Abstract: The present invention provides genes encoding novel luciferases having at least the properties of: being capable of using coelenterazine as their luminescent substrates; and being capable of being recombinantly expressed in a mammal cell as a host and produced to be secreted to the outside of the host cell. Specifically, the gene encoding novel luciferases according to the present invention is a DNA molecule comprising a nucleotide sequence encoding any of the full-length amino acid sequences of two types of luciferase proteins, luciferase 1 and luciferase 2, from M. pacifica, and is, for example, a gene encoding the following full-length amino acid sequence of the luciferase 1.

Abstract: A human tracking apparatus and method capable of highly accurately tracking the movement of persons photographed in moving images includes: an image memory 107 that stores an inputted frame image; a human detecting unit 101 that detects persons photographed in the inputted frame image; a candidate registering unit 106 that registers already detected persons as candidates; a similarity index calculating unit 102 that calculates similarity indices indicating the similarity between the persons detected in the inputted frame image and the registered candidates for two or more types of parameters based on the stored frame images in relation to all combinations of the persons and the candidates; a normalizing unit 103 that normalizes the similarity indices; an integrating unit 104 that integrates the normalized indices for each combination of the detected persons and the candidates; and a tracking unit 105 that identifies a person the same as an arbitrary candidate based on the similarity indices.

Abstract: The present invention is to provide a method for predicting secondary structure of RNA capable of predicting the secondary structure which has been difficult to predict the secondary structure including pseudonot structure, and an apparatus for predicting secondary structure of RNA using the method for predicting.

Abstract: An attribute estimation system and a method in which there are no cases that the estimation accuracy declines in a specific numerical value area, and an age estimation system, a gender estimation system and an age and gender estimation system using this is provided. It is a system to estimate an age of a person photographed in an input image, the system including: a classifier 3 that estimates the age of a person as a discrete quantity based on data of an input image; a classifier 4 that estimates the age of a person as a continuous quantity based on data of an input image; and an integration unit 7 that integrates an estimated result of the classifier 3 and an estimated result of the classifier 4.

Abstract: The object of the present invention is to provide a method of predicting a higher-order structure of a nucleic acid sequence typified by a G quartet structure, and an apparatus and a program that execute the method. The method according to the present invention relates to a method of predicting a nucleic acid higher-order structure that predicts a higher-order structure of a nucleic acid sequence, the method, including the steps of: extracting bases capable of forming a higher-order structure as a higher-order structure candidate from said nucleic acid sequence; extracting bases capable of forming a stem structure as a stem structure candidate from said nucleic acid sequence; and searching an optimal combinatorial structure based on the higher-order structure candidate and the stem structure candidate.

Abstract: It is intended to provide a method for identifying a nucleotide sequence necessary for expressing an affinity for a target substance in nucleotide sequences of nucleic acid molecules such as aptamers having the affinity for the target substance based on a homology of the respective nucleotide sequences and an evaluation value related to the affinity of the nucleotide sequences, and a method for predicting a secondary structure of a nucleic acid molecule containing the identified nucleotide sequence. The method for identifying a nucleotide sequence necessary for expressing an affinity for a target substance in nucleotide sequences of nucleic acid molecules having such an affinity is characterized by comprising the steps of: extracting a single-strand region from the nucleotide sequences of nucleic acid molecules by excluding nucleotides capable of forming a stem structure; and searching a motif sequence based on an evaluation value of the affinity from the single-strand region.

Abstract: The present invention is to provide a method for obtaining an oligonucleotide such as RNA aptamer having high binding capacity to a target substance with easy-to-use and high purity. The method for obtaining oligonucleotide according to the present invention is as follows: A method for obtaining oligonucleotide comprising the steps of: performing an electrophoresis of a nucleic acid molecule/target substance complex comprising a nucleic acid molecule and a target substance; recovering said nucleic acid molecule/target substance complex; extracting the nucleic acid molecule from said nucleic acid molecule/target substance complex; gene amplifying said nucleic acid molecule.

Abstract: The present invention provides a process for generation of a transformed plant capable of emitting fluorescence by introducing a gene encoding a non-plant-derived fluorescent protein into a plant such that the fluorescent protein is recombinantly expressed in the active form of its mature protein in the leaf or petal of the plant, and also provides a transformed garden plant capable of emitting fluorescence that is generated by using the process. For example, cDNA encoding the full-length amino acid sequence of a Chiridius poppei-derived fluorescent protein CpYGFP or its H52F modified protein CpYGFP H52F is inserted into a T-DNA-based expression vector system, which is in turn introduced into the chromosomal DNA of a plant. As a result, the transformed plant thus generated can exhibit fluorescence attributed to these fluorescent proteins and exhibit no substantial difference in the other phenotypes from wild-type one of the plant.

Abstract: The present invention provides a “nucleic acid adaptor molecule” having specific binding affinity to a GST protein portion serving as an N-terminal fusion partner in a fusion protein consisting of the GST protein and a protein of interest. A “nucleic acid adaptor molecule against a GST protein” according to the present invention is an RNA aptamer molecule having any of the following nucleotide sequences I to III: nucleotide sequence I (SEQ ID NO: 1): GGUAGAUACGAUGGAUGGUUGUGUAAAGGUGGUCGUAUCCGCCGA CAUG ACGCGCAGCCAA 61; nucleotide sequence II (SEQ ID NO: 2): GGUAGAUACGAUGGACUAACUGCGCAAAUUACUCGUAUUAGCCGA CAUG ACGCGCAGCCAA 61; or nucleotide sequence III (SEQ ID NO: 3): GGUAGAUACGAUGGAUACCGAAAAAUUAGUGUCGUUGACUGCAA CAUGA CGCGCAGCCAA 60.

Abstract: The present invention provides: a method of changing the fluorescence wavelength of a GFP-like fluorescent protein from copepod while maintaining recombinant expression efficiency, which comprises identifying a structural factor for determining the fluorescence wavelength thereof in the three-dimensional structure of the protein and modifying amino acid residues associated with the structural factor; and a modified fluorescent protein obtained by applying said method. For example, with regard to a GFP-like fluorescent protein from Chiridius poppei, His52 in an ? helix-like secondary structure: PFLLSHCMGYGFYHF (?1 47-61) comprising a fluorescent moiety site GYG is replaced with an aromatic amino acid selected from Phe, Tyr and Trp, so as to cause a red shift of the fluorescent peak wavelength; or it is replaced with Ala, Val, Ile, Leu, Gly, Cys, Met, Ser, Thr, or Asp, Asn, Glu or Gln, so as to cause a blue shift of the fluorescence peak wavelength.

Abstract: The present invention provides genes encoding novel luciferases having at least the properties of: being capable of using coelenterazine as their luminescent substrates; and being capable of being recombinantly expressed in a mammal cell as a host and produced to be secreted to the outside of the host cell. Specifically, the gene encoding novel luciferases according to the present invention is a DNA molecule comprising a nucleotide sequence encoding any of the full-length amino acid sequences of two types of luciferase proteins, luciferase 1 and luciferase 2, from M. pacifica, and is, for example, a gene encoding the following full-length amino acid sequence of the luciferase 1.

Abstract: The route search system of the present invention receives the provision request of the information about route search from a route search terminal. The information included in the provision request from a route search terminal is acquired, calculation processing of the environmental load value of the relevant vehicle and the environmental load value of other vehicle by which it is generated with movement of a relevant vehicle from the acquired information is carried out using an environmental load calculation unit.

Abstract: The present invention provides a novel fluorescent protein the wavelength of the maximum of the fluorescence of which exists in a wavelength side longer than 510 nm, and which exhibits yellow fluorescence or yellowish green fluorescence and can be expressed in a heterogeneous cell, and a gene encoding the same, wherein the fluorescent protein has an amino acid sequence as set forth in SEQ ID NO: 1 and it is a fluorescent protein derived from a copepod taxonomically classified to Chiridius Poppei.

Abstract: The present invention provides a novel Kunitz-type inhibitor protein exhibiting high potency to inhibit serine protease activity of human blood coagulation factor Xa. The Kunitz-type inhibitor protein against human blood coagulation factor Xa according to the present invention is a Kunitz-type inhibitor protein: bitoran D from Bitis arietans venom having the following amino-acid sequence I: (SEQ ID NO:1) SKKRP DFCYL PADDG PCRAF IPSFY YNSTS NECNT FIYGG CYGNA NKFES MDECR KTCVA SA, a Kunitz-type inhibitor protein: bitoran V from Bitis arietans venom having the following amino-acid sequence II: (SEQ ID NO:2) C RQNRP DFCYL PAVEG PCRAY IRSFF YNSTS NECEK FFYGG CYGNA NKFET RDECR KTCVA SA, or a modified protein thereof.

Abstract: An exemplary object of the present invention is to provide method, predictor and predicting program for predicting secondary structure of nucleic acid sequence capable of evaluating not only overall similarity and but also localized similarity of secondary structure of nucleic acid sequence. A method according to an exemplary aspect of the present invention includes the steps of: extracting a structural element of the secondary structure from the secondary structure of the nucleic acid sequence; and evaluating a similarity of each structural element of the nucleic acid sequence as a subject, based on a feature vector of the structural element.

Abstract: The present invention provides a novel fluorescent protein the wavelength of the maximum of the fluorescence of which exists in a wavelength side longer than 510 nm, and which exhibits yellow fluorescence or yellowish green fluorescence and can be expressed in a heterogeneous cell, and a gene encoding the same, wherein the fluorescent protein has an amino acid sequence as set forth in SEQ ID NO:1and it is a fluorescent protein derived from a copepod taxonomically classified to Chiridius Poppei.

Abstract: In a data/strobe encoding scheme circuit in which data and a strobe signal are transmitted through different lines, changes respectively in the data and the strobe signal are employed as clock signals for a latching operation, and the data is transmitted to a succeeding-stage circuit operating on a second clock signal. The circuit latches predetermined data by an FF circuit and passes a data pair including a signal indicating that the data has been latched and held therein as well as the latched data to the succeeding-stage circuit, activates, if assertion of a signal indicating reception of the data is received from the succeeding-stage circuit, again the FF circuit which has latched the data and has entered a stop state, and receives new data.

Abstract: When key interruption is notified to an application in a embedded system like a portable information terminal, sometimes notification of a key event to CPU is not carried out appropriately. A key controller includes a key table containing key information which specifies key type and operation style valid to execution of application by the CPU and notification information which specifies notification style to the interruption controller for each key. A key control unit of the key controller sets key information and notification information corresponding to the application which the CPU executes, in a register of the key controller and notifies the interruption controller of generation of key interruption corresponding to key operation based on the set information.