Cancer Patents (Class 800/10)
  • Patent number: 11173173
    Abstract: The disclosure provides methods of treating cancer by selectively inhibiting p-S552-?-catenin, p-T217-?-catenin, p-T332-?-catenin, and/or p-S675-?-catenin production and/or activity. Such methods also and/or limit cancer-initiating cells.
    Type: Grant
    Filed: July 28, 2016
    Date of Patent: November 16, 2021
    Assignees: UNIVERSITY OF CONNECTICUT, UNIVERSITY OF KANSAS, STOWERS INSTITUTE FOR MEDICAL RESEARCH
    Inventors: Rajeswari Kasi, Linheng Li, Xiuling Lu, John M. Perry, Gurusingham Sitta Sittampalam, Anuradha Roy, Xi C. He
  • Patent number: 11098380
    Abstract: The invention provides are agent and a method using this reagent for the detection of porcine adenovirus in a sample. The reagent comprises the following primer pair: the upstream primer: (5?-3?) ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1); the downstream primer: (5?-3?) CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), among the downstream primer Y can be T or C. This reagent and method are of strong specificity and high sensitivity, which can rapidly detect pig porcine adenovirus in samples.
    Type: Grant
    Filed: October 29, 2018
    Date of Patent: August 24, 2021
    Assignee: JIAXING ANYU BIOTECHNOLOGY CO., LTD.
    Inventors: Ping Chen, Na Li, Xintao Zhong, Tingting Zhang, Nan Li
  • Patent number: 10925950
    Abstract: An immunogenic composition is provided herein. The immunogenic compositions are used to identify and select immunogenic antigens that elicit immune responses in a subject and may be subsequently used in multi-antigen vaccine compositions against one or more diseases or conditions. According to some embodiments, the immunogenic composition may include a plurality of nucleic acid fragments or minigenes derived from a nucleic acid library, wherein each nucleic acid fragment encodes a different antigen or functional portion thereof, and wherein the different antigens or functional portions thereof are associated with one or more disease or condition. The immunogenic composition may also include a delivery medium loaded with the plurality of nucleic acid fragments and in some embodiments, the delivery medium is loaded with nucleic acid fragments in such a way that individual antigen presenting cells receive only a subset of the nucleic acids within a vaccine in order to minimize antigenic competition.
    Type: Grant
    Filed: August 3, 2016
    Date of Patent: February 23, 2021
    Assignee: UNIVERSITY OF WASHINGTON
    Inventors: Sean C. Murphy, Brad Stone
  • Patent number: 10738089
    Abstract: It has been found that an extracellular polypeptide derived from Akkermansia municiphila is capable of modulating and/or promoting gut mucosal immune system function and/or maintaining and/or restoring metabolic status and/or increasing the physical integrity of the gut mucosal barrier in a mammal. The polypeptide or host cells including such polypeptide may be employed to prevent and/or treat a variety of conditions that benefit from an increased physical integrity of the gut mucosal barrier and/or an improved gut mucosal immune system function and metabolic status.
    Type: Grant
    Filed: May 4, 2016
    Date of Patent: August 11, 2020
    Assignees: WAGENINGEN UNIVERSITEIT, UNIVERSITÉ CATHOLIQUE DE LOUVAIN
    Inventors: Clara Belzer, Willem Meindert De Vos, Patrice Daniel Cani
  • Patent number: 10583156
    Abstract: This present disclosure relates to methods and compositions comprising biologically active nanoparticle formulations of MYC protein. Provided are methods of making the nanoparticle formulations and methods of using the nanoparticle formulations for treatment.
    Type: Grant
    Filed: December 1, 2017
    Date of Patent: March 10, 2020
    Assignee: TAIGA BIOTECHNOLOGIES, INC.
    Inventors: Brian Curtis Turner, Yosef Refaeli, Gregory Alan Bird
  • Patent number: 10570382
    Abstract: Transposase polypeptides and polynucleotides are provided, which have a high activity in mammalian cells. Methods for engineering cells, such as chimeric antigen T-cells, with the transposes are also provided.
    Type: Grant
    Filed: March 10, 2016
    Date of Patent: February 25, 2020
    Assignee: BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM
    Inventors: Laurence J. N. Cooper, Natalya Belousova
  • Patent number: 10166282
    Abstract: The present invention relates to immortalized porcine alveolar macrophages (PAMs), to cell cultures comprising such PAMs, to methods for the immortalization of PAMs, to methods of replicating PRRS virus on immortalized PAMs and to methods for the preparation of vaccines comprising PRRSV.
    Type: Grant
    Filed: December 8, 2017
    Date of Patent: January 1, 2019
    Assignee: Intervet Inc.
    Inventors: Jaap Kool, Carla Christina Schrier
  • Patent number: 9932375
    Abstract: The present invention relates to functional binding fragments comprising the minimal binding fragments of VAR2CSA, to antibodies against such binding fragments of VAR2CSA, nucleic acids encoding such fragments of VAR2CSA as well as methods for their production. The invention further relates to conjugates and fusion proteins of VAR2CSA polypeptides including the minimal binding fragments and their use, in particular in the treatment of conditions associated with expression of chondroitin sulfate A (CSA), such as an inappropriate expression of chondroitin sulfate A (CSA).
    Type: Grant
    Filed: October 5, 2016
    Date of Patent: April 3, 2018
    Assignee: VAR2 PHARMACEUTICALS APS
    Inventors: Ali Salanti, Thor Grundtvig Theander, Mads Daugaard, Morten Nielsen, Madeleine Dahlback, Thomas Mandel Clausen
  • Patent number: 9872896
    Abstract: The present invention relates to immortalized porcine alveolar macrophages (PAMs), to cell cultures comprising such PAMs, to methods for the immortalization of PAMs, to methods of replicating PRRS virus on immortalized PAMs and to methods for the preparation of vaccines comprising PRRSV.
    Type: Grant
    Filed: December 11, 2014
    Date of Patent: January 23, 2018
    Assignee: Intervet Inc.
    Inventors: Jaap Kool, Carla Christina Schrier
  • Patent number: 9580750
    Abstract: Given the important role of protein kinases in pathways affecting cellular growth and invasion, we have analyzed 340 serine/threonine kinases for genetic mutations in colorectal cancers. Mutations in eight genes were identified, including three members of the phosphatidylinositol-3-kinase (PI3K) pathway; the alterations in the latter genes each occurred in different tumors and did not overlap with mutations in PIK3CA or other non-serine-threonine kinase (STK) members of the PI3K pathway, suggesting that mutations in any of these genes had equivalent tumorigenic effects. These data demonstrate that the PI3K pathway is a major target for mutational activation in colorectal cancers and provide new opportunities for therapeutic intervention.
    Type: Grant
    Filed: May 23, 2006
    Date of Patent: February 28, 2017
    Assignee: The Johns Hopkins University
    Inventors: Donald William Parsons, Tian-li Wang, Yardena Samuels, Alberto Bardelli, Christopher Lengauer, Victor Velculescu, Kenneth W. Kinzler, Bert Vogelstein
  • Patent number: 9526911
    Abstract: Systems and methods for delivering electric fields to a target tissue of a patient for destruction of cancerous cells so as to elicit or induce a specific anti-cancerous cell immune response in the patient.
    Type: Grant
    Filed: April 27, 2011
    Date of Patent: December 27, 2016
    Assignee: LAZURE SCIENTIFIC, INC.
    Inventors: Larry Azure, Charles E. Hill, Andrew L. Azure, Rafael Ponce, Lawrence L. Kunz
  • Patent number: 9267153
    Abstract: Disclosed are methods of transforming dendritic cells with a chimeric adenovirus-5 (Ad5). A chimeric adenovirus includes a fiber comprising a tail, a shaft and a knob, wherein the knob is a porcine knob, and a nucleic acid comprising a promoter operably linked to a heterologous sequence encoding an antigen peptide.
    Type: Grant
    Filed: December 14, 2012
    Date of Patent: February 23, 2016
    Assignee: Washington University
    Inventor: David T Curiel
  • Patent number: 9198986
    Abstract: WD-repeat proteins are very diverse, yet these are structurally related proteins that participate in a wide range of cellular functions. WDR13, a member of this family, is conserved from fishes to humans and localizes into the nucleus. To understand the in vivo function(s) of Wdr13 gene, we have created and characterized a mutant mouse strain lacking this gene. The mutant mice had higher serum insulin levels and increased pancreatic islet mass as a result of the enhanced beta cell proliferation. While a known cell cycle inhibitor, p21, was down regulated in the mutant islets overexpression of WDR13 in the pancreatic MIN6 cell line resulted in upregulation of p21, accompanied by retardation of cell proliferation. We suggest that WDR13 is a novel negative regulator of the pancreatic beta cell proliferation. Co-immunoprecipitation experiments showed that this protein interacts with estrogen receptors and various HDACs.
    Type: Grant
    Filed: April 27, 2012
    Date of Patent: December 1, 2015
    Assignee: Council of Scientific and Industrial Research
    Inventors: Satish Kumar, Vijay Pratap Singh
  • Publication number: 20150135342
    Abstract: Provided is a renal sarcomatoid cell line RCC09HYF, of which the deposit No. is CCTCC C201130, and the preparation method of the renal sarcomatoid cell line. The renal sarcomatoid cell line RCC09HYF can grow for a long period and be steadily passaged in vitro. By tumorigenic experiments using in-situ animal models in vitro it has been found that: the tumorigenesis is relatively fast inside animals and 3-4 weeks after tumor inoculation, the transplanted tumors fill the whole abdominal cavity, and dyscrasia appears in above 50% of nude mice; moreover, lung metastasis is present in a few individuals. The renal sarcomatoid cell line RCC09HYF can provide an effective and steady cell model for further study of the genesis and metastasis mechanism of renal sarcomatoid carcinoma in persons of Han nationality and for clinical prediction, diagnosis and treatment.
    Type: Application
    Filed: July 19, 2012
    Publication date: May 14, 2015
    Applicant: SECOND MILITARY MEDICAL UNIVERSITY
    Inventors: Xiaojie Tan, Yifang Han, Wei Guan, Wenjun Chang, Guangwen Cao
  • Publication number: 20150135341
    Abstract: Provided herein are an isolated or enriched population of tumor initiating cells derived from normal cells, cells susceptible to neoplasia, or neoplastic cells. Methods of use of the cells for screening for anti-hyperproliferative agents, and use of the cells for animal models of hyperproliferative disorders including metastatic cancer, diagnostic methods, and therapeutic methods are provided.
    Type: Application
    Filed: January 31, 2014
    Publication date: May 14, 2015
    Applicant: GENESYS RESEARCH INSTITUTE
    Inventor: Lynn Hlatky
  • Patent number: 9018438
    Abstract: Use of an animal model of spontaneous metastasis bearing a tumor derived from a cell line RM72 (Accession No. NITE BP-1110) allows simultaneous evaluation of tumorigenesis and spontaneous cancer metastasis. Use of a screening method using the animal model of spontaneous metastasis allows the obtainment of a substance having an anticancer activity and/or an anti-metastatic activity. Use of another screening method for selecting a substance that increases the expression of RECK in a cancer cell allows the obtainment of a substance that can serve as an active ingredient in an anticancer drug.
    Type: Grant
    Filed: July 29, 2011
    Date of Patent: April 28, 2015
    Assignee: Kyoto University
    Inventors: Makoto Noda, Ryuya Murai, Hitoshi Kitayama, Yoko Yoshida
  • Publication number: 20150110717
    Abstract: Methods and materials for increasing the number of target cells recovered from a fluid sample containing cells are described. The methods include isolating the target cells on a filter and then implanting the filter containing the target cells in an immunodeficient non-human animal, where at least some of the target cells can proliferate.
    Type: Application
    Filed: September 7, 2012
    Publication date: April 23, 2015
    Applicants: SCREENCELL, DANA FARBER CANCER INSTITUTE, INC.
    Inventors: Robert J. Distel, Yvon Cayre
  • Publication number: 20150104391
    Abstract: Provided is a method for producing a glioblastoma mouse model and the mouse model produced thereby, the method including the steps of: (a) dividing a glioblastoma tissue, isolated from a patient, into 4 or more sections, and collecting one or more pieces from each of the sections; (b) dissociating a mixture of the collected pieces into glioblastoma cells as single cells; and (c) orthotopically transplanting a graft sample containing the glioblastoma cells obtained in step (b), into the brain of an immunodeficient mouse. Further provided are a method of screening a glioblastoma therapeutic agent using the mouse model and a method of providing information for selection of a patient-specific glioblastoma therapy using the mouse model. The glioblastoma mouse model shows the same genetic, morphological and pathological characteristics as those of the parental tumor, and it allows screening patient-specific glioblastoma therapeutic agent or selecting safer and more effective patient-specific glioblastoma therapy.
    Type: Application
    Filed: June 21, 2013
    Publication date: April 16, 2015
    Applicant: SAMSUNG LIFE PUBLIC WELFARE FOUNDATION
    Inventors: Do Hyun Nam, Ju Yuon Jin, Kyeung Min Joo
  • Publication number: 20150089677
    Abstract: The present application discloses a method of testing for efficacy of a potential drug agent against cancerous cells in a mammal, including generating the cancer cells in a mammal; contacting the cancer cells with a potential drug agent by administering the potential drug agent to the mammal; and measuring effect of the potential drug agent on the cancer cells, wherein reduction of number of cancer cells in the mammal is indicative of efficaciousness of the potential drug agent against cancerous cells.
    Type: Application
    Filed: August 25, 2014
    Publication date: March 26, 2015
    Inventor: Cynthia BAMDAD
  • Publication number: 20140373186
    Abstract: The present invention relates to a non human model animal for ulcerative colitis and its main complications such as primary sclerosing cholangitis and colorectal cancer. More particularly, the present invention relates to a transgenic non human animal model for ulcerative colitis and its main complications such as primary sclerosing cholangitis, and colorectal cancer comprising a targeted disruption in the IL10 and NOX1 genes so that IL10 and NOX1 are not expressed in said animal.
    Type: Application
    Filed: April 13, 2012
    Publication date: December 18, 2014
    Applicant: Institut National de la Sante et de la Recherche Medicale (INSERM)
    Inventors: Eric Ogier-Denis, Xavier Treton, Fanny Daniel, Cecile Guichard, Eric Pedruzzi, Yoram Bouhnik, Yann Harnoy
  • Publication number: 20140314675
    Abstract: An objective of the present invention is to provide: a cancer stem cell isolated using a cell marker; a substantively homogeneous cancer stem cell population including said cancer stem cell; and a method of preparing said cancer stem cell population. Another objective of the present invention is to provide: a method for separating cancer stem cells with a high proliferative potential and those with a low proliferative potential; a method for inducing cancer stem cells to have a different proliferative potential; and cancer stem cells separated or induced by these separation or induction methods. A further objective of the present invention is to provide: a method of screening for pharmaceuticals using said cancer stem cell or cancer stem cell population; a method for detecting the presence of said cancer stem cell or cancer stem cell population and for identifying or quantifying the same.
    Type: Application
    Filed: September 7, 2012
    Publication date: October 23, 2014
    Inventors: Tatsumi Yamazaki, Hisafumi Okabe, Shinta Kobayashi, Takeshi Watanabe, Koichi Matsubara, Atsuhiko Kato, Masami Suzuki
  • Publication number: 20140304844
    Abstract: The disclosure herein provides a bone metastasis-derived prostate cancer xenograft model. The disclosure also provides methods for making a bone metastasis-derived prostate cancer xenograft model. In alternative embodiments, the disclosure provides compositions and methods for testing whether a drug, compound, diet, therapy or treatment is effective or efficacious for preventing, ameliorating, slowing the progress of, stopping or slowing the metastasis of, or for causing a full or partial remission of, a cancer, or a prostate cancer, or a human prostate cancer.
    Type: Application
    Filed: October 12, 2012
    Publication date: October 9, 2014
    Inventors: Christina Jamieson, Anna A. Kulidjian, Catriona H. Jamieson, Christopher J. Kane, Koichi Masuda, Christina CN Wu, Omer A. Raheem
  • Publication number: 20140298493
    Abstract: The invention concerns the development of a PIK3CA H1047R knock-in non-human animal breast cancer model, and its use for identification of a spontaneous loss-of-function TP53 mutation involved in spindle cell tumor formation. The invention further concerns the identification of additional somatic mutations and copy number aberrations in the breast tumors using this model, and methods and means for the diagnosis and treatment of breast cancer.
    Type: Application
    Filed: July 26, 2012
    Publication date: October 2, 2014
    Inventor: Somasekar Seshagiri
  • Publication number: 20140298498
    Abstract: The present invention is directed to methods of inhibiting tumor growth in a subject. The present invention is further directed to methods of diagnosing cancer in a subject and identifying a suitable course of treatment for the subject based on the diagnosis. The present invention is also directed to an orthotopic animal model of pancreatic cancer.
    Type: Application
    Filed: August 20, 2012
    Publication date: October 2, 2014
    Applicant: NEW YORK UNIVERSITY
    Inventors: Dafna Bar-Sagi, Yuliya Pylayeva-Gupta, Kyoung Eun Lee
  • Publication number: 20140286868
    Abstract: Immortalized human cell lines derived from prostate cells are disclosed. Immortalized cells derived from a human epithelial prostate tissue cancer tumor are provided, as well as immortalized cells derived from healthy human epithelial prostate tissue from the same patient. Methods for utilizing such immortalized cell lines for researching, screening, and evaluating antimalignancy therapies and drug candidates are also disclosed.
    Type: Application
    Filed: June 5, 2014
    Publication date: September 25, 2014
    Applicant: TUSKEGEE UNIVERSITY
    Inventors: Clayton Yates, Timothy Turner
  • Publication number: 20140227286
    Abstract: AnnexinA2 (ANXA2), a member of the Annexin family of calcium-dependent, phospholipid binding proteins, is one of a panel of identified antigens recognized by the post-vaccination sera of patients who demonstrated prolonged disease-free survival following multiple vaccinations. AnnexinA2 is abundantly expressed in pancreatic adenocarcinomas and cell surface/membrane AnnexinA2 increases with the progression from premalignant lesions to invasive pancreatic adenocarcinomas. The cytoplasmic to cell surface translocation of AnnexinA2 expression is critical for pancreatic cancer cell invasion. In addition, phosphorylation of AnnexinA2 at Tyrosine 23 is important for its localization to the cell surface and for the invasion of pancreatic cancer cells. Finally, loss of AnnexinA2 leads to the loss of the Epithelial-Mesenchymal Transition.
    Type: Application
    Filed: April 10, 2014
    Publication date: August 14, 2014
    Applicant: The Johns Hopkins University
    Inventors: Elizabeth Marion JAFFEE, Lanqing HUANG, Lei ZHENG
  • Publication number: 20140215644
    Abstract: The present invention discloses soluble isoforms of CD5 and CD6, which are scavenger-like lymphocyte receptors, for use in the prophylaxis or therapy of disorders or in therapeutic interventions, which would benefit from an exacerbated immune response to either endogenous or exogenous antigens, resulting from a decrease in lymphocyte subpopulations with regulatory functions and/or increase in lymphocyte subpopulations with effector functions. Special disorders are cell growth disorders, and chronic infections of bacterial, viral, fungal or parasitic origin. The invention also provides animal models for the study and the prophylaxis/treatment of autoimmune diseases, cancer, and chronic infections.
    Type: Application
    Filed: May 29, 2012
    Publication date: July 31, 2014
    Applicants: FUNDACIO CLINIC PER A LA RECERCA BIOMEDICA, UNIVERSITAT DE BARCELONA, HOSPITAL CLINIC I PROVINCIAL DE BARCELONA
    Inventors: Francisco Lozano Soto, Vanessa Gabriela Martinez, Rafael Fenutria Aumesquet
  • Publication number: 20140178306
    Abstract: Fatty liver was induced by administering agents for inducing organ inflammation to experimental animals to evoke insulin resistance and by rearing them with high-fat diets. As a result, steatohepatitis was successfully induced in the animals. The animals show pathological findings similar to those of humans. By using these model animals, substances for treating or preventing diseases can be efficiently screened and the efficacy of medicinal substances can be effectively evaluated.
    Type: Application
    Filed: February 27, 2014
    Publication date: June 26, 2014
    Applicant: STELIC INSTITUTE OF REGENERATIVE MEDICINE, STELIC INSTITUTE & CO.
    Inventors: HIROYUKI YONEYAMA, MASATO FUJII
  • Publication number: 20140157444
    Abstract: WD-repeat proteins are very diverse, yet these are structurally related proteins that participate in a wide range of cellular functions. WDR13, a member of this family, is conserved from fishes to humans and localizes into the nucleus. To understand the in vivo function(s) of Wdr13 gene, we have created and characterized a mutant mouse strain lacking this gene. The mutant mice had higher serum insulin levels and increased pancreatic islet mass as a result of the enhanced beta cell proliferation. While a known cell cycle inhibitor, p21, was down regulated in the mutant islets overexpression of WDR13 in the pancreatic MIN6 cell line resulted in upregulation of p21, accompanied by retardation of cell proliferation. We suggest that WDR13 is a novel negative regulator of the pancreatic beta cell proliferation. Co-immunoprecipitation experiments showed that this protein interacts with estrogen receptors and various HDACs.
    Type: Application
    Filed: April 27, 2012
    Publication date: June 5, 2014
    Applicant: COUNCIL OF SCIENTIFIC AND INDUSTRIAL RESEARCH
    Inventors: Satish Kumar, Vijay Pratap Singh
  • Publication number: 20140157443
    Abstract: Provided herein is a novel mTOR-comprising complex, mT-ORC3, which comprises mTOR and the Ets transcription factor TEL2. Specific mTORC3 binding agents and modulating agents are provided, along with kits and methods for the detection of mTORC3. Methods of modulating the activity of mTORC3 or modulating cell growth and/or survival are also provided. Further provided are methods for screening for mTORC3 binding agents and for mTORC3 modulating agents. Various methods of diagnosis and treatment are further provided.
    Type: Application
    Filed: April 12, 2012
    Publication date: June 5, 2014
    Applicant: ST. JUDE CHILDREN'S RESEARCH HOSPITAL
    Inventors: Gerard C. Grosveld, Frank C. Harwood, Ramon I. Klein-Geltink
  • Publication number: 20140137274
    Abstract: PROBLEM There are provided induced malignant stem cells capable of in vitro proliferation that are useful in cancer research and drug discovery for cancer therapy, as well as processes for production thereof, cancer cells derived from these cells, and applications of these cells.
    Type: Application
    Filed: November 30, 2012
    Publication date: May 15, 2014
    Applicants: LSIP, LLC, National Cancer Center
    Inventors: National Cancer Center, LSIP, LLC
  • Publication number: 20140134662
    Abstract: Genetically modified non-human animals are provided that may be used to model human hematopoietic cell development, function, or disease. The genetically modified non-human animals comprise a nucleic acid encoding human IL-6 operably linked to an IL-6 promoter. In some instances, the genetically modified non-human animal expressing human IL-6 also expresses at least one of human M-CSF, human IL-3, human GM-CSF, human SIRPa or human TPO. In some instances, the genetically modified non-human animal is immunodeficient. In some such instances, the genetically modified non-human animal is engrafted with healthy or diseased human hematopoietic cells. Also provided are methods for using the subject genetically modified non-human animals in modeling human hematopoietic cell development, function, and/or disease, as well as reagents and kits thereof that find use in making the subject genetically modified non-human animals and/or practicing the subject methods.
    Type: Application
    Filed: November 5, 2013
    Publication date: May 15, 2014
    Inventors: Richard Flavell, Till Strowig, Markus G. Manz, Chiara Borsotti, Madhav Dhodapkar, Andrew J. Murphy, Sean Stevens, George D. Yancopoulos
  • Patent number: 8722964
    Abstract: This invention relates to the engineering of animal cells, preferably mammalian, more preferably rat, that are deficient due to the disruption of tumor suppressor gene(s) or gene product(s). In another aspect, the invention relates to genetically modified rats, as well as the descendants and ancestors of such animals, which are animal models of human cancer and methods of their use.
    Type: Grant
    Filed: April 23, 2010
    Date of Patent: May 13, 2014
    Assignee: Transposagen Biopharmaceuticals, Inc.
    Inventors: Eric M. Ostertag, John Stuart Crawford
  • Patent number: 8703485
    Abstract: The invention relates to transgenic animals lacking endogenous Ig and capable of producing transgenic antibodies, as well as methods of making the same. The invention further relates to methods for producing transgenic antibodies in such animals, and transgenic antibodies so produced.
    Type: Grant
    Filed: May 30, 2008
    Date of Patent: April 22, 2014
    Assignee: OMT, Inc.
    Inventor: Roland Buelow
  • Publication number: 20140109244
    Abstract: In one aspect, the invention provides a transgenic non-human animal model havings germ cells and somatic cells containing an endogenous MMTV-SV40-Spy1A gene sequence introduced into said animal model, or an ancestor of said animal model at an embryonic stage, wherein said gene sequence comprises a mouse mammary tumor virus gene (MMTV), a functionally disrupted SV40 gene (SV40) and a human Spy1A gene. In another aspect, the present invention provides a transgenic non-human animal model whose germ cells and somatic cells contain an endogenous Spy1A-pTRE-Tight gene sequence introduced into said animal model or an ancestor of said animal model at an embryonic stage. Preferably, the Spy1A-pTRE-Tight animal model expresses the Spy1A and develop cancer, preferably breast cancer, when administered with tetracycline, preferably doxycycline.
    Type: Application
    Filed: August 30, 2013
    Publication date: April 17, 2014
    Inventors: Lisa Porter, Bre-Anne Fifield, Dorota Lubanska, Espanta Jalili
  • Publication number: 20140109245
    Abstract: The present disclosure, in part, is directed to a mammalian prostate cancer cell line comprising at least one or a set of primary mammalian epithelial cells which have been infected with a retroviral vector carrying an oncogene selected from the group consisting of c-Myc, Ha-Ras, NeuT, c-Src and combinations thereof and in which said gene is expressed.
    Type: Application
    Filed: March 9, 2012
    Publication date: April 17, 2014
    Inventor: Richard G. Pestell
  • Publication number: 20140109246
    Abstract: The present invention provides methods for the generation of xenochimaeric animals; for example, xenochimaeric mice, comprising bone marrow progenitor cells and tumors from a heterologous animal. In some aspects, the invention provides xenochimaeric mice bearing humanized bone marrow and human tumors. Such animals are a model system for the study of human tumor stroma, for drug discovery, and for the treatment of human cancers.
    Type: Application
    Filed: September 24, 2013
    Publication date: April 17, 2014
    Applicant: The Regents of the University of Colorado, a body corporate
    Inventors: Antonio JIMENO, Yosef REFAELI, Xiao-Jing WANG, Dennis ROOP
  • Publication number: 20140093456
    Abstract: The present invention relates to a method of developing a Tumor Model System. The invention deals with a tumor model system with adhesion deprived cells. This observation provides a new method for primary detection of transformation of adhesion-deprived cells and tumorigenicity. The adhesion-deprived cells are capable of metastasizing at distant sites and the model system includes both the tumor formation and metastasis.
    Type: Application
    Filed: September 17, 2013
    Publication date: April 3, 2014
    Applicant: COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH
    Inventors: Rajeswari Jinka, Gopal Pande
  • Patent number: 8674172
    Abstract: The present invention relates to a prostate cancer cell line CNCM deposit number I-4126, the use thereof for preparing resistant prostate cancer cell lines, the resistant prostate cancer cell lines, and the use of these prostate cancer cell lines for screening compounds of interest.
    Type: Grant
    Filed: April 12, 2010
    Date of Patent: March 18, 2014
    Assignee: Institut Gustave Roussy
    Inventors: Anne Chauchereau, Karim Fizazi, Catherine Gaudin, Nader Al Nakouzi, Jean Benard
  • Publication number: 20140056814
    Abstract: A cell culture support is first prepared that is coated on a surface with a polymer the hydration force of which changes in a temperature range of 0-80° C.; cancer cells are then cultivated on the support in a temperature region where the polymer has weak hydration force; thereafter, the culture solution is adjusted to a temperature at which the polymer has a stronger hydration force, whereby the cultured cancer cells are detached; the detached cancer cells are then transplanted to a specified site of an animal on which transplantation is to be performed; this method is an efficient way of cancer cells transplantation.
    Type: Application
    Filed: July 18, 2013
    Publication date: February 27, 2014
    Inventors: Teruo OKANO, Akihiko KIKUCHI, Masayuki YAMATO, Akira MASUDA
  • Publication number: 20140047570
    Abstract: The subject invention pertains to a non-human animal model of human cancer, methods of producing a non-human animal model of human cancer, methods of using a non-human animal model to propagate human cancer cells, methods of using a non-human animal model to study cancer, methods of using a non-human animal model to screen potential treatments for a subject's cancer, methods of using a non-human animal model for treating cancer in a subject (providing personalized therapy), methods of using a non-human animal model for identifying a biomarker of cancer treatment; and methods of using a non-human animal model for selecting cancer patients for a clinical trial.
    Type: Application
    Filed: April 19, 2012
    Publication date: February 13, 2014
    Applicant: H. LEE MOFFITT CANCER CENTER AND RESEARCH INSTITUTE, INC.
    Inventor: Soner Altiok
  • Patent number: 8642834
    Abstract: The present invention provides tumor cell preparations for use as models of the EMT process for use in the identification of anti-cancer agents, wherein said tumor cell preparations comprise cells of the epithelial tumor cell line CFPAC-1, which are stimulated by receptor ligands to induce EMT, or which have been engineered to inducibly express a protein that stimulates EMT. The present invention also provides methods of identifying potential anti-cancer agents by using such tumor cell preparations to identify agents that inhibit EMT, stimulate MET, or inhibit the growth of mesenchymal-like cells. Such agents should be particularly useful when used in conjunction with other anti-cancer drugs such as EGFR and IGF-1R kinase inhibitors, which appear to be less effective at inhibiting tumor cells that have undergone an EMT.
    Type: Grant
    Filed: February 26, 2010
    Date of Patent: February 4, 2014
    Assignee: OSI Pharmaceuticals, LLC
    Inventors: Julie Kan, Salam A. Shaaban, Joseph S. Krueger, Maryland Franklin, Robert C. Wild
  • Publication number: 20140026234
    Abstract: Presented herein are novel protein biomarkers related to cancers with stromal components. These newly identified biomarkers create the basis for multiple (single) assays using traditional bioassay technologies and when used in combination yield exceptional clinical sensitivity and specificity in the determination of diagnosis and/or prognosis of cancer. A new genetic model able to identify potential genetic suppressors and/or potential therapeutic agents for treating stromal cancers is also described. Means and methods for evaluating data generated using multiple biomarkers in order to validate findings and further the use of the biomarkers and the genetic model system in clinical, diagnostic and therapeutic uses is also included.
    Type: Application
    Filed: January 27, 2012
    Publication date: January 23, 2014
    Applicant: Thomas Jefferson University
    Inventors: Michael P. Lisanti, Sotgia Federica
  • Publication number: 20130263296
    Abstract: Genetic constructs comprising reporter genes operably linked to cancer specific or cancer selective promoters (such as the progression elevated gene-3 (PEG-3) promoter) are provided, as are methods for their use in cancer imaging, cancer treatment, and combined imaging and treatment protocols. Transgenic animals in which a reporter gene is linked to a cancer specific or cancer selective promoter, and which may be further genetically engineered, bred or selected to have a predisposition to develop cancer, are also provided.
    Type: Application
    Filed: October 28, 2011
    Publication date: October 3, 2013
    Applicants: THE JOHNS HOPKINS UNIVERSITY, VIRGINIA COMMONWEALTH UNIVERSITY
    Inventors: Martin Gilbert Pomper, Hyo-eun Bhang, Paul Fisher
  • Publication number: 20130260385
    Abstract: Markers useful for the identification, characterization and, optionally, the enrichment or isolation of tumorigenic cells or cell subpopulations are disclosed.
    Type: Application
    Filed: September 2, 2011
    Publication date: October 3, 2013
    Inventors: Scott J. Dylla, Marianne Santaguida, Wade C. Anderson
  • Publication number: 20130263297
    Abstract: The present invention relates to metastases. More specifically, the invention relates to compositions and methods for the inhibition of metastases of cancer cells, such as prostate cancer cells, to bones and soft tissue. The present invention also relates to the treatment of cancer, including but not limited to prostate cancer. Also provided are animal models for studying cancer metastasis; particularly, prostate cancer metastasis. Further provided are compositions, processes and systems to prognosticate cancer.
    Type: Application
    Filed: May 7, 2013
    Publication date: October 3, 2013
    Inventors: Gina C.Y. Chu, Leland W.K. Chung, Haiyen E. Zhau, Ruoxiang Wang
  • Publication number: 20130239239
    Abstract: The present invention provides LMCD1 cancer markers, and methods, compositions, and kits for their use. The invention also provides expression vectors, host cells, and transgenic animals comprising one or more LMCD1 mutations, and methods for their use in characterizing, diagnosing, and treating cancers, and for identifying potential therapeutics. The invention also provides cancer therapeutics.
    Type: Application
    Filed: March 7, 2012
    Publication date: September 12, 2013
    Inventors: Y-S Jou, C-Y Chang
  • Publication number: 20130219531
    Abstract: Immortalized human cell lines derived from prostate cells are disclosed. Immortalized cells derived from a human epithelial prostate tissue cancer tumor are provided, as well as immortalized cells derived from healthy human epithelial prostate tissue from the same patient. Methods for utilizing such immortalized cell lines for researching, screening, and evaluating antimalignancy therapies and drug candidates are also disclosed.
    Type: Application
    Filed: August 20, 2012
    Publication date: August 22, 2013
    Applicant: TUSKEGEE UNIVERSITY
    Inventors: Clayton YATES, Timothy TURNER
  • Publication number: 20130212721
    Abstract: The present invention aims to provide a novel reagent for tumor testing and a novel pharmaceutical composition for tumor prevention. The present invention provides a reagent for tumor detection, which comprises a probe for the FEAT gene or amplification primers for the FEAT gene, or an antibody against the FEAT protein or a fragment of the antibody. Moreover, the present invention also provides a pharmaceutical composition for tumor prevention, which is configured to use the FEAT gene or the FEAT protein as a tumor marker to thereby recognize tumor cells.
    Type: Application
    Filed: August 15, 2011
    Publication date: August 15, 2013
    Applicant: Kyushu University, National University Corporation
    Inventor: Atsushi Takahashi
  • Publication number: 20130198876
    Abstract: The present invention provides an induced cancer cell capable of self-replication in vitro which is useful in cancer therapy research and the research for cancer-related drug discovery, processes for production thereof, cancer cells induced by the malignant cells, and applications of these cells. The present invention provides an induced cancer stem cell capable of proliferation (self-replication) in vitro, wherein the induced cancer stem cell has the following two characteristics: (1) expressing the six genes (self-renewal related genes) POU5F1, NANOG, SOX2, ZFP42, LIN28, and TERT selected from a certain group of genes; and (2) having an aberration which is either (a) a mutation in an endogenous tumor suppressor gene or (b) increased expression of an endogenous cancer-related gene.
    Type: Application
    Filed: May 25, 2011
    Publication date: August 1, 2013
    Applicant: NATIONAL CANCER CENTER
    Inventor: Tetsuya Ishikawa