Patents Issued in March 26, 2020
  • Publication number: 20200093101
    Abstract: A device (5) attached to the neck (6) of an animal (2) includes an accelerometer (28) which produces first and second signals indicative of movement of the animal (2) and the raised and lowered states of the head of the animal. A microprocessor (30) in the device (5) processes the first and second signals to detect ruminating, resting, feeding and three activity states of the animal during respective second predefined time periods of approximately 15 minutes duration. Data indicative of the states of the animal is stored by the microprocessor (30) in the device (5) and periodically transmitted to a cloud computer server which further processes the data to determine various health states and other issues of the animal.
    Type: Application
    Filed: November 21, 2019
    Publication date: March 26, 2020
    Applicant: DAIRYMASTER
    Inventors: EDMOND PATRICK HARTY, Liam Eoghan Mullane, John Gerard Daly
  • Publication number: 20200093102
    Abstract: A hive tool is provided which may be used to pry apart or separate two objects, such as an upper hive body from a lower hive body of a bee hive. The tool may include a handle, having a handle axis, and a blade coupled to the handle. The blade may include a lifting surface angled relative to the handle axis. A nose may join the lifting surface with a first lower surface. A first upper surface may be positioned between the lifting surface and a first stop surface. A second upper surface may be positioned between the first stop surface and the handle. A catch surface may be positioned between the first lower surface and a second lower surface, and the second lower surface may be positioned between the catch surface and the handle.
    Type: Application
    Filed: September 23, 2019
    Publication date: March 26, 2020
    Inventor: Jason Gouedy
  • Publication number: 20200093103
    Abstract: Anguilliformes breeding water contains a thyroid hormone such as thyroxine, and a method for rearing anguilliformes includes a step for administering a thyroid hormone such as thyroxine, wherein the amount of the thyroid hormone to be administered changes as the anguilliforme fingerling changes from a transformation start phase (stage 1) to a transformation final phase (stage 2), and the amount of the thyroid hormone to be administered in the transformation final phase (stage 2) is less than the amount of the thyroid hormone to be administered in the transformation start phase (stage 1).
    Type: Application
    Filed: December 27, 2017
    Publication date: March 26, 2020
    Applicant: SHIN NIPPON BIOMEDICAL LABORATORIES, LTD.
    Inventors: Ryoichi Nagata, Yutaka Kawakami
  • Publication number: 20200093104
    Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
    Type: Application
    Filed: December 5, 2019
    Publication date: March 26, 2020
    Inventors: Paul Feinstein, Charlotte D'Hulst
  • Publication number: 20200093105
    Abstract: The invention relates generally to genetically modified non-human animals expressing human polypeptides and their methods of use.
    Type: Application
    Filed: September 27, 2019
    Publication date: March 26, 2020
    Inventors: Richard Flavell, Markus Manz, Anthony Rongvaux, Till Strowig, Tim Willinger, Andrew J. Murphy, Sean Stevens, George Yancopoulos
  • Publication number: 20200093106
    Abstract: Mice, embryos, cells, and tissues having a restricted immunoglobulin heavy chain locus and an ectopic sequence encoding one or more ADAM6 proteins are provided. In various embodiments, mice are described that have humanized endogenous immunoglobulin heavy chain loci and are capable of expressing an ADAM6 protein or ortholog or homolog or functional fragment thereof that is functional in a male mouse. Mice, embryos, cells, and tissues having an immunoglobulin heavy chain locus characterized by a single human VH gene segment, a plurality of human DH gene segments and a plurality of human JH gene segments and capable expressing an ADAM6 protein or ortholog or homolog or functional fragment thereof are also provided.
    Type: Application
    Filed: December 4, 2019
    Publication date: March 26, 2020
    Inventors: Lynn Macdonald, Sean Stevens, Andrew J. Murphy, Margaret Karow, John McWhirter
  • Publication number: 20200093107
    Abstract: A fishing hook assembly includes a hook element including a tie rail, which defines an enlarged line-pass-through area.
    Type: Application
    Filed: November 13, 2019
    Publication date: March 26, 2020
    Inventors: Corey Bechtold, Lisa Bechtold
  • Publication number: 20200093108
    Abstract: An armrest apparatus configured to be mounted on a rod. The armrest apparatus includes an upper armrest unit including an upper armrest bracket and armrest. The apparatus includes a lower armrest unit including a lower armrest bracket configured to attach to the upper armrest bracket to collectively farm a generally cylindrical space. The generally cylindrical space is designed to encircle an outer circumference of the rod. A grip apparatus configured to be mounted on a rod. The grip apparatus includes an upper grip assembly including a grip and a top mounting block. The top mounting block includes a lower bracket and an upper engagement portion. The grip apparatus includes a on grip assembly including a bottom mounting block configured to attach to the top mounting block to collectively form a generally cylindrical space. The generally cylindrical space is designed to encircle an outer circumference of the rod.
    Type: Application
    Filed: September 23, 2019
    Publication date: March 26, 2020
    Inventor: Ha V. Duong
  • Publication number: 20200093109
    Abstract: A sound generating mechanism for a spinning reel that generates sound by rotation of a spool relative to a spool shaft includes a first member, a second member, a pin member, a coil spring and a metal holding member. The first member is integrally rotatable with the spool, and has a plurality of concavo-convex portions arranged at intervals in a direction of rotation of the spool. The second member is rotationally fixed with respect to the spool shaft. The pin member is disposed to be capable of contacting the concavo-convex portions. The coil spring is configured to bias the pin member toward the concavo-convex portions. The metal holding member is attached to the second member and holding the coil spring.
    Type: Application
    Filed: August 13, 2019
    Publication date: March 26, 2020
    Inventor: Koji OCHIAI
  • Publication number: 20200093110
    Abstract: A brake mechanism is provided for braking rotation of a rotary member in a spinning reel or a baitcasting reel. The brake mechanism includes a frame unit, an actuating member, a biasing member, a plurality of actuated members, and a plurality of brake pieces. The actuating member is biased by the biasing member to an outer position. In response to movement of the actuating member to an Inner position from the outer position, the actuated members are moved radially and outwardly to permit the brake pieces to be brought into frictional engagement with the rotary member to thereby brake the rotation of the rotary member.
    Type: Application
    Filed: September 9, 2019
    Publication date: March 26, 2020
    Inventor: Wen-Hsiang LEE
  • Publication number: 20200093111
    Abstract: A maneuverable device for facilitating the optimal use of dual fishing rods on a fishing boat, particularly for use on a kayak, wherein the device may contain one or more compartments for fishing accessories, and the rods may be positioned generally in parallel line with the kayak and may extend forwards and backwards along the plane of the kayak and may also, upon user interest, angle outwards to the right and left of the kayak, respectively.
    Type: Application
    Filed: February 26, 2019
    Publication date: March 26, 2020
    Inventor: Michael D. Fryar
  • Publication number: 20200093112
    Abstract: The present invention relates to cromoglycate and a salt thereof and compositions for the prophylactic and/or therapeutic treatment of a dry hoof condition and/or for use in increasing hoof growth in ungulates. Cromoglycate and a salt thereof and the compositions are useful to treat and maintain hooves in healthy condition.
    Type: Application
    Filed: April 8, 2019
    Publication date: March 26, 2020
    Inventors: Lekha Anil Kumar, Sharika Pariyachery, Hans Meijer
  • Publication number: 20200093113
    Abstract: One example insect sensing system includes a light emitter configured to emit light; a structured light generator positioned to receive the emitted light and configured to generate structured light from the emitted light; a plurality of light sensors arranged in a line, each of the light sensors oriented to receive at least a portion of the structured light and output a sensor signal indicating an amount of light received by the respective light sensor; a processing device configured to: obtain the sensor signals from each of the light sensors, and determine a presence of an insect based a received sensor signal from at least one light sensor, the sensor signal indicating a reduced amount of received light by the at least one light sensor. Another example insect sensing system includes a camera comprising an image sensor and a lens having an aperture of f/2.8 or wider; and a processor configured to obtain an image from the camera and detect an insect in the image.
    Type: Application
    Filed: July 17, 2019
    Publication date: March 26, 2020
    Inventors: Jianyi Liu, Peter Massaro
  • Publication number: 20200093114
    Abstract: A device for controlling at least one insect bait station (100), in particular for insects harmful to humans, animals and plants, in which the bait station is provided with: at least one container (3, 5) provided with an insect entrance opening, the container containing bait and being at least partially transparent or translucent, a lighting device (10) lighting the inside of the container but located outside same, a telecommunication module (23, 25) and a printed circuit comprising, inter alia, a memory and a processor connected to said telecommunication means. The device comprises an optical sensor essentially opposite the lighting device, and connected to the printed circuit (12), which measures the general opacity caused by the insect(s) in the container, the corresponding value being transmitted for processing and analysis of the status of the bait station.
    Type: Application
    Filed: October 25, 2019
    Publication date: March 26, 2020
    Inventor: Abraham FROJMOVICS
  • Publication number: 20200093115
    Abstract: In some implementations, a detector may include one or more sensors, one or more external indicators, one or more processors, and one or more non-transitory computer readable media storing instructions that are executable by the one or more processors to perform various operations. The operations may include detecting, by a motion sensor, movement associated with the pest and capturing, by a sensor (e.g., an imaging sensor) of the detector, sensor data (e.g., a digital image) of the pest. The operations may include determining, by a machine learning algorithm, that the sensor data indicates a presence of a pest, and sending a notification message to a computing device. The notification message may include at least a portion of the sensor data. The operations may include visually indicating, using a pest indicator of the one or more external indicators, that the pest was detected.
    Type: Application
    Filed: November 27, 2019
    Publication date: March 26, 2020
    Inventors: Jace W. Files, John Trevor Morrison, Shivshanker Somashekar Naimpally
  • Publication number: 20200093116
    Abstract: In some implementations, a detector may include one or more sensors, one or more external indicators, one or more processors, and one or more non-transitory computer readable media storing instructions that are executable by the one or more processors to perform various operations. The operations may include detecting, by a motion sensor, movement associated with the pest and capturing, by a sensor (e.g., an imaging sensor) of the detector, sensor data (e.g., a digital image) of the pest. The operations may include determining, by a machine learning algorithm, that the sensor data indicates a presence of a pest, and sending a notification message to a computing device. The notification message may include at least a portion of the sensor data. The operations may include visually indicating, using a pest indicator of the one or more external indicators, that the pest was detected.
    Type: Application
    Filed: November 27, 2019
    Publication date: March 26, 2020
    Inventors: Jace W. Files, John Trevor Morrison, Shivshanker Somashekar Naimpally
  • Publication number: 20200093117
    Abstract: The present invention provides a flying insect trap employing a scent-based insect bait to attract flying insects to the trap. Insects can enter the trap through entry pipes in the side of the trap which curve or angle downward once inside the trap. A window of clear plastic or similar material is provided in the top surface of the trap to admit sunlight and draw insects seeking to escape upward and away from the entry pipes. If the entry pipes are made of a dark, opaque material, relatively little sunlight will enter the trap through the entry pipes compared with the clear plastic window, and insects within the trap will not perceive the entry pipes as a possible exit. The trap can be constructed within a removable top cap so that the trap can be supplied with dry insect bait which can be activated before deployment by removing the cap and adding water to the dry bait.
    Type: Application
    Filed: September 24, 2019
    Publication date: March 26, 2020
    Inventor: Timothy Coleton Graham
  • Publication number: 20200093118
    Abstract: A method of operating a fluid sprayer includes dispersing a first fluid selected from a group consisting of larvicide, adulticide, and a barrier repellant from the fluid sprayer with a first nozzle assembly at a first volumetric flow rate, replacing the first nozzle assembly with a second nozzle assembly, and dispersing a second fluid selected from the group from the fluid sprayer with the second nozzle assembly at a second volumetric flow rate different than the first volumetric flow rate.
    Type: Application
    Filed: October 24, 2019
    Publication date: March 26, 2020
    Inventors: Frank Clarke, Grifith Lizarraga, Daniel Fachet
  • Publication number: 20200093119
    Abstract: A flying insect deterrence system and device is provided. The flying insect deterrence device may include a rotary element, a vertical column, a cordage, a cordage element, and a motor. The flying insect deterrence system may include a base and an insect deterrence device. The insect deterrence device may include a vertical column, a rotary element, a motor, a cordage, and a cordage element. The rotary device is located on top of the vertical column and is powered by the motor that spins a cordage attached to the rotary device to deter flying insects from flying or landing in the area.
    Type: Application
    Filed: September 26, 2019
    Publication date: March 26, 2020
    Applicant: No Fly Zone, LLC
    Inventor: Ryan Peltekian
  • Publication number: 20200093120
    Abstract: The subject matter of the invention is a fragrance set to deter martens, especially a fragrance pendant, in particular to deter beech martens (Martes foina) from cars in the garage. The fragrance set to deter martens, especially the fragrance pendant, has a container with through channels, preferably an organza pouch or a drawpiece with a sling, preferably insulated with an outer removable cover made of foil, containing at least two carriers of fragrance, preferably in the form of a polymer, and is characterized in that the hopper (1) has fragrance carriers (2), which are the fibers (3) of the mammalian coat, excrements (4) of predatory animals and/or mixtures thereof, preferably with wax, oil, polyacrylamide gel, most preferably with the addition of a capsaicin solution in the form of oleoresin. Favourably, the carrier (2) of fragrance is the fiber (3) of the dog's fur and/or human hair.
    Type: Application
    Filed: March 20, 2018
    Publication date: March 26, 2020
    Inventor: Artur OLEJNICZAK
  • Publication number: 20200093121
    Abstract: Device embodiments use a person's exhaled breath to distribute an evaporated, sublimated, or vaporized material. The disclosure provides non-powered devices that use evaporation or sublimation to create the vapor that is distributed and the disclosure provides devices with electric vaporizers which rapidly vaporize liquid scent materials for distribution. The scent can be designed as a masking or cover scent, an aromatic lure scent, a scent elimination material, a pleasant scent for freshening air in a room or automobile, or a repellant scent. The device can be worn as a mask or configured as a game call.
    Type: Application
    Filed: November 8, 2019
    Publication date: March 26, 2020
    Inventor: Robert M. Wynalda, JR.
  • Publication number: 20200093122
    Abstract: Provided herein are devices and related methods for rapidly freezing a sample using, for example, liquid nitrogen. The device includes an input portion with an input port, a sample chamber, a waste reservoir in fluid communication with the sample chamber, and a filtering mechanism that selectively allows a fluid introduced through the input port to pass through the sample chamber and into the waste reservoir, while retaining a sample within the sample chamber. The sample chamber, waste reservoir, and filtering mechanism are configured to draw fluid from the sample chamber through the filtering mechanism and into the waste reservoir via capillary action.
    Type: Application
    Filed: April 20, 2018
    Publication date: March 26, 2020
    Applicant: FUJIFILM Irvine Scientific, Inc.
    Inventors: Sabrina C. LIN, Hsiao-Tzu Ni
  • Publication number: 20200093123
    Abstract: The invention relates to compositions and methods for repelling, knocking down, or killing pests or ectoparasites, such as mosquitoes.
    Type: Application
    Filed: November 30, 2017
    Publication date: March 26, 2020
    Inventors: Roderick Stephen BRADBURY, Jean Davin AMICK
  • Publication number: 20200093124
    Abstract: The present disclosure provides an antibacterial hydrophilic compound. The antibacterial hydrophilic compound may react, induced by light through a hydrogen abstraction group in the structural formula thereof, with a C—H group and thus bind to a surface of a material having the C—H group (for example, chemical fibers such as polyester, chinlon, and the like; plastics, rubbers, and other similar materials), which can impart a durable antibacterial activity and hydrophilicity to the material. The antibacterial hydrophilic compound has a relatively strong binding force to the surface of the material without damaging the mechanical properties of the raw material. The present disclosure also provides a modified material that is modified by the antibacterial hydrophilic compound.
    Type: Application
    Filed: November 29, 2019
    Publication date: March 26, 2020
    Applicant: SHENZHEN UNIVERSITY
    Inventors: Shiguo CHEN, Shaobo ZHANG, Xiaohua CAI, Zaochuan GE
  • Publication number: 20200093125
    Abstract: The present disclosure provides inoculant compositions and methods for enhancing the survival and/or stability of microbial cells and/or spores in an inoculant composition. In some embodiments, inoculant compositions of the present disclosure comprise microbial cells and/or spores in a carrier comprising one or more paraffin oils and/or waxes.
    Type: Application
    Filed: May 24, 2018
    Publication date: March 26, 2020
    Applicant: NOVOZYMES BIOAG A/S
    Inventors: Dan Clary, Ben Doughan
  • Publication number: 20200093126
    Abstract: The pesticide and method of manufacturing includes one component extracted from an evergreen Bush “Larrea tridentate” the common name of which is Gobernadora, in which the main active ingredient is nordihydroguaiaretic acid(NDGA) 1,4-Bis(3,4-dihydroxyphenyl)-2,3-dimethylbutane, 4,4?-(2,3-Dimethyltetramethylene) dipyrocatechol. The composition of which is enriched with plant oils, emulsifiers and humidifiers, thus obtaining a product which can be easily used in crops with the help of sprinklers. Consequently, the action field of this procedure is within chemical compositions used to cultivate crops and fruit products.
    Type: Application
    Filed: November 24, 2019
    Publication date: March 26, 2020
    Inventors: Mario SAAVEDRA AGUILAR, Odon VITE VALLEJO
  • Publication number: 20200093127
    Abstract: A composition for a formulation additive that is water free that can be added to a formulation or other solution to increase its sanitizing persistence capabilities. The composition can include, by weight, from about 20% to about 70% cyclomethicone; from about 16% to about 35% quaternary ammonium salt; from about 16% to about 50% solvent; and from about 0% to about 35% emulsifier.
    Type: Application
    Filed: September 24, 2019
    Publication date: March 26, 2020
    Inventors: Jeffrey L. Southard, Brian K. Southard
  • Publication number: 20200093128
    Abstract: Compositions and methods for reducing microbial loads on agricultural products are disclosed. The compositions include at least one acidulant and at least one surfactant, each present in an effective amount to reduce a microbial load on an agricultural product. The methods include applying compositions of at least one acidulant and at least one surfactant to agricultural products to reduce microbial loads and cross contamination of agricultural processing equipment.
    Type: Application
    Filed: September 11, 2019
    Publication date: March 26, 2020
    Inventors: Joshua Gurtler, Xiaoling Dong
  • Publication number: 20200093129
    Abstract: This invention relates in part to soybean event pDAB8264.44.06.1 and includes a novel expression cassettes and transgenic inserts comprising multiple traits conferring resistance to glyphosate, aryloxyalkanoate, and glufosinate herbicides. This invention also relates in part to methods of controlling resistant weeds, plant breeding and herbicide tolerant plants. In some embodiments, the event sequence can be “stacked” with other traits, including, for example, other herbicide tolerance gene(s) and/or insect-inhibitory proteins. This invention further relates in part to endpoint TaqMan PCR assays for the detection of Event pDAB8264.44.06.1 in soybeans and related plant material. Some embodiments can perform high throughput zygosity analysis of plant material and other embodiments can be used to uniquely identify the zygosity of and breed soybean lines comprising the event of the subject invention. Kits and conditions useful in conducting these assays are also provided.
    Type: Application
    Filed: June 7, 2019
    Publication date: March 26, 2020
    Inventors: Yunxing C. Cui, Thomas Hoffman, Ning Zhou, Stephen N. Novak, Julissa Colon, Dawn M. Parkhurst, Sandra G. Toledo, Terry R. Wright, Sean M. Russell, Bruce Held, Vaithilingam Sekar
  • Publication number: 20200093130
    Abstract: An application of tetrahydrobenzazole in the preparation of an agricultural fungicide or a fungicide composition and a preparation method therefor. A 4-((-(2-chloro-4-(4-chlorophenoxy)phenyl)-4-methyl-1,3-dioxapentan-2-yl)methyl)-4H-1,2,4-triazole(tetrahydrobenzazole) compound has application in agricultural fungicides, having the structural formula shown in formula I is provided. Also, the embodiments transform waste that can usually only be treated as a hazardous organic waste solid, accounting for 35-40% of the production process of an agricultural fungicide difenoconazole, into a useful pesticide, significantly reducing discharge of hazardous organic waste solids, and alleviating environmental protection pressure on manufacturers. The preparation method of the embodiments can also increase the yield of difenoconazole and reduce costs.
    Type: Application
    Filed: December 6, 2017
    Publication date: March 26, 2020
    Inventors: Kangping YU, Nan LI, Jie JIA, Hongwei BAI
  • Publication number: 20200093131
    Abstract: The invention relates to storage-stable prothioconazole-containing formulations having a particularly low content of 2-(1-chlorocyclopropyl)-1-(2-chlorophenyl)-3-( H-1,2,4-triazol-1-yl)propan-2-ol based on organic vinyl compounds, to a process for their preparation, to a method for controlling phytopathogenic fungi in crop protection and to their use as crop protection agents.
    Type: Application
    Filed: June 6, 2018
    Publication date: March 26, 2020
    Inventors: Jens KRAUSE, Martin WEISS, Martin STEINBECK
  • Publication number: 20200093132
    Abstract: Disclosed herein are methods of making (4aR,6S,8aR)-6-((R)-1-hydroxyethyl)-6,8a-dihydropyrano[3,2-b]pyran-2-(4aH)-one (2) and methods of making (4aR,6S,8aR)-6-cyano-6,8a-dihydropyrano-[3,2-b]pyran-2(4aH)-one (4). Other pyranopyrans were also synthesized. Also compositions containing (4aR,6S,8aR)-6-cyano-6,8a-dihydropyrano-[3,2-b]pyran-2(4aH)-one (4) (or other pyranopyrans described herein) and optionally a carrier. In addition, methods for killing microorganisms or weeds on or in an object or area involving contacting the object or area with an effective microorganisms or weeds killing amount of a composition containing (4aR,6S,8aR)-6-cyano-6,8a-dihydropyrano-[3,2-b]pyran-2(4aH)-one (4) (or other pyranopyrans described herein) and optionally a carrier.
    Type: Application
    Filed: September 23, 2019
    Publication date: March 26, 2020
    Inventors: Kevin Schrader, Stephen O. Duke, Robert M. Giuliano
  • Publication number: 20200093133
    Abstract: Disclosed are compounds of Formula 1, including all geometric and stereoisomers, N-oxides, and salts thereof, wherein A, X, Y, Z, R1, R2a, R2b and Q are as defined in the disclosure. Also disclosed are compositions containing the compounds of Formula 1 and methods for controlling an invertebrate pest comprising contacting the invertebrate pest or its environment with a biologically effective amount of a compound or a composition of the invention.
    Type: Application
    Filed: May 4, 2018
    Publication date: March 26, 2020
    Inventor: Caleb William Holyoke, Jr.
  • Publication number: 20200093134
    Abstract: Concentrated suspensions containing phytosterols are described, in an amount higher than 25% by weight, in addition to a process for their preparation and their relative use as stimulants of plant growth.
    Type: Application
    Filed: June 14, 2018
    Publication date: March 26, 2020
    Inventors: Paolo BELLANDI, Ilenia Fiorenza MAZZALI, Elisa GALIMBERTI, Claudio DACARRO
  • Publication number: 20200093135
    Abstract: Provided herein are systems, methods, active ingredients, compositions and formulations for killing, deterring growth, or suppressing a population of certain species of pests such as insects, fungi and bacteria.
    Type: Application
    Filed: October 18, 2019
    Publication date: March 26, 2020
    Inventors: Emeka J. NCHEKWUBE, Cyprian Emeka UZOH
  • Publication number: 20200093136
    Abstract: The present application discloses herbicidal compositions containing a first herbicide beflubutamid, or an optically enriched form thereof, and a second herbicide selected from WSSA Group 15 herbicides, WSSA Group 13 herbicides, WSSA Group 27 herbicides, WSSA Group 9 herbicides, WSSA Group 10 herbicides, WSSA Group 22 herbicides, WSSA Group 7 herbicides, WSSA Group 3 herbicides, WSSA Group 14 triazolinone herbicides, WSSA Group 1 cyclohexanedione herbicides, WSSA Group 2 imidazolinone herbicides, WSSA Group 14 N-phenylphthalimide herbicides, WSSA Group 14 diphenylether herbicides, WSSA Group 14 pyrimidinedione herbicides, WSSA Group 5 1,2,4-triazine herbicides and herbicides selected from metamifop, atrazine, fenoxaprop-P-ethyl, 2,4-D (2,4-dichlorophenoxyacetic acid), florasulam, halosulfuron-methyl and prosulfocarb. The application also discloses a method of controlling undesired vegetation in a crop by applying to the locus of such vegetation a herbicidally effective amount of a herbicidal composition.
    Type: Application
    Filed: December 22, 2017
    Publication date: March 26, 2020
    Inventors: Sandra L. Shinn, Frank J. D'Amico, JR., Joachim Duus
  • Publication number: 20200093137
    Abstract: The present invention is directed to compositions containing herbicidal mixtures of pyroxasulfone and glutamine synthesis inhibitors. The present invention is further directed to methods of increasing the activity of a glutamine synthesis inhibitor with the compositions of the present invention.
    Type: Application
    Filed: November 26, 2019
    Publication date: March 26, 2020
    Inventor: Dawn Refsell
  • Publication number: 20200093138
    Abstract: Provided herein are methods for using RNAi molecules targeting an Inhibitor of Apoptosis (IAP) gene for controlling Coleopteran insects, methods for producing RNAi molecules targeting IAP, and compositions comprising RNAi molecules targeting IAP.
    Type: Application
    Filed: September 26, 2019
    Publication date: March 26, 2020
    Applicant: GreenLight Biosciences, Inc.
    Inventors: Thais Barros Rodrigues, Suresh Desai, Krishnakumar Sridharan
  • Publication number: 20200093139
    Abstract: A composition and method for treating a plant including a lyophilized bacteriophage present in an amount effective for the elimination of Xylella fastiodisa or Xanthonomas in the plant. The lyophilized bacteriophage is further combined with a bacteriophage nutrient and a water soluble polymer.
    Type: Application
    Filed: November 26, 2019
    Publication date: March 26, 2020
    Applicant: FAIRHAVEN VINEYARDS
    Inventor: Ronald Linwood Winters
  • Publication number: 20200093140
    Abstract: A dispensing baked good container assembly includes a container having a top and a bottom and a cavity between the top and the bottom configured to hold baked good ingredients. The container includes a closure member at the top configured to be opened. A pastry bag is configured to extend from the container. The pastry bag is initially packed in the cavity and configured to be deployed from the container after the container is opened. The pastry bag is open to the cavity such that items are configured to be passed through the cavity into the pastry bag after being deployed for mixing and dispensing of the baked good ingredients from the pastry bag.
    Type: Application
    Filed: November 26, 2019
    Publication date: March 26, 2020
    Inventors: Samuel Siwak, Benjamin Siwak, Molly Siwak
  • Publication number: 20200093141
    Abstract: A knife having scales includes a U-shaped handle having a first shaft and a second shaft, a first fixed knife, which is coupled with the handle, a second movable knife, which is able to connect to and move along the first shaft in order to divide an object by a desired angle, and a protractor, which is possible to be put on the first shaft, and is used as a guide for dividing the object into desired numbers, each of which is equal amount, wherein scales are shown on the protractor, and wherein the scales are grouped in accordance with the number that the object is divided.
    Type: Application
    Filed: November 29, 2019
    Publication date: March 26, 2020
    Inventors: Ayame NARA, Yuki FUKUDA, Ayumi NISHIMINE, Kana NAGASAWA, Keigo NAOI, Kazuma FUJISAWA, Miho ISHIDA, Yuka YAMANAKA, Kai KOMIYA
  • Publication number: 20200093142
    Abstract: A process and system is provided for the manufacture of vegetable dough using only water as an ingredient of the dough, and for a time interval ranging between 5 minutes and up to 10 minutes, wherein the vegetable is selected from vegetables and grains.
    Type: Application
    Filed: September 14, 2017
    Publication date: March 26, 2020
    Inventors: Andrew Anthony Caridis, Ernesto Isam Arao Toyohara, Jesús Adolfo Sandoval Avila, Sergio González Granados, Miguel Angel Gómez Angulo, Mario Lorenzana Saucedo, Arturo Lorenzana Guerrero
  • Publication number: 20200093143
    Abstract: A dough for the production of an outer casing for a snack product including the ingredients: crumbs of a previously made bakery product; fat component; liquid component; emulsifier; and raising agent, wherein the proportion of the crumbs is between 20% by weight and 60% by weight.
    Type: Application
    Filed: October 17, 2019
    Publication date: March 26, 2020
    Inventors: Hans Mandl, Rudolf Haindl
  • Publication number: 20200093144
    Abstract: Slaughter installation including a conveyor line with carriers for suspending poultry by the legs and conveying the poultry in a conveying track. Head positioning means arranged for forcing the bill of the poultry in a direction opposite to the transport direction of the suspended poultry. Killing device having at least a first rotary knife positioned alongside of the conveying track for cutting into the neck of the suspended poultry while avoiding to cut a certain parts. A first guide wheel upstream and proximate to the first rotary knife, which first guide wheel is positioned alongside the conveying track. A passageway between the first rotary knife and the first guide wheel through which the poultry neck is able to pass.
    Type: Application
    Filed: September 25, 2019
    Publication date: March 26, 2020
    Inventors: Aloysius Christianus Maria Van Steijn, Joy David Mike Van Spall, Ramzi Souli
  • Publication number: 20200093145
    Abstract: A gravity fed smoker includes a smoking enclosure and an external stack. The stack is double walled with an inner wall, and an outer wall. A vented cooling space exists between the inner wall and the outer wall. An inner chamber of the external stack includes a fire box with a fire grate and a feed hopper positioned above the fire box. A smoke tunnel with a series of openings for releasing smoke into the smoking enclosure extends along the bottom of the food smoking enclosure and is connected to the external fire box at one end. Fuel, including charcoal, lump coal, or wood pellets, is loaded into the feed hopper. As the fuel burns on the fire grate and turns to ashes, the fuel is fed from the hopper onto the fire grate by gravity. A fan and dampers controls air flow through the fire grate and into the smoke tunnel.
    Type: Application
    Filed: August 8, 2019
    Publication date: March 26, 2020
    Inventors: Olin Powell, Adam Carter, Robert V. Terrell, Daniel Mercer
  • Publication number: 20200093146
    Abstract: The present disclosure relates to a method for treating an object with chlorine dioxide gas, comprising contacting the object with chlorine dioxide gas while exposing the object to less than 1000 lux of light. The disclosed method minimizes chlorine containing residue on the surface of the object. The object can be a raw agricultural commodity (RAC) such as a raw fruit or vegetable.
    Type: Application
    Filed: September 30, 2019
    Publication date: March 26, 2020
    Inventors: William Ernst, Joel Tenney
  • Publication number: 20200093147
    Abstract: Embodiments described herein relate generally to plant extract compositions and methods to isolate cutin-derived monomers, oligomers, and mixtures thereof for application in agricultural coating formulations, and in particular, to methods of preparing plant extract compositions that include functionalized and non-functionalized fatty acids and fatty esters (as well as their oligomers and mixtures thereof), which are substantially free from accompanying plant-derived compounds (e.g., proteins, polysaccharides, phenols, lignans, aromatic acids, terpenoids, flavonoids, carotenoids, alkaloids, alcohols, alkanes, and aldehydes) and can be used in agricultural coating formulations.
    Type: Application
    Filed: November 14, 2019
    Publication date: March 26, 2020
    Inventors: Louis Perez, James Rogers, Ronald C. Bakus, II, Chance Holland, Jenny Du
  • Publication number: 20200093148
    Abstract: Provided is a method of preparing fermented milk containing Lactobacillus plantarum SFB1 (KCCM11237P). Owing to rapid production of lactic acid and curd, the fermented milk can significantly reduce fermentation time, maintain high lactic acid bacteria numbers, reduce manufacturing costs, improve production efficiency and provide excellent sensory characteristics.
    Type: Application
    Filed: September 20, 2018
    Publication date: March 26, 2020
    Applicant: Seoul F&B Co., Ltd.
    Inventors: Duk Geun OH, Young Soon LIM
  • Publication number: 20200093149
    Abstract: The dairy industry today faces a problem of providing an alternative to adding sweeteners to fermented milk products in order to achieve the desired sweet taste without the added calories. Furthermore, it would be highly advantageous to establish a method for reducing lactose in fermented milk products to a level which is acceptable for lactose-intolerant consumers. The above problems have been solved by providing mutant Streptococcus thermophilus strains and mutant Lactobacillus delbrueckii subsp. bulgaricus strains that excrete glucose to the milk when the milk is inoculated and fermented with such Streptococcus thermophilus strains and Lactobacillus delbrueckii subsp, bulgaricus strains.
    Type: Application
    Filed: October 17, 2019
    Publication date: March 26, 2020
    Applicant: Chr. Hansen A/S
    Inventors: Eric JOHANSEN, Kim Ib SOERENSEN, Mirjana CURIC-BAWDEN, Mette Pia JUNGE
  • Publication number: 20200093150
    Abstract: The present invention addresses the problem of providing a method for producing a vegetable cheese-like food product which exhibits suitability for a shaping process, such as shredding, and which has natural cheese-like meltiness (melting and oil-release when heated) and a milky flavor similar to that of natural cheese. This vegetable cheese-like food product is obtained by adjusting, through organic acid fermentation and/or lactic acid fermentation, the pH of an emulsified oil or fat composition to 3.5-5.7, said composition including a specific soybean protein, an acid-treated starch, and an oil or fat in which the solid fat content (SFC) account for at least 45% at 10° C. and at least 20% at 20° C.
    Type: Application
    Filed: February 22, 2018
    Publication date: March 26, 2020
    Applicant: FUJI OIL HOLDINGS INC.
    Inventors: Hiroshi MIZUNO, Naoki SHIROTANI, Setsuo TSUJII