Patents by Inventor Markus Sakari Kauppinen
Markus Sakari Kauppinen has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).
-
Patent number: 6143546Abstract: The present invention relates to an enzyme exhibiting aminopeptidase activity, a method for producing said enzyme, an enzyme preparation containing said enzyme exhibiting aminopeptidase activity, and use of said enzyme for various industrial purposes.Type: GrantFiled: June 29, 1999Date of Patent: November 7, 2000Assignee: Novo Nordisk A/SInventors: Markus Sakari Kauppinen, Joan Qi Si, Tina Spendler, Claus Dambmann, Torben Halkier, Peter Rahbek stergaard, Shamkant Anant Patkar, Kim Hansen
-
Patent number: 6140096Abstract: An enzyme having endo-1,3(4)-.beta.-glucanase activity is described which is encoded by the DNA sequence ATGTGGTCTCCCAAGGTTGCTGCTGCCGTCCTCGCCTTTGTTGGTGCTACCAACGCCT GGCAGCCCCCGACCTACAGCGGCTTCAACTTGGTCTGGACTGACACCTTCGCTGGCAACGGTGGCACTTCTCCT A ACCAGAACAACTGGAACATCATCACCGGAAACTTGAACGTCAACGCCGAGCAGGAGACCTACTCCTCCAGCAC C GCCAATGTTCAGCTCAGTGGTGGCAGCACCCTTCAGCTGGTCCCCTGGAGAGACAGCAGCAAGGGAACCAGCA C CTTTGGTGGCTGGACCTCCGGTCGTCTTGAGTCCAAGTACACATTCACTCCCGCGGCCGGCAAGGTCACCCGT CTT GAAGCCGCCATCCGCTTCGGCAGCAACGCTCAGGCCAACAAGCAGGGTATCTGGCCTGCTTTCTGGATGCTGGG T GACTCCCTCCGTCAACCGGGCGGCAGCTGGCCCAACTGTGGTGAGATCGACATCATGGAGACTGTCGACGGCC A GGCTACCGGCCACGGTACCCTTCACTGCGACGTCTACCCCGGCGGTATCTGCAACGAGGGTAACGGTATTGGA GG CCCTGTCAACATCGCCAACGTCAACGACTGGCACGCTTGGCGTGTTGAGATCGACCGCACTCCCAGCAGCTGGC A ATCCGAGACCCTCACCTGGTCCCTCGACGGCACCATCTACTTCCAGATCACTGGCTCTCGCATTGGCAACCAG GG CGTCTGGAACAACATTGCTCACAGCCCCCTCTTCTTCATTCTTAACGTTGCTGTCGGTGGCAACTGGCCTGGCA AC CCCAACAGCGCTACCCTCGATGGCTACGGAAGCATGATGGAGGTTGGCTACGTCGCTCAGTACTCTACCTAA (SEQ ID NO:3).Type: GrantFiled: June 17, 1998Date of Patent: October 31, 2000Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Markus Sakari Kauppinen, Stephan Christgau, Henrlk Dalb.o slashed.ge, Hans Sejr Olsen, Jens Breinholt
-
Patent number: 6080567Abstract: An enzyme exhibiting xylanase activity, which enzyme is immunologically reactive with antibody raised against a purified xylanase derived from Aspergillus aculeatus, CBS 101.43. The enzyme may be used for degrading plant cell wall components, e.g., in the preparation of feed, in baking, in the paper and pulp industry, and in connection with separation of wheat into starch and gluten.Type: GrantFiled: July 16, 1998Date of Patent: June 27, 2000Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Henrik Dalb.o slashed.ge, Lene Nonboe Andersen, Joan Qi Si, Tina Sejersg.ang.rd Jacobsen, Niels Munk, Anette Mullertz
-
Patent number: 6071735Abstract: The present invention relates to an isolated enzyme exhibiting cellulolytic (endoglucanase) activity at alkaline pH, an enzyme composition comprising the enzyme, a DNA construct encoding the enzyme, methods for producing the enzyme or enzyme composition, a detergent composition comprising the enzyme, and methods for using the enzyme in, e.g., providing localized variation in the color density of dyed fabric, improving the drainage of an aqueous suspension of paper pulp, and de-inking of recycled paper.Type: GrantFiled: October 22, 1997Date of Patent: June 6, 2000Assignee: Novo Nordisk A/SInventors: Martin Schulein, Karen Margrethe Oxenb.o slashed.ll, Lene Nonboe Andersen, S.o slashed.ren Flensted Lassen, Markus Sakari Kauppinen, Jack Bech Nielsen
-
Patent number: 6037161Abstract: The present invention provides an enzyme with acetyl esterase activity comprising the amino acid sequence IxFGDxYYT(SEQ ID NO: 1), in which x designates any amino acid residue. The enzyme exhibits activity towards acetylated xylan and acetylated mannan and may be used for modifying or degrading plant containing materials.Type: GrantFiled: November 3, 1998Date of Patent: March 14, 2000Assignee: Novo Nordisk A/SInventors: Stephan Christgau, Thomas Sandal, Markus Sakari Kauppinen, Torben Halkier, Henrik Dalb.o slashed.ge
-
Patent number: 6033900Abstract: Animal feed compositions and methods for treating one or more of soy, pea or rape-seed, or other material derived from Fabales or Cruciferaceae, with an enzyme having rhamnogalacturonase activity, wherein the enzyme having rhamnogalacturonase activity cleaves a rhamnogalacturonan backbone to produce rhamnose as a non-reducing end (RGase II) or cleaves a rhamnogalaturonan backbone to produce galacturonic acid as a non-reducing end.Type: GrantFiled: November 30, 1998Date of Patent: March 7, 2000Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Henrik Dalb.o slashed.ge, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Claus Christophersen, Per Munk Nielsen, Alphons Gerard Joseph Voragen, Hendrik Arie Schols
-
Patent number: 6022723Abstract: The present invention relates to an enzyme with .beta.-(1-6)-endoglucanase activity encoded by a DNA sequence, which DNA sequence a) comprises the DNA sequence shown in SEQ ID No. 3, or b) comprises an analogue of the DNA sequence shown in SEQ ID No. 3, which i) is homologous with the DNA sequences shown in or SEQ ID No. 3, and/or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 3, and/or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 3, and/or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against a purified .beta.-(1-6)-glucanase shown in SEQ ID No. 4 derived from Trichoderma harzianum, CBS 243.71.Type: GrantFiled: March 18, 1998Date of Patent: February 8, 2000Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Markus Sakari Kauppinen, Stephan Christgau, Henrik Dalb.o slashed.ge, Hans Sejr Olsen
-
Patent number: 6001639Abstract: The present invention relates to enzyme preparations consisting essentially of an enzyme which has cellulytic activity and comprises a first amino acid sequence consisting of 14 amino acid residues having the following sequenceThr Arg Xaa Xaa Asp Cys Cys Xaa Xaa (SEQ ID NO:79) 1 2 3 4 5 6 7 8 9 - Xaa Cys Xaa Trp Xaa 10 11 12 13 14and a second amino acid sequence consisting of 5 amino acid residues having the following sequenceTrp Cys Cys Xaa Cys (SEQ ID NO:80) 1 2 3 4 5wherein, in position 3 of the first sequence, the amino acid is Trp, Tyr or Phe; in position 4 of the first sequence, the amino acid is Trp, Tyr or Phe; in position 8 of the first sequence, the amino acid is Arg, Lys or His; in position 9, 10, 12 and 14, respectively, of the first sequence, and in position 4 of the second sequence, the amino acid is any of the 20 naturally occurring amino acid residues with the provisos that, in the first amino acid sequence, (i) when the amino residue in position 12 is Ser, then the amino acid residue in positType: GrantFiled: May 21, 1996Date of Patent: December 14, 1999Assignee: Novo Nordisk A/SInventors: Martin Schulein, Lene Nonboe Andersen, S.o slashed.ren Flensted Lassen, Markus Sakari Kauppinen, Lene Lange, Ruby Iium Nielsen, Michiko Ihara, Shinobu Takagi
-
Patent number: 5998190Abstract: An isolated and purified enzyme exhibiting protease activity at a pH of 4-7 which exhibits protease activity in 5% hydrogen peroxide and which is encoded by a DNA sequence which hybridizes to a DNA sequence depicted in SEQ ID NO. 1 or 2.Type: GrantFiled: November 12, 1998Date of Patent: December 7, 1999Assignee: Novo Nordisk A/SInventors: Henrik Dalb.o slashed.ge, Stephan Christgau, Lene Nonboe Andersen, Lene Venke Kofod, Markus Sakari Kauppinen, Jack Bech Nielsen, Claus Dambmann
-
Patent number: 5994113Abstract: The present invention relates to a enzyme exhibiting aminopeptidase activity, a method for producting said enzyme, and enzyme preparation containing said enzyme exhibithing aminopeptidase activity, and use of said enzyme for various industrial purposes.Type: GrantFiled: September 15, 1997Date of Patent: November 30, 1999Assignee: Novo Nordisk A/SInventors: Markus Sakari Kauppinen, Joan Qi Si, Tina Spendler, Claus Dambmann, Torben Halkier, Peter Rahbek stergaard, Shamkant Anant Patkar, Kim Hansen
-
Patent number: 5919691Abstract: DNA sequences are disclosed encoding an enzyme exhibiting endoglucanase activity. The endoglucanase is useful in a variety of industrial processes requiring an alkaline cellulase.Type: GrantFiled: March 20, 1997Date of Patent: July 6, 1999Assignee: Novo Nordisk A/SInventors: Martin Schulein, Karen Margrethe Oxenb.o slashed.ll, Lene Nonboe Andersen, S.o slashed.ren Flensted Lassen, Markus Sakari Kauppinen, Jack Bech Nielsen
-
Patent number: 5885819Abstract: An enzyme exhibiting xylanase activity, which enzyme is immunologically reactive with an antibody raised against a purified xylanase derived from Aspergillus aculeatus, CBS 101.43. The enzyme may be used for degrading plant cell wall components e.g. in the preparation of feed, in baking, in the paper and pulp industry and in connection with separation of wheat into starch and gluten.Type: GrantFiled: July 30, 1997Date of Patent: March 23, 1999Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Henrik Dalb.o slashed.ge, Lene Nonboe Andersen, Joan Qi Si, Tina Sejersg.ang.rd Jacobsen, Niels Munk, Anette Mullertz
-
Patent number: 5882911Abstract: The present invention relates to DNA sequences encoding a rhamnogalacturonase which comprises(a) the DNA sequence of nucleotides 64-1587 of SEQ ID NO:1;(b) a DNA sequence which hybridizes to the same probe as nucleotides 64-1587 of SEQ ID NO:1 under conditions of presoaking in 5.times.SSC and prehybridizing for 1 hour at -40.degree. C. in a solution of 5.times.SSC, 5.times.Denhardt's solution, 50 mM sodium phosphate, pH 6.8, and 50 mg of denatured sonicated calf thymus DNA, followed by hybridization in the same solution supplemented with 50 .mu.Ci 32-P-dCTP labelled probe for 18 h at -40.degree. C., followed by washing three times in 2.times.SSC, 0.2% SDS at 40.degree. C. for 30 minutes; or(c) a DNA sequence encoding an amino acid sequence having amino acids 20-527 of the sequence of SEQ ID NO;2.Type: GrantFiled: June 22, 1998Date of Patent: March 16, 1999Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Henrik Dalb.o slashed.ge, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Claus Christophersen, Per Munk Nielsen, Alphons Gerard Joseph Voragen, Hendrik Arie Schols
-
Patent number: 5871966Abstract: A partial amino acid sequence of an endo-.beta.-1,4-glucanase obtainable by means of Aspergillus aculeatus is described, and also corresponding recombinant DNA sequences, vectors and transformed hosts. Use of the endo-.beta.- 1,4-glucanase or a pectinase preparation enriched with the endo-.beta.-1,4-glucanase for degradation or modification of plant cell walls is described.Type: GrantFiled: November 8, 1996Date of Patent: February 16, 1999Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Markus Sakari Kauppinen, Stephan Christgau, Henrik Dalb.o slashed.ge, Hans Sejr Olsen, Jens Breinholt
-
Patent number: 5858760Abstract: The nucleic acid sequence encoding a pectin lyase from Aspergillus aculeatus, CBS 101.43 and the corresponding amino acid sequence are disclosed. The nucleic acid is used to transform a host cell which is utilized in a method to make the pectin lyase. The catalytic properties and stability characteristics of the enzyme are reported. The enzyme is useful for the degradation of plant cell wall components.Type: GrantFiled: July 2, 1997Date of Patent: January 12, 1999Assignee: Novo Nordisk A/SInventors: Henrik Dalb.o slashed.ge, Lene Venke Kofod, Markus Sakari Kauppinen, Lene Nonboe Andersen, Stephan Christgau, Hans Peter Heldt-Hansen
-
Patent number: 5854050Abstract: A DNA construct comprising a DNA sequence encoding an enzyme exhibiting protease activity, which DNA sequence comprises the DNA sequence shown in SEQ ID No. 1 or 2 or an analog of any of these sequences being at least 80% homologous to the DNA sequence shown in SEQ ID No. 1 or 2. The proteases encoded by the DNA sequences have an acid pH optimum.Type: GrantFiled: February 1, 1996Date of Patent: December 29, 1998Assignee: Novo Nordisk A/SInventors: Henrik Dalb.o slashed.ge, Stephan Christgau, Lene Nonboe Andersen, Lene Venke Kofod, Markus Sakari Kauppinen, Jack Bech Nielsen, Claus Dambmann
-
Patent number: 5830734Abstract: An isolated and purified acetyl esterase with activity towards acetylated xylan and acetylated mannan obtained from Aspergillus aculeatus and having amino acid sequence that comprises Seq ID No 1. An enzyme can be used for the modification of plant cell wall components.Type: GrantFiled: January 4, 1996Date of Patent: November 3, 1998Assignee: Novo Nordisk A/SInventors: Stephen Christgau, Thomas Sandal, Markus Sakari Kauppinen, Torben Halkier, Henrik Dalb.o slashed.ge
-
Patent number: 5817499Abstract: DNA encoding an endoglucanase from Trichoderma harzianum is disclosed. The endoglucanase has activity toward mixed .beta.-1,3-1,4 glucans and is especially useful in brewing processes.Type: GrantFiled: January 3, 1996Date of Patent: October 6, 1998Assignee: Novo Nordisk A/SInventors: Henrik Dalb.o slashed.ge, Stephan Christgau, Lene Nonboe Andersen, Lene Venke Kofod, Markus Sakari Kauppinen
-
Patent number: 5811291Abstract: An enzyme exhibiting rhamnogalacturonase activity, capable of cleaving a rhamnogalacturonan backbone in such a manner that galacturonic acids are left as the non-reducing ends, and which exhibits activity on hairy regions from a soy bean material and/or on saponified hairy regions from a sugar beet material. The enzyme has the amino acid sequence of SEQ ID NO:2 and is encoded by the DNA sequence of SEQ ID NO:1.Type: GrantFiled: September 25, 1995Date of Patent: September 22, 1998Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Henrik Dalb.o slashed.ge, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Claus Christophersen, Per Munk Nielsen, Alphons Gerar Joseph Voragen, Hendrik Arie Schols
-
Patent number: 5770406Abstract: The present invention relates to an enzyme with .beta.-(1-6)-endoglucanase activity encoded by a DNA sequence, which DNA sequence a) comprises the DNA sequence shown in SEQ ID No. 3, or b) comprises an analogue of the DNA sequence shown in SEQ ID No. 3, which i) is homologous with the DNA sequences shown in or SEQ ID No. 3, and/or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 3, and/or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 3, and/or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against a purified .beta.-(1-6)-glucanase shown in SEQ ID No. 4 derived from Trichoderma harzianum, CBS 243.71.Type: GrantFiled: November 8, 1996Date of Patent: June 23, 1998Inventors: Lene Venke Kofod, Lene Nonboe Andersen, Markus Sakari Kauppinen, Stephan Christgau, Henrik Dalb.o slashed.ge, Hans Sejr Olsen