Abstract: A system for tracking files and documents includes: a plurality of programmable networked tags operable at a low radio frequency not exceeding one megahertz; a plurality of files with the programmable networked tag affixed to each file; a container for the plurality of files; a base station configured for transmission of signals to and from the plurality of programmable networked tags; and a computer in communication with the base station. The computer includes software for enabling real-time transmissions and a graphical user interface for enabling a user to read and write data to be transmitted to and from the plurality of programmable networked tags.

Abstract: Disclosed is a transparent/translucent molding composition and process for making prepared from an impact modifier and a resin blend of polycarbonate and a cycloaliphatic polyester having a matching index of refraction.

Abstract: A method of increasing the branching and polydispersity of a polycarbonate includes the steps of: (a) including in the polycarbonate at least one species of an alkyl substituted monomer, and (b) treating the polycarbonate at an elevated temperature and for a sufficient time to increase the branching and polydispersity relative to an otherwise equivalent polycarbonate without alkyl substituents.

Abstract: Provided is a health diagnosis apparatus and method in which brain waves are sequentially measured from the frontal lobe of a human body that is to be diagnosed when the eyes are in an eyes-open and eyes-closed state, the measured brain waves are fast Fourier transformed to then be accumulated, and then the health conditions of the respective portions of the human body can be determined according to the patterns with respective frequencies. The health condition diagnosis method includes measuring brain waves; performing a fast-Fourier-transform on the measured brain waves; classifying the frequency-based brain wave data into opened and closed eye state brain waves to thus accumulate the classified result; finding a specific frequency and a pattern thereof which repeats from the accumulated brain wave data; correspondingly connecting the frequency and the respective portions of the human body based on the specific frequency pattern; and determining the health condition of the human body.

Abstract: Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration.

Abstract: Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.

Abstract: Plastic articles, and in particular polycarbonate articles, provide an appealing aesthetic look in the form of a colored glow at locations defined by cuts and/or protrusions in the surface of the article as a result of incorporation of a photoluminescent material in the polycarbonate from which the article is formed. The cuts and/or protrusions define a graphic image, for example one or more letters (i.e., an initial or name), an abstract design, a drawing or a trademark or logo. Ambient light entering the plastic body results in luminescence from the photoluminescent material which is conducted as a result of internal reflectance within the plastic body to the edges of the cuts in the bodies surface.

Abstract: A test strip and analytical apparatus have pin connections permitting the definition of geographic regions or of particular customers. A test strip made for use in a particular region or for a particular customer will have pin connections matching features of the apparatus made for use in that region or by that customer. Insertion of the strip into the apparatus does not merely turn on the apparatus, but provides the regional or customer coding. Analog switches within the apparatus allow coding of a larger number of distinct regions or customers than would otherwise be possible, all without degrading the quality of the measurements made of the fluid being tested. Conductive paths in the strips permit testing the strips during manufacture so as to detect quality lapses regarding the printing or deposition of the paths.

Abstract: The present invention provides methods of producing high molecular weight polymer. A method of forming polycarbonate includes the step of combining in a reaction mixture a diaryl carbonate, a transesterification catalyst, an aliphatic dihydroxy compound, and a diacid compound in a reactor system. The temperature and pressure of the reactor system are adjusted to a first reactor setpoints and the reaction mixture is monitored to detect initiation of the exothermic oligomerization reaction. The reactor setpoint are adjusted to second reactor setpoints after detection of initiation of the exothermic oligomerization reaction. The reactor system is maintained at the second reactor setpoints to allow the reaction mixture to react to form an oligomer mixture.

Abstract: The invention disclosed provides a method, system, and associated tag for detection and tracking of inanimate and animate objects.

Abstract: A method of forming polycarbonate includes the steps of introducing a plurality of reaction components to a reactor operating under melt polymerization conditions and removing ester-substituted phenol from the reactor. The plurality of reaction components include a dihydroxy compound, an ester-substituted diaryl carbonate, and a melt transesterification catalyst. The reaction components are introduced in a plurality of reaction component streams. A first reaction component streams includes a melt transesterification catalyst dissolved or suspended in a liquid carrier containing an ester-substituted phenol. The composition of the first reaction component stream is selected such that ester-substituted phenol is not generated as a reaction product in the first reaction component stream.

Abstract: Activities of individuals and the movements/usage of products are monitored in an operating room during a surgical procedure by disposing in the operating room a first transceiver operating in a long wavelength mode in which 99.99% or more of radiated energy is in the form of a magnetic field, for example 131 KHz. A distinguishable radio frequency-enabled identification tag is associated with each of a plurality of persons assigned to the surgical procedure, including for example, doctors, nurses, and/or the patient, and optionally with products to be monitored. A signal is transmitted from the first transceiver and responses from the identification tags are monitored. A log is created from the monitored responses indicative activities of each of the persons in the operating room or of movements of tagged products.

Abstract: A keg is formed from (A) a shaped jacket or liner forming a container, obtained from at least two nonsymmetrical parts (1a, 1b) welded together, one of the parts containing an opening provided with a neck, and (B) a filling/tapping device (3) positioned in the neck of the opening. The part of the container with the filling/tapping opening contains a riser or peripheral skirt (13) having a height at least equal to that of the outer part of the filling/tapping device and, optionally, sufficient to contain at least one cut-out forming a handle, and while the neck of the opening contains a part (9) extending inside the lumen of the jacket and having a limited diameter at its end (10), so as to permit passage and maintenance of the tapping device (3), and containing at least one other opening (11), advantageously on the periphery of the opening for passage and maintenance of the tapping device.

Abstract: The invention disclosed provides a method, system, and tag for detection and tracking of objects. The method includes the steps of: a) attaching to each of the objects a low radio frequency detection tag having an antenna, a transceiver, a data storage device operable to store data including identification data, a programmed data processor, and an energy source; b) storing, in the data storage device of each tag, shipping data; c) commingling the objects in a repository provided with a large loop field antenna; d) reading the identification data and shipping data from the transceiver of each tag by interrogating all tags commingled in said repository with data signals via said field antenna; and e) transmitting the identification data and shipping data from each tag to a central data processor to provide a tally of the objects in said repository.

Abstract: An isosorbide-containing polycarbonate composition is provided. The composition contains a polycarbonate having repeat units derived from isosorbide, a polycarbonate-property-modifying additive, and a pH stabilizer. When a solution containing 10 wt. % of the composition dissolved in dichloromethane is prepared the solution has a non-aqueous pH in a range of equal to or between 0.8 below and 0.5 above the pH of the dichloromethane.

Abstract: This invention relates to a method and system for authenticating and for preventing alteration of histories of events occurring within at least one repository (e.g. a cargo container, fixed warehouse or a movable vehicle) for objects (e.g. auto parts, pharmaceutical materials, computer parts, laptops, etc.) held for a period of time, where the repository is exposed to an unauthorized intrusion therewithin (and potential theft of said objects therefrom and potential insertion of dangerous items therewithin). The events include changes in environmental conditions (e.g. light levels, infrared levels, temperature, air pressure, etc) which indicate an unauthorized intrusion.

Abstract: A method of making polycarbonate includes the steps of forming polycarbonate by a melt transesterification method using an activated diaryl carbonate, and compounding the polycarbonate with a phosphorus-containing compound that has an abstractable proton or hydrolyzable group. The phosphorus-containing compound is compounded with the polycarbonate in an amount sufficient to result in an improvement in the color properties of the polycarbonate as compared to pellets formed from the same polycarbonate without addition of the phosphorus-containing compound.

Abstract: A method is provided for determining analyte concentrations, for example glucose concentrations, that utilizes a dynamic determination of the appropriate time for making a glucose measurement, for example when a current versus time curve substantially conforms to a Cottrell decay, or when the current is established in a plateau region. Dynamic determination of the time to take the measurement allows each strip to operate in the shortest appropriate time frame, thereby avoiding using an average measurement time that may be longer than necessary for some strips and too short for others.