Abstract: The disclosure provides a new and distinct hybrid variety of spinach, NUN 05048 SPS as well as seeds and plants and fruits thereof.

Abstract: The disclosure provides a new and distinct hybrid variety of spinach, NUN 06202 SPS as well as seeds and plants and fruits thereof.

Abstract: A novel Mandevilla genus plant is provided that has a novel color tone unable to be previously produced. A candidate Mandevilla genus plant is selected as a parent Mandevilla genus plant in the case carotenoid pigment is extracted from the petals thereof, and neoxanthin or a derivative thereof is present in the carotenoid pigment extract.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV753235. The invention thus relates to the plants, seeds and tissue cultures of the variety CV753235, and to methods for producing a corn plant produced by crossing a corn plant of variety CV753235 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV753235 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV753235.

Abstract: According to the invention, there is provided seed and plants of the hybrid corn variety designated CH288975. The invention thus relates to the plants, seeds and tissue cultures of the variety CH288975, and to methods for producing a corn plant produced by crossing a corn plant of variety CH288975 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH288975.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV744511. The invention thus relates to the plants, seeds and tissue cultures of the variety CV744511, and to methods for producing a corn plant produced by crossing a corn plant of variety CV744511 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV744511 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV744511.

Abstract: According to the invention, there is provided seed and plants of the hybrid corn variety designated CH205107. The invention thus relates to the plants, seeds and tissue cultures of the variety CH205107, and to methods for producing a corn plant produced by crossing a corn plant of variety CH205107 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH205107.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV742016. The invention thus relates to the plants, seeds and tissue cultures of the variety CV742016, and to methods for producing a corn plant produced by crossing a corn plant of variety CV742016 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV742016 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV742016.

Abstract: According to the invention, there is provided seed and plants of the hybrid corn variety designated CH174815. The invention thus relates to the plants, seeds and tissue cultures of the variety CH174815, and to methods for producing a corn plant produced by crossing a corn plant of variety CH174815 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH174815.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV730108. The invention thus relates to the plants, seeds and tissue cultures of the variety CV730108, and to methods for producing a corn plant produced by crossing a corn plant of variety CV730108 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV730108 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV730108.

Abstract: According to the invention, there is provided seed and plants of the hybrid corn variety designated CH320399. The invention thus relates to the plants, seeds and tissue cultures of the variety CH320399, and to methods for producing a corn plant produced by crossing a corn plant of variety CH320399 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH320399.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV734155. The invention thus relates to the plants, seeds and tissue cultures of the variety CV734155, and to methods for producing a corn plant produced by crossing a corn plant of variety CV734155 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV734155 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV734155.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV465213. The invention thus relates to the plants, seeds and tissue cultures of the variety CV465213, and to methods for producing a corn plant produced by crossing a corn plant of variety CV465213 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV465213 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV465213.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV752112. The invention thus relates to the plants, seeds and tissue cultures of the variety CV752112, and to methods for producing a corn plant produced by crossing a corn plant of variety CV752112 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV752112 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV752112.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV757078. The invention thus relates to the plants, seeds and tissue cultures of the variety CV757078, and to methods for producing a corn plant produced by crossing a corn plant of variety CV757078 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV757078 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV757078.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV725465. The invention thus relates to the plants, seeds and tissue cultures of the variety CV725465, and to methods for producing a corn plant produced by crossing a corn plant of variety CV725465 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV725465 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV725465.

Abstract: According to the invention, there is provided seed and plants of the hybrid corn variety designated CH851343. The invention thus relates to the plants, seeds and tissue cultures of the variety CH851343, and to methods for producing a corn plant produced by crossing a corn plant of variety CH851343 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH851343.

Abstract: According to the invention, there is provided seed and plants of the hybrid corn variety designated CH887497. The invention thus relates to the plants, seeds and tissue cultures of the variety CH887497, and to methods for producing a corn plant produced by crossing a corn plant of variety CH887497 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH887497.

Abstract: A novel soybean variety, designated P04A60R is provided. Also provided are the seeds of soybean variety P04A60R, cells from soybean variety P04A60R, plants of soybean P04A60R, and plant parts of soybean variety P04A60R. Methods provided include producing a soybean plant by crossing soybean variety P04A60R with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety P04A60R, methods for producing other soybean varieties or plant parts derived from soybean variety P04A60R, and methods of characterizing soybean variety P04A60R. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety P04A60R are further provided.

Abstract: A novel soybean variety, designated P06A13R is provided. Also provided are the seeds of soybean variety P06A13R, cells from soybean variety P06A13R, plants of soybean P06A13R, and plant parts of soybean variety P06A13R. Methods provided include producing a soybean plant by crossing soybean variety P06A13R with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety P06A13R, methods for producing other soybean varieties or plant parts derived from soybean variety P06A13R, and methods of characterizing soybean variety P06A13R. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety P06A13R are further provided.

Abstract: A novel soybean variety, designated 5PYQB84 is provided. Also provided are the seeds of soybean variety 5PYQB84, cells from soybean variety 5PYQB84, plants of soybean 5PYQB84, and plant parts of soybean variety 5PYQB84. Methods provided include producing a soybean plant by crossing soybean variety 5PYQB84 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety 5PYQB84, methods for producing other soybean varieties or plant parts derived from soybean variety 5PYQB84, and methods of characterizing soybean variety 5PYQB84. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety 5PYQB84 are further provided.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV754236. The invention thus relates to the plants, seeds and tissue cultures of the variety CV754236, and to methods for producing a corn plant produced by crossing a corn plant of variety CV754236 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV754236 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV754236.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV461699. The invention thus relates to the plants, seeds and tissue cultures of the variety CV461699, and to methods for producing a corn plant produced by crossing a corn plant of variety CV461699 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV461699 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV461699.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV756266. The invention thus relates to the plants, seeds and tissue cultures of the variety CV756266, and to methods for producing a corn plant produced by crossing a corn plant of variety CV756266 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV756266 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV756266.

Abstract: According to the invention, there is provided seed and plants of the corn variety designated CV077335. The invention thus relates to the plants, seeds and tissue cultures of the variety CV077335, and to methods for producing a corn plant produced by crossing a corn plant of variety CV077335 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV077335 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV077335.

Abstract: A novel soybean variety, designated 5PFDE97 is provided. Also provided are the seeds of soybean variety 5PFDE97, cells from soybean variety 5PFDE97, plants of soybean 5PFDE97, and plant parts of soybean variety 5PFDE97. Methods provided include producing a soybean plant by crossing soybean variety 5PFDE97 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety 5PFDE97, methods for producing other soybean varieties or plant parts derived from soybean variety 5PFDE97, and methods of characterizing soybean variety 5PFDE97. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety 5PFDE97 are further provided.

Abstract: The invention provides seed and plants of tomato hybrid SV0599TM and the parent lines thereof. The invention thus relates to the plants, seeds and tissue cultures of tomato hybrid SV0599TM and the parent lines thereof, and to methods for producing a tomato plant produced by crossing such plants with themselves or with another tomato plant, such as a plant of another genotype. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of such plants, including the fruit and gametes of such plants.

Abstract: The present invention provides novel lettuce cultivar Red Crispita and plant parts, seed, and tissue culture therefrom. The invention also provides methods for producing a lettuce plant by crossing the lettuce plants of the invention with themselves or another lettuce plant. The invention also provides lettuce plants produced from such a crossing as well as plant parts, seed, and tissue culture therefrom.

Abstract: Disclosed is a system for treating dairy livestock having fore legs and hind legs, wherein the system comprises a parallel milking parlor ramp, livestock stalls positioned along at least part of the parallel milking parlor ramp, wherein each stall is configured to contain one dairy livestock, at least one vertical upright teat cup holder comprising teat cups and a mobile unit. The mobile unit comprises equipment for treating livestock and a processor, where the mobile unit is configured to travel between the fore legs and hind legs of the dairy livestock on the parallel milking parlor ramp and use the equipment to perform at least one action related to a treatment of the dairy livestock. Also disclosed is that the equipment includes an arm configured to withdraw the teat cups from the vertical upright teat cup holder and connect them to the dairy livestock.

Abstract: An absorbent member of animal excreta disposal sheet includes a first absorbent core containing at least hydrophilic fibers and a second absorbent core composed of a plurality of highly absorbent polymer particles. The plurality of highly absorbent polymer particles includes a large-diameter particle group having a plurality of large-diameter highly absorbent polymer particles, and a small-diameter particle group having a plurality of small-diameter highly absorbent polymer particles. The mass proportions of the large-diameter particle group and the small-diameter particle group are each 15-60 mass %, and the total mass proportion of the large-diameter particle group and the small-diameter particle group is at least 50 mass %.

Abstract: A livestock stanchion with an improved support yoke including at least one releaseable support yoke comprising a mounting member fixed to and projecting upward from a horizontal rail. A support space formed in an upper end of each mounting member supports a locking bar. A removable pin for a support yoke crosses the upper region of a support space to prevent dislodging of the locking bar. The mounting member can be a plate or have a generally “V,” “U,” “H,” circular, arcuate or poloygonal shaped cross section.

Abstract: An electric fence connection system includes a body formed with a slot have a predetermined depth. The slot may be formed to receive a polymer coated cable such that at least a portion of the polymer coated cable is surround by the body. The body may be formed to also include a first threaded aperture that extends through the body to the slot. A first threaded fastener may be sized to threadably engage the first threaded aperture. The first threaded fastener may include a head at a proximate end, a conical tip at a distal end and threads along a shaft of the fastener between the distal and the proximate end. The conical tip of the first threaded fastener may be formed to pierce the polymer coated cable positioned in the slot. The body may be formed with a second aperture formed to receive a power supply cable to supply electrical power to the polymer coated cable via the first threaded fastener.

Abstract: The disclosure provides an S-shaped folding pet dining table, which comprises a tabletop made from a plastic material and two foldable table legs mounted at bottoms of left and right ends of the tabletop, wherein the tabletop is flush in height, a tabletop body is bent in an S shape, and at least two feeding bowl placement holes are formed in a staggering manner according to bending of the S shape of the tabletop; and the two foldable table legs are both positioned outside front and rear side edges of the tabletop after being oppositely folded, and the left and right opposite table legs are staggered according to a bending part of the S shape of the tabletop. The dining table reaches a height comfortable for a large/medium dog, the height may be maximized by virtue of a finite space, the structure is simple, and convenience for operation is achieved.

Abstract: An animal feeding system can consist of at least a housing physically supported by a stand a predetermined distance above a ground level. A first dispensing assembly may be attached to a first dispensing aperture of the housing while a second dispensing assembly is attached to a second dispensing aperture of the housing. The first dispensing assembly and second dispensing assemblies can be different and physically separated.

Abstract: A solar float device for use in a livestock watering facility to inhibit the freezing of water in a livestock watering facility. The solar float device having upper and lower shells that are connected to each other. The upper shell encloses an air space and the lower shell encloses a ballast space. A bulkhead is connected to the lower shell and separates the air and ballast spaces. A ballast material contained within the ballast space maintains the float device upright in the water and is thermally conductive for receiving and storing heat generated by the solar float device from solar radiation. An energy absorbing element contacts the lower shell and at least a portion is arranged either at or above the level of the water such that the energy absorbing element is exposed to the solar radiation for absorbing the solar radiation and converting the solar radiation into heat.

Abstract: A grooming tool includes a handle and a head attached to the handle. The head has curved blades adjustable in at least an extended position and a non-extended position. Methods of grooming an animal can include selecting the length of the curved blades by adjusting the blades in at least an extended position or non-extended position.

Abstract: A shield-like garment to be worn by dogs. The garment includes a durable water-resistant fabric cover that fits snugly on the back of the dog with straps that pass under the torso holding it in place. Due to the stiffness of the garment, the dog finds it very difficult if not impossible to bend and scratch areas that may be itching. The garment may have a fabric outer cover which presents relatively soft surfaces against the dog and a stiff plastic insert that extends up the length of the shield. The garment is sized to extend from the dog's tail to just behind the dog's neck for maximum resistance to the dog bending around.

Abstract: A therapeutic shoe for cloven-hooved lactating animals protects a diseased or injured hoof from the external environment to promote healing. The shoe is notionally divided into four parts: a sole portion for supporting the undersides of the medial and lateral claws; a vamp portion connected to the sole portion for at least partially enveloping the hoof wall between its toe, heel and coronary band; a quarter portion connected to the vamp portion for at least partially enveloping the front and lateral pastern sections; and a heel portion connected to both the vamp and quarter portions for at least partially enveloping the heel and the area beneath the dew claws. The material of the shoe at the heel portion is relatively more deformable than the material of the shoe at the sole, vamp or quarter portions thus avoiding the application of excess pressure to this sensitive area of the hoof anatomy.

Abstract: The invention is a system and method for the reduction of stress and anxiety responses by animals to unfamiliar events or circumstances such as veterinary visits. The method includes progressive scent identification conditioning. An animal associates one or more pleasing fragrances or scents with pleasure and safety and thus a reduced level of stress/anxiety. This association persists for a sufficient period of time so the animal is able to better handle unfamiliar events/circumstances by maintaining a lower level of stress/anxiety. Scent association conditioning is achieved by presentation of a reward such as edible treats of different sizes and effective taste intensities when scent exposure occurs. The time between scent exposure and receipt of a treat is gradually increased during conditioning to reach an optimal or maximum period in which the animal can maintain a low level of stress/anxiety.

Abstract: Provided is an absorbent article for a pet animal being capable of prevent urine leaking out of a tail opening. The absorbent article includes a cutting line forming the fail opening positioned on a dorsal region side in an intermediate region and an indicator positioned on a body non-facing surface of an absorbent layer and to show a color reaction by coming in contact with excreted urine. The absorbent layer is positioned between the cutting line and a ventral region. The absorbent core has a first end edge and a second end edge opposite to the first end edge in a longitudinal direction, and the indicator is positioned longitudinally outboard of at least the first end edge of the first end edge and the second end edge.

Abstract: A retractable leash device (10, 53) for rolling up and unrolling a leash (13), especially for leading an animal, includes a leash roller (22) mounted rotatably on a carrier and a resetting device to reset the leash into a rolled-up position, in which the leash is wound up onto a leash roller. A blocking feature blocks the unrolling of the leash. A transmission is coupled to the leash roller and brings about blocking when a predetermined leash length is unrolled from leash roller. A simple configuration with high operating reliability and low wear is provided with the transmission having a first transmission element arranged rotatably on the carrier and a second transmission element arranged nonrotatably on the carrier. The first transmission element and the second transmission element have an outer circumference and an inner circumference associated with one another, which mesh with one another at least in an active state.

Abstract: A submodule and the associated device for varying/adjusting the height of the plate supporting vaccine/nutrient injectors for adapting the ratio between the path of the needle and egg size, used in a substance application module of an egg vaccination/nutrition system and equipment, represents a solution in the field of poultry farming, in particular in the poultry breeding sector, and is particularly useful when applied to aid the operation of the application of vaccines, nutrients and/or nutritional vaccinal complexes to fertile eggs by injection into the egg, characterised in that, whatever the size of the eggs [Ov] in the batch, large eggs [Og], medium eggs [Om] or small eggs [Op], the introduction of a submodule for adjusting the height of the injectors [m32] in the substance application module [m3], using an actuation device [6], the operation of which is controlled by data regarding the size of the eggs [Ov] in the batch, allows an unprecedented protection of the embryo [O5] from contact with the needle

Abstract: Oxalic acid vaporizer with integral body tube, detachable proximal end air nozzle, and floating heating element is a pest control vaporizer or pesticide vaporizer that is used to protect bees from certain pests, mites, and insects where the pesticide vaporizer expels a vapor that kills harmful pests, mites, and insects but does not harm or affect bees in the colony. Oxalic acid vaporizer with integral body tube, detachable proximal end air nozzle, and floating heating element includes an integral body tube that is without any holes, perforations, punctures, gaps, vents, or discontinuities. Oxalic acid vaporizer with integral body tube, detachable proximal end air nozzle, and floating heating element includes a detachable proximal end air nozzle. Oxalic acid vaporizer with integral body tube, detachable proximal end air nozzle, and floating heating element includes a floating heating element with a floating electrical connection.

Abstract: Method for producing YY super-male and XY physiological female common carps, with which YY-chromosome super-male common carp can be cultivated and androgenetic YY super-male common carp is produced, where microsatellite markers are used for paternity testing and test crossing confirmation. The YY common carp is crossed with normal female common carp to produce the progenies of only male common carp, and without sex identification, the juvenile male common carp with known sex are subjected to artificial sex reversal to produce XY physiological female common carp.

Abstract: An object of the present invention is to provide oysters which are highly safe and not contaminated with microorganisms including viruses and bacteria, the oysters moreover being fresh and having high nutritional value, and being available throughout the year in the same state as oysters from the in-season period. Provided is a method for cultivating oysters on land, the method including growing oyster larvae into adult shellfish in seawater containing deep-sea water in a water tank through feeding microalgae cultured in seawater containing deep-sea water to the oyster larvae.

Abstract: There is disclosed herein a submergible net pen system including for receiving a net, the system including: at least four support members; a plurality of span members connecting the support members, wherein the support members and span members collectively notionally define a pen volume; at least one chamber affixed to one or more of the span members and the support members; and at least one compressor in fluid communication with the chamber to selectively inflate the chamber with a gas.

Abstract: Artificial reef for recreational diving (1) comprising a base (2) of a slab of reinforced concrete and a vertically extending superstructure (3) made of concrete of inert lightweight materials that is ejected onto a structural frame comprising a plurality of stem members (32) around a trunk (31) implanted into the base and plastic grid items (12) suspended thereupon in a predetermined manner so as to form, following concrete ejection, a reef having a form and aesthetics corresponding to that of a natural reef, comprising blind crevices (9) and through holes (7) leading to chambers (8) and smaller or larger cavities (10, 11), constituting microhabitats and refuges for targeted benthic and benthopelagic organisms. The reef (1) is founded onto the seabed with one or more beams (30) introduced into holes (4) that pass perpendicularly through the base (2) and extend vertically along the superstructure (3).

Abstract: A system of decorating a housing that includes a base and a plurality of decorative elements. The decorative elements are irremovably disposed on or partially in the base. The width and depth of the base is less than or equal to the width and depth of the bottom inner surface dimensions of the housing such that the bottom inner surface area of the housing is entirely covered by one or more bases.

Abstract: An improved structure of the aquarium filter includes a filter cloth made of nonwoven fabric with small pores and high density that is installed on the outermost layer of the filter, an activated carbon filter sheet that wraps within the filter cloth and can deodorize smell and filter impurities, and a filter net made of resin foam with large pores and low density that wraps within the activated carbon filter sheet. The filter is made of filter materials in multiple layers that are formed individually by one single process so that the production cost can be reduced. Furthermore, a support frame is installed on the aquarium. A support platform is set on the support frame on which the planting unit sits. The filter is placed on the uppermost support platform. Nutrients generated from the decomposition of fish excreta in the water are absorbed by plants.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.