Patents Issued in August 24, 2021
  • Amorphous solid form of compounds containing S—N-valeryl-N-{[2?-(1H-tetrazole-5-yl)-biphenyl-4-yl]-methyl}-valine and (2R,4S)-5-biphenyl-4-yl-4-(3-carboxy-propionylamino)-2-methyl-pentanoic acid ethyl ester moieties and sodium cations
    Patent number: 11096918
    Abstract: An amorphous solid form of a compound comprising the angiotensin receptor antagonist (ARB) valsartan, the neutral endopeptidase inhibitor (NEPi) (2R,4S)-5-biphenyl-4-yl-4-(3-carboxy-propionylamino)-2-methylpentanoic acid ethyl ester and sodium cations is provided. This compound is useful for the treatment of hypertension and/or heart failure.
    Type: Grant
    Filed: September 23, 2019
    Date of Patent: August 24, 2021
    Assignee: NOVARTIS PHARMACEUTICALS CORPORATION
    Inventors: Lili Feng, Sven Erik Godtfredsen, Paul Allen Sutton, Mahavir Prashad, Michael J. Girgis, Bin Hu, Yugang Liu, Thomas J. Blacklock, Piotr Henryk Karpinski
  • Esters for treatment of ocular inflammatory conditions
    Patent number: 11096919
    Abstract: The present invention relates to ophthalmic compositions and methods for the treatment of dry eye and other inflammatory ocular conditions. In particular, the present invention relates to a composition comprising an esterified anti-inflammatory lipid mediator, which is an ester of an anti-inflammatory lipid mediator that is a reaction product of the anti-inflammatory lipid mediator and a monohydric alcohol or an amide wherein the majority of the anti-inflammatory lipid mediator is present in an ester form. In this way, the compositions are substantially free of an acid form of the anti-inflammatory lipid mediators. This composition can be topically delivered to the ocular surface via a preparation, solution, gel, ointment, and/or strip and/or a contact lens.
    Type: Grant
    Filed: July 2, 2019
    Date of Patent: August 24, 2021
    Assignee: Johnson & Johnson Vision Care, Inc.
    Inventors: Annabelle Gallois-Bernos, Frank F. Molock, Jr., Carrie L. Davis, Kathrine Osborn Lorenz, James K. Young, Kristy L. Canavan, Fang Lu
  • Low-dose doxepin formulations and methods of making and using the same
    Patent number: 11096920
    Abstract: The invention disclosed herein generally relates to low-dose oral doxepin pharmaceutical formulations and the use of these formulations to promote sleep.
    Type: Grant
    Filed: February 3, 2020
    Date of Patent: August 24, 2021
    Assignee: Currax Pharmaceuticals LLC
    Inventors: Luigi Schioppi, Brian Talmadge Dorsey, Michael Skinner, John Carter, Robert Mansbach, Philip Jochelson, Roberta L. Rogowski, Cara Baron Casseday, Meredith Perry, Bryan Knox
  • SIRT 1 activator including syringaresinol
    Patent number: 11096921
    Abstract: The present invention relates to a compound of Formula 1, and an SIRT 1 activator including, as an active ingredient, derivatives thereof or pharmaceutically acceptable salts thereof. The present invention also relates to a composition including the SIRT 1 activator for detoxification, for the improvement of metabolic disorders, for the prevention or improvement of eye diseases, or the prevention or improvement of immune diseases.
    Type: Grant
    Filed: May 20, 2016
    Date of Patent: August 24, 2021
    Assignee: AMOREPACIFIC CORPORATION
    Inventors: Byung Gyu Kim, Hyun Woo Jeong, Su Kyung Kim, Si Young Cho, Chan Woong Park, Dae Bang Seo, Wan Gi Kim, Sang Jun Lee
  • Anesthetic composition and method of anesthetizing the eye
    Patent number: 11096922
    Abstract: A topical ophthalmic anesthetic composition includes a formulation with an amount of articaine to provide anesthetic properties when applied topically to the eye, and a pH, viscosity, osmolality, dissociation constant, and additives such as antioxidants, buffers, methylcellulose, to achieve efficacy and safety. The composition can contain articaine in amounts of about 4.0% w/v to about 12.0% w/v and have a pH of about pH 3.5 to pH 7.0. The buffer can be borate/mannitol complex obtained from boric acid or salt thereof and D-mannitol. The articaine formulations can achieve adequate anesthesia of the internal aspect of the eye wall by topical application, without the use of an injectable anesthetic. Exemplary implementations of the disclosure include formulations include articaine in an amount of at least 7.0% w/v, where the formulation is an aqueous solution, a gel, an ointment, or in an encapsulated form.
    Type: Grant
    Filed: March 6, 2020
    Date of Patent: August 24, 2021
    Inventor: Martin Uram
  • Pharmaceutical composition containing polymyxin B/trimethoprim based therapeutics
    Patent number: 11096923
    Abstract: The present invention features an antibacterial composition comprising 1) a composition A comprising polymyxin B and trimethoprim; and 2) an antibiotic agent selected from the group consisting of rifampicin, rifabutin, rifapentine, rifaximin, pefloxacin mesylate, sparfloxacin, sarafloxacin HCl, tobramycin, lomefloxacin, besifloxacin, danofloxacin mesylate, enrofloxacin, nadifloxacin and clinafloxacin, a topical pharmaceutical thereof, and a method of treating bacterial infections using mixtures of 1 and 2.
    Type: Grant
    Filed: August 16, 2017
    Date of Patent: August 24, 2021
    Assignee: University of Rochester
    Inventors: Paul M. Dunman, Rachel Wozniak
  • Combination therapies using immuno-dash inhibitors and PGE2 antagonists
    Patent number: 11096924
    Abstract: Disclosed are combination therapies including administration of I-DASH inhibitors and PGE2 antagonists, and the use of such therapies in the treatment of cell proliferative diseases.
    Type: Grant
    Filed: September 7, 2017
    Date of Patent: August 24, 2021
    Assignee: Trustees of Tufts College
    Inventors: William W. Bachovchin, Hung-sen Lai, Wengen Wu
  • Indole derivatives for biofilm disruption and inhibition
    Patent number: 11096925
    Abstract: A method for inhibiting biofilm formation by bacteria on a surface or disrupting existing biofilm on a surface, including contacting the surface or existing biofilm with 2-(indolin-2-yl)-1H-ind, di(1H-indol-3-yl)methane and 1,1?-biindole, or any combination thereof.
    Type: Grant
    Filed: January 4, 2018
    Date of Patent: August 24, 2021
    Assignee: Life Matters Ltd.
    Inventors: Ariel Kushmaro, Robert S. Marks, Karina Golberg
  • (3AR)-1,3A,8-trimethyl-1,2,3,3A,8,8A-hexahydropyrrolo[2,3-b]indol-5-yl phenylcarbamate and methods of treating or preventing neurodegeneration
    Patent number: 11096926
    Abstract: The invention includes an amount of (3aR)-1,3a,8-trimethyl-1,2,3,3a,8,8a-hexahydropyrrolo[2,3-b]indol-5-yl phenylcarbamate for administering to a subject and also a method of preventing or treating neurotoxicity or neurodegenerative processes in a subject in need thereof using the amount thereof.
    Type: Grant
    Filed: July 8, 2019
    Date of Patent: August 24, 2021
    Assignee: ANNOVIS BIO, INC.
    Inventor: Maria Maccecchini
  • Anti-flavivirus compounds and methods of use
    Patent number: 11096927
    Abstract: The present invention concerns the use of compounds and compositions for the treatment or prevention of Flavivirus infections, such as dengue virus infections and Zika virus infections. Aspects of the invention include methods for treating or preventing Flavivirus virus infection, such as dengue virus and Zika virus infection, by administering a compound or composition of the invention, to a subject in need thereof; methods for inhibiting Flavivirus infections, such as dengue virus and Zika virus infections, in a cell in vitro or in vivo; pharmaceutical compositions; packaged dosage formulations; and kits useful for treating or preventing Flavivirus infections, such as dengue virus and Zika virus infections.
    Type: Grant
    Filed: December 19, 2019
    Date of Patent: August 24, 2021
    Assignees: FLORIDA STATE UNIVERSITY RESEARCH FOUNDATION, INC., THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES, THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA
    Inventors: Hengli Tang, Emily M. Lee, Wei Zheng, Ruili Huang, Miao Xu, Wenwei Huang, Khalida Shamim, Guoli Ming, Hongjun Song
  • Pharmaceutical composition
    Patent number: 11096928
    Abstract: The present invention relates to a pharmaceutical composition comprising: (a) at least one neutral endopeptidase inhibitor or a pharmaceutically acceptable salt or ester thereof, (b) at least one compound represented by formula (I) or a pharmaceutically acceptable salt or ester thereof, and a pharmaceutically acceptable carrier. Combined administration showed better medicinal effects than separate administration.
    Type: Grant
    Filed: September 27, 2017
    Date of Patent: August 24, 2021
    Assignee: WUHAN LL SCIENCE AND TECHNOLOGY DEVELOPMENT CO., LTD.
    Inventors: Chaodong Wang, Yongkai Chen, Liu Hu, Xian Zeng, Daiwu Kang
  • Methods of treating developmental disorders with gaboxadol
    Patent number: 11096929
    Abstract: Methods of treating developmental disorders such as Angelman syndrome, Fragile X syndrome, Fragile X-associated tremor/ataxia syndrome (FXTAS), Autistic Spectrum Disorder, Autism, Asperger's syndrome, pervasive developmental disorder, Childhood Disintegrative Disorder, Rett syndrome, Lanau-Kleffner Syndrome, Prader-Willi Syndrome, Tardive Dyskinesia, and/or Williams Syndrome with gaboxadol or a pharmaceutically acceptable salt thereof are provided. The methods provide therapeutic compositions that may be used to improve one or more symptoms of the developmental disorder.
    Type: Grant
    Filed: December 17, 2018
    Date of Patent: August 24, 2021
    Assignee: OVID THERAPEUTICS INC.
    Inventor: Matthew During
  • Substituted imidazopyridine compounds as inhibitors of indoleamine 2,3-dioxygenase and/or tryptophan-2,3-dioxygenase
    Patent number: 11096930
    Abstract: Disclosed herein are substituted imidazopyridine compounds of formula (I) which are inhibitors of indoleamine 2,3-dioxygenase (IDO) and/or tryptophan-2,3-dioxygenase (TDO) enzymes: (I). Also disclosed herein are uses of the compounds in the potential treatment or prevention of an IDO- and/or TDO-associated disease or disorder. Also disclosed herein are compositions comprising these compounds. Further disclosed herein are uses of the compositions in the potential treatment or prevention of an IDO- and/or TDO-associated disease or disorder.
    Type: Grant
    Filed: April 24, 2017
    Date of Patent: August 24, 2021
    Assignees: Merck Sharp & Dohme Corp., IOmet Pharma Ltd.
    Inventors: Phillip M. Cowley, Meredeth Ann McGowan, Thomas J. Brown, Yongxin Han, Kun Liu, Qinglin Pu, Alan Wise, Hongjun Zhang, Hua Zhou
  • Amide derivatives useful in the treatment of HBV infection or HBV-induced diseases
    Patent number: 11096931
    Abstract: The application relates to amide derivatives, processes for their preparation, pharmaceutical compositions, and their uses, more particularly their uses in treating chronic hepatitis B virus (HBV) infection.
    Type: Grant
    Filed: February 21, 2020
    Date of Patent: August 24, 2021
    Assignee: Janssen Sciences Ireland Unlimited Company
    Inventors: Stefaan Julien Last, Bart Rudolf Romanie Kesteleyn, Sandrine Céline Grosse, Tim Hugo Maria Jonckers, Jan Martin Berke, Geerwin Yvonne Paul Haché, Edgar Jacoby, Carolina Martinez Lamenca, Morgan Charles R. Lecomte, Abdellah Tahri, Sarah Sauviller, Karen Maria Vergauwen
  • Methods and compositions for increasing mucus clearance
    Patent number: 11096932
    Abstract: Provided herein are methods of increasing mucus clearance in a subject having decreased mucus clearance. Also provided are methods of treating or preventing a respiratory disorder.
    Type: Grant
    Filed: September 29, 2017
    Date of Patent: August 24, 2021
    Assignee: THE UAB RESEARCH FOUNDATION
    Inventors: Sammeta Vamsee Raju, Lawrence Rasmussen, Steven Mark Rowe
  • Method of treating disorders associated with chronic inflammation
    Patent number: 11096933
    Abstract: In one aspect, a method of treating a disorder associated with chronic inflammation includes administering to an individual in need thereof a therapeutically effective amount of isomyosmine or a pharmaceutically acceptable salt thereof. In some aspects, the disorder is a cancer, an autoimmune disorder, hypertension, or autism. In other aspects, isomyosmine is administered to treat viral infections or disorders associated with elevated levels of hydrogen peroxide and/or other Reactive Oxygen Species (ROS).
    Type: Grant
    Filed: October 29, 2020
    Date of Patent: August 24, 2021
    Assignee: MyMD Pharmaceuticals (Florida), Inc.
    Inventor: Jonnie R. Williams
  • Compounds and methods useful for treating or preventing hematological cancers
    Patent number: 11096934
    Abstract: The present invention includes methods of treating patients with acute myeloid leukemia across a range of genetic subtypes with DHODH inhibitors, such as 6-fluoro-2-(2?-fluoro-[1,1?-biphenyl]-4-yl)-3-methylquinoline-4-carboxylic acid).
    Type: Grant
    Filed: August 29, 2016
    Date of Patent: August 24, 2021
    Assignees: THE BROAD INSTITUTE, INC., THE GENERAL HOSPITAL CORPORATION, PRESIDENT AND FELLOWS OF HARVARD COLLEGE, BAYER PHARMA AKTIENGESELLSCHAFT
    Inventors: David B. Sykes, David Scadden, Timothy A. Lewis, Andreas Janzer, Hanna Meyer, Detlef Stöckigt
  • Use of hexokinase 2/mitochondria-detaching compounds for activating immune responses
    Patent number: 11096935
    Abstract: The present invention provides methods of use of hexokinase 2 (HK2)/mitochondria-detaching compounds, including jasmonate derivatives and piperazine derivatives and pharmaceutical compositions including such compounds for inducing immune responses in a subject, including potentiating the immune response to hyperproliferative disorders such as cancer and potentiating the immune response to infectious diseases.
    Type: Grant
    Filed: January 29, 2020
    Date of Patent: August 24, 2021
    Assignee: VIDAC PHARMA LTD
    Inventors: Vered Behar, Oren Menahem Becker, Reut Yosef Hamo, Eyal Dor-On
  • Cocrystals of naloxone and naltrexone
    Patent number: 11096936
    Abstract: This invention relates to cocrystals of naloxone and of naltrexone and their use as opioid antagonists. The cocrystals of the invention include naloxone isonicotinamide cocrystal, naloxone hydrochloride piperazine cocrystal, naltrexone menthol cocrystal, naltrexone thymine cocrystal, naltrexone 2,5-dihydroxybenzoic acid cocrystal, naltrexone salicylic acid cocrystal, naltrexone hydrochloride piperazine cocrystal and naltrexone hydrochloride sulfathiazole cocrystal. A drug-in¬ adhesive transdermal patch containing the opioid analgesic fentanyl or an analog thereof and a cocrystal of naloxone or naltrexone is disclosed. Also disclosed is a method of treating pain, such as acute, chronic or intermittent pain, by applying a drug-in-adhesive transdermal patch of the invention to the skin of a patient in need thereof.
    Type: Grant
    Filed: September 26, 2016
    Date of Patent: August 24, 2021
    Assignee: Cassava Sciences, Inc.
    Inventors: Remi Barbier, Nadav Friedmann, Vijay Srirambhatla, Stephen Watt, Michael Zamloot
  • Bupropion as a modulator of drug activity
    Patent number: 11096937
    Abstract: Dosage forms, drug delivery systems, and methods related to sustained release of dextromethorphan or improved therapeutic effects are disclosed. Typically, bupropion or a related compound is orally administered to a human being to be treated with, or being treated with, dextromethorphan.
    Type: Grant
    Filed: October 20, 2020
    Date of Patent: August 24, 2021
    Assignee: ANTECIP BIOVENTURES II LLC
    Inventor: Herriot Tabuteau
  • Device and kit for dosing and dispensing non-liquid medicine
    Patent number: 11096938
    Abstract: A kit comprising a device for dosing and dispensing a dose of a non-liquid medicine that is readily dispersible in an aqueous solution suitable for oral administration, preferably a temozolomide formulation that can be titrated readily and accurately.
    Type: Grant
    Filed: March 16, 2019
    Date of Patent: August 24, 2021
    Assignee: AMPLIPHARM PHARMACEUTICALS, LLC
    Inventors: Gary Payton, Jeff Bryant, Frank Francavilla
  • KRAS G12C inhibitors and methods of using the same
    Patent number: 11096939
    Abstract: Provided herein are KRAS G12C inhibitors, such as composition of the same, and methods of using the same. These inhibitors are useful for treating a number of disorders, including pancreatic, colorectal, and lung cancers.
    Type: Grant
    Filed: May 31, 2019
    Date of Patent: August 24, 2021
    Assignee: Amgen Inc.
    Inventors: Shon Booker, John Gordon Allen, Brian Alan Lanman, Ryan Paul Wurz, Ning Chen, Victor J. Cee, Patricia Lopez, Aaron C. Siegmund, Michael D. Bartberger
  • Treatment of hepatocellular carcinoma characterized by hepatitis B virus infection
    Patent number: 11096940
    Abstract: Provided herein are methods for treating and/or preventing hepatocellular carcinoma (HCC) characterized by hepatitis B virus (HBV) infection in a patient, comprising administering an effective amount of 7-(6-(2-hydroxypropan-2-yl)pyridin-3-yl)-1-((trans)-4-methoxycyclohexyl)-3,4-dihydropyrazino[2,3-b]pyrazin-2(1H)-one or a pharmaceutically acceptable salt or tautomer thereof (collectively referred to herein as “Compound 1”) to the patient having HCC characterized by HBV infection.
    Type: Grant
    Filed: June 21, 2018
    Date of Patent: August 24, 2021
    Assignee: Celgene Corporation
    Inventors: Ellen Filvaroff, Kristen M. Hege, Shaoyi Li
  • Methods of treating circadian rhythm sleep disorders
    Patent number: 11096941
    Abstract: Methods of treating irregular sleep-wake rhythm disorder in subjects and compositions for use in the same are disclosed.
    Type: Grant
    Filed: May 11, 2017
    Date of Patent: August 24, 2021
    Assignee: EISAI R&D MANAGEMENT CO.. LTD.
    Inventors: Carsten T. Beuckmann, Margaret Moline, Andrew Satlin
  • Heterocyclic compounds and uses thereof
    Patent number: 11096942
    Abstract: The present invention provides compounds, pharmaceutically acceptable compositions thereof, and methods of using the same.
    Type: Grant
    Filed: October 4, 2019
    Date of Patent: August 24, 2021
    Assignee: Celgene CAR LLC
    Inventors: Kwangho Lee, Deqiang Niu, Russell C. Petter, Matthew Frank Baevsky, Juswinder Singh
  • Organic compounds
    Patent number: 11096944
    Abstract: The invention relates to particular substituted deuterated heterocycle fused gamma-carbolines, their prodrugs, in free, solid, pharmaceutically acceptable salt and/or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving 5-HT2A receptor, serotonin transporter (SERT) and/or pathways involving dopamine D1/D2 receptor signaling systems, and/or the treatment of residual symptoms.
    Type: Grant
    Filed: May 15, 2020
    Date of Patent: August 24, 2021
    Assignee: Intra-Cellular Therapies, Inc.
    Inventors: Wei Yao, Peng Li
  • Pharmaceutical compositions of linagliptin and process for preparation thereof
    Patent number: 11096945
    Abstract: Pharmaceutical compositions comprising an antidiabetic agent as an active agent are provided. The present invention relates to pharmaceutical compositions comprising linagliptin or a pharmaceutically acceptable salt thereof as an active agent. The present invention also relates to process of preparation of pharmaceutical compositions comprising linagliptin or a pharmaceutically acceptable salt thereof. The present invention also relates to method of administering the compositions comprising linagliptin to a subject in need thereof.
    Type: Grant
    Filed: April 23, 2018
    Date of Patent: August 24, 2021
    Assignee: Aurobindo Pharma Ltd
    Inventors: Venugopala Chokkasandra Jayaramareddy, Sreenivas Reddy, Chandrashekhar Shriram Kandi, Sivakumaran Meenakshisunderam
  • Use of a PPAR-? agonist for reducing loss of muscle strength, muscle mass, or type I muscle fibers in an immobilized limb
    Patent number: 11096946
    Abstract: The present invention provides methods for reducing loss of muscle strength, muscle mass, or Type I muscle fibers in an immobilized limb by administering (E)-[4-[3-(4-Fluorophenyl)-3-[4-[3-(morpholin-4-yl)propynyl]phenyl]allyloxy]-2-methyl-phenoxy]acetic acid or a pharmaceutically acceptable salt thereof.
    Type: Grant
    Filed: October 22, 2019
    Date of Patent: August 24, 2021
    Assignee: VTV THERAPEUTICS LLC
    Inventors: Maria Carmen Valcarce Lopez, Eliot Ohlstein
  • Combination products with tyrosine kinase inhibitors and their use
    Patent number: 11096947
    Abstract: The present invention relates to pharmaceutical products comprising a combination of (i) a MET inhibitor and (ii) an EGFR inhibitor, or a pharmaceutically acceptable salt thereof, respectively, or a prodrug thereof, which are jointly active in the treatment of proliferative diseases, corresponding pharmaceutical formulations, uses, methods, processes, commercial packages and related invention embodiments.
    Type: Grant
    Filed: June 18, 2020
    Date of Patent: August 24, 2021
    Assignee: Novartis AG
    Inventors: Ralph Tiedt, Christian Chatenay-Rivauday, Moriko Ito, Mikhail Akimov, Bin Peng, Ying Gong
  • Methods for treating infection
    Patent number: 11096948
    Abstract: Composition and methods suitable for treating Helicobacter infection and diseases associated therewith are provided. The composition containing fusidic acid or a pharmaceutically acceptable salt or solvate thereof.
    Type: Grant
    Filed: January 16, 2017
    Date of Patent: August 24, 2021
    Assignee: DEXCEL PHARMA TECHNOLOGIES LTD.
    Inventor: Dan Oren
  • In-vial deposition of a stable, sterile and crystalline O-acetyl salicylic acid
    Patent number: 11096949
    Abstract: Improved, stable aspirin formulations for intravenous use are disclosed. Methods of lyophilizing the aspirin from bulk solutions as well as kits containing the lyophilized aspirin and methods of treatment using the same are also disclosed.
    Type: Grant
    Filed: May 29, 2018
    Date of Patent: August 24, 2021
    Assignee: RHOSHAN PHARMACEUTICALS, INC.
    Inventor: Nagesh R. Palepu
  • Compounds, methods, and treatments for abnormal signaling pathways for prenatal and postnatal development
    Patent number: 11096950
    Abstract: The present invention relates to prevention of congenital deformations. The invention further relates to cancer inhibition and prevention. The invention further relates to methods and compositions to modulate, antagonize, or agonize disparate signaling pathways that may converge to regulate patterning events and gene expression during prenatal development, post-natal development, and during development in the adult organism. The invention also relates to activators or deactivators of pyruvate kinase M2 (PKM2) for the treatment, prevention, or amelioration of diseases related to PKM2 function.
    Type: Grant
    Filed: December 22, 2015
    Date of Patent: August 24, 2021
    Inventor: Barbara Brooke Jennings
  • Prebiotic composition containing butyryl-fructooligosaccharides
    Patent number: 11096951
    Abstract: Provided is a prebiotic composition containing butyryl-fructooligosaccharide (B-FOS). B-FOS of the present invention facilitates selective growth of probiotics, thereby controlling intestinal microbes and contributing to physiological functions as an energy source of intestinal epithelial cells.
    Type: Grant
    Filed: June 29, 2018
    Date of Patent: August 24, 2021
    Assignee: BIFIDO CO., LTD.
    Inventors: Geun Eog Ji, Min Hee Um, Si Ni Kang, Myeong Soo Park, Bin Kwon
  • Chemicals and methods to prevent and treat TGF-beta mediated activation of fibroblasts to reduce and treat cancer and fibrosis
    Patent number: 11096952
    Abstract: A method of treating an activated fibroblast associated disease or pre-disease condition in a mammal comprising, administering a pharmaceutical composition including a therapeutically effective amount of a first therapeutic, wherein the first therapeutic is one of an intracellular Ca2+ elevator, a YAP/TAZ inhibitor, both a intracellular Ca2+ elevator and a YAP/TAZ inhibitor, or pharmacologically acceptable salts, solvates, esters, amides, clathrates, stereoisomers, enantiomers, prodrugs or analogs thereof, or a combination thereof.
    Type: Grant
    Filed: February 2, 2017
    Date of Patent: August 24, 2021
    Assignee: BOARD OF SUPERVISORS OF LOUISIANA STATE UNIVERSITY AND AGRICULTURAL AND MECHANICAL COLLEGE
    Inventors: James Allen Cardelli, Charles Albert Stephens, Alana Lea Gray, David Thomas Coleman
  • Compositions comprising decitabine and tetrahydrouridine and uses thereof
    Patent number: 11096953
    Abstract: Embodiments of compositions and methods for the treatment of blood disorders and malignancies in a subject are described herein. In one embodiment, a composition for the treatment of a blood disorder or a malignancy in a subject comprises decitabine, tetrahydrouridine, and an excipient. In another embodiment, a method for the treatment of a blood disorder or a malignancy in a subject comprises the oral administration of a composition comprising decitabine and tetrahydrouridine. In some examples, the composition may be administered 1-3 times weekly.
    Type: Grant
    Filed: November 15, 2019
    Date of Patent: August 24, 2021
    Assignee: BOARD OF TRUSTEES OF THE UNIVERSITY OF ILLINOIS
    Inventors: Joseph Desimone, Yogen Saunthararajah
  • Bisphosphocin gel formulations and uses thereof
    Patent number: 11096954
    Abstract: Gel formulations including a Bisphosphocin having antimicrobial activity are disclosed. Methods of using the gel formulations including a Bisphosphocin are further disclosed.
    Type: Grant
    Filed: June 12, 2018
    Date of Patent: August 24, 2021
    Assignee: Lakewood Amedex, Inc.
    Inventors: Steven A. Kates, Keith Arthur Johnson
  • Synthetic promoters and uses thereof
    Patent number: 11096955
    Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC? wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.
    Type: Grant
    Filed: February 9, 2017
    Date of Patent: August 24, 2021
    Assignee: Fondazione Telethon
    Inventors: Enrico Maria Surace, Mariangela Lupo, Salvatore Botta, Elena Marrocco, Nicola De Prisco
  • Antisense oligomers and uses thereof
    Patent number: 11096956
    Abstract: Provided herein are methods and compositions for increasing the expression of a protein, and for treating a subject in need thereof, e.g., a subject with deficient protein expression or a subject having a disease described herein.
    Type: Grant
    Filed: June 13, 2018
    Date of Patent: August 24, 2021
    Assignees: STOKE THERAPEUTICS, INC., COLD SPRING HARBOR LABORATORY
    Inventors: Isabel Aznarez, Huw M. Nash, Adrian Krainer
  • High molecular weight glucan having low digestion rate
    Patent number: 11096957
    Abstract: One purpose of the present invention is to provide a high molecular weight glucan having both properties low digestion rate and high digestibility. A high molecular weight glucan that has property digested slowly and contains almost no indigestible ingredients is produced by enzymatic reactions of (1) a specific concentration of branching enzyme and (2) 4-?-glucanotransferase and/or an exo-type amylase to a branched glucan used as a substrate.
    Type: Grant
    Filed: December 22, 2017
    Date of Patent: August 24, 2021
    Assignee: EZAKI GLICO CO., LTD.
    Inventors: Hiroshi Watanabe, Yoshinobu Terada
  • Sodium chlorite compositions with enhanced anti-microbial efficacy and reduced toxicity
    Patent number: 11096958
    Abstract: Disclosed are antiseptic compositions for disinfecting tissues, in particular for ocular use. Methods and compositions disclosed herein include sodium chlorite, optionally in combination with a surfactant.
    Type: Grant
    Filed: April 25, 2019
    Date of Patent: August 24, 2021
    Assignee: Allergan, Inc.
    Inventors: James A. Burke, Richard S. Graham, Corine Ghosn, Alexandra Almazan, Michael Engles, Lakshmi Rajagopalan
  • Microenvironment hydrogen-supplying breathable layer and applications thereof
    Patent number: 11096959
    Abstract: A hydrogen-supplying breathable layer in the present disclosure comprises: a thin layer wrapping a hydrogen-producing formula inside, having an airtight outer side as well as an air-permeable inner side on which a plurality of micro pores are opened and featuring a monolayer or a composite layer; a hydrogen-producing formula wrapped inside the thin layer and not dissipated but absorbing moistures in air or liquid water for generation of hydrogen; hydrogen permeating a plurality of micro pores and released to skin and intra-corporal parts. The hydrogen-producing formula in the hydrogen-supplying breathable layer comprises metal peroxides (metal hydroxides or metal hydrides) and aluminum powders (or silica powders); the breathable layer is applicable to a dressing pack or other sanitary paraphernalia in daily lives for relieving non-bacteria inflammations and promoting health care effects.
    Type: Grant
    Filed: June 5, 2019
    Date of Patent: August 24, 2021
    Assignee: TO2M CORPORATION
    Inventors: Garry Tsaur, Ting-Hua Wang, Frank Tsaur, Nancy Tsaur, Emily Tsaur
  • Mineral, nutritional, cosmetic, pharmaceutical, and agricultural compositions and methods for producing the same
    Patent number: 11096960
    Abstract: Mineral, cosmetic, pharmaceutical, agricultural, nutraceutical, and other compositions are produced using a mineral composition containing minimal concentrations of cadmium, lead, arsenic, and mercury and containing relatively high concentrations of micro and macro mineral elements, of rare earth elements, of calcium, and of silica. The mineral concentrations are produced by processing naturally occurring clay soil to concentrate mineral elements naturally occurring in the soil.
    Type: Grant
    Filed: September 10, 2019
    Date of Patent: August 24, 2021
    Assignee: Core Intellectual Properties Holdings, LLC
    Inventors: Roger D. Blotsky, Ramon Figueroa
  • Pharmaceutical composition for suppressing spinal cord ischemic disorder
    Patent number: 11096961
    Abstract: To provide a gaseous pharmaceutical composition for suppressing spinal cord ischemic disorder, comprising carbon dioxide.
    Type: Grant
    Filed: April 1, 2020
    Date of Patent: August 24, 2021
    Assignees: SUMITOMO SEIKA CHEMICALS CO., LTD., Kotaro Kida
    Inventor: Kotaro Kida
  • Nanoparticles for use as a therapeutic vaccine
    Patent number: 11096962
    Abstract: The present invention relates to the field of human health and more particularly concerns nanoparticles for use as a therapeutic vaccine in the context of radiotherapy in a subject suffering of a cancer, in particular of a metastatic cancer or of a liquid cancer.
    Type: Grant
    Filed: May 27, 2016
    Date of Patent: August 24, 2021
    Assignee: NANOBIOTIX
    Inventors: Julie Marill, Agnes Pottier, Laurent Levy
  • Cryoprecipitate compositions and methods of preparation thereof
    Patent number: 11096963
    Abstract: Provided herein are compositions and kits including a pathogen-inactivated cryoprecipitate suitable for infusion into a subject at least 1 day after thawing. The methods are useful in the efficient preparation of cryoprecipitates with desirable characteristics, including pathogen-inactivated cryoprecipitates that are suitable for infusion into a subject at least 1 day after thawing.
    Type: Grant
    Filed: June 24, 2016
    Date of Patent: August 24, 2021
    Assignee: Cerus Corporation
    Inventors: Laurence Corash, Elan Weiner, Melody Holtan, Richard Benjamin
  • Compositions and methods for immune cell modulation in adoptive immunotherapies
    Patent number: 11096964
    Abstract: Compounds that either produced a higher proportion or greater absolute number of phenotypically identified nave, stem cell memory, central memory T cells, adaptive NK cells, and type I NKT cells are identified. Compositions and methods for modulating immune cells including T, NK, and NKT cells for adoptive cell therapies with improved efficacy are provided.
    Type: Grant
    Filed: January 20, 2017
    Date of Patent: August 24, 2021
    Assignee: FATE THERAPEUTICS, INC.
    Inventors: Jonathan Rosen, Betsy Rezner, Bahram Valamehr, Ryan Bjordahl, Eigen Peralta
  • Compositions and methods related to polycytotoxic T cells
    Patent number: 11096965
    Abstract: Various aspects of the invention relate to compositions comprising polycytotoxic T cells. Some aspects relate to methods for obtaining a composition comprising polycytotoxic T cells. Some aspects relate to methods of administering a composition comprising polycytotoxic T cells to a subject. Some aspects relate to methods for monitoring an immune response in a subject, comprising determining the concentration of polycytotoxic T cells in the blood of the subject. Some aspects relate to methods for treating a condition or disease in a subject, comprising administering to the subject a composition comprising an antibody, or an antigen-binding portion thereof, that specifically binds to a protein expressed by a polycytotoxic T cell.
    Type: Grant
    Filed: April 4, 2017
    Date of Patent: August 24, 2021
    Assignees: The Regents of the University of California, ULM UNIVERSITY
    Inventors: Samuel J. Balin, Robert L. Modlin, Steffen Stenger, Matteo Pellegrini
  • Cell preparations for extemporaneous use, useful for healing and rejuvenation in vivo
    Patent number: 11096966
    Abstract: The present invention relates to new plasma or new platelet-rich plasma preparations, new cell dissociation methods, new cell associations or compositions, a method of preparation thereof, a use thereof, devices for the preparation thereof and preparations containing such a platelet-rich plasma preparation and cell associations or compositions. Specifically, the invention provides plasma or platelet-rich plasma alone or in cell composition preparations for use in tissue regeneration and bone regeneration and pain reduction.
    Type: Grant
    Filed: February 18, 2020
    Date of Patent: August 24, 2021
    Assignee: RegenLab USA LLC
    Inventors: Antoine Turzi, Donald Du Toit
  • Pharmaceutical composition for preventing or treating regulatory T cell-mediated diseases
    Patent number: 11096967
    Abstract: The present invention relates to a composition and a method for inducing CD4+ T cells to differentiate into regulatory T cells and proliferate through an induced T cell co-stimulator ligand (ICOSL) or an ICOSL-overexpressing mesenchymal stem cell and for preventing or treating regulatory T cell-mediated diseases. The induced T cell co-stimulator ligand (ICOSL) or ICOSL-overexpressing mesenchymal stem cell according to the present invention effectively suppresses the proliferation of PBMCs, induces the expression of an ICOS in regulatory T cells, thereby inducing the differentiation and proliferation of the regulatory T cells through a PI3K-Akt mechanism, and thus can effectively prevent, treat, or enhance regulatory T cell-mediated diseases.
    Type: Grant
    Filed: February 24, 2017
    Date of Patent: August 24, 2021
    Assignee: SCM LIFESCIENCE CO., LTD.
    Inventors: Sun Uk Song, Tac Ghee Yi, Hyun Joo Lee
  • Use of anti-aging glycoprotein for enhancing survival of neurosensory precursor cells
    Patent number: 11096968
    Abstract: The present disclosure relates to an in vitro method for enhancing engraftment of neurosensory precursor cell comprising the step of contacting an isolated neurosensory precursor cell prior to a transplantation in a subject in need thereof, with a gem-difluorinated C-glycopeptide compound of general formula I, or a pharmaceutically acceptable base, addition salt with an acid, hydrate or solvate thereof: (I).
    Type: Grant
    Filed: January 27, 2017
    Date of Patent: August 24, 2021
    Assignee: Protokinetix Inc.
    Inventor: Lachlan Grant Young