Abstract: A bacterial strain of Rhodococcus biphenylivorans named Palladio 22 and registered at the BCCM-LMG Bacteria Collection under registration number LMG P-29520. A method is provided for the production of acrylamide following hydration of acrylonitrile using a biomass of the bacterial strain.

Abstract: There is provided a method of producing at least one unsaturated amino acid from at least one amino acid comprising at least two carbonyl groups, the method comprising (a) contacting a recombinant microbial cell with a medium comprising the amino acid comprising the carbonyl groups, wherein the cell is genetically modified to comprise—at least a first genetic mutation that increases the expression relative to the wild type cell of an enzyme (E) selected from the CYP152 10 peroxygenase family, and—at least a second genetic mutation that increases the expression relative to the wild type cell of at least one NAD(P)+ oxidoreductase (E2) and the corresponding mediator protein.

Abstract: Host cells that are engineered to produce benzylisoquinoline alkaloid (BIAs) precursors, such as norcodaurine (NC) and norlaudanosoline (NL), are provided. The host cells may have one or more engineered modifications selected from: a feedback inhibition alleviating mutation in a enzyme gene; a transcriptional modulation modification of a biosynthetic enzyme gene; an inactivating mutation in an enzyme; and a heterologous coding sequence. Also provided are methods of producing a BIA of interest or a precursor thereof using the host cells and compositions, e.g., kits, systems etc., that find use in methods of the invention.

Abstract: In a method and an apparatus for an enzymatic hydrolysis in which plant based raw material is hydrolysed by means of enzymes in at least one enzymatic hydrolysis stage. A plant based feed (1) is fed to the enzymatic hydrolysis stage (2) in which the plant based feed is hydrolysed. A liquid fraction (3) comprising carbohydrates is separated from a solid fraction (4) in a solid-liquid separation stage (11). At least a part (5) of the solid fraction (4) comprising enzymes is recirculated to the plant based feed (1) of the enzymatic hydrolysis stage (2) or to the enzymatic hydrolysis stage (2), and a rest part (6) of the solid fraction (4) is recovered. Further, the invention relates to the liquid fraction and the solid fraction and their use.

Abstract: The present invention provides glycosyl transferase (GT) enzymes, polypeptides having GT activity, and polynucleotides encoding these enzymes, as well as vectors and host cells comprising these polynucleotides and polypeptides. The present invention also provides methods of using these GT enzymes to generate products with ?-glucose linkages.

Abstract: A method of producing coenzyme Q10 includes contacting an extract from a coenzyme Q10-producing microorganism with an adsorbent (A) such that the adsorbent (A) adsorbs a component of the extract other than coenzyme Q10, and that coenzyme Q10 is obtained. The adsorbent (A) includes aluminum silicate at a content of 50% or more.

Abstract: The present invention relates to a genetically mutated bacteria strain for detecting an estrogenic compound and a method for detecting an estrogenic compound by using the same. More specifically, the present invention relates to a bacteria strain having an ability to detect an estrogenic compound, transformed by plasmid A comprising base sequences in which a gene for encoding a coactivator interacting with an estrogen receptor ligand binding domain (ER LBD) is conjugated to a gene for encoding ?CI protein, and plasmid B in which a gene for encoding an estrogen receptor ligand binding domain (ER LBD) is conjugated to a gene for encoding ?NTD protein, and a method for detecting an estrogenic compound by using same.

Abstract: Disclosed are devices and methods for preparing pre-metabolized compound libraries and for screening compound metabolites in a high throughput format. The devices and methods disclosed herein increase the chemical diversity of a chemical library prior to screening, and thereby enhance the number and value of hits identified in such chemical screening efforts.

Abstract: A high through-put screening method for identifying agents effective for inhibiting biofilm formation and/or killing established biofilm are disclosed. The method includes three tiers, and each tier includes three specific biological process assays. The tier levels are a primary screen, a confirmation screen, and a dose-response screen, and the biological process assays include assays for total bacterial growth, bacterial metabolic activity, and biofilm formation. The series of assays may be run once or more than once at each tier. A library of compounds is subject to tier A and only compounds meeting a primary parameter advance to tier B, and only tier B compounds meeting a confirmation parameter advance to tier C, and only tier C compounds meeting a dose-response parameter are identified as putative agents effective for inhibiting and/or eradicating a biofilm, further wherein the assays are conducted for each compound subject to the respective tier.

Abstract: Disclosed is a novel method of allele profiling, or nucleic acid sieving, with pooled Sanger sequencing as a first (aka “screening”) stage; where the first step is: amplifying a single sequence, delineated by forward and reverse primers which may represent a single exon, or a segment thereof, or a contiguous stretch of multiple exons and introns. The amplicons produced from a pool of samples include the amplified sequence, and these are next converted into fragments in the standard Sanger labeling reaction. Ambiguities will appear as superposed peaks at any heterozygous position of interest, as the origin of the variant signal cannot be uniquely attributable to a specific sample, or samples, in the pool. These ambiguities may be resolved by the allele profiling process; or, resolution can be done with source-tagged primers generating source-tagged amplicons, which generate position shifts in labels, which can be decoded to resolve the ambiguities.

Abstract: Provided herein are qPCR-based methods for quantitatively detecting and differentiating between live and dead pathogenic bacteria such as carbapenem-resistant Enterobacteriaceae (CRE). Also provided herein are simple, fast, and reliable genomic DNA extraction methods with improved efficiency.

Abstract: A receptacle transport mechanism comprises a body, a plunger configured to be movable with respect to the body, and one or more limbs movably attached to the body and positioned in operative engagement with the plunger. The plunger is movable with respect to the body between a first position whereby engagement by the plunger with the one or more limbs positions a lower portion of each limb proximal to the body and a second position whereby engagement by the plunger with the one or more limbs extends the lower portion of each limb outwardly relative to the body.

Abstract: A screening method for the identification of a characteristic of a target nucleic acid in a whole blood sample, including positioning a composition comprising whole blood and at least one preservative agent within a centrifuge, centrifugating the composition to isolate a plasma that includes at least one target nucleic acid for further analysis and analyzing the at least one target nucleic acid to identify a characteristic about the at least one target nucleic acid, and a composition including the plasma, the preservative agent, and any other ingredient, which is produced by the method.

Abstract: A method to detect liver fibrosis or for the differential diagnosis of non-alchohlic fatty liver disease (NAFLD) in a subject is provided. The method comprises analyzing a biological sample from a subject to determine an intestinal microbiome signature for the subject, and inspecting the intestinal microbiome signature relative to a reference intestinal microbiome signature to detect presence or absence of liver fibrosis.

Abstract: The present invention generally relates to a combination of molecular barcoding and emulsion-based microfluidics to isolate, lyse, barcode, and prepare nucleic acids from individual cells in a high-throughput manner.

Abstract: The present invention provides methods of detecting a target nucleic acid in a sample using a duplex-specific nuclease (DSN), such as Kamchatka crab nuclease or RNaseH, and compositions for DSN reactions. For example, a composition of the invention may include a sample having a target nucleic acid, a nucleic acid probe, a DSN, and a buffer, and the composition may be maintained at about 90° C. to about 97° C. The target nucleic acid may be detected, for example, by hybridizing the target nucleic acid to a detection probe and digesting the resultant duplex using the duplex-specific nuclease, thus releasing a detectable component of the probe, which can be separated from unbound probe for detection or detected in situ. The invention also features methods of catalyzing hybridization or stabilizing hybridization between nucleic acid strands using DSNs.

Abstract: A digital assay for a micro RNA (miRNA) or other target analyte in a sample makes use of nanoparticles that absorb light at the resonant wavelength of a photonic crystal (PC). Such nanoparticles locally quench the resonant reflection of light from the PC when present on the surface of the PC. The nanoparticles are functionalized to specifically bind to the target analyte, and the PC surface is functionalized to specifically bind to the nanoparticles that have bound to the target analyte. The sample is exposed to the functionalized nanoparticles, and the individual nanoparticles bound to the PC surface can be identified and counted based on reduced intensity values in the reflected light from the PC. The number of bound nanoparticles that are counted in this way can be correlated to the abundance of the target analyte in the sample.

Abstract: The disclosure relates to novel probes for use in LAMP detection methods. The probes contain a single fluorophore label bound to an internal cytosine residue of the probe. The probes are particularly useful in the detection of chlamydia and gonorrhea infections in a patient.

Abstract: The present invention relates to a method of covalently attaching a chromosome within a cell to a matrix including modifying a plurality of nucleotides within the chromosome to include a matrix attachment moiety wherein the chromosome contacts the matrix, and attaching the matrix attachment moiety of the plurality of nucleotides to the matrix, thereby attaching the chromosome to the matrix.

Abstract: A method of multi-gene absolute quantification for PCR array is provided, wherein a nucleic acid sample to be tested includes at least one kind of nucleic acid target. Primers for amplifying a plurality of standard DNA or the nucleic acid target to be tested are respectively disposed in a plurality of reaction wells of a test carrier. Afterwards, the plurality of standard DNA with known copy number and the nucleic acid sample are mixed and added into the reaction wells, and qPCR is performed on the standard DNA and the nucleic acid sample. A sequence-specific combination of a forward primer and a reverse primer is designed for each standard DNA, and the same DNA template sequence is presented between regions corresponding to the forward primer and the reverse primer. The primers for amplifying standard DNA and the nucleic acid target to be tested have similar amplification efficiencies.

Abstract: The invention generally relates to sequencing library preparation methods. In certain embodiments, two or more template nucleic acids are joined together by a linking molecule, such as a PEG derivative. Identical copies of a nucleic acid fragment or both strands of a duplex fragment may be linked together. The linked nucleic acids are amplified, creating linked amplicons. Emulsion PCR with linked primers creates linked template nucleic acids for seeding sequencing clusters and errors can be readily identified by their presence on only one of the linked fragments.

Abstract: The present invention generally relates to microfluidics and labeled nucleic acids. Certain aspects are generally directed to containing cells in gels, such as agarose gels, and determining nucleic acids within the cells, e.g., while contained within the gels. The nucleic acids may be, for example, genomic DNA, mRNA, transcriptomes, or the like. In some embodiments, for instance, both genomic DNA and RNA (e.g., as in a transcriptome) from a cell may be determined. In some cases, the nucleic acids may be attached to beads for sequencing or other purposes. Such systems may be useful, for example, for high-throughput sequencing or other applications.

Abstract: The present invention relates generally to 3?-OH unblocked nucleotides and nucleosides labeled and unlabeled with 5-methoxy-substituted nitrobenzyl-based photocleavable terminating groups for use in methods and systems related to DNA and RNA sequencing and analysis. These compounds may be used as reversible terminators as they exhibit fast nucleotide incorporation kinetics, single-base termination, high nucleotide selectivity, and rapid terminating group cleavage that results in a naturally occurring nucleotide.

Abstract: Sets of compounds bearing detectably different groups of labels are provided. Typically, different compounds bear different numbers of a single type of label and are thus distinguishable by the amplitude of signal produced by the label. The compounds are assembled from label components and protein cores to facilitate modular production of the compounds. In compounds containing two or more proteins, the proteins are typically covalently linked. Useful sets of compounds include sets of labeled nucleotide analogs, particularly dye-label nucleotide analogs that include tetravalent biotin-binding protein cores.

Abstract: The methods and reagents are provided for barcoding and analysis of DNA samples using partition (e.g., droplet) technology while avoiding performing amplification in droplets.

Abstract: According to one embodiment, a primer set for elongating a target short-chain nucleic acid containing a first sequence to obtain an elongated product is provided. The elongated product contains a second, a third, a fourth sequence, a complementary sequence of the 1?-th sequence and a sixth sequence. The complementary sequence of the 1?-th sequence is a loop primer sequence. The primer set contains a first elongation primer containing a first elongation primer sequence and a complementary sequence of the sixth sequence, and a second elongation primer containing a second elongation primer sequence, the fourth, the third, and the second sequence.

Abstract: The present disclosure provides methods of determining one or more tissues and/or cell-types contributing to cell-free DNA (“cfDNA”) in a biological sample of a subject. In some embodiments, the present disclosure provides a method of identifying a disease or disorder in a subject as a function of one or more determined more tissues and/or cell-types contributing to cfDNA in a biological sample from the subject.

Abstract: The present invention discloses a method for prognosing and reducing cardiovascular diseases in patients with kidney diseases, comprising obtaining a bio-sample of a healthy person and a bio-sample of a patient with kidney disease, detecting the expression of specific lncRNA biomarkers individually, such as one or more combinations of DKFZP434I0714, KCNJ2AS1, LOC256880, LOC644656, FAM86FP, FAM66D, LOC100289511, and HTR7P1, comparing the expressions between the samples of the healthy persons and the samples of the patients with kidney diseases to obtain a ratio, and prognosing whether the patients with kidney diseases belong to a high-risk group to have cardiovascular diseases based on the ratio. Furthermore, the method reduces the possibility of patients with kidney diseases to have cardiovascular diseases through the inhibition technology.

Abstract: The present invention is based on the discovery of genetic polymorphisms that are associated with liver fibrosis and related pathologies. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection.

Abstract: The invention relates to new biomarkers for the diagnosis of inflammation-related diseases.

Abstract: Markers useful for determining multiple sclerosis activity in a human subject are provided, along with kits for measuring quantitative expression values of the markers. Also provided are computer systems and software embodiments of predictive models for scoring and determining multiple sclerosis activity in human subjects based on the quantitative expression values of the markers.

Abstract: FRET-based analytes detection and related methods and systems are described where a pair of FRET labeled primers and/or oligonucleotides are used that are specific for target sequences located at a distance up to four time the Förster distance of the FRET chromophores presented on the FRET labeled primers and/or oligonucleotides one with respect to the other in one or more polynucleotide analyte; in particular the pair of FRET labeled primers and/or oligonucleotides is combined with a sample and subjected to one or more polynucleotide amplification reactions before measuring FRET signals from at least one FRET chromophore.

Abstract: Described herein are methods used for the detection of gingivitis and the monitoring of gingivitis in a subject.

Abstract: An assay for a GCH1 allele and associated genotype for the screening, prediction, diagnosis, prognosis, treatment and treatment response of psychiatric, neuropsychiatric, and neurological disorders, such as schizophrenia, schizoaffective disorder and bipolar disorder, and for defining treatments of such disorders. The presence of a variant in the GCH1 gene, alone or in conjunction with a measurement of low or altered biopterin, or altered BH4 system measures, is used to screen or diagnose subjects at risk for developing a psychiatric, neuropsychiatric, or neurological disorder. The genetic assay, with or without a biopterin or BH4 system assay, may also be used to determine treatment regimens. For subjects with an impaired BH4 system, treatments to increase or normalize biopterin, BH4, or the BH4 system can also be used, such as BH4 supplementation, lithium treatment, phenylalanine treatment, or other treatments and therapies.

Abstract: The present disclosure relates to a new biomarker for predicting susceptibility to an EGFR-targeted agent and a use thereof, and more particularly, provides a biomarker for predicting susceptibility to an EGFR (Epidermal Growth Factor Receptor)-targeted agent, comprising a RON (Recepteur d'Origine Nantais) gene; a composition for predicting susceptibility to the EGFR-targeted agent, comprising an agent which measures a gene expression level of the biomarker; or an expression or activity level of a protein thereof; a composition for enhancing the susceptibility to the EGFR-targeted agent, comprising an inhibitor of the expression of the gene or the expression or activity of the protein of the gene as active ingredients; a kit for predicting the susceptibility to the EGFR-targeted agent, comprising the composition; and a method for predicting the susceptibility to the EGFR-targeted agent.

Abstract: In one aspect, provided herein is a method comprising: (a) (i) determining cytolytic activity in a tumor from the subject; and/or (ii) determining genetic alterations associated with cytolytic activity in the tumor; and (b) administering an immunotherapeutic agent to the subject if (i) cytolytic activity is detected in the tumor and/or (ii) a genetic alteration associated with induction of cytolytic activity, tumor resistance to cytolytic activity and/or suppression of cytolytic activity is detected in the tumor.

Abstract: Novel gene deletions and translocations involving chromosome 2 resulting in fusion proteins combining part of Anaplastic Lymphoma Kinase (ALK) kinase with part of a secondary protein have been identified herein in human solid tumors, e.g. non-small cell lung carcinoma (NSCLC). Secondary proteins include Echinoderm Microtubule-Associated Protein-Like 4 (EML-4) and TRK-Fusion Gene (TFC). The EML4-ALK fusion protein, which retains ALK tyrosine kinase activity, was confirmed to drive the proliferation and survival of NSCLC characterized by this mutation. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ALK kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides.

Abstract: A molecular subgroup of cancer is characterised by misregulation of the MAPK signalling pathway and the epithelial-mesenchymal transition (EMT) pathway. Biomarker signatures can be used to identify cancers within the molecular subgroup. The signatures are also useful for identifying the treatment that is best suited for a given patient. A method for selecting a treatment for a subject having a cancer, comprises measuring the expression level(s) of at least biomarker selected from Table A or Table B in a sample from the subject. By assessing the expression level(s) of the at least 1 biomarker it can be determined whether the sample from the subject is positive or negative for a biomarker signature comprising the at least 1 biomarker. Based on the outcome of this assessment different treatments selected from MAPK pathway 10 inhibitors, EMT pathway inhibitors, SRC pathway inhibitors, taxanes and anti-angiogenic therapeutic agents may be indicated. Related treatment methods and products are also provided.

Abstract: The present invention relates to a biomarker composition for diagnosing anticancer drug resistance of gastric cancer, including an FGFR2-ACSL5 fusion gene or a protein that the fusion gene encodes, a composition and a kit for diagnosing anticancer drug resistance of gastric cancer, including a preparation which detects an mRNA or protein of the fusion gene, and a method for diagnosing anticancer drug resistance of gastric cancer by using the biomarker. It is possible to diagnose in advance whether resistance to the drug will be exhibited during the treatment with the FGFR inhibitor by detecting an mRNA of the FGFR2-ACSL5 fusion gene according to the present invention or a protein which the gene encodes in a tissue derived from the patient with gastric cancer, so that the treatment efficiency can be enhanced by applying a more appropriate treatment to the patient.

Abstract: Disclosed is a quality evaluation method performed in a genetic test for testing a gene in a sample collected from a subject, for a plurality of types of gene mutations that include a first type gene mutation and a second type gene mutation different from the first type gene mutation, and the quality evaluation method includes preparing a quality control sample that includes a first reference gene having the first type gene mutation, and a second reference gene having the second type gene mutation; obtaining sequence information of the genes included in the quality control sample; and outputting an index for evaluation of a quality of the genetic test, based on the sequence information having been obtained.

Abstract: Provided herein is technology relating to detecting neoplasia and particularly, but not exclusively, to methods, compositions, and related uses for detecting neoplasms such as cholangiocarcinoma.

Abstract: This invention relates to novel nucleic acid probes and methods for detecting Plasmodium parasites as well as detecting different Plasmodium parasites selectively from one another.

Abstract: Disclosed herein are materials and methods for achieving sequence-specific organism detection and/or phenotype(s) using sequence-specific oligonucleotides. Also disclosed are related kits, cultures, and cells for detecting and/or phenotyping microorganisms in a sequence-specific manner.

Abstract: The invention provides are agent and a method using this reagent for the detection of porcine adenovirus in a sample. The reagent comprises the following primer pair: the upstream primer: (5?-3?) ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1); the downstream primer: (5?-3?) CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), among the downstream primer Y can be T or C. This reagent and method are of strong specificity and high sensitivity, which can rapidly detect pig porcine adenovirus in samples.

Abstract: The present disclosure relates to a novel method of inhibiting sugar crystallization and/or sugar crystal growth with at least one glycoside as the sugar crystallization and/or sugar crystal growth inhibitor, and novel compositions comprising amorphous sugar and at least one glycoside as the sugar crystallization and/or sugar crystal growth inhibitor.

Abstract: A ferrosilicon inoculant for gray cast iron containing between 0.1 to 10% by weight strontium, less than 0.35% by weight calcium, 1.5 to 10% by weight aluminum and 0.1 to 15% zirconium. The inoculant, method for producing the inoculant, method for inoculating the melt and a gray cast iron inoculated with the inoculant are covered.

Abstract: There is provided a precipitation hardening stainless steel with the composition: C: 0.05-0.30 wt %, Ni: 9-10 wt %, Mo: 0.5-1.5 wt %, Al: 1.75-3 wt %, Cr: 10.5-13 wt %, V: 0.25-1.5 wt %, Co: 0-0.03 wt %, Mn: 0-0.5 wt %, Si: 0-0.3 wt %, and remaining part up to 100 wt % is Fe and impurity elements, with the additional proviso that the amounts of Al and Ni also fulfil Al=Ni/4±0.5 in wt %. Further Creq is in the interval 11-15.4 wt % and Nieq is in the interval 10.5-15 wt %. There is the possibility to have very low amounts of cobalt, well below 0.01 wt %. The precipitation hardening stainless steel displays, low segregation, high yield strength at elevated temperatures, and can also suitably be nitrided. The precipitation hardening stainless steel is more economical to manufacture compared to stainless steel according to the state of the art with the same strength at elevated temperatures.

Abstract: There is provided a precipitation hardening steel with the composition: C: 0.05-0.30 wt %, Ni: 3-9 wt %, Mo: 0.5-1.5 wt %, Al: 1-3 wt %, Cr: 2-14 wt %, V: 0.25-1.5 wt %, Co: 0-0.03 wt %, Mn: 0-0.5 wt %, Si: 0-0.3 wt %, and remaining part up to 100 wt % is Fe and impurity elements, with the additional proviso that the amounts of Al and Ni also fulfil Al=Ni/3±0.5 in wt %. There is the possibility to have very low amounts of cobalt, well below 0.01 wt %. The precipitation hardening steel displays, low segregation, high yield strength at elevated temperatures, high resistance against corrosion, and can also suitably be nitrided. The precipitation hardening steel is more economical to manufacture compared to steel according to the state of the art with the same strength at elevated temperatures.

Abstract: The present invention provides a tube body that is to be used in a high-temperature atmosphere and a method for stably forming a metal oxide layer on an inner surface of the tube body at a high area percentage. The tube body that is to be used in a high-temperature atmosphere according to the present invention is constituted by a heat-resistant alloy containing Cr in an amount of 15 mass % or more and Ni in an amount of 18 mass % or more, and on the inner surface, an arithmetic average roughness (Sa) of three-dimensional surface roughness satisfies 1.5?Sa?5.0 and a skewness (Ssk) of a surface height distribution satisfies |Ssk|?0.30. The heat-resistant alloy may contain Al in an amount of 2.0 mass % or more. On the inner surface, a kurtosis (Sku) of a surface height distribution of the three-dimensional surface roughness may satisfy Sku?2.5.

Abstract: There is provided a hot forged product having excellent wear resistance and fatigue strength even when the hot forged product is produced with a thermal refining treatment and a case hardening thermal treatment after hot forging omitted, and having a chemical composition consisting of, in mass %, C: 0.45 to 0.70%, Si: 0.01 to 0.70%, Mn: 1.0 to 1.7%, S: 0.01 to 0.1%, Cr: 0.05 to 0.25%, Al: 0.003 to 0.050%, N: 0.003 to 0.02% with the balance being Fe and impurities. The matrix at the depth of 500 ?m to 5 mm from an unmachined surface of the forged product is a ferrite-pearlite structure, in which a pro-eutectoid ferrite area fraction is 3% or less or a pearlite structure, and the average diameter of pearlite colonies in the pearlite structure at the depth of 500 ?m to 5 mm from the unmachined surface is 5.0 ?m or less.