Abstract: With the aim of proving an antibacterial composition against oral bacteria and the like capable of inducing Th1 cell proliferation or activation in an intestinal tract, the present inventors have found out that bacteria that suppress colonization and the like of the oral bacteria and the like in the intestinal tract are present in an intestinal microbiota. Moreover, the present inventors have succeeded in isolating intestinal bacteria that suppress intestinal colonization and the like of oral bacteria and the like.

Abstract: The present invention provides a novel Streptococcus thermophilus strain ST4, and its use in manufacturing a medicament and/or food composition for treating and/or preventing an inflammatory disease and/or a cancer.

Abstract: The disclosure provides methods of treating cancer by selectively inhibiting p-S552-?-catenin, p-T217-?-catenin, p-T332-?-catenin, and/or p-S675-?-catenin production and/or activity. Such methods also and/or limit cancer-initiating cells.

Abstract: The invention provides are agent and a method using this reagent for the detection of porcine adenovirus in a sample. The reagent comprises the following primer pair: the upstream primer: (5?-3?) ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1); the downstream primer: (5?-3?) CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), among the downstream primer Y can be T or C. This reagent and method are of strong specificity and high sensitivity, which can rapidly detect pig porcine adenovirus in samples.

Abstract: An immunogenic composition is provided herein. The immunogenic compositions are used to identify and select immunogenic antigens that elicit immune responses in a subject and may be subsequently used in multi-antigen vaccine compositions against one or more diseases or conditions. According to some embodiments, the immunogenic composition may include a plurality of nucleic acid fragments or minigenes derived from a nucleic acid library, wherein each nucleic acid fragment encodes a different antigen or functional portion thereof, and wherein the different antigens or functional portions thereof are associated with one or more disease or condition. The immunogenic composition may also include a delivery medium loaded with the plurality of nucleic acid fragments and in some embodiments, the delivery medium is loaded with nucleic acid fragments in such a way that individual antigen presenting cells receive only a subset of the nucleic acids within a vaccine in order to minimize antigenic competition.

Abstract: It has been found that an extracellular polypeptide derived from Akkermansia municiphila is capable of modulating and/or promoting gut mucosal immune system function and/or maintaining and/or restoring metabolic status and/or increasing the physical integrity of the gut mucosal barrier in a mammal. The polypeptide or host cells including such polypeptide may be employed to prevent and/or treat a variety of conditions that benefit from an increased physical integrity of the gut mucosal barrier and/or an improved gut mucosal immune system function and metabolic status.

Abstract: This present disclosure relates to methods and compositions comprising biologically active nanoparticle formulations of MYC protein. Provided are methods of making the nanoparticle formulations and methods of using the nanoparticle formulations for treatment.

Abstract: Transposase polypeptides and polynucleotides are provided, which have a high activity in mammalian cells. Methods for engineering cells, such as chimeric antigen T-cells, with the transposes are also provided.

Abstract: The present invention relates to immortalized porcine alveolar macrophages (PAMs), to cell cultures comprising such PAMs, to methods for the immortalization of PAMs, to methods of replicating PRRS virus on immortalized PAMs and to methods for the preparation of vaccines comprising PRRSV.

Abstract: The present invention relates to functional binding fragments comprising the minimal binding fragments of VAR2CSA, to antibodies against such binding fragments of VAR2CSA, nucleic acids encoding such fragments of VAR2CSA as well as methods for their production. The invention further relates to conjugates and fusion proteins of VAR2CSA polypeptides including the minimal binding fragments and their use, in particular in the treatment of conditions associated with expression of chondroitin sulfate A (CSA), such as an inappropriate expression of chondroitin sulfate A (CSA).

Abstract: The present invention relates to immortalized porcine alveolar macrophages (PAMs), to cell cultures comprising such PAMs, to methods for the immortalization of PAMs, to methods of replicating PRRS virus on immortalized PAMs and to methods for the preparation of vaccines comprising PRRSV.

Abstract: Given the important role of protein kinases in pathways affecting cellular growth and invasion, we have analyzed 340 serine/threonine kinases for genetic mutations in colorectal cancers. Mutations in eight genes were identified, including three members of the phosphatidylinositol-3-kinase (PI3K) pathway; the alterations in the latter genes each occurred in different tumors and did not overlap with mutations in PIK3CA or other non-serine-threonine kinase (STK) members of the PI3K pathway, suggesting that mutations in any of these genes had equivalent tumorigenic effects. These data demonstrate that the PI3K pathway is a major target for mutational activation in colorectal cancers and provide new opportunities for therapeutic intervention.

Abstract: Systems and methods for delivering electric fields to a target tissue of a patient for destruction of cancerous cells so as to elicit or induce a specific anti-cancerous cell immune response in the patient.

Abstract: Disclosed are methods of transforming dendritic cells with a chimeric adenovirus-5 (Ad5). A chimeric adenovirus includes a fiber comprising a tail, a shaft and a knob, wherein the knob is a porcine knob, and a nucleic acid comprising a promoter operably linked to a heterologous sequence encoding an antigen peptide.

Abstract: WD-repeat proteins are very diverse, yet these are structurally related proteins that participate in a wide range of cellular functions. WDR13, a member of this family, is conserved from fishes to humans and localizes into the nucleus. To understand the in vivo function(s) of Wdr13 gene, we have created and characterized a mutant mouse strain lacking this gene. The mutant mice had higher serum insulin levels and increased pancreatic islet mass as a result of the enhanced beta cell proliferation. While a known cell cycle inhibitor, p21, was down regulated in the mutant islets overexpression of WDR13 in the pancreatic MIN6 cell line resulted in upregulation of p21, accompanied by retardation of cell proliferation. We suggest that WDR13 is a novel negative regulator of the pancreatic beta cell proliferation. Co-immunoprecipitation experiments showed that this protein interacts with estrogen receptors and various HDACs.

Abstract: Provided is a renal sarcomatoid cell line RCC09HYF, of which the deposit No. is CCTCC C201130, and the preparation method of the renal sarcomatoid cell line. The renal sarcomatoid cell line RCC09HYF can grow for a long period and be steadily passaged in vitro. By tumorigenic experiments using in-situ animal models in vitro it has been found that: the tumorigenesis is relatively fast inside animals and 3-4 weeks after tumor inoculation, the transplanted tumors fill the whole abdominal cavity, and dyscrasia appears in above 50% of nude mice; moreover, lung metastasis is present in a few individuals. The renal sarcomatoid cell line RCC09HYF can provide an effective and steady cell model for further study of the genesis and metastasis mechanism of renal sarcomatoid carcinoma in persons of Han nationality and for clinical prediction, diagnosis and treatment.

Abstract: Provided herein are an isolated or enriched population of tumor initiating cells derived from normal cells, cells susceptible to neoplasia, or neoplastic cells. Methods of use of the cells for screening for anti-hyperproliferative agents, and use of the cells for animal models of hyperproliferative disorders including metastatic cancer, diagnostic methods, and therapeutic methods are provided.

Abstract: Use of an animal model of spontaneous metastasis bearing a tumor derived from a cell line RM72 (Accession No. NITE BP-1110) allows simultaneous evaluation of tumorigenesis and spontaneous cancer metastasis. Use of a screening method using the animal model of spontaneous metastasis allows the obtainment of a substance having an anticancer activity and/or an anti-metastatic activity. Use of another screening method for selecting a substance that increases the expression of RECK in a cancer cell allows the obtainment of a substance that can serve as an active ingredient in an anticancer drug.

Abstract: Methods and materials for increasing the number of target cells recovered from a fluid sample containing cells are described. The methods include isolating the target cells on a filter and then implanting the filter containing the target cells in an immunodeficient non-human animal, where at least some of the target cells can proliferate.

Abstract: Provided is a method for producing a glioblastoma mouse model and the mouse model produced thereby, the method including the steps of: (a) dividing a glioblastoma tissue, isolated from a patient, into 4 or more sections, and collecting one or more pieces from each of the sections; (b) dissociating a mixture of the collected pieces into glioblastoma cells as single cells; and (c) orthotopically transplanting a graft sample containing the glioblastoma cells obtained in step (b), into the brain of an immunodeficient mouse. Further provided are a method of screening a glioblastoma therapeutic agent using the mouse model and a method of providing information for selection of a patient-specific glioblastoma therapy using the mouse model. The glioblastoma mouse model shows the same genetic, morphological and pathological characteristics as those of the parental tumor, and it allows screening patient-specific glioblastoma therapeutic agent or selecting safer and more effective patient-specific glioblastoma therapy.

Abstract: The present application discloses a method of testing for efficacy of a potential drug agent against cancerous cells in a mammal, including generating the cancer cells in a mammal; contacting the cancer cells with a potential drug agent by administering the potential drug agent to the mammal; and measuring effect of the potential drug agent on the cancer cells, wherein reduction of number of cancer cells in the mammal is indicative of efficaciousness of the potential drug agent against cancerous cells.

Abstract: The present invention relates to a non human model animal for ulcerative colitis and its main complications such as primary sclerosing cholangitis and colorectal cancer. More particularly, the present invention relates to a transgenic non human animal model for ulcerative colitis and its main complications such as primary sclerosing cholangitis, and colorectal cancer comprising a targeted disruption in the IL10 and NOX1 genes so that IL10 and NOX1 are not expressed in said animal.

Abstract: An objective of the present invention is to provide: a cancer stem cell isolated using a cell marker; a substantively homogeneous cancer stem cell population including said cancer stem cell; and a method of preparing said cancer stem cell population. Another objective of the present invention is to provide: a method for separating cancer stem cells with a high proliferative potential and those with a low proliferative potential; a method for inducing cancer stem cells to have a different proliferative potential; and cancer stem cells separated or induced by these separation or induction methods. A further objective of the present invention is to provide: a method of screening for pharmaceuticals using said cancer stem cell or cancer stem cell population; a method for detecting the presence of said cancer stem cell or cancer stem cell population and for identifying or quantifying the same.

Abstract: The disclosure herein provides a bone metastasis-derived prostate cancer xenograft model. The disclosure also provides methods for making a bone metastasis-derived prostate cancer xenograft model. In alternative embodiments, the disclosure provides compositions and methods for testing whether a drug, compound, diet, therapy or treatment is effective or efficacious for preventing, ameliorating, slowing the progress of, stopping or slowing the metastasis of, or for causing a full or partial remission of, a cancer, or a prostate cancer, or a human prostate cancer.

Abstract: The invention concerns the development of a PIK3CA H1047R knock-in non-human animal breast cancer model, and its use for identification of a spontaneous loss-of-function TP53 mutation involved in spindle cell tumor formation. The invention further concerns the identification of additional somatic mutations and copy number aberrations in the breast tumors using this model, and methods and means for the diagnosis and treatment of breast cancer.

Abstract: The present invention is directed to methods of inhibiting tumor growth in a subject. The present invention is further directed to methods of diagnosing cancer in a subject and identifying a suitable course of treatment for the subject based on the diagnosis. The present invention is also directed to an orthotopic animal model of pancreatic cancer.

Abstract: Immortalized human cell lines derived from prostate cells are disclosed. Immortalized cells derived from a human epithelial prostate tissue cancer tumor are provided, as well as immortalized cells derived from healthy human epithelial prostate tissue from the same patient. Methods for utilizing such immortalized cell lines for researching, screening, and evaluating antimalignancy therapies and drug candidates are also disclosed.

Abstract: AnnexinA2 (ANXA2), a member of the Annexin family of calcium-dependent, phospholipid binding proteins, is one of a panel of identified antigens recognized by the post-vaccination sera of patients who demonstrated prolonged disease-free survival following multiple vaccinations. AnnexinA2 is abundantly expressed in pancreatic adenocarcinomas and cell surface/membrane AnnexinA2 increases with the progression from premalignant lesions to invasive pancreatic adenocarcinomas. The cytoplasmic to cell surface translocation of AnnexinA2 expression is critical for pancreatic cancer cell invasion. In addition, phosphorylation of AnnexinA2 at Tyrosine 23 is important for its localization to the cell surface and for the invasion of pancreatic cancer cells. Finally, loss of AnnexinA2 leads to the loss of the Epithelial-Mesenchymal Transition.

Abstract: The present invention discloses soluble isoforms of CD5 and CD6, which are scavenger-like lymphocyte receptors, for use in the prophylaxis or therapy of disorders or in therapeutic interventions, which would benefit from an exacerbated immune response to either endogenous or exogenous antigens, resulting from a decrease in lymphocyte subpopulations with regulatory functions and/or increase in lymphocyte subpopulations with effector functions. Special disorders are cell growth disorders, and chronic infections of bacterial, viral, fungal or parasitic origin. The invention also provides animal models for the study and the prophylaxis/treatment of autoimmune diseases, cancer, and chronic infections.

Abstract: Fatty liver was induced by administering agents for inducing organ inflammation to experimental animals to evoke insulin resistance and by rearing them with high-fat diets. As a result, steatohepatitis was successfully induced in the animals. The animals show pathological findings similar to those of humans. By using these model animals, substances for treating or preventing diseases can be efficiently screened and the efficacy of medicinal substances can be effectively evaluated.

Abstract: Provided herein is a novel mTOR-comprising complex, mT-ORC3, which comprises mTOR and the Ets transcription factor TEL2. Specific mTORC3 binding agents and modulating agents are provided, along with kits and methods for the detection of mTORC3. Methods of modulating the activity of mTORC3 or modulating cell growth and/or survival are also provided. Further provided are methods for screening for mTORC3 binding agents and for mTORC3 modulating agents. Various methods of diagnosis and treatment are further provided.

Abstract: WD-repeat proteins are very diverse, yet these are structurally related proteins that participate in a wide range of cellular functions. WDR13, a member of this family, is conserved from fishes to humans and localizes into the nucleus. To understand the in vivo function(s) of Wdr13 gene, we have created and characterized a mutant mouse strain lacking this gene. The mutant mice had higher serum insulin levels and increased pancreatic islet mass as a result of the enhanced beta cell proliferation. While a known cell cycle inhibitor, p21, was down regulated in the mutant islets overexpression of WDR13 in the pancreatic MIN6 cell line resulted in upregulation of p21, accompanied by retardation of cell proliferation. We suggest that WDR13 is a novel negative regulator of the pancreatic beta cell proliferation. Co-immunoprecipitation experiments showed that this protein interacts with estrogen receptors and various HDACs.

Abstract: PROBLEM There are provided induced malignant stem cells capable of in vitro proliferation that are useful in cancer research and drug discovery for cancer therapy, as well as processes for production thereof, cancer cells derived from these cells, and applications of these cells.

Abstract: Genetically modified non-human animals are provided that may be used to model human hematopoietic cell development, function, or disease. The genetically modified non-human animals comprise a nucleic acid encoding human IL-6 operably linked to an IL-6 promoter. In some instances, the genetically modified non-human animal expressing human IL-6 also expresses at least one of human M-CSF, human IL-3, human GM-CSF, human SIRPa or human TPO. In some instances, the genetically modified non-human animal is immunodeficient. In some such instances, the genetically modified non-human animal is engrafted with healthy or diseased human hematopoietic cells. Also provided are methods for using the subject genetically modified non-human animals in modeling human hematopoietic cell development, function, and/or disease, as well as reagents and kits thereof that find use in making the subject genetically modified non-human animals and/or practicing the subject methods.

Abstract: This invention relates to the engineering of animal cells, preferably mammalian, more preferably rat, that are deficient due to the disruption of tumor suppressor gene(s) or gene product(s). In another aspect, the invention relates to genetically modified rats, as well as the descendants and ancestors of such animals, which are animal models of human cancer and methods of their use.

Abstract: The invention relates to transgenic animals lacking endogenous Ig and capable of producing transgenic antibodies, as well as methods of making the same. The invention further relates to methods for producing transgenic antibodies in such animals, and transgenic antibodies so produced.

Abstract: The present disclosure, in part, is directed to a mammalian prostate cancer cell line comprising at least one or a set of primary mammalian epithelial cells which have been infected with a retroviral vector carrying an oncogene selected from the group consisting of c-Myc, Ha-Ras, NeuT, c-Src and combinations thereof and in which said gene is expressed.

Abstract: In one aspect, the invention provides a transgenic non-human animal model havings germ cells and somatic cells containing an endogenous MMTV-SV40-Spy1A gene sequence introduced into said animal model, or an ancestor of said animal model at an embryonic stage, wherein said gene sequence comprises a mouse mammary tumor virus gene (MMTV), a functionally disrupted SV40 gene (SV40) and a human Spy1A gene. In another aspect, the present invention provides a transgenic non-human animal model whose germ cells and somatic cells contain an endogenous Spy1A-pTRE-Tight gene sequence introduced into said animal model or an ancestor of said animal model at an embryonic stage. Preferably, the Spy1A-pTRE-Tight animal model expresses the Spy1A and develop cancer, preferably breast cancer, when administered with tetracycline, preferably doxycycline.

Abstract: The present invention provides methods for the generation of xenochimaeric animals; for example, xenochimaeric mice, comprising bone marrow progenitor cells and tumors from a heterologous animal. In some aspects, the invention provides xenochimaeric mice bearing humanized bone marrow and human tumors. Such animals are a model system for the study of human tumor stroma, for drug discovery, and for the treatment of human cancers.

Abstract: The present invention relates to a method of developing a Tumor Model System. The invention deals with a tumor model system with adhesion deprived cells. This observation provides a new method for primary detection of transformation of adhesion-deprived cells and tumorigenicity. The adhesion-deprived cells are capable of metastasizing at distant sites and the model system includes both the tumor formation and metastasis.

Abstract: The present invention relates to a prostate cancer cell line CNCM deposit number I-4126, the use thereof for preparing resistant prostate cancer cell lines, the resistant prostate cancer cell lines, and the use of these prostate cancer cell lines for screening compounds of interest.

Abstract: A cell culture support is first prepared that is coated on a surface with a polymer the hydration force of which changes in a temperature range of 0-80° C.; cancer cells are then cultivated on the support in a temperature region where the polymer has weak hydration force; thereafter, the culture solution is adjusted to a temperature at which the polymer has a stronger hydration force, whereby the cultured cancer cells are detached; the detached cancer cells are then transplanted to a specified site of an animal on which transplantation is to be performed; this method is an efficient way of cancer cells transplantation.

Abstract: The subject invention pertains to a non-human animal model of human cancer, methods of producing a non-human animal model of human cancer, methods of using a non-human animal model to propagate human cancer cells, methods of using a non-human animal model to study cancer, methods of using a non-human animal model to screen potential treatments for a subject's cancer, methods of using a non-human animal model for treating cancer in a subject (providing personalized therapy), methods of using a non-human animal model for identifying a biomarker of cancer treatment; and methods of using a non-human animal model for selecting cancer patients for a clinical trial.

Abstract: The present invention provides tumor cell preparations for use as models of the EMT process for use in the identification of anti-cancer agents, wherein said tumor cell preparations comprise cells of the epithelial tumor cell line CFPAC-1, which are stimulated by receptor ligands to induce EMT, or which have been engineered to inducibly express a protein that stimulates EMT. The present invention also provides methods of identifying potential anti-cancer agents by using such tumor cell preparations to identify agents that inhibit EMT, stimulate MET, or inhibit the growth of mesenchymal-like cells. Such agents should be particularly useful when used in conjunction with other anti-cancer drugs such as EGFR and IGF-1R kinase inhibitors, which appear to be less effective at inhibiting tumor cells that have undergone an EMT.

Abstract: Presented herein are novel protein biomarkers related to cancers with stromal components. These newly identified biomarkers create the basis for multiple (single) assays using traditional bioassay technologies and when used in combination yield exceptional clinical sensitivity and specificity in the determination of diagnosis and/or prognosis of cancer. A new genetic model able to identify potential genetic suppressors and/or potential therapeutic agents for treating stromal cancers is also described. Means and methods for evaluating data generated using multiple biomarkers in order to validate findings and further the use of the biomarkers and the genetic model system in clinical, diagnostic and therapeutic uses is also included.

Abstract: Genetic constructs comprising reporter genes operably linked to cancer specific or cancer selective promoters (such as the progression elevated gene-3 (PEG-3) promoter) are provided, as are methods for their use in cancer imaging, cancer treatment, and combined imaging and treatment protocols. Transgenic animals in which a reporter gene is linked to a cancer specific or cancer selective promoter, and which may be further genetically engineered, bred or selected to have a predisposition to develop cancer, are also provided.

Abstract: The present invention relates to metastases. More specifically, the invention relates to compositions and methods for the inhibition of metastases of cancer cells, such as prostate cancer cells, to bones and soft tissue. The present invention also relates to the treatment of cancer, including but not limited to prostate cancer. Also provided are animal models for studying cancer metastasis; particularly, prostate cancer metastasis. Further provided are compositions, processes and systems to prognosticate cancer.

Abstract: Markers useful for the identification, characterization and, optionally, the enrichment or isolation of tumorigenic cells or cell subpopulations are disclosed.

Abstract: The present invention provides LMCD1 cancer markers, and methods, compositions, and kits for their use. The invention also provides expression vectors, host cells, and transgenic animals comprising one or more LMCD1 mutations, and methods for their use in characterizing, diagnosing, and treating cancers, and for identifying potential therapeutics. The invention also provides cancer therapeutics.

Abstract: Immortalized human cell lines derived from prostate cells are disclosed. Immortalized cells derived from a human epithelial prostate tissue cancer tumor are provided, as well as immortalized cells derived from healthy human epithelial prostate tissue from the same patient. Methods for utilizing such immortalized cell lines for researching, screening, and evaluating antimalignancy therapies and drug candidates are also disclosed.