucleotides, nucleosides, nucleobases or related compounds used as a reagent in the DNA amplification methods, such as primers and probes. The oligonucleotide may be DNA and/or RNA and/or analogs thereof. The term oligonucleotide does not denote any particular function to the reagent, rather, it is used generically to coverall such reagents described herein. Specific oligonucleotides of the present invention are described in more detail below. As used herein, an oligonucleotide can be virtually any length, limited only by its specific function in the DNA amplification reaction. Oligonucleotides of a defined sequence and chemical structure may be produced by techniques known to those of ordinary skill in the art, such as by chemical or biochemical synthesis, and by in vitro or in vivo expression from recombinant nucleic acid molecules, e.g., bacterial or viral vectors. Oligonucleotides may be modified in any way, as long as a given modification is compatible with the desired function of a given oligonucleotide. One of ordinary skill in the art can easily determine whether a given modification is suitable or desired for any given oligonucleotide of the present invention. Modifications include, but are not limited to base modifications, sugar modifications or backbone modifications. While design and sequence of oligonucleotides for the present invention depend on their function as described below, several variables must generally be taken into account. Among the most critical are: length, G/C content, melting temperature (Tm), Gibb free energy (G), specificity, self-complementarity and complementarity with other oligonucleotides in the system, polypyrimidine (T, C) or polypurine (A, G) stretches, and the 3′-end sequence. Controlling for these and other variables is a standard and well-known aspect of oligonucleotide design, and various computer programs are readily available to screen large numbers of potential oligonucleotides for optimal ones.

As used herein, the term “PCR reaction”, “PCR amplifying” or “PCR amplification” refers generally to cycling polymerase-mediated exponential amplification of nucleic acids employing primers that hybridize to complementary strands, as described for example in Innis et al, PCR Protocols: A Guide to Methods and Applications, Academic Press (1990). Devices have been developed that can perform thermal cycling reactions with compositions containing fluorescent indicators which are able to emit a light beam of a specified wavelength, read the intensity of the fluorescent dye, and display the intensity of fluorescence after each cycle. The amplification product contains a sequence having sequence identity with a target nucleic acid sequence or its complement and can be detected with, for example, an intercalating dye or a detection probe having specificity for a region of the target nucleic acid sequence or its complement. The PCR reaction as defined in the present invention is preferably performed as a real-time PCR assay.

As used herein, the term “probe” refers to any of a variety of signalling molecules indicative of amplification. For example, SYBR® Green and other DNA-binding dyes are detector probes. Some detector probes can be sequence-based, for example 5′ nuclease probes. Various detector probes are known in the art, for example TaqMan® probes (See U.S. Pat. No. 5,538,848). The melting temperature, Tm, of the probes can be increased by addition of modified nucleotides. The amount of modified nucleotides in one probe is preferably 1, 2, 3, 4 or more. The modified nucleotide can be a LNA nucleotide (Exiqon A/S), minor groove binder (MGB™), SuperBase, or Peptide Nucleic Acid (PNA) or any other modification increasing the Tm of the probe.

A person skilled in the art knows that amplified target sequences, i.e. amplicons, naturally vary in related strains. This minor variation can be taken into account while designing primers suitable to amplify said amplicons in the method of the present invention.

Preferably, at least 50, 60, 70, 80, 90 or 100 nucleotides long sequence of each of the target amplicons selected from the group consisting of SEQ ID NOS:1, 2 and 10 is amplified in the method.

Preferably, the primers and probes comprise the sequences as defined in the claims and are less than 30, 35, 40, 45, 50 or 55 nucleotides long, and more preferably, less than 50 nucleotides long. Each of the present primers and probes can also be defined as consisting of at least 10, 15, 16, 17, 18, 19 or 20 contiguous nucleotides present in any one of primer or probe sequences selected from the group consisting of SEQ ID NOS:3-9 and 11-13 or comprising a sequence selected from the group consisting of SEQ ID NOS:3-9 and 11-13.

The present invention is directed to a method of detecting the presence of a hypervirulent Clostridium difficile strain in a biological sample. Preferably, the method is a real-time PCR assay. The method can be performed using a DNA chip, gel electrophoresis, a radiation measurement, a fluorescence measurement, or a phosphorescence measurement. A person skilled in the art may use the primers and probes of the invention also in other methods and platforms utilizing PCR or nucleic acid amplification. Said biological sample can be, e.g., a stool sample, an environmental sample or a food sample.

The method comprises the step of:

performing a nucleic acid amplification reaction comprising DNA extracted from the biological sample as a template, a first oligonucleotide primer set specific for amplifying a target sequence in the C. difficile hydR gene in the reaction, wherein said hydR gene comprises a sequence corresponding to SEQ ID NO: 1, and a second oligonucleotide primer set specific for amplifying at least part of the target sequence corresponding to C. difficile sequence set forth in SEQ ID NO:2 in the reaction. Preferably, the method comprises a step of detecting the presence of a hypervirulent Clostridium difficile strain in said biological sample by any method capable of detecting amplified target sequences in the reaction.

The hypervirulent Clostridium difficile strain is detected in the sample, when the first oligonucleotide primer set does not amplify a specific product, i.e. the target sequence in hydR gene is a negative marker for hypervirulent Clostridium difficile strain, and the second oligonucleotide primer set amplifies a specific product. i.e. the sequence targeted by the second primer set in C. difficile genome is a positive marker for hypervirulent Clostridium difficile strains.

The most important hypervirulent Clostridium difficile strain detected by the present method is toxin producing Clostridium difficile strain 027. Thus, the present method is particularly directed to the detection of this Clostridium difficile strain. The presence of C. difficile hydR gene DNA in said sample, however, indicates that Clostridium difficile strain 027 is not present in the examined sample or that in addition to the presence of a toxin producing Clostridium difficile strain 027 there is also presence of another Clostridium difficile strain in the sample A skilled person of the art is, however, aware that some of hypervirulent C. difficile strains are not classified as 027-ribotype strains, therefore, the present invention is also directed to the detection of hypervirulent 027-ribotype-resembling Clostridium difficile strains.

Preferably, the first oligonucleotide primer set targets the C. difficile hydR gene and amplifies the hydR sequence set forth in SEQ ID NO:1 so that at least part of the sequence is specifically amplified in the amplification reaction. More preferably, the first oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 3 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 4, said primers amplifying at least part of the hydR sequence set forth in SEQ ID NO: 1. Most preferably, the first oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 3 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 4.

The presence of the target sequence amplified with the first oligonucleotide primer set can be detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:7, or preferably, by the use of a probe comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO-7.

The target sequence of the second oligonucleotide primer set in C. difficile genome corresponds to a gene encoding a putative conjugative transposon DNA recombination protein. Preferably, said second oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 6. More preferably, the second oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 6.

The probes for the second oligonucleotide primer set as defined in SEQ ID NO: 8 and 9 can be used as competitive probes in a same reaction to detect a G/A polymorphism in C. difficile genome in a position corresponding to position 12 in SEQ ID NO:8 or 9. The presence of the target sequence amplified with the second oligonucleotide primer set can be detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:7 so that said G/A polymorphism is detected. Preferably, the target sequence amplified with the second oligonucleotide primer set is detected by the use of a probe comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO:8 or 9.

The amplification reaction as defined in the method may further comprise a third oligonucleotide primer set specific for amplifying C. difficile toxin B gene (tcdB). The third oligonucleotide primer set amplifies at least part of nucleotide region as set forth in SEQ ID NO: 10.

Preferably, the third oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 12.

More preferably, the third oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 12.

The presence of the target sequence amplified with the third oligonucleotide primer set is detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:13, preferably, by the use of a primer comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 13.

The present invention is also directed to oligonucleotide primer sets, i.e. oligonucleotides, comprising primers as defined above for the first, second or third oligonucleotide primer set or a mix thereof. The primer sets may also comprise probes as defined above for use with each of the primer sets. The present invention is also directed to the use of these oligonucleotide primer sets for the detection of the presence of a hypervirulent Clostridium difficile strain in a biological sample, such as a stool sample or a food sample.

The present invention also provides kits for detecting a hypervirulent Clostridium difficile strain in a biological sample, a kit may comprise the oligonucleotide primer set as defined above; and a reagent for performing amplification of a nucleic acid. Preferably, the reagent is selected from the group consisting of: DNA polymerase, dNTPs, and a buffer.

Another embodiment of the invention is a method of detecting the presence of a hypervirulent Clostridium difficile strain in a biological sample using oligonucleotide primers and probes with modified nucleotides. Generally, the use of modified nucleotides renders possible shortening of an oligonucleotide primer or probe without compromising its specificity. The amount of modified nucleotides in one primer or probe is preferably 1, 2, 3, 4 or more. The modified nucleotide can be a LNA nucleotide (Exiqon A/S), minor groove binder (MGB™), SuperBase, or Peptide Nucleic Acid (PNA) or any other nucleotide modification having the same effect on the oligonucleotide. The method comprises essentially same steps as the method described above and in the claims but is performed with at least one modified primer or probe. One example of the primers and probes for such method is:

Primer pair 1 (for the detection of hydR gene): SEQ ID NO: 3 and SEQ ID NO: 4 with a probe having the sequence SEQ ID NO: 7.

Primer pair 2 (for the detection of putative conjugative transposon, pct): SEQ ID NO: 5 and SEQ ID NO: 6 with a probe having the sequence CTG TAG ATT TCG GTA CGA (SEQ ID NO: 14), wherein underlined nucleotides are modified nucleotides such as LNA.

Primer pair 3 (for the detection of tcdB gene): SEQ ID NO: 11 and SEQ ID NO. 12 with a probe having the sequence SEQ ID NO: 13.

Accordingly, a person skilled in the art would understand that the length of any of the above primers or probes may be shortened in a similar way by using at least one modified nucleotide.

The publications and other materials used herein to illuminate the background of the invention, and in particular, to provide additional details with respect to its practice, are incorporated herein by reference. The present invention is further described in the following example, which is not intended to limit the scope of the invention.

EXPERIMENTAL SECTION Example 1

In this example, the assay of the disclosed invention was used to detect both toxin-producing and non-toxin-producing C. difficile strains. A total of 48 characterized samples representing 37 different ribotypes were tested. This test excluded 027 or genetically very closely related ribotypes.

The assay contains one multiplex PCR reaction which amplifies the target panel (Table 1). Identification of toxin producing C. difficile and differentiation of hypervirulent C. difficile is based on combined detection of these markers. Toxin marker: tcdB gene encodes Toxin B, 027-negative marker hydR encodes TetR family transcriptional regulator protein and 027-positive marker: pct encodes putative conjugative transposon DNA recombination protein. Primers and probes were as defined in Table 9.

The C. difficile assay should give positive results from different toxin-producing C. difficile strains, and negative results for non-toxin-producing C. difficile strains. Inclusivity (analytical reactivity) is tested to account for potential genetic variation among the targets included in the panel. This example describes the results of the inclusivity of the C. difficile qPCR assay using well characterized strains.

TABLE 1 C. difficile assay target panel Target gene Marker region Description Toxin 8 tcdB Detects cytotoxin (Toxin B) producing C. difficile Positive hypervirulent pct Positive hypervirulent marker is marker detected only from hypervirulent strains (ribotype 027) Negative hypervirulent hydR Negative marker is not detected marker from ribotype 027 strains, but is positive for other C. difficile strains

Materials and Methods 1.1 The List of the Bacterial Targets

The C. difficile assay covers pathogens causing gastrointestinal infections. A total of 48 characterized samples representing 37 different ribotypes were tested in this inclusivity study covering non-toxinogenic C. difficile and Toxin B producing C. difficile. The list of strains is described in Table 2. This test excluded 027 or genetically very closely related ribotypes.

Strains were collected from commercial available biobanks (ATCC, DSMZ, and Microbiologies). DNA samples were tested in concentrations less than 100 ng/μl.

TABLE 2 Amplidiag C. difficile GE assays inclusivity test panel # Original code 1 ATCC 51695 2 ATCC 43599 3 ATCC 17857 4 ATCC BAA-1871 5 0329P (ATCC 9689) 6 ATCC BAA-1813 7 ATCC BAA-1874 8 ATCC BAA-1809 9 ATCC BAA-1810 10 ATCC BAA-1801 11 ATCC BAA-1382 12 ATCC 43596 13 ATCC 43600 14 AHS 56050 15 ATCC 43598 16 106222 17 ATCC BAA-1808 18 106216 19 ATCC BAA-1812 20 ATCC 43601 21 ATCC 43602 22 0527P (ATCC 700057) 23 106210 24 ATCC BAA-1873 25 ATCC BAA-1804 26 ATCC BAA-1811 27 AHS 55375 28 0833P (ATCC 43593) 29 RHC 7722 30 AHS 26782 31 AHS 55985 32 ATCC BAA-1875 33 106090 34 ATCC 43603 35 ATCC 43255 36 AHS 56035 37 ATCC BAA-2156 38 RHC 7727 39 AHS 55868 40 106194 41 RHC 7758 42 ATCC BAA-1807 43 ATCC BAA-1872 44 ATCC BAA-1806 45 ATCC BAA 2155 46 ATCC BAA-1814 47 106073 48 AHS 56010

1.2 Reagents and Instruments

qPCR Reagents:

qPCR Mastermix, Mobidiag

Assay mixture consisting of C. difficile qPCR primers and probes

Devices:

Stratagene MxPro 3000

PCR Setup

In reaction:

10 μl 2 x Mastermix 5 μl 4 x Primer mix 5 μl sample/pos. control DNA mix/DNA extraction control/H2O 20 μl TOTAL PCR program: 95° C. 10 min 95° C. 15 s 45x 60° C. 60 s

Results

TABLE 3 Identification of markers toxB, pct and hydR in C. difficile strains. Identification of markers # Original code Ribotype Characterization toxB pct hydR Result 1 ATCC 5169S 001 A + B+, Binary toxin cdtB− + − + ToxB+ 2 ATCC 48599 001 A + B+, Binary toxin cdtB− + − + ToxB+ 3 ATCC 17857 001 A + B+, Binary toxin cdtB− + − + ToxB+ 4 ATCC BAA-1871 001 A + B+, Binary toxin cdtB− + − + ToxB+ 5 0329P (ATCC 9689) 001 A + B+, Binary toxin cdtB− + − + ToxB+ 6 ATCC BAA-1813 002 A + B+, Binary toxin cdtB− + − + ToxB+ 7 ATCC BAA-1874 002 A + B+, Binary toxin cdtB− + − + ToxB+ 8 ATCC BAA-1809 009 A − B−, Binary toxin cdtB− − − + Negative 9 ATCC BAA-1810 009 A − B−, Binary toxin cdtB− − − + Negative 10 ATCC BAA-1801 010 A − B−, Binary toxin cdtB− − − + Negative 11 ATCC BAA-1382 012 A + B+, Binary toxin cdtB− + − + ToxB+ 12 ATCC 43595 012 A + B+, Binary toxin cdtB− + − + ToxB+ 13 ATCC 43600 014 A + B+, Binary toxin cdtB− + − + ToxB+ 14 AHS 56050 015 A + B+, Binary toxin−, tcdC 18bp del + + + ToxB+ 15 ATCC 43598 017 A − B+, Binary toxin cdtB− + − + ToxB+ 16 106222 019 A + B+, Binary toxin+, tcdC 18bp del + − + ToxB+ 17 ATCC BAA-1808 020 A + B+, Binary toxin cdtB− + − + ToxB+ 18 106216 023 A + B+, Binary toxin+ + − + ToxB+ 19 ATCC BAA-1812 024 A + B+, Binary toxin cdtB− + − + ToxB+ 20 ATCC 43601 031 A − B−, Binary toxin cdtB− − − + Negative 21 ATCC 43602 031 A − B−, Binary toxin cdtB− − − + Negative 22 0527P (ATCC 700057) 038 A − B−, Binary toxin cdtB− − − + Negative 23 106210 045 A + B+, Binary toxin+ + − + ToxB+ 24 ATCC BAA-1873 053 A + B+, Binary toxin cdtB− + − + ToxB+ 25 ATCC BAA-1804 053 A + B+, Binary toxin cdtB− + − + ToxB+ 26 ATCC BAA-1811 057 A + B+, Binary toxin cdtB− + − + ToxB+ 27 AHS 55375 058 A + B+, Binary toxin+ + − + ToxB+ 28 0833P (ATCC 43593) 060 A − B−, Binary toxin cdtB− − − + Negative 29 RHC 7722 063 A + B+, Binary toxin+, tcdC 18bp del + − + ToxB+ 30 AHS 26782 unk. 67 A + B+, Binary toxin+, tcdC 18bp del + − + ToxB+ 31 AHS 55985 075 A + B+, Binary toxin+, tcdC 18bp del + − − ToxB+ 32 ATCC BAA-1875 078 A + B+, Binary toxin cdtB+ + − + ToxB+ 33 106090 080 A + B+, Binary toxin+, tcdC 18bp del + − − ToxB+ 34 ATCC 43603 085 A − B−, Binary toxin cdtB− − − + Negative 35 ATCC 43255 087 A + B+, Binary toxin cdtB− + − + ToxB+ 36 AHS 56035 111 A + B+, Binary toxin+ + − + ToxB+ 37 ATCC BAA-2156 118 A + B+, Binary toxin cdtB− + − + ToxB+ 38 RHC 7727 122 A + B+, Binary toxin+, tcdC 18bp del + − + ToxB+ 39 AHS 55868 unk. 122 A + B+, Binary toxin+ + − + ToxB+ 40 106194 126 A + B+, Binary toxin+ + − + ToxB+ 41 RHC 7758 131 A + B+, Binary toxin+, tcdC 18bp del + − + ToxB+ 42 ATCC BAA-1807 140 A − B−, Binary toxin cdtB− − + + Negative 43 ATCC BAA-1872 207 A + B+, Binary toxin cdtB− + − + ToxB+ 44 ATCC BAA-1806 220 A + B+, Binary toxin cdtB− + − + ToxB+ 45 ATCC BAA-2155 251 A + B+, Binary toxin cdtB+ + − + ToxB+ 36 ATCC BAA-1814 251 A + B+, Binary toxin cdtB+ + − + ToxB+ 47 106073 254 A + B+, Binary toxin+ + − + ToxB+ 48 AHS 56010 308 A + B+, Binary toxin−, tcdC 18bp del + − + ToxB+

Functionality of Controls

    • Positive controls were detected as positive
    • Negative control was detected as negative
    • Internal Amplification Control was detected in all samples

CONCLUSIONS

All 39 toxin-producing strains were identified correctly as ToxB+. All 9 non-toxin-producing strains were correctly identified as negative. No strain gave false positive identification of the 027 ribotype (toxB+, pct+, hydR−).

Controls were detected as expected, which confirmed the reliability of the results.

Example 2

In this example, the functionality of the disclosed invention to differentiate 027 ribotype detection was tested. Two very closely related ribotypes, namely 016 and 176, were included in the samples.

Materials and Methods DNA Extraction

The DNA from C. difficile isolates were extracted as described below:

A colony from bacterial cultures was suspended to the 1×PBS buffer in the final concentration ca. 1.5×10{circumflex over ( )}8 CFU/ml (ref. McFarlan standard 0.5). 100 μl of bacterial suspension was transferred to the off-board lysis step following the automated extraction with NucliSENS EasyMAG (bioMérieux) device according to the manufacturer's protocol for Generic 2.0.1 program. DNAs were eluted to the 100 μl of elution buffer. Extraction series contained Extraction Control i.e. C. difficile (non-toxin producing strain).

Real-Time PCR and Analysis

The PCR reactions were conducted as defined in Example 1. Internal amplification control, Positive PCR control and Negative PCR control is included to the test series.

A total of 18 different 027 ribotype strains, one 16 ribotype strain and one 176 ribotype strain were tested.

TABLE 4 Identification of markers toxB, pct and hydR in C. difficile 027 strains. # Original code Ribotype Characterization toxB pct hydR Result 1 ATCC BAA-1805 027 A + B+, Binary toxin cdtB+ + + − 027+ 2 ATCC BAA-1803 027 A + B+, Binary toxin cdtB+ + + − 027+ 3 01048P (ATCC 027 A + B+, Binary toxin cdtB+ + + − 027+ BAA-1870) 4 CD14-038 027 n/a + + − 027+ 5 CD13-177 027 n/a + + − 027+ 6 CD13-032 027 n/a + + − 027+ 7 CD13-221 027 n/a + + − 027+ 8 CD14-078 027 n/a + + − 027+ 9 CD14-072 027 n/a + + − 027+ 10 CD14-161 027 n/a + + − 027+ 11 CD13-097 027 n/a + + − 027+ 12 CD12-100 027 n/a + + − 027+ 13 CD13-305 027 n/a + + − 027+ 14 CD13-056 027 n/a + + − 027+ 15 CD13-004 027 n/a + + − 027+ 16 CD13-247 027 n/a + + − 027+ 17 CD13-245 027 n/a + + − 027+ 18 CD13-108 027 n/a + + − 027+ 19 AHS 55742 016 A + B+, Binary toxin+, tcdC 18bp del + + − 027+ 20 AHS 26967 176 A + B+, Binary toxin+, tcdC 18bp del + + − 027+

The assay gave a correct positive identification of all the 18 different 027 strains, and gave a positive identification of 016 and 176 ribotypes. Thus, the assay detects genetically closely related 016 and 176 ribotypes in addition to 027 ribotype as 027+.

Example 3

In this example, the disclosed invention was compared to a prior art method for detecting a 027 presumptive positive C. difficile. The assay of the invention was compared to Xpert C. difficile/Epi (Cepheid) test.

The Xpert C. difficile/Epi test uses the detection of a deletion in tcdC gene to report a positive 027 presumptive finding.

A total of 11 different strains, representing 11 different ribotypes, were tested with both methods and the results were compared.

TABLE 5 Comparison to Xpert C. difficile/Epi (Cepheid) test. Identification of Original GeneXpert disclosed markers # code Ribotype Characterization tox B Binary TcdC Result toxB pct hydR Result 1 AHS 55742 016 A + B+, Binary toxin+, tcdC 18bp del + + + toxigenic C.diff positive, 027 + + − 027+ presumptive positive 2 106222 019 A + B+, Binary toxin+, tcdC 18bp del + + + toxigenic C.diff positive, 027 + − + ToxB+ presumptive positive 3 AHS 26782 unk. 67 A + B+, Binary toxin+, tcdC 18bp del + + + toxigenic C.diff positive, 027 + − + ToxB+ presumptive positive 4 106090 080 A + B+, Binary toxin+, tcdC 18bp del + + + toxigenic C.diff positive, 027 + − − ToxB+ presumptive positive 5 AHS 26967 176 A + B+, Binary toxin+, tcdC 18bp del + + + toxigenic C.diff positive, 027 + + − 027+ presumptive positive 6 106210 045 A + B+, Binary toxin+ + + − toxigenic C.diff positive, 027 + − + ToxB+ presumptive negative 7 RHC 7722 063 A + B+, Binary toxin+, tcdC 18bp del + + − toxigenic C.diff positive, 027 + − + ToxB+ presumptive negative 8 AHS 55985 075 A + B+, Binary toxin+, tcdC 18bp del + + − toxigenic C.diff positive, 027 + − − ToxB+ presumptive negative 9 AHS 56035 111 A + B+, Binary toxin+ + + − toxigenic C.diff positive, 027 + − + ToxB+ presumptive negative 10 RHC 7727 122 A + B+, Binary toxin+, tcdC 18bp del + + − toxigenic C.diff positive, 027 + − + ToxB+ presumptive negative 11 RHC 7758 131 A + B+, Binary toxin+, tcdC 18bp del + + − toxigenic C.diff positive, 027 + − + ToxB+ presumptive negative

The Xpert C. difficile/Epi test reported 5 strains to be toxigenic C. difficile positive, 027 presumptive positive, while none of the tested strains were actually ribotype 027. Of these 5 strains, the method of the present invention identified only 2 strains as 027 positive, so demonstrating an improved effect in differentiating between a 027 and non-027 ribotype compared to prior art. It is notable that these two C. difficile strains (016 and 176) have been shown to be highly related to hypervirulent C. difficile strains (Knetsch et al., 2011).

The identification of the disclosed markers reported 9 strains correctly as ToxB+, but not 027+, as expected. In summary, the assay of the invention identified 9/11 strains correctly as 027−, while the Xpert C. difficile/Epi test reported 6/11 strains correctly with regard to the presumptive negativity of 027.

Example 4

The workflow of the present invention consists of extraction of nucleic acids from stool samples (NucliSens easyMAG), real-time PCR amplification and detection of target gene regions and analysis of results.

In this example, different toxin-producing C. difficile strains were tested as spiked samples in stool background. A total of 35 different strains were used. Each strain was spiked into a stool sample negative for C. difficile. DNA was extracted from stool samples, and qPCR reactions were prepared so that the strain was present in concentrations of either 7.5 CFU/reaction or 75 CFU/reactions as illustrated in Table 6. All samples were tested in duplicate reactions.

The results demonstrate that that the strains were correctly identified as positive in all cases.

TABLE 6 Detection of different toxin-producing C. difficile strains in spiked stool samples. Cq values of detection of markers Original Code CFU/rxn toxB 027+ 027− IC Result ATCC BAA-1870 7.5 37.14 3613 n/a 28.32 027+ ATCC 9689 7.5 34.44 n/a 36.47 27.94 ToxB+ ATCC BAA-1382 7.5 36.37 n/a 37.44 27.77 ToxB+ ATCC 17858 7.5 35.32 n/a n/a 28.55 ToxB4 ATCC 43600 7.5 37.74 n/a 37.21 28.68 ToxB+ ATCC 43596 7.5 37 n/a n/a 28.29 ToxB+ ATCC 43594 7.5 37.89 n/a n/a 28.31 ToxB+ ATCC 43598 7.5 36.23 n/a n/a 28.7 ToxB+ ATCC BAA-1803 7.5 37.14 34.99 n/a 28.46 027+ ATCC BAA-1808 7.5 35.7 n/a 34.32 28.37 ToxB+ ATCC BAA-1811 7.5 35.66 n/a 35.92 28.5 ToxB+ ATCC BAA-1812 7.5 37.13 n/a 37.67 28.43 ToxB+ ATCC BAA-1813 7.5 38.07 n/a 37.5 28.43 ToxB+ ATCC BAA-1815 7.5 37.6 n/a 36.11 28.28 ToxB+ ATCC BAA-1872 7.5 35.38 n/a 36.6 28.36 ToxB+ ATCC BAA-1875 7.5 36.84 n/a 37.56 28.36 ToxB+ ATCC BAA-2155 7.5 35.85 n/a 35.74 28.59 ToxB+ ATCC BAA-2156 7.5 35.73 n/a 35.67 28.3 ToxB+ ATCC BAA-1804 7.5 37.37 n/a 35.5 28.46 ToxB+ ATCC BAA-1806 75 35.7 n/a 35.33 28.97 ToxB+ CD14-038 75 36.09 35.08 n/a 29.12 027+ CD13-177 75 34.53 34.21 n/a 29.05 027+ CD13-032 75 34.72 34.6 n/a 29.13 027+ CD13-221 75 36.09 37.14 n/a 29.42 027+ CD14-078 75 32.07 33.3 n/a 29.12 027+ CD14-072 75 32.9 27.53 43.92 27.52 027+ CD14-161 75 33.53 35.89 n/a 29.24 027+ CD13-097 75 32.72 33.83 n/a 29.14 027+ CD12-100 75 38.56 36.27 n/a 29.34 027+ CD13-305 75 35.97 39.19 n/a 29.43 027+ CD13-056 75 35.46 35.02 n/a 29.14 027+ CD13-004 75 33.22 34.07 n/a 28.93 027+ CD13-247 75 33.75 34.59 n/a 29.08 027+ CD13-245 75 33.08 34.24 n/a 29.02 027+ CD13-108 75 34.55 36.18 n/a 29.04 027+ IC = internal control, controls PCR inhibition CFU/rxn = colony forming units/reaction Two replicates per sample

Example 5

This example describes results from a study of potential false positive results in the C. difficile qPCR assay due to a cross-reaction. Sample material for this designed assay is stool sample. Therefore, pathogens (bacteria, viruses and parasites) associated with gastrointestinal infections, and which are not covered by assay panel, can cause potential cross-reaction. Also bacteria included to commensal flora may cross-react. Furthermore, pathogens including to the assay target panel are added to the cross-reaction study since only the target pathogen should be detected and no cross-reaction among other targets should happen.

Materials and Methods

Reagents, devices and samples

qPCR Reagents:

Mobidiag's qPCR Mastermix (MM)

Assay mixture consisting of C. difficile qPCR primers and probes (see Table 9)

Devices:

Stratagene Mxp3000

PCR Setup

In reaction:

10 μl 2 x MM 5 μl 4 x Primer mix 5 μl sample/pos. Control DNA mix/H2O 20 μl 95° C. 10 min 95° C. 15 s 40x 60° C.  1 min Pos. Control = template mix

Samples:

DNA (or RNA) extracted from 127 pathogens. Strains have been mainly collected from commercial available biobanks (ATCC, DSMZ, Microbiologics Qnostics and Vircell). Some strains are added from Mobidiag biobank and those strains have been originally purified from patient samples and characterized by HUSLAB (Helsinki University central hospital laboratory).

The amount of DNA was determined by 16S rRNA assay or by NanoDrop.

TABLE 7 Cross-reaction results. # Species Result 1 Acinetobacter baumannii Negative 2 Actinomyces Negative actinomycetemcomitans 3 Actinomyces israelii Negative 4 Actinomyces naeslundii Negative 5 Aspergillus fumigatus Negative 6 Astrovirus Negative 7 Bacillus cereus Negative 8 Bacillus subtilis Negative 9 Bacteroides fragilis Negative 10 Bacteroides Negative thetaiotaomicron 11 Bacteroides vulgatus Negative 12 Campylobacter coli Negative 13 Campylobacter fetus Negative 14 Campylobacter jejuni subsp. Negative jejuni 15 Campylobacter lari Negative 16 Candida albicans Negative 17 Candida glabrata Negative 18 Candida krusei Negative 19 Chromobacterium violaceum Negative 20 Citrobacter amalonaticus Negative 21 Citrobacter braakii Negative 22 Citrobacter freundii Negative 23 Citrobacter koserii Negative 24 Clostridium histolyticum Negative 25 Clostridium perfringens Negative 26 Clostridium septicum Negative 27 Clostridium sordellii Negative 28 Clostridium sporogenes Negative 29 Clostridium tetani Negative 30 Corynebacterium Negative amycolatum 31 Corynebacterium Negative diphtheriae 32 Cronobacter sakazakii Negative 33 Cryptosporidiumn parvum Negative 34 Cytomegalovirus Negative 35 Desulfovibrio sp. Negative 36 Dientamoeba fragilis Negative 37 Edwardsiella tarda Negative 38 Eggerthella lenta Negative 39 Elizabethkingia Negative meningoseptica 40 Entamoeba histolytica Negative 41 Enterobacter aerogenes Negative 42 Enterobacter cloacae Negative 43 Enterobacter hormaechei Negative subsp. hormaechei 44 Enterococcus casseliflavus Negative 45 Enterococcus faecalis Negative 46 Enterococcus faecium Negative 47 Enterococcus gallinarum Negative 48 Escherichia coli, non Negative toxigenic 49 Escherichia coli, EAEC Negative 50 Escherichia coli, EHEC Negative 51 Escherichia coli, EIEC Negative 52 Escherichia coli, EPEC Negative 53 Escherichia coli, ETEC Negative 54 Escherichia fergusonii Negative 55 Escherichia hermanii Negative 56 Escherichia vulneris Negative 57 Fusarium solani Negative 58 Fusobacterium necrophorum Negative subsp. necrophorum 59 Fusobacterium nucleotum Negative subsp. nucleatum 60 Gardnerella vaginalis Negative 61 Giardia lamblia Negative 62 Gordonia ssp. Negative 63 Haemophilus ducreyi Negative 64 Haemophilus influenzae Negative 65 Haemophilus parainfluenzae Negative 66 Helicobacter mustelae Negative 67 Helicobacter pylori Negative 68 Helicobacter pylori Negative 69 Human adenovirus 40 Negative 70 Human adenovirus 41 Negative 71 Human herpesvirus 2 Negative 72 Kingella kingae Negative 73 Klebsiella oxytoca Negative 74 Klebsiella pneumoniae subsp. Negative pneumoniae 75 Kluyvera intermedia Negative 76 Lactobacillus acidophilus Negative 77 Lactobacillus casei Negative 78 Lactococcus sp. Negative 79 Listeria monocytogenes Negative 80 Micrococcus luteus Negative 81 Moraxella catarrhalis Negative 82 Morganella morganii subsp. morganii Negative 83 Neisseria lactamica Negative 84 Neisseria sicca Negative 85 Norovirus genogroup 2 Negative 86 Norovirus genogroup 2 Negative 87 Pasteurella multocida Negative 88 Peptostreptococcus micros Negative 89 Plesiomonas shigelloides Negative 90 Porphyromonas gingivalis Negative 91 Prevotella intermedia Negative 92 Prevotella loescheii Negative 93 Propionibacterium acnes Negative 94 Proteus mirabilis Negative 95 Proteus vulgaris Negative 96 Providencia rettgeri Negative 97 Providencia stuartii Negative 98 Pseudomonas aeruginosa Negative 99 Raoutella ornithinolytica Negative 100 Rhodococcus equi Negative 101 Rotavirus A Negative 102 Saccharomyces kudriaczevii Negative 103 Salmonella bongori Negative 104 Salmonella enterica subsp. enterica, Negative Typhimurium 105 Sapovirus Negative 106 Serratia liquefaciens Negative 107 Serratia marcescens subsp. marcescens Negative 108 Shigella boydii Negative 109 Staphylococcus aureus Negative 110 Staphylococcus epidermidis Negative 111 Staphylococcus lugdunensis Negative 112 Stenotrophomonas maltophilia Negative 113 Streptococcus agalactiae Negative 114 Streptococcus anginosus Negative 115 Streptococcus bovis Negative 116 Streptococcus dysgalactiae subsp. Negative equisimilis 117 Streptococcus oralis Negative 118 Streptococcus pneumoniae Negative 119 Streptococcus pyogenes Negative 120 Streptococcus salivarius Negative 121 Streptococcus viridans Negative 122 Streptococcus viridans Negative 123 Streptomyces spp. Negative 124 Vibrio parhaemolyticus Negative 125 Vibrio vulnificus Negative 126 Yersinia enterocolitica subsp. Negative enterocolitica 127 Yersinia pseudotuberculosis Negative

Functionality of Controls

    • Positive controls were detected as positive
    • Negative controls were detected as negative

Results

The cross-reactivity test showed no false positives.

TABLE 9 Oligonucleotide primers and probes. Internal modifica- 5′ 3′ Oligo Name Sequence 5′ → 3′ tion modification modification F_tcdb_01 GGAAGTGAATGTATATGAAAACC SEQ ID NO: 11 R_tcdb_01 GCCATTTTTTCTAACTGTTTTC SEQ ID NO: 12 P_tcdb_01_ AGAAAGGAGGATATATAAAAGAGTTTTAGC ZEN 6-FAM Iowa Black® FQ SEQ ID NO: 13 dq F_hyd_01 CGAACTTCCTCTATTAAAGC SEQ ID NO: 3 R_hyd_01 GTGCAATGTATCATCACTTTA SEQ ID NO: 4 P_hyd_01 AATCATTCGCACTATGAACAACCAATT ROX Iowa Black® RQ SEQ ID NO: 7 F_pct_01 ACGGAAACATCAAATAACG SEQ ID NO: 5 R_pet_01 GTACCTTTACCAATGTTATTATATG SEQ ID NO: 6 P_pct_03_ TCTGTAGATTTCGGTACGAAAACTTCA ZEN HEX Iowa Black® FQ SEQ ID NO: 8 dq S_pct_03 TCTGTAGATTTTGGTACGAAAACTTCA Iows Black® FQ SEQ ID NO: 9

TABLE 10 Amplicons amplified by the oligonucleotide sets. Name Sequence 5′ → 3′ Size bp C.dif_pct_hypV ACGGAAACATCAAATAACGAATTGACAATTTCTGTAGATTTCGGTAC 119 SEQ ID NO: 2 GAAAACTTCATGGGAAAGCAGCTTGGTAACCCAATTAAATGAAATA CCATATAATAACATTGGTAAAGGTAC C.dif_hydR_01 CGAACTTCCTCTATTAAAGCGAATGGGATTTTTTCTAACCAGCTACA 232 SEQ ID NO: 1 ATGTACCATTTTTCTACGTGTGTAATCATTCGCACTATGAACAACCAA TTCTATTATTTTTTCATTTGCTGTAAGGGTGTCATCAGCAACAAGATA CTCTAAAAAATTATTCATTTGTGAGTAAAGTTCTTTTGTGACACTTCT CAGTATATCTTCTTTAGTTTTAAAGTGATGATACATTGCAC C.dif_tcdB_short GGAAGTGAATGTATATGAAAACCTAAGTAGATATTAGTATATTTTAT 171 SEQ ID NO: 10 AAATAGAAAGGAGGATATATAAAAGAGTTTTAGCATTTAGATGTAA AAATATTCAATAAAAATATTATAGTAAAGGAGAAAATTTTATGAGTT TAGTTAATAGAAAACAGTTAGAAAAAATGGC

REFERENCES

  • Denéve, C, Janoira, C. Poilaneb, I., Fantinatob, C., and Collignon, A., New trends in Clostridium difficile virulence and pathogenesis, International Journal of Antimicrobial Agents, 2009 33:24-28.
  • Eastwood, K., Else P., Charlett, A., and Wilcox, MH., Comparison of Nine Commercially Available Clostridium difficile Toxin Detection Assays, a Real-Time PCR Assay for C. difficile tcdB, and a Glutamate Dehydrogenase Detection Assay to Cytotoxin Testing and Cytotoxigenic Culture Methods, J. Clin. Microbiol., October 2009, p. 3211-3217.
  • Hirvonen, J J., Mentula, S., Kaukoranta, S-S., Evaluation of a New Automated Homogeneous PCR Assay, GenomEra C. difficile, for Rapid Detection of Toxigenic Clostridium difficile in Fecal Specimens, J. Clin. Microbiol. 2013, 51(9):2908. DOI: 10.1128/JCM.01083-13.
  • Houser, BA., Hattel, A L., and Jayarao, BM, Real-Time Multiplex Polymerase Chain Reaction Assay for Rapid Detection of Clostridium difficile Toxin-Encoding Strains, Foodborne Pathogens And Disease, 2010, 7(6)-719-726.
  • Knetsch, CW., Hensgens, M P M., Harmanus, C., van der Bijl, MW., Savelkoul, P H M., Kuijper, E J., Corver J., and van Leeuwen, HC., Genetic markers for Clostridium difficile lineages linked to hypervirulence, Microbiology (2011), 157, 3113-3123.
  • Rupnik, M., Wilcox, M H. and Gerding, D N, Clostridium difficile infection: new developments in epidemiology and pathogenesis, Nature Reviews Microbiology 7, 526-536 (July 2009) p 526, doi:10.1038/nrmicro2164.

Claims

1.-20. (canceled)

21. An oligonucleotide primer set comprising a first oligonucleotide comprising or consisting of a nucleotide sequence of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 3, a second oligonucleotide comprising or consisting of a nucleotide sequence of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 4, wherein the oligonucleotide primer set amplifies a target sequence in the C. difficile hydR gene, and a probe, wherein the probe comprises one or more modified nucleotides and/or a fluorescent label, radiolabel, or phosphorescent label.

22. The oligonucleotide primer set according to claim 21, wherein the first oligonucleotide comprises the nucleotide sequence as set forth in SEQ ID NO: 3 and the second oligonucleotide comprises the nucleotide sequence as set forth in SEQ ID NO: 4.

23. The oligonucleotide primer set according to claim 22, wherein the first oligonucleotide consists of the nucleotide sequence as set forth in SEQ ID NO: 3 and the second oligonucleotide consists of the nucleotide sequence as set forth in SEQ ID NO: 4.

24. The oligonucleotide primer set according to claim 21, further comprising a probe comprising or consisting of a nucleotide sequence of at least 10 contiguous nucleotides as set forth in SEQ ID NO: 7.

25. The oligonucleotide primer set according to claim 24, wherein said probe sequence comprises or consists of the nucleotide sequence as set forth in SEQ ID NO: 7.

26.-37. (canceled)

38. An oligonucleotide probe comprising an oligonucleotide comprising or consisting of a nucleotide sequence of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 7, wherein the probe comprises one or more modified nucleotides and/or a fluorescent label, radiolabel, or phosphorescent label.

39.-40. (canceled)

41. A kit for detecting a hypervirulent Clostridium difficile strain in a biological sample, the kit comprising: the oligonucleotide primer set according to any one of claims 21-23; and a reagent for performing amplification on a nucleotide acid.

42. The kit according to claim 41, wherein the reagent is selected from the group consisting of: DNA polymerase, dNTPs, and a buffer.

43. An oligonucleotide primer set for generating an amplicon from a C. difficile hydR gene, wherein the primer set comprises a first primer comprising a nucleotide sequence consisting of SEQ ID NO: 3, a second primer wherein the second primer is from 10 to 21 contiguous nucleotides in length, and a probe, wherein the probe comprises one or more modified nucleotides and/or a fluorescent label, radiolabel, or phosphorescent label, and wherein the first and second primers are configured to amplify at least 50 nucleotides of SEQ ID NO: 1.

44. An oligonucleotide primer set for generating an amplicon from a C. difficile hydR gene, wherein the primer set comprises a first primer comprising a nucleotide sequence consisting of from 10 to 20 contiguous nucleotides, a second primer comprising a nucleotide sequence consisting of SEQ ID NO: 4, and a probe, wherein the probe comprises one or more modified nucleotides and/or a fluorescent label, radiolabel, or phosphorescent label, and wherein the first and second primers are configured to amplify at least 50 nucleotides of SEQ ID NO: 1.

45. The oligonucleotide primer set according to claim 22, wherein the probe comprises a nucleotide sequence of at least 10 contiguous nucleotides as set forth in SEQ ID NO: 7.

46. The oligonucleotide primer set according to claim 23, wherein the probe comprises a nucleotide sequence of at least 10 contiguous nucleotides as set forth in SEQ ID NO: 7.

47. The oligonucleotide primer set according to claim 43, wherein the probe comprises a nucleotide sequence of at least 10 contiguous nucleotides as set forth in SEQ ID NO: 7.

48. The oligonucleotide primer set according to claim 44, wherein the probe comprises a nucleotide sequence of at least 10 contiguous nucleotides as set forth in SEQ ID NO: 7.

Patent History
Publication number: 20230323478
Type: Application
Filed: Dec 22, 2022
Publication Date: Oct 12, 2023
Applicant: Mobidiag Ltd (Espoo)
Inventors: Juha Kirveskari (Espoo), Jaakko Kurkela (Espoo)
Application Number: 18/087,603
Classifications
International Classification: C12Q 1/689 (20060101);