Pacemaker ion channel proteins and uses thereof
The present invention provides an isolated nucleic acid molecule encoding a brain cyclic nucleotide gated ion channel (BCNG) protein. An isolated BCNG protein is also provided as is a composition comprising a BCNG encoding nucleic acid or protein or a portion thereof. The present invention also provides a method of identifying an ion channel subunit related protein encoding nucleic acid molecule in a sample. The invention further provides a method for evaluating the ability of a compound to modulate an ion channel associated neurological, cardia, or renal condition. The invention also provides a method for evaluating the ability of a compound to interact with a BCNG-related ion channel subunit protein. Additionally, the present invention provides a method for identifying a compound capable of modulating the activity of a BCNG-related protein. The present invention additionally provides a method of treating a cardiac, renal or neurological condition. Finally, the present invention provides an antibody which specifically reacts with BCNG protein.
Latest The Trustees of Columbia University in the City of New York Patents:
- Synthesis of novel disulfide linker based nucleotides as reversible terminators for DNA sequencing by synthesis
- Fusion proteins and methods thereof
- Methods of preventing cancer metastasis
- Synthesis of novel disulfide linker based nucleotides as reversible terminators for DNA sequencing by synthesis
- Serological assay for the detection of zika virus-specific antibodies utilizing overlapping peptides comprising an NS2B epitope
Throughout this application, various publications are referenced by author and date. Full citations for these publications may be found listed alphabetically at the end of the specification immediately preceding the Sequence Listing and the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art.
BACKGROUND OF THE INVENTIONIntroduction
Ion channels are a diverse group of proteins that regulate the flow of ions across cellular membranes. In the nervous system, ion channel activity has evolved into a rapid and accurate system for intercellular communication. The electrical excitability characteristics of each neuron is in part determined by the set of channels it expresses. However, cells are also able to regulate the activity of individual channels in response to physiological or developmental events, and there is growing evidence that ion channels can be the site of integration of multiple electrical and biochemical pathways.
In vivo, ion channels appear to be multimeric proteins that are comprised of several distinct gene families, coding for channels with distinct structural and functional properties. Within a gene family, the potential for heterogeneity arising from the combinatorial assembly of different pore-forming and auxiliary subunits (Green, et al., 1995). Channel properties can be modulated by second messenger cascades and can directly bind intracellular proteins such as kinases suggesting that this may be an important way to efficiently target the signaling cascade to its effector molecule. The electrical characteristics of each neuron is, in part, determined by the set of ion channels that it expresses. However, cells are also able to regulate the activity of individual channels in response to physiological or developmental events; pore-forming (α) subunits can interact with a variety of intracellular proteins, including auxiliary (β) subunits, cytoskeleton-associated proteins and protein kinases (Green, et al., 1995). In addition to auxiliary (β) subunits, pore-forming subunits can interact with a variety of intracellular proteins and second messenger molecules themselves including G-proteins, cytoskeleton-associated proteins and protein-kinases (Adelman, et al., 1995).
Several classes of ion channels bind directly, and are regulated by, second messenger molecules such as cyclic nucleotides (Zagotta, et al., 1996; Bruggemann, et al., 1993, and Hoshi, et al., 1995) or Ca+2 (Adelman, et al., 1992; Kohler, et al., 1996). Channels with this property may be key elements in the control of neuronal signaling, as they directly couple biochemical cascades with electrical activity. Cyclic nucleotide-gated channels (CNG) play a distinct role both in visual and olfactory signal transduction; their recent identification in the hippocampus and other regions of the brain, where cAMP and cGMP are known to mediate different forms of synaptic plasticity (Krapivinisky, et al., 1995; Frey, et al., 1993; Boshakov, et al., 1997; and Arancio, et al., 1995), suggests that CNG-channels may also contribute to the regulation of excitability in central neurons (Kingston, et al., 1996 and Bradley, et al., 1997).
The first structural gene for a K+ channel to be isolated was the gene encoded by the Shaker (Sh) locus in Drosophila melanogaster (Strong, et al., 1993; Papazian, et al., 1987). Its sequence is the prototype of a large and still expanding family of related genes (Kamb, et al., 1987; Warmke, et al., 1994). The properties of a number of well characterized K+ currents, that still await a molecular definition, predicts that other members of this family are yet to be identified (Atkinson, et al., 1991).
Although the initial members of the K+ channel superfamily were cloned by chromosomal localization of alleles responsible for functional defects (Sh, eag and slo from Drosophila; (Papazian, et al., 1987; Kamb, et al., 1987; Warmke, et al., 1991; Atkinson, et al., 1991) or following the purification of a relatively abundant protein such as the cGMP-channel from bovine retina (Liman, et al., 1994), the most widely used strategy for cloning new members of the K+ channel superfamily is by homology to these sequences. Unfortunately, this approach is not well suited for identifying more divergent sequences and potentially new branches in the phylogenetic tree of the K+ channel superfamily. Expression cloning in Xenopus oocytes can circumvent this problem; this implies a pre-existing or readily detectable physiological characterization of the channel.
SUMMARY OF THE INVENTIONThe present invention provides an isolated nucleic acid molecule having sequence encoding a brain cyclic nucleotide gated (BCNG) ion channel protein or a portion thereof. The present invention additionally provides an isolated BCNG protein. The present invention further provides a composition comprising a nucleic acid, having sequence encoding a BCNG protein or a portion thereof and a carrier. The present invention further additionally provides a composition comprising a BCNG protein or portion thereof and a carrier.
In addition, the present invention provides a method of identifying a nucleic acid encoding an ion channel subunit-related protein in a sample which comprises detecting in the sample a nucleic acid molecule encoding a BCNG-related protein, positive detection indicating the presence of an ion channel subunit related protein encoding nucleic acid molecule, thereby identifying a nucleic acid encoding an ion channel subunit-related protein in the sample.
The present invention also provides a method for evaluating the ability of a compound to modulate an ion channel associated with a condition in a subject which comprises: (a) contacting a cell which expresses a BCNG-related protein in a cell culture with a compound; (b) determining the amount of BCNG-related protein expression in the cell culture; and (c) comparing the amount of BCNG-related protein expression determined in step (b) with the amount determined in the absence of the compound so as to evaluate the ability of the compound to modulate the ion channel associated with the condition in the subject.
The present invention also provides a method for evaluating the ability of a compound to interact with a BCNG-related ion channel subunit protein which comprises: (a) contacting a cell which expresses a BCNG-related protein in a cell culture with a compound under conditions permissive to formation of a complex between the compound and the BCNG-related protein; (b) determining the amount of complex formed between the compound and the BCNG-related protein in the cell culture; and (c) comparing the amount of complex formed in step (b) with the amount formed in the absence of the compound so as to evaluate the ability of the compound to interact with a BCNG-related ion channel subunit protein.
Additionally, the present invention provides a method for identifying whether a compound is capable of modulating a dysfunction in an animal comprising: (a) administering the compound to the animal under conditions permissive to formation of a complex between the compound and the BCNG-related protein; (b) determining the amount of complex formed between the compound and the BCNG-related protein in the animal; and (c) comparing the amount of complex formed in step (b) with the amount of complex formed in the animal in the absence of the compound so as to identify whether the compound is capable of modulating the dysfunction in the animal, a change in the amount of complex formed in the presence of the compound indicating that the compound is capable of modulating dysfunction in the animal.
Further, the present invention provides a method of identifying a compound which modulates the activity of BCNG-related protein which comprises: (a) introducing the nucleic acid of claim 1 into an expression system and causing the expression system to express the nucleic acid under conditions whereby an ion channel subunit protein is produced; (b) contacting the channel subunit protein with the compound; (c) determining the activity of the ion channel subunit protein; and (d) comparing the activity determined in step (c) with the activity determined in the absence of the compound, an increase or decrease in activity in the presence of the compound indicating identification of a compound which modulates the activity of BCNG-related protein.
The present invention also provides a pharmaceutical composition which comprises a compound capable of modulating BCNG-related protein activity and a pharmaceutically acceptable carrier. According to an embodiment of this invention, the carrier is a diluent, an aerosol, a topical carrier, an aqueous solution, a nonaqueous solution or a solid carrier.
Finally, the present invention provides an antibody that specifically binds to BCNG protein.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 4. In situ hybridization analysis of BCNG-1 expression in the brain. Parasagittal section of a mouse brain probed with an antisense oligonucleotide directed to the mRNA region corresponding to amino acids 648-657 of the BCNG-1 sequence. Abbreviations: nCtx, neocortex; Hp, hippocampus; Crb, cerebellum; BrSt, brainstem.
FIGS. 5A-5F: Immunohistochemical analysis of BCNG-1 expression in the brain. Parasagittal sections of a mouse brain were stained with αq1 and αq2 antisera. The patterns of BCNG-1 expression detected with the two different antisera were identical, and in both cases the staining was entirely abolished by preadsorbing the sera with the GST-d5 fusion protein. BCNG-1 immunoreactivity in the cerebral cortex. (
(
The present invention provides an isolated nucleic acid molecule having sequence encoding a BCNG ion channel protein or a portion thereof. In one embodiment of the present invention, the nucleic acid molecule is mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2. In an embodiment of the present invention, the nucleic acid molecule is DNA. In another embodiment of the invention, the nucleic acid molecule is RNA. In yet another embodiment of the present invention, the DNA is cDNA. In one embodiment of this invention, the cDNA has substantially the same coding sequence as the coding sequence shown in SEQ. ID. No.: 1, SEQ. ID. No.: 3, SEQ. ID. No.: 5, SEQ. ID. No.: 7, SEQ. ID. No.: 9, or SEQ. ID. No.:11. In still another embodiment the present invention is a vector comprising the nucleic acid. In one embodiment of this invention, the vector is a virus. In another embodiment of this invention, the vector is a plasmid. Another embodiment of this invention is a host vector system for the production of a mammalian BCNG molecule which comprises the vector in a suitable host. In an embodiment of this invention, the suitable host is a bacterial cell, a eukaryotic cell, a mammalian cell or an insect cell. Another embodiment of the present invention is a nucleic acid molecule capable of specifically hybridizing with the nucleic acid molecule encoding BCNG-related protein. Still another embodiment of the present invention is an isolated BCNG protein. In an embodiment of this invention, the BCNG protein is mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2. In another embodiment of this invention, the protein has substantially the same amino acid sequence as the amino acid sequence shown in SEQUENCE ID NO.: 2, SEQ. ID. No.: 4, SEQ. ID. No.: 6, SEQ. ID. No.: 8, SEQ. ID. No.: 10, or SEQ. ID. No.: 12. Still another embodiment of the present invention is a composition comprising a nucleic acid, having sequence encoding a BCNG protein or a portion thereof and a carrier. In an embodiment of this invention, the nucleic acid comprises substantially the same coding sequence as the coding sequence shown in SEQ. ID. No.: 1, SEQ. ID. No.: 3, SEQ. ID. No.: 5, SEQ. ID. No.: 7, SEQ. ID. No.: 9, SEQ. ID. No.:11 or portion thereof. Yet another embodiment of the present invention is a composition comprising a BCNG protein or portion thereof and a carrier. In one embodiment of this invention, the BCNG protein comprises substantially the same amino acid sequence as the amino acid sequence shown in SEQ. ID. No.: 2, SEQ. ID. No.: 4, SEQ. ID. No.: 6, SEQ. ID. No.: 8, SEQ. ID. No.: 10, SEQ. ID. No.:12 or a portion thereof.
In addition, the present invention provides a method of identifying a nucleic acid encoding an ion channel subunit-related protein in a sample which comprises detecting in the sample a nucleic acid molecule encoding a BCNG-related protein, positive detection indicating the presence of an ion channel subunit related protein encoding nucleic acid molecule, thereby identifying a nucleic acid encoding an ion channel subunit-related protein in the sample.
In an embodiment of the present invention, the nucleic acid molecule encoding the ion channel subunit related protein is detected by size fractionation. In an embodiment of this invention, the size fractionation is effected by a polyacrylamide or an agarose gel. In an embodiment of this invention, the detection of the nucleic acid molecule encoding the BCNG-related protein comprises contacting the sample with a second nucleic acid molecule capable of hybridizing with the nucleic acid molecule encoding the BCNG-related protein, wherein the second nucleic acid molecule is labeled with a detectable marker under conditions permitting the second nucleic acid molecule to hybridize with the nucleic acid molecule encoding the BCNG-related protein, thereby identifying the nucleic acid molecule in the sample. In one embodiment of this invention, the second nucleic acid molecule is capable of hybridizing to mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2. In one embodiment of the invention, the detectable marker is a radiolabeled molecule, a fluorescent molecule, an enzyme, a ligand, or a magnetic bead. In an embodiment of this invention, the detection of the nucleic acid molecule encoding the BCNG-related protein comprises amplifying the nucleic acid molecule encoding the BCNG-related protein, thereby identifying the nucleic acid molecule encoding the BCNG-related protein in the sample. In one embodiment of the invention, the amplification of the nucleic acid molecule encoding the BCNG-related protein comprises contacting the nucleic acid molecule from the sample with at least one primer capable of hybridizing to mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2 under conditions suitable for polymerase chain reaction. In an embodiment of this invention, the amplified nucleic acid molecule encoding the BCNG-related protein is detected by size fractionation. In an embodiment of this invention, the size fractionation is via a polyacrylamide gel or an agarose gel.
The present invention also provides a method for evaluating the ability of a compound to modulate an ion channel associated with a condition in a subject which comprises: (a) contacting a cell which expresses a BCNG-related protein in a cell culture with a compound; (b) determining the amount of BCNG-related protein expression in the cell culture; and (c) comparing the amount of BCNG-related protein expression determined in step (b) with the amount determined in the absence of the compound so as to evaluate the ability of the compound to modulate the ion channel associated with the condition in the subject.
In an embodiment of this invention, the condition is a neurological condition, cardiovascular condition, renal condition, pulmonary condition, or hepatic condition. In one embodiment of this invention, the condition is epilepsy, Alzheimer's Disease, Parkinson's Disease, long QT syndrome, sick sinus syndrome, age-related memory loss, cystic fibrosis, sudden death syndrome or a pacemaker rhythm dysfunction. According to an embodiment of this invention, the BCNG-related protein comprises mBCNG-1, mBCNG-2, MBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2 or a portion thereof. In an embodiment of this invention, the cell is a cardiac cell, a kidney cell, a hepatic cell, an airway epithelial cell, a muscle cell, a neuronal cell, a glial cell, a microglial cell, an endothelial cell, a mononuclear cell, a tumor cell, a mammalian cell, an insect cell, or a Xenopus oocyte. According to an embodiment of this invention, the compound is a peptide, a peptidomimetic, a nucleic acid, a polymer, or a small molecule. In one embodiment of this invention, the compound is bound to a solid support.
The present invention also provides a method for evaluating the ability of a compound to interact with a BCNG-related ion channel subunit protein which comprises: (a) contacting a cell which expresses a BCNG-related protein in a cell culture with a compound under conditions permissive to formation of a complex between the compound and the BCNG-related protein; (b) determining the amount of complex formed between the compound and the BCNG-related protein in the cell culture; and (c) comparing the amount of complex formed in step (b) with the amount formed in the absence of the compound so as to evaluate the ability of the compound to interact with a BCNG-related ion channel subunit protein. According to one embodiment of this invention, the BCNG-related protein comprises mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2 or a portion thereof. In an embodiment of the present invention, the cell is a cardiac cell, a kidney cell, a hepatic cell, an airway epithelial cell, a muscle cell, a neuronal cell, a glial cell, a microglial cell, an endothelial cell, a mononuclear cell, a tumor cell, a mammalian cell, an insect cell, or a Xenopus oocyte. Further, in an embodiment of this invention, the compound is a peptide, a peptidomimetic, a nucleic acid, a polymer, or a small molecule. In still a further embodiment of the present invention, the compound is bound to a solid support.
Additionally, the present invention provides a method for identifying whether a compound is capable of modulating a dysfunction in an animal comprising: (a) administering the compound to the animal under conditions permissive to formation of a complex between the compound and the BCNG-related protein; (b) determining the amount of complex formed between the compound and the BCNG-related protein in the animal; and (c) comparing the amount of complex formed in step (b) with the amount of complex formed in the animal in the absence of the compound so as to identify whether the compound is capable of modulating the dysfunction in the animal, a change in the amount of complex formed in the presence of the compound indicating that the compound is capable of modulating dysfunction in the animal. In one embodiment of this invention is a the condition is a neurological condition, cardiovascular condition, renal condition, pulmonary condition, or hepatic condition. In yet another embodiment, the condition is epilepsy, Alzheimer's Disease, Parkinson's Disease, long QT syndrome, sick sinus syndrome, age-related memory loss, cystic fibrosis, sudden death syndrome or a pacemaker rhythm dysfunction.
Further, the present invention provides a method of identifying a compound which modulates the activity of BCNG-related protein which comprises: (a) introducing the nucleic acid of claim 1 into an expression system and causing the expression system to express the nucleic acid under conditions whereby an ion channel subunit protein is produced; (b) contacting the channel subunit protein with the compound; (c) determining the activity of the ion channel subunit protein; and (d) comparing the activity determined in step (c) with the activity determined in the absence of the compound, an increase or decrease in activity in the presence of the compound indicating identification of a compound which modulates the activity of BCNG-related protein.
In one embodiment of this invention, the active determination step (c) comprises measuring the channel electrical current or intracellular calcium level in the presence of the compound. In another embodiment, the detection is by a florescence-activated cell sorter (FACS) or by a video imaging system. In another embodiment of this invention, the detection is in a high throughput screening system. In another embodiment of this invention, the expression system comprises a cultured host cell. In another embodiment, the host cell is a cardiac cell, a kidney cell, a hepatic cell, an airway epithelial cell, a muscle cell, a neuronal cell, a glial cell, a microglial cell, an endothelial cell, a mononuclear cell, a tumor cell, a mammalian cell, an insect cell, or a Xenopus oocyte.
The present invention also provides a pharmaceutical composition which comprises a compound capable of modulating BCNG-related protein activity and a pharmaceutically acceptable carrier. According to an embodiment of this invention, the carrier is a diluent, an aerosol, a topical carrier, an aqueous solution, a nonaqueous solution or a solid carrier.
One embodiment of this invention is a method for treating a condition in a subject which comprises administering to the subject an amount of the pharmaceutical composition effective to treat the condition in the subject. In an embodiment of this invention, the condition is a neurological condition, renal condition, pulmonary condition, hepatic condition, or cardiovascular condition. In an embodiment of this invention, the condition is epilepsy, Alzheimer's Disease, Parkinson's Disease, long QT syndrome, sick sinus syndrome, age-related memory loss, cystic fibrosis, sudden death syndrome or a pacemaker rhythm dysfunction. In still another embodiment of this invention, the subject is a human.
The present invention further provides a method of treating a condition in a subject which comprises administering to the subject an effective amount of a compound which modulates the activity of BCNG-related protein, so as to treat the condition. In an embodiment of this invention, the condition is a neurological condition, cardiovascular condition, renal condition, pulmonary condition, or hepatic condition. In another embodiment of this invention, the condition is epilepsy, Alzheimer's Disease, Parkinson's Disease, long QT syndrome, sick sinus syndrome, age-related memory loss, cystic fibrosis, sudden death syndrome or a pacemaker rhythm dysfunction.
Finally, the present invention provides an antibody that specifically binds to BCNG protein. One embodiment of this invention is a cell line producing the antibody specific for BCNG-related protein. Another embodiment of the present invention is a method of identifying the protein of claim 11 in a sample comprising: a) contacting the sample with the antibody of claim 56 under conditions permissive to the formation of a complex between the antibody and the protein; b) determining the amount of complex formed; and c) comparing the amount of complex formed in step (b) with the amount of complex formed in the absence of the antibody, the presence of an increased amount of complex formed in the presence of the antibody indicating identification of the protein in the sample.
The degree of hybridization depends on the degree of complementarity, the length of the nucleic acid molecules being hybridized, and the stringency of the conditions in a reaction mixture. Stringency conditions are affected by a variety of factors including, but not limited to temperature, salt concentration, concentration of the nucleic acids, length of the nucleic acids, sequence of the nucleic acids and viscosity of the reaction mixture. More stringent conditions require greater complementarity between the nucleic acids in order to achieve effective hybridization.
A preferred method of hybridization is blot hybridization. See Sambrook et al. 1989 Molecular Cloning: A Laboratory Manual 2nd Ed. for additional details regarding blot hybridization.
The second nucleic acid molecule specifically hybridizes to a particular sequence which is bound nonspecifically to the solid matrix. The second nucleic acid molecule can be DNA or RNA and can be labeled with a detectable marker. Such labeling techniques methods include, but are not limited to, radio-labeling, digoxygenin-labeling, and biotin-labeling.
A well-known method of labeling DNA is 32P using DNA polymerase, Klenow enzyme or polynucleotide kinase. In addition, there are known non-radioactive techniques for signal amplification including methods for attaching chemical moieties to pyrimidine and purine rings (Dale, R. N. K. et al., 1973 Proc. Natl. Acad. Sci. USA 70:2238-42), methods which allow detection by chemiluminescence (Barton, S. K. et al., 1992 J. Am. Chem. Soc. 114:8736-40) and methods utilizing biotinylated nucleic acid probes (Johnson, T. K. et al., 1983 Anal. Biochem. 133:125-131; Erickson, P. F. et al., 1982 J. Immunol. Methods 51:241-49; Matthaei, F. S. et al., 1986 Anal. Biochem. 157-123-28) and methods which allow detection by fluorescence using commercially available products. Non-radioactive labelling kits are also commercially available.
Nucleic acid amplification is described in Mullis, U.S. Pat. No. 4,683,202, which is incorporated herein by reference.
In a polymerase chain reaction (PCR), an amplification reaction uses a template nucleic acid contained in a sample can use one or more primer sequences and inducing agents.
Suitable enzymes to effect amplification, specifically extension include, for example, E. coli DNA polymerase I, thermostable Taq DNA polymerase, Klenow fragment of E. coli DNA polymerase I, T4 DNA polymerase, other available DNA polymerases, reverse transcriptase and other enzymes which will facilitate covalent linkage of the nucleotides to polynucleotides which are form amplification products. The oligonucleotide primers can be synthesized by automated instruments sold by a variety of manufacturers or can be commercially prepared.
Solid matrices are available to the skilled artisan. A solid matrix may include polystyrene, polyethylene, polypropylene, polycarbonate, or any solid plastic material in the shape of test tubes, beads, microparticles, dipsticks, plates or the like. Additionally matrices include, but are not limited to membranes, 96-well microtiter plates, test tubes and Eppendorf tubes. Solid phases also include glass beads, glass test tubes and any other appropriate shape made of glass. A functionalized solid phase such as plastic or glass which has been modified so that the surface carries carboxyl, amino, hydrazide, or aldehyde groups can also be used. In general such matrices comprise any surface wherein a ligand-binding agent can be attached or a surface which itself provides a ligand attachment site.
In the practice of any of the methods of the invention or in the preparation of any of the pharmaceutical compositions of the present invention a “therapeutically effective amount” is an amount which is capable of modulating the activity or function of a BCNG-related protein. Accordingly, the effective amount will vary with the subject being treated, as well as the condition to be treated. The methods of administration may include, but are not limited to, administration cutaneously, subcutaneously, intravenously, parenterally, orally, topically, or by aerosol.
As used herein, the term “suitable pharmaceutically acceptable carrier” encompasses any of the standard pharmaceutically accepted carriers, such as phosphate buffered saline solution, water, emulsions such as an oil/water emulsion or a triglyceride emulsion, various types of wetting agents, tablets, coated tablets and capsules. An example of an acceptable triglyceride emulsion useful in intravenous and intraperitoneal administration of the compounds is the triglyceride emulsion commercially known as Intralipid®.
Typically such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid, talc, vegetable fats or oils, gums, glycols, or other known excipients. Such carriers may also include flavor and color additives or other ingredients.
This invention also provides for pharmaceutical compositions capable of inhibiting neurotoxicity together with suitable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers. Such compositions are liquids or lyophilized or otherwise dried formulations and include diluents of various buffer content (e.g., Tris-HCl., acetate, phosphate), pH and ionic strength, additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), solubilizing agents (e.g., glycerol, polyethylene glycerol), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), bulking substances or tonicity modifiers (e.g., lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to the compound, complexation with metal ions, or incorporation of the compound into or onto particulate preparations of polymeric compounds such as polylactic acid, polglycolic acid, hydrogels, etc, or onto liposomes, micro emulsions, micelles, unilamellar or multi lamellar vesicles, erythrocyte ghosts, or spheroplasts. Such compositions will influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance of the compound or composition.
Controlled or sustained release compositions include formulation in lipophilic depots (e.g., fatty acids, waxes, oils). Also comprehended by the invention are particulate compositions coated with polymers (e.g., poloxamers or poloxamines) and the compound coupled to antibodies directed against tissue-specific receptors, ligands or antigens or coupled to ligands of tissue-specific receptors. Other embodiments of the compositions of the invention incorporate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral.
When administered, compounds are often cleared rapidly from the circulation and may therefore elicit relatively short-lived pharmacological activity. Consequently, frequent injections of relatively large doses of bioactive compounds may by required to sustain therapeutic efficacy. Compounds modified by the covalent attachment of water-soluble polymers such as polyethylene glycol, copolymers of polyethylene glycol and polypropylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidone or polyproline are known to exhibit substantially longer half-lives in blood following intravenous injection than do the corresponding unmodified compounds (Abuchowski et al., 1981; Newmark et al., 1982; and Katre et al., 1987). Such modifications may also increase the compound's solubility in aqueous solution, eliminate aggregation, enhance the physical and chemical stability of the compound, and greatly reduce the immunogenicity and reactivity of the compound. As a result, the desired in vivo biological activity may be achieved by the administration of such polymer-compound adducts less frequently or in lower doses than with the unmodified compound.
Attachment of polyethylene glycol (PEG) to compounds is particularly useful because PEG has very low toxicity in mammals (Carpenter et al., 1971). For example, a PEG adduct of adenosine deaminase was approved in the United States for use in humans for the treatment of severe combined immunodeficiency syndrome. A second advantage afforded by the conjugation of PEG is that of effectively reducing the immunogenicity and antigenicity of heterologous compounds. For example, a PEG adduct of a human protein might be useful for the treatment of disease in other mammalian species without the risk of triggering a severe immune response. The carrier includes a microencapsulation device so as to reduce or prevent an host immune response against the compound or against cells which may produce the compound. The compound of the present invention may also be delivered microencapsulated in a membrane, such as a liposome.
Polymers such as PEG may be conveniently attached to one or more reactive amino acid residues in a protein such as the alpha-amino group of the amino terminal amino acid, the epsilon amino groups of lysine side chains, the sulfhydryl groups of cysteine side chains, the carboxyl groups of aspartyl and glutamyl side chains, the alpha-carboxyl group of the carboxy-terminal amino acid, tyrosine side chains, or to activated derivatives of glycosyl chains attached to certain asparagine, serine or threonine residues.
Numerous activated forms of PEG suitable for direct reaction with proteins have been described. Useful PEG reagents for reaction with protein amino groups include active esters of carboxylic acid or carbonate derivatives, particularly those in which the leaving groups are N-hydroxysuccinimide, p-nitrophenol, imidazole or 1-hydroxy-2-nitrobenzene-4-sulfonate. PEG derivatives containing maleimido or haloacetyl groups are useful reagents for the modification of protein free sulfhydryl groups. Likewise, PEG reagents containing amino hydrazine or hydrazide groups are useful for reaction with aldehydes generated by periodate oxidation of carbohydrate groups in proteins.
This invention is illustrated in the Experimental Details section which follows. These sections are set forth to aid in an understanding of the invention but are not intended to, and should not be construed to, limit in any way the invention as set forth in the claims which follow thereafter.
EXPERIMENTAL DETAILS Example 1 Interactive Cloning with the SH3 Domain of N-Src Identifies a New Brain-Specific Ion Channel Protein, with Homology to Cyclic Nucleotide-Gated ChannelsBy screening for molecules that interact with the neuronal form of Src tyrosine kinase a novel cDNA was isolated that appears to represent a new class of ion channels. The encoded polypeptide, mBCNG-1, is distantly related to proteins in the family of the cyclic nucleotide-gated channels and the voltage-gated channels, Eag and H-erg. mBCNG-1 is expressed exclusively in the brain as a glycosylated protein of approximately 132 kD. Immunohistochemical analysis indicates that mBCNG-1 is preferentially expressed in specific subsets of neurons in the neocortex, hippocampus and cerebellum, in particular pyramidal neurons and basket cells. Within individual neurons, the BCNG-1 protein is localized to either the dendrites or the axon terminals depending on the cell type.
Southern blot analysis shows that several other BCNG-related sequences are present in the mouse genome, indicating the emergence of an entirely new subfamily of ion channel coding genes. These findings suggest the existence of a novel class of ion channel, which is potentially able to modulate membrane excitability in the brain and which may respond to regulation by cyclic nucleotides.
Defining signal transduction pathways that contribute to the control of synaptic strength in the brain is an important and long-sought goal. In an effort to identify the biochemical targets of Src-family tyrosine kinases in the central nervous system, the yeast two-hybrid system was used to clone proteins that could interact with the SH3 domain of the neural specific form of Src kinase (Brugge, et al., 1985; Martinez, et al., 1987). As a result of this screening a new protein, BCNG-1 (Brain Cyclic Nucleotide Gated-1) was identified and isolated.
BCNG-1 has been identified and characterized as an ion channel protein and exhibits sequence homology to voltage-gated potassium channels, CNG channels, and plant inward rectifers. Southern blot analysis suggests that this is the first member of a new family of proteins. BCNG-1 is expressed exclusively in the brain and is preferentially localized to the processes of subsets of neurons in the neocortex, cerebellar cortex and hippocampus. The specific localization pattern of BCNG-1 and the potential for a direct interaction with cyclic nucleotides suggest that it may represent a new brain-specific ion channel protein that is an important component in the expression of intercellular and intracellular signaling.
Results
Isolation of BCNG-1. BCNG-1, a novel cDNA with homology to CNG-related and Eag-related ion channels was initially isolated and identified by interactive cloning with the N-src SH3 domain in a yeast two-hybrid screen. The src gene expresses an alternatively spliced form (N-src or pp60src-c(*), which is specific for neuronal cells and has an increased kinase activity (Brugge, et al., 1985). The N-src protein differs from the non-neuronal form (c-src or pp60src-c) by an insertion of six amino acids in the region corresponding to the Src homology 3 (SH3) domain of the protein (Martinez et al. 1987). SH3 domains are considered modules for protein-protein interaction (Pawson, et al., 1995). Therefore the yeast two-hybrid screen (Fields, et al., 1989; Zervos, et al., 1993) was used to identify brain specific proteins that would selectively interact with the N-src SH3 domain.
The screening of 5×105 independent clones with the N-src SH3 bait resulted in the isolation of a single positively reacting fusion product (pJG-d5). This clone encoded a protein that showed a strong interaction with the N-src SH3 domain, but no significant interaction with the c-src, fyn, or abl SH3 domains, indicating a specific recognition of the N-src SH3 domain in the yeast two-hybrid system. The sequence analysis of pJG-d5 indicated that it encodes the C-terminal portion of a larger protein. Overlapping cDNA clones were therefore isolated from a λgt10 library and an open reading frame (ORF) was identified that encodes a 910 amino acid polypeptide with a predicted molecular weight of 104 kDa (
The N-terminal part of the predicted protein contains an hydrophobic core comprising seven hydrophobic domains (
Among all the known K+ channel superfamily genes, the core region of BCNG-1 displays the highest similarity (22%) to the corresponding region in the mouse Eag protein, whereas the similarity to cyclic nucleotide-gated channels is only 17% in this region (distances were determined by the MegAlign program of DNASTAR). The S4 domain of BCNG-1 has a total of eight positively charged residues (two groups of four, separated by a serine), which again makes it more similar to voltage activated K+ channels (Sh and eag families) than to cyclic nucleotide-gated channels.
The putative pore forming region of the BCNG-1 protein (
BCNG-1 is a 132 kDa Glycoprotein. To characterize the protein encoded by the BCNG-1 cDNA, antibodies were generated against two separate domains in the predicted cytoplasmic tail: amino acids 594-720 (fusion protein GST-q1; antiserum αq1) and amino acids 777-910 (fusion protein GST-q2; antiserum αq2). Both antisera specifically immunoprecipitated the in vitro translation product of the cloned BCNG-1 sequence.
In Western blots of mouse brain extracts, both the αq1 and αq2 antisera recognized a diffuse band with an apparent molecular mass of 132 kDa (
Sequence analysis indicates that three N-glycosylation consensus sites are present in the BCNG-1 protein. Among these, Asn 327 is predicted to lie between transmembrane domain S5 and the pore (P) on the extracellular side of the plasma membrane (
BCNG-1 is expressed in neurons. Northern blot analysis revealed the presence of multiple BCNG-1 transcripts in poly(A)+ RNA from the brain, the most abundant species being 3.4, 4.4, 5.8 and 8.2 kb long (
The cellular localization of BCNG-1 within the brain was examined by in situ hybridization (
In the cerebral cortex, in situ hybridization shows a strong expression of the BCNG-1 mRNA layer V pyramidal neuron cell bodies that are distributed in a continuous line along the neocortex (
A similar expression pattern can be recognized in the hippocampus. Here, the in situ hybridization shows a strong BCNG-1 mRNA expression in the pyramidal cell body layer of areas CA1 and CA3 (
The immunostaining in the cerebellum also shows a pattern characteristic of basket cell expression. In the cerebellar cortex, basket cell nerve endings branch and contact the initial segment of the Purkinje cell axon in a distinct structure known as “pinceau” (Palay, et al., 1974). As shown in
BCNG-1 defines a new subfamily of K+ channel genes. Most of the ion channel sequences characterized so far are members of evolutionarily related multigene families. To investigate whether more sequences related to BCNG-1 exist, mouse genomic DNA Southern blots were analyzed under various stringency conditions (
The probe (B1-T) was designed in the hydrophobic core region of BCNG-1, including transmembrane domains S5, P and S6; the repeat region in the C-terminal portion of the protein was excluded. Reducing the stringency of the hybridization conditions from 8° C. below the melting temperature of the B1-T probe (
Discussion
Voltage-gated potassium (VGK) channels constitute a large and still expanding superfamily of related genes (Strong, et al., 1993; Warmke and Gonetzky, 1994). The most widely used strategy for cloning new genes in the VGK family has been by homology to a small number of initial members (Sh, eag, and slo from Drosophila (Papazian, et al., 1987; Kamb, et al., 1987; Warmke, et al., 1991; Atkinson, et al., 1991); cGMP-channel from bovine retina (Kaupp, et al., 1989). Unfortunately, this approach is not well suited for identifying more divergent sequences. Expression cloning in Xenopus ocytes can circumvent this problem, however, this implies a pre-existing or readily detectable physiological characterization of the channel.
An alternative cloning strategy that requires no a priori knowledge of the structure or activity of the target protein is to screen for K+ channels by means of protein-protein interactions. Using the SH3 domain of N-src as a bait, a protein, mBCNG-1, was obtained that appears to constitute a new branch of the K+ channel superfamily. mBCNG-1 displays the motifs of a voltage-gated K+ channel (six transmembrane spanning domains, a highly basic S4, and a P region) (Strong, et al., 1993, Warmke, et al., 1994 and
The fusion between an ancestral K+ channel and an ancestral cyclic nucleotide binding site is likely to have occurred prior to the evolutionary separation between plants and animals (Warmke, et al., 1994). Divergence from this common ancestor would have led on one hand to Eag-related channels and plant inward rectifiers (which maintained more of the features of voltage activated K+ channels, while showing a progressive deviation from the original CNBs sequence) and on the other hand to CNG-channels (which show a higher evolutionary constraint on the cyclic nucleotide binding site, while they have lost voltage activation and K+ selectivity). The features of BCNG-1 suggest that it may have remained closer to the ancestral molecule that represents the evolutionary link between voltage-gated K+ channels and cyclic nucleotide-gated channels.
The emerging pattern for olfactory and retinal CNG-channels and the non-consensus sequence of the putative pore forming region of BCNG-1 suggests that the lack of detectable electric current following BCNG-1 expression in xenopus oocytes is due to BCNG-1 representing a β subunit of a heteromultimeric channel (Chen, et al., 1993; Liman, et al., 1994; Bradley, et al., 1994). Indeed the data show the existence of a number of BCNG-related sequences in the mouse genome, and one or more of these genes could encode additional subunits required for the formation of an active channel.
BCNG-1 protein is expressed only in the brain and in particular in two of the principal classes of neurons within the cerebral, hippocampal and cerebellar cortexes: pyramidal neurons and basket cells. This distribution would be consistent with an in vivo interaction of BCNG-1 with N-src, which is also expressed in cerebral and hippocampal pyramidal neurons (Sugrue, et al., 1990). The observed interaction between BCNG-1 and the N-src SH3 domain is intriguing as is its physiological relevance and the role of the proline-rich region. The possibility that other factors may target the proline-rich region of BCNG-1 has also to be considered, particularly in view of the recently discovered WW domains (Sudol, et al., 1996; Staub, et al., 1996).
The varied subcellular localization of BCNG-1 (dendritic in pyramidal cells and axonal in basket cells) suggests that BCNG-1 could play different roles in different populations of neurons, perhaps by regulating presynaptic or postsynaptic membrane excitability depending on the cell type. A similar distribution has been demonstrated for the K+ channel subunit Kv 1.2 (Sheng, et al., 1994; Wang, et al., 1994). Kv 1.2 forms heteromultimeric K+ channels with several other Shaker type subunits, which have an overlapping yet differential pattern of expression, giving rise to a range of conductances with diversified functional characteristics.
The presence of BCNG-1 in the dendrites of hippocampal pyramidal cells is particularly intriguing; cAMP has been shown to be important for the establishment of some forms of long-term synaptic potentiation in these cells (Frey, et al., 1993, Bolshakov, et al., 1997; Thomas, et al., 1996). The structural features of BCNG-1 predict a K+ conducting activity, directly modulated by cyclic nucleotide binding. Interestingly, a current with similar characteristics has been described in the hippocampal pyramidal neurons of area CA1 (Pedarzani, et al., 1995), where BCNG-1 is highly expressed. This current (IQ) is believed to contribute to the noradrenergic modulation of hippocampal activity, by regulating neuronal excitability in response to cAMP levels. BCNG-1 could participate in the formation of the channels responsible for this type of current.
Experimental Procedures
Yeast two hybrid interaction cloning of mBCNG-1. The two-hybrid screen was performed following published procedures (Zervos, et al., 1993); the reagents used included plasmids pEG202, pJG4-5, pJK103 and Saccharomyces cerevisiae strain EGY48 (MA Ta trp1 ura3 his3 LEU2:pLexAop6-LEU2).
The bait was created by subcloning the SH3 domain of N-src in plasmid pEG202, and contains amino acids 83-147 from the mouse N-src sequence (Martinez, et al., 1987). The cDNA fusion library was constructed in plasmid pJG4-5, using poly(A)+ RNA from the whole brain of an adult C57BL/6 male mouse; the cDNA was synthesized using random hexamers and the GIBCO-BRL SuperScript II synthesis kit, according to the manufacturer's instructions. Only the library constructed from the two fractions with an average cDNA size of >1.5 kb (total of 1×106 independent clones) was used in the two hybrid screen. Library amplification was done in 0.3% SeaPrep agarose (FMC) to avoid changes in complexity.
For library screening, Saccharomyces cerevisiae strain EGY48 was first cotransformed with the bait plasmid pEG202-Nsrc and the reporter plasmid pJK103. The resulting strain was maintained under selection for the HIS3 and URA3 markers, and subsequently transformed with the mouse brain cDNA library in plasmid pJG4-5. This description though is more accurate and should be substituted for the transformation mix was grown for two days in a Ura− His− Trp−-glucose medium containing 0.3% SeaPrep agarose (FMC); the cells were then harvested and plated on Ura− His− Trp− Leu−-galactose. Leu+ colonies were screened for β-galactosidase activity using a filter lift assay (Breede and Nasmith, 1985). Positively reacting fusion products were isolated and tested for specificity following retransformation into an independent yeast strain. Fusion product pJGd5 corresponds to the C-terminal part of mBCNG-1 (amino acids 404-910; see
Full length cloning of mBCNG-1. For the isolation of the 5′ end region of the mBCNG-1 cDNA, two rounds of PCR were performed on the pJG4-5 library, using nested oligonucleotides derived from the pJG-d5 sequence. The downstream primer in the first round was: 5′-AGAGGCATAGTAGCCACCAGTTTCC-3 (Seq. ID. No.: 13)(d5.RL, corresponding to amino acids 456-463 of the mBCNG-1 sequence; see
PCR cycling was performed as follows: 1×(2 minutes, 94° C.); 25× (45 seconds, 94° C.; 30 seconds, 58° C.; 3 minutes, 72° C.); 1×(10 minutes, 72° C.).
The longest amplification product obtained from this series of reactions was a 700 bp DNA fragment, which contained amino acids 204-430 from the mBCNG-1 sequence (See
Positively reacting clones were further screened by PCR, using oligonucleotide d5.RL (Seq. ID. No.: 13) as a downstream primer. The upstream primer was either of the two following vector oligonucleotides: 5 GAGCAAGTTCAGCCTGGTTAAGTCC-3 (Seq. ID. No.: 17) (15′.N2), located 5′ to the EcoRI site in the λgt10 sequence, or 5′-GTGGCTTATGAGTATTTCTTCCAGGG-3 (Seq. ID. No.: 18) (13′.N2), located 3′ to the EcoRI site. PCR cycling was performed as described above.
The resulting products were subcloned and sequenced. The longest extension contained amino acids 1-463 of the mBCNG-1 sequence (See
In vitro transcription (MESSAGE MACHINE, Ambion, Austin, Tex.) and translation in vitro Express, Stratagene.
Northern/Southern Blot Hybridization
PCR-generated cDNA fragments corresponding to the indicated amino acids 6-131 (λgt10-derived) 5′ sequence) and 594-720 (pJG-5 derived 3′ sequence) were used to probe a Multiple Tissue Northern Blot (CLONTECH, 7762-1).
For Southern blots, a Mouse Geno-Blot (CLONTECH, 7650-1) was probed using a PCR generated cDNA fragment (B1-T) corresponding to amino acids 270-463 of the BCNG-1 sequence, as described (Sambrook, 1989). Blots were hybridized at 65° (5× standard saline citrate 1×SSC=0.15M sodium chloride/0.015 M sodium citrate, pH7 buffer in aqueous solution) and washed as described in figure legends. Washings conditions were as indicated. The melting temperature (TM) for the B1-T probe was calculated according to the formula Tm=81.5° C.+16.6 (logM)+0.41 (% GC)−(675/L), where M is the cation concentration and L is the probe length in base pairs.
Antibody production, extracts and Immunochemistry and in situ hybridization. The Glutathione S-transferanse (GST)-fusion proteins were created by subcloning the q1 (corresponding to amino acids 594-720 of the mBCNG-1 protein) or q2 (corresponding to amino acids 777-910 of the mBCNG-1 protein) (see
For Western Blot analysis, mouse brain extracts were separated on a 10% SDS-PAGE and electroblottted to PVDF membranes (Immobilon-P, Millipore) as described (Grant, 1995). Blocking and antibody incubations were done in TBST (10 mM Tris pH 7.5, 150 mM NaCl, 0.1% Tween-20)+2% BSA. The αq1 and αq2 antisera were used at a 1:1000 dilution. Secondary anti-rabbit antibodies coupled to alkaline phosphatase (Bio-Rad) were used at a 1:5000 dilution, and the bands were visualized by incubation in NBT\CIP (Boehringer Mannheim). Total brain extracts were prepared as described (Grant, 1995). For N-glycosidase treatment, 2% SDS was added to the extract and the proteins denatured by boiling for 10 min; reactions were carried out in 50 mM NaP (pH 7.2), 25 mM EDTA, 0.5% Triton-X100, 0.2% SDS, 1 mg/ml protein and 20 U/ml N-glycosidase F (Boehringer) for 1 hr at 37C.
For immunohistochemistry, 20 μm cryostat sections of mouse brain (fixed in 4% paraformaldehyde/PBS), quenched in 50 mM NH4Cl/PBS, were blocked (10% goat serum, 0.1% goat serum, 0.1% saponin in PBS) and then exposed to αq1 or αq2 antisera (diluted 1:400 in blocking solution). After washing in PBS+0.1% saponin, sections were incubated with Cy3-conjugated goat anti-rabbit F(ab′) 2 fragments (Jackson Immunoreasearch Labs) diluted 1:200 in blocking solution.
In situ hybridization was performed essentially as described (Mayford et al., 1995) using oligonucleotide probes labeled by 31 tailing with using35 (S) thio-dATP and terminal transferase (Boehringer Mannheim) to a specific activity of 5×108 cpm/μg. Hybridizations were carried out at 37° C. Slides were washed at 60° C. in 0.2×SSC and exposed to film for 2 weeks.
Example 2 Initial Cloning and Description of the Mouse BCNG Gene FamilyThe original sequence in the BCNG family (mBCNG-1) was isolated from a mouse brain cDNA library using yeast two-hybrid interaction cloning with the n-Src tyrosine kinase as a bait as described in Example 1. The DNA and amino acid sequences of this protein are Seq. ID. No.:1 and Seq. ID. No.:2 respectively. Clones comprising two additional genes (mBCNG-2 and mBCNG-3) have been isolated. The DNA and amino acid sequences of mBCNG-2 are Seq. ID. No.:5 and Seq. ID. No.: 6 respectively. The DNA and amino acid sequences of mBCNG-3 are Seq. ID. No.:9 and Seq. ID. No.:10 respectively. A more detailed description of the methods used to identify the sequences reported here are given in the methods section below.
All of the identified sequences contain the motifs of a voltage gated potassium channel (six transmembrane spanning domains, including a highly basic S4 domain, and a pore region) as well as a distinct cyclic nucleotide binding site (see
Northern blot analysis showed individual patterns of tissue distribution for each of these clones (see
The distinct sequences and tissue distributions of these clones reveals that the BCNG clones represent a family of ion channel proteins, with characteristic voltage sensing and cyclic nucleotide binding motifs, that are predominantly located in heart and brain.
Utilization of the EST data base in subsequent cloning of mouse and human BCNG genes. To assist in the complete cloning of the mouse genes and to begin the search for the human homologues of the BCNG genes, the EST data base was searched using the sequence of the mBCNG-1 protein. This search revealed four EST clones that appear to be fragments of two mouse BCNG genes (M41, M28) and two human BCNG genes (H57, H61). Correspondence between these ESTs and the BCNG gene family is shown schematically in
M41-EST This sequence appeared to represent a 3′ region fragment of a BCNG-like gene, overlapping the cyclic nucleotide binding site. An oligonucleotide was designed corresponding to the M41 sequence and was used in an RT-PCR reaction together with an oligonucleotide designed in a conserved region of the 5′ portion of the BCNG clones (oligo B123(Seq. ID. No.: 23)). A product of the expected size was obtained, both from mouse brain and heart polyA+ RNA, subcloned and sequenced. An overlap in the 5′ end region of M41-EST and in the 3′ end region of the partial clone of mBCNG-2 indicated that M41-EST represents the 3′ end region of mBCNG-2. Accordingly, this clone is valuable to acquire the 3′ end region of the gene for mBCNG-2.
Table I list the trivial names (designated herein), the probable correspondence between these ESTs and the BCNG genes, the GeneBank accession numbers and the clone identification numbers used by the I.M.A.G.E. consortium and Genome systems for these clones.
M28-EST. This clone also appears to contain a fragment of a BCNG-like gene, including the 3′ end region of the cyclic nucleotide binding site. An oligonucleotide to the M28 sequence was designed and used in an RT-PCR reaction together with the B123 oligonucleotide (Seq ID. No.: 23). Again, a product of the expected size was obtained both from mouse brain and heart polyA+ RNA, subcloned and sequenced. This product appeared to represent an extension of mBCNG-3. However, no overlap was present with the M28-EST sequence, leading to the conclusion that M28 represents yet another BCNG-like gene, which we designated BCNG-4. Indeed Northern blot analysis revealed a distinct pattern of tissue distribution for BCNG-4 (see
Complete sequencing of the M28-EST clone reveals that only the 3′ end region of the clone aligns with the BCNG sequences; the sequence 5′ to position 632 is likely to represent an intron (see Seq. ID. No.: 11 and Seq. ID. No.: 12 respectively).
H57-EST. Homology between H57-EST and mBCNG-1 suggested that this EST most likely represented the 3′ end region of hBCNG-1. The validity of this identification was strengthened by Northern blot analysis.
Based on this assignment, an oligonucleotide was generated corresponding to a sequence in the 5′ end region of mBCNG-1 and a second oligonucleotide was designed within the H57-EST. Amplification yielded a single, strong RT-PCR product of the predicted length from human brain POLYA+ RNA. Complete sequencing of the original EST clone and of the reverse transcriptase-PCR (RT-PCR) product, together yielded 2247 bp of the hBCNG-1 sequence (Seq. ID. No.:3). The amino acid sequence is shown as Seq. ID. No.: 4. The core region of the hBCNG-1 proteins exhibits 100% similarity to mBCNG-1.
H61-EST. This sequence showed marked sequence similarity to mBCNG-2 and may represent the human homologue of the mBCNG-2 protein. Northern blot analysis using a probe based on H61-EST (see
Accordingly a sequence within the H61-EST was used to probe a human brain λgt10 cDNA library. Positive clones obtained from this screening were sequenced, and shown to encode the human homologue of the mBCNG-2 protein. Together the sequences of the H61-EST and of the λgt10 clones, yielded 1792 bp of the hBCNG-2 sequence (Seq. ID. No.: 7). The amino acid sequence is shown as Seq. ID. No.: 8). The core region of the hBCNG-2 protein is 98% homologous to mBCNG-2.
Functional expression studies of mouse and human BCNG gene family members. Because the BCNG genes appear to encode an ion channel, mBCNG-1 was injected into in Xenopus oocytes as cRNA in order to record currents, using both two electrode voltage clamp and excised inside-out patch clamp approaches. A failure to detect current may result from a failure of correct trafficking or proper post-translational modification. In order to overcome such possible problems and to obtain functional expression of mBCNG-1, two approaches may be utilized. Firstly, expression of mBCNG-1 in a human cell line (HEK293 cells) and/or insect cell line (SF9 cells) may provide the proper post-translational modification. Second, expression in an insect cell system with a more efficient production of mBCNG-1 may yield a functional ion channel. It is also possible that mBCNG-1 can not form a functional protein alone and that it requires additional subunits. Thus, co-expression of other members of the BCNG family may circumvent this problem. Other members will be expressed individually and in combination as they are cloned.
An alternative approach is to use other ion channel subunits that are known to form heteromultimeric complexes and to co-express these with each of the BCNG subunits proteins. An important guide to this approach is to establish first which proteins exhibit overlapping tissue distribution with the BCNG proteins as determined from both Northern blot analysis (such as those in
Cloning of mBCNG-2. From the nested PCR reactions perform on the pJG4-5 library (see Example 1, Full-length cloning of mBCNG-1) an amplification product was isolated, that had a sequence similar but not identical to the expected mBCNG-1 sequence. It was thus inferred that it represented a different gene, closely related to mBCNG-1, which we called mBCNG-2. The identified fragment encoded amino acids 234-430 from the mBCNG-2 sequence (numbering according to mBCNG-1, see
Next performed was a series of RT-PCR reactions on polyA+ RNA derived from mouse brain and heart, using oligos: 5-TGGGAAGAGATATTCCACATGACC-3′ (Seq. ID. No.: 19) (7.SEQ1, corresponding to amino acids 270-277 of the mBCNG-1 sequence; see
The Clontech Mouse Brain λgt10 library was screened at high stringency (see Example 1, Full-length cloning of mBCNG-1), with a PCR probe derived from the mBCNG-2 sequence (probe “dA”) using oligos: 5′-TACGACCTGGCAAGTGCAGTGATGCGC-3′ (Seq. ID. No.: 20) (ASEQ2, corresponding to amino acids 278-286 of the mBCNG-2 sequence, numbering according to mBCNG-1; see
Positively reacting clones were further screened by PCR, using oligonucleotide: 5′-CTGGTGGATATATCGGATGAGCCG-3′ (Seq. ID. No.: 22) (B2-ASE, corresponding to amino acids 262-269 of the mBCNG-2 sequence, numbering according to mBCNG-1; see
After obtaining the sequence for EST-M41, a further round of RT-PCR reactions was performed both on mouse brain and heart polyA+ RNA, using oligonucleotides: 5′-CAGTGGGAAGAGATTTTCCACATGACC-3′ (Seq. ID. No.: 23) (B123, corresponding to aa 269-277 of the BCNG sequences, numbering according to mBCNG-1; see
PCR cycling was performed as follows: 1× (2 minutes, 94° C.); 25× (45 seconds, 94° C., 30 seconds, 55° C.); 2 minutes, 72° C.); 1× (10 min, 72° C.).
Cloning of mBCNG-3
From the λgt10 library screen for mBCNG-2 (see above) one positively reacting clone was obtained (#15) which appeared to give a consistently weaker hybridization signal. This insert was amplified with oligonucleotides 15.N2 (Seq. ID. No.: 17) and 13.N2 (Seq. ID. No.: 18), subcloned, sequenced and shown to represent a third BCNG-related sequence, different both from mBCNG-1 and mBCNG-2, which was called mBCNG-3. The identified fragment encoded the N-terminal part of the mBCNG-3 sequence up to aa 319 (numbering according to mBCNG-1; see
After obtaining the sequence for EST-M28, an RT-PCR was performed both on mouse brain and heart polyA+ RNA using oligonucleotide B123 as an upstream primer, and degenerate oligonucleotide: 5′-CACCKCRTTGAAGTGGTCCACGCT-3′ (Seq. ID. No.: 25) (28REV, corresponding to amino acids 554-561 of the BCNG sequences, numbering according to mBCNG-1; see
Cloning of hBCNG-1. After obtaining the sequence for EST-H57, an RT-PCR reaction was performed on human brain polyA+ RNA, using oligonucleotides: 5′-ATGTTCGGSAGCCAGAAGGCGGTGGAG-3′ (Seq. ID. No.: 26) (MB1-3, corresponding to aa 102-110 of the BCNG sequences, numbering according to mBCNG-1; see
PCR was performed as follows: 1× (2 minutes, 94° C.); 25× (45 seconds, 94° C., 20 seconds, 58° C., 3 minutes, 72° C.); 1× (10 minute, 72° C.).
Cloning of hBCNG-2. After obtaining the sequence for EST-H61, a PCR probe was made using oligonucleotides: 5′AACTTCAACTGCCGGAAGCTGGTG3′ (Seq. ID. No.: 28) (H61.A, corresponding to amino acids 452-459 of the hBCNG-2 sequence, numbering according to mBCNG-1; see
Northern blots. For mouse gene expression studies, a Mouse Multiple Tissue Northern Blot (CLONTECH, cat. no. 7762-1) was probed with the following PCR products: For mBCNG-1, probe “q0”, obtained using oligos q0.5′ (5′GCGAATTCAAACCCAACTCCGCGTCCAA3′) (Seq. ID. No.: 31) and q0.3′ (5′CCTGAATTCACTGTACGGATGGAT3′) (Seq. ID. No.: 32). Amplification product corresponding to aa 6-131 of the mBCNG-1 sequence (see
For human gene expression studies, a Human Multiple Tissue Northern Blot (CLONTECH, cat. no. 7760-1) or Human Brain Multiple Tissue Northern Blot (CLONETECH, cat. no. 7750-1) was probed with the following PCR products: For hBCNG-1, probe H57, obtained using oligos H57.A (5′GTCGTACTGCCAGTGTTCGAGCTG3′)(Seq. ID. No.: 33) and H57.B (5′GGTCAGGTTGGTGTTGTGAAACGC3′) (Seq. ID. No.: 34). Fragment corresponding to aa 537-800 of the hBCNG-1 sequence (numbering according to mBCNG-1; see
Hybridizations were all performed in ExpressHyb solution for 1 hour, 68° C., as indicated in the manufacturer's Protocol Handbook. Washing was performed as follows: 10 minutes, room temperature in 2×SSC/0.1% SDS, followed by twice 30 minutes, 65° C. in 0.2×SSC/0.1% SDS. Filters were stripped between subsequent hybridizations by boiling for 5 min in 0.5% SDS/H2O.
Sequence alignments and EST database search. Alignments and distance calculations were all performed with MegAlign (DNASTAR) on the indicated peptide sequences.
The EST database search was performed with BLAST (NCBI), using the mBCNG-1 polypeptide sequence (amino acids 1-720, to avoid the glutamine repeat present in the C-terminal region of the protein) and the TBLASTN program.
Discussion
Ion channels are important targets of drugs for treatment of a variety of neurological and cardiovascular diseases. Members of the novel BCNG family of ion channels are expressed at the mRNA level in brain, cardiac muscle sketch muscle, lung, kidney and liver. From their amino acid sequence, these channels described herein are likely to have two important physiological properties that make them a priori attractive targets for drug development. First, they are members of the voltage-gated channel family and are most similar to voltage-gated K+ channels. Second, they possess a cyclic nucleotide binding domain in their carboxy terminus, suggesting that they will be directly regulated by cyclic nucleotides. Based on these properties, combined with the tissue distribution and high levels of expression at mRNA levels, these channels are likely to play important roles in controlling neuronal and cardiac electrical activity. The regulation of these channels through drugs may as well as transport functions in lung, liver and kidney provide a unique opportunity for regulating electrical activity associated with diseases as diverse as epilepsy, cardiac arrhythmias and cystic Fibrosis. Moreover, the cyclic nucleotide binding domain of these channels provides a unique pharmacological target that could be used to develop novel, specific, cyclic nucleotide agonists or antagonists to upregulate or downregulate channel function.
Finally, these channels are attractive candidate genes for the pacemaker current that underlies spontaneous activity in the heart and various nuclei in the brain. This hypothesis is based on physiological studies which have shown that pacemaker channels are expressed in both heart and brain and have the unique property of being gated by both voltage and the direct binding of cyclic nucleotides to a cytoplasmic site on the channel—properties similar to those predicted for BCNG channels. As these pacemaker channels regulate the rhythmic beating of the heart, respiration, attention, sleep and wakefulness, they are prime targets for drug therapy. The expression of BCNG gene family members in heterologous systems, such as mammalian cell lines, facilitates rapid drug screens that could selectively identify compounds that target channel subunits encoded by BCNG genes expressed in brain or heart.
Example 3 Physiological and pharmacological significance of mouse and human BCNG channel genes.Introduction
The unique structural features and the tissue distribution of the predicted proteins of the BCNG gene family suggests that they may encode the pacemaker current (variously called Ih, If or Iq) of the heart and brain. Even if the BCNG gene family does not encode the pacemaker current it is likely to be a component of other—perhaps unidentified—ionic current(s) that are important in cardiac renal, hepatic and central nervous system function. Irrespective of the identity of the current(s) that the BCNG proteins contribute to, the unique structural features of the predicted BCNG proteins (the unusual ion conducting pore (P) domain, the highly conserved cyclic nucleotide binding (cnbs) site and the highly conserved and highly charged S4 voltage sensor) indicate that they will be susceptible to multiple drug intervention strategies that target the pore, the cyclic nucleotide binding site and the voltage-dependent gating apparatus.
Analysis And Predicted Structure and General Features of the BCNG Proteins. The predicted amino acid sequence of the BCNG genes reveals that they are members of the voltage-gated ion channel superfamily. Specifically, the BCNG proteins show similarities to the superfamily of channels that includes the voltage-gated K+ channels (Pongs, et al., 1995) and the cyclic nucleotide-gated channels, non-selective cation channels that are permeable to Na, K+ and Ca (Zagotta and Siegelbaum, 1996). As shown schematically in
Results
The Hydrophobic Core. The core of BCNG channels is predicted to have six transmembrane (α-helical sequences (S1-S6) and a pore forming P loop. This assignment is homologous to a single subunit of the tetrameric K+ channels (and tetrameric cyclic nucleotide-gated channels) or single repeat in the pseudo tetrameric Na and Ca channels. This homology suggests that the BCNG channels are members of the voltage-gated K+ channel superfamily (which also includes the voltage-independent but structurally homologous cyclic nucleotide-gated channels). It is likely that the BCNG channels will be composed of four such polypeptides in a hetero or homomultimeric structure as is seen for the voltage-gated K+ channels and the cyclic nucleotide-gated channels (Chen et al., 1993; Bradley et al., 1994; Liman and Back, 1994; Lin et al., 1996). However, BCNG-1 shows considerable divergence from all other known K+ channel and cyclic nucleotide-gated channel sequences. As noted above, the highest homology in the hydrophobic core region is to mouse Eag (22% amino acid similarity)—a voltage-gated K+ channel that has a degenerate and probably non-functional cyclic nucleotide binding site Warimke and Gancleky. Over this core region, mBCNG-1 shows 17% identity to the voltage independent cyclic nucleotide-gated channels.
In contrast, the proteins that are predicted to be encoded by the BCNG genes show high homology to each other (>80%, see Examples 1 and 2). Indeed, mouse BCNG-1 and human BCNG-1 are identical over the core region. Similarly, mBCNG-2 and hBCNG-2 are 98% identical over the core region. Thus, the BCNG family of genes appears to constitute a new branch of the K+ channel superfamily which could be regulated by cyclic nucleotide binding. The presence of a gene family with members showing such sequence conservation strongly suggests important biological function.
The S4 voltage-sensing domain. The presence of positively charged arginine and lysine residues at every third posit in the fourth transmembrane helix is a signature sequence voltage-dependent gating (Hille, 1992; Catterall, 1992, see
The S4 of BCNG channels are most closely related to the corresponding regions in the voltage-gated K+ channels Shaker and eag, albeit poorly (mBCNG-1 is 30% homologous to the S4 of Shaker and eag). Despite an interruption by the inclusion of a serine in place of an arginine in the S4 of BCNG channels, the BCNG sequence contains more positively charged residues than any other member of the voltage-gated K+ channel superfamily (see
The cyclic nucleotide binding site. Cyclic nucleotides regulate the activity of a diverse family of proteins involved in cellular signaling. These include a transcription factor (the bacterial catabolite activating protein, CAP), the cAMP-and cGMP-dependent protein kinases (PKA and PKG) and the cyclic nucleotide-gated (CNG) ion channels involved in visual and olfactory signal transduction (Shabb and Corbin, 1992; Zagotta and Siegelbaum, 1996). Despite obvious divergence among the effector domains of these proteins, the cyclic nucleotide binding sites appear to share a common architecture. Solution of the crystal structures of CAP (Weber and Steitz, 1987) and a recombinant bovine PKA R1α subunit (Su, et al., 1995) has demonstrated that their cyclic nucleotide binding sites are formed from an α helix (A helix), an eight stranded β-roll, and two more α-helices (B and C), with the C-helix forming the back of the binding pocket. Of the approximately 120 amino acids that comprise one of these cyclic nucleotide binding sites, six are invariant in all CAP, PKA, PKG and cyclic nucleotide gated channels. Thus, it has been suggested that the invariant residues play important—and conserved—roles in the folding and/or function of the CNB sites of these diverse proteins (Shabb and Corbin, 1992; Zagotta and Siegelbaum, 1996; Weber and Steitz, 1987; Su, et al., 1995; Kumar and Weber, 1992; Scott, et al., 1996). Indeed, the crystal structure of CAP (Weber and Steitz, 1987) and the regulatory subunit of recombinant bovine R1α (Su, et al., 1995) reveals that the glycines are at turns within the β-roll while the glutamate and the arginine form bonds with the ribose-phosphate of the nucleotide.
Interestingly, only three of these residues—two glycines and the arginine—appear to be conserved among the more distantly related voltage-gated channels which bear the CNB site motif but whose gating may NOT be modulated significantly by direct binding of cyclic nucleotide (KAT1 (Hoshi, 1995) and drosophila EAG (dEAG) (Bruggeman, et al., 1993) (see
Thus in the plant channel, KAT1, the first glycine is mutated to an asparagine and the alanine is changed to a threonine. In dEAG the glutamate in changed to an aspartate. Furthermore, the alignment of dEAG to the highly conserved RXA sequence in β-7 is uncertain. Often, the SAA sequence within the dEAG β-7 is aligned with the RXA consensus sequence which suggests that the arginine is lost and replaced with a serine. RAL is aligned with the RXA consensus sequence which would indicate that the arginine is retained but the alanine is replaced with a leucine. Regardless of which alignment is considered, it is clear that the binding site sequence of KAT1, dEAG and related channels all show deviations from the consensus motif for a functional cyclic nucleotide binding site. In keeping with this structural divergence, there is only one report that any cloned EAG is being sensitive to direct cyclic nucleotide binding (Bruggermann et al., 1993). However, this result has not been confirmed and it is now thought to be an artifact. There is some evidence that the gating of the plant channel KAT1, may be weakly sensitive to cyclic nucleotide modulation (Hoshi, 1995).
Recent evidence has demonstrated that the third (or C) α-helix moves relative to the agonist upon channel activation, forming additional favorable contacts with the purine ring. Indeed, the selective activation of bRET1 by cGMP relative to cAMP is largely determined by α-residue in the C α-helix, D604 {Varnum et al., 1995}. This acidic residue is thought to form two hydrogen bonds with the hydrogens on a ring nitrogen and amino group of the cGMP purine ring. Unlike the cGMP selective bRET1 channel, cyclic nucleotide-gated channels that are activated equally well by cAMP or cGMP (fOLF1, Goulding et al., 1992; Goulding et al., 1994) or which favor activation by cAMP (rOLF2 coexpressed with rOLF1, Liman & Buck, 1994; Bradley et al., 1994) do not have an acidic residue here, but rather, have polar or hydrophobic amino acids (see Varnum, et al., 1995}. Neutralization of D604 results in a loss of the ability to form the favorable hydrogen bonds with cGMP and the loss of the unfavorable interaction with the lone pair of electrons on the purine ring of cAMP, thus accounting for the channels which bear a hydrophobic or polar residue at this position becoming non-selective between cAMP and cGMP or even selective for cAMP.
In the C-terminus of the BCNG proteins there is a sequence of approximately 120 amino acids that is homologous to these cyclic nucleotide binding sites. Strikingly, the six residues that have been shown to be totally conserved in all functional cyclic nucleotide binding sites are conserved all of the BCNG proteins that we have identified so far. The cyclic nucleotide binding site of the BCNG channels are most similar to the functional site present in the voltage-independent cyclic nucleotide-gated channels (30%). When the cyclic nucleotide binding sites found in channel genes are compared to those in protein kinases, the BCNG channel sites are more similar (25% similarity to yeast cAMP-dependent protein kinases) than those of any other ion channel. These data strongly suggest that the BCNG genes encode proteins whose activity is modulated by direct binding of cyclic nucleotide. Furthermore, the BCNG channels all have an isoleucine residue in the position where D604 is found in the cGMP selective bRET1 channel. Thus, the BCNG are probably cAMP selective.
The pore. Despite the functional divergence that has given rise to Na, Ca or K selective families and to the presence of channels within these families whose conductances vary by 1-2 orders of magnitude, the pores of all members of the voltage-gated superfamily are related (see Itillic 1992; For example see
Overall, the P region of mBCNG-1 is most closely related to the corresponding region in the K selective Shaker and eag channels, albeit poorly (30%). Based on the presence of a GYG motif in the P loop, the BCNG proteins would be expected to be K selective. However, the BCNG P loops contain substitutions in several positions that are otherwise highly conserved in other voltage activated K+ channels. These changes can be seen in
Interestingly, some of the substitutions found in the BCNG channels are similar to those found in the β-subunit of the CNG-channel (see hRET-2 in
Although the amino acid substitutions seen in the P region of the BCNG subunits do not necessarily indicate that the channel will have lost its K selectivity (for example a lysine is present in the P region of the K selective Shaw channel, See
Discussion
Significance of the BCNG Structure
The presence of cyclic nucleotide binding sites on a number of K+ channels that are found in both plant and animal phyla suggests that the fusion between an ancestral K+ channel and an ancestral cyclic nucleotide binding site is likely to have occurred prior to the evolutionary separation between plants and animals (Warmke and Ganetzky, 1994). Indeed, the finding that many of these sites are degenerate and non-functional supports this interpretation. Divergence from this common ancestor would have led on one hand to Eag-related channels (EAG, ERG, ELK) (Warmke and Ganetsky, 1994) and plant inward rectifiers (AKT and KAT), which maintained more of the features of voltage activated K+ channels, while showing a progressive deviation from the original cyclic nucleotide binding site sequence) and on the other hand to CNG-channels (which show a higher evolutionary constraint on the cyclic nucleotide binding site, while they have lost voltage activation and K+ selectivity) (Anderson, et al., 1992; Sentenac, et al., 1992). The features of BCNG-1 suggest that it may have remained closer to the ancestral molecule that represents the evolutionary link between voltage-gated K+ channels and cyclic nucleotide-gated channels. This is supported by the observations that the cyclic nucleotide binding site of mBCNG-1 shows the closest homology to binding sites present in protein kinases, in particular in yeast cAMP-dependent protein kinases (25%) while the channel domains are most closely related to the voltage-dependent channel encoded by the Shaker gene that does not have a cyclic nucleotide binding site and thus, presumably arose before the gene fusion event. The cyclic nucleotide binding site of mBCNG-1 is most homologous to the site present in cyclic nucleotide-gated channels (30%) which again demonstrates that these probably arose from a common ancestor and in both there was pressure to maintain the cyclic nucleotide binding site because it contributed to the function of the protein. Thus, BCNG-1 appears to constitute a new branch of the K+ channel superfamily.
Physiological Significance. Ion channels are central components underlying the electrical activity of all excitable cells and serve important transport functions in non-excitable cells. Members of the novel BCNG family of ion channels are expressed in both brain and cardiac muscle as well as skeletal muscle, lung, liver and kidney. From their amino acid sequence, members of the BCNG channel gene family are likely to have important, novel roles in the electrophysiological activity of the brain and the heart and other tissues. This view is based, first, on the finding that mRNA coding for BCNG channel protein is expressed in both heart and brain. Second, the deduced primary amino acid sequence of the BCNG channels indicate that they are members of the voltage-gated channel family but unlike most voltage-gated channels, the BCNG channels contain what appears to be a functional cyclic nucleotide-binding domain in their carboxy terminus.
Northern blots of the four mouse BCNG channel genes show interesting differences in expression patterns (see
Based on the BCNG amino acid sequence and tissue distribution, it is hypothesized that the channels encode a either a voltage-gated potassium channel that is activated by membrane depolarization and modulated by the direct binding of cyclic nucleotides, or the hyperpolarization-activated pacemaker channel that underlies spontaneous electrical activity in the heart DiFrancesco and Torta, 1991 and in various regions of the brain Steride et al., 1993. This latter hypothesis is based on the finding that the pacemaker channels, similar to BCNG genes, are expressed in both brain and the heart. Moreover, the pacemaker channels are known to be non-selective cation channels that are gated by both voltage and the direct binding of cyclic nucleotides to a cytoplasmic site on the channel (DiFrancesco and Torta, 1991; Pedarzani and Storm, 1995 Larkman And Kelly, 1997, McCormick and Page, 1990). To date, there is no biochemical or molecular biological information as to the nature of the pacemaker channel. However, the similarity in tissue distribution and proposed gating mechanisms between the pacemaker channels and the BCNG channels suggests that the BCNG genes code for one or more subunits that comprise the pacemaker channels.
Pacemaker channels have been studied at the electrophysiological level in both cardiac tissue and central neurons. In both instances, the channels are activated when the cell membrane voltage is made more negative than −40 mV. These non-selective channels are permeable to both Na and K+ ions. However, at the negative membrane potential range over which these channels open, their main effect is to allow positively charged sodium to enter the cell from the extracellular environment, causing the cell membrane to become more positive. This eventually causes the membrane voltage to reach threshold and the cell fires an action potential. (See
An alternative function for the BCNG channels, that they encode for a novel voltage-gated and cyclic nucleotide-gated potassium channel, is suggested by the amino acid region that is known to line the ion-conducting pore and hence determine the ionic selectivity of the channel. This S5-S6 loop contains a three amino acid motif, GYG, that is conserved in almost all voltage-gated K+ channels Heginbotham et al., 1994. The BCNG channel S5-S6 loop shows amino acid similarity with that of other potassium channels, including the GYG motif. This suggests that the BCNG channels may be K+ selective. However, there are a number of striking differences in the sequence between BCNG and other K+ channels that may indicate that the BCNG channels are less K-selective compared to other K+ channels, consistent with the view that the BCNG channels code for the non-selective cation pacemaker channels that are permeable to both Na and K+.
The presence of BCNG-1 in the dendrites of hippocampal pyramidal cells is particularly intriguing, as cAMP has been shown to be important for the establishment of some forms of long-term synaptic potentiation in these cells (Frey, et al., 1993; Boshakov, et al., 1997; Huang and Kandel, 1994; Thomas, et al., 1996).The structural features of BCNG1 predict a K+ conducting activity, directly modulated by cyclic nucleotide binding.
Interestingly, a current with similar characteristics has been described in the hippocampal pyramidal neurons of area CAl (Warmke, et al., 1991) where BCNG-1 is highly expressed. This current (IQ) is believed to contribute to the noradrenergic modulation of hippocampal activity, by regulating neuronal excitability in response to cAMP levels. BCNG-1 may participate in the formation of the channels responsible for this type of current.
By analogy with the emerging pattern for olfactory and retinal CNG-channels, the non-consensus sequence of the putative pore forming region of mBCNG-1 suggests that this protein may represent a 1-subunit of a heteromultimeric channel (Liman and Buck, 1994; Bradley, et al., 1994). Indeed the data show the existence of a number of BCNG-related sequences in the mouse genome, and one or more of these genes could encode additional subunits required for the formation of an active channel. These channels are likely to have two important physiological properties that suggest they serve important functions in the role of many excitable cells. First, they are members of the voltage-gated channel family and are most similar to voltage-gated K+ channels. Second, they possess a cyclic nucleotide binding domain in their carboxy terminus, suggesting that they will be directly regulated by cyclic nucleotides. Based on these properties, combined with their tissue distribution and high levels of expression at the mRNA levels, these channels are likely to play important roles in controlling neuronal and cardiac electrical activity as well as having important functions in other excitable and non-excitable cells.
Based on the widespread tissue distribution and likely important physiological role of the BCNG channels in electrical signaling, drugs that interact with these channels are of potential therapeutic use in a number of neurological, psychiatric and cardiac diseases as well as systemic diseases of tissues such as skeletal muscle, liver and kidney.
Neurological disease: Based on the high expression of these channels in the hippocampus and potential role in spontaneous pacemaker activity, they may be useful, novel targets for treatment of epilepsy. For example, by blocking these channels it may be possible to prevent or diminish the severity of seizures. In diseases associated with hippocampal neuronal loss, such as age-related memory deficit, stroke-induced memory loss, and Alzheimers disease, a drug which enhanced pacemaker channel activity may be of therapeutic use by increasing neuronal activity in the hippocampus. As these channels are also expressed in the basal ganglia and striatum, they may be potential targets in Parkinson's and Huntington's disease. The BCNG channels are also highly expressed in the thalamus, where pacemaker channels have been shown to be important in generating spontaneous action potentials important for arousal. Targeting of such channels may help treat attention deficit disorder.
Psychiatric disease: Given the high levels of expression of hBCNG-1 in the amygdala, these channels may be targets for drugs involving various affective disorders and anxiety. Their high expression in the limbic system suggests that they may also be of potential benefit in treatment of schizophrenia.
Cardiac disease: The expression of the BCNG-2 channels in the heart suggests that they may be useful targets for treatment of certain cardiac arrhythmias. Based on the hypothesis that these genes may encode pacemaker channels the BCNG channels will be potential targets for treats both bradyarrhythmias through drugs that enhance pacemaker channel activity and certain tachyarrhythmias due to enhanced automaticity. Even if the BCNG channels are not the pacemaker channels, they are likely to play an important role in cardiac electrical activity, perhaps contributing to action potential repolarization, and thus would remain attractive targets for drug development.
A number of drugs, toxins and endogenous compounds are known to interact with various types of ion channels. These drugs have proved useful as local anesthetics and in the treatment of cardiac arrhythmias, hypertension, epilepsy and anxiety. These drugs fall into several classes including pore blockers, allosteric modulators, and competitive antagonists (see Table II). The BCNG channels present some unique features that make them very attractive drugs. First, there are both brain specific genes (BCNG-1) and genes that expressed in both brain and heart (BCNG-2,3). Thus BCNG may yield drugs specific for brain or heart. Second, the pore region of the BCNG channels shows considerable divergence from that of other known potassium channels. Thus, yielding pore-blocking drugs that would selectively alter BCNG channels but spare other types of voltage-gated K+ channels. Third, the cyclic nucleotide-binding site elucidate another important target with respect to the opening of the BCNG channels. By designing specific cyclic nucleotide analogs it should be possible to design either synthetic agonists, which will increase channel opening, or antagonists which will decrease channel opening. Most available drugs for ion channels decrease channel opening, relatively few increase channel opening. The ability to either increase or decrease the opening of BCNG channels offers much potential for therapeutically effective compounds. For example in bovine photoreceptor CNG channels, Rp-cGMPS is an antagonist of channel opening whereas Sp-cGMPS is an agonist (Kramer and Tibbs, 1996). Moreover, the amino acid sequence of the cyclic nucleotide binding site of the BCNG channels shows considerable divergence with cyclic nucleotide binding sites of protein kinases and the cyclic nucleotide-gated channels of olfactory and photoreceptor neurons. Thus it should be possible to design cyclic nucleotide analogs which specifically target the BCNG channels.
(Hille, 1992; Catterall, 1992; Roden, 1996)
From their amino acid sequence, these channels are likely to have three important physiological properties that make them a priori attractive targets for drug development. First, their gating should be voltage-dependent and thus it should be sensitive to modulation of the voltage-gating mechanism. Second, they possess a cyclic nucleotide binding domain in their C-terminus and it is probable that their gating will be modulated by direct binding of cyclic nucleotides. This presents a second target for drug targeting. Third, the unusual sequence of the pore forming domain of the BCNG channels should allow the ion conduction properties of the channel to be selectively targeted.
If, the gating of the channels involves both the voltage-sensor machinery and the cyclic nucleotide binding site it is likely that coordinated drug regimes such that two compounds with low efficacy and even low selectivity can combine to selectively target the BCNG channels. Thus one compound that alone would have weak pharmacological effects on many voltage-activated channels combined with one that has a similarly weak effect on the various cyclic nucleotide binding pockets could be applied together. As no class of molecules is currently known that functionally combines BOTH of these structural elements—with the anticipated exception of the BCNG channels—it is likely that such a regime would lead to a highly efficacious and selective targeting of channels containing the BCNG subunits. Selective intervention against BCNG sub-types should also be possible.
The regulation of these channels through drugs provides a unique opportunity for regulating electrical activity associated with diseases as diverse as epilepsy and cardiac arrhythmias. Moreover, the cyclic nucleotide binding domain of these channels provides a unique pharmacological target that could be used to develop novel, specific, cyclic nucleotide agonists or antagonists to upregulate or downregulate channel function
Drugs can modulate voltage-dependent gating—coupled with CNG to achieve selectivity.
Cell lines expressing BCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 and hBCNG-2 offer the promise of rapid screening for compounds that interact with the channels. To identify drugs that interact with the cyclic nucleotide binding domain, this region could be expressed selectively in bacteria and then purified. The purified protein fragment could then be used in standard ligand-binding assays to detect cyclic nucleotide analogs that bind with high affinity.
Functional effects of drugs on channel opening or ion permeation through the pore are tested using whole cell patch clamp of mammalian cell lines expressing the various BCNG genes. Where the BCNG channels resemble the CNG channels, they exhibit significant permeability to calcium. This permits a high throughput screen in which channel function is assessed by imaging intracellular calcium concentration. Drugs that increase channel opening also increase internal calcium.
Example 4 Expression of Functional BCNG ProteinsAs the BCNG genes appear to encode an ion channel, mBCNG-1 is expressed in Xenopus oocytes by injection of cRNA and current is recorded using both two electrode voltage clamp and excised inside-out patch clamp approaches. A lack of current may result from a failure of correct trafficking or proper post-translational modification. In an attempt to over come such problems and to obtain functional expression of the BCNG channels, alternative expression systems are utilized. BCNG channels are expressed in a human cell line such as HEK293 cells, or in an insect cell line such as SF9 cells. Proper post-translational modification provided by the mammalian HEK293 cells or the efficient protein production of the insect cell system, may be required to yield a functional ion channel. As each new subunit of the BCNG family is cloned they are expressed in each of the systems described above. Some members of the family may form functional homomultimers (eg. as is seen with some subunits of cyclic nucleotide gated channels and the some of the neuronal nicotinic acetylcholine receptor subunits).
Cloning Additional Subunits that Interact with the BCNG Proteins to Give Rise to Functional Current
Coexpression of BCNG channel subunits and candidate proteins. Although the BCNG clones show considerable homology, it is possible that the subunits that are expressed in the same tissue form heteromultimeric proteins with each other and the homomultimers are non-functional. In order to delineate the functional roles of new BCNG subunits, new BCNG subunits are coexpressed with BCNG subunits that have overlapping tissue distribution. Voltage-gated K+ channels and cyclic nucleotide-gated channels both form heteromultimers. In some cases, the subunits can form complexes with completely distinct proteins (eg. KvLQT1 with MinK—(Barhanin, et al., 1996; HERG with MinK McDonald, et al., 1997); IrK6.1 and IrK6.2 with the sulphonylurea receptor—Isomoto, et al., 1996; Inagaki, et al., 1996). BCNG proteins may assemble with subunits such as MinK or ERG like subunits. Candidate proteins are selected on the basis of overlapping tissue distribution and likelihood based on known functional properties. For example, Kv1.2 shows overlapping distribution with mBCNG-1 even at the subcellular level (Sheng, et al., 1994; Wang, et al., 1994).
Coexpression with PolyA+ mRNA. If another protein is required to form a functional heteromultimer with the BCNG channel proteins, co-expression with size fractionated mRNA from tissue (eg. heart, brain, muscle or kidney) where the appropriate BCNG subunit is expressed (as shown by Northern blot analysis) should result in a unique current in electrophysiological currents when the BCNG RNA is coinjected with the mRNA from the tissue.
Alternative strategies to clone subunits that will permit functional expression of the BCNG channels include low stringency homology screening of the appropriate libraries using BNA nucleotide probes derived from the current BCNG genes or PCR amplification from genomic or cDNA using degenerate oligonucleotides based on the known BCNG genes.
Yet another method to isolate other channel subunit proteins that may coassemble with identified BCNG family members is to use the yeast two hybrid system (Fields and Soug, 1989). This system was initially used to clone mBCNG-1 based on its interaction with the n-src SH3 domain. Conserved cytoplasmic N- and C-terminal domains from BCNG channel proteins are used as the ‘bait’ in the yeast two hybrid system. N- and C-terminal fragments will be subcloned in the plasmid pEG202 (Zervos et al., 1983).
REFERENCES
- Adelman, J. P., Shen, K.-Z., Kavanaugh, M. P., Warren, R. A., Wu, Y.-N., Lagrutta, A., Bond, C. T., & North, R. A. (1992) Neuron 9, 209-216.
- Adelman, J. P. (1995) Current Opinion in Neurobiology 5, 286-295.
- Aiba, H., Fujimoto, S. and Ozaki, N. (1982) Nucleic Acids Res. 10:1345-1361.
- Anderson, J. A., Huprikar, S. S., Kochian, L. V., Lucas, W. J. and Gaber, R. F. (1992) Proc. Natl. Acad. Sci. 89:3736-3740.
- Arancio, O., Kandel, E. R., & Hawkins, R. D. (1995) Nature 376, 74-80.
- Atkinson, N. S., Robertson, G. A., & Ganetzky, B. (1991) Science 253, 551-555.
- Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., & Struhl, K. (1994) Current Protocols in Molecular Biology (John Wiley and Sons, New York, N.Y.).
- Barhanin, J., Lesage, F., Guillemare, E., Fink, M., Lazdunski, M. & Romey, G. (1996) Nature 384:78-80.
- Barton, S. K. et al., 1992 J. Am. Chem. Soc. 114:8736-40.
- Bolshakov, V. Y., Golan, H., Kandel, E. R., & Siegelbaum, S. A. (1997) Neuron 19,635-651.
- Bradley, J., Zhang, Y, Bakin, R., Lester, H. A., Ronnett, G. V., & Zinn, K. (1997) J. of Neurosci. 17, 1993-2005.
- Bradley, J., Li, J., Davidson, N., Lester, H. A., & Zinn, K. (1994) Proc. Natl. Acad. Sci USA 91, 8890-8894.
- Breede, L., & Nasmyth, K. (1985) Cold Spring Harbor Symp. Quant. Biol. 50, 643-650.
- Broillet, M. C. & Firestein, S. (1997) Neuron 18: 951-958.
- Brugge, J. S., Cotton, P. C., Querel, A. E., Barrett, J. N., Normer, D., & Keane, R. W. (1985) Nature 316, 554-557.
- Brüggemann, A., Pardo, L., Stühmer, W., & Pongs, O. (1993) Nature 365, 445-448.
- Chen, T. Y., Peng, Y. W., Dhallan, R. S., Ahamed, B., Reed, R. R, & Yau K. W. (1993) Nature 362, 764-767.
- Cossart, P. and Gicquel-Sanzey, B. (1982) Nucleic Acids Res. 10: 1363-1378.
- Dale, R. N. K. et al., 1973 Proc. Natl. Acad. Sci. USA 70:2238-42.
- Dhallan, R. S., Yau, K. W., Schrader, K. A., and Reed, R. R. (1990) Nature 347, 184-187.
- Erickson, P. F. et al., 1982 J. Immunol. Methods 51:241-49.
- Fields S., & Song O. K. (1989) Nature 340, 245-246.
- Frangioni, J. V., & Neel, B. G. (1993) Anal. Biochem. 210, 179-187.
- Frey, U, Huang, Y.-Y., & Kandel, E. R. (1993) Science 260, 1661-1664.
- Goulding, E. H., Ngai, J., Kramer, R. H., Colicos, S., Axel, R., Siegelbaum, S. A. and Chess, A. (1992) Neuron 8:45-58.
- Goulding, E. H., Tibbs, G. R. and Siegelbaum, S. A. (1994) Nature 372:369-374.
- Grant, S. G. N., Karl, K. A., Kiebler, M., & Kandel, E. R. (1995) Genes Dev. 9, 1909-1921.
- Greene, W. N., & Millar, N. S. (1995) Trends Neurosci. 18, 280-287.
- Harlow, E., & Lane, D. (1988) Antibodies: a laboratory manual (Cold Spring Harbor Lab. Press, Cold Spring Harbor, N.Y.).
- Hille, B. (1992). Ionic Channels of Excitable Membranes. Sinauer.
- Hoshi, T. (1995) J. Gen. Physiol. 105, 309-328.
- Huang Y.-Y., & Kandel E. R. (1994) Learning & Memory 1:74-82.
- Isomoto, S., Kondo, C., Yamada, M., Matsumoto, S., Higashiguchi, O., Horio, Y., Matsuzawa, Y. & Kurachi, Y. (1996) J Biol Chem 271:24321-24324.
- Inagaki, N., Gonoi, T., Clement, J. P., Wang, C. Z., Aguilar-Bryan, L., Bryan, J. & Seino, S. (1996) Neuron 16:1011-1017.
- Jegla, T. & Salkoff, L. J. Neurosci (1997) 17, 32-44.
- Johnson, T. K. et al., 1983 Anal. Biochem. 133:125-131.
- Kamb, A., Iverson, L. E., & Tanouye, M. A. (1987) Cell 50, 405-413.
- Kamb, A., Iverson, L. E., & Tanouye, M. A. (1987) Cell 50, 405-413.
- Kaupp, U. B., Niidome, T, Tanabe, T., Terada, S., Bönigk, W., Stühmer, W., Cook, N. J., Kangawa, K., Matsuo, H., Hirose, T., Miyata, T., & Numa, S. (1989) Nature 342, 762-766.
- Kingston, P. A., Zufall; F., & Barnstable, C. J. (1996) Proc. Natl. Acad. Sci. USA 93,10440-10445.
- Kohler, M., Hirschberg, B., Bond, C. T., Kinzie, J. M., Marrion, N. V., Maylie, J., & Adelman, J. P. (1996) Science 273, 1709-1714.
- Kramer, R. H. and Tibbs, G. R. (1996) J. Neurosci. 16:1285-1293.
- Krapivinsky, G., Krapivinsky, L., Wickman, K., & Clapham, D. E. (1995) J. Biol. Chem. 270,29059-29062.
- Kumar, V. D. and Weber, I. T. (1992) Biochemistry 31:4643-4649.
- Liman, E. R., & Buck, L. B. (1994) Neuron 13, 1-20.
- Liman, E. R., Hess, P., Weaver, F. & Koren, G. Nature (1991) 353: 752-756.
- Martinez, R., Mathey-Prevot, B., Bernards, A., & Baltimore, D. (1987) Science 237, 411-415.
- McDonald, T. V., Yu, Z., Ming, Z., Palma, E., Meyers, M. B., Wang, K. W., Goldstein, S. A. & Fishman, G. I. (1997) Nature 388:289-292.
- Matthaei, F. S. et al., (1986) Anal. Biochem. 157:123-128.
- Mayford, M., Wang, J., Kandel, E. R., & O'Dell, T. J. (1995) Cell 81:891-904.
- Palay, S. L., & Chan-Palay, V. (1974) Cerebellar cortex: cytology and organization (Springer, New York, N.Y.).
- Pallanck, L., & Ganetzky, B. (1994) Hum. Mol. Genet. 3, 1239-1243.
- Papazian, D. M., Schwartz, T. L., Tempel, B. L., Jan, Y. N., & Jan, L. Y. (1987) Science 237, 749-753.
- Papazian, D. M., Tempe, L. C., Jan, Y. N., & Jan, L. Y. (1991) Nature 349:305-310.
- Pawson, T. (1995) Nature 373, 573-580. Pedarzani, P., & Storm, J. F. (1995) Proc. Natl. Acad. Sci. USA 92, 11716-11720.
- Pedarzani, P., & Storm, J. F. (1995) Proc. Natl. Acad. Sci. USA 92, 11716-11720.
- Pongs, O., (1992) Physiol. Rev. 72: S69-S88.
- Raisman, G., Cowan, W. M., & Powell, T. P. S. (1965) Brain 88:963-996.
- Roden, D. (1996). Antiarryhthmic drugs. In, The Pharmacological Basis of Therapeutics, ninth ed. Eds, Hardman, J. G., Limbird, L. E. McGraw Hill, New York.
- Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989) Molecular cloning: a laboratory manual (Cold Spring Harbor Lab. Press, Cold Spring Harbor, N.Y.) 2nd Ed.
- Scott, S.-P., Harrison, R. W., Weber, I. T. and Tanaka, J. C. (1996) Protein Engineering 9:333-344.
- Sentenac, H., Bonneaud, N., Minet, M., Lacroute, F., Salmon, J.-M., Gaymard, F. and Grignon, C. (1992) Science 256:663-665.
- Shabb, J. B. and Corbin, J. D. (1992) J. Biol. Chem. 267, 5723-5726.
- Sheng, M., Tsaur, M.-L., Jan, Y. N., & Jan, L. Y. (1994) J. Neurosci. 14, 2408-2417.
- Staub, O., Dho, S., Henry, P. C., Correa, J., Ishikawa, T., McGlade, J., & Rotin, D. (1996) EMBO J. 15, 2371-2380.
- Strong, M., Chandy, G., & Gutman, G. (1993) Mol. Biol. Evol. 10, 221-242.
- Su, Y., Dostmann, W. R. G., Herberg, F. W., Durick, K., Xuong, N-H., Ten Eyck, L., Taylor, S. S. and Varughese, K. I. (1995) Science 269:807-813.
- Sudol, M. (1996) TIBS 21, 161-163.
- Sugrue, M. M., Brugge, J. S., Marshak, D. R., Greengard, P., & Gustafson, E. L. (1990) J. Neurosci. 10, 2513-2527.
- Thomas M. J., Moody T. D., Makhinson M., and O'Dell, T. J. (1996) Neuron 17, 475-482.
- Titani, K., Sasagawa, T., Ericsson, L. H., Kumar, S., Smith, S. B., Krebs, E. G. and Walsh, K. A. (1984) Biochemistry 23:4193-4199.
- Varnum, M. D., Black, K. D. and Zagotta, W. N. (1995) Neuron 15:619-625.
- Wang, H., Kunkel, D. D., Schwartzkroin, P. A., & Tempel, B. L. (1994) J. Neurosci. 14, 4588-4599.
- Warmke, J. W., & Ganetzky, B. (1994) Proc. Natl. Acad. Sci. USA 91, 3438-3442.
- Warmke, J, Drysdale, R., & Ganetzky, B. (1991) Science 252, 1560-1562.
- Weber, I. T., Shabb, J. B., & Corbin, J. D. (1989) Biochemistry 28, 6122-6127.
- Weber, I. T. and Steitz, T. A. (1987) J. Mol. Biol. 198:311-326.
- Wohlfart, P., Haase, W., Molday, R. S., & Cook, N. J. (1992) J. Biol. Chem. 267, 644-648.
- Zagotta, W. N., & Siegelbaum, S. A. (1996) Annu. Rev. Neurosci. 19, 235-263.
- Zervos, A. S., Gyuris, J., & Brent, R. (1993) Cell 72, 223-232.
Claims
1. An isolated nucleic acid molecule having sequence encoding a BCNG ion channel protein or a portion thereof.
2. The nucleic acid molecule of claim 1, wherein the BCNG ion channel protein is mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2.
3. The nucleic acid molecule of claim 1, wherein the nucleic acid is DNA or RNA.
4. The nucleic acid molecule of claim 3, wherein the DNA is cDNA.
5. The nucleic acid molecule of claim 4, wherein the cDNA has substantially the same coding sequence as the coding sequence shown in SEQ. ID. No.: 1, SEQ. ID. No.: 3, SEQ. ID. No.: 5, SEQ. ID. No.: 7, SEQ. ID. No.: 9, or SEQ. ID. No.:11.
6. A vector comprising the nucleic acid molecule of claim 4.
7. The vector of claim 6, wherein the vector is a virus or a plasmid.
8. A host vector system for the production of a mammalian BCNG molecule which comprises the vector of claim 6 in a suitable host.
9. The host vector system of claim 8, wherein the suitable host is a bacterial cell, a eukaryotic cell, a mammalian cell or an insect cell.
10. A nucleic acid molecule capable of specifically hybridizing with the nucleic acid molecule of claim 1.
11. An isolated BCNG protein.
12. The protein of claim 11, wherein the BCNG protein is mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2.
13. The protein of claim 11, wherein the BCNG protein has substantially the same amino acid sequence as the amino acid sequence shown in SEQUENCE ID NO.: 2, SEQ. ID. No.: 4, SEQ. ID. No.: 6, SEQ. ID. No.: 8, SEQ. ID. No.: 10, or SEQ. ID. No.: 12.
14. A composition comprising a nucleic acid, having sequence encoding a BCNG protein or a portion thereof and a carrier.
15. The composition of claim 14, wherein the nucleic acid comprises substantially the same coding sequence as the coding sequence shown in SEQ. ID. No.: 1, SEQ. ID. No.: 3, SEQ. ID. No.: 5, SEQ. ID. No.: 7, SEQ. ID. No.: 9, SEQ. ID. No.:11 or portion thereof.
16. A composition comprising a BCNG protein or portion thereof and a carrier.
17. The composition of claim 16, wherein the BCNG protein comprises substantially the same amino acid sequence as the amino acid sequence shown in SEQ. ID. No.: 2, SEQ. ID. No.: 4, SEQ. ID. No.: 6, SEQ. ID. No.: 8, SEQ. ID. No.: 10, SEQ. ID. No.:12 or portion thereof.
18. A method of identifying a nucleic acid encoding an ion channel subunit-related protein in a sample which comprises detecting in the sample a nucleic acid molecule encoding a BCNG-related protein, positive detection indicating the presence of an ion channel subunit related protein encoding nucleic acid molecule, thereby identifying a nucleic acid encoding an ion channel subunit-related protein in the sample.
19. The method of claim 18, wherein the nucleic acid molecule encoding the ion channel subunit related protein is detected by size fractionation.
20. The method of claim 19, wherein the size fractionation is effected by a polyacrylamide or an agarose gel.
21. The method of claim 20, wherein the detection of the nucleic acid molecule encoding the BCNG-related protein comprises contacting the sample with a second nucleic acid molecule capable of hybridizing with the nucleic acid molecule encoding the BCNG-related protein, wherein the second nucleic acid molecule is labeled with a detectable marker under conditions permitting the second nucleic acid molecule to hybridize with the nucleic acid molecule encoding the BCNG-related protein, thereby identifying the nucleic acid molecule in the sample.
22. The method of claim 21, wherein the second nucleic acid molecule is capable of hybridizing to mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2.
23. The method of claim 21, wherein the detectable marker is a radiolabeled molecule, a fluorescent molecule, an enzyme, a ligand, or a magnetic bead.
24. The method of claim 18, wherein the detection of the nucleic acid molecule encoding the BCNG-related protein comprises amplifying the nucleic acid molecule encoding the BCNG-related protein, thereby identifying the nucleic acid molecule encoding the BCNG-related protein in the sample.
25. The method of claim 24, wherein the amplification of the nucleic acid molecule encoding the BCNG-related protein comprises contacting the sample with at least one primer capable of hybridizing to mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2 under conditions suitable for polymerase chain reaction.
26. The method of claim 25, wherein the amplified nucleic acid molecule encoding the BCNG-related protein is detected by size fractionation.
27. The method of claim 26, wherein the size fractionation is via a polyacrylamide gel or an agarose gel.
28. A method for evaluating the ability of a compound to modulate an ion channel associated with a condition in a subject which comprises:
- (a) contacting a cell which expresses a BCNG-related protein in a cell culture with a compound;
- (b) determining the amount of BCNG-related protein expression in the cell culture; and
- (c) comparing the amount of BCNG-related protein expression determined in step (b) with the amount determined in the absence of the compound so as to evaluate the ability of the compound to modulate the ion channel associated with the condition in the subject.
29. The method of claim 28, wherein the condition is a neurological condition, cardiovascular condition, renal condition, pulmonary condition, or hepatic condition.
30. The method of claim 28, wherein the condition is epilepsy, Alzheimer's Disease, Parkinson's Disease, long QT syndrome, sick sinus syndrome, age-related memory loss, cystic fibrosis, sudden death syndrome or a pacemaker rhythm dysfunction.
31. The method of claim 28, wherein the BCNG-related protein comprises mBCNG-1, mBCNG-2, mBCNG-3, MBCNG-4, hBCNG-1 or hBCNG-2 or a portion thereof.
32. The method of claim 28, wherein the cell is a cardiac cell, a kidney cell, a hepatic cell, an airway epithelial cell, a muscle cell, a neuronal cell, a glial cell, a microglial cell, an endothelial cell, a mononuclear cell, a tumor cell, a mammalian cell, an insect cell, or a Xenopus oocyte.
33. The method of claim 28, wherein the compound is a peptide, a peptidomimetic, a nucleic acid, a polymer, or a small molecule.
34. The method of claim 28, wherein the compound is bound to a solid support.
35. A method for evaluating the ability of a compound to interact with a BCNG-related ion channel subunit protein which comprises:
- (a) contacting a cell which expresses a BCNG-related protein in a cell culture with a compound under conditions permissive to formation of a complex between the compound and the BCNG-related protein;
- (b) determining the amount of complex formed between the compound and the BCNG-related protein in the cell culture; and
- (c) comparing the amount of complex formed in step (b) with the amount formed in the absence of the compound so as to evaluate the ability of the compound to interact with a BCNG-related ion channel subunit protein.
36. The method of claim 35, wherein the BCNG-related protein comprises mBCNG-1, mBCNG-2, mBCNG-3, mBCNG-4, hBCNG-1 or hBCNG-2 or a portion thereof.
37. The method of claim 35, wherein the cell is a cardiac cell, a kidney cell, a hepatic cell, an airway epithelial cell, a muscle cell, a neuronal cell, a glial cell, a microglial cell, an endothelial cell, a mononuclear cell, a tumor cell, a mammalian cell, an insect cell, or a Xenopus oocyte.
38. The method of claim 35, wherein the compound is a peptide, a peptidomimetic, a nucleic acid, a polymer, or a small molecule.
39. The method of claim 35, wherein the compound is bound to a solid support.
40. A method for identifying whether a compound is capable of modulating a dysfunction in an animal comprising:
- (a) administering the compound to the animal under conditions permissive to formation of a complex between the compound and the BCNG-related protein;
- (b) determining the amount of complex formed between the compound and the BCNG-related protein in the animal; and
- (c) comparing the amount of complex formed in step (b) with the amount of complex formed in the animal in the absence of the compound so as to identify whether the compound is capable of modulating the dysfunction in the animal, a change in the amount of complex formed in the presence of the compound indicating that the compound is capable of modulating dysfunction in the animal.
41. The method of claim 40, wherein the condition is a neurological condition, cardiovascular condition, renal condition, pulmonary condition, or hepatic condition.
42. The method of claim 41, wherein the condition is epilepsy, Alzheimer's Disease, Parkinson's Disease, long QT syndrome, sick sinus syndrome, age-related memory loss, cystic fibrosis, sudden death syndrome or a pacemaker rhythm dysfunction.
43. A method of identifying a compound which modulates the activity of BCNG-related protein which comprises:
- (a) introducing the nucleic acid of claim 1 into an expression system and causing the expression system to express the nucleic acid under conditions whereby an ion channel subunit protein is produced;
- (b) contacting the channel subunit protein with the compound;
- (c) determining the activity of the ion channel subunit protein; and
- (d) comparing the activity determined in step (c) with the activity determined in the absence of the compound, an increase or decrease in activity in the presence of the compound indicating identification of a compound which modulates the activity of BCNG-related protein.
44. The method of claim 43, wherein the activity determination step (c) comprises measuring the channel electrical current or intracellular calcium level in the presence of the compound.
45. The method of claim 43, wherein the expression system comprises a cultured host cell.
46. The method of claim 45, wherein the cultured host cell is a cardiac cell, a kidney cell, a hepatic cell, an airway epithelial cell, a muscle cell, a neuronal cell, a glial cell, a microglial cell, an endothelial cell, a mononuclear cell, a tumor cell, a mammalian cell, an insect cell, or a Xenopus oocyte.
47. A method of treating a condition in a subject which comprises administering to the subject an effective amount of a compound which modulates the activity of BCNG-related protein identified by the method of claim 43, so as to treat the condition.
48. The method of claim 47, wherein the condition is a neurological condition, cardiovascular condition, renal condition, pulmonary condition, or hepatic condition.
49. The method of claim 48, wherein the condition is epilepsy, Alzheimer's Disease, Parkinson's Disease, long QT syndrome, sick sinus syndrome, age-related memory loss, cystic fibrosis, sudden death syndrome or a pacemaker rhythm dysfunction.
50. A pharmaceutical composition which comprises a compound capable of modulating BCNG-related protein activity identified by the method of claim 43, and a pharmaceutically acceptable carrier.
51. The pharmaceutical composition of claim 50, wherein the carrier is a diluent, an aerosol, a topical carrier, an aqueous solution, a nonaqueous solution or a solid carrier.
52. A method for treating a condition in a subject which comprises administering to the subject an amount of the pharmaceutical composition of claim 51, effective to treat the condition in the subject.
53. The method of claim 52, wherein the condition is a neurological condition, renal condition, pulmonary condition, hepatic condition, or cardiovascular condition.
54. The method of claim 53, wherein the condition is epilepsy, Alzheimer's Disease, Parkinson's Disease, long QT syndrome, sick sinus syndrome, age-related memory loss, cystic fibrosis, sudden death syndrome or a pacemaker rhythm dysfunction.
55. The method of claim 52, wherein the subject is a human.
56. An antibody which binds specifically to the protein of claim 11.
57. A cell line producing the antibody of claim 56.
58. A method of identifying the protein of claim 11 in a sample comprising:
- (a) contacting the sample with the antibody of claim 56 under conditions permissive to the formation of a complex between the antibody and the protein;
- (b) determining the amount of complex formed; and
- (c) comparing the amount of complex formed in step (b) with the amount of complex formed in the absence of the antibody, the presence of an increased amount of complex formed in the presence of the antibody indicating identification of the protein in the sample.
Type: Application
Filed: Mar 6, 2003
Publication Date: Jan 6, 2005
Applicant: The Trustees of Columbia University in the City of New York (New York, NY)
Inventors: Eric Kandel (Riverdale, NY), Bina Santoro (New York, NY), Dusan Bartsch (Wallstadt-Nord), Steven Siegelbaum (New York, NY), Gareth Tibbs (New York, NY), Seth Grant (Edinburgh)
Application Number: 10/384,107