plant named ‘Tonda Pacifica’

A new and distinct cultivar of Corylus plant named ‘Tonda Pacifica’ is provided.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description

Latin name of the genus and species of the plant claimed: Corylus avellana.

Variety denomination: ‘Tonda Pacifica’.

BACKGROUND OF THE INVENTION

The present invention relates to a new and distinct cultivar of Corylus plant (hazelnut, filbert), botanically known as Corylus avellana, and hereinafter referred to by the name ‘Tonda Pacifica.’

The new Corylus resulted from a controlled cross of female parent ‘Tonda Gentile delle Langhe’ and male parent OSU 23.024 made in 1981 by Maxine M. Thompson. Neither parent was protected by a plant patent. Hybrid seeds from the cross were harvested in August 1981, stratified, and seedlings grown in the greenhouse during the summer of 1982. From this cross, total of 95 seedling trees were planted in the field in Corvallis in October, 1982. ‘Tonda Pacifica’ was discovered and selected as a single plant within the progeny of the stated cross-pollination in a controlled environment in Corvallis, Oreg., USA. It was originally assigned the designation OSU 228.084, which indicates the row and tree location of the original seedling. ‘Tonda Gentile delle Langhe’ is an important cultivar in Piemonte, northern Italy. The male parent, OSU 23.024, is from a controlled cross of ‘Barcelona’ and ‘Extra Ghiaghli’. ‘Extra Ghiaghli’, obtained as scions from Greece, is a clone of the important Turkish cultivar ‘Tombul’.

The new cultivar was asexually reproduced by rooted suckers annually for seven years in Corvallis, Oreg. The new cultivar was also asexually propagated by whip grafting in Corvallis, Oreg. The unique features of this new Corylus are stable and reproduce true-to-type in successive generations of asexual reproduction.

SUMMARY OF THE INVENTION

The following traits have been observed and are determined to be the unique characteristics of ‘Tonda Pacifica.’ These characteristics in combination distinguish ‘Tonda Pacifica’ as a new and distinct cultivar:

    • 1. Globose plant habit.
    • 2. Yellowish-green developing and fully expanded leaves during the spring and summer.
    • 3. Susceptibility to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Müller.
    • 4. Absence of random amplified polymorphic DNA markers 152-800 and 268-580 in DNA of ‘Tonda Pacifica’ amplified by the polymerase chain reaction (PCR). These two markers are linked to a dominant allele for resistance to eastern filbert blight from the cultivar Gasaway, not patented.
    • 5. Expression of incompatibility alleles S1 and S2 in the styles.
    • 6. DNA fingerprints at 28 microsatellite marker loci differ from its parent ‘Tonda Gentile delle Langhe’ and grandparents ‘Barcelona’ and ‘Extra Ghiaghli’. The microsatellite primers are shown in Table 1, and allele sizes are shown in Table 2.

Comparisons in three replicated trials conducted in Corvallis, Oreg., plants of the new Corylus differed from plants of the Corylus avellena cultivar ‘Tonda Gentile delle Langhe’, not patented, and other cultivars and selections of Corylus avellena known to the Inventors primarily in nut size, nut shape, kernel percentage (ratio of kernel weight to nut weight), frequency of blank nuts (nuts lacking kernels), time of pollen shed, time of nut maturity, length of the husk or involucre, and plant size. ‘Tonda Pacifica’ combines the high kernel quality of its parent ‘Tonda Gentile delle Langhe’ with higher yields, thinner shells, and lower susceptibility to bud mites (primarily Phytoptus avellanae Nal.).

BRIEF DESCRIPTION OF THE PHOTOGRAPHS

The accompanying colored photographs illustrate the overall appearance of the new cultivar, showing the colors as true as it is reasonably possible to obtain in colored reproductions of this type.

The photograph on the first sheet comprises a side perspective view of a typical plant of ‘Tonda Pacifica’ in Corvallis, Oreg.

The photograph on the second sheet shows typical nuts, raw kernels, and blanched kernels of ‘Tonda Pacifica’.

DETAILED DESCRIPTION OF THE INVENTION

The cultivar ‘Tonda Pacifica’ has not been observed under all possible environmental conditions. The phenotype may vary somewhat with variations in environment such as temperature and light intensity, without, however, any variance in genotype. The aforementioned photographs and following observations and measurements describe plants grown in Corvallis, Oreg. under commercial practice outdoors in the field during the fall, winter, and spring. Plants used for the photographs and description were about twelve years old. In the following description, color references are made to The Royal Horticultural Society Colour Chart, 1966 Edition, except where general terms of ordinary dictionary significance are used. The following description is based on self-rooted trees growing in Corvallis, Oreg. For grafting, the rootstocks were cv. ‘Montebello’, not patented, propagated by tie-off layerage (stooling).

  • Botanical classification: Corylus avellana cultivar ‘Tonda Pacifica.’
  • Parentage:
      • Female, or seed, parent.—Corylus avellana ‘Tonda Gentile delle Langhe’, not patented.
      • Male, or pollen, parent.—Corylus avellana selection OSU 23.024, not patented.
  • Propagation:
      • Type.—Rooted suckers.
      • Time to initiate roots.—About 30 days at 20° C.
      • Time to produce a rooted young plant.—About six months at 22° C.
      • Root description.—Fine to thick; freely branching; creamy white in color.
      • Type.—Whip grafting.
      • Time to budbreak on the scions.—About 14 days at 25° C.
      • Time to produce a grafted plant.—About six months at 25° C.
  • Plant description:
      • General appearance.—Perennial shrub. Globose plant habit, with slightly pendulous shoots.
      • Growth and branching habit.—Freely branching; about 15 lateral branches develop per plant. Pinching, i.e., removal of the terminal apices, enhances branching with lateral branches potentially forming at every node. Moderately vigorous growth habit.
      • Plant height.—About 5 meters.
      • Plant diameter or spread.—About 5 meters.
      • Lateral branch description.—Length: About 20 cm. Diameter: About 6 mm. Internode length: About 3.6 cm. Texture: Smooth, glabrous. Strength: Strong. Color, immature: 146C. Color, mature: 195A.
  • Foliage description:
      • Arrangement.—Alternate, simple.
      • Length.—About 11 cm.
      • Width.—About 10 cm.
      • Shape.—Oblong to ovate.
      • Apex.—Obtuse to acute.
      • Base.—Cordate.
      • Margin.—Serrate.
      • Texture, upper and lower surfaces.—Slightly pubescent.
      • Venation pattern.—Pinnate.
      • Color.—Developing foliage, upper and lower surfaces: 144A. Fully expanded foliage, upper surface: Spring and summer, 136A; late summer and fall, 136A. Fully expanded foliage, lower surface: Spring and summer, 137C; late summer and fall, 137C. Venation, upper surface: Spring and summer, 139A; late summer and fall, 139A. Venation, lower surface: Spring and summer, 139C; late summer and fall, 139C.
      • Petiole.—Length: About 11 mm. Diameter: About 1.9 mm. Texture, upper and lower surfaces: Pubescent. Color, upper surface: Spring and summer, 146D; late summer and fall, 146D. Color, lower surface: Spring and summer, 146D; late summer and fall, 146D.
  • Flower description: Male inflorescences are catkins, color prior to elongation 194C. Female inflorescence style color 048C.
  • Nuts description:
      • Length.—About 19 mm. Width: About 18 mm. Depth: About 16.5 mm. Shape: Round. Nut shape index [(Width+Depth)/2*Length]=0.91. Nut compression index (Width/Depth)=1.09. Nut shell color: 164A. Nut weight: About 2.24 grams. Kernel weight: About 1.06 grams. Kernel percentage (kernel weight/nut weight): About 47%.
  • Disease/pathogen/pest resistance: Plants of the new Corylus are susceptible to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Muller. Plants of the new Corylus are moderately resistant to bud mites (Phytoptus avellanae Nal.), while plants of ‘Tonda Gentile delle Langhe’ are highly susceptible, and plants of ‘Barcelona’ are highly resistant.
  • Temperature tolerance: Plants of the new Corylus have been observed to tolerate temperatures from about −10° C. to about 38° C. in the field in Corvallis, Oreg.

Nut yields of ‘Tonda Pacifica’ are similar or slightly higher than nut yields for ‘Barcelona’. Since ‘Tonda Pacifica’ trees are smaller than ‘Barcelona’ trees, the nut yield efficiency for ‘Tonda Pacifica’ is significantly higher than that for ‘Barcelona’. The nuts of ‘Tonda Pacifica’ are borne in clusters of 3-4 in husks 75 to 100% longer than the nuts. The husks are slit down the side and the nuts fall free at maturity. The harvest date for the nuts of ‘Tonda Pacifica’ is estimated to be 7-10 days before ‘Barcelona’. ‘Tonda Pacifica’ produces fewer blank nuts and fewer defects than ‘Barcelona’. Raw kernels have a moderate amount of fiber attached to the pellicle, which can be mostly removed by light roasting and rubbing. Blanching scores for ‘Tonda Pacifica’ are better than for ‘Barcelona’ and ‘Tonda Gentile delle Langhe’.

Fingerprinting with microsatellite markers, also known as simple sequence repeat (SSR) markers, was performed. Twenty nine marker loci (Table 1) were selected from those published for hazelnut (Bassil et al. (2005) J. Amer. Soc. Hort. Sci., 130:543-549; Bassil et al. (2005) Acta Hort., 686:105-110; Boccacci et al. (2005) Molec. Ecol. Notes, 5:934-937; Gürcan et al. (2010) Tree Genetics and Genomes (available on-line as DOI 10.1007/s11295-010-0269-y); Gürcan et al. (2010) Molecular Breeding, 26:551-559). SSR markers have been used for fingerprinting hazelnut accessions (Boccacci et al. (2006) Genome 49:598-611; Gökirmak et al. (2009) Genetic Resources and Crop Evolution, 56:147-172; Gürcan et al. (2010) Plant Breeding, 129:422-434). Using primers designed for each SSR loci, hazelnut DNA was amplified by PCR. One of the two primers was fluorescently labeled with FAM, HEX, or NED, and the size of the amplified fragment was determined by capillary electrophoresis on an ABI 3100 instrument (Applied Biosystems; Foster City, Calif.). ‘Tonda Pacifica’ was found to exhibit different allele sizes at certain loci that allowed for it to be distinguish from other hazelnut genotypes such as its parent ‘Tonda Gentile delle Langhe’ and its grandparents ‘Barcelona’ and ‘Extra Ghiaghli’ (Table 2).

TABLE 1 Primers and annealing temperatures for the 29 microsatellite marker loci used to fingerprint ‘Tonda Pacifica’ and five other hazelnut cultivars. Locus Tm Allele Sizes Repeat Motif A613 60 149-177 (TC)13(CA)12 A614 60 125-156 (TC)17(CA)10NNN(CA)6 A616 60 136-162 (AC)11 A640 67 354-378 (CT)15(CA)13 B029b 58 114-136 (GA)13 B619 60 146-180 (TC)21 B628 60 290-312 (TC)7NN(CT)6 B634 60 218-238 (AG)15 B657 60 210-228 (AG)15 B664 60 186-216 (TC)21 B665 60 177-203 (CT)17 B670 60 153-182 (GA)19 B671 60 221-249 (AG)6NN(GA)17 B706 60 168-206 (CT)28 B720 60 159-179 (AG)14 B732 60 140-156 (GA)13 B733 60 161-183 (TC)15 B741 60 176-194 (GT)5(GA)12 B749 60 200-210 (TC)12 B751 60 141-153 (GA)15 B758 60 154-176 (CT)15 B767 60 198-238 (TC)15(AT)7 B776 60 134-148 (GA)17 B795 60 296-332 (TC)8Ns(CT)7Ns(CT)10Ns (TC)5 C115 60 167-225 (TAA)5(GAA)12 KG807 54 226-248 (TAAA)AA(TAAA)2A (TAAA)2 KG810 56 366-392 (AG)15 KG827 67 264-282 (CT)13AA(CA)7 KG830 67 279-311 (CT)14GTATT(CA)8 Forward Primer (5′-3′) Reverse Primer (5′-3′) Locus (SEQ ID NO) (SEQ ID NO) A613 Ned-CACACGCCTTGTCAC R- TCTTT (1) CCCCTTTCACATGTTTGCTT (30) A614 Hex- R- TGGCAGAGCTTTGTCAG GCAGTGGAGGATTGCTGA CTT (2) CT (31) A616 Fam- R- CACTCATACCGCAAAC ATGGCTTTTGCTTCGTTTTG TCCA (3) (32) A640 F- Fam- TGCCTCTGCAGTTAGTCA CGCCATATAATTGGGATG TCAAATGTAGG (4) CTTGTTG (33) B029b Ned- R-AAGTTCACCCAAGAAATC CAATTTACACCTCAGGG CAC (34) AAGAG (5) B619 Fam- R- AGTCGGCTCCCCTTTTCTC GCGATCTGACCTCATTTTTG (6) (35) B628 Fam-AATCCCCTCTAGCCC R-CACAGAATATTTGTAATT CATTA (7) ACCACCACA (36) B634 Hex-CCTGCATCCAGGACT R- CATTA (8) GTGCAGAGGTTGCACTCA AA (37) B657 Ned- R- GAGAGTGCGTCTTCCT AGCCTCACCTCCAACGAAC CTGG (9) (38) B664 Ned- R- CAAAGCCGTCGACAACAG TTTGCATTTGATGCCGATAA (10) (39) B665 Hex- R- GCAACCACCAAATTGC GCTTTTAAAGTCCACGCAT ACTA (11) GA (40) B670 Fam- R- CAACACTCACGTTTGG TCTGTGTTGTTGGGAGTGGA TTGC (12) (41) B671 Hex- R- TTGCCAGTGCATACTCT ACCAGCTCTGGGCTTAACAC GATG (13) (42) B706 Fam- R-AGCAAAGAGGTAAGCAA TGCATGAAATGGAATCA ATTCA (43) CAGA (14) B720 Fam- R- CTCTGTGTCGGCTTTC ATAAACCTCACGCCACACCT TGGT (15) (44) B732 Fam- R- GCCCTTCTTCTTTTCTG AGTGCCACCTCAACAAAT CAA (16) CC (45) B733 Ned- R- CACCCTCTTCACCACC CATCCCCTGTTGGAGTTTTC TCAT (17) (46) B741 Fam- R- GTTCACAGGCTGTTGG CGTGTTGCTCATGTGTTGTG GTTT (18) (47) B749 Hex- R- GGCTGACAACACAGCA TCGGCTAGGGTTAGGGTTTT GAAA (19) (48) B751 Fam- R-AAACTCAAATAAAACCCC AGCTGGTTCTTCGACA TGCTC (49) TTCC (20) B758 Fam- R- TAATTTAAGCTGCCGT TGCAAAATTGCATTGCTCAT GCAA (21) (50) B767 Fam- R- CCACCAACTGTTTCAC GCGAAATGGAGCTCTTGA ACCA (22) AC (51) B776 Fam- R- TGTATGTACACACGGA TGAGGGGAAGAGGTTTGA GAGAGAGA (23) TG (52) B795 Fam- R- GACCCACAAACAATAAC TGGGCATCATCCAGGTCTA CTATCTC (24) (53) C115 Fam- R-TCCAGATCTGCCTCCATA CATTTTCCGCAGATAAT TAAT (54) ACAGG (25) KG807 AAGCAAGAAAGGGATGG Fam- T(26) CTTACAGATAAATGGCT CAAA (55) KG810 TCCTCACCAATCACACTA Ned- TTT (27) TTATTCCACCAAAGTCTA CCTC (56) KG827 Fam- R-GAGGGAGCAAGTCAAAG AGAACTCCGACTAATAA TTGAGAAGAAA (57) TCCTAACCCTTGC (28) KG830 Ned- R-AAAGCAACTCATAGCTGA TGGAGGAAGTTTTGAATG AGTCCAATCA (58) GTAGTAGAGGA (29) Tm = annealing temperature. One of the two primers at each locus had a fluorescent label (Fam, Hex or Ned) to allow sizing with capillary electrophoresis.

TABLE 2 Allele sizes in ‘Tonda Pacifica’ and five other hazelnut cultivars at 29 microsatellite loci. The female parent of ‘Tonda Pacifica’ is ‘Tonda Gentile delle Langhe’. The male parent is OSU 23.024, which is from a cross of ‘Barcelona’ x ‘Extra Ghiaghli’. Note that one of the alleles of ‘Tonda Pacifica’ is from ‘Tonda Gentile delle Langhe’, and the other is from either ‘Barcelona’ or ‘Extra Ghiaghli’. Cultivar Tonda Micro- Gentile satellite Tonda delle Extra Locus Pacifica Langhe Barcelona Ghiaghli Clark Lewis A613 157/167 151/157 151/159 167/169 151/177 151/177 A614 134/148 125/134 125/131 125/148 131/131 131/148 A616 148/158 148/150 142/150 150/158 148/150 148/150 A640 368/374 354/368 354/374 374/374 354/354 354/354 B029b 118/120 120/124 124/130 118/132 124/130 124/124 B619 164/170 148/164 156/170 164/174 156/168 156/168 B628 297/297 297/299 293/297 293/297 297/297 293/297 B628 298/298 298/300 294/298 294/298 298/298 294/298 B634 226/226 226/226 226/226 226/226 230/234 226/234 B657 210/226 218/226 218/222 210/222 210/218 214/222 B664 186/206 186/206 206/214 206/208 192/204 188/208 B665 178/185 185/189 189/195 178/189 195/195 193/195 B670 169/182 159/182 153/159 169/177 173/177 159/173 B671 227/237 237/241 223/227 227/247 223/247 223/223 B706 174/206 190/206 168/190 172/174 190/200 190/200 B720 161/167 167/167 161/167 165/179 159/159 159/179 B732 140/154 140/154 150/154 140/154 150/154 150/150 B733 171/173 171/173 171/173 171/171 171/179 173/179 B741 176/186 176/184 176/186 176/184 176/186 176/186 B749 206/208 206/208 208/208 208/208 208/208 206/208 B751 143/153 149/153 143/153 143/147 147/151 151/153 B758 160/160 160/168 168/168 160/160 168/168 168/168 B767 198/216 211/216 211/237 198/204 204/235 211/235 B776 136/136 136/136 134/136 134/136 136/136 136/136 B795 312/330 312/330 330/330 296/310 330/330 330/330 C115 173/182 173/173 193/193 182/193 193/193 193/193 KG807 246/248 234/248 234/248 248/250 226/248 234/248 KG810 378/382 374/378 374/378 378/382 378/380 378/382 KG827 268/282 268/268 280/282 276/282 270/276 270/280 KG830 291/295 291/295 291/295 289/295 295/303 291/303

Claims

1. A new and distinct Corylus plant named ‘Tonda Pacifica’ as illustrated and described.

Patent History
Patent number: PP22715
Type: Grant
Filed: Dec 16, 2010
Date of Patent: May 8, 2012
Assignee: The State of Oregon, Acting by & Through the State Board of Higher Education, Orgeon State University (Corvallis, OR)
Inventor: Shawn A. Mehlenbacher (Corvallis, OR)
Primary Examiner: Annette Para
Attorney: Dann, Dorfman, Herrell & Skillman
Application Number: 12/928,688
Classifications
Current U.S. Class: Nut (including Ornamental Variety) (PLT/152)
International Classification: A01H 5/00 (20060101);