Abstract: An isolated nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:1, or a nucleic acid sequence of at least 1000 bp having at least 70% identity to the sequence of SEQ ID NO:1. The isolated nucleic acid molecule can lead to the expression of a gene in retinal ON bipolar cells when a nucleic acid sequence coding for a gene is operatively linked to the isolated nucleic acid molecule.

Abstract: The present inventions relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 200 by having at least 70% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal amacrine bipolar cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 200 bp having at least 70% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in cones and/or OFF bipolar cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 400 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in Muller cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for mi RNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or mi RNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.

Abstract: The present invention relates to an isolated nucleic acid molecule comprising i) a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence and ii) a nucleotide sequence coding for a neurotrophic factor for use in the treatment of a retinal degenerative disease.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1000 by having at least 70% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in ON bipolar cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides a method for the targeted infection of cells. Said method is characterized in that it comprises the step of contacting the cell with a virus attached to a support. The present invention also encompasses a support to which a molecule binding specifically to a molecule present on the surface of a virus is attached, said molecule binding specifically to a molecule present on the surface of said virus being optionally attached to the support through a linking moiety.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 200 bp having at least 70% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in cones and/or OFF bipolar cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The invention relates to the use of a light-gated ion channel for the manufacture of a medicament for the treatment of blindness and a method for expressing said cell specific fashion, e.g. in ON-bipolar cells, ON-ganglion cells, or AII amacrine cells.

Abstract: The present invention relates to an isolated nucleic acid molecule comprising i) a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence and ii) a nucleotide sequence coding for a neurotrophic factor for use in the treatment of a retinal degenerative disease.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 200 bp having at least 70% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The invention relates to the use of a light-gated ion channel for the manufacture of a medicament for the treatment of blindness and a method for expressing said cell specific fashion, e.g. in ON-bipolar cells, ON-ganglion cells, or AII amacrine cells.

Abstract: The present inventions relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: The invention relates to the use of a light-gated ion channel for the manufacture of a medicament for the treatment of blindness and a method for expressing said cell specific fashion, e.g. in ON-bipolar cells, ON-ganglion cells, or AII amacrine cells.

Abstract: The present inventions relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: The present invention provides an organotypic system comprising a portion of a retina containing live cells in a cultured in medium, wherein photosensitivity has been restored in at least some of said live cells. Methods of use thereof are also provided.

Abstract: The application relates to an isolated transsynaptic virus expressing an exogenous fluorescent activity sensor. Preferably, the transsynaptic virus is a rhabdovirus, e.g. rabies virus, or a herpesvirus, preferably an alphaherpesvirus, e.g. pseudorabies virus. The fluorescent exogenous activity sensor used in the transsynaptic virus can be a fluorescent protein Ca2+ sensor, e.g. yellow cameleon, camgaroo, G-CaMP/Pericam, or TN-L15, preferably TN-L15, or a fluorescent protein voltage sensor, e.g. FlaSh, SPARC, or a VSP, preferably VSP1. The transsynaptic virus of the invention can be used in a method for analyzing the neural activity in local circuits. Moreover, the present application also relates to a kit for analyzing the neural activity in local circuits, said kit comprising a transsynaptic virus of the invention.

Abstract: The invention relates to the use of a light-gated ion channel for the manufacture of a medicament for the treatment of blindness and a method for expressing said cell specific fashion, e.g. in ON-bipolar cells, ON-ganglion cells, or AII amacrine cells.