Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 150 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1000 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in cells of the retinal pigment epithelium of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence coding for a depolarizing light-gated ion channel functionally linked to a promoter leading to the specific expression of said depolarizing light-gated ion channel in a retinal photoreceptor, or the nucleotide sequence complementary to said nucleotide sequence, for use in treating or ameliorating blindness. The present invention also relates to methods of using such nucleic acid molecules in the treatment of blindness.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1800 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal ganglion cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides a method of infecting a cell with a virus, said method comprising the step of contacting the cell with a virus attached to a support, said method being characterized in that said support can be attracted by a magnet and in that a magnetic field is used to guide said support comprising said virus to the cell which should be infected by the virus bound to said support.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 700 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in interneurons of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1000 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in interneurons of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 400 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in direction selective retinal ganglion cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present inventions relates to tools and methods for the treatment of blindness in a patient, wherein a vector comprising a gene coding for a light-sensitive molecule is injected into the lateral geniculate nucleus of the patient.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 150 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 400 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in Muller cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention relates to a nucleic acid sequence derived from the regulatory region of the human gamma-synuclein gene and having a promoter activity in retinal ganglion cells. The present invention also relates to expression cassettes or vectors comprising said promoter operably linked to a nucleic acid sequence encoding a polypeptide of interest as well as viral particles or host cells comprising said expression cassette or vector. The present invention also relates to the use of said expression cassettes, vectors, viral particles or cells in the treatment of ocular disease, in particular ocular disease associated with retinal ganglion cell or photoreceptor cell degeneration.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 300 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 400 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 300 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 600 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal endothelial cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence coding for a depolarizing light-gated ion channel functionally linked to a promoter leading to the specific expression of said depolarizing light-gated ion channel in a retinal photoreceptor, or the nucleotide sequence complementary to said nucleotide sequence, for use in treating or ameliorating blindness. The present invention also relates to methods of using such nucleic acid molecules in the treatment of blindness.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for miRNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or miRNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence of at least 200 bp having at least 70% identity to the sequence of SEQ ID NO: 1, wherein the isolated nucleic acid molecule specifically leads to the expression in retinal amacrine bipolar cells of a gene when operatively linked to a nucleic acid sequence coding for the gene.

Abstract: The present invention relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.