Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Abstract: A shark barrier that comprises an anchoring assembly having a pair of anchors (9) with a flexible connecting element (11) extending between the anchors. The shark barriers also includes multiple spaced apart buoyant resiliently flexible elongate members (15) that are secured at one end along a length of the connecting element of the anchoring assembly to operatively extend generally upwardly from the connecting element. The buoyant members comprise an elongate flexible spine (32) that extends through a series of tubular members (38).

Abstract: A system and method for the detection and quantification of biomolecules by measuring a piezoelectric signal is described. The system comprises a plurality of elongate zinc oxide nanowires mounted generally parallel to each another on a semi conductive silicon substrate. The free ends of the nanowires are provided with biomolecules that are capable of associating with complementary biomolecules within a biological or water sample. Following incubation of the system in a sample, the association of molecules of interest with the immobilised biomolecules on the system results in the displacement of the zinc oxide nanowires. The displacement of the nanowires produces a piezoelectric voltage signal that is useful in diagnosing a pathogenic infection or the contamination of a sample.

Abstract: A solution including an antimicrobial polymer in a polar solvent and a method of producing the solution. The polymer has the structure of Formula (I). The antimicrobial solution may be coated onto a substrate and cured to provide an antimicrobial substrate in which the polymer is covalently bonded to the substrate so that it cannot leach from the substrate.

Abstract: An ankle imaging accessory is provided by the present invention, particularly an ankle positioning device to facilitate the taking of X-ray views of a patient who had sustained an ankle fracture. The ankle imaging accessory is made from an X-ray translucent material and includes heel supports on which heels of a patient can locate. A pair of spaced apart stops defines the limits of an arc on which a foot pivoting on the heel support can move.

Abstract: The invention provides a method for preventing or treating microbial growth on a manufactured material or product. A composition comprising a cyclic decapeptide which is a tyrocidine, trypocidine, phenycidine or gramicidin S having an amino acid sequence of cyclo(valine-X1-leucine-D-phenylalanine-proline-X2-X3-X4-X5-X6) (SEQ ID NO: 1) is applied to the product and the cyclic decapeptides are adsorbed onto the product. Suitable products include medical devices (e.g. a catheter), wound dressings, food packaging, containers, wrappings, surfaces or devices used in the processing, transport or storage of food, filters, composites, paper, wrapping materials, walls, work surfaces, floors, pipes or the like. The composition could be used to disinfect or sterilise a material, surface or product or to inhibit formation of biofilms and/or biofouling on the surface of the product to which it is applied.

Abstract: A peptide-polymer conjugate is provided for use in treating malaria infections, and in particular terminal or drug resistant malaria infections. The conjugate is formed from a polymer to which a peptide having activity against a malaria parasite is co-valently attached. The peptide is a cyclic decapeptide from the closely-related group of tyrocidines, tryptocidines, phenycidines and gramicidin S, and the polymer is a hydrophilic and biocompatible polymer with a terminal thiol, such as poly(N-vinylpyrrolidone) (PVP). The polymer chains can be decorated with a hydrophilic targeting ligand that specifically targets an epitope on red blood cells, and in particular red blood cells infected with a plasmodial parasite. A method for synthesising the peptide-polymer conjugate is also provided.

Abstract: A versatile phantom provides image quality control on multiple different types of medical x-ray imaging equipment. The phantom has a radiolucent housing including a first series of elements of the same shape and size wherein each element has a different electron density such that grey scale can be evaluated. A second series of elements of the same shape and material has a range of different sizes for assessing low contrast detectability. At least one position indicating item is selected from a central ball within the housing, position indicating lines on the housing and a unique flat peripheral face of the housing. The phantom also has at least one mammography dedicated item selected from elements representative of mammography fibers and mammography micro-calcifications. An instruction manual and optional result analysis program provides for semi-automatic result analysis for analyzing results and recommending corrective action for test results that are out of tolerance.

Abstract: A cargo securing apparatus and a method of maintaining a user configured tension in a cargo securing element are disclosed. The apparatus includes at least one sensor arranged to measure a first and second tension in a tensile element (used to secure the cargo) at different times and a processor in data communication with the sensor. The processor is configured to receive the tension measurements from the sensor and to distinguish between acute and sustained deviations in tension based on the tension measurements. Conditionally, the processor may compare the first and second tension measurements to a user configured tension setting and determine tension correction parameters required to maintain the tension in the tensile element within a range of the user configured setting. The apparatus may include one or more manual or automated adjustment drives to adjust the tension in the tensile element in accordance with the tension correction parameters.

Abstract: A dephlegmator is provided comprising two stages connected in series wherein a first stage includes an air-cooled reflux condenser and a second stage includes a generally horizontal tube bundle of smooth or finned tubes that can be operated selectively in either an air-cooled (dry) mode under selected ambient conditions or in a wet evaporatively cooled mode under other selected ambient conditions including that of elevated ambient temperature. Spray nozzles may be installed above the tube bundle whereby water can be sprayed onto the tube bundle. One or more collection troughs are preferably provided beneath the tube bundle for collecting run-off water and enabling recycling of excess deluge water. Preferably, the tube bundle comprises at least two, and preferably three groups of tubes communicating with each other wherein the second group of tubes has appreciably fewer tubes in it than the first group of tubes and any third group of tubes has appreciably fewer tubes in it than the second group of tubes.

Abstract: A device for detecting target biomolecules is provided. The device consists of an electrically conductive membrane having a biological recognition component configured to bind a target biomolecule immobilized thereon. The membrane is connected to an electric circuit by means of electrodes. A voltage source applies a voltage to the membrane and a resistance monitoring device monitors the resistance of the membrane as a selected volume of fluid sample suspected of containing the target biomolecule is delivered onto the membrane.

Abstract: The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction.

Abstract: A shark barrier that comprises an anchoring assembly having a pair of anchors (9) with a flexible connecting element (11) extending between the anchors. The shark barriers also includes multiple spaced apart buoyant resiliently flexible elongate members (15) that are secured at one end along a length of the connecting element of the anchoring assembly to operatively extend generally upwardly from the connecting element. The buoyant members comprise an elongate flexible spine (32) that extends through a series of tubular members (38).

Abstract: The use of plant material from the Prosopis glandulosa tree (commonly known as Honey mesquite) is described for aiding sporting ability, and in particular for preventing and/or treating muscle injury and enhancing muscle strength. The plant material is typically the dried and ground pods from the tree, but could also be from other parts of the tree, such as the leaves, bark or roots.

Abstract: A recombinant yeast that expresses both an ?-amylase (SEQ ID NO: 1) and a glucoamylase (SEQ ID NO: 2) from Talaromyces emersonii (recently re-named as Rasamsonia emersonii) is provided. The use of the recombinant yeast in a process for producing an alcohol, in particular a biofuel, from starch or sugars is also described.

Abstract: A method for preparing a fermented beverage having a modulated aromatic profile is provided as well as a fermented beverage produced thereby. The method includes preparing a fermentable mixture, such as juice, must, or wort and introducing ammonium sulphide into the fermentable mixture at a predetermined concentration. The fermentable mixture is then subjected to fermentation. A C6 aldehyde, C6 alcohol or a combination thereof may be added to the fermentable mixture in combination with ammonium sulphide to enhance its effect on the aromatic profile of the fermented beverage.

Abstract: The present invention provides for heterologous expression of polypeptides encoded by wild-type and codon-optimized cbh2 genes from the organisms Cochliobolus heterostrophus, Gibberella zeae, Irpex lacteus, Volvariella volvacea, and Piromyces sp. in host cells, such as the yeast Saccharomyces cerevisiae. The expression in such host cells of the corresponding genes, and variants and combinations thereof, result in improved specific activity of the expressed cellobiohydrolases. Thus, such genes and expression systems are useful for efficient and cost-effective consolidated bioprocessing systems.

Abstract: The invention disclosed herein relates to the use of an extract of Dodonaea viscosa in breast cancer therapy, either alone or in combination with other breast cancer therapies.

Abstract: The invention provides variants of the Aspergillus japonicus ?-fructofuranosidase enzyme which have been modified so as to improve synthesis of inulin-type fructooligosaccharides (FOS) from sucrose. One or more substitutions may be made to the parent ?-fructofuranosidase polypeptide at amino acid positions 121, 159, 302 and/or 471 of the mature peptide (SEQ ID NO: 3), corresponding to crystal positions 140, 178, 321 and 490. A method of synthesizing FOS using the variants is also claimed.

Abstract: The invention provides protein-functionalized magnetic nanoparticles comprising magnetic nanoparticles (MNPs) to which a lactose-binding protein or enzyme has been immobilized. The protein-functionalized magnetic nanoparticles are particularly suitable for separating lactose from a lactose-containing solution, such as milk, cheese, yoghurt, flavored milk or the like. The protein-functionalized MNPs can be added to the lactose-containing solution and be allowed to bind to the lactose in the solution. The MNPs, to which the lactose is bound, can then be magnetically removed from the solution, e.g. by applying an external magnetic field.