Abstract: Cell-based compositions and methods for targeting and treating human diseases, including cancers and infectious diseases, are provided, wherein exogenous intracellular sarcosine is used for improved delivery of the composition.

Abstract: Disclosed herein are a pharmaceutical composition and a disease therapy method. The pharmaceutical composition relates to an artificial chimeric antigen receptor (CAR). Specifically, the pharmaceutical composition includes a CAR protein that is highly specific to CD19 antigen, a vector that is capable of inducing a cell to generate the certain CAR 19 protein and a population of a modified mammal cell including the CAR19 protein, the vector or combination thereof. Furthermore, the artificial CAR19 includes a CD19 antigen-binding fragment, a transmembrane domain, and a signaling domain. The CD19 antigen-binding fragment is a single-chain variable fragment (scFv) having specific amino acid sequences. Additionally, the method relates to a cancer therapy by using said modified mammal cells. Furthermore, the method includes the steps of purifying a population of autologous cells, modifying the population of autologous cells with an artificial CAR, and administrating the modified autologous cells.

Abstract: Disclosed are methods of identifying immunosuppressive TR1 regulatory T cells, including in methods of diagnosing the presence of immune tolerance, methods of producing immunosuppressive regulatory T cells, and methods of eliciting immune tolerance in a subject. These methods include screening T cells to detect Eomes+IL-10+ T cells or expressing recombinant Eomes in T cell populations to generate immunosuppressive regulatory T cells.

Abstract: The present invention relates to a novel use of regulatory T cell-specific surface protein Lrig-1, and more specifically to an immunosuppressive agent comprising siRNA which inhibits the expression of surface protein Lrig-1. In addition, the invention relates to a method for screening an immunosuppressive agent which inhibits proteins of Lrig-1 or genes encoding the proteins. As a result, an immunosuppressive agent with low side effects and high specificity can be developed.

Abstract: The present invention provides compositions comprising a protein expression blocker or PEBL comprising a target-binding molecule and localizing domain, and methods of using such compositions in cancer therapy. PEBLs are useful as a blockade of expression of target surface receptors (peptides or antigens) in immune cells. Also provided herein are CD3/TCR??-deficient T cells and CD3/TCR??-deficient chimeric antigen receptor T cells that express such PEBLs.

Abstract: The present invention relates to the field of prophylaxis and therapy of cancer. In particular there is provided a protein Indoleamine 2,3-dioxygenase (IDO) or peptide fragments here of that are capable of eliciting anti-cancer immune responses. Specifically, the invention relates to the use of IDO or peptides derived here from or IDO specific T-cells for treatment of cancer. The invention thus relates to an anti-cancer vaccine which optionally may be used in combination with other immunotherapies and to IDO specific T-cells adoptively transferred or induced in vivo by vaccination as a treatment of cancer. It is an aspect of the invention that the medicaments herein provided may be used in combination with cancer chemotherapy treatment. A further aspect relates to the prophylaxis and therapy of infections by the same means as described above. The use of IDO and immunogenic peptide fragments hereof in cancer and infection treatment, diagnosis and prognosis is also provided.

Abstract: The present technology relates, inter alia, to compositions and methods, including heterodimeric proteins that find use in the treatment of disease, such as immunotherapies for cancer and autoimmunity.

Abstract: A trifunctional molecule comprising a target-specific ligand, a ligand that binds a protein associated with the TCR complex and a T cell receptor signaling domain polypeptide is provided. The ligand that binds a protein associated with a TCR complex is UCHT1 with a Y182T mutation. Engineering T cells with this novel receptor engenders antigen specific activation of numerous T cell functions, including cytokine production, degranulation and cytolysis.

Abstract: The present application relates to specific binding members that bind carbonic anhydrase IX (CAIX). In particular, the present application relates to the treatment, diagnosis and detection of tumours, e.g. solid tumours, using specific binding members that bind CAIX. The specific binding member may be conjugated to a biocidal or cytotoxic molecule, or to a detectable label.

Abstract: The present invention is directed to anti-PVRIG antibodies and methods of using same.

Abstract: The present invention relates to regulatory T cell and uses thereof. By their immunosuppressive and anti-inflammatory activities, regulatory T cells play a central role in peripheral tolerance and thus critically prevent the development of autoimmune and inflammatory disorders. The inventors showed that Foxp3+CD4+ Tregs express high levels of LT?, which negatively regulates their immunosuppressive signature. They demonstrated that the adoptive transfer of LT??/? Tregs in mice protects from dextran sodium sulfate (DSS)-induced colitis and attenuates inflammatory bowel disease (IBD), multi-organ autoimmunity and the development of CAC. The inventors also showed that by mixed bone marrow chimeras that LT? expression specifically in hematopoietic cells negatively controls the immunosuppressive signature of Tregs. In particular, the present invention relates to regulatory T cell characterized in that it does not express or expresses reduced levels of lymphotoxin alpha.

Abstract: Provided are TCRs (e.g., TCRs that bind to NY-ESO-1), cells and pharmaceutical compositions comprising these TCRs, nucleic acids encoding these TCRs, expression vectors and host cells for making these TCRs, and methods of treating a subject using these TCRs.

Abstract: The present invention relates to a humanized DR4 antibody gene having apoptosis-inducing activity, and a dual-acting chimeric antigen receptor T cell or natural killer cell therapeutic agent, a secretory DR4 scFv antibody recombinant protein synthesized by using a humanized DR4 scFv antibody gene (humanized anti-DR4 scFv) may be used as an anticancer drug specifically targeting DR4 by binding to DR4 expressed on surface of the cancer cells to induce apoptosis of the cancer cells. In addition, the chimeric antigen receptor (CAR) using the humanized DR4 scFv antibody gene is predicted to have a strong anticancer immune effect as a dual-acting cell therapeutic agent, which is capable of simultaneously inducing apoptosis in cancer cells by DR4 and exhibiting a cytotoxic effect for cytotoxic T lymphocytes or natural killer cells by binding to DR4 expressed on the surface of cancer cells, as a DR4-specific CAR-T cell or CAR-NK cell therapeutic agent.

Abstract: The invention provides agonistic anti-human VISTA antibodies and antibody fragments. These agonist antibodies and antibody fragments may be used to potentiate or enhance or mimic VISTA's suppressive effects on T cell immunity and thereby suppress T cell immunity. These agonist antibodies and antibody fragments are especially useful in the treatment of autoimmunity, allergy, inflammatory conditions, GVHD, sepsis and transplant recipients. Screening assays for identifying these agonists are also provided.

Abstract: The invention provides agonistic anti-human VISTA antibodies and antibody fragments. These agonist antibodies and antibody fragments may be used to potentiate or enhance or mimic VISTA's suppressive effects on T cell immunity and thereby suppress T cell immunity. These agonist antibodies and antibody fragments are especially useful in the treatment of autoimmunity, allergy, inflammatory conditions, GVHD, sepsis and transplant recipients. Screening assays for identifying these agonists are also provided.

Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

Abstract: TCR AND PEPTIDES A T-cell receptor (TCR), which binds to a Wilms tumour 1 protein (WT1) peptide when presented by a major histocompatibility complex (MHC).

Abstract: The present disclosure provides recombinant T cells that include a vector encoding one or more of peroxisome proliferator-activated receptor (PPAR) gamma coactivator 1-alpha (PGC1?), mitochondrial transcription factor A (Tfam), GA binding protein transcription factor alpha subunit (GABPA), and estrogen-related receptor alpha (ERR?). Such recombinant T cells can also include a chimeric antigen receptor (CAR) or a recombinant T cell receptor (TCR). Methods of using these recombinant T cells in cancer immunotherapy are provided. Also provided are kits and compositions that can be used with such methods.

Abstract: The present invention provides novel full-length human antibodies that bind to human Fc epsilon-R1 alpha (monospecific antibodies). The present invention also provides novel bispecific antibodies (bsAbs) that bind to both Fc epsilon-R1 alpha and CD3 and activate T cells via the CD3 complex in the presence of Fc epsilon-R1 alpha-expressing cells. The bispecific antigen-binding molecules of the invention are useful for the treatment of diseases and disorders in which an upregulated or induced Fc epsilon-R1 alpha-targeted immune response is desired and/or therapeutically beneficial. For example, the bispecific antibodies of the invention are useful for the treatment of allergies, including anaphylaxis.

Abstract: Contemplated compositions and methods generate a durable immune synapse and so lead to activated T-cells and memory T-cell formation by use of selected co-stimulatory receptors and their ligands in conjunction with selected neoepitopes. Moreover, immune competent cells are attracted into a tumor microenvironment after activation of the T-cells using hybrid or chimeric binding proteins that comprise a chemokine portion and that target components of necrotic cells.