Abstract: Compounds and methods for modulating cell proliferation, preferably inhibiting the proliferation of tumor cells are described. Compounds that may be used to modulate cell proliferation include antisense oligonucleotides complementary to regions of the mammalian ribonucleotide reductase genes.

Abstract: Novel stable, concentrated, biologically active and ready-to-use lipid-comprising drug delivery complexes and methods for their production are described. The biological activity of the complexes produced are comparable to the formulations prepared according to the prior art admixture method and upon purification, the complexes produced by the method of this invention are 50 to 500 fold more concentrated than the complexes formed by admixture. The method described herein provides for the large scale production of lipid-comprising drug delivery systems useful for gene therapy and other applications.

Abstract: The present invention relates to methods and compositions for the inhibition of gene expression. In particular, the present invention provides oligonucleotide-based therapeutics for the inhibition of oncogenes involved in cancers.

Abstract: This disclosure describes structural elements that enhance fusogenicity of lipids and lipid assemblies (e.g. liposomes) with biological membranes, in particular cell membranes, and use of such structures. The elements are pH sensitive in terms of charge and hydrophilicity and undergo a polar—apolar transition when exposed to low pH.

Abstract: Disclosed are methods and compositions to genetically modify substantially intact cells having cosmetic function to enhance the cosmetic appearance in mammals so as to enhance and/or maintain a biochemical and/or physiological process that has a positive effect on cosmetic appearance. The methods and compositions may provide cosmetic benefits such as reduced skin sagging, increased skin thickness, reduced wrinkles, increased skin thickness and collagen content, increased skin tone and elasticity, increased skin hydration, and improved skin texture and color.

Abstract: A sterol derivative with a pKa value of between 3.5 and 8, according to the general formula cation-spacer 2-Y-spacer 1-X-sterol, wherein Y and X represent linking groups, is suggested, as well as liposomes comprising such sterol derivatives.

Abstract: Novel stable, concentrated, biologically active and ready-to-use lipid-comprising drug delivery complexes and methods for their production are described. The biological activity of the complexes produced are comparable to the formulations prepared according to the prior art admixture method and upon purification, the complexes produced by the method of this invention are 50 to 500 fold more concentrated than the complexes formed by admixture. The method described herein provides for the large scale production of lipid-comprising drug delivery systems useful for gene therapy and other applications.

Abstract: A composition for magnetofecting genetic materials into cells with the assistant of an external magnetic force is described. The composition includes hydrophilic vectors, magnetic nanoparticles, and genetic materials, wherein the magnetic nanoparticles and the genetic materials are enveloped inside the hydrophilic vectors.

Abstract: Described are compositions and methods relating to gene therapy, particularly as applied to hematopoietic progenitor (HP) cells, to transduced cells and methods of obtaining them, and to methods of using them to provide prolonged engraftment of modified hematopoietic cells in human subjects. The invention particularly relates to ex vivo gene therapy of HP cells for treatment or prevention of HIV infection.

Abstract: Methods for the preparation of a lipid-nucleic acid composition are provided. According to the methods, a mixture of lipids containing a protonatable or deprotonatable lipid, for example an amino lipid and a lipid such as a PEG- or Polyamide oligomer-modified lipid is combined with a buffered aqueous solution of a charged therapeutic agent, for example polyanionic nucleic acids, to produce particles in which the therapeutic agent is encapsulated in a lipid vesicle. Surface charges on the lipid particles are at least partially neutralized to provide surface-neutralized lipid-encapsulated compositions of the therapeutic agents. The method permits the preparation of compositions with high ratios of therapeutic agent to lipid and with encapsulation efficiencies in excess of 50%.

Abstract: Novel stable, concentrated, biologically active and ready-to-use lipid-comprising drug delivery complexes and methods for their production are described. The biological activity of the complexes produced are comparable to the formulations prepared according to the prior art admixture method and upon purification, the complexes produced by the method of this invention are 50 to 500 fold more concentrated than the complexes formed by admixture. The method described herein provides for the large scale production of lipid-comprising drug delivery systems useful for gene therapy and other applications.

Abstract: A composition of an interfering RNA comprising a double-stranded RNA (dsRNA) molecule having a double-stranded region of from about 15 to about 40 base pairs, a peptide having a hydrophobic region and a cationic region, and a non-cationic phospholipid, and uses thereof.

Abstract: Methods for delivering nucleic acid molecules into cells and methods for measuring nucleic acid delivery into cells and the expression of the nucleic acids are provided. The methods are designed for introduction of large nucleic acid molecules, including artificial chromosomes, into cells, and are practiced in vitro and in vivo.

Abstract: Methods and compositions are provided for transgene expression in target cells. Expression constructs using an inducible amplification system to drive expression of a therapeutic gene or other gene of interest in mammalian host cells are provided, as well as methods therefor. Inducible expression of the transgenes at high levels under physiologic conditions results from induction by hyperthermic conditions relative to the basal temperature of the host cells.

Abstract: An electrospraying apparatus and/or method is used to coat particles. For example, a flow including at least one liquid suspension may be provided through at least one opening at a spray dispenser end. The flow includes at least particles and a coating material. A spray of microdroplets suspending at least the particles is established forward of the spray dispenser end by creating a nonuniform electrical field between the spray dispenser end and an electrode electrically isolated therefrom. The particles are coated with at least a portion of the coating material as the microdroplet evaporates. For example, the suspension may include biological material particles.

Abstract: Brucellosis is a disease caused by facultative intracellular bacteria of the monospecific genus Brucella melitensis. The invention in one aspect is an immunogenic nucleic acid composition comprising DNA encoding Brucella melitensis Invasion Protein B, a polypeptide with at least 95% identity thereto, or an immunologically active fragment of either of these, and an adjuvant. In another aspect, the invention is a DNA vaccine composition comprising a plasmid vector having DNA encoding a polypeptide as recited above, in which said plasmid vector is adsorbed to a liposome. Other aspects of the invention include methods of inducing an enhanced immune response to Brucella infection in an animal, methods for the differential diagnosis in an animal of brucellosis and vaccination by an immunogenic nucleic acid composition having DNA encoding any of the above-recited polypeptides, and a kit for conducting said differential diagnosis methods.

Abstract: An artery wall binding peptide (AWBP) based on the artery wall cell-binding domain of apolipoprotein B-100 was conjugated to a cationic backbone configured for forming a complex with a nucleic acid to produce a composition that enhances gene transfer to artery wall cells. An illustrative cationic backbone is poly(ethylene glycol)-grafted-poly(L-lysine) (PEG-g-PLL). Methods of making and using the composition for gene transfer are also described.

Abstract: The invention relates to the use of oligonucleotide containing cationic liposomal formulations to enhance the efficacy of chemotherapy and/or radiotherapy, particularly as a means to sensitize cancerous tumor tissues to the efficiencies of chemotherapy. This is particularly advantageous in the context of treating raf expressing tumors such as breast, lung, pancreatic and prostate tumors.

Abstract: The invention provides a peptide having at least 3 amino acids comprising an amino acid sequence selected from a) X1SM [SEQ.ID.NO.:1] b) LX2HK [SEQ.ID.NO.:2] c) PSGX3ARA [SEQ.ID.NO.:9] d) SX4RSMNF [SEQ.ID. NO.:16] e) LX5HKSMP [SEQ.ID.NO.:18] in which X is a basic amino acid residue, X1 is Q or P, X2 is A or T, X3 is an acidic amino acid residue and X4 is P or Q, the invention further provides non-viral cell-targeting vector complexes and methods associated therewith.

Abstract: The invention provides new compositions and methods for immunomodulation of individuals. Immunomodulation is accomplished by administration of immunomodulatory polynucleotide/microcarrier (IMP/MC) complexes. The IMP/MC complexes may be covalently or non-covalently bound, and feature a polynucleotide comprising at least one immunostimulatory sequence bound to a biodegradable microcarrier or noncarrier.

Abstract: A method for the direct in vivo transformation of cells in and surrounding a solid tumor is disclosed. This method is based on the site-specific delivery of proteins to solid tumors and to tissue surrounding the solid tumor by direct injection of a nucleic acid sequence. In particular, this method is directed to site-specific delivery of nucleic acids encoding major histocompatibility proteins, cytokines, and toxins to a solid tumor. This technique provides for the transfer of vectors and expression of recombinant genes in vivo and allows the introduction of proteins of therapeutic or diagnostic value for the treatment of disease.

Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5?GCTCGGCGCCGCCATTTCCAG3?. The invention also provides for an antisense oligonucleotide having the sequence 5?GTCAGCGGCCATCAGCTT3?. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? effective to inhibit death of the cell.

Abstract: Compounds, compositions and methods are provided for modulating the expression of HIF1? and/or HIF2?. The compositions comprise oligonucleotides, targeted to nucleic acid encoding HIF1? and HIF2?. Methods of using these compounds for modulation of HIF1? and/or HIF2? expression and for diagnosis and treatment of disease associated with expression of HIF1? and/or HIF2? are provided.

Abstract: A system relating to the delivery of desired compounds (e.g., drugs and nucleic acids) into cells using pH-sensitive delivery systems. The system provides compositions and methods for the delivery and release of a compound to a cell.

Abstract: The present invention relates to compositions and methods for transferring nucleic acids into cells in vitro and in vivo. The compositions comprise a transfection reagent and one or more detergents. In preferred embodiments, the compositions comprise delivery systems providing nucleic acid transfer complexes that transfect cells with high efficiency.

Abstract: The present invention provides novel and surprisingly effective methods for delivering nucleic acids to cells. These methods are based upon the discovery that the presence of endosomal membrane destabilizers (e.g., calcium) leads to a dramatic increase in the transfection efficiency of plasmids formulated as SPLP, or “stabilized plasmid-lipid particles.

Abstract: Highly specific hammerhead ribozymes are provided that human target estrogen receptor mRNA. These ribozymes, designated RZ1 through RZ7 provide predictable mRNA cleavage products. Methods for inhibiting estrogen-dependent tumor growth, such as that characteristic of breast cancer, are also provided employing these ribozymes. One or both of the ribozymes may be used together or separately with equal efficiency. The ribozymes possess a sequence region with a catalytic core that provides the attributed catalytic activity to these ribozymes.

Abstract: Compounds, compositions and methods are provided for modulating the expression of PTP1B. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PTP1B. Methods of using these compounds for modulation of PTP1B expression and for treatment of diseases associated with expression of PTP1B are provided.

Abstract: Disclosed are compounds capable of facilitating transport of biologically active agents or substances into cells having the general structure: wherein Q is selected from the group consisting of N, O and S; L is any bivalent organic radical capable of linking each Q, such as C, CH, (CH2)l, or {(CH2)i-Y—(CH2)j}k, wherein Y is selected from the group consisting of CH2, an ether, a polyether, an amide, a polyamide, an ester, a sulfide, a urea, a thiourea, a guanidyl, a carbamoyl, a carbonate, a phosphate, a sulfate, a sulfoxide, an imine, a carbonyl, and a secondary amino group and wherein Y is optionally substituted by —X1-L?-X2-Z or -Z; R1–R6, independently of one another, are selected from the group consisting of H, —(CH2)p-D-Z, an alkyl, an alkenyl, an aryl, and an alkyl or alkyl ether optionally substituted by one or more of an alcohol, an aminoalcohol, an amine, an amide, an ether, a polyether, a polyamide, an ester, a mercaptan, an alkylthio, a urea, a thiourea, a guanidyl, or a carbamoyl group, and

Abstract: The invention provides a composition containing particulate composite of a polymer and a therapeutic agent. The composition also contains a complexing agent. The polymer interacts with the complexing agent in a host-guest or a guest-host interaction to form an inclusion complex. A therapeutic composition of the invention may be used to deliver the therapeutic agent and to treat various disorders. Both the polymer of the particulate composite and the complexing agent may be used to introduce functionality into the therapeutic composition. The invention also relates to a method of preparing a composition. The method combines a therapeutic agent, a polymer having host or guest functionality, and a complexing agent having guest or host functionality to form the therapeutic composition. The complexing agent forms an inclusion complex with the polymer. The invention also relates to a method of delivering a therapeutic agent.

Abstract: A method for immunization using genetic material is disclosed. Compositions for genetic immunization comprising cationic lipids and polynucleotides are also disclosed. Methods for using genetic immunization to produce polyclonal and monoclonal antibodies are also disclosed. A method for epitope mapping is also disclosed.

Abstract: The invention provides a pharmaceutical agent delivery composition comprising: (i) a transport polymer comprising a linear or branched peptide having from about 10 to about 300 amino acid residues, having from about 5 to 100% histidine residues, and optionally having from 0 to about 95% non-histidine amino acid residues; (ii) at least one pharmaceutical agent; and optionally (iii) one or more intracellular delivery components in association with the transport polymer. The invention also provides methods for using such composition to deliver the pharmaceutical agent to the interior of cells.

Abstract: The present invention provides novel pseudotyped retroviral vectors that can transduce human and other cells. Vectors are provided that are packaged efficiently in packaging cells and cell lines to generate high titer recombinant virus stocks expressing novel envelope glycoproteins. The present invention further relates to compositions for gene therapy.

Abstract: The present invention provides a pharmaceutical composition, comprising: (a) cationic lipids, wherein said lipids are a liposomal mixture of a diacyl-ethyl-phosphocholine and 1,2-diacyl-sn-glycero-3-phosphoethanolamine; and (b) a plasmid cDNA sequence encoding a protein having tumor suppressor or pro-apoptotic activity. This composition has a high gene transfection efficiency at non-toxic doses and is designed to transfect human bronchial premalignant lesions and early endo-bronchial malignancies.

Abstract: Disclosed are compounds capable of facilitating transport of biologically active agents or substances into cells having the general structure: wherein Q is selected from the group consisting of N, O and S; L is any bivalent organic radical capable of linking each Q, such as C, CH, (CH2)l, or {(CH2)i-Y—(CH2)j}k, wherein Y is selected from the group consisting of CH2, an ether, a polyether, an amide, a polyamide, an ester, a sulfide, a urea, a thiourea, a guanidyl, a carbamoyl, a carbonate, a phosphate, a sulfate, a sulfoxide, an imine, a carbonyl, and a secondary amino group and wherein Y is optionally substituted by —X1—L?—X2—Z or —Z; R1–R6, independently of one another, are selected from the group consisting of H, —(CH2)p-D—Z, an alkyl, an alkenyl, an aryl, and an alkyl or alkyl ether optionally substituted by one or more of an alcohol, an aminoalcohol, an amine, an amide, an ether, a polyether, a polyamide, an ester, a mercaptan, an alkylthio, a urea, a thiourea, a guanidyl, or a carbamoyl group, and

Abstract: A method is provided for treating solid tumors comprising administering a composition comprising a PDGF aptamer and a cytotoxic agent. In a preferred embodiment the PDGF aptamer is identified using the SELEX process for the Systematic Evolution of Ligands by Exponential enrichment. A method is also provided for reducing the interstitial fluid pressure (IFP) of a solid tumor comprising administering a PDGF aptamer. Finally, a method is provided for increasing the uptake of cytotoxic agents into a tumor comprising administering a composition comprising a PDGF aptamer and a cytotoxic agent.

Abstract: The present invention provides a composition of matter for introducing an exogenous nucleic acid molecule into a target cell, comprising a liposome, a ligand polymeric scaffold, wherein the ligand can bind to a cell surface receptor or molecule. The invention also provides methods for introducing an exogenous nucleic acid molecule into a target cell using the composition of matter.

Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding stearoyl-CoA desaturase. Methods of using these compounds for modulation of stearoyl-CoA desaturase expression and for treatment of diseases associated with expression of stearoyl-CoA desaturase are provided.

Abstract: A method for introducing a foreign matter into a cell, includes the steps of placing a small particle carrying a foreign matter at a part of a cell surface of a living cell, boring a hole in a cell wall and/or a cell membrane by irradiating and treating said part of the cell surface with a laser beam, and introducing the foreign matter into the living cell.

Abstract: Coalescence of cells or other membrane-bound entities is facilitated by anchoring an outwardly projecting first oligonucleotide in one member and an outwardly projecting second oligonucleotide, complementary to the first, in a second member and incubating under hybridizing conditions. Liposomes may be coalesced with cells to deliver hydrophilic agents thereto, such as DNA probes or drugs. Kits containing complementary oligonucleotides containing hydrophobic anchoring moieties may be used.

Abstract: The invention provides new compositions and methods for immunomodulation of individuals. Immunomodulation is accomplished by administration of immunomodulatory polynucleotide/microcarrier (IMP/MC) complexes. The IMP/MC complexes may be covalently or non-covalently bound, and feature a polynucleotide comprising at least one immunostimulatory sequence bound to a nonbiodegradable microcarrier or nanocarrier.

Abstract: A method for introducing and expressing genes in animal cells, in which the animal cells are transfected with bacterial blebs containing a eukaryotic expression cassette encoding the gene. Bacterial blebs comprising a eukaryotic expression cassette, wherein the bacterial blebs are derived from gram negative bacteria.

Abstract: The present invention relates to methods of intracellular delivery of oligonucleotides. More particularly, the present invention relates to the use of the delivery system to deliver G-quartet oligonucleotides as a cancer therapy or an anti-viral therapy.

Abstract: The present invention relates to cells and methods for treating or preventing tumor formation or infections with pathogens in a patient. The cells of the invention are antigen-presenting cells (e.g., dendritic cells or macrophage) that have been loaded with RNA derived from tumors or pathogens. By administering the RNA-loaded antigen-presenting cells to a patient, tumor formation or pathogen infections can be treated or prevented. Alternatively, the RNA-loaded cells can be used as stimulator cells in the ex vivo expansion of CTL. Such CTL can then be used in a variation of conventional adoptive immunotherapy techniques.

Abstract: Described is a deliverable composition with low toxicity comprising an amphipathic compound, a polycation, and a siRNA. The composition may be used in the process of delivering a siRNA to an animal cell or more particularly, a mammal cell.

Abstract: Expression constructs using an inducible amplification system to drive expression of a therapeutic gene or other genes of interest in mammalian cells are provided, as well as methods of using the same.

Abstract: An polyampholyte is utilized in a condensed polynucleotide complex for purposes of nucleic acid delivery to a cell. The complex can be formed with an appropriate amount of positive and/or negative charge such that the resulting complex can be delivered to the extravascular space and may be further delivered to a cell.

Abstract: An polyampholyte is utilized in a condensed polynucleotide complex for purposes of nucleic acid delivery to a cell. The complex can be formed with an appropriate amount of positive and/or negative charge such that the resulting complex can be delivered to the extravascular space and may be further delivered to a cell.

Abstract: Polyampholyte are able to condense nucleic acid to form small complexes which can be utilized in the delivery of nucleic acid to mammalian cells. The polyampholytes can be formed prior to interaction with nucleic acid or they can be formed in the presence of nucleic acid. Stabilized polycation/nucleic acid complexes can be modified to reduce the positive charge of the polycation and add targeting ligands without destabilizing the complex. The resultant particles retain their small size and are more effective in delivery of nucleic acid to cells in vivo.

Abstract: A complex is described that is deliverable to a cell comprising inserting a nucleic acid or other cargo into a reverse micelle. The reverse micelle has the property to compact the nucleic acid for easier delivery.