Abstract: This invention relates to base ester compounds and complex ester compounds that can be used as a base stock for lubricant applications or a base stock blend component for use in a finished lubricant or for particular applications, and methods of making the same. The base ester compounds and complex esters described herein comprise dimer and/or trimer esters, and their respective branched derivatives.

Abstract: Lubricants based on renewable feedstocks and methods of making them.

Abstract: A method of improving air release in lubricant base stocks and lubricating oils is provided. The method includes providing a Group I base stock, a Group II base stock or a combination thereof and adding to the base stock an effective amount of C7 to C80 paraffin, wherein the lubricant base stock provides air release according to the ASTM D3427 test at least 20% lower than the same lubricant base stock not including the C7 to C80 paraffin. Also provided are lube base stocks and lubricating oils with improved air release and methods of making such base stocks and oils.

Abstract: To provide is a lubricating oil composition capable of exerting an improved fuel-saving performance and having an improved shear stability. The lubricating oil composition comprises (A) a mineral base oil having kinematic viscosity at 100° C. of no more than 5 mm2/s and % CP of no less than 90; and (B) a polymer having weight average molecular weight of no more than 15000.

Abstract: Embodiments of the present invention may include a macro-composition with a special structure. The structure includes a layered macro-composition made of a nanoparticle as an inner nucleus, an intermediate layer around the nucleus, and an outer layer intercalated with the nucleus or encapsulating the nucleus and the intermediate layer. A plurality of the layered macro-compositions is bonded together by bonds, so that each layered macro-composition is bonded to at least one other such layered macro-composition. Embodiments include a macro-composition made of three 3-layered macro-compositions joined in a chain by two bonds. These macro-composition assemblies may take the shape of layered macro-compositions bonded together in chains, or forming other shapes, such as rings. The layered macro-composition may be no more than about 100 nanometers in size, for example. The bonds of the complex macro-composition may have an average length of no more than about 100 nanometers, for example.

Abstract: A lubricating oil composition for an internal combustion engine containing a mixed base oil (AB) including a mixture of a base oil (A) being a mineral oil and/or a synthetic oil with a kinematic viscosity at 100° C. of not more than 3.5 mm2/s and a base oil (B) being a mineral oil and/or a synthetic oil with a kinematic viscosity at 100° C. of more than 3.5 mm2/s, wherein the ratio of the base oil (A) to the entire base oil is not more than 40 mass %, a calcium salicylate-based detergent (C) in 0.05 mass % to 0.5 mass % as a calcium amount based on the total amount of the composition, and a calcium sulfonate-based detergent (D) in 0.002 mass % to 0.2 mass % as a calcium amount based on the total amount of the composition.

Abstract: The invention provides a lubricating composition containing (a) a polymer derived from greater than 50 wt % or more of a non-diene monomer, wherein the polymer has a weight average molecular weight of about 2000 to about 200,000, and wherein the polymer has a shear stability index of about 0 to about 25; (b) a phosphorus-containing acid, salt, or ester; (c) an extreme pressure agent, other than a phosphorus-containing acid, salt, or ester; and (d) an oil of lubricating viscosity. The invention further provides a method for lubricating a mechanical device with the lubricating composition.

Abstract: The invention provides a lubricating composition containing a compound comprising the reaction product of a polyolefin, an ethylenically unsaturated aromatic acylating agent (or carboxylic reactant), and an amine, and an oil of lubricating viscosity. The invention further relates to the use of the lubricating composition in an internal combustion engine.

Abstract: The present disclosure relates to conveyor lubricant compositions including an emulsion. The present disclosure also relates to methods of employing such lubricant compositions. In an embodiment, the methods include applying the present lubricant composition to a conveyor with a non-energized nozzle. In an embodiment, the methods include applying the present lubricant composition in a “semi-dry” mode.

Abstract: The present invention provides methods for the isolation of oils from intact or lysed microorganisms in aqueous media with pressurized carbon dioxide as a solute. Such oils may be used for the production of biofuels. Also provided for are methods for harvesting and rupturing whole cell microorganisms in aqueous media with pressurized carbon dioxide as a solute.

Abstract: A substantially pure Candida host cell is provided for the biotransformation of a substrate to a product wherein the host cell is characterized by a first genetic modification class that comprises one or more genetic modifications that collectively or individually disrupt at least one alcohol dehydrogenase gene in the substantially pure Candida host cell.

Abstract: The present invention provides an aqueous gel composition for removing actinide ions, lanthanide ions, fission product ions, or a combination thereof from a porous surface contaminated therewith. The composition comprises a polymer mixture comprising a gel forming cross-linked polymer and a linear polymer. The linear polymer is present at a concentration that is less than the concentration of the cross-linked polymer. The polymer mixture is at least about 95% hydrated with an aqueous solution comprising about 0.1 to about 3 percent by weight (wt %) of a multi-dentate organic acid chelating agent, and about 0.02 to about 0.6 molar (M) carbonate salt, to form a gel. When applied to a porous surface contaminated with actinide ions, lanthanide ions, and/or other fission product ions, the aqueous gel absorbs contaminating ions from the surface.

Abstract: The present invention is directed to fluid fabric enhancing compositions and processes of making and using same. Such fluid fabric enhancing compositions have a desirable fabric enhancer active efficiency that is, at least in part, due to the particle index of such fluid fabric enhancing compositions. Certain chemical processing and physical processing methods are not required to produce such compositions.

Abstract: Provided in part herein are compositions that include isolated microbial enzymes, such as amylases, lipases, and proteases that are useful as detergent additives. Also provided are methods of isolating amylases, lipases, and proteases from microbes, as well as methods of using these enzymes as detergent additives, and for stain removal.

Abstract: In one embodiment, a liquid or flowable cleansing or skin treatment composition is described which is substantially nonaqueous and which has a continuous and a discontinuous phase. Components of the discontinuous phase can chemically react with each other or with water when water is blended with the nonaqueous cleansing or skin treatment composition during consumer use. In a second embodiment, a solidified cleansing or skin treatment composition is described which contains components that can chemically react with each other or with water when water is blended with the solidified cleansing composition during consumer use. Methods for treating the skin with the inventive compositions are also described.

Abstract: The present invention relates to agents and processes for the improved production of beer and mixed beer beverages, wherein the main fermentation is shortened and the formation of vicinal diketones is reduced.

Abstract: The present invention relates to yeast strains and, in particular, to yeast stains for use in fermentation processes. The invention also relates to methods of fermentation using the yeast strains of the invention either alone or in combination with other yeast strains. The invention thither relates to methods for the selection of yeast strains suitable for fermentation cultures by screening for various metabolic products and the use of specific nutrient sources.

Abstract: The present invention relates to multilayered structures. In various embodiments, the present invention provides an at least partially transparent multilayered structure that includes at least one first layer including at least one polyolefin, and at least one second layer including at least one of a cyclic olefin copolymer and a cyclic olefin polymer. In various embodiments, the present invention provides methods of making such multilayered structures, and photobioreactors having compartments including such multilayered structures.

Abstract: The invention relates to the use of at least one chelating agent, including an iron chelating agent, in order to stimulate the growth of magnetotactic bacteria.

Abstract: The present invention concerns methods for deriving and culturing embryonic cells and in particular to methods for maintaining the undifferentiated state of stems cells and cell lines in culture. The invention also concerns cells and cell lines derived by the methods of the invention.

Abstract: The present invention provides a neutralized glucomannan scaffold capable of promoting cell growth and suitable for three-dimensional tissue culture and engineering. The present invention also provides methods for making and degrading the neutralized glucomannan scaffold. The present invention further provides a method of growing cells on a neutralized glucomannan scaffold.

Abstract: Disclosed is a method for inducing stem cells to differentiate into retinal cells at high yield within a short period of time, without gene implantation and co-culture with retinal tissues, by implementing a differentiation process similar to the in vivo embryonic development in chemically defined conditions. Also, retinal cells including the photoreceptor cells and their progenitor cells, and various types of other retinal cells, generated according to the method, are disclosed. A composition comprising the retinal cells and a method are provided for treating retinal degeneration-related diseases. The differentiated photoreceptor cells, when transplanted into degenerated or injured retinas, can be engrafted and fused within the retinas to prevent or cure retinal degeneration.

Abstract: The invention relates to purified, tissue-specific progenitors, methods of making and using such tissue-specific progenitors.

Abstract: An artificial tissue capable of carrying necessary nutrients for maintaining activities of cells and tissues, and method of manufacturing artificial blood vessel. A plurality of forms of blood vessels are extracted from an image of living tissue and made into blood vessel form image. Each of the blood vessel forms of the blood vessel form image is adjusted and a blood vessel formation pattern is formed. A blood vessel cell culturing pattern of forming is formed, in a cell culturing layer. The blood vessel cell culturing pattern includes: a cell adhesion portion having adhesive properties with blood vessel cell and formed to the blood vessel formation pattern; and a cell adhesion-inhibiting portion having cell adhesion-inhibiting properties for inhibiting adhesion with a blood vessel cell and formed in an area other than the cell adhesion portion. A blood vessel cell is adhered to the cell adhesion portion, and cultured into tissue.

Abstract: Disclosed is a method for preparation of transmissible spongiform encephalopathy (TSE) susceptible cells, and such cells may be efficiently used in diagnosis of TSE, etiology studies and development of novel therapeutics, etc.

Abstract: Provided is a modified bacteriophage capable of infecting a target bacterium, which bacteriophage includes an ?/? small acid-soluble spore protein (SASP) gene encoding a SASP which is toxic to the target bacterium, wherein the SASP gene is under the control of a constitutive promoter which is foreign to the bacteriophage and the SASP gene.

Abstract: The invention provides isolated nucleic acid molecules which encode novel fatty acid desaturase family members. The invention also provides recombinant expression vectors containing desaturase nucleic acid molecules, host cells into which the expression vectors have been introduced, and methods for large-scale production of long chain polyunsaturated fatty acids (LCPUFAs), e.g., DHA.

Abstract: MT-SP1 mutein proteases with altered specificity for the target molecules they cleave can be used to treat human diseases, such as cancer. Cleaving VEGF or VEGFR at certain substrate sequences with wild-type and mutein MT-SP1 proteases can be used to treat pathologies associated with angiogenesis.

Abstract: Engineered transcriptional activator-like effectors (TALEs) are versatile tools for genome manipulation with applications in research and clinical contexts. One current drawback of TALEs is their tendency to bind and cleave off-target sequence, which hampers their clinical application and renders applications requiring high-fidelity binding unfeasible. This disclosure provides engineered TALE domains and TALEs comprising such engineered domains, e.g., TALE nucleases (TALENs), TALE transcriptional activators, TALE transcriptional repressors, and TALE epigenetic modification enzymes, with improved specificity and methods for generating and using such TALEs.

Abstract: Collection devices and kits for biological sample collection include a biologic sample collection device having a hydrophilic swab matrix that includes a modified polycaprolactone (PCL). Methods of production and use thereof are also described herein. The biologic sample collection devices, kits and methods described herein are used to collect a biologic sample (e.g., blood, buccal cells, etc.) and to enable extraction of nucleic acids (e.g., DNA) from that biologic sample so that the nucleic acids can be analyzed (e.g., sequencing and subsequent analyses of DNA).

Abstract: The present invention features a number of methods for identifying one or more compounds that bind to a biological target. The methods include synthesizing a library of compounds, wherein the compounds contain a functional moiety having one or more diversity positions. The functional moiety of the compounds is operatively linked to an initiator oligonucleotide that identifies the structure of the functional moiety.

Abstract: The present invention relates to immunostimulatory oligodeoxynucleotides, vectors and vaccines comprising such oligodeoxynucleotides, to their use as a medicament, to their use in preventing or combating infectious disease, to methods for the detection of such oligodeoxynucleotides and to cells to be used in these methods.

Abstract: The present invention encompasses a class of compounds known as splice modulating oligonucleotides (SMOs) that modulate pre-mRNA splicing, thereby affecting expression and functionality of a specific protein in a cell. The present invention further provides compositions and methods for modulating pre-mRNA splicing using a SMO of the invention to abrogate disease-causing mutations in a protein. Accordingly, the present invention provides compositions and methods of treating a subject at risk of, susceptible to, or having a disease, disorder, or condition associated with aberrant or unwanted target pre-mRNA expression or activity.

Abstract: The present invention relates to an inhibitor of the expression of IRS-1 for treating an angiogenic and/or inflammatory skin disease. The present invention also relates to a transdermal composition, preferably an ointment, comprising an inhibitor of the expression of IRS-1, and to the use thereof for treating an angiogenic and/or inflammatory skin disease.

Abstract: Methods of treating cancer using antisense oligonucleotides directed against DNA double-strand break repair proteins such as BRCA2 or RAD51 are provided. The antisense oligonucleotides can be used alone, in tandem or in combination with other cancer therapies, in particular with therapies that lead to DNA damage, inhibition of DNA repair or inhibition of DNA synthesis, such as radiation, platinum drugs, alkylating agents, PARP inhibitors, or inhibitors of thymidylate synthase.

Abstract: The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.

Abstract: Use of an agent which upregulates an activity or amount of miRNA-9 or miRNA-9* is disclosed for the preparation of a medicament for the treatment of a motor neuron disease (MND).

Abstract: Disclosed herein are antisense compounds and methods for decreasing STAT3 mRNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate hyperproliferative diseases.

Abstract: Provided herein are methods for the treatment of Alport Syndrome, using modified oligonucleotides targeted to miR-21. In certain embodiments, a modified oligonucleotide targeted to miR-21 improves kidney function and/or reduces fibrosis in subjects having Alport Syndrome. In certain embodiments, administration of a modified oligonucleotide targeted to miR-21 delays the onset of end-stage renal disease in a subject having Alport Syndrome. In certain embodiments, a modified oligonucleotide targeted to miR-21 delays the need for dialysis or kidney transplant in a subject having Alport Syndrome.

Abstract: A method for purifying GLA-domain coagulation proteins, includes the following steps: a) bringing a sample containing one or more GLA-domain coagulation proteins into contact with an affinity substrate on which nucleic aptamers which bind specifically to the GLA-domain coagulation proteins are immobilized, in order to form complexes between (i) the nucleic aptamers and (ii) the GLA-domain coagulation protein(s), b) releasing the GLA-domain coagulation protein(s) from the complexes formed in step a), and c) recovering the GLA-domain coagulation protein(s) in a purified form.

Abstract: The invention relates, inter alia, to novel genetically modified microorganisms capable of using CO to produce 1-butanol and/or a precursor thereof, novel methyltransferases and nucleic acids encoding same, methods for producing genetically modified microorganisms using said novel methyltransferases, and methods of producing 1-butanol and/or a precursor thereof by microbial fermentation.

Abstract: The invention relates to a nucleic acid sequence encoding an itaconate transporting Major Facilitator Superfamily Transporter (MFST) gene sequence and the protein encoded thereby. Preferably said sequence is the nucleic acid that comprises the sequence of ATEG_09972.1 of Aspergillus terreus or homologues thereof. Overexpression of the protein enhances the production of itaconic acid in micro-organisms.

Abstract: The present invention relates to a yeast cell, in particular a recombinant yeast cell, the cell lacking enzymatic activity needed for the NADH-dependent glycerol synthesis or the cell having a reduced enzymatic activity with respect to the NADH-dependent glycerol synthesis compared to its corresponding wild-type yeast cell, the cell comprising one or more heterologous nucleic acid sequences encoding an NAD+-dependent acetylating acetaldehyde dehydrogenase (EC 1.2.1.10) activity. The invention further relates to the use of a cell according to the invention in the preparation of ethanol.

Abstract: The present disclosure relates to a novel class of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzymes, which enzymes are identifiable both by conserved amino acid sequence motifs (primary structure) and secondary and tertiary structural elements. Also disclosed are nucleic acids useful in encoding the novel EPSPS enzymes.

Abstract: The present invention relates to plants having increased pre-formed defense, their production and uses. The invention more particularly discloses plants which overexpress a p33kD or BURP protein, or an ortholog thereof, and exhibit an increased pre-formed resistance to pathogens.

Abstract: Provided herein is a synthetic or isolated polynucleotide encoding a mammalian 18S rRNA that is resistant to pactamycin. The pactamycin-resistance is conferred by one or more single residue substitutions in the 18S rRNA sequence; a fragment thereof harboring said substitutions; a complementary sequence thereto; or a substantially identical sequence of the foregoing. Related systems, methods and kits are also described.

Abstract: The present invention describes new mammalian expression vectors comprising a novel combination of regulatory elements and one or more selection marker gene(s). The vector allows for incorporation of at least one, preferably two or more genes of interest, its/their subsequent expression, and for selection of transfected cells using, e.g., G418 and/or MTX. The pDGP?GOI vector as an example for a mammalian expression vector according to the present invention exhibits a 9555 bp sequence, one strand of which is represented by SEQ ID NO:2.

Abstract: A recombinant vector comprises simian adenovirus SAdV-39, -25.2, -26, -30, -37, and -38 sequences and a heterologous gene under the control of regulatory sequences. A cell line which expresses simian adenovirus SAdV-39, -25.2, -26, -30, -37, and -383 gene(s) is also disclosed. Methods of using the vectors and cell lines are provided.

Abstract: Described are processes for the liquefaction of lignocellulosic biomass under the digestive action of dicarboxylic acid(s). Such digests can exhibit enhanced flowability, reduced volume, and significant biomass conversion to dissolved components, and can in some embodiments be further liquefied by contact with an enzyme. Products resultant of these steps can be used for their sugar content to manufacture biofuels or other products.

Abstract: Biomass (e.g., plant biomass, animal biomass, and municipal waste biomass) is processed to produce useful intermediates and products, such as energy, fuels, foods or materials. For example, methods are described that can use feedstock materials, such as cellulosic and/or lignocellulosic materials, to produce an intermediate or product, e.g., by fermentation.