Abstract: Amino, amido, and heterocyclic compounds are disclosed. The compounds may be prepared as pharmaceutical compositions, and may be used for the prevention and treatment of a variety of conditions in mammals including humans, including by way of non-limiting example, diabetes complications, inflammation, and neurodegeneration, obesity, cancer, ischemia/reperfusion injury, cardiovascular disease and other diseases related to RAGE activity.

Abstract: Provided are methods for treating pancreatic cancer in a patient by administering liposomal irinotecan (MM-398) alone or in combination with additional therapeutic agents. In one embodiment, the liposomal irinotecan (MM-398) is co-administered with 5-fluorouracil and leucovorin.

Abstract: A method for treatment of the symptoms of neurologic dysfunctions, including major depression, an autism spectrum disorder (ASD), and schizophrenia. The patient is administered an amount of a compound that increases the catalytic activity of MAO-A. The effective compound is preferably reserpine, administered in a dosage of less than about 0.03 mg per day. The reserpine may be administered topically or transdermally at a dosage in the range from about 0.002 mg per day to about 0.02 mg per day. In homeopathic use, the reserpine may be administered in the form of a homeopathic dilution, preferably as a 12 C homeopathic dilution of reserpine.

Abstract: The present invention is directed to compositions and methods that target the PI3K signaling pathway for the treatment or prevention of cancer. In one aspect, there is provided a pharmaceutical formulation comprising Polymorph E of N-(3-{[(2Z)-3-[(2-chloro-5-methoxyphenyl)amino]quinoxalin-2(1H)-ylidene]sulfamoyl}phenyl)-2-methylalaninamide.

Abstract: The present invention provides methods of treating, stabilizing or lessening the severity or progression of a disease or disorder associated with BTK.

Abstract: The invention provides the identification of the presence of mutant ROS protein in human cancer. In some embodiments, the mutant ROS are FIG-ROS fusion proteins comprising part of the FIG protein fused to the kinase domain of the ROS kinase. In some embodiments, the mutant ROS is the overexpression of wild-type ROS in cancerous tissues (or tissues suspected of being cancerous) where, in normal tissue of that same tissue type, ROS is not expressed or is expressed at lower levels. The mutant ROS proteins of the invention are anticipated to drive the proliferation and survival of a subgroup of human cancers, particularly in cancers of the liver (including bile duct), pancreas, kidney, and testes. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ROS polypeptides (e.g., a FIG-ROS(S) fusion polypeptide), probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides.

Abstract: The invention comprises use of a therapeutically effective amount of the compound of the formula below for preparation of a medicament for treating polycystic kidney diseases (PKD) in a mammal, such as human or feline (e.g., Persian cat). Formula (I). Also provided are the above compound and compositions comprising it for treating PKD.

Abstract: The present invention relates to ENOblock, which is a non-substrate analog having an enolase inhibitory activity, and a pharmaceutical composition for preventing or treating cancer or enolase-associated diseases, containing the same. The ENOblock of the present invention directly binds to enolase so as to inhibit an activity thereof, and the inhibition is more effective in hypoxia than in normoxia. In addition, the ENOblock of the present invention inhibits migration, metastasis and invasion of cancer cells. Furthermore, the ENOblock of the present invention induces glucose uptake into cells, down-regulates the expression of PEPCK, and inhibits adipogenesis and foam cell formation. Therefore, a composition containing the ENOblock of the present invention can be very effectively applied to prevent or treat cancer or enolase-associated diseases.

Abstract: The present invention is directed to novel substituted bicyclic aromatic compounds useful as S-nitrosoglutathione reductase (GSNOR) inhibitors, pharmaceutical compositions comprising such compounds, and methods of making and using the same.

Abstract: The present invention relates to compounds of formula I that are useful as hepatitis C virus (HCV) NS5B polymerase inhibitors, the synthesis of such compounds, and the use of such compounds for inhibiting HCV NS5B polymerase activity, for treating or preventing HCV infections and for inhibiting HCV viral replication and/or viral production in a cell-based system.

Abstract: The present invention concerns a premix composition for feeding cattle, comprising: a) a premix carrier having an overall particle size comprised between 300 and 400 ?m, b) zilpaterol, and c) a surface agent. The present invention is also related to a method of increasing the rate of weight gain in cattle, comprising the administration to the cattle of feed additives consisting of a premix composition such as described, over a period of at least two weeks.

Abstract: The invention provides a method for treating viral infections and coinfections through the use of inhibitory agents that prevent a unique viral structural protein motifs from binding to host proteins from the clathrin adaptor proteins family and subsequently preventing viral replication.

Abstract: The application provides formulations for the topical administration of an active agent comprising at least one steroid, in the form of topical sprays that are propellant-free, and/or substantially non-foaming, and/or alcohol-free. The present application also provides processes for preparing such compositions and methods of using them in management of skin diseases or disorders such as psoriasis, dermatoses, and other associated skin diseases or disorders.

Abstract: Disclosed is a method of remyelinating axons with 6-substituted estradiol compounds of the formula The methods can be used to treat a variety of demyelinating diseases.

Abstract: A composition for transdermal delivery of a progestin for progestin hormone therapy is disclosed. Also disclosed is a transdermal delivery device comprising the composition. For progestin-only hormone therapy, the composition contains an anti-oxidant and does not contain an estrogen. For therapy involving a progestin and an estrogen, the composition contains the progestin, the estrogen and an additional anti-oxidant. Methods of improving the stability of progestin-containing compositions comprising oxidative agents are also disclosed. The methods comprise including one or more anti-oxidants in the compositions.

Abstract: Methods for effective remyelination in patients are disclosed comprising treating the patient with an androgen receptor ligand which exerts binding to androgen receptors and elicits androgen-receptor-induced biological responses at a dosage sufficient to induce remyelination. The androgen compound preferably comprises MENT in an androgen targeting both androgen and estrogen receptors, and the methods include combining the androgen compound with a progestin compound in order to provide both contraception in men and treatment for neurodegeneration.

Abstract: The present invention relates to a novel crystals of 5-({[2-amino-3-(4-carbamoyl-2,6-dimethyl-phenyl)-propionyl]-[1-(4-phenyl-1h-imidazol-2-yl)-ethyl]-amino}-methyl)-2-methoxy-benzoic acid and methods of making the zwitterion of 5-({[2-amino-3-(4-carbamoyl-2,6-dimethyl-phenyl)-propionyl]-[1-(4-phenyl-1h-imidazol-2-yl)-ethyl]-amino}-methyl)-2-methoxy-benzoic acid.

Abstract: Use of a derivative containing C—O—P bonds in a controlled release form to treat patients with kidney failure. Moreover, it comprises the use of said derivatives together with other active substances, which particularly may be selected from a list comprising a calcimirnetic, vitamin, phosphate binder, thiosulfate, bisphosphonate, pyrophosphate, citrate, diuretic, antihypertensive and anticholesteraemic agent.

Abstract: The invention relates to products comprising an antibiotic agent and a second agent being a dispersant or an anti-adhesive agent, in particular a mucolytic dispersant or a mucolytic anti-adhesive agent, which are useful in relation to the prevention and treatment of bacterial infections.

Abstract: The present invention provides a method for preparing a glycoside of a flavonoid compound, which comprises the step of treating flavonoid and a glycosyl donor with an enzymatic agent having glycosylation activity and being derived from the genus Trichoderma (preferably Trichoderma viride or Trichoderma reesei). Such a flavonoid compound includes a catechin compound or a methylated derivative thereof, and the glycosyl donor includes a carbohydrate containing a maltotriose residue (preferably maltotriose, maltotetraose, maltopentaose, maltohexaose, maltoheptaose, dextrin, ?-cyclodextrin or soluble starch). Glycosides obtained by the present invention have higher water solubility, improved taste, and increased stability. The present invention also provides novel glycosides of catechin compounds, which are obtained by the method of the present invention.

Abstract: The present invention relates to a new use of a known medicament. Specifically, the invention relates to methods and compositions for enhancing the therapeutic efficacy of a therapeutic agent by increasing the uptake of the therapeutic agent by target cells, and in particular relates to a pharmaceutical composition comprising a regulating agent of lipid raft/caveolae-dependent endocytic pathway and some therapeutic agents, such as anti-tumor agents. The invention also relates to a method for screening a regulating agent of lipid raft/caveolae-dependent endocytic pathway capable of enhancing the therapeutic efficacy of anti-tumor agents.

Abstract: The present invention concerns products containing (i) at least one nucleic acid sequence coding for the human somatostatin 2 receptor protein (sst2) having the sequence SEQ ID NO: 1, ortholog or derivative thereof, (ii) at least one nucleic acid sequence coding for the human deoxycytidine kinase protein (dck) having the sequence SEQ ID NO:2, ortholog or derivative thereof, (iii) at least one nucleic acid sequence coding for the human uridine monophosphate kinase protein (umk) having the sequence SEQ ID NO: 3 ortholog or derivative thereof, and (iv) gemcitabine, as a combined preparation for simultaneous, separate, or sequential use for treating cancer in a subject.

Abstract: The invention provides for LNA oligomers, for the treatment of a metabolic or liver disorder, wherein the LNA oligomer is administered orally in a unit dose of less than 50 mgs/kg, wherein the LNA oligomer is administered in the presence of a penetration (permeation) enhancer.

Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.

Abstract: The invention relates to treatments of cognitive disorders e.g. Mild Cognitive Disorder comprising the use of agents which are capable of lowering homocysteine levels in a subject, preferably a human subject. Aspects of the invention relate to a method of treating such disorders comprising administering one or more B vitamins e.g. folic acid, Vitamin B6 and/or Vitamin B12 or derivatives thereof.

Abstract: A prodrug comprising a heparin and a drug is provided. The prodrug can be used to form a coating on a medical device. The prodrug can also be used with a polymeric material to form a coating on a medical device. The polymeric material can be a hydrophobic polymer, a hydrophilic polymer, a non-fouling polymer, or combinations thereof. The medical device can be implanted in a human being for the treatment of a disease such as atherosclerosis, thrombosis, restenosis, hemorrhage, vascular dissection or perforation, vascular aneurysm, vulnerable plaque, chronic total occlusion, claudication, anastomotic proliferation for vein and artificial grafts, bile duct obstruction, ureter obstruction, tumor obstruction, or combinations thereof.

Abstract: A graft composition intended for transplantation into a patient comprises an injection solution comprising an isolated cell transplant and dextran sulfate, or a pharmaceutically acceptable salt thereof.

Abstract: A method for treating cancer is described using combination therapies comprising the use of hyperbaric oxygen with histone deacetylase inhibitors, with and without glycolytic therapies. The patient is subjected to a hyperbaric environment of substantially pure oxygen. A predetermined dose of one or more HDACI substances is administered to the patient. In addition, glycolitic inhibitors may also be administered. Dosages, pressures, and durations are selected as described herein to have a therapeutic effect on the patient.

Abstract: The invention features methods of treating a macrophage-associated neurodegenerative disease such as amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), or multiple sclerosis (MS) in a subject by administering chlorite in an amount effective to decrease blood immune cell activation. The invention also features methods of monitoring therapy by assessing blood immune cell activation before and after therapy.

Abstract: The present invention relates to stable pharmaceutical formulations that include a delivery agent and/or pharmaceutically acceptable salt thereof.

Abstract: Blood-derived plastic articles prepared from compositions including blood and, in some embodiments, at least one crosslinking agent and/or at least one biological response modifier, that can be useful for biological applications such as wound repair and tissue grafts; methods of making and using the same; methods for assessing the concentration of a biological response modifier in an article; and systems for preparing blood-derived plastic articles are provided.

Abstract: The invention relates to a composition which induces, in a host, a cytotoxic cell response directed against cells expressing an antigen, in particular tumor cells, and which comprises red blood cells containing said antigen. These red blood cells may be in the form of an immune complex with an immunoglobulin, in particular IgG, which recognizes an epitope at the surface of the red blood cells, and/or be heat-treated or chemically treated so as to promote phagocytosis of said red blood cells by dendritic cells. As a variant, the red blood cells may be xenogenic red blood cells. The invention also relates to a therapeutic especially anti-tumor vaccine containing such a composition.

Abstract: The present invention is directed to compositions and methods for treating an animal diagnosed with Glioblastoma multiforme (GBM).

Abstract: The present disclosure provides methods of inducing smooth muscle cell differentiation. The present disclosure provides genetically modified cells comprising exogenous miR-143 and/or miR-145 nucleic acids; and artificial tissues comprising the genetically modified cells. The present disclosure provides methods and compositions for reducing pathological angiogenesis. The present disclosure provides methods of inducing therapeutic angiogenesis. The present disclosure provides methods, compositions, and devices for inhibiting vascular smooth muscle cell proliferation.

Abstract: This invention relates to use of probiotics, particularly P acidilactici and S boulardii, for use in conjunction with steroids and other immune suppressor agents to ameliorate symptoms of autoimmune diseases, especially disease symptoms arising from the body's production of antibodies against autologous blood cells. The practice of the invention sustains ameliorative response associated with immune suppressor agents while lowering the amount of immune suppressor agents required for treatment.

Abstract: Provided is a plant derived extract including inhibitory activity against one or more extracellular proteases which degrade human tissue matrix. Moreover, the amount of inhibitory activity in an extract can be increased by stressing the plant prior to forming an extract. These extracts are each prepared by a process and demonstrate the ability to inhibit one or more extracellular proteases which degrade human tissue matrix. Libraries of extracts can be prepared from stressed and non-stressed plants, where each of the extracts demonstrate inhibitory activity against on or more extracellular protease inhibitors. Alternatively, semi-purified and purified inhibitory compounds can be isolated from the extracts. In one aspect, these extracts with inhibitory activity can be used during protein purification to minimize degradation due to extracellular proteases.

Abstract: The invention relates to therapeutic uses of gum mastic, and compounds found therein including polymeric myrcene. More particularly, the invention relates to methods of treating impaired neurological function using compositions comprising polymeric myrcene.

Abstract: A botanical composition and combinations thereof that include a leaf extract of Hylotelephium spectabile (Boreau) H. Ohba and is useful for treating and/or preventing histamine-mediated conditions or disorders are described. Methods of manufacture and use thereof are also described.

Abstract: The present application provides a natural aqueous extract obtainable from a cinnamon bark (Cinnamon sp.) which has antiviral activity against enveloped viruses including influenza A, Parainfluenza (Sendai) virus and HSV-1 viruses, as well as in vivo activity in inhibition of Influenza A and Parainfluenza viruses. The present application also concerns a method for the extraction of said cinnamon extract and applications thereof.

Abstract: An aloe vera based liquid composition comprising at least one antioxidant agent that reduces oxidative stress in the lungs and delivers various antioxidants and nutrients when absorbed upon vaping by the user.

Abstract: Compositions that include nanoscale structured materials or precursors thereof (e.g., self-assembling peptides) are described. The compositions can include other substances (e.g., a vasoconstrictor). Also described are methods for using the compositions to promote hemostasis, to protect the skin or wounds from contamination, to decontaminate a site upon removal of previously applied compositions that provided a protective coating, and to inhibit the movement of bodily substances other than blood. The compositions are also useful in isolating tissue, removing tissue, preserving tissue (for, e.g., subsequent transplantation or reattachment), and as bulking, stabilizing or hydrating agents. Medical devices that include the compositions (e.g., a stent or catheter), bandages or other wound dressings, sutures, and kits that include the compositions are also described.

Abstract: A chimeric peptide construct having a cell penetrating peptide linked to a pro-apoptotic peptide. The construct can be used for treating a tumor in combination with an anti-tumor agent. Also disclosed is a method for treating a tumor with the chimeric peptide construct and a chemotherapeutic agent.

Abstract: The present invention is directed to a method of treating a patient suffering from the metabolic syndrome and/or related disorders including obesity, Type 2 diabetes, pre-diabetes, hypertension, dyslipidemia, insulin resistance, endothelial dysfunction, pro-inflammatory state, and pro-coagulative state, and comprising the steps of (a) providing to the patient a dietary regimen that decreases overactive CNS noradrenergic tone; followed by (b) providing to the patient a dietary regimen that increases dopaminergic tone while maintaining the above decreased overactive CNS noradrenergic tone. The present invention is also directed to food products useful in implementing the dietary regimens.

Abstract: The present invention is directed to various uses of fibronectin binding proteins or polypeptides for treating and preventing fibrosis and fibrosis related conditions. The fibronectin binding proteins and polypeptides are also useful for treating conditions associated with vascular remodeling and cardiac dysfunction.

Abstract: Provided are methods of treatment for tumors. In particular, methods are provided for use of a chemically modified IL-10 to treat tumors.

Abstract: The present invention provides a pharmaceutical composition capable of forming in-situ implant comprising goserelin or its pharmaceutically acceptable salts thereof, biodegradable polymer and a biocompatible organic solvent wherein the biocompatible organic solvent is miscible to dispersible in aqueous medium or body fluid. The present invention further provides a process for the preparation of pharmaceutical composition capable of forming in-situ implant. A kit containing composition for in-situ implant is provided comprising a first vial comprising a composition comprising a biodegradable polymer and a biocompatible organic solvent; wherein the biocompatible organic solvent is miscible to dispersible in aqueous medium or body fluid; and a second vial comprising goserelin acetate.

Abstract: The present application relates to a pharmaceutical composition for use in the prevention or/and treatment of a neurodegenerative disease, the composition comprising desPro36Exendin-4(1-39)-Lys6-NH2 or/and a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier, adjuvant, or/and auxiliary substance. In addition, the present application relates to the use of the pharmaceutical composition for the treatment and prevention of a neurodegenerative disease.

Abstract: This invention relates to Factor VIII muteins that are covalently bound, at a predefined site that is not an N-terminal amine, to one or more biocompatible polymers such as polyethylene glycol. The mutein conjugates retain FVIII procoagulant activity and have improved pharmacokinetic properties.

Abstract: Provided are preparations of tissue kallikrein-1 (KLK1) glycoforms having a defined number of oligosaccharide units per KLK1 molecule. Also provided are mixtures of such glycoforms, pharmaceutical compositions containing such glycoforms or mixtures thereof, methods of obtaining the rhKLK1 glycoforms, and therapeutic uses thereof.

Abstract: MicroRNAs (miRNAs) are a diverse and abundant class of ˜22-nucleotide (nt) endogenous regulatory RNAs that play a variety of roles in animal cells by controlling gene expression at the posttranscriptional level. Increased miR-181a expression in mature T cells is shown to cause a marked increase in T cell activation and augments T cell sensitivity to peptide antigens. Moreover, T cell blasts with higher miR-181a expression become reactive to antagonists. The effects of miR-181a on antigen discrimination are in part achieved by dampening the expression of multiple negative regulators in the T cell receptor (TCR) signaling pathway, including PTPN22 and the dual specificity phosphatases DUSP5 and DUSP6. This results in a reduction in the TCR signaling threshold, thus quantitatively and qualitatively enhancing T cell sensitivity to antigens.