Abstract: Self-sustained, safe, stable and scalable microbial consortia (S5MicroCon) are described. The microbial consortia are regulated by photoautotroph-heterotroph interactions and RNA aptamer-based gene circuits. A rapid, high-throughput method for engineering RNA aptamer-based gene circuits (e.g. riboswitches) is also described.

Abstract: A method for stem or progenitor cell culture. More precisely, the invention relates to a method for cell culture using one or more I?I (inter-alpha trypsin inhibitor or Inter-alpha inhibitor) protein(s) or part(s) thereof as a component in a cell culture media or a coating on a cell culture surface material. Furthermore the invention relates to a cell culture media and a cell culture coating/matrix provided with one or more I?I proteins(s) or part(s) thereof.

Abstract: The present invention pertains to a method for the generation of neurotoxin-sensitive, neuronal differentiated cells comprising the steps of: a) cultivating tumor cells which are able to differentiate into neuronal cells in a culture medium under conditions and for a time which primes said tumor cells for neuronal differentiation; and b) cultivating the tumor cells primed for neuronal differentiation of a) in a differentiation medium having an osmolality of 100 to 270 mOsm/kg, and comprising (i) B27 supplement and/or (ii) N2 supplement, for at least 3 days, thereby obtaining neurotoxin-sensitive, neuronal differentiated cells. The invention further relates to neurotoxin-sensitive, neuronal differentiated cells obtainable by the method of the invention.

Abstract: An industrial preparation of natural killer cells (NKs) is produced by: using umbilical cord blood and peripheral blood from legitimate sources as raw materials, obtaining stem cells by a method for extracting and separating karyocytes, or using FICOLL® or PERCOLL® density gradient media centrifugation to isolate and screen out karyocytes; diluting the above-mentioned karyocytes with cell culture medium, adding interferon, interleukin, CD3 antibody, and human albumin, loading them together into a bioreactor for perfusion culture, and then performing multiplication culture; the passage number of natural killer cells from multiplication culture is no less than 8, and the culture time is no less than 4 weeks; the markers of the natural killer cells obtained after the multiplication culture are CD3?\CD56+, CD16+, CD57+, and CD8+, wherein CD16+/CD56+?15%, CD3?/CD56+?50%, and CD8+/CD57+?8%; then preparing an injection with a certain concentration using the cell suspension obtained by above-mentioned method.

Abstract: The invention relates to a process for producing enveloped viruses in a mildly acid medium. The processes of the invention are useful for producing and recovering at a large scale enveloped viruses under conditions observing good manufacturing practice (GMP).

Abstract: This invention relates to a method of producing a recombinant enzyme, more particularly, this invention relates to a method of producing water soluble enzymatically active recombinant glycine N-acyltransferase (GLYAT (E.G. 2.1.3.13)), including the steps of providing a suitable expression host; preparing a vector including a gene for expressing GLYAT in the expression host to form an expression plasmid; transforming the host with the expression plasmid to form an expression system; expressing the GLYAT gene in the expression system; and separating the expressed GLYAT from the expression system.

Abstract: The present disclosure provides engineered cross-type-nucleic-acid targeting nucleic acids and compositions thereof. Nucleic acid sequences encoding the engineered cross-type-nucleic-acid targeting nucleic acids, as well as expression cassettes, vectors and cells comprising such nucleic acid sequences, are described. Also, methods are disclosed for making and using the engineered cross-type-nucleic-acid targeting nucleic acids and compositions thereof.

Abstract: By combination of hydrophobic chromatography and strongly basic anion-exchange chromatography, a novel, highly hydrophobic ?-glucosidase was successfully identified from Acremonium cellulolyticus. Further, a gene corresponding to the identified ?-glucosidase was isolated. When multiple modifications were introduced into the base sequence of the gene, the gene was successfully expressed in Trichoderma viride at a high level, and the expression product successfully exhibited a high ?-glucosidase activity.

Abstract: Provided are methods to identify modulators and in particular inhibitors of body malodor formation employing peptidase enzymes, the peptidase enzymes and corresponding nucleotide sequences, expression vectors, transfected host cells, methods of forming the peptidase enzymes and methods to prevent body malodor.

Abstract: The present invention relates to variants of a vitamin K-dependent serine protease of the coagulation cascade, preferably variants of factor IX (F.IX), wherein the variant is characterized in that it has clotting activity in absence of its cofactor. The present invention furthermore relates to the use of these variants for the treatment and/or prophylaxis of bleeding disorders, in particular hemophilia A and/or hemophilia B or hemophilia caused or complicated by inhibitory antibodies to F.VIII. The present invention also relates to further variants of factor IX (F.IX) which have desired properties and can, thus be tailored for respective specific therapeutic applications.

Abstract: The invention includes, in part, methods and compounds for treating diseases and conditions characterized by reduced threonyl-tRNA synthetase (TARS) activity, which include, but are not limited to diseases and conditions in which angiogenesis is reduced as compared to normal. In some embodiments of the invention, a level of a TARS molecule is determined and compared to a control level of TARS to assess a treatment for a disease or condition characterized by reduced TARS activity.

Abstract: Provided are electrokinetically-altered fluids (gas-enriched (e.g., oxygen-enriched) electrokinetic fluids) comprising an ionic aqueous solution of charge-stabilized oxygen-containing nanostructures in an amount sufficient to provide, upon contact with a cell, modulation of at least one of cellular membrane potential and cellular membrane conductivity, and therapeutic compositions and methods for using same in treating inflammation or at least one symptom thereof. The electrokinetically-altered fluid compositions and methods include electrokinetically-altered ionic aqueous fluids optionally in combination with other therapeutic agents.

Abstract: The present invention relates to a method for promoting the generation and secretion of extracellular vesicles from cells by using extracorporeal shockwave. More precisely, the inventors confirmed that the generation and secretion of extracellular vesicles from vascular endothelial cells were promoted by extracorporeal shockwave and further confirmed that siRNA can be transferred into cells without any help of a carrier. The inventors continued to find out that angiogenesis could be inhibited by introducing siRNA to an animal tumor model and succeeded to measure the size and amount of extracellular vesicles secreted by extracorporeal shockwave. Therefore, the present invention can be used in various fields since it can safely promote the generation and secretion of extracellular vesicles from cells.

Abstract: This disclosure provides for compositions and methods for the use of nucleic acid-targeting nucleic acids and complexes thereof.

Abstract: Provided herein are RNAi-inducing double-stranded nucleic acid molecules having cell penetrating ability and targeting mRNA encoding a connective tissue growth factor (CTGF). In certain embodiments, the RNAi-inducing double-stranded nucleic acid molecule comprises a first strand of having a sequence of UCUUCCAGUCGGUAAGCCGCGAGGGCAGGCC and comprising 4 to 17 phosphorothioate bonds and at least one 2?-O-Me modified nucleotide, as well as a second strand having a sequence of CUUACCGACUGGAAGA and comprising at least one phosphorothioate bond and at least one 2?-O-Me modified nucleotide and further comprising a cholesterol moiety covalently attached to its 3? end.

Abstract: The invention provides a conjugate comprising (i) a selectivity agent which binds specifically to one or more neurotransmitter transporters selected from the group consisting of a dopamine transporter (DAT), serotonin transporter (SERT) or a norepinephrine transporter (NET) and (ii) a nucleic acid capable of specifically binding to a target molecule which is expressed in the same cell as the neurotransmitter transporter wherein said target molecule is ?-synuclein or the mRNA encoding ?-synuclein. The conjugates of the present invention are useful for the delivery of the nucleic acid to a cell of interest and thus, for the treatment of diseases which require a down-regulation of the protein encoded by the target nucleic acid as well as for the delivery of imaging agents to the cells for diagnostic purposes.

Abstract: The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1.

Abstract: A method of treating a bipolar disorder in a subject in need thereof is disclosed. The method comprising administering to the subject sa therapeutically effective amount of a miR-135, a precursor thereof or a nucleic acid molecule encoding said miR-135 or said precursor thereof, thereby treating the bipolar disorder. Methods of diagnosing a mood disorder in a human subject and of monitoring treatment of an anti-depressant drug or a medicament for the treatment of a mood disorder are also disclosed.

Abstract: Provided is siRNA effective for the treatment of fibrosis and a pharmaceutical containing the siRNA.

Abstract: The present invention relates to a pharmaceutical composition for preventing or treating atopic dermatitis, the pharmaceutical composition including, as an active ingredient, X-shaped DNA (XL-DNA) formed by complementary binding of oligonucleotides having nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 4. When the pharmaceutical composition is subcutaneously injected into an animal model of atopic dermatitis, effects of easing skin lesions, such as erythema, bleeding and edema, and the like, and ear edema, and reducing expression of immunoglobulin E (IgE) are exhibited. In this regard, the composition can be used as a pharmaceutical composition, a health food, or a cosmetic for atopic dermatitis.

Abstract: The invention refers to an oligonucleotide consisting of 10 to 20 nucleotides of selected regions of the TGF-beta1, TGF-beta2 or TGF-beta3 nucleic acid sequence, which comprises modified nucleotides such as LNA, ENA, polyalkylene oxide-, 2?-fluoro, 2?-O-methoxy and/or 2?-O-methyl modified nucleotides. The invention further relates to pharmaceutical compositions comprising such oligonucleotide, wherein the composition or the oligonucleotide is used in a method for the prevention and/or treatment of glaucoma, posterior capsular opacification, dry eye, Marfan or Loeys-Dietz syndrome, riboblastoma, choroidcarcinoma, macular degeneration, such as age-related macular degeneration, diabetic macular endma, or cataract.

Abstract: The invention relates to RNAi agents, e.g., double-stranded RNAi agents, targeting the PCSK9 gene, and methods of using such RNAi agents to inhibit expression of PCSK9 and methods of treating subjects having a lipid disorder, such as a hyperlipidemia.

Abstract: A method for producing a useful protein using a plant of the present invention comprises the steps of: cultivating the plant (cultivation step); infecting the cultivated plant with Agrobacterium having a polynucleotide encoding the useful protein (infection step); and allowing the infected plant to express the useful protein (expression step); wherein, in at least part of the cultivation step, the plant is cultivated under lighting conditions where the ratio of the light energy within the wavelength region of 600 nm to 700 nm to the light energy within the wavelength region of 400 nm to 800 nm is not less than 50%.

Abstract: The present invention discloses isolated polynucleotides encoding WUSCHEL-related homeobox4 proteins from two species of jute plants, namely, the Corchorus olitorius (“C. olitorius”) and Corchorus capsularis (“C. capsularis”), and corresponding polypeptides derived therefrom. The disclosed polynucleotide sequences encode WUSCHEL-related homeobox4 polypeptides (WOX4), which possess catalytic activities in enhancing fiber production in jute. The present invention also relates to the plants having a modulated expression of a nucleic acid encoding a WOX4 polypeptide, which have enhanced fiber yield relative to corresponding wild type plants or other control plants. Vectors, expression constructs and host cells comprising and/or consisting of the nucleotide sequences of the protein are also provided. Also disclosed are methods for producing the proteins and methods for modifying the proteins in order to improve their desirable characteristics.

Abstract: Methods and compositions for modulating plant development are provided. Nucleotide sequences and amino acid sequences encoding Ovule Development Protein 2 (ODP2) proteins are provided. The sequences can be used in a variety of methods including modulating development, developmental pathways, altering oil content in a plant, increasing transformation efficiencies, modulating stress tolerance, and modulating the regenerative capacity of a plant. Transformed plants, plant cells, tissues, and seed are also provided.

Abstract: A single vector or multiple separate vectors that contain two or more non-competing replicons for transient expression of the heavy and light chains of Rituximab in Nicotiana benthamiana leaves is described. The correct assembly of these subunit proteins into functional oligomeric structures to optimize the expression is also described. This system advances plant transient expression technology by eliminating the need for non-competing viruses, and thus, enhances the realistic commercial application of the multi-replicon single vector system for producing Rituximab in plant cells.

Abstract: The present invention provides a recombinant influenza virus vector comprising an NS gene encoding a truncated NS1 protein of at least 73 and up to 122 amino acids of the N-terminus of the respective wild type NS 1 protein, wherein said vector replicates in IFN-sensitive tumor cells and does not replicate in normal, non-tumor cells, and expresses a heterologous immunostimulatory polypetide. The invention further provides a pharmaceutical composition containing said influenza virus vector, its use for the treatment of cancer patients and methods for producing said influenza virus vaccine.

Abstract: This disclosure provides for compositions and methods for the use of designed nucleic acid-targeting nucleic acids, Argonautes, and complexes thereof.

Abstract: Provided herein is a gaseous isoprene composition comprising isoprene, carbon dioxide and water, wherein the isoprene is in an amount between about 0.1% and about 15% by volume; wherein the carbon dioxide is in an amount between about 0.04% and about 35% by volume; wherein the water is in an amount greater than about 70% of its saturation amount. Also provided herein is a liquid isoprene composition comprising isoprene in an amount of at least 65% by weight and carbon dioxide in an amount between about 0.01% and about 1% by weight.

Abstract: A method for the in vivo production of 1,3-butadiene from 2,4-pentadienoate is described (FIG. 1). Enzymes capable of decarboxylating 2,4-pentadienoate to 1,3-butadiene have been discovered. Recombinant expression of these newly discovered enzymes has resulted in the engineering of microorganisms capable of producing 1,3-butadiene when cultured in the presence of 2,4-pentadienoate. 1,3-butadienoate is an important monomer used in the manufacturing of rubbers and plastics. This invention will help to enable the biological production of 1,3-butadiene from renewable resources such as sugar, for example.

Abstract: There is provided an additive for a bioethanol fermentation process comprising a polyoxyalkylene compound (A) having a Griffin's HLB value in the range of 0 to 6, a polyoxyalkylene polyol (B) and a base oil (C) that is liquid at 25° C. The compound (A) is preferably a mixture of a compound represented by a general formula (1) and a compound represented by a general formula (2). In the formula, R1 and R3 represent alkyl or alkenyl, R2 and R4 represent a hydrogen atom or a monovalent organic group, AO represents oxyalkylene having a carbon number of 3 to 18, a reaction residue of glycidol, a reaction residue of an alkyl glycidyl ether or a reaction residue of an alkenyl glycidyl ether, EO represents oxyethylene, m and n are 1 to 100, and p is 3 to 10.

Abstract: An object of the present invention is to obtain a fermentative yeast having a highly efficient ethanol production without introducing a foreign gene. A further object is to obtain a fermentative yeast that is resistant to proliferation inhibitors such as organic acids, which prevent the growth of the fermentative yeast. Yeast having improved ethanol production ability was generated by introducing transaldolase and alcohol dehydrogenase gene by self-cloning to Meyerozyma guilliermondii that can produce ethanol effectively from pentose and hexose obtained by breeding. This fermentative yeast is deposited to NITE Patent Microorganisms Depositary under the accession number NITE ABP-01976.

Abstract: The present invention relates to isolated polypeptides having glucoamylase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Abstract: The invention relates to the production of aromatic molecules in prokaryotic and eukaryotic hosts such as E. coli, yeasts, filamentous fungi, algae, microalgae, other plant cells.

Abstract: Novel plant acyl-ACP thioesterase genes of the FatB and FatA classes and proteins encoded by these genes are disclosed. The genes are useful for constructing recombinant host cells having altered fatty acid profiles. Expression of the novel and/or mutated FATB and FATA genes is demonstrated in oleaginous microalga host cells. Furthermore, a method for producing an oil elevated in one or more of C12:0, C14:0, C16:0, C18:0 and/or C18:1 fatty acids includes transforming a cell with novel and/or mutated FATB and/or FATA genes, e.g., having an N-terminal deletion. The cells produce triglycerides with altered and useful fatty acid profiles.

Abstract: Disclosed is a method for producing L-citrulline using recombinant Corynebacterium crenatum cells as whole-cell biocatalysts. The present invention provides a recombinant C. crenatum that expresses an exogenous arginine deiminase gene from Lactobacillus brevis. The recombinant C. crenatum SDNN403 is used as biocatalysts for converting L-arginine to produce L-citrulline. Using the method of the invention, the concentration of L-citrulline reached 301.4 g/L after a 48 hr conversion reaction, and the molar conversion rate reached 99.9%.

Abstract: The present invention relates to a stabilizing composition useful for improving the stability of reagent for redox reaction, and a reagent composition for redox reaction having an improved stability. The reagent composition for redox reaction can be applied for a reagent for electrochemical biosensor.

Abstract: Disclosed are methods of measuring enzyme activity in a sample. The methods use disulfide-containing detection reagents with an electrochemiluminescent functional group.

Abstract: An apparatus includes a housing and an actuator. The housing, which defines a reagent volume that can receive a reagent container, can be removably coupled to a reaction chamber. The housing includes a puncturer that defines a transfer pathway in fluid communication with the reagent volume. A delivery portion of the housing defines a delivery pathway between the transfer pathway and the reaction chamber when the housing is coupled to the reaction chamber. The actuator has a plunger portion disposed within the reagent volume. An engagement portion of the actuator can be manipulated to move the plunger portion within the reagent volume to deform the reagent container. The puncturer can pierce a frangible portion of the reagent container to convey a reagent from the reagent container into the reaction chamber via the transfer pathway and/or the delivery pathway.

Abstract: The invention relates to methods for the identification of compounds, peptides and proteins that can act as substrates for histone deacetylases. The invention further relates to compounds of Formula I: F1—X1-L1-X2—P1—X3-G1??(Formula I) The invention relates to the treatment of diseases or disorders mediated by ARID1A (BAF250A).

Abstract: An integrated sample purification system includes a housing, a sample container rack, a filter holder, and a cylindrical magnet. The sample container rack and the filter device holder are disposed in the housing. The sample container rack is configured to hold one or more sample containers, the filter device holder is configured to hold one or more filter devices. The cylindrical magnet is adjacent to and external to the sample container rack, and is rotated about a central, longitudinal axis of the magnet by an electric motor disposed in the housing to lyse cells. Molecules of interest in the lysed cells are purified using filters that bind specifically to the molecules of interest. The system is readily amenable to automation and rapid purification and analysis of molecules of interest, such as nucleic acids and proteins.

Abstract: A sample handling method may include drawing an encapsulating liquid from an encapsulating-liquid input; discharging the drawn encapsulating liquid (a) onto a free surface of a carrier liquid in a carrier-liquid conduit comprising a stabilisation feature and (b) proximate to the stabilisation feature, the encapsulating liquid being immiscible with the carrier liquid, so that the discharged encapsulating liquid does not mix with the carrier liquid, floats on top of the carrier liquid, and is immobilised by the stabilisation feature; drawing a sample liquid from a sample-liquid input; and discharging the drawn sample liquid, the sample liquid being immiscible with the encapsulating liquid and with the carrier liquid, so that the sample liquid does not mix with the encapsulating liquid or with the carrier liquid.

Abstract: Nucleosides and nucleotides are disclosed that are linked to detectable labels via a cleavable linker group.

Abstract: Real time electronic sequencing methods, devices, and systems are described. Arrays of nanoFET devices are used to provide sequence information about a template nucleic acid in a polymerase-template complex bound to the nanoFET. A sequencing reaction mixture comprising nucleotide analogs having conductivity labels is introduced to the array of nanoscale electronic elements comprising nanoFETs under conditions of polymerase mediated nucleic acid synthesis. The polymerase enzyme template complex is attached to the gate of the nanoFET in an orientation whereby the nucleotide exit region of the polymerase enzyme is directed toward the gate of the nanoFET. Methods for producing nanoFET arrays are provided.

Abstract: The invention provides methods and kits for ordering sequence information derived from one or more target polynucleotides. In one aspect, one or more tiers or levels of fragmentation and aliquoting are generated, after which sequence information is obtained from fragments in a final level or tier. Each fragment in such final tier is from a particular aliquot, which, in turn, is from a particular aliquot of a prior tier, and so on. For every fragment of an aliquot in the final tier, the aliquots from which it was derived at every prior tier is known, or can be discerned. Thus, identical sequences from overlapping fragments from different aliquots can be distinguished and grouped as being derived from the same or different fragments from prior tiers. When the fragments in the final tier are sequenced, overlapping sequence regions of fragments in different aliquots are used to register the fragments so that non-overlapping regions are ordered.

Abstract: Provided herein are devices and methods suitable for sequencing, detecting, amplifying, analyzing, and performing sample preparation procedures for nucleic acids and other molecules. In some cases, the devices and methods provided herein are used for computation.

Abstract: The present invention relates to compositions and methods for detecting cell death by detecting cell DNA in a biological sample. The invention relates the discovery that the presence of hypomethylated ? cell DNA outside of the pancreas of a subject is indicative of ? cell death. Thus, in one embodiment, the invention is a method of detecting hypomethylated ? cell insulin DNA in a biological sample of a subject including the steps of: obtaining a biological sample from the subject, where the biological sample is obtained from outside of the subject's pancreas and where the biological sample contains ? cell insulin DNA; determining the methylation status of at least one of the CpG dinucleotides in the ? cell insulin DNA, where when at least one of the CpG dinucleotides in the ? cell insulin DNA is determined to be unmethylated, the hypomethylated ? cell insulin DNA is detected.

Abstract: Compositions and methods for the diagnosis and treatment of T1D are disclosed. More specifically, the invention provides gene targets containing single nucleotide polymorphisms associated with this disease. Methods and kits for using the sequences so identified for diagnostic and therapeutic purposes are also provided.

Abstract: Provided in the present invention are an affinity mediated amplification method of telomeric C-ssDNA with a template probe and a detection kit using this method for performing alternative lengthening detection of telomeres.

Abstract: The disclosure includes methods of identifying a dog at risk of developing a an autoimmune disease or condition, for example a hypothyroid disease or condition, comprising testing whether the dog exhibits one or more selected single nucleotide polymorphisms (SNPs), together with diagnostic kits for carrying out such methods, methods of treatment or prophylaxis of such autoimmune disease or condition, e.g., comprising administering an effective amount of tea extract to a dog in need thereof, and a canine diet or supplement comprising tea extract, useful for treatment of prophylaxis of such autoimmune disease or condition, or for maintenance of thyroid health in a dog.